Evaluation of four endogenous reference genes and their real-time PCR assays for common wheat quantification in GMOs detection.

Science.gov (United States)

Huang, Huali; Cheng, Fang; Wang, Ruoan; Zhang, Dabing; Yang, Litao

2013-01-01

Proper selection of endogenous reference genes and their real-time PCR assays is quite important in genetically modified organisms (GMOs) detection. To find a suitable endogenous reference gene and its real-time PCR assay for common wheat (Triticum aestivum L.) DNA content or copy number quantification, four previously reported wheat endogenous reference genes and their real-time PCR assays were comprehensively evaluated for the target gene sequence variation and their real-time PCR performance among 37 common wheat lines. Three SNPs were observed in the PKABA1 and ALMT1 genes, and these SNPs significantly decreased the efficiency of real-time PCR amplification. GeNorm analysis of the real-time PCR performance of each gene among common wheat lines showed that the Waxy-D1 assay had the lowest M values with the best stability among all tested lines. All results indicated that the Waxy-D1 gene and its real-time PCR assay were most suitable to be used as an endogenous reference gene for common wheat DNA content quantification. The validated Waxy-D1 gene assay will be useful in establishing accurate and creditable qualitative and quantitative PCR analysis of GM wheat.

Evaluation of four endogenous reference genes and their real-time PCR assays for common wheat quantification in GMOs detection.

Directory of Open Access Journals (Sweden)

Huali Huang

Full Text Available Proper selection of endogenous reference genes and their real-time PCR assays is quite important in genetically modified organisms (GMOs detection. To find a suitable endogenous reference gene and its real-time PCR assay for common wheat (Triticum aestivum L. DNA content or copy number quantification, four previously reported wheat endogenous reference genes and their real-time PCR assays were comprehensively evaluated for the target gene sequence variation and their real-time PCR performance among 37 common wheat lines. Three SNPs were observed in the PKABA1 and ALMT1 genes, and these SNPs significantly decreased the efficiency of real-time PCR amplification. GeNorm analysis of the real-time PCR performance of each gene among common wheat lines showed that the Waxy-D1 assay had the lowest M values with the best stability among all tested lines. All results indicated that the Waxy-D1 gene and its real-time PCR assay were most suitable to be used as an endogenous reference gene for common wheat DNA content quantification. The validated Waxy-D1 gene assay will be useful in establishing accurate and creditable qualitative and quantitative PCR analysis of GM wheat.

Evaluation of Four Endogenous Reference Genes and Their Real-Time PCR Assays for Common Wheat Quantification in GMOs Detection

Science.gov (United States)

Huang, Huali; Cheng, Fang; Wang, Ruoan; Zhang, Dabing; Yang, Litao

2013-01-01

Proper selection of endogenous reference genes and their real-time PCR assays is quite important in genetically modified organisms (GMOs) detection. To find a suitable endogenous reference gene and its real-time PCR assay for common wheat (Triticum aestivum L.) DNA content or copy number quantification, four previously reported wheat endogenous reference genes and their real-time PCR assays were comprehensively evaluated for the target gene sequence variation and their real-time PCR performance among 37 common wheat lines. Three SNPs were observed in the PKABA1 and ALMT1 genes, and these SNPs significantly decreased the efficiency of real-time PCR amplification. GeNorm analysis of the real-time PCR performance of each gene among common wheat lines showed that the Waxy-D1 assay had the lowest M values with the best stability among all tested lines. All results indicated that the Waxy-D1 gene and its real-time PCR assay were most suitable to be used as an endogenous reference gene for common wheat DNA content quantification. The validated Waxy-D1 gene assay will be useful in establishing accurate and creditable qualitative and quantitative PCR analysis of GM wheat. PMID:24098735

Multiplex PCR assay for detection of recombinant genes encoding fatty acid desaturases fused with lichenase reporter protein in GM plants.

Science.gov (United States)

Berdichevets, Iryna N; Shimshilashvili, Hristina R; Gerasymenko, Iryna M; Sindarovska, Yana R; Sheludko, Yuriy V; Goldenkova-Pavlova, Irina V

2010-07-01

Thermostable lichenase encoded by licB gene of Clostridium thermocellum can be used as a reporter protein in plant, bacterial, yeast, and mammalian cells. It has important advantages of high sensitivity and specificity in qualitative and quantitative assays. Deletion variants of LicB (e.g., LicBM3) retain its enzymatic activity and thermostability and can be expressed in translational fusion with target proteins without compromising with their properties. Fusion with the lichenase reporter is especially convenient for the heterologous expression of proteins whose analysis is difficult or compromised by host enzyme activities, as it is in case of fatty acid desaturases occurring in all groups of organisms. Recombinant desaturase-lichenase genes can be used for creating genetically modified (GM) plants with improved chill tolerance. Development of an analytical method for detection of fused desaturase-lichenase transgenes is necessary both for production of GM plants and for their certification. Here, we report a multiplex polymerase chain reaction method for detection of desA and desC desaturase genes of cyanobacteria Synechocystis sp. PCC6803 and Synechococcus vulcanus, respectively, fused to licBM3 reporter in GM plants.

Development and Validation of a Novel Dual Luciferase Reporter Gene Assay to Quantify Ebola Virus VP24 Inhibition of IFN Signaling

Directory of Open Access Journals (Sweden)

Elisa Fanunza

2018-02-01

Full Text Available The interferon (IFN system is the first line of defense against viral infections. Evasion of IFN signaling by Ebola viral protein 24 (VP24 is a critical event in the pathogenesis of the infection and, hence, VP24 is a potential target for drug development. Since no drugs target VP24, the identification of molecules able to inhibit VP24, restoring and possibly enhancing the IFN response, is a goal of concern. Accordingly, we developed a dual signal firefly and Renilla luciferase cell-based drug screening assay able to quantify IFN-mediated induction of Interferon Stimulated Genes (ISGs and its inhibition by VP24. Human Embryonic Kidney 293T (HEK293T cells were transiently transfected with a luciferase reporter gene construct driven by the promoter of ISGs, Interferon-Stimulated Response Element (ISRE. Stimulation of cells with IFN-α activated the IFN cascade leading to the expression of ISRE. Cotransfection of cells with a plasmid expressing VP24 cloned from a virus isolated during the last 2014 outbreak led to the inhibition of ISRE transcription, quantified by a luminescent signal. To adapt this system to test a large number of compounds, we performed it in 96-well plates; optimized the assay analyzing different parameters; and validated the system by calculating the Z′- and Z-factor, which showed values of 0.62 and 0.53 for IFN-α stimulation assay and VP24 inhibition assay, respectively, indicative of robust assay performance.

A reporter system for replication-competent gammaretroviruses: the inGluc-MLV-DERSE assay

Science.gov (United States)

Aloia, Amanda L.; Duffy, Lisa; Pak, Vladimir; Lee, KyeongEun; Sanchez-Martinez, Silvia; Derse, David; Heidecker, Gisela; Cornetta, Kenneth; Rein, Alan

2012-01-01

While novel retroviral vectors for use in gene-therapy products are reducing the potential for formation of replication-competent retrovirus (RCR), it remains crucial to screen products for RCR for both research and clinical purposes. For clinical grade gammaretrovirus-based vectors, RCR screening is achieved by an extended S+L− or marker rescue assay, while standard methods for replication-competent lentivirus detection are still in development. In this report, we describe a rapid and sensitive method for replication-competent gammaretrovirus detection. We used this assay to detect three members of the gammaretrovirus family and compared the sensitivity of our assay with well-established methods for retrovirus detection, including the extended S+L− assay. Results presented here demonstrate that this assay should be useful for gene-therapy product testing. PMID:22402321

Screening of molecular cell targets for carcinogenic heterocyclic aromatic amines by using CALUX® reporter gene assays.

Science.gov (United States)

Steinberg, Pablo; Behnisch, Peter A; Besselink, Harrie; Brouwer, Abraham A

2017-06-01

Heterocyclic aromatic amines (HCAs) are compounds formed when meat or fish are cooked at high temperatures for a long time or over an open fire. To determine which pathways of toxicity are activated by HCAs, nine out of the ten HCAs known to be carcinogenic in rodents (2-amino-9H-pyrido[2,3-b]indole (AαC), 2-aminodipyrido[1,2-a:3',2-d]imidazole (Glu-P-2), 2-amino-3-methylimidazo[4,5-f]quinoline (IQ), 2-amino-3-methyl-9H-pyrido[2,3-b]indole (MeAαC), 2-amino-3,4-dimethylimidazo[4,5-f]quinoline (MeIQ), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), 3-amino-1,4-dimethyl-5H-pyrido[4,3-b]indole (Trp-P-1), and 3-amino-1-methyl-5H-pyrido[4,3-b]indole (Trp-P-2)) were tested in the estrogen receptor α (ERα), androgen receptor (AR), glucocorticoid receptor (GR), peroxisome proliferator-activated receptor γ2 (PPARγ2), polycyclic aromatic hydrocarbons (PAH), Nrf2, and p53 CALUX® reporter gene assays. Trp-P-1 was the only HCA that led to a positive response in the ERα, PPARγ2, and Nrf2 CALUX® assays. In the PAH CALUX® assay, Trp-P-2, MeAαC, and AαC induced luciferase activity to a greater extent than MeIQ and PhIP. In the p53 CALUX® assay without a coupled metabolic activation, only Trp-P-1 and Trp-P-2 enhanced luciferase expression; when a metabolic activation step was coupled to the p53 CALUX® assay, Trp-P-1, Glu-P-2, MeIQ, MeIQx, and PhIP induced a positive response. No HCA was positive in the AR and GR CALUX® assays. Taken together, the results obtained show that the battery of CALUX® assays performed in the present study can successfully be used to screen for molecular cell targets of carcinogenic compounds such as HCAs.

Methods for transient assay of gene function in floral tissues

Directory of Open Access Journals (Sweden)

Pathirana Nilangani N

2007-01-01

Full Text Available Abstract Background There is considerable interest in rapid assays or screening systems for assigning gene function. However, analysis of gene function in the flowers of some species is restricted due to the difficulty of producing stably transformed transgenic plants. As a result, experimental approaches based on transient gene expression assays are frequently used. Biolistics has long been used for transient over-expression of genes of interest, but has not been exploited for gene silencing studies. Agrobacterium-infiltration has also been used, but the focus primarily has been on the transient transformation of leaf tissue. Results Two constructs, one expressing an inverted repeat of the Antirrhinum majus (Antirrhinum chalcone synthase gene (CHS and the other an inverted repeat of the Antirrhinum transcription factor gene Rosea1, were shown to effectively induce CHS and Rosea1 gene silencing, respectively, when introduced biolistically into petal tissue of Antirrhinum flowers developing in vitro. A high-throughput vector expressing the Antirrhinum CHS gene attached to an inverted repeat of the nos terminator was also shown to be effective. Silencing spread systemically to create large zones of petal tissue lacking pigmentation, with transmission of the silenced state spreading both laterally within the affected epidermal cell layer and into lower cell layers, including the epidermis of the other petal surface. Transient Agrobacterium-mediated transformation of petal tissue of tobacco and petunia flowers in situ or detached was also achieved, using expression of the reporter genes GUS and GFP to visualise transgene expression. Conclusion We demonstrate the feasibility of using biolistics-based transient RNAi, and transient transformation of petal tissue via Agrobacterium infiltration to study gene function in petals. We have also produced a vector for high throughput gene silencing studies, incorporating the option of using T-A cloning to

Development and validation of cell-based luciferase reporter gene assays for measuring neutralizing anti-drug antibodies against interferon beta.

Science.gov (United States)

Hermanrud, Christina; Ryner, Malin; Luft, Thomas; Jensen, Poul Erik; Ingenhoven, Kathleen; Rat, Dorothea; Deisenhammer, Florian; Sørensen, Per Soelberg; Pallardy, Marc; Sikkema, Dan; Bertotti, Elisa; Kramer, Daniel; Creeke, Paul; Fogdell-Hahn, Anna

2016-03-01

Neutralizing anti-drug antibodies (NAbs) against therapeutic interferon beta (IFNβ) in people with multiple sclerosis (MS) are measured with cell-based bioassays. The aim of this study was to redevelop and validate two luciferase reporter-gene bioassays, LUC and iLite, using a cut-point approach to identify NAb positive samples. Such an approach is favored by the pharmaceutical industry and governmental regulatory agencies as it has a clear statistical basis and overcomes the limitations of the current assays based on the Kawade principle. The work was conducted following the latest assay guidelines. The assays were re-developed and validated as part of the "Anti-Biopharmaceutical Immunization: Prediction and analysis of clinical relevance to minimize the risk" (ABIRISK) consortium and involved a joint collaboration between four academic laboratories and two pharmaceutical companies. The LUC assay was validated at Innsbruck Medical University (LUCIMU) and at Rigshospitalet (LUCRH) Copenhagen, and the iLite assay at Karolinska Institutet, Stockholm. For both assays, the optimal serum sample concentration in relation to sensitivity and recovery was 2.5% (v/v) in assay media. A Shapiro-Wilk test indicated a normal distribution for the majority of runs, allowing a parametric approach for cut-point calculation to be used, where NAb positive samples could be identified with 95% confidence. An analysis of means and variances indicated that a floating cut-point should be used for all assays. The assays demonstrated acceptable sensitivity for being cell-based assays, with a confirmed limit of detection in neat serum of 1519 ng/mL for LUCIMU, 814 ng/mL for LUCRH, and 320 ng/mL for iLite. Use of the validated cut-point assay, in comparison with the previously used Kawade method, identified 14% more NAb positive samples. In conclusion, implementation of the cut-point design resulted in increased sensitivity to detect NAbs. However, the clinical significance of these low

Detection of anabolic androgenic steroid abuse in doping control using mammalian reporter gene bioassays.

Science.gov (United States)

Houtman, Corine J; Sterk, Saskia S; van de Heijning, Monique P M; Brouwer, Abraham; Stephany, Rainer W; van der Burg, Bart; Sonneveld, Edwin

2009-04-01

Anabolic androgenic steroids (AAS) are a class of steroid hormones related to the male hormone testosterone. They are frequently detected as drugs in sport doping control. Being similar to or derived from natural male hormones, AAS share the activation of the androgen receptor (AR) as common mechanism of action. The mammalian androgen responsive reporter gene assay (AR CALUX bioassay), measuring compounds interacting with the AR can be used for the analysis of AAS without the necessity of knowing their chemical structure beforehand, whereas current chemical-analytical approaches may have difficulty in detecting compounds with unknown structures, such as designer steroids. This study demonstrated that AAS prohibited in sports and potential designer AAS can be detected with this AR reporter gene assay, but that also additional steroid activities of AAS could be found using additional mammalian bioassays for other types of steroid hormones. Mixtures of AAS were found to behave additively in the AR reporter gene assay showing that it is possible to use this method for complex mixtures as are found in doping control samples, including mixtures that are a result of multi drug use. To test if mammalian reporter gene assays could be used for the detection of AAS in urine samples, background steroidal activities were measured. AAS-spiked urine samples, mimicking doping positive samples, showed significantly higher androgenic activities than unspiked samples. GC-MS analysis of endogenous androgens and AR reporter gene assay analysis of urine samples showed how a combined chemical-analytical and bioassay approach can be used to identify samples containing AAS. The results indicate that the AR reporter gene assay, in addition to chemical-analytical methods, can be a valuable tool for the analysis of AAS for doping control purposes.

High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.

Science.gov (United States)

Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert

2018-01-01

Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.

Micro-fluidic module for blood cell separation for gene expression radiobiological assays

International Nuclear Information System (INIS)

Brengues, Muriel; Gu, Jian; Zenhausern, Frederic

2015-01-01

Advances in molecular techniques have improved discovery of biomarkers associated with radiation exposure. Gene expression techniques have been demonstrated as effective tools for biodosimetry, and different assay platforms with different chemistries are now available. One of the main challenges is to integrate the sample preparation processing of these assays into micro-fluidic platforms to be fully automated for point-of-care medical countermeasures in the case of a radiological event. Most of these assays follow the same workflow processing that comprises first the collection of blood samples followed by cellular and molecular sample preparation. The sample preparation is based on the specific reagents of the assay system and depends also on the different subsets of cells population and the type of biomarkers of interest. In this article, the authors present a module for isolation of white blood cells from peripheral blood as a prerequisite for automation of gene expression assays on a micro-fluidic cartridge. For each sample condition, the gene expression platform can be adapted to suit the requirements of the selected assay chemistry (authors)

Application of the dual-luciferase reporter assay to the analysis of promoter activity in Zebrafish embryos

Directory of Open Access Journals (Sweden)

Mulero Victoriano

2008-10-01

Full Text Available Abstract Background The dual-luciferase assay has been widely used in cell lines to determine rapidly but accurately the activity of a given promoter. Although this strategy has proved very useful, it does not allow the promoter and gene function to be analyzed in the context of the whole organism. Results Here, we present a rapid and sensitive assay based on the classical dual-luciferase reporter technique which can be used as a new tool to characterize the minimum promoter region of a gene as well as the in vivo response of inducible promoters to different stimuli. We illustrate the usefulness of this system for studying both constitutive (telomerase and inducible (NF-κB-dependent promoters. The flexibility of this assay is demonstrated by induction of the NF-κB-dependent promoters using simultaneous microinjection of different pathogen-associated molecular patterns as well as with the use of morpholino-gene mediated knockdown. Conclusion This assay has several advantages compared with the classical in vitro (cell lines and in vivo (transgenic mice approaches. Among others, the assay allows a rapid and quantitative measurement of the effects of particular genes or drugs in a given promoter in the context of a whole organism and it can also be used in high throughput screening experiments.

Water quality assessment using the AREc32 reporter gene assay indicative of the oxidative stress response pathway.

Science.gov (United States)

Escher, Beate I; Dutt, Mriga; Maylin, Erin; Tang, Janet Y M; Toze, Simon; Wolf, C Roland; Lang, Matti

2012-11-01

The reporter gene assay AREc32 is based on the induction of the Nrf2 mediated oxidative stress response pathway in the human breast cancer cell line MCF7, where eight copies of the antioxidant response element (ARE) are linked to a reporter gene encoding for luciferase. The Nrf2-ARE pathway is responsive to many chemicals that cause oxidative stress, among them a large number of pesticides and skin irritants. We adopted and validated the AREc32 bioassay for water quality testing. tert-Butylhydroquinone served as the positive control, phenol as the negative control and other reactive chemicals were assessed for their specificity. An environmentally relevant reference chemical, benzo(a)pyrene was the most potent inducer of all tested chemicals. The concentration causing an induction ratio (IR) of 1.5 (EC(IR1.5)) was chosen as the effect benchmark value. The assay was applied to 21 water samples ranging from sewage to drinking water, including secondary treatment and various tertiary treatment options (ozonation, biologically activated carbon filtration, membrane filtration, reverse osmosis, advanced oxidation, chlorination, chloramination). The samples were enriched by solid phase extraction. In most samples the oxidative stress response was far more sensitive than cytotoxicity. The primary and secondary treated effluent exceeded the effect threshold IR 1.5 at a relative enrichment factor (REF) of 1, i.e., the native samples were active. All tertiary treated samples were less potent and their EC(IR1.5) lay between REF 1 and 10. The Nrf2 pathway was induced at a REF of approximately 10 for surface waters and drinking water, and above this enrichment cytotoxicity took over in most samples and quenched the induction. The blank (ultrapure water run through the sample enrichment process) was cytotoxic at an REF of 100, which is the limit of concentrations range that can be evaluated. Treatment typically decreased both the cytotoxicity and oxidative stress response apart

Collaborative ring trial of the papaya endogenous reference gene and its polymerase chain reaction assays for genetically modified organism analysis.

Science.gov (United States)

Wei, Jiaojun; Li, Feiwu; Guo, Jinchao; Li, Xiang; Xu, Junfeng; Wu, Gang; Zhang, Dabing; Yang, Litao

2013-11-27

The papaya (Carica papaya L.) Chymopapain (CHY) gene has been reported as a suitable endogenous reference gene for genetically modified (GM) papaya detection in previous studies. Herein, we further validated the use of the CHY gene and its qualitative and quantitative polymerase chain reaction (PCR) assays through an interlaboratory collaborative ring trial. A total of 12 laboratories working on detection of genetically modified organisms participated in the ring trial and returned test results. Statistical analysis of the returned results confirmed the species specificity, low heterogeneity, and single-copy number of the CHY gene among different papaya varieties. The limit of detection of the CHY qualitative PCR assay was 0.1%, while the limit of quantification of the quantitative PCR assay was ∼25 copies of haploid papaya genome with acceptable PCR efficiency and linearity. The differences between the tested and true values of papaya content in 10 blind samples ranged from 0.84 to 6.58%. These results indicated that the CHY gene was suitable as an endogenous reference gene for the identification and quantification of GM papaya.

QuASAR-MPRA: accurate allele-specific analysis for massively parallel reporter assays.

Science.gov (United States)

Kalita, Cynthia A; Moyerbrailean, Gregory A; Brown, Christopher; Wen, Xiaoquan; Luca, Francesca; Pique-Regi, Roger

2018-03-01

The majority of the human genome is composed of non-coding regions containing regulatory elements such as enhancers, which are crucial for controlling gene expression. Many variants associated with complex traits are in these regions, and may disrupt gene regulatory sequences. Consequently, it is important to not only identify true enhancers but also to test if a variant within an enhancer affects gene regulation. Recently, allele-specific analysis in high-throughput reporter assays, such as massively parallel reporter assays (MPRAs), have been used to functionally validate non-coding variants. However, we are still missing high-quality and robust data analysis tools for these datasets. We have further developed our method for allele-specific analysis QuASAR (quantitative allele-specific analysis of reads) to analyze allele-specific signals in barcoded read counts data from MPRA. Using this approach, we can take into account the uncertainty on the original plasmid proportions, over-dispersion, and sequencing errors. The provided allelic skew estimate and its standard error also simplifies meta-analysis of replicate experiments. Additionally, we show that a beta-binomial distribution better models the variability present in the allelic imbalance of these synthetic reporters and results in a test that is statistically well calibrated under the null. Applying this approach to the MPRA data, we found 602 SNPs with significant (false discovery rate 10%) allele-specific regulatory function in LCLs. We also show that we can combine MPRA with QuASAR estimates to validate existing experimental and computational annotations of regulatory variants. Our study shows that with appropriate data analysis tools, we can improve the power to detect allelic effects in high-throughput reporter assays. http://github.com/piquelab/QuASAR/tree/master/mpra. fluca@wayne.edu or rpique@wayne.edu. Supplementary data are available online at Bioinformatics. © The Author (2017). Published by

Bidirectional reporter assay using HAL promoter and TOPFLASH improves specificity in high-throughput screening of Wnt inhibitors.

Science.gov (United States)

Yamaguchi, Kiyoshi; Zhu, Chi; Ohsugi, Tomoyuki; Yamaguchi, Yuko; Ikenoue, Tsuneo; Furukawa, Yoichi

2017-12-01

Constitutive activation of Wnt signaling plays an important role in colorectal and liver tumorigenesis. Cell-based assays using synthetic TCF/LEF (T-cell factor/lymphoid enhancer factor) reporters, as readouts of β-catenin/TCF-dependent transcriptional activity, have contributed greatly to the discovery of small molecules that modulate Wnt signaling. In the present study, we report a novel screening method, called a bidirectional dual reporter assay. Integrated transcriptome analysis identified a histidine ammonia-lyase gene (HAL) that was negatively regulated by β-catenin/TCF-dependent transcriptional activity. We leveraged a promoter region of the HAL gene as another transcriptional readout of Wnt signaling. Cells stably expressing both an optimized HAL reporter and the TCF/LEF reporter enabled bidirectional reporter activities in response to Wnt signaling. Increased HAL reporter activity and decreased TCF/LEF reporter activity were observed simultaneously in the cells when β-catenin/TCF7L2 was inhibited. Notably, this method could decrease the number of false positives observed when screening an inhibitor library compared with the conventional TCF/LEF assay. We found that Brefeldin A, a disruptor of the Golgi apparatus, inhibited the Wnt/β-catenin signaling pathway. The utility of our system could be expanded to examine other disease-associated pathways beyond the Wnt/β-catenin signaling pathway. © 2017 Wiley Periodicals, Inc.

Impact of ubiquitous inhibitors on the GUS gene reporter system: evidence from the model plants Arabidopsis, tobacco and rice and correction methods for quantitative assays of transgenic and endogenous GUS

Directory of Open Access Journals (Sweden)

Gerola Paolo D

2009-12-01

Full Text Available Abstract Background The β-glucuronidase (GUS gene reporter system is one of the most effective and employed techniques in the study of gene regulation in plant molecular biology. Improving protocols for GUS assays have rendered the original method described by Jefferson amenable to various requirements and conditions, but the serious limitation caused by inhibitors of the enzyme activity in plant tissues has thus far been underestimated. Results We report that inhibitors of GUS activity are ubiquitous in organ tissues of Arabidopsis, tobacco and rice, and significantly bias quantitative assessment of GUS activity in plant transformation experiments. Combined with previous literature reports on non-model species, our findings suggest that inhibitors may be common components of plant cells, with variable affinity towards the E. coli enzyme. The reduced inhibitory capacity towards the plant endogenous GUS discredits the hypothesis of a regulatory role of these compounds in plant cells, and their effect on the bacterial enzyme is better interpreted as a side effect due to their interaction with GUS during the assay. This is likely to have a bearing also on histochemical analyses, leading to inaccurate evaluations of GUS expression. Conclusions In order to achieve reliable results, inhibitor activity should be routinely tested during quantitative GUS assays. Two separate methods to correct the measured activity of the transgenic and endogenous GUS are presented.

A Luciferase Reporter Gene Assay to Measure Ebola Virus Viral Protein 35-Associated Inhibition of Double-Stranded RNA-Stimulated, Retinoic Acid-Inducible Gene 1-Mediated Induction of Interferon β.

Science.gov (United States)

Cannas, Valeria; Daino, Gian Luca; Corona, Angela; Esposito, Francesca; Tramontano, Enzo

2015-10-01

During Ebola virus (EBOV) infection, the type I interferon α/β (IFN-α/β) innate immune response is suppressed by EBOV viral protein 35 (VP35), a validated drug target. Identification of EBOV VP35 inhibitors requires a cellular system able to assess the VP35-based inhibitory functions of viral double-stranded RNA (dsRNA) IFN-β induction. We established a miniaturized luciferase gene reporter assay in A549 cells that measures IFN-β induction by viral dsRNA and is dose-dependently inhibited by VP35 expression. When compared to influenza A virus NS1 protein, EBOV VP35 showed improved inhibition of viral dsRNA-based IFN-β induction. This assay can be used to screen for EBOV VP35 inhibitors. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Aptamer-Phage Reporters for Ultrasensitive Lateral Flow Assays.

Science.gov (United States)

Adhikari, Meena; Strych, Ulrich; Kim, Jinsu; Goux, Heather; Dhamane, Sagar; Poongavanam, Mohan-Vivekanandan; Hagström, Anna E V; Kourentzi, Katerina; Conrad, Jacinta C; Willson, Richard C

2015-12-01

We introduce the modification of bacteriophage particles with aptamers for use as bioanalytical reporters, and demonstrate the use of these particles in ultrasensitive lateral flow assays. M13 phage displaying an in vivo biotinylatable peptide (AviTag) genetically fused to the phage tail protein pIII were used as reporter particle scaffolds, with biotinylated aptamers attached via avidin-biotin linkages, and horseradish peroxidase (HRP) reporter enzymes covalently attached to the pVIII coat protein. These modified viral nanoparticles were used in immunochromatographic sandwich assays for the direct detection of IgE and of the penicillin-binding protein from Staphylococcus aureus (PBP2a). We also developed an additional lateral flow assay for IgE, in which the analyte is sandwiched between immobilized anti-IgE antibodies and aptamer-bearing reporter phage modified with HRP. The limit of detection of this LFA was 0.13 ng/mL IgE, ∼100 times lower than those of previously reported IgE assays.

Dioxin-like activity of brominated dioxins as individual compounds or mixtures in in vitro reporter gene assays with rat and mouse hepatoma cell lines.

Science.gov (United States)

Suzuki, G; Nakamura, M; Michinaka, C; Tue, N M; Handa, H; Takigami, H

2017-10-01

In vitro reporter gene assays detecting dioxin-like compounds have been developed and validated since the middle 1990's, and applied to the determination of dioxin-like activities in various samples for their risk management. Data on characterizing the potency of individual brominated dioxins and their activity in mixture with chlorinated dioxins are still limited on the cell-based assay. This study characterized the dioxin-like activities of the 32 brominated dioxins, such as polybrominated dibenzo-p-dioxins, polybrominated dibenzofurans (PBDFs), coplanar polybrominated biphenyls, mixed halogenated dibenzo-p-dioxins and dibenzofurans (PXDFs), as a sole component or in a mixture by DR-CALUX (dioxin-responsive chemically activated luciferase expression) using the rat hepatoma H4IIE cell line and XDS-CALUX (xenobiotic detection systems-chemically activated luciferase expression) assays using the mouse hepatoma H1L6.1 cell line. The 2,3,7,8-TCDD-relative potencies (REPs) of most of the brominated dioxins were within a factor of 10 of the WHO toxicity equivalency factor (WHO-TEF) for the chlorinated analogues. The REPs of a few PXDFs were an order of magnitude higher than the corresponding WHO-TEFs, indicating their toxicological importance. Results with reconstituted mixtures suggest that the activity of brominated and chlorinated dioxins in both CALUX assays was dose-additive. Thus, obtained results indicated the applicability of the CALUX assays as screening tools of brominated dioxins together with their chlorinated analogues. Copyright © 2017 Elsevier Ltd. All rights reserved.

Measurement of gene expression in archival paraffin-embedded tissues: development and performance of a 92-gene reverse transcriptase-polymerase chain reaction assay.

Science.gov (United States)

Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B

2004-01-01

Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.

Biomarker discovery for colon cancer using a 761 gene RT-PCR assay

Directory of Open Access Journals (Sweden)

Hackett James R

2007-08-01

Full Text Available Abstract Background Reverse transcription PCR (RT-PCR is widely recognized to be the gold standard method for quantifying gene expression. Studies using RT-PCR technology as a discovery tool have historically been limited to relatively small gene sets compared to other gene expression platforms such as microarrays. We have recently shown that TaqMan® RT-PCR can be scaled up to profile expression for 192 genes in fixed paraffin-embedded (FPE clinical study tumor specimens. This technology has also been used to develop and commercialize a widely used clinical test for breast cancer prognosis and prediction, the Onco typeDX™ assay. A similar need exists in colon cancer for a test that provides information on the likelihood of disease recurrence in colon cancer (prognosis and the likelihood of tumor response to standard chemotherapy regimens (prediction. We have now scaled our RT-PCR assay to efficiently screen 761 biomarkers across hundreds of patient samples and applied this process to biomarker discovery in colon cancer. This screening strategy remains attractive due to the inherent advantages of maintaining platform consistency from discovery through clinical application. Results RNA was extracted from formalin fixed paraffin embedded (FPE tissue, as old as 28 years, from 354 patients enrolled in NSABP C-01 and C-02 colon cancer studies. Multiplexed reverse transcription reactions were performed using a gene specific primer pool containing 761 unique primers. PCR was performed as independent TaqMan® reactions for each candidate gene. Hierarchal clustering demonstrates that genes expected to co-express form obvious, distinct and in certain cases very tightly correlated clusters, validating the reliability of this technical approach to biomarker discovery. Conclusion We have developed a high throughput, quantitatively precise multi-analyte gene expression platform for biomarker discovery that approaches low density DNA arrays in numbers of

International network for comparison of HIV neutralization assays: the NeutNet report.

Science.gov (United States)

Fenyö, Eva Maria; Heath, Alan; Dispinseri, Stefania; Holmes, Harvey; Lusso, Paolo; Zolla-Pazner, Susan; Donners, Helen; Heyndrickx, Leo; Alcami, Jose; Bongertz, Vera; Jassoy, Christian; Malnati, Mauro; Montefiori, David; Moog, Christiane; Morris, Lynn; Osmanov, Saladin; Polonis, Victoria; Sattentau, Quentin; Schuitemaker, Hanneke; Sutthent, Ruengpung; Wrin, Terri; Scarlatti, Gabriella

2009-01-01

Neutralizing antibody assessments play a central role in human immunodeficiency virus type-1 (HIV-1) vaccine development but it is unclear which assay, or combination of assays, will provide reliable measures of correlates of protection. To address this, an international collaboration (NeutNet) involving 18 independent participants was organized to compare different assays. Each laboratory evaluated four neutralizing reagents (TriMab, 447-52D, 4E10, sCD4) at a given range of concentrations against a panel of 11 viruses representing a wide range of genetic subtypes and phenotypes. A total of 16 different assays were compared. The assays utilized either uncloned virus produced in peripheral blood mononuclear cells (PBMCs) (virus infectivity assays, VI assays), or their Env-pseudotyped (gp160) derivatives produced in 293T cells (PSV assays) from molecular clones or uncloned virus. Target cells included PBMC and genetically-engineered cell lines in either a single- or multiple-cycle infection format. Infection was quantified by using a range of assay read-outs that included extracellular or intracellular p24 antigen detection, RNA quantification and luciferase and beta-galactosidase reporter gene expression. PSV assays were generally more sensitive than VI assays, but there were important differences according to the virus and inhibitor used. For example, for TriMab, the mean IC50 was always lower in PSV than in VI assays. However, with 4E10 or sCD4 some viruses were neutralized with a lower IC50 in VI assays than in the PSV assays. Inter-laboratory concordance was slightly better for PSV than for VI assays with some viruses, but for other viruses agreement between laboratories was limited and depended on both the virus and the neutralizing reagent. The NeutNet project demonstrated clear differences in assay sensitivity that were dependent on both the neutralizing reagent and the virus. No single assay was capable of detecting the entire spectrum of neutralizing

In planta assays involving epigenetically silenced genes reveal inhibition of cytosine methylation by genistein

Directory of Open Access Journals (Sweden)

Arase Sachiko

2012-03-01

Full Text Available Abstract Background Cytosine methylation is involved in epigenetic control of gene expression in a wide range of organisms. An increasing number of examples indicate that changing the frequency of cytosine methylation in the genome is a feasible tool to engineer novel traits in plants. Although demethylating effects of compounds have been analyzed in human cultured cells in terms of suppressing cancer, their effect in plant cells has not been analyzed extensively. Here, we developed in planta assay systems to detect inhibition of cytosine methylation using plants that contain a transgene transcriptionally silenced by an epigenetic mechanism. Results Seeds of two transgenic plants were used: a petunia line that has been identified as a revertant of the co-suppression of the chalcone synthase-A (CHS-A gene and contains CHS-A transgenes whose transcription is repressed; Nicotiana benthamiana plants that contain the green fluorescent protein (GFP reporter gene whose transcription is repressed through virus-induced transcriptional gene silencing. Seeds of these plants were sown on a medium that contained a demethylating agent, either 5-azacytidine or trichostatin A, and the restoration of the transcriptionally active state of the transgene was detected in seedlings. Using these systems, we found that genistein, a major isoflavonoid compound, inhibits cytosine methylation, thus restoring transgene transcription. Genistein also restored the transcription of an epigenetically silenced endogenous gene in Arabidopsis plants. Conclusions Our assay systems allowed us to assess the inhibition of cytosine methylation, in particular of maintenance of methylation, by compounds in plant cells. These results suggest a novel role of flavonoids in plant cells and that genistein is useful for modifying the epigenetic state of plant genomes.

Development and evaluation of a 28S rRNA gene-based nested PCR assay for P. falciparum and P. vivax

Science.gov (United States)

Pakalapati, Deepak; Garg, Shilpi; Middha, Sheetal; Acharya, Jyoti; Subudhi, Amit K; Boopathi, Arunachalam P; Saxena, Vishal; Kochar, Sanjay K; Kochar, Dhanpat K; Das, Ashis

2013-01-01

The 28S rRNA gene was amplified and sequenced from P. falciparum and P. vivax isolates collected from northwest India. Based upon the sequence diversity of the Plasmodium 28SrRNA gene in comparison with its human counterpart, various nested polymerase chain reaction (PCR) primers were designed from the 3R region of the 28SrRNA gene and evaluated on field isolates. This is the first report demonstrating the utility of this gene for species-specific diagnosis of malaria for these two species, prevalent in India. The initial evaluation on 363 clinical isolates indicated that, in comparison with microscopy, which showed sensitivity and specificity of 85.39% and 100% respectively, the sensitivity and specificity of the nested PCR assay was found to be 99.08% and 100% respectively. This assay was also successful in detecting mixed infections that are undetected by microscopy. Our results demonstrate the utility of the 28S rRNA gene as a diagnostic target for the detection of the major plasmodial species infecting humans. PMID:23816509

Detection and characterization of recombinant DNA expressing vip3A-type insecticidal gene in GMOs--standard single, multiplex and construct-specific PCR assays.

Science.gov (United States)

Singh, Chandra K; Ojha, Abhishek; Bhatanagar, Raj K; Kachru, Devendra N

2008-01-01

Vegetative insecticidal protein (Vip), a unique class of insecticidal protein, is now part of transgenic plants for conferring resistance against lepidopteron pests. In order to address the imminent regulatory need for detection and labeling of vip3A carrying genetically modified (GM) products, we have developed a standard single PCR and a multiplex PCR assay. As far as we are aware, this is the first report on PCR-based detection of a vip3A-type gene (vip-s) in transgenic cotton and tobacco. Our assay involves amplification of a 284-bp region of the vip-s gene. This assay can possibly detect as many as 20 natural wild-type isolates bearing a vip3A-like gene and two synthetic genes of vip3A in transgenic plants. The limit of detection as established by our assay for GM trait (vip-s) is 0.1%. Spiking with nontarget DNA originating from diverse plant sources had no inhibitory effect on vip-s detection. Since autoclaving of vip-s bearing GM leaf samples showed no deterioration/interference in detection efficacy, the assay seems to be suitable for processed food products as well. The vip-s amplicon identity was reconfirmed by restriction endonuclease assay. The primer set for vip-s was equally effective in a multiplex PCR assay format (duplex, triplex and quadruplex), used in conjunction with the primer sets for the npt-II selectable marker gene, Cauliflower mosaic virus 35S promoter and nopaline synthetase terminator, enabling concurrent detection of the transgene, regulatory sequences and marker gene. Further, the entire transgene construct was amplified using the forward primer of the promoter and the reverse primer of the terminator. The resultant amplicon served as a template for nested PCR to confirm the construct integrity. The method is suitable for screening any vip3A-carrying GM plant and food. The availability of a reliable PCR assay method prior to commercial release of vip3A-based transgenic crops and food would facilitate rapid and efficient regulatory

A dual reporter cell assay for identifying serotype and drug susceptibility of herpes simplex virus.

Science.gov (United States)

Lu, Wen-Wen; Sun, Jun-Ren; Wu, Szu-Sian; Lin, Wan-Hsuan; Kung, Szu-Hao

2011-08-15

A dual reporter cell assay (DRCA) that allows real-time detection of herpes simplex virus (HSV) infection was developed. This was achieved by stable transfection of cells with an expression cassette that contains the dual reporter genes, secreted alkaline phosphatase (SEAP) and enhanced green fluorescent protein (EGFP), under the control of an HSV early gene promoter. Baby hamster kidney (BHK) and Chinese hamster ovary (CHO) cell lines were used as parental cell lines because the former is permissive for both HSV serotypes, HSV-1 and HSV-2, whereas the latter is susceptible to infection only by HSV-2. The DRCA permitted differential detection of HSV-1 and HSV-2 by observation of EGFP-positive cells, as substantiated by screening a total of 35 samples. The BHK-based cell line is sensitive to a viral titer as low as a single plaque-forming unit with a robust assay window as measured by a chemiluminescent assay. Evaluations of the DRCA with representative acyclovir-sensitive and acyclovir-resistant HSV strains demonstrated that their drug susceptibilities were accurately determined by a 48-h format. In summary, this novel DRCA is a useful means for serotyping of HSV in real time as well as a rapid screening method for determining anti-HSV susceptibilities. Copyright © 2011 Elsevier Inc. All rights reserved.

Identification of Five Novel Salmonella Typhi-Specific Genes as Markers for Diagnosis of Typhoid Fever Using Single-Gene Target PCR Assays

Directory of Open Access Journals (Sweden)

Yuan Xin Goay

2016-01-01

Full Text Available Salmonella Typhi (S. Typhi causes typhoid fever which is a disease characterised by high mortality and morbidity worldwide. In order to curtail the transmission of this highly infectious disease, identification of new markers that can detect the pathogen is needed for development of sensitive and specific diagnostic tests. In this study, genomic comparison of S. Typhi with other enteric pathogens was performed, and 6 S. Typhi genes, that is, STY0201, STY0307, STY0322, STY0326, STY2020, and STY2021, were found to be specific in silico. Six PCR assays each targeting a unique gene were developed to test the specificity of these genes in vitro. The diagnostic sensitivities and specificities of each assay were determined using 39 S. Typhi, 62 non-Typhi Salmonella, and 10 non-Salmonella clinical isolates. The results showed that 5 of these genes, that is, STY0307, STY0322, STY0326, STY2020, and STY2021, demonstrated 100% sensitivity (39/39 and 100% specificity (0/72. The detection limit of the 5 PCR assays was 32 pg for STY0322, 6.4 pg for STY0326, STY2020, and STY2021, and 1.28 pg for STY0307. In conclusion, 5 PCR assays using STY0307, STY0322, STY0326, STY2020, and STY2021 were developed and found to be highly specific at single-gene target resolution for diagnosis of typhoid fever.

Identification of Five Novel Salmonella Typhi-Specific Genes as Markers for Diagnosis of Typhoid Fever Using Single-Gene Target PCR Assays.

Science.gov (United States)

Goay, Yuan Xin; Chin, Kai Ling; Tan, Clarissa Ling Ling; Yeoh, Chiann Ying; Ja'afar, Ja'afar Nuhu; Zaidah, Abdul Rahman; Chinni, Suresh Venkata; Phua, Kia Kien

2016-01-01

Salmonella Typhi ( S . Typhi) causes typhoid fever which is a disease characterised by high mortality and morbidity worldwide. In order to curtail the transmission of this highly infectious disease, identification of new markers that can detect the pathogen is needed for development of sensitive and specific diagnostic tests. In this study, genomic comparison of S . Typhi with other enteric pathogens was performed, and 6 S . Typhi genes, that is, STY0201, STY0307, STY0322, STY0326, STY2020, and STY2021, were found to be specific in silico . Six PCR assays each targeting a unique gene were developed to test the specificity of these genes in vitro . The diagnostic sensitivities and specificities of each assay were determined using 39 S . Typhi, 62 non-Typhi Salmonella , and 10 non- Salmonella clinical isolates. The results showed that 5 of these genes, that is, STY0307, STY0322, STY0326, STY2020, and STY2021, demonstrated 100% sensitivity (39/39) and 100% specificity (0/72). The detection limit of the 5 PCR assays was 32 pg for STY0322, 6.4 pg for STY0326, STY2020, and STY2021, and 1.28 pg for STY0307. In conclusion, 5 PCR assays using STY0307, STY0322, STY0326, STY2020, and STY2021 were developed and found to be highly specific at single-gene target resolution for diagnosis of typhoid fever.

An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v1; ref status: indexed, http://f1000r.es/2tt

Directory of Open Access Journals (Sweden)

Shin-ichiro Kojima

2014-02-01

Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v2; ref status: indexed, http://f1000r.es/39j

Directory of Open Access Journals (Sweden)

Shin-ichiro Kojima

2014-05-01

Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

A comparison of 12-gene colon cancer assay gene expression in African American and Caucasian patients with stage II colon cancer.

Science.gov (United States)

Govindarajan, Rangaswamy; Posey, James; Chao, Calvin Y; Lu, Ruixiao; Jadhav, Trafina; Javed, Ahmed Y; Javed, Awais; Mahmoud, Fade A; Osarogiagbon, Raymond U; Manne, Upender

2016-06-18

African American (AA) colon cancer patients have a worse prognosis than Caucasian (CA) colon cancer patients, however, reasons for this disparity are not well understood. To determine if tumor biology might contribute to differential prognosis, we measured recurrence risk and gene expression using the Oncotype DX® Colon Cancer Assay (12-gene assay) and compared the Recurrence Score results and gene expression profiles between AA patients and CA patients with stage II colon cancer. We retrieved demographic, clinical, and archived tumor tissues from stage II colon cancer patients at four institutions. The 12-gene assay and mismatch repair (MMR) status were performed by Genomic Health (Redwood City, California). Student's t-test and the Wilcoxon rank sum test were used to compare Recurrence Score data and gene expression data from AA and CA patients (SAS Enterprise Guide 5.1). Samples from 122 AA and 122 CA patients were analyzed. There were 118 women (63 AA, 55 CA) and 126 men (59 AA, 67 CA). Median age was 66 years for AA patients and 68 for CA patients. Age, gender, year of surgery, pathologic T-stage, tumor location, the number of lymph nodes examined, lymphovascular invasion, and MMR status were not significantly different between groups (p = 0.93). The mean Recurrence Score result for AA patients (27.9 ± 12.8) and CA patients (28.1 ± 11.8) was not significantly different and the proportions of patients with high Recurrence Score values (≥41) were similar between the groups (17/122 AA; 15/122 CA). None of the gene expression variables, either single genes or gene groups (cell cycle group, stromal group, BGN1, FAP, INHBA1, Ki67, MYBL2, cMYC and GADD45B), was significantly different between the racial groups. After controlling for clinical and pathologic covariates, the means and distributions of Recurrence Score results and gene expression profiles showed no statistically significant difference between patient groups. The distribution of

A comparison of 12-gene colon cancer assay gene expression in African American and Caucasian patients with stage II colon cancer

International Nuclear Information System (INIS)

Govindarajan, Rangaswamy; Posey, James; Chao, Calvin Y.; Lu, Ruixiao; Jadhav, Trafina; Javed, Ahmed Y.; Javed, Awais; Mahmoud, Fade A.; Osarogiagbon, Raymond University; Manne, Upender

2016-01-01

African American (AA) colon cancer patients have a worse prognosis than Caucasian (CA) colon cancer patients, however, reasons for this disparity are not well understood. To determine if tumor biology might contribute to differential prognosis, we measured recurrence risk and gene expression using the Oncotype DX® Colon Cancer Assay (12-gene assay) and compared the Recurrence Score results and gene expression profiles between AA patients and CA patients with stage II colon cancer. We retrieved demographic, clinical, and archived tumor tissues from stage II colon cancer patients at four institutions. The 12-gene assay and mismatch repair (MMR) status were performed by Genomic Health (Redwood City, California). Student’s t-test and the Wilcoxon rank sum test were used to compare Recurrence Score data and gene expression data from AA and CA patients (SAS Enterprise Guide 5.1). Samples from 122 AA and 122 CA patients were analyzed. There were 118 women (63 AA, 55 CA) and 126 men (59 AA, 67 CA). Median age was 66 years for AA patients and 68 for CA patients. Age, gender, year of surgery, pathologic T-stage, tumor location, the number of lymph nodes examined, lymphovascular invasion, and MMR status were not significantly different between groups (p = 0.93). The mean Recurrence Score result for AA patients (27.9 ± 12.8) and CA patients (28.1 ± 11.8) was not significantly different and the proportions of patients with high Recurrence Score values (≥41) were similar between the groups (17/122 AA; 15/122 CA). None of the gene expression variables, either single genes or gene groups (cell cycle group, stromal group, BGN1, FAP, INHBA1, Ki67, MYBL2, cMYC and GADD45B), was significantly different between the racial groups. After controlling for clinical and pathologic covariates, the means and distributions of Recurrence Score results and gene expression profiles showed no statistically significant difference between patient groups. The distribution of Recurrence Score

Molecular Imaging of Human Embryonic Stem Cells Stably Expressing Human PET Reporter Genes After Zinc Finger Nuclease-Mediated Genome Editing.

Science.gov (United States)

Wolfs, Esther; Holvoet, Bryan; Ordovas, Laura; Breuls, Natacha; Helsen, Nicky; Schönberger, Matthias; Raitano, Susanna; Struys, Tom; Vanbilloen, Bert; Casteels, Cindy; Sampaolesi, Maurilio; Van Laere, Koen; Lambrichts, Ivo; Verfaillie, Catherine M; Deroose, Christophe M

2017-10-01

Molecular imaging is indispensable for determining the fate and persistence of engrafted stem cells. Standard strategies for transgene induction involve the use of viral vectors prone to silencing and insertional mutagenesis or the use of nonhuman genes. Methods: We used zinc finger nucleases to induce stable expression of human imaging reporter genes into the safe-harbor locus adeno-associated virus integration site 1 in human embryonic stem cells. Plasmids were generated carrying reporter genes for fluorescence, bioluminescence imaging, and human PET reporter genes. Results: In vitro assays confirmed their functionality, and embryonic stem cells retained differentiation capacity. Teratoma formation assays were performed, and tumors were imaged over time with PET and bioluminescence imaging. Conclusion: This study demonstrates the application of genome editing for targeted integration of human imaging reporter genes in human embryonic stem cells for long-term molecular imaging. © 2017 by the Society of Nuclear Medicine and Molecular Imaging.

A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

Directory of Open Access Journals (Sweden)

Jie Lei

2018-03-01

Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

Assay development status report for total cyanide

International Nuclear Information System (INIS)

Simpson, B.C.; Jones, T.E.; Pool, K.H.

1993-02-01

A validated cyanide assay that is applicable to a variety of tank waste matrices is necessary to resolve certain waste tank safety issues and for purposes of overall waste characterization. The target for this effort is an assay with an applicable range of greater than 1,000 ppM (0.10 wt%) total cyanide and a confidence level greater than 80%. Figure 1 illustrates the operating regime of the proposed cyanide assay method. The Assay Development Status Report for Total Cyanide will summarize the past experience with cyanide analyses on-tank waste matrices and will rate the status of the analytical methods used to assay total cyanide (CN - ion) in the tank waste matrices as acceptable or unacceptable. This paper will also briefly describe the current efforts for improving analytical resolution of the assays and the attempts at speciation

Characterization of vitellogenin gene expression in round goby (Neogobius melanostomus) using a quantitative polymerase chain reaction assay.

Science.gov (United States)

Bowley, Lucas A; Alam, Farhana; Marentette, Julie R; Balshine, Sigal; Wilson, Joanna Y

2010-12-01

A growing concern over endocrine disruption in aquatic species has prompted the development of molecular assays to monitor environmental impacts. This study describes the development of quantitative polymerase chain reaction (qPCR) assays to characterize the expression of two vitellogenin (Vtg) genes in the invasive round goby (Neogobius melanostomus). Fragments from the 18SrRNA (housekeeping gene), Vtg II, and Vtg III genes were cloned and sequenced. The qPCR assays were developed to detect hepatic Vtg expression in goby. The assays detected induction of both Vtg genes in nonreproductive males following a two-week laboratory exposure to 17β-estradiol (≥1 mg/kg i.p. injection). The assays were applied to goby from Hamilton Harbour, Lake Ontario (Canada), including those from sites where feminization and intersex of goby has been documented. Both Vtg genes had significantly higher expression in females compared to males. Male reproductive goby adopt either parental or sneaker tactics; Vtg II expression was higher in sneaker than in parental males but parental and nonreproductive males did not differ from each other. The Vtg III expression was significantly higher in sneaker males followed by parental males and nonreproductive males, respectively. The Vtg II and III expression in nonreproductive males was elevated in the contaminated site with documented intersex. This assay provides an important tool for the use of an invasive species in monitoring endocrine disruption in the Great Lakes region. Copyright © 2010 SETAC.

International network for comparison of HIV neutralization assays: the NeutNet report.

Directory of Open Access Journals (Sweden)

Eva Maria Fenyö

Full Text Available Neutralizing antibody assessments play a central role in human immunodeficiency virus type-1 (HIV-1 vaccine development but it is unclear which assay, or combination of assays, will provide reliable measures of correlates of protection. To address this, an international collaboration (NeutNet involving 18 independent participants was organized to compare different assays.Each laboratory evaluated four neutralizing reagents (TriMab, 447-52D, 4E10, sCD4 at a given range of concentrations against a panel of 11 viruses representing a wide range of genetic subtypes and phenotypes. A total of 16 different assays were compared. The assays utilized either uncloned virus produced in peripheral blood mononuclear cells (PBMCs (virus infectivity assays, VI assays, or their Env-pseudotyped (gp160 derivatives produced in 293T cells (PSV assays from molecular clones or uncloned virus. Target cells included PBMC and genetically-engineered cell lines in either a single- or multiple-cycle infection format. Infection was quantified by using a range of assay read-outs that included extracellular or intracellular p24 antigen detection, RNA quantification and luciferase and beta-galactosidase reporter gene expression.PSV assays were generally more sensitive than VI assays, but there were important differences according to the virus and inhibitor used. For example, for TriMab, the mean IC50 was always lower in PSV than in VI assays. However, with 4E10 or sCD4 some viruses were neutralized with a lower IC50 in VI assays than in the PSV assays. Inter-laboratory concordance was slightly better for PSV than for VI assays with some viruses, but for other viruses agreement between laboratories was limited and depended on both the virus and the neutralizing reagent.The NeutNet project demonstrated clear differences in assay sensitivity that were dependent on both the neutralizing reagent and the virus. No single assay was capable of detecting the entire spectrum of

Detection of selected antibiotic resistance genes using multiplex PCR assay in mastitis pathogens in the Czech Republic

Directory of Open Access Journals (Sweden)

Vladimir Pyatov

2017-01-01

Full Text Available The aim of this research was to develop multiplex polymerase chain reaction assays for the detection of aminoglycoside (strA, strB, sulphonamide (sulI, sulII, tetracycline (tetA, tetB, tetK, tetM, tetO, macrolide and lincosamide (msrA, ermA, ermB, ermC, mefA/E genes of resistance in mastitis pathogens (Escherichia coli, Staphylococcus aureus, Streptococcus uberis, Streptococcus agalactiae and Streptococcus dysgalactiae. Applying the established assays, we investigated the distribution of antibiotic resistance genes in the above mentioned species isolated from milk samples in the Czech Republic. Each assay consisted of seven pairs of primers. Six of them amplified fragments of antibiotic resistance genes and one pair a fragment of a species specific gene. Polymerase chain reaction conditions were optimized to amplify seven gene fragments simultaneously in one reaction. In total, 249 isolates were used, among which 111 were positive for E. coli, 52 for S. aureus and 86 for Streptococcus spp. The majority (60.2% of bacteria carried at least one antibiotic resistance gene and 44.6% were multidrug-resistant. The designed multiplex polymerase chain reaction assays may be applied as diagnostic method to replace or complement standard techniques of antibiotic susceptibility testing in the mentioned pathogens.

Multiple-endpoints gene alteration-based (MEGA) assay: A toxicogenomics approach for water quality assessment of wastewater effluents.

Science.gov (United States)

Fukushima, Toshikazu; Hara-Yamamura, Hiroe; Nakashima, Koji; Tan, Lea Chua; Okabe, Satoshi

2017-12-01

Wastewater effluents contain a significant number of toxic contaminants, which, even at low concentrations, display a wide variety of toxic actions. In this study, we developed a multiple-endpoints gene alteration-based (MEGA) assay, a real-time PCR-based transcriptomic analysis, to assess the water quality of wastewater effluents for human health risk assessment and management. Twenty-one genes from the human hepatoblastoma cell line (HepG2), covering the basic health-relevant stress responses such as response to xenobiotics, genotoxicity, and cytotoxicity, were selected and incorporated into the MEGA assay. The genes related to the p53-mediated DNA damage response and cytochrome P450 were selected as markers for genotoxicity and response to xenobiotics, respectively. Additionally, the genes that were dose-dependently regulated by exposure to the wastewater effluents were chosen as markers for cytotoxicity. The alterations in the expression of an individual gene, induced by exposure to the wastewater effluents, were evaluated by real-time PCR and the results were validated by genotoxicity (e.g., comet assay) and cell-based cytotoxicity tests. In summary, the MEGA assay is a real-time PCR-based assay that targets cellular responses to contaminants present in wastewater effluents at the transcriptional level; it is rapid, cost-effective, and high-throughput and can thus complement any chemical analysis for water quality assessment and management. Copyright © 2017 Elsevier Ltd. All rights reserved.

Tissue-specific methylation of human insulin gene and PCR assay for monitoring beta cell death.

Directory of Open Access Journals (Sweden)

Mohamed I Husseiny

Full Text Available The onset of metabolic dysregulation in type 1 diabetes (T1D occurs after autoimmune destruction of the majority of pancreatic insulin-producing beta cells. We previously demonstrated that the DNA encoding the insulin gene is uniquely unmethylated in these cells and then developed a methylation-specific PCR (MSP assay to identify circulating beta cell DNA in streptozotocin-treated mice prior to the rise in blood glucose. The current study extends to autoimmune non-obese diabetic (NOD mice and humans, showing in NOD mice that beta cell death occurs six weeks before the rise in blood sugar and coincides with the onset of islet infiltration by immune cells, demonstrating the utility of MSP for monitoring T1D. We previously reported unique patterns of methylation of the human insulin gene, and now extend this to other human tissues. The methylation patterns of the human insulin promoter, intron 1, exon 2, and intron 2 were determined in several normal human tissues. Similar to our previous report, the human insulin promoter was unmethylated in beta cells, but methylated in all other tissues tested. In contrast, intron 1, exon 2 and intron 2 did not exhibit any tissue-specific DNA methylation pattern. Subsequently, a human MSP assay was developed based on the methylation pattern of the insulin promoter and human islet DNA was successfully detected in circulation of T1D patients after islet transplantation therapy. Signal levels of normal controls and pre-transplant samples were shown to be similar, but increased dramatically after islet transplantation. In plasma the signal declines with time but in whole blood remains elevated for at least two weeks, indicating that association of beta cell DNA with blood cells prolongs the signal. This assay provides an effective method to monitor beta cell destruction in early T1D and in islet transplantation therapy.

Repetitive Imaging of Reporter Gene Expression in the Lung

Directory of Open Access Journals (Sweden)

Jean-Christophe Richard

2003-10-01

Full Text Available Positron emission tomographic imaging is emerging as a powerful technology to monitor reporter transgene expression in the lungs and other organs. However, little information is available about its usefulness for studying gene expression over time. Therefore, we infected 20 rats with a replication-deficient adenovirus containing a fusion gene encoding for a mutant Herpes simplex virus type-1 thymidine kinase and an enhanced green fluorescent protein. Five additional rats were infected with a control virus. Pulmonary gene transfer was performed via intratracheal administration of vector using a surfactant-based method. Imaging was performed 4–6 hr, and 4, 7, and 10 days after gene transfer, using 9-(4-[18F]-fluoro-3-hydroxymethylbutylguanine, an imaging substrate for the mutant kinase. Lung tracer uptake assessed with imaging was moderately but significantly increased 4–6 hr after gene transfer, was maximal after 4 days, and was no longer detectable by 10 days. The temporal pattern of transgene expression measured ex vivo with in vitro assays of thymidine kinase activity and green fluorescent protein was similar to imaging. In conclusion, positron emission tomography is a reliable new tool to evaluate the onset and duration of reporter gene expression noninvasively in the lungs of intact animals.

Radionuclide reporter gene imaging for cardiac gene therapy

International Nuclear Information System (INIS)

Inubushi, Masayuki; Tamaki, Nagara

2007-01-01

In the field of cardiac gene therapy, angiogenic gene therapy has been most extensively investigated. The first clinical trial of cardiac angiogenic gene therapy was reported in 1998, and at the peak, more than 20 clinical trial protocols were under evaluation. However, most trials have ceased owing to the lack of decisive proof of therapeutic effects and the potential risks of viral vectors. In order to further advance cardiac angiogenic gene therapy, remaining open issues need to be resolved: there needs to be improvement of gene transfer methods, regulation of gene expression, development of much safer vectors and optimisation of therapeutic genes. For these purposes, imaging of gene expression in living organisms is of great importance. In radionuclide reporter gene imaging, ''reporter genes'' transferred into cell nuclei encode for a protein that retains a complementary ''reporter probe'' of a positron or single-photon emitter; thus expression of the reporter genes can be imaged with positron emission tomography or single-photon emission computed tomography. Accordingly, in the setting of gene therapy, the location, magnitude and duration of the therapeutic gene co-expression with the reporter genes can be monitored non-invasively. In the near future, gene therapy may evolve into combination therapy with stem/progenitor cell transplantation, so-called cell-based gene therapy or gene-modified cell therapy. Radionuclide reporter gene imaging is now expected to contribute in providing evidence on the usefulness of this novel therapeutic approach, as well as in investigating the molecular mechanisms underlying neovascularisation and safety issues relevant to further progress in conventional gene therapy. (orig.)

Multiplex real-time PCR assay for the detection of extended-spectrum β-lactamase and carbapenemase genes using melting curve analysis.

Science.gov (United States)

Singh, Prashant; Pfeifer, Yvonne; Mustapha, Azlin

2016-05-01

Real-time PCR melt curve assays for the detection of β-lactamase, extended-spectrum β-lactamase and carbapenemase genes in Gram-negative bacteria were developed. Two multiplex real-time PCR melt curve assays were developed for the detection of ten common β-lactamase genes: blaKPC-like, blaOXA-48-like, blaNDM-like, blaVIM-like, blaIMP-like, blaCTX-M-1+2-group, blaCMY-like, blaACC-like, blaSHV-like and blaTEM-like. The assays were evaluated using 25 bacterial strains and 31 DNA samples (total n=56) comprising different Enterobacteriaceae genera and Pseudomonas spp. These strains were previously characterized at five research institutes. Each resistance gene targeted in this study generated a non-overlapping and distinct melt curve peak. The assay worked effectively and detected the presence of additional resistance genes in 23 samples. The assays developed in this study offer a simple, low cost method for the detection of prevalent β-lactamase, ESBL and carbapenemase genes among Gram-negative pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.

Real-time PCR based on SYBR-Green I fluorescence: An alternative to the TaqMan assay for a relative quantification of gene rearrangements, gene amplifications and micro gene deletions

Directory of Open Access Journals (Sweden)

Puisieux Alain

2003-10-01

Full Text Available Abstract Background Real-time PCR is increasingly being adopted for RNA quantification and genetic analysis. At present the most popular real-time PCR assay is based on the hybridisation of a dual-labelled probe to the PCR product, and the development of a signal by loss of fluorescence quenching as PCR degrades the probe. Though this so-called 'TaqMan' approach has proved easy to optimise in practice, the dual-labelled probes are relatively expensive. Results We have designed a new assay based on SYBR-Green I binding that is quick, reliable, easily optimised and compares well with the published assay. Here we demonstrate its general applicability by measuring copy number in three different genetic contexts; the quantification of a gene rearrangement (T-cell receptor excision circles (TREC in peripheral blood mononuclear cells; the detection and quantification of GLI, MYC-C and MYC-N gene amplification in cell lines and cancer biopsies; and detection of deletions in the OPA1 gene in dominant optic atrophy. Conclusion Our assay has important clinical applications, providing accurate diagnostic results in less time, from less biopsy material and at less cost than assays currently employed such as FISH or Southern blotting.

The detection and differentiation of methicillin-resistant and methicillin-susceptible Staphylococcus aureus endocarditis by using the BD GeneOhm StaphSR Assay.

Science.gov (United States)

Frey, Amy B; Wilson, Deborah A; LaSalvia, Margaret M; Tan, Carmela D; Rodriguez, E Rene; Shrestha, Nabin K; Hall, Gerri S; Procop, Gary W

2011-11-01

We use the BD GeneOhm StaphSR Assay (BD Diagnostics, Oakville, Canada) to screen for Staphylococcus aureus nasal colonization and sought to evaluate this assay for the assessment of valve specimens from patients with endocarditis. We examined 23 paired fresh and formalin-fixed, paraffin-embedded cardiac valve tissue samples, 12 of which had S aureus endocarditis, using the BD GeneOhm StaphSR Assay for the detection and differentiation of methicillin-susceptible and methicillin-resistant S aureus. This assay appropriately characterized all specimens with respect to the presence or absence of S aureus. There was an 87.5% correlation between the presence or absence of the mecA gene and the oxacillin susceptibility results for the S aureus isolates studied. The GeneOhm StaphSR assay accurately detected S aureus in cardiac valve tissue samples. Rare discordances were observed between oxacillin susceptibility status and mecA gene detection by this assay.

Advance in plasma SEPT9 gene methylation assay for colorectal cancer early detection.

Science.gov (United States)

Wang, Yu; Chen, Pei-Min; Liu, Rong-Bin

2018-01-15

This review article summarizes the research advances of the plasma-based SEPT9 gene methylation assay for the clinical detection of colorectal cancer and its limitations. Colorectal cancer is a common malignancy with a poor prognosis and a high mortality, for which early detection and diagnosis are particularly crucial for the high-risk groups. Increasing evidence supported that SEPT9 gene methylation is associated with the pathogenesis of colorectal cancer and that detecting the level of methylation of SEPT9 in the peripheral blood can be used for screening of colorectal cancer in susceptible populations. In recent years, the data obtained in clinical studies demonstrated that the SEPT9 gene methylation assay has a good diagnostic performance with regard to both sensitivity and specificity with the advantage of better acceptability, convenience and compliance with serological testing compared with fecal occult blood tests and carcinoembryonic antigen for colorectal cancer (CRC). Furthermore, the combination of multiple methods or markers has become a growing trend for CRC detection and screening. Nevertheless, the clinical availability of the methylated SEPT9 assay is still limited because of the large degree of sample heterogeneity caused by demographic characteristics, pathological features, comorbidities and/or technique selection. Another factor is the cost-effectiveness of colorectal cancer screening strategies that hinders its large-scale application. In addition, improvements in its accuracy in detecting adenomas and premalignant polyps are required.

Comparison of gull-specific assays targeting 16S rRNA gene of Catellicoccus marimammalium and Streptococcus spp.

Science.gov (United States)

Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...

Assay for identification of heterozygous single-nucleotide polymorphism (Ala67Thr in human poliovirus receptor gene

Directory of Open Access Journals (Sweden)

Shyam Sundar Nandi

2016-01-01

Results: A new SNP assay for detection of heterozygous Ala67Thr genotype was developed and validated by testing 150 DNA samples. Heterozygous CD155 was detected in 27.33 per cent (41/150 of DNA samples tested by both SNP detection assay and sequencing. Interpretation & conclusions: The SNP detection assay was successfully developed for identification of Ala67Thr polymorphism in human PVR/CD155 gene. The SNP assay will be useful for large scale screening of DNA samples.

Imaging reporter gene for monitoring gene therapy

International Nuclear Information System (INIS)

Beco, V. de; Baillet, G.; Tamgac, F.; Tofighi, M.; Weinmann, P.; Vergote, J.; Moretti, J.L.; Tamgac, G.

2002-01-01

Scintigraphic images can be obtained to document gene function at cellular level. This approach is presented here and the use of a reporter gene to monitor gene therapy is described. Two main ways are presented: either the use of a reporter gene coding for an enzyme the action of which will be monitored by radiolabeled pro-drug, or a cellular receptor gene, the action of which is documented by a radio labeled cognate receptor ligand. (author)

Tetraplex PCR assay involving double gene-sites discriminates beef and buffalo in Malaysian meat curry and burger products.

Science.gov (United States)

Hossain, M A Motalib; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Hossain, S M Azad; Asing; Nizar, Nina Naquiah Ahmad; Uddin, Mohammad Nasir; Ali, Lokman; Asaduzzaman, Md; Akanda, Md Jahurul Haque

2017-06-01

Replacement of beef by buffalo and vice versa is frequent in global markets, but their authentication is challenging in processed foods due to the fragmentation of most biomarkers including DNA. The shortening of target sequences through use of two target sites might ameliorate assay reliability because it is highly unlikely that both targets will be lost during food processing. For the first time, we report a tetraplex polymerase chain reaction (PCR) assay targeting two different DNA regions in beef (106 and 120-bp) and buffalo (90 and 138-bp) mitochondrial genes to discriminate beef and buffalo in processed foods. All targets were stable under boiling, autoclaving and microwave cooking conditions. A survey in Malaysian markets revealed 71% beef curries contained buffalo but there was no buffalo in beef burgers. The assay detected down to 0.01ng DNA and 1% meat in admixed and burger products. Copyright © 2016 Elsevier Ltd. All rights reserved.

Developing a yeast-based assay protocol to monitor total ...

African Journals Online (AJOL)

A yeast-based assay protocol developed for detecting oestrogenic activity in activated sludge (AS) supernatant is described. The protocol used Saccharomyces cerevisiae construct RMY/ER-ERE with human oestrogen receptor (ERα) and lacZ reporter genes, and was developed by modifying existing assays for use with AS ...

Gene-mutation assays in lambda-lacZ transgenic mice : comparison of lacZ with endogenous genes in splenocytes and small intestinal epithelium

NARCIS (Netherlands)

Delft, J.H.M. van; Bergmans, A.; Dam, F.J. van; Tates, A.D.; Howard, L.; Winton, D.J.; Baan, R.A.

1998-01-01

Comparison of results derived from transgenic animal gene-mutation assays with those from mutation analyses in endogenous genes is an important step in the validation of the former. We have used λlacZ transgenic mice to study alkylation-induced mutagenesis in vivo in (a) lacZ and hprt in spleen

International network for comparison of HIV neutralization assays: the NeutNet report II.

Directory of Open Access Journals (Sweden)

Leo Heyndrickx

Full Text Available BACKGROUND: Neutralizing antibodies provide markers for vaccine-induced protective immunity in many viral infections. By analogy, HIV-1 neutralizing antibodies induced by immunization may well predict vaccine effectiveness. Assessment of neutralizing antibodies is therefore of primary importance, but is hampered by the fact that we do not know which assay(s can provide measures of protective immunity. An international collaboration (NeutNet involving 18 different laboratories previously compared different assays using monoclonal antibodies (mAbs and soluble CD4 (Phase I study. METHODS: In the present study (Phase II, polyclonal reagents were evaluated by 13 laboratories. Each laboratory evaluated nine plasmas against an 8 virus panel representing different genetic subtypes and phenotypes. TriMab, a mixture of three mAbs, was used as a positive control allowing comparison of the results with Phase I in a total of nine different assays. The assays used either uncloned virus produced in peripheral blood mononuclear cells (PBMCs (Virus Infectivity Assays, VIA, or Env (gp160-pseudotyped viruses (pseudoviruses, PSV produced in HEK293T cells from molecular clones or from uncloned virus. Target cells included PBMC and genetically engineered cell lines in either single- or multiple-cycle infection format. Infection was quantified by using a range of assay read-outs including extra- or intra-cellular p24 antigen detection, luciferase, beta-galactosidase or green fluorescent protein (GFP reporter gene expression. FINDINGS: Using TriMab, results of Phase I and Phase II were generally in agreement for six of the eight viruses tested and confirmed that the PSV assay is more sensitive than PBMC (p = 0.014. Comparisons with the polyclonal reagents showed that sensitivities were dependent on both virus and plasma. CONCLUSIONS: Here we further demonstrate clear differences in assay sensitivities that were dependent on both the neutralizing reagent and the virus

International network for comparison of HIV neutralization assays: the NeutNet report II.

Science.gov (United States)

Heyndrickx, Leo; Heath, Alan; Sheik-Khalil, Enas; Alcami, Jose; Bongertz, Vera; Jansson, Marianne; Malnati, Mauro; Montefiori, David; Moog, Christiane; Morris, Lynn; Osmanov, Saladin; Polonis, Victoria; Ramaswamy, Meghna; Sattentau, Quentin; Tolazzi, Monica; Schuitemaker, Hanneke; Willems, Betty; Wrin, Terri; Fenyö, Eva Maria; Scarlatti, Gabriella

2012-01-01

Neutralizing antibodies provide markers for vaccine-induced protective immunity in many viral infections. By analogy, HIV-1 neutralizing antibodies induced by immunization may well predict vaccine effectiveness. Assessment of neutralizing antibodies is therefore of primary importance, but is hampered by the fact that we do not know which assay(s) can provide measures of protective immunity. An international collaboration (NeutNet) involving 18 different laboratories previously compared different assays using monoclonal antibodies (mAbs) and soluble CD4 (Phase I study). In the present study (Phase II), polyclonal reagents were evaluated by 13 laboratories. Each laboratory evaluated nine plasmas against an 8 virus panel representing different genetic subtypes and phenotypes. TriMab, a mixture of three mAbs, was used as a positive control allowing comparison of the results with Phase I in a total of nine different assays. The assays used either uncloned virus produced in peripheral blood mononuclear cells (PBMCs) (Virus Infectivity Assays, VIA), or Env (gp160)-pseudotyped viruses (pseudoviruses, PSV) produced in HEK293T cells from molecular clones or from uncloned virus. Target cells included PBMC and genetically engineered cell lines in either single- or multiple-cycle infection format. Infection was quantified by using a range of assay read-outs including extra- or intra-cellular p24 antigen detection, luciferase, beta-galactosidase or green fluorescent protein (GFP) reporter gene expression. Using TriMab, results of Phase I and Phase II were generally in agreement for six of the eight viruses tested and confirmed that the PSV assay is more sensitive than PBMC (p = 0.014). Comparisons with the polyclonal reagents showed that sensitivities were dependent on both virus and plasma. Here we further demonstrate clear differences in assay sensitivities that were dependent on both the neutralizing reagent and the virus. Consistent with the Phase I study, we recommend

The performance of the SEPT9 gene methylation assay and a comparison with other CRC screening tests: A meta-analysis.

Science.gov (United States)

Song, Lele; Jia, Jia; Peng, Xiumei; Xiao, Wenhua; Li, Yuemin

2017-06-08

The SEPT9 gene methylation assay is the first FDA-approved blood assay for colorectal cancer (CRC) screening. Fecal immunochemical test (FIT), FIT-DNA test and CEA assay are also in vitro diagnostic (IVD) tests used in CRC screening. This meta-analysis aims to review the SEPT9 assay performance and compare it with other IVD CRC screening tests. By searching the Ovid MEDLINE, EMBASE, CBMdisc and CJFD database, 25 out of 180 studies were identified to report the SEPT9 assay performance. 2613 CRC cases and 6030 controls were included, and sensitivity and specificity were used to evaluate its performance at various algorithms. 1/3 algorithm exhibited the best sensitivity while 2/3 and 1/1 algorithm exhibited the best balance between sensitivity and specificity. The performance of the blood SEPT9 assay is superior to that of the serum protein markers and the FIT test in symptomatic population, while appeared to be less potent than FIT and FIT-DNA tests in asymptomatic population. In conclusion, 1/3 algorithm is recommended for CRC screening, and 2/3 or 1/1 algorithms are suitable for early detection for diagnostic purpose. The SEPT9 assay exhibited better performance in symptomatic population than in asymptomatic population.

Assaying gene function by growth competition experiment.

Science.gov (United States)

Merritt, Joshua; Edwards, Jeremy S

2004-07-01

High-throughput screening and analysis is one of the emerging paradigms in biotechnology. In particular, high-throughput methods are essential in the field of functional genomics because of the vast amount of data generated in recent and ongoing genome sequencing efforts. In this report we discuss integrated functional analysis methodologies which incorporate both a growth competition component and a highly parallel assay used to quantify results of the growth competition. Several applications of the two most widely used technologies in the field, i.e., transposon mutagenesis and deletion strain library growth competition, and individual applications of several developing or less widely reported technologies are presented.

Advances in study of reporter gene imaging for monitoring gene therapy

International Nuclear Information System (INIS)

Mu Chuanjie; Zhou Jiwen

2003-01-01

To evaluate the efficiency of gene therapy, it is requisite to monitor localization and expression of the therapeutic gene in vivo. Monitoring expression of reporter gene using radionuclide reporter gene technique is the best method. Adenoviral vectors expressing reporter gene are constructed using gene fusion, bicistronic, double promoter or bidirectional transcriptional recombination techniques, and transferred into target cells and tissues, then injected radiolabeled reporter probes which couple to the reporter genes. The reporter genes can be imaged invasively, repeatedly, quantitatively with γ-camera, PET and SPECT. Recently, several reporter gene and reporter probe systems have been used in studies of gene therapy. The part of them has been used for clinic trials

A high-throughput fluorescence-based assay system for appetite-regulating gene and drug screening.

Directory of Open Access Journals (Sweden)

Yasuhito Shimada

Full Text Available The increasing number of people suffering from metabolic syndrome and obesity is becoming a serious problem not only in developed countries, but also in developing countries. However, there are few agents currently approved for the treatment of obesity. Those that are available are mainly appetite suppressants and gastrointestinal fat blockers. We have developed a simple and rapid method for the measurement of the feeding volume of Danio rerio (zebrafish. This assay can be used to screen appetite suppressants and enhancers. In this study, zebrafish were fed viable paramecia that were fluorescently-labeled, and feeding volume was measured using a 96-well microplate reader. Gene expression analysis of brain-derived neurotrophic factor (bdnf, knockdown of appetite-regulating genes (neuropeptide Y, preproinsulin, melanocortin 4 receptor, agouti related protein, and cannabinoid receptor 1, and the administration of clinical appetite suppressants (fluoxetine, sibutramine, mazindol, phentermine, and rimonabant revealed the similarity among mechanisms regulating appetite in zebrafish and mammals. In combination with behavioral analysis, we were able to evaluate adverse effects on locomotor activities from gene knockdown and chemical treatments. In conclusion, we have developed an assay that uses zebrafish, which can be applied to high-throughput screening and target gene discovery for appetite suppressants and enhancers.

Comparison of Gull Feces-specific Assays Targeting the 16S rRNA Gene of Catellicoccus Marimammalium and Streptococcus spp.

Science.gov (United States)

Two novel gull-specific qPCR assays were developed using 16S rRNA gene sequences from gull fecal clone libraries: a SYBR-green-based assay targeting Streptococcus spp. (i.e., gull3) and a TaqMan qPCR assay targeting Catellicoccus marimammalium (i.e., gull4). The main objectives ...

Comparison of two commercial carbapenemase gene confirmatory assays in multiresistant Enterobacteriaceae and Acinetobacter baumannii-complex.

Science.gov (United States)

Rösner, Stephan; Gehlweiler, Kevin; Küsters, Uta; Kolbert, Mathias; Hübner, Kirsten; Pfennigwerth, Niels; Mack, Dietrich

2018-01-01

Multidrug-resistant Gram-negative bacilli (MDR-GNB) producing carbapenemases are increasing at an alarming speed. Rapid confirmation of carbapenemase type will be an important diagnostic step in clinical microbiology laboratories not only to reduce the risk of transmissions but also for optimising antibiotic therapy in the future. We compared diagnostic reliability of two commercially available molecular assays (Check-Direct CPE vs. AID line probe assay) for detection and typing of carbapenemase genes in 80 well-characterized isolates of MDR-GNB. Respective strains were isolated in various clinical specimens at our clinical microbiology laboratory. The reference standard included confirmation of carbapenemase-production at the molecular level at the German National Reference Laboratory for Multidrug-resistant Gram-negative bacteria (Ruhr-University Bochum, Germany). 53 Enterobacteriaceae and 27 members of the A. baumannii-complex were used in this study. The tested assays appeared highly reliable to confirm carbapenemase-producing Enterobacteriaceae (CPE) with respective sensitivities of 97.7%, but are currently unsuitable for analysis of members of the A. baumannii-complex. Both assays are easy to perform and rapid tools for confirmation and typing of the most common carbapenemase genes in Enterobacteriaceae. Implementation should be possible for any clinical microbiology laboratory with Check-Direct CPE being easier to handle and having less technological requirements.

Comparison of two commercial carbapenemase gene confirmatory assays in multiresistant Enterobacteriaceae and Acinetobacter baumannii-complex.

Directory of Open Access Journals (Sweden)

Stephan Rösner

Full Text Available Multidrug-resistant Gram-negative bacilli (MDR-GNB producing carbapenemases are increasing at an alarming speed. Rapid confirmation of carbapenemase type will be an important diagnostic step in clinical microbiology laboratories not only to reduce the risk of transmissions but also for optimising antibiotic therapy in the future. We compared diagnostic reliability of two commercially available molecular assays (Check-Direct CPE vs. AID line probe assay for detection and typing of carbapenemase genes in 80 well-characterized isolates of MDR-GNB. Respective strains were isolated in various clinical specimens at our clinical microbiology laboratory. The reference standard included confirmation of carbapenemase-production at the molecular level at the German National Reference Laboratory for Multidrug-resistant Gram-negative bacteria (Ruhr-University Bochum, Germany. 53 Enterobacteriaceae and 27 members of the A. baumannii-complex were used in this study. The tested assays appeared highly reliable to confirm carbapenemase-producing Enterobacteriaceae (CPE with respective sensitivities of 97.7%, but are currently unsuitable for analysis of members of the A. baumannii-complex. Both assays are easy to perform and rapid tools for confirmation and typing of the most common carbapenemase genes in Enterobacteriaceae. Implementation should be possible for any clinical microbiology laboratory with Check-Direct CPE being easier to handle and having less technological requirements.

Assays of dioxins and dioxin-like compounds in actually contaminated soils using transgenic tobacco plants carrying a recombinant mouse aryl hydrocarbon receptor-mediated β-glucuronidase reporter gene expression system.

Science.gov (United States)

Inui, Hideyuki; Gion, Keiko; Utani, Yasushi; Wakai, Taketo; Kodama, Susumu; Eun, Heesoo; Kim, Yun-Seok; Ohkawa, Hideo

2012-01-01

The transgenic tobacco plant XD4V-26 carrying the recombinant mouse aryl hydrocarbon receptor XD4V-mediated β-glucuronidase (GUS) reporter gene expression system was used for assay of dioxins and dioxin-like compounds consisting of polychlorinated dibenzeno-p-dioxins, polychlorinated dibenzofurans, and coplanar polychlorinated biphenyls (Co-PCBs) in actually contaminated soils. The transgenic tobacco plant XD4V-26 showed a significant dose-dependent induced GUS activity when cultured on MS medium containing PCB126 [toxic equivalency factor (TEF) = 0.1]. In contrast, PCB169 and PCB180, which have 0.03 of TEF and unassigned TEF values, respectively, did not significantly induce GUS activity under the same conditions as with PCB126. When the tobacco plants were cultivated for up to 5 weeks on actually contaminated soils with dioxins and dioxin-like compounds collected from the periphery of an incinerator used for disposal of residential and industrial wastes, GUS activity in the leaves was dose-dependently increased. The plants clearly detected 360 pg-TEQ g(-1) of dioxins and dioxin-like compounds in this assay. There was a positive correlation between GUS activity and TEQ value of dioxins and dioxin-like compounds in the plants. This assay does not require any extraction and purification processes for the actually contaminated soil samples.

Analytical Performance Characteristics of the Cepheid GeneXpert Ebola Assay for the Detection of Ebola Virus

Science.gov (United States)

Pinsky, Benjamin A.; Sahoo, Malaya K.; Sandlund, Johanna; Kleman, Marika; Kulkarni, Medha; Grufman, Per; Nygren, Malin; Kwiatkowski, Robert; Baron, Ellen Jo; Tenover, Fred; Denison, Blake; Higuchi, Russell; Van Atta, Reuel; Beer, Neil Reginald; Carrillo, Alda Celena; Naraghi-Arani, Pejman; Mire, Chad E.; Ranadheera, Charlene; Grolla, Allen; Lagerqvist, Nina; Persing, David H.

2015-01-01

Background The recently developed Xpert® Ebola Assay is a novel nucleic acid amplification test for simplified detection of Ebola virus (EBOV) in whole blood and buccal swab samples. The assay targets sequences in two EBOV genes, lowering the risk for new variants to escape detection in the test. The objective of this report is to present analytical characteristics of the Xpert® Ebola Assay on whole blood samples. Methods and Findings This study evaluated the assay’s analytical sensitivity, analytical specificity, inclusivity and exclusivity performance in whole blood specimens. EBOV RNA, inactivated EBOV, and infectious EBOV were used as targets. The dynamic range of the assay, the inactivation of virus, and specimen stability were also evaluated. The lower limit of detection (LoD) for the assay using inactivated virus was estimated to be 73 copies/mL (95% CI: 51–97 copies/mL). The LoD for infectious virus was estimated to be 1 plaque-forming unit/mL, and for RNA to be 232 copies/mL (95% CI 163–302 copies/mL). The assay correctly identified five different Ebola viruses, Yambuku-Mayinga, Makona-C07, Yambuku-Ecran, Gabon-Ilembe, and Kikwit-956210, and correctly excluded all non-EBOV isolates tested. The conditions used by Xpert® Ebola for inactivation of infectious virus reduced EBOV titer by ≥6 logs. Conclusion In summary, we found the Xpert® Ebola Assay to have high analytical sensitivity and specificity for the detection of EBOV in whole blood. It offers ease of use, fast turnaround time, and remote monitoring. The test has an efficient viral inactivation protocol, fulfills inclusivity and exclusivity criteria, and has specimen stability characteristics consistent with the need for decentralized testing. The simplicity of the assay should enable testing in a wide variety of laboratory settings, including remote laboratories that are not capable of performing highly complex nucleic acid amplification tests, and during outbreaks where time to detection

New in vitro reporter gene bioassays for screening of hormonal active compounds in the environment

Czech Academy of Sciences Publication Activity Database

Svobodová, Kateřina; Cajthaml, Tomáš

2010-01-01

Roč. 88, č. 4 (2010), s. 839-847 ISSN 0175-7598 R&D Projects: GA ČR GAP503/10/0408 Institutional research plan: CEZ:AV0Z50200510 Keywords : endocrine disruptors * in vitro bioassays * reporter gene assays Subject RIV: EE - Microbiology, Virology Impact factor: 3.280, year: 2010

Detection of Cyanobacteria in Eutrophic Water Using a Portable Electrocoagulator and NanoGene Assay.

Science.gov (United States)

Lee, Eun-Hee; Chua, Beelee; Son, Ahjeong

2018-02-06

We have demonstrated the detection of cyanobacteria in eutrophic water samples using a portable electrocoagulator and NanoGene assay. The electrocoagulator is designed to preconcentrate cyanobacteria from water samples prior to analysis via NanoGene assay. Using Microcystis aeruginosa laboratory culture and environmental samples (cell densities ranging from 1.7 × 10 5 to 4.1 × 10 6 and 6.5 × 10 3 to 6.6 × 10 7 cells·mL -1 , respectively), the electrocoagulator was evaluated and compared with a conventional centrifuge. Varying the operation duration from 0 to 300 s with different cell densities was first investigated. Preconcentration efficiencies (obtained via absorbance measurement) and dry cell weight of preconcentrated cyanobacteria were then obtained and compared. For laboratory samples at cell densities from 3.2 × 10 5 to 4.1 × 10 6 cells·mL -1 , the preconcentration efficiencies of electrocoagulator appeared to be stable at ∼60%. At lower cell densities (1.7 and 2.2 × 10 5 cells·mL -1 ), the preconcentration efficiencies decreased to 33.9 ± 0.2 and 40.4 ± 5.4%, respectively. For environmental samples at cell densities of 2.7 × 10 5 and 6.6 × 10 7 cells·mL -1 , the electrocoagulator maintained its preconcentration efficiency at ∼60%. On the other hand, the centrifuge's preconcentration efficiencies decreased to nondetectable and below 40%, respectively. This shows that the electrocoagulator outperformed the centrifuge when using eutrophic water samples. Finally, the compatibility of the electrocoagulator with the NanoGene assay was verified via the successful detection of the microcystin synthetase D (mcyD) gene in environmental samples. The viability of the electrocoagulator as an in situ compatible alternative to the centrifuge is also discussed.

Investigating a multigene prognostic assay based on significant pathways for Luminal A breast cancer through gene expression profile analysis.

Science.gov (United States)

Gao, Haiyan; Yang, Mei; Zhang, Xiaolan

2018-04-01

The present study aimed to investigate potential recurrence-risk biomarkers based on significant pathways for Luminal A breast cancer through gene expression profile analysis. Initially, the gene expression profiles of Luminal A breast cancer patients were downloaded from The Cancer Genome Atlas database. The differentially expressed genes (DEGs) were identified using a Limma package and the hierarchical clustering analysis was conducted for the DEGs. In addition, the functional pathways were screened using Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses and rank ratio calculation. The multigene prognostic assay was exploited based on the statistically significant pathways and its prognostic function was tested using train set and verified using the gene expression data and survival data of Luminal A breast cancer patients downloaded from the Gene Expression Omnibus. A total of 300 DEGs were identified between good and poor outcome groups, including 176 upregulated genes and 124 downregulated genes. The DEGs may be used to effectively distinguish Luminal A samples with different prognoses verified by hierarchical clustering analysis. There were 9 pathways screened as significant pathways and a total of 18 DEGs involved in these 9 pathways were identified as prognostic biomarkers. According to the survival analysis and receiver operating characteristic curve, the obtained 18-gene prognostic assay exhibited good prognostic function with high sensitivity and specificity to both the train and test samples. In conclusion the 18-gene prognostic assay including the key genes, transcription factor 7-like 2, anterior parietal cortex and lymphocyte enhancer factor-1 may provide a new method for predicting outcomes and may be conducive to the promotion of precision medicine for Luminal A breast cancer.

The E-screen test and the MELN gene-reporter assay used for determination of estrogenic activity in fruits and vegetables in relation to pesticide residues.

Science.gov (United States)

Schilirò, Tiziana; Porfido, Arianna; Longo, Annalisa; Coluccia, Sara; Gilli, Giorgio

2013-12-01

Endocrine-disrupting chemicals (EDCs) may lead to adverse systemic effects by interfering with normal hormone homeostasis, and diet is considered to be among the main routes of EDC exposure. The present study investigated the total estrogenic activity of fruits and vegetables by calculating the 17-β-estradiol equivalent quantity (EEQ) using two in vitro tests: the human breast cancer cell line (MCF-7 BUS) proliferation assay (E-screen test) and the luciferase-transfected human breast cancer cell line (MELN) gene-reporter assay. Of the 24 analyzed fruits and vegetables, 14 contained from 1 to 4 pesticide residues in concentrations ranging from 0.02 to 1.19 ppm, whereas the other 10 did not contain any pesticide residues. The EEQ values for all positive samples ranged from 0.010 to 0.616 μg/100g for the above in vitro tests. Our study demonstrates that estrogenic activity was present in fruits and vegetables and that the concentration of allowable pesticide residues and EEQ values were positively correlated; however, no correlation was found by comparing the estrogenic activity and the intrinsic content of phytoestrogens obtained from the available literature. A theoretical adult dietary intake of 0.7-0.9 ng EEQ/L/day from fruits and vegetables was calculated. Copyright © 2013 Elsevier Ltd. All rights reserved.

Radionuclide reporter gene imaging

Energy Technology Data Exchange (ETDEWEB)

Min, Jung Joon [School of Medicine, Chonnam National Univ., Gwangju (Korea, Republic of)

2004-04-01

Recent progress in the development of non-invasive imaging technologies continues to strengthen the role of molecular imaging biological research. These tools have been validated recently in variety of research models, and have been shown to provide continuous quantitative monitoring of the location(s), magnitude, and time-variation of gene expression. This article reviews the principles, characteristics, categories and the use of radionuclide reporter gene imaging technologies as they have been used in imaging cell trafficking, imaging gene therapy, imaging endogenous gene expression and imaging molecular interactions. The studies published to date demonstrate that reporter gene imaging technologies will help to accelerate model validation as well as allow for clinical monitoring of human diseases.

Radionuclide reporter gene imaging

International Nuclear Information System (INIS)

Min, Jung Joon

2004-01-01

Recent progress in the development of non-invasive imaging technologies continues to strengthen the role of molecular imaging biological research. These tools have been validated recently in variety of research models, and have been shown to provide continuous quantitative monitoring of the location(s), magnitude, and time-variation of gene expression. This article reviews the principles, characteristics, categories and the use of radionuclide reporter gene imaging technologies as they have been used in imaging cell trafficking, imaging gene therapy, imaging endogenous gene expression and imaging molecular interactions. The studies published to date demonstrate that reporter gene imaging technologies will help to accelerate model validation as well as allow for clinical monitoring of human diseases

Development of a Gene Expression Assay for the Diagnosis of Mycobacterium bovis Infection in African Lions (Panthera leo).

Science.gov (United States)

Olivier, T T; Viljoen, I M; Hofmeyr, J; Hausler, G A; Goosen, W J; Tordiffe, A S W; Buss, P; Loxton, A G; Warren, R M; Miller, M A; van Helden, P D; Parsons, S D C

2017-06-01

Mycobacterium bovis infection, the cause of bovine tuberculosis (BTB), is endemic in wildlife in the Kruger National Park (KNP), South Africa. In lions, a high infection prevalence and BTB mortalities have been documented in the KNP; however, the ecological consequences of this disease are currently unknown. Sensitive assays for the detection of this infection in this species are therefore required. Blood from M. bovis-exposed, M. bovis-unexposed, M. tuberculosis-exposed and M. bovis-infected lions was incubated in QuantiFERON ® -TB Gold (QFT) tubes containing either saline or ESAT-6/CFP-10 peptides. Using qPCR, selected reference genes were evaluated for expression stability in these samples and selected target genes were evaluated as markers of antigen-dependent immune activation. The abundance of monokine induced by gamma interferon (MIG/CXCL9) mRNA, measured in relation to that of YWHAZ, was used as a marker of ESAT-6/CFP-10 sensitization. The gene expression assay results were compared between lion groups, and lenient and stringent diagnostic cut-off values were calculated. This CXCL9 gene expression assay combines a highly specific stimulation platform with a sensitive diagnostic marker that allows for discrimination between M. bovis-infected and M. bovis-uninfected lions. © 2015 Blackwell Verlag GmbH.

Use of a real time PCR assay for detection of the ctxA gene of Vibrio cholerae in an environmental survey of Mobile Bay.

Science.gov (United States)

Blackstone, George M; Nordstrom, Jessica L; Bowen, Michael D; Meyer, Richard F; Imbro, Paula; DePaola, Angelo

2007-02-01

Toxigenic Vibrio cholerae, the etiological agent of cholera, is a natural inhabitant of the marine environment and causes severe diarrheal disease affecting thousands of people each year in developing countries. It is the subject of extensive testing of shrimp produced and exported from these countries. We report the development of a real time PCR (qPCR) assay to detect the gene encoding cholera toxin, ctxA, found in toxigenic V. cholerae strains. This assay was tested against DNA isolated from soil samples collected from diverse locations in the US, a panel of eukaryotic DNA from various sources, and prokaryotic DNA from closely related and unrelated bacterial sources. Only Vibrio strains known to contain ctxA generated a fluorescent signal with the 5' nuclease probe targeting the ctxA gene, thus confirming the specificity of the assay. In addition, the assay was quantitative in pure culture across a six-log dynamic range down to <10 CFU per reaction. To test the robustness of this assay, oysters, aquatic sediments, and seawaters from Mobile Bay, AL, were analyzed by qPCR and traditional culture methods. The assay was applied to overnight alkaline peptone water enrichments of these matrices after boiling the enrichments for 10 min. Toxigenic V. cholerae strains were not detected by either qPCR or conventional methods in the 16 environmental samples examined. A novel exogenous internal amplification control developed by us to prevent false negatives identified the samples that were inhibitory to the PCR. This assay, with the incorporated internal control, provides a highly specific, sensitive, and rapid detection method for the detection of toxigenic strains of V. cholerae.

A Multiplex SYBR Green Real-Time PCR Assay for the Detection of Three Colistin Resistance Genes from Cultured Bacteria, Feces, and Environment Samples

Directory of Open Access Journals (Sweden)

Jiyun Li

2017-10-01

Full Text Available The aim of the study was to develop a multiplex assay for rapid detection of mcr-1, mcr-2, and mcr-3, a group of genes of conferring resistance to colistin mediated by plasmid in Enterobacteriaceae. A SYBR Green based real-time PCR assay has been designed to detect the mcr genes, and applied to cultured bacteria, feces and soil samples. All three mcr genes could be detected with a lower limit of 102 cultured bacteria. This test was highly specific and sensitive, and generated no false-positive results. The assay was also conclusive when applied to feces and soil samples containing mcr-1-positive Escherichia coli, which could facilitate the screening of mcr genes not only in the bacteria, but also directly from the environment. This simple, rapid, sensitive, and specific multiplex assay will be useful for rapid screening of the colistin resistance in both clinical medicine and animal husbandry.

A versatile transfection assay system to evaluate the biological effects of diverse industrial chemicals.

Science.gov (United States)

Koizumi, Shinji; Ohno, Shotaro; Otsuka, Fuminori

2012-01-01

Gene expression processes are now recognized as important targets of the toxic effects exerted by industrial chemicals. The transient transfection assay is a powerful tool to evaluate such effects. Thus, we developed a versatile assay system by constructing a basic reporter plasmid in which the regulatory DNA sequence to be studied can easily be substituted. To verify the performance of this system, reporter plasmids carrying any of the three distinct regulatory sequences, estrogen responsive element (ERE), glucocorticoid responsive element (GRE) and xenobiotic responsive element (XRE) were constructed. After transfection of human cells, these plasmids successfully expressed the relevant reporter genes in response to specific inducers, β-estradiol, dexamethasone and 3-methylcholanthrene, respectively. Several industrial chemicals were assayed using these reporter plasmids, and the ability of p-dimethylaminoazobenzene to elevate GRE- and XRE-mediated transcription was detected. α-Naphthylamine and o-tolidine were also observed to increase the XRE-mediated response. The transfection assay system established here will be useful to evaluate the effects of a wide variety of industrial chemicals.

Authentication of beef, carabeef, chevon, mutton and pork by a PCR-RFLP assay of mitochondrial cytb gene.

Science.gov (United States)

Kumar, Deepak; Singh, S P; Karabasanavar, Nagappa S; Singh, Rashmi; Umapathi, V

2014-11-01

Authentication of meat assumes significance in view of religious, quality assurance, food safety, public health, conservation and legal concerns. Here, we describe a PCR-RFLP (Polymerase Chain Reaction- Restriction Fragment Length Polymorphism) assay targeting mitochondrial cytochrome-b gene for the identification of meats of five most common food animals namely cattle, buffalo, goat, sheep and pig. A pair of forward and reverse primers (VPH-F & VPH-R) amplifying a conserved region (168-776 bp) of mitochondrial cytochrome-b (cytb) gene for targeted species was designed which yielded a 609 bp PCR amplicon. Further, restriction enzyme digestion of the amplicons with Alu1 and Taq1 restriction enzymes resulted in a distinctive digestion pattern that was able to discriminate each species. The repeatability of the PCR-RFLP assay was validated ten times with consistent results observed. The developed assay can be used in routine diagnostic laboratories to differentiate the meats of closely related domestic livestock species namely cattle from buffalo and sheep from goat.

A novel reporter system for neutralizing and enhancing antibody assay against dengue virus.

Science.gov (United States)

Song, Ke-Yu; Zhao, Hui; Jiang, Zhen-You; Li, Xiao-Feng; Deng, Yong-Qiang; Jiang, Tao; Zhu, Shun-Ya; Shi, Pei-Yong; Zhang, Bo; Zhang, Fu-Chun; Qin, E-De; Qin, Cheng-Feng

2014-02-18

Dengue virus (DENV) still poses a global public health threat, and no vaccine or antiviral therapy is currently available. Antibody plays distinct roles in controlling DENV infections. Neutralizing antibody is protective against DENV infection, whereas sub-neutralizing concentration of antibody can increase DENV infection, termed antibody-dependent enhancement (ADE). Plaque-based assay represents the most widely accepted method measuring neutralizing or enhancing antibodies. In this study, a novel reporter virus-based system was developed for measuring neutralization and ADE activity. A stable Renilla luciferase reporter DENV (Luc-DENV) that can produce robust luciferase signals in BHK-21 and K562 cells were used to establish the assay and validated against traditional plaque-based assay. Luciferase value analysis using various known DENV-specific monoclonal antibodies showed good repeatability and a well linear correlation with conventional plaque-based assays. The newly developed assay was finally validated with clinical samples from infected animals and individuals. This reporter virus-based assay for neutralizing and enhancing antibody evaluation is rapid, lower cost, and high throughput, and will be helpful for laboratory detection and epidemiological investigation for DENV antibodies.

Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

Science.gov (United States)

In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

1997-03-01

Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.

Differentiating Botulinum Neurotoxin-Producing Clostridia with a Simple, Multiplex PCR Assay.

Science.gov (United States)

Williamson, Charles H D; Vazquez, Adam J; Hill, Karen; Smith, Theresa J; Nottingham, Roxanne; Stone, Nathan E; Sobek, Colin J; Cocking, Jill H; Fernández, Rafael A; Caballero, Patricia A; Leiser, Owen P; Keim, Paul; Sahl, Jason W

2017-09-15

Diverse members of the genus Clostridium produce botulinum neurotoxins (BoNTs), which cause a flaccid paralysis known as botulism. While multiple species of clostridia produce BoNTs, the majority of human botulism cases have been attributed to Clostridium botulinum groups I and II. Recent comparative genomic studies have demonstrated the genomic diversity within these BoNT-producing species. This report introduces a multiplex PCR assay for differentiating members of C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Coding region sequences unique to each of the four species/subgroups were identified by in silico analyses of thousands of genome assemblies, and PCR primers were designed to amplify each marker. The resulting multiplex PCR assay correctly assigned 41 tested isolates to the appropriate species or subgroup. A separate PCR assay to determine the presence of the ntnh gene (a gene associated with the botulinum neurotoxin gene cluster) was developed and validated. The ntnh gene PCR assay provides information about the presence or absence of the botulinum neurotoxin gene cluster and the type of gene cluster present ( ha positive [ ha + ] or orfX + ). The increased availability of whole-genome sequence data and comparative genomic tools enabled the design of these assays, which provide valuable information for characterizing BoNT-producing clostridia. The PCR assays are rapid, inexpensive tests that can be applied to a variety of sample types to assign isolates to species/subgroups and to detect clostridia with botulinum neurotoxin gene ( bont ) clusters. IMPORTANCE Diverse clostridia produce the botulinum neurotoxin, one of the most potent known neurotoxins. In this study, a multiplex PCR assay was developed to differentiate clostridia that are most commonly isolated in connection with human botulism cases: C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Since Bo

Loop-Mediated Isothermal Amplification Assay Targeting the MOMP Gene for Rapid Detection of Chlamydia psittaci Abortus Strain

Directory of Open Access Journals (Sweden)

Guo-Zhen Lin, Fu-Ying Zheng, Ji-Zhang Zhou, Guang-Hua Wang, Xiao-An Cao, Xiao-Wei Gong and Chang-Qing Qiu*

2012-05-01

Full Text Available For rapid detection of the Chlamydia psittaci abortus strain, a loop-mediated isothermal amplification (LAMP assay was developed and evaluated in this study. The primers for the LAMP assay were designed on the basis of the main outer membrane protein (MOMP gene sequence of C. psittaci. Analysis showed that the assay could detect the abortus strain of C. psittaci with adequate specificity. The sensitivity of the test was the same as that of the nested-conventional PCR and higher than that of chick embryo isolation. Testing of 153 samples indicated that the LAMP assay could detect the genome of the C. psittaci abortus strain effectively in clinical samples. This assay is a useful tool for rapid diagnosis of C. psittaci infection in sheep, swine and cattle.

Detection of Toxoplasma gondii in Diabetic Patients Using the Nested PCR Assay via RE and B1 Genes.

Science.gov (United States)

Mousavi, Mohammad; Saravani, Ramin; Jafari Modrek, Mohammad; Shahrakipour, Mahnaz; Sekandarpour, Sina

2016-02-01

Toxoplasma gondii is an obligate intracellular protozoan parasite that exists worldwide. Various techniques have been developed for T. gondii detection. The aim of this study was the detection of T. gondii in diabetic patients with RE and B1 genes and the comparison of these two genes for diagnosis using the nested-PCR assay method. DNA samples from 205 diabetic patients who had been referred to the diabetes center of Ali Asghar hospital in Zahedan, Iran, were collected and analyzed using the nested-PCR assay method. Toxoplasma antibody data gathered using the enzyme-linked immunosorbent assay (ELISA) method from a previous study was used to group patients. The data were analyzed using SPSS 18. The chi-square test was used for comparison. Of the diabetic patients selected, the following results were obtained: 53 (IgG+, IgM+); 20 (IgG-, IgM+); 72 (IgG+, IgM-); and 60 (IgG-, IgM-). The nested-PCR detected the following: in the acute group, 21/53 (39.63%), 30/53 (56.60%) (IgM+, IgG+); in the chronic group, 40/72 (55.56%), 51/72 (70.83%), (IgG+, IgM-); in the false positive group, 18/20 (90%), 17/20 (85%) (IgM+, IgG-); and sero-negative samples of 38/60 (63.33%) and 60/ 41 (77.35%) for RE and B1 genes, respectively. The prevalence of toxoplasmosis showed positive in patients with diabetes in the B1 gene 139 (67.8%) and RE gene 117 (57.1%). Our study demonstrated that the B1 gene, more so than the RE gene, showed positive samples and can be used to detect toxoplasmosis, although the B1 gene, in comparison to the RE gene, did not show any superiority of molecular diagnosing capability. Results also showed that toxoplasma molecular detection methods can be used instead of routine serological detection methods in a clinical laboratory testing.

Evaluation of a real-time PCR assay based on the single-copy SAG1 gene for the detection of Toxoplasma gondii.

Science.gov (United States)

Yu, Haijie; Huang, Bin; Zhuo, Xunhui; Chen, Xueqiu; Du, Aifang

2013-11-08

Real-time PCR-based detection of Toxoplasma gondii is very sensitive and convenient for diagnosing toxoplasmosis. However, the performance of the PCR assays could be influenced by the target gene chosen. Here we evaluate a real-time PCR assay using double-stranded DNA dyes (SYBR(®) Green I assay) with a new set of primers targeting the SAG1 gene for the fast and specific detection of T. gondii. The assay showed higher sensitivity than conventional PCR protocols using T. gondii DNA as template. The detection limit of the developed real-time PCR assay was in the order of 1 tachyzoite. The assay was also assessed by experimentally infected mice and showed positive results for blood (25%), spleen (50%) and lung (50%) as early as 1 dpi. The specificity of the assay was confirmed by using DNA from Neospora caninum, Escherichia coli, Babesia bovis, Trypanosoma brucei, Cryptosporidium parvum, and Toxocara canis. Assay applicability was successfully tested in blood samples collected from slaughtered pigs. These results indicate that, based on SYBR(®) green I, the quantitative SAG1 assay may also be useful in the study of the pathogenicity, immunoprophylaxis, and treatment of T. gondii. Copyright © 2013 Elsevier B.V. All rights reserved.

Development of a Rickettsia bellii-Specific TaqMan Assay Targeting the Citrate Synthase Gene.

Science.gov (United States)

Hecht, Joy A; Allerdice, Michelle E J; Krawczak, Felipe S; Labruna, Marcelo B; Paddock, Christopher D; Karpathy, Sandor E

2016-11-01

Rickettsia bellii is a rickettsial species of unknown pathogenicity that infects argasid and ixodid ticks throughout the Americas. Many molecular assays used to detect spotted fever group (SFG) Rickettsia species do not detect R. bellii, so that infection with this bacterium may be concealed in tick populations when assays are used that screen specifically for SFG rickettsiae. We describe the development and validation of a R. bellii-specific, quantitative, real-time PCR TaqMan assay that targets a segment of the citrate synthase (gltA) gene. The specificity of this assay was validated against a panel of DNA samples that included 26 species of Rickettsia, Orientia, Ehrlichia, Anaplasma, and Bartonella, five samples of tick and human DNA, and DNA from 20 isolates of R. bellii, including 11 from North America and nine from South America. A R. bellii control plasmid was constructed, and serial dilutions of the plasmid were used to determine the limit of detection of the assay to be one copy per 4 µl of template DNA. This assay can be used to better determine the role of R. bellii in the epidemiology of tick-borne rickettsioses in the Western Hemisphere. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by US Government employees and is in the public domain in the US.

Splicing analysis for exonic and intronic mismatch repair gene variants associated with Lynch syndrome confirms high concordance between minigene assays and patient RNA analyses

Science.gov (United States)

van der Klift, Heleen M; Jansen, Anne M L; van der Steenstraten, Niki; Bik, Elsa C; Tops, Carli M J; Devilee, Peter; Wijnen, Juul T

2015-01-01

A subset of DNA variants causes genetic disease through aberrant splicing. Experimental splicing assays, either RT-PCR analyses of patient RNA or functional splicing reporter minigene assays, are required to evaluate the molecular nature of the splice defect. Here, we present minigene assays performed for 17 variants in the consensus splice site regions, 14 exonic variants outside these regions, and two deep intronic variants, all in the DNA mismatch-repair (MMR) genes MLH1, MSH2, MSH6, and PMS2, associated with Lynch syndrome. We also included two deep intronic variants in APC and PKD2. For one variant (MLH1 c.122A>G), our minigene assay and patient RNA analysis could not confirm the previously reported aberrant splicing. The aim of our study was to further investigate the concordance between minigene splicing assays and patient RNA analyses. For 30 variants results from patient RNA analyses were available, either performed by our laboratory or presented in literature. Some variants were deliberately included in this study because they resulted in multiple aberrant transcripts in patient RNA analysis, or caused a splice effect other than the prevalent exon skip. While both methods were completely concordant in the assessment of splice effects, four variants exhibited major differences in aberrant splice patterns. Based on the present and earlier studies, together showing an almost 100% concordance of minigene assays with patient RNA analyses, we discuss the weight given to minigene splicing assays in the current criteria proposed by InSiGHT for clinical classification of MMR variants. PMID:26247049

Cytotoxicity and genotoxicity of Agaricus blazei methanolic extract fractions assessed using gene and chromosomal mutation assays

Directory of Open Access Journals (Sweden)

Marilanda Ferreira Bellini

2008-01-01

Full Text Available Functional food investigations have demonstrated the presence of substances that could be beneficial to human health when consumed. However, the toxic effects of some substances contained in foods have been determined. Reported medicinal and nutritive properties have led to the extensive commercialization of the basidiomycete fungi Agaricus blazei Murrill (sensu Heinemann, also known as Agaricus brasiliensis Wasser et al., Agaricus subrufescens Peck or the Brazilian medical mushroom (BMM. Different methanolic extract fractions (ME of this mushroom were submitted to the cytokinesis-block micronucleus (CBMN clastogenic assay and the hypoxanthine-guanine phosphoribosyl transferase locus (HGPRT assay for gene mutation, both using Chinese hamster ovary cells clone K1 (CHO-K1. The results suggest that all the fractions tested possess cytotoxic and mutagenic potential but no clastogenic effects. Further information is needed on the biochemical components of the A. blazei methanol fractions to identify any substances with cytotoxic and/or mutagenicity potential. These findings indicate that A. blazei methanolic extract should not be used due to their genotoxicity and care should be taken in the use of A. blazei by the general population until further biochemical characterization of this fungi is completed.

Sequence diversity within the HA-1 gene as detected by melting temperature assay without oligonucleotide probes

Directory of Open Access Journals (Sweden)

Mattiuz Pier

2005-10-01

Full Text Available Abstract Background The minor histocompatibility antigens (mHags are self-peptides derived from common cellular proteins and presented by MHC class I and II molecules. Disparities in mHags are a potential risk for the development of graft-versus-host disease (GvHD in the recipients of bone marrow from HLA-identical donors. Two alleles have been identified in the mHag HA-1. The correlation between mismatches of the mHag HA-1 and GvHD has been suggested and methods to facilitate large-scale testing were afterwards developed. Methods We used sequence specific primer (SSP PCR and direct sequencing to detect HA-1 gene polymorphisms in a sample of 131 unrelated Italian subjects. We then set up a novel melting temperature (Tm assay that may help identification of HA-1 alleles without oligonucleotide probes. Results We report the frequencies of HA-1 alleles in the Italian population and the presence of an intronic 5 base-pair deletion associated with the immunogeneic allele HA-1H. We also detected novel variable sites with respect to the consensus sequence of HA-1 locus. Even though recombination/gene conversion events are documented, there is considerable linkage disequilibrium in the data. The gametic associations between HA-1R/H alleles and the intronic 5-bp ins/del polymorphism prompted us to try the Tm analysis with SYBR® Green I. We show that the addition of dimethylsulfoxide (DMSO during the assay yields distinct patterns when amplicons from HA-1H homozygotes, HA-1R homozygotes, and heterozygotes are analysed. Conclusion The possibility to use SYBR® Green I to detect Tm differences between allelic variants is attractive but requires great caution. We succeeded in allele discrimination of the HA-1 locus using a relatively short (101 bp amplicon, only in the presence of DMSO. We believe that, at least in certain assets, Tm assays may benefit by the addition of DMSO or other agents affecting DNA strand conformation and stability.

Radioactive waste package assay facility. Final report - V. A

International Nuclear Information System (INIS)

Molesworth, T.V.; Strachan, N.R.; Findlay, D.J.S.; Wise, M.O.; Forrest, K.R.; Rogers, J.D.

1993-01-01

This report provides a summary of research work carried out in support of the development of an integrated assay system for the quality checking of Intermediate Level Waste encapsulated in cement. Four non-destructive techniques were originally identified as being viable methods for obtaining radiometric inventory data from a cemented 500 litre ILW package. The major part of the programme was devoted to the development of two interrogation techniques; active neutron for measuring the total fissile content and active gamma for measuring the total actinide content. An electron linear accelerator was used to supply the interrogating beam for these two methods. In addition the linear accelerator beam could be used for high energy radiography. The results of this work are described and the performances and limitations of the non-destructive methods are summarised. The main engineering and operational features which influence the design of an integrated assay facility are outlined and a conceptual layout for a facility to inspect 750 ILW drums a year is described. Details of the detection methods, data processing and potential application of the assay facility are given in three associated HMIP reports. (Author)

Testing candidate genes for attention-deficit/hyperactivity disorder in fruit flies using a high throughput assay for complex behavior

DEFF Research Database (Denmark)

Rohde, Palle Duun; Madsen, Lisbeth Strøm; Arvidson, Sandra Marie Neumann

2016-01-01

Fruit flies are important model organisms for functional testing of candidate genes in multiple disciplines, including the study of human diseases. Here we use a high-throughput locomotor activity assay to test the response on activity behavior of gene disruption in Drosophila melanogaster. The aim...

Identification and Functional Analysis of Gene Regulatory Sequences Interacting with Colorectal Tumor Suppressors

DEFF Research Database (Denmark)

Dahlgaard, Katja; Troelsen, Jesper

2018-01-01

Several tumor suppressors possess gene regulatory activity. Here, we describe how promoter and promoter/enhancer reporter assays can be used to characterize a colorectal tumor suppressor proteins’ gene regulatory activity of possible target genes. In the first part, a bioinformatic approach...... of the quick and efficient In-Fusion cloning method, and how to carry out transient transfections of Caco-2 colon cancer cells with the produced luciferase reporter plasmids using polyethyleneimine (PEI). A plan describing how to set up and carry out the luciferase expression assay is presented. The luciferase...... to identify relevant gene regulatory regions of potential target genes is presented. In the second part, it is demonstrated how to prepare and carry out the functional assay. We explain how to clone the bioinformatically identified gene regulatory regions into luciferase reporter plasmids by the use...

Evaluation of Myc Gene Amplification in Prostate Cancer Using a Dual Color Chromogenic in-Situ Hybridization (Dual CISH) Assay

OpenAIRE

Daniel Lerda; Marta Cabrera; Jorge Flores; Luis Gutierrez; Armando Chierichetti; Martin Revol; Hernan Garcia Onto

2013-01-01

Objetive: The overall purpose of the study was to demonstrate applicability of the Dako dual-color chromogenic in situ hybridization (CISH) assay (DAKO Denmark, Glostrup) with respect to fluorescence in situ hybridization (FISH) probes MYC-C. Methods: MYC gene amplification by FISH and Dako dual-color CISH Results: The study showed that the dual-color CISH assay can convert Texas red and fluorescein isothiocyanate (FITC) signals into chromogenic signals. The dual –color CISH assay was p...

MRI Reporter Genes for Noninvasive Molecular Imaging

Directory of Open Access Journals (Sweden)

Caixia Yang

2016-05-01

Full Text Available Magnetic resonance imaging (MRI is one of the most important imaging technologies used in clinical diagnosis. Reporter genes for MRI can be applied to accurately track the delivery of cell in cell therapy, evaluate the therapy effect of gene delivery, and monitor tissue/cell-specific microenvironments. Commonly used reporter genes for MRI usually include genes encoding the enzyme (e.g., tyrosinase and β-galactosidase, the receptor on the cells (e.g., transferrin receptor, and endogenous reporter genes (e.g., ferritin reporter gene. However, low sensitivity limits the application of MRI and reporter gene-based multimodal imaging strategies are common including optical imaging and radionuclide imaging. These can significantly improve diagnostic efficiency and accelerate the development of new therapies.

Evaluation of Myc Gene Amplification in Prostate Cancer Using a Dual Color Chromogenic in-Situ Hybridization (Dual CISH Assay

Directory of Open Access Journals (Sweden)

Daniel Lerda

2013-04-01

Full Text Available Objetive: The overall purpose of the study was to demonstrate applicability of the Dako dual-color chromogenic in situ hybridization (CISH assay (DAKO Denmark, Glostrup with respect to fluorescence in situ hybridization (FISH probes MYC-C. Methods: MYC gene amplification by FISH and Dako dual-color CISH Results: The study showed that the dual-color CISH assay can convert Texas red and fluorescein isothiocyanate (FITC signals into chromogenic signals. The dual –color CISH assay was performed on 40 cases of prostate cancer. Amplification was identified in 12 of 40 (30% tumors. No amplification was seen in 28 of 40 (70% tumors. FISH data were available in total of 40 tumors. All tumors showed concordant results between dual-color CISH and FISH for classifying a tumor as MYC amplified or not amplified. Conclusions: We conclude that dual-color Dako CISH assay is an accurate method for determining MYC gene amplification with added advantages that make it a more practically useful method. [J Interdiscipl Histopathol 2013; 1(2.000: 81-84

Assay for mutagenesis in heterozygous diploid human lymphoblasts

Science.gov (United States)

Skopek, Thomas R.; Liber, Howard L.; Penman, Bruce W.; Thilly, William G.; Hoppe, IV, Henry

1981-01-01

An assay is disclosed for determining mutagenic damage caused by the administration of a known or suspected mutagen to diploid human lymphoblastoid cell lines. The gene locus employed for this assay is the gene for thymidine kinase, uridine kinase, or cytidine deaminase. Since human lymphoblastoid cells contain two genes for these enzymes, heterozygotes of human lymphoblastoid cells are used in this assay.

hNIS-IRES-eGFP Dual Reporter Gene Imaging

Directory of Open Access Journals (Sweden)

Jiantu Che

2005-04-01

Full Text Available The human and rodent sodium iodide symporters (NIS have recently been cloned and are being investigated as potential therapeutic and reporter genes. We have extended this effort by constructing an internal ribosomal entry site (IRES-linked human NIS (hNIS-enhanced green fluorescent protein (eGFP hybrid reporter gene for both nuclear and optical imaging. A self-inactivating retroviral vector, termed pQCNIG, containing hNIS-IRES-eGFP dual reporter gene, driven by a constitutive CMV promoter, was constructed and used to generate RG2-pQCNIG cells and RG2-pQCNIG tumors. 131I-iodide and 99mTcO4-pertechnetate accumulation studies plus fluorescence microscopy and intensity assays were performed in vitro, and gamma camera imaging studies in RG2-pQCNIG and RG2 tumor-bearing athymic rats were performed. RG2-pQCNIG cells expressed high levels of hNIS protein and showed high intensity of eGFP fluorescence compared with RG2 wild-type cells. RG2-pQCNIG cells accumulated Na131I and 99mTcO4– to a 50:1 and a 170:1 tissue/medium ratio at 10 min, compared with 0.8:1.2 tissue/medium ratio in wild-type RG2 cells. A significant correlation between radiotracer accumulation and eGFP fluorescence intensity was demonstrated. RG2-pQCNIG and RG2 tumors were readily differentiated by in vivo gamma camera imaging; radiotracer uptake increased in RG2-pQCNIG but declined in RG2 tumors over the 50-min imaging period. Stomach and thyroid were the major organs of radionuclide accumulation. The IRES-linked hNIS-eGFP dual reporter gene is functional and stable in transduced RG2-pQCNIG cells. Optical and nuclear imaging of tumors produced from these cell lines provides the opportunity to monitor tumor growth and response to therapy. These studies indicate the potential for a wider application of hNIS reporter imaging and translation into patient studies using radioisotopes that are currently available for human use for both SPECT and PET imaging.

Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation.

Science.gov (United States)

Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum

2014-08-01

A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods. Copyright © 2014 Elsevier Ltd. All rights reserved.

A Functional Henipavirus Envelope Glycoprotein Pseudotyped Lentivirus Assay System

Directory of Open Access Journals (Sweden)

Broder Christopher C

2010-11-01

Full Text Available Abstract Background Hendra virus (HeV and Nipah virus (NiV are newly emerged zoonotic paramyxoviruses discovered during outbreaks in Queensland, Australia in 1994 and peninsular Malaysia in 1998/9 respectively and classified within the new Henipavirus genus. Both viruses can infect a broad range of mammalian species causing severe and often-lethal disease in humans and animals, and repeated outbreaks continue to occur. Extensive laboratory studies on the host cell infection stage of HeV and NiV and the roles of their envelope glycoproteins have been hampered by their highly pathogenic nature and restriction to biosafety level-4 (BSL-4 containment. To circumvent this problem, we have developed a henipavirus envelope glycoprotein pseudotyped lentivirus assay system using either a luciferase gene or green fluorescent protein (GFP gene encoding human immunodeficiency virus type-1 (HIV-1 genome in conjunction with the HeV and NiV fusion (F and attachment (G glycoproteins. Results Functional retrovirus particles pseudotyped with henipavirus F and G glycoproteins displayed proper target cell tropism and entry and infection was dependent on the presence of the HeV and NiV receptors ephrinB2 or B3 on target cells. The functional specificity of the assay was confirmed by the lack of reporter-gene signals when particles bearing either only the F or only G glycoprotein were prepared and assayed. Virus entry could be specifically blocked when infection was carried out in the presence of a fusion inhibiting C-terminal heptad (HR-2 peptide, a well-characterized, cross-reactive, neutralizing human mAb specific for the henipavirus G glycoprotein, and soluble ephrinB2 and B3 receptors. In addition, the utility of the assay was also demonstrated by an examination of the influence of the cytoplasmic tail of F in its fusion activity and incorporation into pseudotyped virus particles by generating and testing a panel of truncation mutants of NiV and HeV F

Validation of a PCR Assay for Chlamydophila abortus rRNA gene detection in a murine model

Directory of Open Access Journals (Sweden)

Francielle Gibson da Silva-Zacarias

2009-11-01

Full Text Available Chlamydophila abortus (C. abortus is associated with reproductive problems in cattle, sheep, and goats. Diagnosis of C. abortus using embryonated chicken eggs or immortalized cell lines has a very low sensitivity. Polymerase chain reaction (PCR assays have been used to detect C. abortus infection in clinical specimens and organ fragments, such as placenta, fetal organs, vaginal secretions, and semen. The aim of this study was to develop a PCR assay for the amplification of an 856-bp fragment of the rRNA gene of the Chlamydiaceae family. The PCR assay was evaluated using organs from 15 mice experimentally infected with the S26/3 reference strain of C. abortus. The results of the rRNA PCR were compared to the results from another PCR system (Omp2 PCR that has been previously described for the Omp2 (outer major protein gene from the Chlamydiaceae family. From the 15 C. abortus-inoculated mice, 13 (K=0.84, standard error =0.20 tested positive using the rRNA PCR assay and 9 (K=0.55, standard error=0.18 tested positive using the Omp2 PCR assay. The detection limit, measured using inclusion-forming units (IFU, for C. abortus with the rRNA PCR (1.05 IFU was 100-fold lower than for the Omp2 PCR (105 IFU. The higher sensitivity of the rRNA PCR, as compared to the previously described PCR assay, and the specificity of the assay, demonstrated using different pathogenic microorganisms of the bovine reproductive system, suggest that the new PCR assay developed in this study can be used for the molecular diagnosis of C. abortus in abortion and other reproductive failures in bovines, caprines, and ovines.Chlamydophila abortus (C. abortus é frequentemente associada a distúrbios reprodutivos em bovinos, ovinos e caprinos. Para o diagnóstico, os métodos de cultivo em ovo embrionado de galinha e em células de linhagem contínua apresentam baixa sensibilidade. A reação em cadeia da polimerase (PCR tem sido utilizada em placenta, órgãos fetais, secre

Development and Application of Loop-Mediated Isothermal Amplification Assays for Rapid Visual Detection of cry2Ab and cry3A Genes in Genetically-Modified Crops

Directory of Open Access Journals (Sweden)

Feiwu Li

2014-08-01

Full Text Available The cry2Ab and cry3A genes are two of the most important insect-resistant exogenous genes and had been widely used in genetically-modified crops. To develop more effective alternatives for the quick identification of genetically-modified organisms (GMOs containing these genes, a rapid and visual loop-mediated isothermal amplification (LAMP method to detect the cry2Ab and cry3A genes is described in this study. The LAMP assay can be finished within 60 min at an isothermal condition of 63 °C. The derived LAMP products can be obtained by a real-time turbidimeter via monitoring the white turbidity or directly observed by the naked eye through adding SYBR Green I dye. The specificity of the LAMP assay was determined by analyzing thirteen insect-resistant genetically-modified (GM crop events with different Bt genes. Furthermore, the sensitivity of the LAMP assay was evaluated by diluting the template genomic DNA. Results showed that the limit of detection of the established LAMP assays was approximately five copies of haploid genomic DNA, about five-fold greater than that of conventional PCR assays. All of the results indicated that this established rapid and visual LAMP assay was quick, accurate and cost effective, with high specificity and sensitivity. In addition, this method does not need specific expensive instruments or facilities, which can provide a simpler and quicker approach to detecting the cry2Ab and cry3A genes in GM crops, especially for on-site, large-scale test purposes in the field.

Development and application of loop-mediated isothermal amplification assays for rapid visual detection of cry2Ab and cry3A genes in genetically-modified crops.

Science.gov (United States)

Li, Feiwu; Yan, Wei; Long, Likun; Qi, Xing; Li, Congcong; Zhang, Shihong

2014-08-27

The cry2Ab and cry3A genes are two of the most important insect-resistant exogenous genes and had been widely used in genetically-modified crops. To develop more effective alternatives for the quick identification of genetically-modified organisms (GMOs) containing these genes, a rapid and visual loop-mediated isothermal amplification (LAMP) method to detect the cry2Ab and cry3A genes is described in this study. The LAMP assay can be finished within 60 min at an isothermal condition of 63 °C. The derived LAMP products can be obtained by a real-time turbidimeter via monitoring the white turbidity or directly observed by the naked eye through adding SYBR Green I dye. The specificity of the LAMP assay was determined by analyzing thirteen insect-resistant genetically-modified (GM) crop events with different Bt genes. Furthermore, the sensitivity of the LAMP assay was evaluated by diluting the template genomic DNA. Results showed that the limit of detection of the established LAMP assays was approximately five copies of haploid genomic DNA, about five-fold greater than that of conventional PCR assays. All of the results indicated that this established rapid and visual LAMP assay was quick, accurate and cost effective, with high specificity and sensitivity. In addition, this method does not need specific expensive instruments or facilities, which can provide a simpler and quicker approach to detecting the cry2Ab and cry3A genes in GM crops, especially for on-site, large-scale test purposes in the field.

Inhibition of Reporter Genes by Small Interfering RNAs in Cell Culture and Living Fish

DEFF Research Database (Denmark)

Larashati, Sekar; Schyth, Brian Dall; Lorenzen, Niels

2011-01-01

be used to observe the knock down effect by siRNAs designed to target these reporters. One aim of this project is to verify the specific knock down effect of siRNAs in cell culture and in living fish and to establish easy-read out models for testing the effect especially in vivo. Cell culture from human...... coinjection and the assay is important in order to detect knock down by siRNA. Our experiment reveal in vivo knock down at 72 hours post injection of reporter gene and siRNA, but further dose-response experiments are required to confirm specifity....

Value of a gene signature assay in patients with early breast cancer and intermediate risk: a single institution retrospective study.

Science.gov (United States)

Bonneterre, Jacques; Prat, Aleix; Galván, Patricia; Morel, Pascale; Giard, Sylvia

2016-05-01

Purpose In daily clinical practice, the indication for adjuvant chemotherapy (CT) is relatively easy to make in patients with early hormone-receptor-positive (HR+) breast cancer with either very poor or very good clinicopathological prognostic variables. However, this decision is much more difficult in patients with intermediate clinicopathological prognostic variables. Here, we evaluate the value of a gene-expression profile identified by the Prosigna gene signature assay in guiding treatment decision-making in patients with these intermediate features. Methods A consecutive cohort of 577 HR + breast cancer patients surgically treated in a single institution between January 2012 and December 2012 was evaluated. From this population, pre- and post-menopausal patients with intermediate prognosis clinicopathological variables were identified and indication of adjuvant CT in these patients was recorded. The gene signature assay was performed retrospectively in this intermediate risk group. Descriptive statistics are presented. Results Among 96 intermediate-risk patients, 64 postmenopausal patients underwent gene signature testing. Subtype distribution was as follows: Luminal A (N = 33; 51.6%), Luminal B (N = 31; 48.4%). Risk of recurrence (ROR) distribution was as follows: ROR-low (n = 16; 25%); ROR-intermediate (N = 26; 40.6%); and ROR-high (N = 22; 34.4%). CT was subsequently administered in 18.7%, 53.8% and 59.0% of the ROR-low, ROR-intermediate and ROR-high groups, respectively. With the use of the gene signature assay, 59.4% of the intermediate cases were re-classified to either ROR-low or ROR-high risk categories. In the ROR-intermediate group, 11/26 patients (42.3%) had Luminal A and 15/26 (57.7%) had Luminal B. Due to follow-up time constraints, no patient outcome results were evaluated. Conclusion The gene signature assay provides clinically useful information and improved treatment decision-making in patients with intermediate risk based on

Characterization of the interferon genes in homozygous rainbow trout reveals two novel genes, alternate splicing and differential regulation of duplicated genes

Science.gov (United States)

Purcell, M.K.; Laing, K.J.; Woodson, J.C.; Thorgaard, G.H.; Hansen, J.D.

2009-01-01

The genes encoding the type I and type II interferons (IFNs) have previously been identified in rainbow trout and their proteins partially characterized. These previous studies reported a single type II IFN (rtIFN-??) and three rainbow trout type I IFN genes that are classified into either group I (rtIFN1, rtIFN2) or group II (rtIFN3). In this present study, we report the identification of a novel IFN-?? gene (rtIFN-??2) and a novel type I group II IFN (rtIFN4) in homozygous rainbow trout and predict that additional IFN genes or pseudogenes exist in the rainbow trout genome. Additionally, we provide evidence that short and long forms of rtIFN1 are actively and differentially transcribed in homozygous trout, and likely arose due to alternate splicing of the first exon. Quantitative reverse transcriptase PCR (qRT-PCR) assays were developed to systematically profile all of the rainbow trout IFN transcripts, with high specificity at an individual gene level, in na??ve fish and after stimulation with virus or viral-related molecules. Cloned PCR products were used to ensure the specificity of the qRT-PCR assays and as absolute standards to assess transcript abundance of each gene. All IFN genes were modulated in response to Infectious hematopoietic necrosis virus (IHNV), a DNA vaccine based on the IHNV glycoprotein, and poly I:C. The most inducible of the type I IFN genes, by all stimuli tested, were rtIFN3 and the short transcript form of rtIFN1. Gene expression of rtIFN-??1 and rtIFN-??2 was highly up-regulated by IHNV infection and DNA vaccination but rtIFN-??2 was induced to a greater magnitude. The specificity of the qRT-PCR assays reported here will be useful for future studies aimed at identifying which cells produce IFNs at early time points after infection. ?? 2008 Elsevier Ltd.

Gain-of-function analysis of poplar CLE genes in Arabidopsis by exogenous application and over-expression assays.

Science.gov (United States)

Liu, Yisen; Yang, Shaohui; Song, Yingjin; Men, Shuzhen; Wang, Jiehua

2016-04-01

Among 50 CLE gene family members in the Populus trichocarpa genome, three and six PtCLE genes encode a CLE motif sequence highly homologous to Arabidopsis CLV3 and TDIF peptides, respectively, which potentially make them functional equivalents. To test and compare their biological activity, we first chemically synthesized each dodecapeptide and analysed itsi n vitro bioactivity on Arabidopsis seedlings. Similarly, but to a different extent, three types of poplar CLV3-related peptides caused root meristem consumption, phyllotaxis disorder, anthocyanin accumulation and failure to enter the bolting stage. In comparison, application of two poplar TDIF-related peptides led to root length promotion in a dose-dependent manner with an even stronger effect observed for poplar TDIF-like peptide than TDIF. Next, we constructed CaMV35S:PtCLE transgenic plants for each of the nine PtCLE genes. Phenotypic abnormalities exemplified by arrested shoot apical meristem and abnormal flower structure were found to be more dominant and severe in 35S:PtCLV3 and 35S:PtCLV3-like2 lines than in the 35S:PtCLV3-like line. Disordered vasculature was detected in both stem and hypocotyl cross-sections in Arabidopsis plants over-expressing poplar TDIF-related genes with the most defective vascular patterning observed for TDIF2 and two TDIF-like genes. Phenotypic difference consistently observed in peptide application assay and transgenic analysis indicated the functional diversity of nine poplar PtCLE genes under investigation. This work represents the first report on the functional analysis of CLE genes in a tree species and constitutes a basis for further study of the CLE peptide signalling pathway in tree development. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Serodiagnosis of cutaneous leishmaniasis: assessment of an enzyme-linked immunosorbent assay using a peptide sequence from gene B protein

DEFF Research Database (Denmark)

Jensen, A T; Gaafar, A; Ismail, A

1996-01-01

An enzyme-linked immunosorbent assay (ELISA) using a 28 amino acid sequence of the repetitive element of gene B protein (GBP) from Leishmania major was developed for serodiagnosis of cutaneous leishmaniasis (CL). The assay was compared to ELISAs using crude amastigote and promastigote antigens from...... samples from healthy Sudanese individuals living in an area endemic for malaria but free of leish-maniasis were negative in all the assays. Significantly higher levels of antibodies were found in the patients who had suffered from the disease for more than eight weeks than in patients with a shorter...

Sea urchin neural alpha2 tubulin gene: isolation and promoter analysis.

Science.gov (United States)

Costa, S; Ragusa, M A; Drago, G; Casano, C; Alaimo, G; Guida, N; Gianguzza, F

2004-04-02

Expression of Talpha2 gene, during sea urchin Paracentrotus lividus development, is spatially and temporally regulated. In order to characterize this gene, we isolated the relevant genomic sequences and scanned the isolated 5'-flanking region in searching for cis-regulatory elements required for proper expression. Gel mobility shift and footprinting assays, as well as reporter gene (CAT and beta-gal) expression assays, were used to address cis-regulatory elements involved in regulation. Here we report that an upstream 5'-flanking fragment of PlTalpha2 gene drives temporal expression of reporter genes congruent with that of endogenous Talpha2 gene. The fragment contains cis-elements able to bind nuclear proteins from the gastrula stage (at which the Talpha2 gene is expressed) whose sequences could be consistent with the consensus sequences for transcription factors present in data bank.

Human reporter genes: potential use in clinical studies

Energy Technology Data Exchange (ETDEWEB)

Serganova, Inna [Department of Neurology, Memorial Sloan-Kettering Cancer Center, New York, NY 10021 (United States); Ponomarev, Vladimir [Department of Radiology, Memorial Sloan-Kettering Cancer Center, New York, NY 10021 (United States); Blasberg, Ronald [Department of Neurology, Memorial Sloan-Kettering Cancer Center, New York, NY 10021 (United States); Department of Radiology, Memorial Sloan-Kettering Cancer Center, New York, NY 10021 (United States)], E-mail: blasberg@neuro1.mskcc.org

2007-10-15

The clinical application of positron-emission-tomography-based reporter gene imaging will expand over the next several years. The translation of reporter gene imaging technology into clinical applications is the focus of this review, with emphasis on the development and use of human reporter genes. Human reporter genes will play an increasingly more important role in this development, and it is likely that one or more reporter systems (human gene and complimentary radiopharmaceutical) will take leading roles. Three classes of human reporter genes are discussed and compared: receptors, transporters and enzymes. Examples of highly expressed cell membrane receptors include specific membrane somatostatin receptors (hSSTrs). The transporter group includes the sodium iodide symporter (hNIS) and the norepinephrine transporter (hNET). The endogenous enzyme classification includes human mitochondrial thymidine kinase 2 (hTK2). In addition, we also discuss the nonhuman dopamine 2 receptor and two viral reporter genes, the wild-type herpes simplex virus 1 thymidine kinase (HSV1-tk) gene and the HSV1-tk mutant (HSV1-sr39tk). Initial applications of reporter gene imaging in patients will be developed within two different clinical disciplines: (a) gene therapy and (b) adoptive cell-based therapies. These studies will benefit from the availability of efficient human reporter systems that can provide critical monitoring information for adenoviral-based, retroviral-based and lenteviral-based gene therapies, oncolytic bacterial and viral therapies, and adoptive cell-based therapies. Translational applications of noninvasive in vivo reporter gene imaging are likely to include: (a) quantitative monitoring of gene therapy vectors for targeting and transduction efficacy in clinical protocols by imaging the location, extent and duration of transgene expression; (b) monitoring of cell trafficking, targeting, replication and activation in adoptive T-cell and stem/progenitor cell therapies

Human reporter genes: potential use in clinical studies

International Nuclear Information System (INIS)

Serganova, Inna; Ponomarev, Vladimir; Blasberg, Ronald

2007-01-01

The clinical application of positron-emission-tomography-based reporter gene imaging will expand over the next several years. The translation of reporter gene imaging technology into clinical applications is the focus of this review, with emphasis on the development and use of human reporter genes. Human reporter genes will play an increasingly more important role in this development, and it is likely that one or more reporter systems (human gene and complimentary radiopharmaceutical) will take leading roles. Three classes of human reporter genes are discussed and compared: receptors, transporters and enzymes. Examples of highly expressed cell membrane receptors include specific membrane somatostatin receptors (hSSTrs). The transporter group includes the sodium iodide symporter (hNIS) and the norepinephrine transporter (hNET). The endogenous enzyme classification includes human mitochondrial thymidine kinase 2 (hTK2). In addition, we also discuss the nonhuman dopamine 2 receptor and two viral reporter genes, the wild-type herpes simplex virus 1 thymidine kinase (HSV1-tk) gene and the HSV1-tk mutant (HSV1-sr39tk). Initial applications of reporter gene imaging in patients will be developed within two different clinical disciplines: (a) gene therapy and (b) adoptive cell-based therapies. These studies will benefit from the availability of efficient human reporter systems that can provide critical monitoring information for adenoviral-based, retroviral-based and lenteviral-based gene therapies, oncolytic bacterial and viral therapies, and adoptive cell-based therapies. Translational applications of noninvasive in vivo reporter gene imaging are likely to include: (a) quantitative monitoring of gene therapy vectors for targeting and transduction efficacy in clinical protocols by imaging the location, extent and duration of transgene expression; (b) monitoring of cell trafficking, targeting, replication and activation in adoptive T-cell and stem/progenitor cell therapies

Nano-immunosafety: issues in assay validation

International Nuclear Information System (INIS)

Boraschi, Diana; Italiani, Paola; Oostingh, Gertie J; Duschl, Albert; Casals, Eudald; Puntes, Victor F; Nelissen, Inge

2011-01-01

Assessing the safety of engineered nanomaterials for human health must include a thorough evaluation of their effects on the immune system, which is responsible for defending the integrity of our body from damage and disease. An array of robust and representative assays should be set up and validated, which could be predictive of the effects of nanomaterials on immune responses. In a trans-European collaborative work, in vitro assays have been developed to this end. In vitro tests have been preferred for their suitability to standardisation and easier applicability. Adapting classical assays to testing the immunotoxicological effects of nanoparticulate materials has raised a series of issues that needed to be appropriately addressed in order to ensure reliability of results. Besides the exquisitely immunological problem of selecting representative endpoints predictive of the risk of developing disease, assay results turned out to be significantly biased by artefactual interference of the nanomaterials or contaminating agents with the assay protocol. Having addressed such problems, a series of robust and representative assays have been developed that describe the effects of engineered nanoparticles on professional and non-professional human defence cells. Two of such assays are described here, one based on primary human monocytes and the other employing human lung epithelial cells transfected with a reporter gene.

An improved method for staining cell colonies in clonogenic assays

OpenAIRE

Guda, Kishore; Natale, Leanna; Markowitz, Sanford D.

2007-01-01

Clonogenic assay is a widely used experimental approach to test for the effects of drugs/genes on the growth and proliferative characteristics of cells in vitro. Accurate quantitation of treatment effects in clonogeneic assays depends on the ability to visualize and count cell colonies precisely. We report a novel method (referred as ETeB) for staining cell colonies grown on plastic and specially coated substrates like collagen. Using colon cancer cell lines grown on plastic and collagen, we ...

The relationship between quantitative human epidermal growth factor receptor 2 gene expression by the 21-gene reverse transcriptase polymerase chain reaction assay and adjuvant trastuzumab benefit in Alliance N9831.

Science.gov (United States)

Perez, Edith A; Baehner, Frederick L; Butler, Steven M; Thompson, E Aubrey; Dueck, Amylou C; Jamshidian, Farid; Cherbavaz, Diana; Yoshizawa, Carl; Shak, Steven; Kaufman, Peter A; Davidson, Nancy E; Gralow, Julie; Asmann, Yan W; Ballman, Karla V

2015-10-01

The N9831 trial demonstrated the efficacy of adjuvant trastuzumab for patients with human epidermal growth factor receptor 2 (HER2) locally positive tumors by protein or gene analysis. We used the 21-gene assay to examine the association of quantitative HER2 messenger RNA (mRNA) gene expression and benefit from trastuzumab. N9831 tested the addition of trastuzumab to chemotherapy in stage I-III HER2-positive breast cancer. For two of the arms of the trial, doxorubicin and cyclophosphamide followed by paclitaxel (AC-T) and doxorubicin and cyclophosphamide followed by paclitaxel and trastuzumab concurrent chemotherapy-trastuzumab (AC-TH), recurrence score (RS) and HER2 mRNA expression were determined by the 21-gene assay (Oncotype DX®) (negative 10 % positive cells = positive), 91 % for RT-PCR versus central fluorescence in situ hybridization (FISH) (≥2.0 = positive) and 94 % for central IHC versus central FISH. In the primary analysis, the association of HER2 expression by 21-gene assay with trastuzumab benefit was marginally nonsignificant (nonlinear p = 0.057). In hormone receptor-positive patients (local IHC) the association was significant (p = 0.002). The association was nonlinear with the greatest estimated benefit at lower and higher HER2 expression levels. Concordance among HER2 assessments by central IHC, FISH, and RT-PCR were similar and high. Association of HER2 mRNA expression with trastuzumab benefit as measured by time to distant recurrence was nonsignificant. A consistent benefit of trastuzumab irrespective of mHER2 levels was observed in patients with either IHC-positive or FISH-positive tumors. Trend for benefit was observed also for the small groups of patients with negative results by any or all of the central assays. Clinicaltrials.gov NCT00005970 . Registered 5 July 2000.

A gene-protein assay for human epidermal growth factor receptor 2 (HER2: brightfield tricolor visualization of HER2 protein, the HER2 gene, and chromosome 17 centromere (CEN17 in formalin-fixed, paraffin-embedded breast cancer tissue sections

Directory of Open Access Journals (Sweden)

Nitta Hiroaki

2012-05-01

Full Text Available Abstract Background The eligibility of breast cancer patients for human epidermal growth factor receptor 2 (HER2-directed therapies is determined by the HER2 gene amplification and/or HER2 protein overexpression status of the breast tumor as determined by in situ hybridization (ISH or immunohistochemistry (IHC, respectively. Our objective was to combine the US Food and Drug Administration (FDA-approved HER2 & chromosome 17 centromere (CEN17 brightfield ISH (BISH and HER2 IHC assays into a single automated HER2 gene-protein assay allowing simultaneous detection of all three targets in a single tissue section. Methods The HER2 gene-protein assay was optimized using formalin-fixed, paraffin-embedded (FFPE samples of the xenograft tumors MCF7 [HER2 negative (non-amplified gene, protein negative] and Calu-3 [HER2 positive (amplified gene, protein positive]. HER2 IHC was performed using a rabbit monoclonal anti-HER2 antibody (clone 4B5 and a conventional 3,3'-diaminobenzidine IHC detection. The HER2 & CEN17 BISH signals were visualized using horseradish peroxidase-based silver and alkaline phosphatase-based red detection systems, respectively with a cocktail of 2,4-dinitrophenyl-labeled HER2 and digoxigenin-labeled CEN17 probes. The performance of the gene-protein assay on tissue microarray slides containing 189 randomly selected FFPE clinical breast cancer tissue cores was compared to that of the separate HER2 IHC and HER2 & CEN17 BISH assays. Results HER2 protein detection was optimal when the HER2 IHC protocol was used before (rather than after the BISH protocol. The sequential use of HER2 IHC and HER2 & CEN17 BISH detection steps on FFPE xenograft tumor sections appropriately co-localized the HER2 protein, HER2 gene, and CEN17 signals after mitigating the silver background staining by using a naphthol phosphate-containing hybridization buffer for the hybridization step. The HER2 protein and HER2 gene status obtained using the multiplex HER2 gene

Rapid identification of carbapenemase genes in gram-negative bacteria with an oligonucleotide microarray-based assay.

Directory of Open Access Journals (Sweden)

Sascha D Braun

Full Text Available Rapid molecular identification of carbapenemase genes in Gram-negative bacteria is crucial for infection control and prevention, surveillance and for epidemiological purposes. Furthermore, it may have a significant impact upon determining the appropriate initial treatment and greatly benefit for critically ill patients. A novel oligonucleotide microarray-based assay was developed to simultaneously detect genes encoding clinically important carbapenemases as well as selected extended (ESBL and narrow spectrum (NSBL beta-lactamases directly from clonal culture material within few hours. Additionally, a panel of species specific markers was included to identify Escherichia coli, Pseudomonas aeruginosa, Citrobacter freundii/braakii, Klebsiella pneumoniae and Acinetobacter baumannii. The assay was tested using a panel of 117 isolates collected from urinary, blood and stool samples. For these isolates, phenotypic identifications and susceptibility tests were available. An independent detection of carbapenemase, ESBL and NSBL genes was carried out by various external reference laboratories using PCR methods. In direct comparison, the microarray correctly identified 98.2% of the covered carbapenemase genes. This included blaVIM (13 out of 13, blaGIM (2/2, blaKPC (27/27, blaNDM (5/5, blaIMP-2/4/7/8/13/14/15/16/31 (10/10, blaOXA-23 (12/13, blaOXA-40-group (7/7, blaOXA-48-group (32/33, blaOXA-51 (1/1 and blaOXA-58 (1/1. Furthermore, the test correctly identified additional beta-lactamases [blaOXA-1 (16/16, blaOXA-2 (4/4, blaOXA-9 (33/33, OXA-10 (3/3, blaOXA-51 (25/25, blaOXA-58 (2/2, CTX-M1/M15 (17/17 and blaVIM (1/1]. In direct comparison to phenotypical identification obtained by VITEK or MALDI-TOF systems, 114 of 117 (97.4% isolates, including Acinetobacter baumannii (28/28, Enterobacter spec. (5/5, Escherichia coli (4/4, Klebsiella pneumoniae (62/63, Klebsiella oxytoca (0/2, Pseudomonas aeruginosa (12/12, Citrobacter freundii (1/1 and Citrobacter

R/L, a double reporter mouse line that expresses luciferase gene upon Cre-mediated excision, followed by inactivation of mRFP expression.

Science.gov (United States)

Jia, Junshuang; Lin, Xiaolin; Lin, Xia; Lin, Taoyan; Chen, Bangzhu; Hao, Weichao; Cheng, Yushuang; Liu, Yu; Dian, Meijuan; Yao, Kaitai; Xiao, Dong; Gu, Weiwang

2016-10-01

The Cre/loxP system has become an important tool for the conditional gene knockout and conditional gene expression in genetically engineered mice. The applications of this system depend on transgenic reporter mouse lines that provide Cre recombinase activity with a defined cell type-, tissue-, or developmental stage-specificity. To develop a sensitive assay for monitoring Cre-mediated DNA excisions in mice, we generated Cre-mediated excision reporter mice, designated R/L mice (R/L: mRFP(monomeric red fluorescent protein)/luciferase), express mRFP throughout embryonic development and adult stages, while Cre-mediated excision deletes a loxP-flanked mRFP reporter gene and STOP sequence, thereby activating the expression of the second reporter gene luciferase, as assayed by in vivo and ex vivo bioluminescence imaging. After germ line deletion of the floxed mRFP and STOP sequence in R/L mice by EIIa-Cre mice, the resulting luciferase transgenic mice in which the loxP-mRFP-STOP-loxP cassette is excised from all cells express luciferase in all tissues and organs examined. The expression of luciferase transgene was activated in liver of RL/Alb-Cre double transgenic mice and in brain of RL/Nestin-Cre double transgenic mice when R/L reporter mice were mated with Alb-Cre mice and Nestin-Cre mice, respectively. Our findings reveal that the double reporter R/L mouse line is able to indicate the occurrence of Cre-mediated excision from early embryonic to adult lineages. Taken together, these findings demonstrate that the R/L mice serve as a sensitive reporter for Cre-mediated DNA excision both in living animals and in organs, tissues, and cells following necropsy.

Method for Screening Compounds That Influence Virulence Gene Expression in Staphylococcus aureus

DEFF Research Database (Denmark)

Nielsen, A.; Nielsen, Kristian Fog; Frees, D.

2010-01-01

We present a simple assay to examine effects of compounds on virulence gene expression in the human pathogen Staphylococcus aureus. The assay employs transcriptional reporter strains carrying lacZ fused to central virulence genes. Compounds affecting virulence gene expression and activity...... of the agr locus are scored based on color change in the presence of a chromogenic beta-galactosidase substrate. The assay can be used to screen for novel antivirulence compounds from many different sources, such as fungi, as demonstrated here....

A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples.

Science.gov (United States)

Cascini, Fidelia; Passerotti, Stella; Martello, Simona

2012-04-10

In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Relative quantification of protein-protein interactions using a dual luciferase reporter pull-down assay system.

Directory of Open Access Journals (Sweden)

Shuaizheng Jia

Full Text Available The identification and quantitative analysis of protein-protein interactions are essential to the functional characterization of proteins in the post-proteomics era. The methods currently available are generally time-consuming, technically complicated, insensitive and/or semi-quantitative. The lack of simple, sensitive approaches to precisely quantify protein-protein interactions still prevents our understanding of the functions of many proteins. Here, we develop a novel dual luciferase reporter pull-down assay by combining a biotinylated Firefly luciferase pull-down assay with a dual luciferase reporter assay. The biotinylated Firefly luciferase-tagged protein enables rapid and efficient isolation of a putative Renilla luciferase-tagged binding protein from a relatively small amount of sample. Both of these proteins can be quantitatively detected using the dual luciferase reporter assay system. Protein-protein interactions, including Fos-Jun located in the nucleus; MAVS-TRAF3 in cytoplasm; inducible IRF3 dimerization; viral protein-regulated interactions, such as MAVS-MAVS and MAVS-TRAF3; IRF3 dimerization; and protein interaction domain mapping, are studied using this novel assay system. Herein, we demonstrate that this dual luciferase reporter pull-down assay enables the quantification of the relative amounts of interacting proteins that bind to streptavidin-coupled beads for protein purification. This study provides a simple, rapid, sensitive, and efficient approach to identify and quantify relative protein-protein interactions. Importantly, the dual luciferase reporter pull-down method will facilitate the functional determination of proteins.

A Cancer Cell-Activatable Aptamer-Reporter System for One-Step Assay of Circulating Tumor Cells

Directory of Open Access Journals (Sweden)

Zihua Zeng

2014-01-01

Full Text Available The current antibody-mediated numeration assays of circulating tumor cells (CTCs require multiple steps and are time-consuming. To overcome these technical limitations, a cancer cell-activatable aptamer-reporter was formulated by conjugating a biomarker-specific aptamer sequence with paired fluorochrome-quencher molecules. In contrast to the antibody probes, the intact aptamer-reporter was optically silent in the absence of cells of interest. However, when used in an assay, the aptamer selectively targeted cancer cells through interaction with a specific surface biomarker, which triggered internalization of the aptamer-reporter and, subsequently, into cell lysosomes. Rapid lysosomal degradation of the aptamer-reporter resulted in separation of the paired fluorochrome-quencher molecules. The released fluorochrome emitted bright fluorescent signals exclusively within the targeted cancer cells, with no background noise in the assay. Thus, the assays could be completed in a single step within minutes. By using this one-step assay, CTCs in whole blood and marrow aspirate samples of patients with lymphoma tumors were selectively highlighted and rapidly detected with no off-target signals from background blood cells. The development of the cancer cell-activatable aptamer-reporter system allows for the possibility of a simple and robust point-of-care test for CTC detection, which is currently unavailable.

Advances in study of molecular imaging reporte gene systems

International Nuclear Information System (INIS)

Wu Tao; An Rui

2010-01-01

The use of molecular imaging reporter gene systems has allowed gene therapy to move from the laboratory to the clinical application, which provides methodology to monitor the expression of therapeutic gene noninvasively and achieve quantitative outcome in vivo. Recently, the radionuclide reporter gene still is the focus many studies, but MRI and optical reporter gene have gradually played a important part in reporter gene systems. On the basis of combination of multi-subject, for example applied chemistry and molecular biology, more and more new modified reporter genes and molecular probes have spread out. This paper mainly introduces the advantages and disadvantages of reporter gene system and development trends. (authors)

Real-time polymerase chain reaction assay for endogenous reference gene for specific detection and quantification of common wheat-derived DNA (Triticum aestivum L.).

Science.gov (United States)

Vautrin, Sonia; Zhang, David

2007-01-01

A species-specific endogenous reference gene system was developed for polymerase chain reaction (PCR)-based analysis in common wheat (Triticum aestivum L.) by targeting the ALMT1 gene, an aluminium-activated malate transporter. The primers and probe were elaborated for real-time PCR-based qualitative and quantitative assay. The size of amplified product is 95 base pairs. The specificity was assessed on 17 monocot and dicot plant species. The established real-time PCR assay amplified only T. aestivum-derived DNA; no amplification occurred on other phylogenetically related species, including durum wheat (T. durum). The robustness of the system was tested on the DNA of 15 common wheat cultivars using 20 000 genomic copies per PCR the mean cycle threshold (Ct) values of 24.02 +/- 0.251 were obtained. The absolute limits of detection and quantification of the real-time PCR assay were estimated to 2 and 20 haploid genome copies of common wheat, respectively. The linearity was experimentally validated on 2-fold serial dilutions of DNA from 650 to 20 000 haploid genome copies. All these results show that the real-time PCR assay developed on the ALMT1 gene is suitable to be used as an endogenous reference gene for PCR-based specific detection and quantification of T. aestivum-derived DNA in various applications, in particular for the detection and quantification of genetically modified materials in common wheat.

A sensitive HIV-1 envelope induced fusion assay identifies fusion enhancement of thrombin

International Nuclear Information System (INIS)

Cheng, De-Chun; Zhong, Guo-Cai; Su, Ju-Xiang; Liu, Yan-Hong; Li, Yan; Wang, Jia-Ye; Hattori, Toshio; Ling, Hong; Zhang, Feng-Min

2010-01-01

To evaluate the interaction between HIV-1 envelope glycoprotein (Env) and target cell receptors, various cell-cell-fusion assays have been developed. In the present study, we established a novel fusion system. In this system, the expression of the sensitive reporter gene, firefly luciferase (FL) gene, in the target cells was used to evaluate cell fusion event. Simultaneously, constitutively expressed Renilla luciferase (RL) gene was used to monitor effector cell number and viability. FL gave a wider dynamic range than other known reporters and the introduction of RL made the assay accurate and reproducible. This system is especially beneficial for investigation of potential entry-influencing agents, for its power of ruling out the false inhibition or enhancement caused by the artificial cell-number variation. As a case study, we applied this fusion system to observe the effect of a serine protease, thrombin, on HIV Env-mediated cell-cell fusion and have found the fusion enhancement activity of thrombin over two R5-tropic HIV strains.

Measuring Gene Expression in Bombarded Barley Aleurone Layers with Increased Throughput.

Science.gov (United States)

Uwase, Grace; Enrico, Taylor P; Chelimo, David S; Keyser, Benjamin R; Johnson, Russell R

2018-03-30

The aleurone layer of barley grains is an important model system for hormone-regulated gene expression in plants. In aleurone cells, genes required for germination or early seedling development are activated by gibberellin (GA), while genes associated with stress responses are activated by abscisic acid (ABA). The mechanisms of GA and ABA signaling can be interrogated by introducing reporter gene constructs into aleurone cells via particle bombardment, with the resulting transient expression measured using enzyme assays. An improved protocol is reported that partially automates and streamlines the grain homogenization step and the enzyme assays, allowing significantly more throughput than existing methods. Homogenization of the grain samples is carried out using an automated tissue homogenizer, and GUS (β-glucuronidase) assays are carried out using a 96-well plate system. Representative results using the protocol suggest that phospholipase D activity may play an important role in the activation of HVA1 gene expression by ABA, through the transcription factor TaABF1.

Reporter gene imaging: potential impact on therapy

International Nuclear Information System (INIS)

Serganova, Inna; Blasberg, Ronald

2005-01-01

Positron emission tomography (PET)-based molecular-genetic imaging in living organisms has enjoyed exceptional growth over the past 5 years; this is particularly striking since it has been identified as a new discipline only within the past decade. Positron emission tomography is one of three imaging technologies (nuclear, magnetic resonance and optical) that has begun to incorporate methods that are established in molecular and cell biology research. The convergence of these disciplines and the wider application of multi-modality imaging are at the heart of this success story. Most current molecular-genetic imaging strategies are 'indirect,' coupling a 'reporter gene' with a complimentary 'reporter probe.' Reporter gene constructs can be driven by constitutive promoter elements and used to monitor gene therapy vectors and the efficacy of trans gene targeting and transduction, as well as to monitor adoptive cell-based therapies. Inducible promoters can be used as 'sensors' to regulate the magnitude of reporter gene expression and can be used to provide information about endogenous cell processes. Reporter systems can also be constructed to monitor mRNA stabilization and specific protein-protein interactions. Promoters can be cell specific and restrict transgene expression to certain tissue and organs. The translation of reporter gene imaging to specific clinical applications is discussed. Several examples that have potential for patient imaging studies in the near future include monitoring adenoviral-based gene therapy, oncolytic herpes virus therapy, adoptive cell-based therapies and Salmonella-based tumor-targeted cancer therapy and imaging. The primary translational applications of noninvasive in vivo reporter gene imaging are likely to be (a) quantitative monitoring of the gene therapy vector and the efficacy of transduction in clinical protocols, by imaging the location, extent and duration of transgene expression; (b) monitoring cell trafficking, targeting

GeneXpert HIV-1 quant assay, a new tool for scale up of viral load monitoring in the success of ART programme in India.

Science.gov (United States)

Kulkarni, Smita; Jadhav, Sushama; Khopkar, Priyanka; Sane, Suvarna; Londhe, Rajkumar; Chimanpure, Vaishali; Dhilpe, Veronica; Ghate, Manisha; Yelagate, Rajendra; Panchal, Narayan; Rahane, Girish; Kadam, Dilip; Gaikwad, Nitin; Rewari, Bharat; Gangakhedkar, Raman

2017-07-21

Recent WHO guidelines identify virologic monitoring for diagnosing and confirming ART failure. In view of this, validation and scale up of point of care viral load technologies is essential in resource limited settings. A systematic validation of the GeneXpert® HIV-1 Quant assay (a point-of-care technology) in view of scaling up HIV-1 viral load in India to monitor the success of national ART programme was carried out. Two hundred nineteen plasma specimens falling in nine viral load ranges (5 L copies/ml) were tested by the Abbott m2000rt Real Time and GeneXpert HIV-1 Quant assays. Additionally, 20 seronegative; 16 stored specimens and 10 spiked controls were also tested. Statistical analysis was done using Stata/IC and sensitivity, specificity, PPV, NPV and %misclassification rates were calculated as per DHSs/AISs, WHO, NACO cut-offs for virological failure. The GeneXpert assay compared well with the Abbott assay with a higher sensitivity (97%), specificity (97-100%) and concordance (91.32%). The correlation between two assays (r = 0.886) was statistically significant (p performance and rapidity will aid in timely diagnosis of ART failures, integrated HIV-TB management and will facilitate the UNAIDS 90-90-90 target.

Gene mining a marama bean expressed sequence tags (ESTs ...

African Journals Online (AJOL)

The authors reported the identification of genes associated with embryonic development and microsatellite sequences. The future direction will entail characterization of these genes using gene over-expression and mutant assays. Key words: Namibia, simple sequence repeats (SSR), data mining, homology searches, ...

The first report of the vanC1 gene in Enterococcus faecium isolated from a human clinical specimen

Directory of Open Access Journals (Sweden)

Mingyue Sun

2014-09-01

Full Text Available The vanC1 gene, which is chromosomally located, confers resistance to vancomycin and serves as a species marker for Enterococcus gallinarum. Enterococcus faecium TJ4031 was isolated from a blood culture and harbours the vanC1gene. Polymerase chain reaction (PCR assays were performed to detect vanXYc and vanTc genes. Only the vanXYc gene was found in the E. faecium TJ4031 isolate. The minimum inhibitory concentrations of vancomycin and teicoplanin were 2 µg/mL and 1 µg/mL, respectively. Real-time reverse transcription-PCR results revealed that the vanC1and vanXYc genes were not expressed. Pulsed-field gel electrophoresis and southern hybridisation results showed that the vanC1 gene was encoded in the chromosome. E. faecalis isolated from animals has been reported to harbour vanC1gene. However, this study is the first to report the presence of the vanC1gene in E. faecium of human origin. Additionally, our research showed the vanC1gene cannot serve as a species-specific gene of E. gallinarum and that it is able to be transferred between bacteria. Although the resistance marker is not expressed in the strain, our results showed that E. faecium could acquire the vanC1gene from different species.

Candidate gene identification of ovulation-inducing genes by RNA sequencing with an in vivo assay in zebrafish.

Directory of Open Access Journals (Sweden)

Wanlada Klangnurak

Full Text Available We previously reported the microarray-based selection of three ovulation-related genes in zebrafish. We used a different selection method in this study, RNA sequencing analysis. An additional eight up-regulated candidates were found as specifically up-regulated genes in ovulation-induced samples. Changes in gene expression were confirmed by qPCR analysis. Furthermore, up-regulation prior to ovulation during natural spawning was verified in samples from natural pairing. Gene knock-out zebrafish strains of one of the candidates, the starmaker gene (stm, were established by CRISPR genome editing techniques. Unexpectedly, homozygous mutants were fertile and could spawn eggs. However, a high percentage of unfertilized eggs and abnormal embryos were produced from these homozygous females. The results suggest that the stm gene is necessary for fertilization. In this study, we selected additional ovulation-inducing candidate genes, and a novel function of the stm gene was investigated.

The potential value of the neutral comet assay and the expression of genes associated with DNA damage in assessing the radiosensitivity of tumor cells.

Science.gov (United States)

Jayakumar, Sundarraj; Bhilwade, Hari N; Pandey, Badri N; Sandur, Santosh K; Chaubey, Ramesh C

2012-10-09

The assessment of tumor radiosensitivity would be particularly useful in optimizing the radiation dose during radiotherapy. Therefore, the degree of correlation between radiation-induced DNA damage, as measured by the alkaline and the neutral comet assays, and the clonogenic survival of different human tumor cells was studied. Further, tumor radiosensitivity was compared with the expression of genes associated with the cellular response to radiation damage. Five different human tumor cell lines were chosen and the radiosensitivity of these cells was established by clonogenic assay. Alkaline and neutral comet assays were performed in γ-irradiated cells (2-8Gy; either acute or fractionated). Quantitative PCR was performed to evaluate the expression of DNA damage response genes in control and irradiated cells. The relative radiosensitivity of the cell lines assessed by the extent of DNA damage (neutral comet assay) immediately after irradiation (4Gy or 6Gy) was in agreement with radiosensitivity pattern obtained by the clonogenic assay. The survival fraction of irradiated cells showed a better correlation with the magnitude of DNA damage measured by the neutral comet assay (r=-0.9; Pcomet assay (r=-0.73; Pcomet assay was better than alkaline comet assay for assessment of radiosensitivities of tumor cells after acute or fractionated doses of irradiation. © 2012 Elsevier B.V. All rights reserved.

Evaluating the genotoxic effects of workers exposed to lead using micronucleus assay, comet assay and TCR gene mutation test

International Nuclear Information System (INIS)

Chen Zhijian; Lou Jianlin; Chen Shijie; Zheng Wei; Wu Wei; Jin Lifen; Deng Hongping; He Jiliang

2006-01-01

To evaluate the genotoxic effects of lead (Pb) exposure, 25 workers in a workplace producing storage battery were monitored for three genetic end-points using micronucleus (MN) assay, comet assay and TCR gene mutation test. Twenty-five controls were matched with workers according to age, gender and smoking. The air Pb concentration in the workplace was 1.26 mg/m 3 . All subjects were measured for Pb concentration of blood by atom absorption spectrophotometry. The mean Pb concentration of blood in workers (0.32 mg/l) was significantly higher than that in controls (0.02 mg/l). The results of MN test showed that the mean micronuclei rate (MNR) and mean micronucleated cells rate (MCR) in workers were 9.04 ± 1.51 per mille and 7.76 ± 1.23 per mille , respectively, which were significantly higher than those (2.36 ± 0.42 per mille and 1.92 ± 0.31 per mille ) in controls (P -4 and 1.74 ± 0.17 x 10 -4 , respectively, there was no significant difference between workers and controls (P > 0.05). The results of our study indicated that the genetic damage was detectable in 25 workers occupationally exposed to lead

In situ detection of the Clostridium botulinum type C1 toxin gene in wetland sediments with a nested PCR assay

Science.gov (United States)

Williamson, Judy L.; Rocke, Tonie E.; Aiken, Judd M.

1999-01-01

A nested PCR was developed for detection of the Clostridium botulinum type C1 toxin gene in sediments collected from wetlands where avian botulism outbreaks had or had not occurred. The C1 toxin gene was detected in 16 of 18 sites, demonstrating both the ubiquitous distribution of C. botulinum type C in wetland sediments and the sensitivity of the detection assay.

Prospective Validation of a 21-Gene Expression Assay in Breast Cancer.

Science.gov (United States)

Sparano, Joseph A; Gray, Robert J; Makower, Della F; Pritchard, Kathleen I; Albain, Kathy S; Hayes, Daniel F; Geyer, Charles E; Dees, Elizabeth C; Perez, Edith A; Olson, John A; Zujewski, JoAnne; Lively, Tracy; Badve, Sunil S; Saphner, Thomas J; Wagner, Lynne I; Whelan, Timothy J; Ellis, Matthew J; Paik, Soonmyung; Wood, William C; Ravdin, Peter; Keane, Maccon M; Gomez Moreno, Henry L; Reddy, Pavan S; Goggins, Timothy F; Mayer, Ingrid A; Brufsky, Adam M; Toppmeyer, Deborah L; Kaklamani, Virginia G; Atkins, James N; Berenberg, Jeffrey L; Sledge, George W

2015-11-19

Prior studies with the use of a prospective-retrospective design including archival tumor samples have shown that gene-expression assays provide clinically useful prognostic information. However, a prospectively conducted study in a uniformly treated population provides the highest level of evidence supporting the clinical validity and usefulness of a biomarker. We performed a prospective trial involving women with hormone-receptor-positive, human epidermal growth factor receptor type 2 (HER2)-negative, axillary node-negative breast cancer with tumors of 1.1 to 5.0 cm in the greatest dimension (or 0.6 to 1.0 cm in the greatest dimension and intermediate or high tumor grade) who met established guidelines for the consideration of adjuvant chemotherapy on the basis of clinicopathologic features. A reverse-transcriptase-polymerase-chain-reaction assay of 21 genes was performed on the paraffin-embedded tumor tissue, and the results were used to calculate a score indicating the risk of breast-cancer recurrence; patients were assigned to receive endocrine therapy without chemotherapy if they had a recurrence score of 0 to 10, indicating a very low risk of recurrence (on a scale of 0 to 100, with higher scores indicating a greater risk of recurrence). Of the 10,253 eligible women enrolled, 1626 women (15.9%) who had a recurrence score of 0 to 10 were assigned to receive endocrine therapy alone without chemotherapy. At 5 years, in this patient population, the rate of invasive disease-free survival was 93.8% (95% confidence interval [CI], 92.4 to 94.9), the rate of freedom from recurrence of breast cancer at a distant site was 99.3% (95% CI, 98.7 to 99.6), the rate of freedom from recurrence of breast cancer at a distant or local-regional site was 98.7% (95% CI, 97.9 to 99.2), and the rate of overall survival was 98.0% (95% CI, 97.1 to 98.6). Among patients with hormone-receptor-positive, HER2-negative, axillary node-negative breast cancer who met established guidelines for

Investigation progress of PET reporter gene imaging

International Nuclear Information System (INIS)

Chen Yumei; Huang Gang

2006-01-01

Molecular imaging for gene therapy and gene expression has been more and more attractive, while the use of gene therapy has been widely investigated and intense research have allowed it to the clinical setting in the last two-decade years. In vivo imaging with positron emission tomography (PET) by combination of appropriate PET reporter gene and PET reporter probe could provide qualitative and quantitative information for gene therapy. PET imaging could also obtain some valuable parameters not available by other techniques. This technology is useful to understand the process and development of gene therapy and how to apply it into clinical practice in the future. (authors)

Identification of Reference Genes for Quantitative Real Time PCR Assays in Aortic Tissue of Syrian Hamsters with Bicuspid Aortic Valve.

Science.gov (United States)

Rueda-Martínez, Carmen; Fernández, M Carmen; Soto-Navarrete, María Teresa; Jiménez-Navarro, Manuel; Durán, Ana Carmen; Fernández, Borja

2016-01-01

Bicuspid aortic valve (BAV) is the most frequent congenital cardiac malformation in humans, and appears frequently associated with dilatation of the ascending aorta. This association is likely the result of a common aetiology. Currently, a Syrian hamster strain with a relatively high (∼40%) incidence of BAV constitutes the only spontaneous animal model of BAV disease. The characterization of molecular alterations in the aorta of hamsters with BAV may serve to identify pathophysiological mechanisms and molecular markers of disease in humans. In this report, we evaluate the expression of ten candidate reference genes in aortic tissue of hamsters in order to identify housekeeping genes for normalization using quantitative real time PCR (RT-qPCR) assays. A total of 51 adult (180-240 days old) and 56 old (300-440 days old) animals were used. They belonged to a control strain of hamsters with normal, tricuspid aortic valve (TAV; n = 30), or to the affected strain of hamsters with TAV (n = 45) or BAV (n = 32). The expression stability of the candidate reference genes was determined by RT-qPCR using three statistical algorithms, GeNorm, NormFinder and Bestkeeper. The expression analyses showed that the most stable reference genes for the three algorithms employed were Cdkn1β, G3pdh and Polr2a. We propose the use of Cdkn1β, or both Cdkn1β and G3pdh as reference genes for mRNA expression analyses in Syrian hamster aorta.

Identification of Reference Genes for Quantitative Real Time PCR Assays in Aortic Tissue of Syrian Hamsters with Bicuspid Aortic Valve.

Directory of Open Access Journals (Sweden)

Carmen Rueda-Martínez

Full Text Available Bicuspid aortic valve (BAV is the most frequent congenital cardiac malformation in humans, and appears frequently associated with dilatation of the ascending aorta. This association is likely the result of a common aetiology. Currently, a Syrian hamster strain with a relatively high (∼40% incidence of BAV constitutes the only spontaneous animal model of BAV disease. The characterization of molecular alterations in the aorta of hamsters with BAV may serve to identify pathophysiological mechanisms and molecular markers of disease in humans. In this report, we evaluate the expression of ten candidate reference genes in aortic tissue of hamsters in order to identify housekeeping genes for normalization using quantitative real time PCR (RT-qPCR assays. A total of 51 adult (180-240 days old and 56 old (300-440 days old animals were used. They belonged to a control strain of hamsters with normal, tricuspid aortic valve (TAV; n = 30, or to the affected strain of hamsters with TAV (n = 45 or BAV (n = 32. The expression stability of the candidate reference genes was determined by RT-qPCR using three statistical algorithms, GeNorm, NormFinder and Bestkeeper. The expression analyses showed that the most stable reference genes for the three algorithms employed were Cdkn1β, G3pdh and Polr2a. We propose the use of Cdkn1β, or both Cdkn1β and G3pdh as reference genes for mRNA expression analyses in Syrian hamster aorta.

Single-Cell Based Quantitative Assay of Chromosome Transmission Fidelity.

Science.gov (United States)

Zhu, Jin; Heinecke, Dominic; Mulla, Wahid A; Bradford, William D; Rubinstein, Boris; Box, Andrew; Haug, Jeffrey S; Li, Rong

2015-03-30

Errors in mitosis are a primary cause of chromosome instability (CIN), generating aneuploid progeny cells. Whereas a variety of factors can influence CIN, under most conditions mitotic errors are rare events that have been difficult to measure accurately. Here we report a green fluorescent protein-based quantitative chromosome transmission fidelity (qCTF) assay in budding yeast that allows sensitive and quantitative detection of CIN and can be easily adapted to high-throughput analysis. Using the qCTF assay, we performed genome-wide quantitative profiling of genes that affect CIN in a dosage-dependent manner and identified genes that elevate CIN when either increased (icCIN) or decreased in copy number (dcCIN). Unexpectedly, qCTF screening also revealed genes whose change in copy number quantitatively suppress CIN, suggesting that the basal error rate of the wild-type genome is not minimized, but rather, may have evolved toward an optimal level that balances both stability and low-level karyotype variation for evolutionary adaptation. Copyright © 2015 Zhu et al.

Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

Science.gov (United States)

Burlibașa, Liliana; Suciu, Ilinca

2015-12-01

Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

Differentiation of the virulence potential of Campylobacter jejuni strains by use of gene transcription analysis and a caco-2 assay

DEFF Research Database (Denmark)

Poli, Vanessa Fadanelli Schoenardie; Thorsen, Line; Olesen, Inger

2012-01-01

properties were evaluated by analyzing transcriptions of the virulence genes cdtB, ciaB, cadF and the stress associated genes clpP, htrB using reverse transcription quantitative PCR (RT-qPCR) and by the ability of the C. jejuni strains to adhere to and invade Caco-2 cells. Similar cell survival and no growth...... gene, cipA between DFVF1099 and NCTC11168 resulting in a 14 amino acid deletion and 28 amino acid addition at the N and C terminal ends respectively of the CipA protein of DFVF1099. In contrast to DFVF1099, strains NCTC1168 and TB1048 were able to invade Caco-2 cells. Invasion ability was not affected...... expression of C. jejuni. The clinical strains appeared to be more virulent than the chicken isolate as measured by the Caco-2 invasion assay which could be due to differences in CipA functionality. The RT-qPCR analysis and Caco-2 assay showed to be useful tools for differentiating virulence potentials...

Comparison of in vitro hormone activities of novel flame retardants TBB, TBPH and their metabolites TBBA and TBMEPH using reporter gene assays.

Science.gov (United States)

Klopčič, Ivana; Skledar, Darja Gramec; Mašič, Lucija Peterlin; Dolenc, Marija Sollner

2016-10-01

The anti-androgenic and anti-thyroid hormonal activities of the two novel brominated flame retardants, TBB and TBPH and of their metabolites TBBA and TBMEPH have been compared using the luciferase reporter gene assays. Only the parent compounds TBB and TBPH exhibited anti-glucocorticoid activity with IC50 values of 1.9 μM and 0.3 μM. Furthermore, mode of action for these two compounds is by direct competing to the glucocorticoid receptor (GR) with IC50 values of 0.03 μM and 0.002 μM. All four tested compounds possess anti-androgenic and anti-thyroid hormonal activities, without agonist activities on the respective receptors. Anti-androgenic activities with IC50 values of 43.5 μM, 0.1 μM, 47.5 μM and 1.3 μM were found for TBB, TBPH, TBBA and TBMEPH. The anti-thyroid hormonal IC50 values of 37.5 μM, 0.1 μM, 22.8 μM and 32.3 μM for TBB, TBPH, TBBA and TBMEPH, together with the above quoted results, indicate that metabolism can modify anti-androgenic, anti-glucocorticoid and anti-thyroid hormonal effects of these novel brominated flame retardants. Furthermore, the parent flame retardants are shown to be able to disrupt the function of the GR as antagonists by direct competition to the receptor. Copyright © 2016 Elsevier Ltd. All rights reserved.

A quantitative assay measuring the function of lipase maturation factor 1

Science.gov (United States)

Yin, Fen; Doolittle, Mark H.; Péterfy, Miklós

2009-01-01

Newly synthesized lipoprotein lipase (LPL) and related members of the lipase gene family require an endoplasmic reticulum maturation factor for attainment of enzyme activity. This factor has been identified as lipase maturation factor 1 (Lmf1), and mutations affecting its function and/or expression result in combined lipase deficiency (cld) and hypertriglyceridemia. To assess the functional impact of Lmf1 sequence variations, both naturally occurring and induced, we report the development of a cell-based assay using LPL activity as a quantitative reporter of Lmf1 function. The assay uses a cell line homozygous for the cld mutation, which renders endogenous Lmf1 nonfunctional. LPL transfected into the mutant cld cell line fails to attain activity; however, cotransfection of LPL with wild-type Lmf1 restores its ability to support normal lipase maturation. In this report, we describe optimized conditions that ensure the detection of a complete range of Lmf1 function (full, partial, or complete loss of function) using LPL activity as the quantitative reporter. To illustrate the dynamic range of the assay, we tested several novel mutations in mouse Lmf1. Our results demonstrate the ability of the assay to detect and analyze Lmf1 mutations having a wide range of effects on Lmf1 function and protein expression. PMID:19471043

Prognostic Utility of the 21-Gene Assay in Hormone Receptor–Positive Operable Breast Cancer Compared With Classical Clinicopathologic Features

Science.gov (United States)

Goldstein, Lori J.; Gray, Robert; Badve, Sunil; Childs, Barrett H.; Yoshizawa, Carl; Rowley, Steve; Shak, Steven; Baehner, Frederick L.; Ravdin, Peter M.; Davidson, Nancy E.; Sledge, George W.; Perez, Edith A.; Shulman, Lawrence N.; Martino, Silvana; Sparano, Joseph A.

2008-01-01

Purpose Adjuvant! is a standardized validated decision aid that projects outcomes in operable breast cancer based on classical clinicopathologic features and therapy. Genomic classifiers offer the potential to more accurately identify individuals who benefit from chemotherapy than clinicopathologic features. Patients and Methods A sample of 465 patients with hormone receptor (HR) –positive breast cancer with zero to three positive axillary nodes who did (n = 99) or did not have recurrence after chemohormonal therapy had tumor tissue evaluated using a 21-gene assay. Histologic grade and HR expression were evaluated locally and in a central laboratory. Results Recurrence Score (RS) was a highly significant predictor of recurrence, including node-negative and node-positive disease (P < .001 for both) and when adjusted for other clinical variables. RS also predicted recurrence more accurately than clinical variables when integrated by an algorithm modeled after Adjuvant! that was adjusted to 5-year outcomes. The 5-year recurrence rate was only 5% or less for the estimated 46% of patients who have a low RS (< 18). Conclusion The 21-gene assay was a more accurate predictor of relapse than standard clinical features for individual patients with HR-positive operable breast cancer treated with chemohormonal therapy and provides information that is complementary to features typically used in anatomic staging, such as tumor size and lymph node involvement. The 21-gene assay may be used to select low-risk patients for abbreviated chemotherapy regimens similar to those used in our study or high-risk patients for more aggressive regimens or clinical trials evaluating novel treatments. PMID:18678838

Prognostic utility of the 21-gene assay in hormone receptor-positive operable breast cancer compared with classical clinicopathologic features.

Science.gov (United States)

Goldstein, Lori J; Gray, Robert; Badve, Sunil; Childs, Barrett H; Yoshizawa, Carl; Rowley, Steve; Shak, Steven; Baehner, Frederick L; Ravdin, Peter M; Davidson, Nancy E; Sledge, George W; Perez, Edith A; Shulman, Lawrence N; Martino, Silvana; Sparano, Joseph A

2008-09-01

Adjuvant! is a standardized validated decision aid that projects outcomes in operable breast cancer based on classical clinicopathologic features and therapy. Genomic classifiers offer the potential to more accurately identify individuals who benefit from chemotherapy than clinicopathologic features. A sample of 465 patients with hormone receptor (HR) -positive breast cancer with zero to three positive axillary nodes who did (n = 99) or did not have recurrence after chemohormonal therapy had tumor tissue evaluated using a 21-gene assay. Histologic grade and HR expression were evaluated locally and in a central laboratory. Recurrence Score (RS) was a highly significant predictor of recurrence, including node-negative and node-positive disease (P < .001 for both) and when adjusted for other clinical variables. RS also predicted recurrence more accurately than clinical variables when integrated by an algorithm modeled after Adjuvant! that was adjusted to 5-year outcomes. The 5-year recurrence rate was only 5% or less for the estimated 46% of patients who have a low RS (< 18). The 21-gene assay was a more accurate predictor of relapse than standard clinical features for individual patients with HR-positive operable breast cancer treated with chemohormonal therapy and provides information that is complementary to features typically used in anatomic staging, such as tumor size and lymph node involvement. The 21-gene assay may be used to select low-risk patients for abbreviated chemotherapy regimens similar to those used in our study or high-risk patients for more aggressive regimens or clinical trials evaluating novel treatments.

In vitro reporter gene assays for assessment of PPAR- and Nrf2-mediated health effects of tomato and its bioactive constituents

NARCIS (Netherlands)

Gijsbers, L.

2013-01-01

The consumption of food products with health-promoting properties, such as for example margarines with plant sterols, fruit juice enriched with calcium and cereals with (soluble) fibre, has increased rapidly during the last years. The present thesis provides proof-of-principle that reporter gene

Evaluation of the reliability of maize reference assays for GMO quantification.

Science.gov (United States)

Papazova, Nina; Zhang, David; Gruden, Kristina; Vojvoda, Jana; Yang, Litao; Buh Gasparic, Meti; Blejec, Andrej; Fouilloux, Stephane; De Loose, Marc; Taverniers, Isabel

2010-03-01

A reliable PCR reference assay for relative genetically modified organism (GMO) quantification must be specific for the target taxon and amplify uniformly along the commercialised varieties within the considered taxon. Different reference assays for maize (Zea mays L.) are used in official methods for GMO quantification. In this study, we evaluated the reliability of eight existing maize reference assays, four of which are used in combination with an event-specific polymerase chain reaction (PCR) assay validated and published by the Community Reference Laboratory (CRL). We analysed the nucleotide sequence variation in the target genomic regions in a broad range of transgenic and conventional varieties and lines: MON 810 varieties cultivated in Spain and conventional varieties from various geographical origins and breeding history. In addition, the reliability of the assays was evaluated based on their PCR amplification performance. A single base pair substitution, corresponding to a single nucleotide polymorphism (SNP) reported in an earlier study, was observed in the forward primer of one of the studied alcohol dehydrogenase 1 (Adh1) (70) assays in a large number of varieties. The SNP presence is consistent with a poor PCR performance observed for this assay along the tested varieties. The obtained data show that the Adh1 (70) assay used in the official CRL NK603 assay is unreliable. Based on our results from both the nucleotide stability study and the PCR performance test, we can conclude that the Adh1 (136) reference assay (T25 and Bt11 assays) as well as the tested high mobility group protein gene assay, which also form parts of CRL methods for quantification, are highly reliable. Despite the observed uniformity in the nucleotide sequence of the invertase gene assay, the PCR performance test reveals that this target sequence might occur in more than one copy. Finally, although currently not forming a part of official quantification methods, zein and SSIIb

Psychosocial and Quality of Life in Women Receiving the 21-Gene Recurrence Score Assay: The Impact of Decision Style in Women with Intermediate RS

International Nuclear Information System (INIS)

Sulayman, N.; Spellman, E.; Graves, K. D.; Peshkin, B. N.; Isaacs, C.; Schwartz, M. D.; O’Neill, S. C.

2012-01-01

Multigene assays such as the 21-gene recurrence score (RS) quantify risk for recurrence and potential benefit from chemotherapy in early-stage, ER+ breast cancers. Few studies have assessed the impact of testing on patient-reported outcomes such as cancer-related distress or quality of life. The few studies that have assessed these outcomes do not consider potential modifiers, such as the patients’ level of involvement in the treatment decision-making process. In the current study, 81 breast cancer patients who received the RS assay completed cross-sectional surveys. We used linear multiple regression to assess whether test result, decision-making role (passive versus shared/active), and their interaction contributed to current levels of distress, quality of life, and decisional conflict. There were no associations between these variables and test result or decision-making role. However, women who received an intermediate RS and took a passive role in their care reported higher-cancer-related distress and cancer worry and lower quality of life than those who took a shared or active role. These data should be confirmed in prospective samples, as these poorer outcomes could be amenable to intervention

Psychosocial and Quality of Life in Women Receiving the 21-Gene Recurrence Score Assay: The Impact of Decision Style in Women with Intermediate RS

Directory of Open Access Journals (Sweden)

Nadiyah Sulayman

2012-01-01

Full Text Available Multigene assays such as the 21-gene recurrence score (RS quantify risk for recurrence and potential benefit from chemotherapy in early-stage, ER+ breast cancers. Few studies have assessed the impact of testing on patient-reported outcomes such as cancer-related distress or quality of life. The few studies that have assessed these outcomes do not consider potential modifiers, such as the patients’ level of involvement in the treatment decision-making process. In the current study, 81 breast cancer patients who received the RS assay completed cross-sectional surveys. We used linear multiple regression to assess whether test result, decision-making role (passive versus shared/active, and their interaction contributed to current levels of distress, quality of life, and decisional conflict. There were no associations between these variables and test result or decision-making role. However, women who received an intermediate RS and took a passive role in their care reported higher-cancer-related distress and cancer worry and lower quality of life than those who took a shared or active role. These data should be confirmed in prospective samples, as these poorer outcomes could be amenable to intervention.

Protocols for screening antimicrobial peptides that influence virulence gene expression in Staphylococcus aureus

DEFF Research Database (Denmark)

Bojer, Martin Saxtorph; Baldry, Mara; Ingmer, Hanne

2017-01-01

Compounds that inhibit virulence gene expression in bacterial pathogens have received increasing interest as possible alternatives to the traditional antibiotic treatment of infections. For the human pathogen Staphylococcus aureus, we have developed two simple assays based on reporter gene fusions...... to central virulence genes that are easily applicable for screening various sources of natural and synthetic peptides for anti-virulence effects. The plate assay is qualitative but simultaneously assesses the effect of gradient concentrations of the investigated compound, whereas the liquid assay...... is quantitative and can be employed to address whether a compound is acting on the central quorum sensing regulatory system, agr, that controls a large number of virulence genes in S. aureus....

Development of a cell-based reporter assay for screening of inhibitors of hypoxia-inducible factor 2-induced gene expression.

Science.gov (United States)

Woldemichael, Girma M; Vasselli, James R; Gardella, Roberta S; McKee, Tawnya C; Linehan, W Marston; McMahon, James B

2006-09-01

Reporter cell lines have been developed for the identification of inhibitors of gene expression enhanced by hypoxia-inducible factor 2, which has been implicated as a transcription factor involved in the tumorigenesis of clear cell renal carcinoma. Stably transformed reporter clones of the human renal clear cell carcinoma cell line 786-O were generated by transfection or retroviral infection. Luciferase reporter expression in the vectors used was driven by either the natural human vascular endothelial growth factor (VEGF) promoter-enhancer or by the VEGF and the human endothelial nitric oxide synthase enhancers modulating minimal human cytomegalovirus promoter. Utility of the generated reporter cell lines was validated by introducing the von Hippel-Lindau protein complex and testing for reporter inducibility by hypoxia. The dynamic range in reporter activity under hypoxic stress was found to be at least 30- to 40-fold, with a signal-to-noise ratio of 60:1. Properties of the cell lines such as tolerance to up to 3% DMSO, signal stability with multiple in vitro passages, and utility in both 96- and 384-well plate formats indicated their suitability for use in a high-throughput screen. In addition, the potential use of these reporter lines in the evaluation of high-throughput screening hits in vivo in various mice models has been demonstrated.

Development of RNA-FISH Assay for Detection of Oncogenic FGFR3-TACC3 Fusion Genes in FFPE Samples.

Directory of Open Access Journals (Sweden)

Masahiro Kurobe

Full Text Available Oncogenic FGFR3-TACC3 fusions and FGFR3 mutations are target candidates for small molecule inhibitors in bladder cancer (BC. Because FGFR3 and TACC3 genes are located very closely on chromosome 4p16.3, detection of the fusion by DNA-FISH (fluorescent in situ hybridization is not a feasible option. In this study, we developed a novel RNA-FISH assay using branched DNA probe to detect FGFR3-TACC3 fusions in formaldehyde-fixed paraffin-embedded (FFPE human BC samples.The RNA-FISH assay was developed and validated using a mouse xenograft model with human BC cell lines. Next, we assessed the consistency of the RNA-FISH assay using 104 human BC samples. In this study, primary BC tissues were stored as frozen and FFPE tissues. FGFR3-TACC3 fusions were independently detected in FFPE sections by the RNA-FISH assay and in frozen tissues by RT-PCR. We also analyzed the presence of FGFR3 mutations by targeted sequencing of genomic DNA extracted from deparaffinized FFPE sections.FGFR3-TACC3 fusion transcripts were identified by RNA-FISH and RT-PCR in mouse xenograft FFPE tissues using the human BC cell lines RT112 and RT4. These cell lines have been reported to be fusion-positive. Signals for FGFR3-TACC3 fusions by RNA-FISH were positive in 2/60 (3% of non-muscle-invasive BC (NMIBC and 2/44 (5% muscle-invasive BC (MIBC patients. The results of RT-PCR of all 104 patients were identical to those of RNA-FISH. FGFR3 mutations were detected in 27/60 (45% NMIBC and 8/44 (18% MIBC patients. Except for one NMIBC patient, FGFR3 mutation and FGFR3-TACC3 fusion were mutually exclusive.We developed an RNA-FISH assay for detection of the FGFR3-TACC3 fusion in FFPE samples of human BC tissues. Screening for not only FGFR3 mutations, but also for FGFR3-TACC3 fusion transcripts has the potential to identify additional patients that can be treated with FGFR inhibitors.

Comparative Evaluation of the Diagnostic Performance of the Prototype Cepheid GeneXpert Ebola Assay

Science.gov (United States)

Jansen van Vuren, Petrus; Grobbelaar, Antoinette; Storm, Nadia; Conteh, Ousman; Konneh, Kelfala; Kamara, Abdul; Sanne, Ian

2015-01-01

The Ebola virus disease (EVD) outbreak in West Africa has highlighted an urgent need for point-of-care (POC) assays for the diagnosis of this devastating disease in resource-limited African countries. The diagnostic performance characteristics of a prototype Cepheid GeneXpert Ebola POC used to detect Ebola virus (EBOV) in stored serum and plasma samples collected from suspected EVD cases in Sierra Leone in 2014 and 2015 was evaluated. The GeneXpert Ebola POC is a self-contained single-cartridge automated system that targets the glycoprotein (GP) and nucleoprotein (NP) genes of EBOV and yields results within 90 min. Results from 281 patient samples were compared to the results of a TaqMan real-time reverse transcription-PCR (RT-PCR) targeting the polymerase gene and performed on two real-time PCR machines. Agreement between the three platforms was 100% at cycle threshold (CT) values of ≤34.99, but discordant results were noted between CT values of 35 and 45.The diagnostic sensitivity of the three platforms was 100% in 91 patient samples that were confirmed to be infectious by virus isolation. All three molecular platforms detected viral EBOV RNA in additional samples that did not contain viable EBOV. The analytical sensitivity of the GeneXpert Ebola POC for the detection of NP was higher, and comparable to that of polymerase gene detection, than that for the detection of GP when using a titrated laboratory stock of EBOV. There was no detectable cross-reactivity with other hemorrhagic fever viruses or arboviruses. The GeneXpert Ebola POC offers an easy to operate and sensitive diagnostic tool that can be used for the rapid screening of suspected EVD cases in treatment or in holding centers during EVD outbreaks. PMID:26637383

Chromosome aberration assays in barley (Hordeum vulgare)

Energy Technology Data Exchange (ETDEWEB)

Constantin, M J [Univ. of Tennessee, Knoxville; Nilan, R A

1982-01-01

Barley is an exceellent organism for studies of induced chromosome aberrations because of its few (2n = 2x = 14) relatively large chromosomes. Root-tip and shoot-tip cells have been used extensively for the study of ionizing radiation-induced chromosome aberrations. The general procedures are well known, the technology is simple and easy to learn, and the assays are relatively quick and inexpensive. Both root tips and shoot tips can be used for the study of chemical mutagens as well as ionizing radiations. Pollen mother cells are well suited for studying the effects of mutagens on meiotic chromosomes. The literature review for the Gene-Tox Program reported on 61 chemicals tested for their effects on barley chromosomes. Of these, 90% were reported to be either positive or positive dose-related, while 7% were negative and 3% were questionable. Barley assays based on chromosomal aberrations are useful to detect the clastogenic potency of chemicals under laboratory conditions. Indications are that the data from barley can be used to corroborate data obtained from other organisms. Among the classes of chemicals assayed were: alcohols and phenols; alkaloids; epoxides; alkyl sulfates; amides and sulfonamides; aromatic amines; aryl halides; aziridines; alkenes; carbamates; hydroazides; nitroaromatics; nitrosamides; nitrosources; phenothiazines; and polycyclic aromatic hydrocarbons.

Development of the 5-HT2CR-Tango System Combined with an EGFP Reporter Gene.

Science.gov (United States)

Watanabe, Yoshihisa; Tsujimura, Atsushi; Aoki, Miku; Taguchi, Katsutoshi; Tanaka, Masaki

2016-02-01

The serotonin 2C receptor (5-HT2CR) is a G-protein-coupled receptor implicated in emotion, feeding, reward, and cognition. 5-HT2CRs are pharmacological targets for mental disorders and metabolic and reward system abnormalities, as alterations in 5-HT2CR expression, RNA editing, and SNPs are involved in these disturbances. To date, 5-HT2CR activity has mainly been measured by quantifying inositol phosphate production and intracellular Ca(2+) release, but these assays are not suitable for in vivo analysis. Here, we developed a 5-HT2CR-Tango assay system, a novel analysis tool of 5-HT2CR activity based on the G-protein-coupled receptor (GPCR)-arrestin interaction. With desensitization of activated 5-HT2CR by arrestin, this system converts the 5-HT2CR-arrestin interaction into EGFP reporter gene signal via the LexA transcriptional activation system. For validation of our system, we measured activity of two 5-HT2CR RNA-editing isoforms (INI and VGV) in HEK293 cells transfected with EGFP reporter gene. The INI isoform displayed both higher basal- and 5-HT-stimulated activities than the VGV isoform. Moreover, an inhibitory effect of 5-HT2CR antagonist SB242084 was also detected by 5-HT2CR-Tango system. This novel tool is useful for in vitro high-throughput targeted 5-HT2CR drug screening and can be applied to future in vivo brain function studies associated with 5-HT2CRs in transgenic animal models.

Evaluation of a 5-tier scheme proposed for classification of sequence variants using bioinformatic and splicing assay data

DEFF Research Database (Denmark)

Walker, Logan C; Whiley, Phillip J; Houdayer, Claude

2013-01-01

BRCA1 and 176 BRCA2 unique variants, from 77 publications. At least six independent reviewers from research and/or clinical settings comprehensively examined splicing assay methods and data reported for 22 variant assays of 21 variants in four publications, and classified the variants using the 5-tier......Splicing assays are commonly undertaken in the clinical setting to assess the clinical relevance of sequence variants in disease predisposition genes. A 5-tier classification system incorporating both bioinformatic and splicing assay information was previously proposed as a method to provide...... of results, and the lack of quantitative data for the aberrant transcripts. We propose suggestions for minimum reporting guidelines for splicing assays, and improvements to the 5-tier splicing classification system to allow future evaluation of its performance as a clinical tool....

Evaluation of a multiple-cycle, recombinant virus, growth competition assay that uses flow cytometry to measure replication efficiency of human immunodeficiency virus type 1 in cell culture.

Science.gov (United States)

Dykes, Carrie; Wang, Jiong; Jin, Xia; Planelles, Vicente; An, Dong Sung; Tallo, Amanda; Huang, Yangxin; Wu, Hulin; Demeter, Lisa M

2006-06-01

Human immunodeficiency virus type 1 (HIV-1) replication efficiency or fitness, as measured in cell culture, has been postulated to correlate with clinical outcome of HIV infection, although this is still controversial. One limitation is the lack of high-throughput assays that can measure replication efficiency over multiple rounds of replication. We have developed a multiple-cycle growth competition assay to measure HIV-1 replication efficiency that uses flow cytometry to determine the relative proportions of test and reference viruses, each of which expresses a different reporter gene in place of nef. The reporter genes are expressed on the surface of infected cells and are detected by commercially available fluorescence-labeled antibodies. This method is less labor-intensive than those that require isolation and amplification of nucleic acids. The two reporter gene products are detected with similar specificity and sensitivity, and the proportion of infected cells in culture correlates with the amount of viral p24 antigen produced in the culture supernatant. HIV replication efficiencies of six different drug-resistant site-directed mutants were reproducibly quantified and were similar to those obtained with a growth competition assay in which the relative proportion of each variant was measured by sequence analysis, indicating that recombination between the pol and reporter genes was negligible. This assay also reproducibly quantified the relative fitness conferred by protease and reverse transcriptase sequences containing multiple drug resistance mutations, amplified from patient plasma. This flow cytometry-based growth competition assay offers advantages over current assays for HIV replication efficiency and should prove useful for the evaluation of patient samples in clinical trials.

A novel data mining method to identify assay-specific signatures in functional genomic studies

Directory of Open Access Journals (Sweden)

Guidarelli Jack W

2006-08-01

Full Text Available Abstract Background: The highly dimensional data produced by functional genomic (FG studies makes it difficult to visualize relationships between gene products and experimental conditions (i.e., assays. Although dimensionality reduction methods such as principal component analysis (PCA have been very useful, their application to identify assay-specific signatures has been limited by the lack of appropriate methodologies. This article proposes a new and powerful PCA-based method for the identification of assay-specific gene signatures in FG studies. Results: The proposed method (PM is unique for several reasons. First, it is the only one, to our knowledge, that uses gene contribution, a product of the loading and expression level, to obtain assay signatures. The PM develops and exploits two types of assay-specific contribution plots, which are new to the application of PCA in the FG area. The first type plots the assay-specific gene contribution against the given order of the genes and reveals variations in distribution between assay-specific gene signatures as well as outliers within assay groups indicating the degree of importance of the most dominant genes. The second type plots the contribution of each gene in ascending or descending order against a constantly increasing index. This type of plots reveals assay-specific gene signatures defined by the inflection points in the curve. In addition, sharp regions within the signature define the genes that contribute the most to the signature. We proposed and used the curvature as an appropriate metric to characterize these sharp regions, thus identifying the subset of genes contributing the most to the signature. Finally, the PM uses the full dataset to determine the final gene signature, thus eliminating the chance of gene exclusion by poor screening in earlier steps. The strengths of the PM are demonstrated using a simulation study, and two studies of real DNA microarray data – a study of

Single-cell multiple gene expression analysis based on single-molecule-detection microarray assay for multi-DNA determination

Energy Technology Data Exchange (ETDEWEB)

Li, Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Xianwei [School of Life Sciences, Shandong University, Jinan 250100 (China); Zhang, Xiaoli [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin, Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

2015-01-07

Highlights: • A single-molecule-detection (SMD) microarray for 10 samples is fabricated. • The based-SMD microarray assay (SMA) can determine 8 DNAs for each sample. • The limit of detection of SMA is as low as 1.3 × 10{sup −16} mol L{sup −1}. • The SMA can be applied in single-cell multiple gene expression analysis. - Abstract: We report a novel ultra-sensitive and high-selective single-molecule-detection microarray assay (SMA) for multiple DNA determination. In the SMA, a capture DNA (DNAc) microarray consisting of 10 subarrays with 9 spots for each subarray is fabricated on a silanized glass coverslip as the substrate. On the subarrays, the spot-to-spot spacing is 500 μm and each spot has a diameter of ∼300 μm. The sequence of the DNAcs on the 9 spots of a subarray is different, to determine 8 types of target DNAs (DNAts). Thus, 8 types of DNAts are captured to their complementary DNAcs at 8 spots of a subarray, respectively, and then labeled with quantum dots (QDs) attached to 8 types of detection DNAs (DNAds) with different sequences. The ninth spot is used to detect the blank value. In order to determine the same 8 types of DNAts in 10 samples, the 10 DNAc-modified subarrays on the microarray are identical. Fluorescence single-molecule images of the QD-labeled DNAts on each spot of the subarray are acquired using a home-made single-molecule microarray reader. The amounts of the DNAts are quantified by counting the bright dots from the QDs. For a microarray, 8 types of DNAts in 10 samples can be quantified in parallel. The limit of detection of the SMA for DNA determination is as low as 1.3 × 10{sup −16} mol L{sup −1}. The SMA for multi-DNA determination can also be applied in single-cell multiple gene expression analysis through quantification of complementary DNAs (cDNAs) corresponding to multiple messenger RNAs (mRNAs) in single cells. To do so, total RNA in single cells is extracted and reversely transcribed into their cDNAs. Three

Screening non-classical 21-hydroxylase gene deficiency from patients diagnosed as polycystic ovary syndrome by gene assay

Directory of Open Access Journals (Sweden)

Jie HU

2016-04-01

Full Text Available Objective 　To screen non-classical 21-hydroxylase deficiency (NC-21OHD from patients diagnosed as polycystic ovary syndrome (PCOS by gene assay. Methods 　Ninety-eight patients with PCOS were enrolled according to 2003 Rotterdam criteria from Department of Endocrinology, Tangdu Hospital of Fourth Military Medical University, and they were divided into three groups according to the modified Ferriman-Gallway (mF-G score as follows: group A with score 0-2; group B with score 3-5, and group C with score ≥6. Meanwhile, 30 healthy subjects from the Medical Center of the Hospital were recruited as control group. Peripheral blood of all subjects were collected for extracting DNA, the CYP21A2 gene were amplified by 5 pairs of specific primers, and then the PCR products were sequenced by Shanghai Sangon Co. The subjects would accept test for serum cortisol and adrenocorticotropic hormone (ACTH at 8:00am if their CYP21A2 was proved to be abnormal. Results 　Thirty subjects of control group had no any defects in CYP21A2, but 5 of 98 patients with PCOS were proved to be deficient in CYP21A2, and the genotypes were V281L/920-921insT (P1, V281L/I230M (P2, V281L/Normal (P3, P4, P5, respectively, and all of them were heterozygous mutations. The incidences of NC-21OHD in group C and B were 28.6% and 3.3%, respectively. Genotype P1 had been identified to belong to NC-21OHD, which was consistent with its clinical phenotype. All genotypes P3, P4 and P5 belonged to carriers. But for P2, since I230M hadn't been reported in literature, the patient with V281L/I230M couldn't be classified now. Serum biochemical results showed that only in P1 the cortisol was close to the normal lower level, and ACTH was close to the normal upper limit of the reported level in the literature, and the remainders were all normal. Conclusions 　Although PCOS and NC-21OHD are very similar in clinical manifestations, they are different completely in the pathogenesis and treatment. So it

A locked nucleic acid (LNA-based real-time PCR assay for the rapid detection of multiple bacterial antibiotic resistance genes directly from positive blood culture.

Directory of Open Access Journals (Sweden)

Lingxiang Zhu

Full Text Available Bacterial strains resistant to various antibiotic drugs are frequently encountered in clinical infections, and the rapid identification of drug-resistant strains is highly essential for clinical treatment. We developed a locked nucleic acid (LNA-based quantitative real-time PCR (LNA-qPCR method for the rapid detection of 13 antibiotic resistance genes and successfully used it to distinguish drug-resistant bacterial strains from positive blood culture samples. A sequence-specific primer-probe set was designed, and the specificity of the assays was assessed using 27 ATCC bacterial strains and 77 negative blood culture samples. No cross-reaction was identified among bacterial strains and in negative samples, indicating 100% specificity. The sensitivity of the assays was determined by spiking each bacterial strain into negative blood samples, and the detection limit was 1-10 colony forming units (CFU per reaction. The LNA-qPCR assays were first applied to 72 clinical bacterial isolates for the identification of known drug resistance genes, and the results were verified by the direct sequencing of PCR products. Finally, the LNA-qPCR assays were used for the detection in 47 positive blood culture samples, 19 of which (40.4% were positive for antibiotic resistance genes, showing 91.5% consistency with phenotypic susceptibility results. In conclusion, LNA-qPCR is a reliable method for the rapid detection of bacterial antibiotic resistance genes and can be used as a supplement to phenotypic susceptibility testing for the early detection of antimicrobial resistance to allow the selection of appropriate antimicrobial treatment and to prevent the spread of resistant isolates.

Variations in CCL3L gene cluster sequence and non-specific gene copy numbers

Directory of Open Access Journals (Sweden)

Edberg Jeffrey C

2010-03-01

Full Text Available Abstract Background Copy number variations (CNVs of the gene CC chemokine ligand 3-like1 (CCL3L1 have been implicated in HIV-1 susceptibility, but the association has been inconsistent. CCL3L1 shares homology with a cluster of genes localized to chromosome 17q12, namely CCL3, CCL3L2, and, CCL3L3. These genes are involved in host defense and inflammatory processes. Several CNV assays have been developed for the CCL3L1 gene. Findings Through pairwise and multiple alignments of these genes, we have shown that the homology between these genes ranges from 50% to 99% in complete gene sequences and from 70-100% in the exonic regions, with CCL3L1 and CCL3L3 being identical. By use of MEGA 4 and BioEdit, we aligned sense primers, anti-sense primers, and probes used in several previously described assays against pre-multiple alignments of all four chemokine genes. Each set of probes and primers aligned and matched with overlapping sequences in at least two of the four genes, indicating that previously utilized RT-PCR based CNV assays are not specific for only CCL3L1. The four available assays measured median copies of 2 and 3-4 in European and African American, respectively. The concordance between the assays ranged from 0.44-0.83 suggesting individual discordant calls and inconsistencies with the assays from the expected gene coverage from the known sequence. Conclusions This indicates that some of the inconsistencies in the association studies could be due to assays that provide heterogenous results. Sequence information to determine CNV of the three genes separately would allow to test whether their association with the pathogenesis of a human disease or phenotype is affected by an individual gene or by a combination of these genes.

Protective effects of the exopolysaccharide Lasiodiplodan against DNA damage and inflammation induced by doxorubicin in rats: Cytogenetic and gene expression assays

International Nuclear Information System (INIS)

Mello, M.B.; Machado, C.S.; Ribeiro, D.L.; Aissa, A.F.; Burim, R.V.; Alves da Cunha, M.A.; Barcelos, G.R.M.

2017-01-01

The lasiodiplodan (LS) is a β-(1 → 6)-D-glucan produced by the fungus Lasiodiplodia theobromae and some of the biological activities of LS were reported as hypoglycemic, anticoagulant, anti-proliferative and anticancer action; however, its effects on DNA instability and modulation of gene expression are still unclear. Aims of study were investigate the genotoxic effects of lasiodiplodan, and its protective activity against DNA damage induced by doxorubicin (DXR) and its impact on the expression of genes associated with DNA damage and inflammatory response pathways. Therefore, Wistar rats were treated (15 days) orally with LS (5.0; 10 and 20 mg/kg bw) alone and in combination with DXR (15 mg/kg bw; administrated intraperitoneally on 14th day) as well as their respective controls: distilled water and DXR. Monitoring of DNA damage was assessed by comet and micronucleus (MN) assays and gene expression was evaluated by PCR-Arrays. Treatments with LS alone did not induce disturbances on DNA; when LS was given in combination with DXR, comet and MN formations were reduced to those found in the respective controls. Moreover, LS was able to reduce the disturbances on gene expressions induced by DXR treatment, since the animals that receive LS associated with DXR showed no alteration in the expression of genes related to DNA damage response. Also, DXR induced several up- and down-regulation of several genes associated to inflammatory process, while the animals that received LS + DXR had their gene expression patterns similar to those found in the control group. In conclusion, our results showed that LS did not induce disturbances on DNA stability and significantly reduce the DNA damage and inflammation caused by DXR exposure. In addition, we give further information concerning the molecular mechanisms associated to LS protective effects which seems to be a promising nutraceutical with chemopreventive potential.

A reverse transcriptase-PCR assay for detecting filarial infective larvae in mosquitoes.

Directory of Open Access Journals (Sweden)

Sandra J Laney

2008-06-01

Full Text Available Existing molecular assays for filarial parasite DNA in mosquitoes cannot distinguish between infected mosquitoes that contain any stage of the parasite and infective mosquitoes that harbor third stage larvae (L3 capable of establishing new infections in humans. We now report development of a molecular L3-detection assay for Brugia malayi in vectors based on RT-PCR detection of an L3-activated gene transcript.Candidate genes identified by bioinformatics analysis of EST datasets across the B. malayi life cycle were initially screened by PCR using cDNA libraries as templates. Stage-specificity was confirmed using RNA isolated from infected mosquitoes. Mosquitoes were collected daily for 14 days after feeding on microfilaremic cat blood. RT-PCR was performed with primer sets that were specific for individual candidate genes. Many promising candidates with strong expression in the L3 stage were excluded because of low-level transcription in less mature larvae. One transcript (TC8100, which encodes a particular form of collagen was only detected in mosquitoes that contained L3 larvae. This assay detects a single L3 in a pool of 25 mosquitoes.This L3-activated gene transcript, combined with a control transcript (tph-1, accession # U80971 that is constitutively expressed by all vector-stage filarial larvae, can be used to detect filarial infectivity in pools of mosquito vectors. This general approach (detection of stage-specific gene transcripts from eukaryotic pathogens may also be useful for detecting infective stages of other vector-borne parasites.

Luciferase assay to study the activity of a cloned promoter DNA fragment.

Science.gov (United States)

Solberg, Nina; Krauss, Stefan

2013-01-01

Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

A two-cassette reporter system for assessing target gene translation and target gene product inclusion body formation

DEFF Research Database (Denmark)

2016-01-01

The present invention relates to a dual cassette reporter system capable of assessing target gene translation and target gene product folding. The present invention further relates to vectors and host cells comprising the dual cassette reporter system. In addition the invention relates to the use...... of the dual cassette reporter system for assessing target gene translation and target gene product folding....

PET/CT imaging of human somatostatin receptor 2 (hsstr2) as reporter gene for gene therapy

International Nuclear Information System (INIS)

Hofmann, M.; Gazdhar, A.; Weitzel, T.; Schmid, R.; Krause, T.

2006-01-01

Localized information on region-selective gene expression in small animals is widely obtained by use of reporter genes inducing light emission. Using these reporter genes for imaging deep inside the human body fluorescent probes are hindered by attenuation, scattering and possible fluorescence quenching. This can be overcome by use of radio-peptide receptors as reporter genes. Therefore, the feasibility of the somatostatin receptor 2 expression vector system for expression imaging was checked against a control vector containing luciferase gene. For in vivo transduction of vector DNA into the rat forelimb muscles the in vivo electroporation technique was chosen because of its high regio-selectivity. The gene expression was imaged by high-sensitive CCD camera (luciferase activity) and by PET/CT using a Ga-68-DOTATOC as radio peptide probe. The relative sstr2 expression was enhanced by gene transduction at maximum to a factor of 15. The PET/CT images could be fully quantified. The above demonstrated feasibility of radio-peptide PET/CT reporter gene imaging may serve in the future as a tool for full quantitative understanding of regional gene expression, especially in large animals and humans

PET/CT imaging of human somatostatin receptor 2 (hsstr2) as reporter gene for gene therapy

Energy Technology Data Exchange (ETDEWEB)

Hofmann, M. [Molecular Imaging and Therapy Group (MIT-Bern), Clinic of Nuclear Medicine, Inselspital, Medical School Bern (Switzerland)]. E-mail: Michael.Hofmann@insel.ch; Gazdhar, A. [Division of Pulmonary Medicine, University Hospital Bern (Switzerland); Weitzel, T. [Molecular Imaging and Therapy Group (MIT-Bern), Clinic of Nuclear Medicine, Inselspital, Medical School Bern (Switzerland); Schmid, R. [Division of Thoracic Surgery, University Hospital Bern (Switzerland); Krause, T. [Molecular Imaging and Therapy Group (MIT-Bern), Clinic of Nuclear Medicine, Inselspital, Medical School Bern (Switzerland)

2006-12-20

Localized information on region-selective gene expression in small animals is widely obtained by use of reporter genes inducing light emission. Using these reporter genes for imaging deep inside the human body fluorescent probes are hindered by attenuation, scattering and possible fluorescence quenching. This can be overcome by use of radio-peptide receptors as reporter genes. Therefore, the feasibility of the somatostatin receptor 2 expression vector system for expression imaging was checked against a control vector containing luciferase gene. For in vivo transduction of vector DNA into the rat forelimb muscles the in vivo electroporation technique was chosen because of its high regio-selectivity. The gene expression was imaged by high-sensitive CCD camera (luciferase activity) and by PET/CT using a Ga-68-DOTATOC as radio peptide probe. The relative sstr2 expression was enhanced by gene transduction at maximum to a factor of 15. The PET/CT images could be fully quantified. The above demonstrated feasibility of radio-peptide PET/CT reporter gene imaging may serve in the future as a tool for full quantitative understanding of regional gene expression, especially in large animals and human000.

Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

Science.gov (United States)

Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L

2015-03-01

Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.

Dissecting miRNA gene repression on single cell level with an advanced fluorescent reporter system

Science.gov (United States)

Lemus-Diaz, Nicolas; Böker, Kai O.; Rodriguez-Polo, Ignacio; Mitter, Michael; Preis, Jasmin; Arlt, Maximilian; Gruber, Jens

2017-01-01

Despite major advances on miRNA profiling and target predictions, functional readouts for endogenous miRNAs are limited and frequently lead to contradicting conclusions. Numerous approaches including functional high-throughput and miRISC complex evaluations suggest that the functional miRNAome differs from the predictions based on quantitative sRNA profiling. To resolve the apparent contradiction of expression versus function, we generated and applied a fluorescence reporter gene assay enabling single cell analysis. This approach integrates and adapts a mathematical model for miRNA-driven gene repression. This model predicts three distinct miRNA-groups with unique repression activities (low, mid and high) governed not just by expression levels but also by miRNA/target-binding capability. Here, we demonstrate the feasibility of the system by applying controlled concentrations of synthetic siRNAs and in parallel, altering target-binding capability on corresponding reporter-constructs. Furthermore, we compared miRNA-profiles with the modeled predictions of 29 individual candidates. We demonstrate that expression levels only partially reflect the miRNA function, fitting to the model-projected groups of different activities. Furthermore, we demonstrate that subcellular localization of miRNAs impacts functionality. Our results imply that miRNA profiling alone cannot define their repression activity. The gene regulatory function is a dynamic and complex process beyond a minimalistic conception of “highly expressed equals high repression”. PMID:28338079

Real-time PCR detection of Fe-type nitrile hydratase genes from environmental isolates suggests horizontal gene transfer between multiple genera.

Science.gov (United States)

Coffey, Lee; Owens, Erica; Tambling, Karen; O'Neill, David; O'Connor, Laura; O'Reilly, Catherine

2010-11-01

Nitriles are widespread in the environment as a result of biological and industrial activity. Nitrile hydratases catalyse the hydration of nitriles to the corresponding amide and are often associated with amidases, which catalyze the conversion of amides to the corresponding acids. Nitrile hydratases have potential as biocatalysts in bioremediation and biotransformation applications, and several successful examples demonstrate the advantages. In this work a real-time PCR assay was designed for the detection of Fe-type nitrile hydratase genes from environmental isolates purified from nitrile-enriched soils and seaweeds. Specific PCR primers were also designed for amplification and sequencing of the genes. Identical or highly homologous nitrile hydratase genes were detected from isolates of numerous genera from geographically diverse sites, as were numerous novel genes. The genes were also detected from isolates of genera not previously reported to harbour nitrile hydratases. The results provide further evidence that many bacteria have acquired the genes via horizontal gene transfer. The real-time PCR assay should prove useful in searching for nitrile hydratases that could have novel substrate specificities and therefore potential in industrial applications.

Comparison of Five Assays for Detection of Clostridium difficile Toxin

Science.gov (United States)

Chapin, Kimberle C.; Dickenson, Roberta A.; Wu, Fongman; Andrea, Sarah B.

2011-01-01

Performance characteristics of five assays for detection of Clostridium difficile toxin were compared using fresh stool samples from patients with C. difficile infection (CDI). Assays were performed simultaneously and according to the manufacturers' instructions. Patients were included in the study if they exhibited clinical symptoms consistent with CDI. Nonmolecular assays included glutamate dehydrogenase antigen tests, with positive findings followed by the Premier Toxin A and B Enzyme Immunoassay (GDH/EIA), and the C. Diff Quik Chek Complete test. Molecular assays (PCR) included the BD GeneOhm Cdiff Assay, the Xpert C. difficile test, and the ProGastro Cd assay. Specimens were considered true positive if results were positive in two or more assays. For each method, the Youden index was calculated and cost-effectiveness was analyzed. Of 81 patients evaluated, 26 (32.1%) were positive for CDI. Sensitivity of the BD GeneOhm Cdiff assay, the Xpert C. difficile test, the ProGastro Cd assay, C. Diff Quik Chek Complete test, and two-step GDH/EIA was 96.2%, 96.2%, 88.5%, 61.5%, and 42.3%, respectively. Specificity of the Xpert C. difficile test was 96.4%, and for the other four assays was 100%. Compared with nonmolecular methods, molecular methods detected 34.7% more positive specimens. Assessment of performance characteristics and cost-effectiveness demonstrated that the BD GeneOhm Cdiff assay yielded the best results. While costly, the Xpert C. difficile test required limited processing and yielded rapid results. Because of discordant results, specimen processing, and extraction equipment requirements, the ProGastro Cd assay was the least favored molecular assay. The GDH/EIA method lacked sufficient sensitivity to be recommended. PMID:21704273

Authentication of beef, carabeef, chevon, mutton and pork by a PCR-RFLP assay of mitochondrial cytb gene

OpenAIRE

Kumar, Deepak; Singh, S. P.; Karabasanavar, Nagappa S.; Singh, Rashmi; Umapathi, V.

2012-01-01

Authentication of meat assumes significance in view of religious, quality assurance, food safety, public health, conservation and legal concerns. Here, we describe a PCR-RFLP (Polymerase Chain Reaction- Restriction Fragment Length Polymorphism) assay targeting mitochondrial cytochrome-b gene for the identification of meats of five most common food animals namely cattle, buffalo, goat, sheep and pig. A pair of forward and reverse primers (VPH-F & VPH-R) amplifying a conserved region (168–776 b...

Real-time multiplex PCR assay for detection of Yersinia pestis and Yersinia pseudotuberculosis.

Science.gov (United States)

Matero, Pirjo; Pasanen, Tanja; Laukkanen, Riikka; Tissari, Päivi; Tarkka, Eveliina; Vaara, Martti; Skurnik, Mikael

2009-01-01

A multiplex real-time polymerase chain reaction (PCR) assay was developed for the detection of Yersinia pestis and Yersinia pseudotuberculosis. The assay includes four primer pairs, two of which are specific for Y. pestis, one for Y. pestis and Y. pseudotuberculosis and one for bacteriophage lambda; the latter was used as an internal amplification control. The Y. pestis-specific target genes in the assay were ypo2088, a gene coding for a putative methyltransferase, and the pla gene coding for the plasminogen activator. In addition, the wzz gene was used as a target to specifically identify both Y. pestis and the closely related Y. pseudotuberculosis group. The primer and probe sets described for the different genes can be used either in single or in multiplex PCR assays because the individual probes were designed with different fluorochromes. The assays were found to be both sensitive and specific; the lower limit of the detection was 10-100 fg of extracted Y. pestis or Y. pseudotuberculosis total DNA. The sensitivity of the tetraplex assay was determined to be 1 cfu for the ypo2088 and pla probe labelled with FAM and JOE fluorescent dyes, respectively.

A FRET-based high throughput screening assay to identify inhibitors of anthrax protective antigen binding to capillary morphogenesis gene 2 protein.

Directory of Open Access Journals (Sweden)

Michael S Rogers

Full Text Available Anti-angiogenic therapies are effective for the treatment of cancer, a variety of ocular diseases, and have potential benefits in cardiovascular disease, arthritis, and psoriasis. We have previously shown that anthrax protective antigen (PA, a non-pathogenic component of anthrax toxin, is an inhibitor of angiogenesis, apparently as a result of interaction with the cell surface receptors capillary morphogenesis gene 2 (CMG2 protein and tumor endothelial marker 8 (TEM8. Hence, molecules that bind the anthrax toxin receptors may be effective to slow or halt pathological vascular growth. Here we describe development and testing of an effective homogeneous steady-state fluorescence resonance energy transfer (FRET high throughput screening assay designed to identify molecules that inhibit binding of PA to CMG2. Molecules identified in the screen can serve as potential lead compounds for the development of anti-angiogenic and anti-anthrax therapies. The assay to screen for inhibitors of this protein-protein interaction is sensitive and robust, with observed Z' values as high as 0.92. Preliminary screens conducted with a library of known bioactive compounds identified tannic acid and cisplatin as inhibitors of the PA-CMG2 interaction. We have confirmed that tannic acid both binds CMG2 and has anti-endothelial properties. In contrast, cisplatin appears to inhibit PA-CMG2 interaction by binding both PA and CMG2, and observed cisplatin anti-angiogenic effects are not mediated by interaction with CMG2. This work represents the first reported high throughput screening assay targeting CMG2 to identify possible inhibitors of both angiogenesis and anthrax intoxication.

Development and accuracy of quantitative real-time polymerase chain reaction assays for detection and quantification of enterotoxigenic Escherichia coli (ETEC) heat labile and heat stable toxin genes in travelers' diarrhea samples.

Science.gov (United States)

Youmans, Bonnie P; Ajami, Nadim J; Jiang, Zhi-Dong; Petrosino, Joseph F; DuPont, Herbert L; Highlander, Sarah K

2014-01-01

Enterotoxigenic Escherichia coli (ETEC), the leading bacterial pathogen of travelers' diarrhea, is routinely detected by an established DNA hybridization protocol that is neither sensitive nor quantitative. Quantitative real-time polymerase chain reaction (qPCR) assays that detect the ETEC toxin genes eltA, sta1, and sta2 in clinical stool samples were developed and tested using donor stool inoculated with known quantities of ETEC bacteria. The sensitivity of the qPCR assays is 89%, compared with 22% for the DNA hybridization assay, and the limits of detection are 10,000-fold lower than the DNA hybridization assays performed in parallel. Ninety-three clinical stool samples, previously characterized by DNA hybridization, were tested using the new ETEC qPCR assays. Discordant toxin profiles were observed for 22 samples, notably, four samples originally typed as ETEC negative were ETEC positive. The qPCR assays are unique in their sensitivity and ability to quantify the three toxin genes in clinical stool samples.

The loss-of-allele assay for ES cell screening and mouse genotyping.

Science.gov (United States)

Frendewey, David; Chernomorsky, Rostislav; Esau, Lakeisha; Om, Jinsop; Xue, Yingzi; Murphy, Andrew J; Yancopoulos, George D; Valenzuela, David M

2010-01-01

Targeting vectors used to create directed mutations in mouse embryonic stem (ES) cells consist, in their simplest form, of a gene for drug selection flanked by mouse genomic sequences, the so-called homology arms that promote site-directed homologous recombination between the vector and the target gene. The VelociGene method for the creation of targeted mutations in ES cells employs targeting vectors, called BACVecs, that are based on bacterial artificial chromosomes. Compared with conventional short targeting vectors, BacVecs provide two major advantages: (1) their much larger homology arms promote high targeting efficiencies without the need for isogenicity or negative selection strategies; and (2) they enable deletions and insertions of up to 100kb in a single targeting event, making possible gene-ablating definitive null alleles and other large-scale genomic modifications. Because of their large arm sizes, however, BACVecs do not permit screening by conventional assays, such as long-range PCR or Southern blotting, that link the inserted targeting vector to the targeted locus. To exploit the advantages of BACVecs for gene targeting, we inverted the conventional screening logic in developing the loss-of-allele (LOA) assay, which quantifies the number of copies of the native locus to which the mutation was directed. In a correctly targeted ES cell clone, the LOA assay detects one of the two native alleles (for genes not on the X or Y chromosome), the other allele being disrupted by the targeted modification. We apply the same principle in reverse as a gain-of-allele assay to quantify the copy number of the inserted targeting vector. The LOA assay reveals a correctly targeted clone as having lost one copy of the native target gene and gained one copy of the drug resistance gene or other inserted marker. The combination of these quantitative assays makes LOA genotyping unequivocal and amenable to automated scoring. We use the quantitative polymerase chain reaction

Recombinant carcinoembryonic antigen as a reporter gene for molecular imaging

International Nuclear Information System (INIS)

Kenanova, Vania; Barat, Bhaswati; Olafsen, Tove; Chatziioannou, Arion; Herschman, Harvey R.; Wu, Anna M.; Braun, Jonathan

2009-01-01

Reporter genes can provide a way of noninvasively assessing gene activity in vivo. However, current reporter gene strategies may be limited by the immunogenicity of foreign reporter proteins, endogenous expression, or unwanted biological activity. We have developed a reporter gene based on carcinoembryonic antigen (CEA), a human protein with limited normal tissue expression. To construct a CEA reporter gene for PET, a CEA minigene (N-A3) was fused to the extracellular and transmembrane domains of the human FcγRIIb receptor. The NA3-FcγRIIb recombinant gene, driven by a CMV promoter, was transfected in Jurkat (human T cell leukemia) cells. Expression was analyzed by flow cytometry, immunohistochemistry (IHC), and microPET imaging. Flow cytometry identified Jurkat clones stably expressing NA3-FcγRIIb at low, medium, and high levels. High and medium NA3-FcγRIIb expression could also be detected by Western blot. Reporter gene positive and negative Jurkat cells were used to establish xenografts in athymic mice. IHC showed staining of the tumor with high reporter gene expression; medium and low N-A3 expression was not detected. MicroPET imaging, using an anti-CEA 124 I-labeled single-chain Fv-Fc antibody fragment, demonstrated that only high N-A3 expression could be detected. Specific accumulation of activity was visualized at the N-A3 positive tumor as early as 4 h. MicroPET image quantitation showed tumor activity of 1.8 ± 0.2, 15.2 ± 1.3, and 4.6 ± 1.2 percent injected dose per gram (%ID/g) at 4, 20, and 48 h, respectively. Biodistribution at 48 h demonstrated tumor uptake of 4.8 ± 0.8%ID/g. The CEA N-A3 minigene has the potential to be used as a reporter gene for imaging cells in vivo. (orig.)

Comparison of five assays for detection of Clostridium difficile toxin.

Science.gov (United States)

Chapin, Kimberle C; Dickenson, Roberta A; Wu, Fongman; Andrea, Sarah B

2011-07-01

Performance characteristics of five assays for detection of Clostridium difficile toxin were compared using fresh stool samples from patients with C. difficile infection (CDI). Assays were performed simultaneously and according to the manufacturers' instructions. Patients were included in the study if they exhibited clinical symptoms consistent with CDI. Nonmolecular assays included glutamate dehydrogenase antigen tests, with positive findings followed by the Premier Toxin A and B Enzyme Immunoassay (GDH/EIA), and the C. Diff Quik Chek Complete test. Molecular assays (PCR) included the BD GeneOhm Cdiff Assay, the Xpert C. difficile test, and the ProGastro Cd assay. Specimens were considered true positive if results were positive in two or more assays. For each method, the Youden index was calculated and cost-effectiveness was analyzed. Of 81 patients evaluated, 26 (32.1%) were positive for CDI. Sensitivity of the BD GeneOhm Cdiff assay, the Xpert C. difficile test, the ProGastro Cd assay, C. Diff Quik Chek Complete test, and two-step GDH/EIA was 96.2%, 96.2%, 88.5%, 61.5%, and 42.3%, respectively. Specificity of the Xpert C. difficile test was 96.4%, and for the other four assays was 100%. Compared with nonmolecular methods, molecular methods detected 34.7% more positive specimens. Assessment of performance characteristics and cost-effectiveness demonstrated that the BD GeneOhm Cdiff assay yielded the best results. While costly, the Xpert C. difficile test required limited processing and yielded rapid results. Because of discordant results, specimen processing, and extraction equipment requirements, the ProGastro Cd assay was the least favored molecular assay. The GDH/EIA method lacked sufficient sensitivity to be recommended. Copyright © 2011 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Progress in hprt mutation assay and its application in radiation biology

International Nuclear Information System (INIS)

He Jing; Li Qiang

2008-01-01

hprt gene is an X-linked locus that has been well studied and widely used as a bio-marker in mutation detection, hprt mutation assay is a gene mutation test system in mammalian cells in vitro which has been used as a biological dosimeter. In this paper, the biological characteristics of hprt gene, hprt mutation detection methodology and the application of hprt mutation assay in radiation biology are comprehensively reviewed. (authors)

Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii

DEFF Research Database (Denmark)

Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida

2002-01-01

) PCR assay for detecting P. carinii f. sp. carinii, the subspecies of P. carinii commonly used in research models of PCP. The assay was based on the single-copy dihydrofolate reductase gene and was able to detect r = 0.99) over...... 6 log values for standards containing > or =5 copies/tube. Application of the assay to a series of 10-fold dilutions of P. carinii organisms isolated from rat lung demonstrated that it was reproducibly quantitative over 5 log values (r = 0.99). The assay was applied to a recently reported in vitro....... In conclusion, a rapid, sensitive, and reproducible quantitative PCR assay for P. carinii f. sp. carinii has been developed and is applicable to in vivo as well as in vitro systems. The assay should prove useful for conducting studies in which quantification of organism burden or growth assessment is critical...

Clinical validation of the Tempus xO assay

Science.gov (United States)

Beaubier, Nike; Tell, Robert; Huether, Robert; Bontrager, Martin; Bush, Stephen; Parsons, Jerod; Shah, Kaanan; Baker, Tim; Selkov, Gene; Taxter, Tim; Thomas, Amber; Bettis, Sam; Khan, Aly; Lau, Denise; Lee, Christina; Barber, Matthew; Cieslik, Marcin; Frankenberger, Casey; Franzen, Amy; Weiner, Ali; Palmer, Gary; Lonigro, Robert; Robinson, Dan; Wu, Yi-Mi; Cao, Xuhong; Lefkofsky, Eric; Chinnaiyan, Arul; White, Kevin P.

2018-01-01

We have developed a clinically validated NGS assay that includes tumor, germline and RNA sequencing. We apply this assay to clinical specimens and cell lines, and we demonstrate a clinical sensitivity of 98.4% and positive predictive value of 100% for the clinically actionable variants measured by the assay. We also demonstrate highly accurate copy number measurements and gene rearrangement identification. PMID:29899824

In vivo characterization of a reporter gene system for imaging hypoxia-induced gene expression.

Science.gov (United States)

Carlin, Sean; Pugachev, Andrei; Sun, Xiaorong; Burke, Sean; Claus, Filip; O'Donoghue, Joseph; Ling, C Clifton; Humm, John L

2009-10-01

To characterize a tumor model containing a hypoxia-inducible reporter gene and to demonstrate utility by comparison of reporter gene expression to the uptake and distribution of the hypoxia tracer (18)F-fluoromisonidazole ((18)F-FMISO). Three tumors derived from the rat prostate cancer cell line R3327-AT were grown in each of two rats as follows: (1) parental R3327-AT, (2) positive control R3327-AT/PC in which the HSV1-tkeGFP fusion reporter gene was expressed constitutively, (3) R3327-AT/HRE in which the reporter gene was placed under the control of a hypoxia-inducible factor-responsive promoter sequence (HRE). Animals were coadministered a hypoxia-specific marker (pimonidazole) and the reporter gene probe (124)I-2'-fluoro-2'-deoxy-1-beta-d-arabinofuranosyl-5-iodouracil ((124)I-FIAU) 3 h prior to sacrifice. Statistical analysis of the spatial association between (124)I-FIAU uptake and pimonidazole fluorescent staining intensity was then performed on a pixel-by-pixel basis. Utility of this system was demonstrated by assessment of reporter gene expression versus the exogenous hypoxia probe (18)F-FMISO. Two rats, each bearing a single R3327-AT/HRE tumor, were injected with (124)I-FIAU (3 h before sacrifice) and (18)F-FMISO (2 h before sacrifice). Statistical analysis of the spatial association between (18)F-FMISO and (124)I-FIAU on a pixel-by-pixel basis was performed. Correlation coefficients between (124)I-FIAU uptake and pimonidazole staining intensity were: 0.11 in R3327-AT tumors, -0.66 in R3327-AT/PC and 0.76 in R3327-AT/HRE, confirming that only in the R3327-AT/HRE tumor was HSV1-tkeGFP gene expression associated with hypoxia. Correlation coefficients between (18)F-FMISO and (124)I-FIAU uptakes in R3327-AT/HRE tumors were r=0.56, demonstrating good spatial correspondence between the two tracers. We have confirmed hypoxia-specific expression of the HSV1-tkeGFP fusion gene in the R3327-AT/HRE tumor model and demonstrated the utility of this model for the

In vivo characterization of a reporter gene system for imaging hypoxia-induced gene expression

International Nuclear Information System (INIS)

Carlin, Sean; Pugachev, Andrei; Sun Xiaorong; Burke, Sean; Claus, Filip; O'Donoghue, Joseph; Ling, C. Clifton; Humm, John L.

2009-01-01

Purpose: To characterize a tumor model containing a hypoxia-inducible reporter gene and to demonstrate utility by comparison of reporter gene expression to the uptake and distribution of the hypoxia tracer 18 F-fluoromisonidazole ( 18 F-FMISO). Methods: Three tumors derived from the rat prostate cancer cell line R3327-AT were grown in each of two rats as follows: (1) parental R3327-AT, (2) positive control R3327-AT/PC in which the HSV1-tkeGFP fusion reporter gene was expressed constitutively, (3) R3327-AT/HRE in which the reporter gene was placed under the control of a hypoxia-inducible factor-responsive promoter sequence (HRE). Animals were coadministered a hypoxia-specific marker (pimonidazole) and the reporter gene probe 124 I-2'-fluoro-2'-deoxy-1-β-D-arabinofuranosyl-5-iodouracil ( 124 I-FIAU) 3 h prior to sacrifice. Statistical analysis of the spatial association between 124 I-FIAU uptake and pimonidazole fluorescent staining intensity was then performed on a pixel-by-pixel basis. Utility of this system was demonstrated by assessment of reporter gene expression versus the exogenous hypoxia probe 18 F-FMISO. Two rats, each bearing a single R3327-AT/HRE tumor, were injected with 124 I-FIAU (3 h before sacrifice) and 18 F-FMISO (2 h before sacrifice). Statistical analysis of the spatial association between 18 F-FMISO and 124 I-FIAU on a pixel-by-pixel basis was performed. Results: Correlation coefficients between 124 I-FIAU uptake and pimonidazole staining intensity were: 0.11 in R3327-AT tumors, -0.66 in R3327-AT/PC and 0.76 in R3327-AT/HRE, confirming that only in the R3327-AT/HRE tumor was HSV1-tkeGFP gene expression associated with hypoxia. Correlation coefficients between 18 F-FMISO and 124 I-FIAU uptakes in R3327-AT/HRE tumors were r=0.56, demonstrating good spatial correspondence between the two tracers. Conclusions: We have confirmed hypoxia-specific expression of the HSV1-tkeGFP fusion gene in the R3327-AT/HRE tumor model and demonstrated the utility of

Development of functional genomic tools in trematodes: RNA interference and luciferase reporter gene activity in Fasciola hepatica.

Directory of Open Access Journals (Sweden)

Gabriel Rinaldi

2008-07-01

Full Text Available The growing availability of sequence information from diverse parasites through genomic and transcriptomic projects offer new opportunities for the identification of key mediators in the parasite-host interaction. Functional genomics approaches and methods for the manipulation of genes are essential tools for deciphering the roles of genes and to identify new intervention targets in parasites. Exciting advances in functional genomics for parasitic helminths are starting to occur, with transgene expression and RNA interference (RNAi reported in several species of nematodes, but the area is still in its infancy in flatworms, with reports in just three species. While advancing in model organisms, there is a need to rapidly extend these technologies to other parasites responsible for several chronic diseases of humans and cattle. In order to extend these approaches to less well studied parasitic worms, we developed a test method for the presence of a viable RNAi pathway by silencing the exogenous reporter gene, firefly luciferase (fLUC. We established the method in the human blood fluke Schistosoma mansoni and then confirmed its utility in the liver fluke Fasciola hepatica. We transformed newly excysted juveniles of F. hepatica by electroporation with mRNA of fLUC and three hours later were able to detect luciferase enzyme activity, concentrated mainly in the digestive ceca. Subsequently, we tested the presence of an active RNAi pathway in F. hepatica by knocking down the exogenous luciferase activity by introduction into the transformed parasites of double-stranded RNA (dsRNA specific for fLUC. In addition, we tested the RNAi pathway targeting an endogenous F. hepatica gene encoding leucine aminopeptidase (FhLAP, and observed a significant reduction in specific mRNA levels. In summary, these studies demonstrated the utility of RNAi targeting reporter fLUC as a reporter gene assay to establish the presence of an intact RNAi pathway in helminth

The progress of PET based reporter gene imaging

International Nuclear Information System (INIS)

Zhao Wei; Zhang Xiuli

2005-01-01

More than two decades of intense research have allowed gene therapy to move from the laboratory to the clinical setting, where its use for the treatment of human pathologies has been considerably increased in the last years. However, many crucial questions remain to be solved in this challenging field. In vivo imaging with positron emission tomography (PET) by combination of the appropriate PET reporter gene and PET reporter probe could provide invaluable qualitative and quantitative information to answer multiple unsolved questions about gene therapy. PET imaging could be used to define parameters not available by other techniques that are of substantial interest not only for the proper understanding of the gene therapy process, but also for its future development and clinical application in humans. (authors)

Evaluation of an hPXR reporter gene assay for the detection of aquatic emerging pollutants: screening of chemicals and application to water samples

Energy Technology Data Exchange (ETDEWEB)

Creusot, Nicolas; Kinani, Said; Maillot-Marechal, Emmanuelle; Porcher, Jean-Marc; Ait-Aissa, Selim [Unite Ecotoxicologie, INERIS, Verneuil-en-Halatte (France); Balaguer, Patrick [IRCM-UM1-CRLC Val d' Aurelle, INSERM U896, Montpellier (France); Tapie, Nathalie; LeMenach, Karyn; Budzinski, Helene [ISM/LPTC-UMR 5255 CNRS Universite Bordeaux 1, Talence (France)

2010-01-15

Many environmental endocrine-disrupting compounds act as ligands for nuclear receptors. Among these receptors, the human pregnane X receptor (hPXR) is well described as a xenobiotic sensor to various classes of chemicals, including pharmaceuticals, pesticides, and steroids. To assess the potential use of PXR as a sensor for aquatic emerging pollutants, we employed an in vitro reporter gene assay (HG5LN-hPXR cells) to screen a panel of environmental chemicals and to assess PXR-active chemicals in (waste) water samples. Of the 57 compounds tested, 37 were active in the bioassay and 10 were identified as new PXR agonists: triazin pesticides (promethryn, terbuthryn, terbutylazine), pharmaceuticals (fenofibrate, bezafibrate, clonazepam, medazepam) and non co-planar polychlorobiphenyls (PCBs; PCB101, 138, 180). Furthermore, we detected potent PXR activity in two types of water samples: passive polar organic compounds integrative sampler (POCIS) extracts from a river moderately impacted by agricultural and urban inputs and three effluents from sewage treatment works (STW). Fractionation of POCIS samples showed the highest PXR activity in the less polar fraction, while in the effluents, PXR activity was mainly associated with the dissolved water phase. Chemical analyses quantified several PXR-active substances (i.e., alkylphenols, hormones, pharmaceuticals, pesticides, PCBs, bisphenol A) in POCIS fractions and effluent extracts. However, mass-balance calculations showed that the analyzed compounds explained only 0.03% and 1.4% of biological activity measured in POCIS and STW samples, respectively. In effluents, bisphenol A and 4-tert-octylphenol were identified as main contributors of instrumentally derived PXR activities. Finally, the PXR bioassay provided complementary information as compared to estrogenic, androgenic, and dioxin-like activity measured in these samples. This study shows the usefulness of HG5LN-hPXR cells to detect PXR-active compounds in water samples

Identification of the major capsid protein of erythrocytic necrosis virus (ENV) and development of quantitative real-time PCR assays for quantification of ENV DNA

Science.gov (United States)

Purcell, Maureen K.; Pearman-Gillman, Schuyler; Thompson, Rachel L.; Gregg, Jacob L.; Hart, Lucas M.; Winton, James R.; Emmenegger, Eveline J.; Hershberger, Paul K.

2016-01-01

Viral erythrocytic necrosis (VEN) is a disease of marine and anadromous fish that is caused by the erythrocytic necrosis virus (ENV), which was recently identified as a novel member of family Iridoviridae by next-generation sequencing. Phylogenetic analysis of the ENV DNA polymerase grouped ENV with other erythrocytic iridoviruses from snakes and lizards. In the present study, we identified the gene encoding the ENV major capsid protein (MCP) and developed a quantitative real-time PCR (qPCR) assay targeting this gene. Phylogenetic analysis of the MCP gene sequence supported the conclusion that ENV does not group with any of the currently described iridovirus genera. Because there is no information regarding genetic variation of the MCP gene across the reported host and geographic range for ENV, we also developed a second qPCR assay for a more conserved ATPase-like gene region. The MCP and ATPase qPCR assays demonstrated good analytical and diagnostic sensitivity and specificity based on samples from laboratory challenges of Pacific herring Clupea pallasii. The qPCR assays had similar diagnostic sensitivity and specificity as light microscopy of stained blood smears for the presence of intraerythrocytic inclusion bodies. However, the qPCR assays may detect viral DNA early in infection prior to the formation of inclusion bodies. Both qPCR assays appear suitable for viral surveillance or as a confirmatory test for ENV in Pacific herring from the Salish Sea.

Advances of reporter gene imaging monitoring stem cell therapy

International Nuclear Information System (INIS)

Pei Zhijun; Zhang Yongxue

2010-01-01

Stem cell transplantation in the treatment of various tissue damage or degenerative diseases are research hotspots both at home and abroad. However, ignorance of the homing, differentiation and functional expression of the stem cell in vivo influence the further development of stem cell therapy. As an important component of molecular imaging technology, reporter gene imaging dynamically monitors the change of stem cell in vivo via monitoring the expression of transfected reporter gene. This paper briefly describes the latest research progress and the future development trend of the monitoring of reporter gene imaging in stem cell therapy in vivo. (authors)

A rapid and efficient branched DNA hybridization assay to titer lentiviral vectors.

Science.gov (United States)

Nair, Ayyappan; Xie, Jinger; Joshi, Sarasijam; Harden, Paul; Davies, Joan; Hermiston, Terry

2008-11-01

A robust assay to titer lentiviral vectors is imperative to qualifying their use in drug discovery, target validation and clinical applications. In this study, a novel branched DNA based hybridization assay was developed to titer lentiviral vectors by quantifying viral RNA genome copy numbers from viral lysates without having to purify viral RNA, and this approach was compared with other non-functional (p24 protein ELISA and viral RT-qPCR) and a functional method (reporter gene expression) used commonly. The RT-qPCR method requires purification of viral RNA and the accuracy of titration therefore depends on the efficiency of purification; this requirement is ameliorated in the hybridization assay as RNA is measured directly in viral lysates. The present study indicates that the hybridization based titration assay performed on viral lysates was more accurate and has additional advantages of being rapid, robust and not dependent on transduction efficiency in different cell types.

Serodiagnosis of Leishmania donovani infections: assessment of enzyme-linked immunosorbent assays using recombinant L. donovani gene B protein (GBP) and a peptide sequence of L. donovani GBP

DEFF Research Database (Denmark)

Jensen, A T; Gasim, S; Moller, T

1999-01-01

The repetitive sequence of Leishmania major gene B protein (GBP) has previously been shown to be a useful tool in the diagnosis of cutaneous leishmaniasis (CL). Here, we have assessed enzyme-linked immunosorbent assays (ELISAs) using recombinant L. donovani GBP (rGBP) and a peptide sequence of L...... for malaria but free of leishmaniasis was negative in both assays....

Telemetric Technologies for the Assay of Gene Expression

Science.gov (United States)

Paul, Anna-Lisa; Bamsey, Matthew; Berinstain, Alain; Neron, Philip; Graham, Thomas; Ferl, Robert

Telemetric data collection has been widely used in spaceflight applications where human participation is limited (orbital mission payloads) or unfeasible (planetary landers, satellites, and probes). The transmission of digital data from electronic sensors of typical environmental parameters, growth patterns and physical properties of materials is routine telemetry, and even the collection and transmission of deep space images is a standard tool of astrophysics. But telemetric imaging for current biological payloads has thus far been limited to the collection of standard white-light photography that is largely confined to reporting the surface characteristics of the specimens involved. Advances in imaging technologies that facilitate the collection of a variety of light wavelengths will expand the science return on biological payloads to include evaluations of the molecular genetic response of organisms to the spaceflight or extraterrestrial environment, with minimal or no human intervention. Advanced imaging technology in combination with biologically engineered sensor organisms can create a system that can report via telemetry on the patterns of gene expression required to adapt to a novel environment. The utilization of genetically engineered plants as biosensors has made elegant strides in the recent years, providing keen insights into the health of plants in general and particularly in the nature and cellular location of stress responses. Moreover, molecular responses to gravitational vectors have been elegantly analyzed with fluorescent tools. Green Fluorescence Protein (GFP) and other fluorophores have made it possible for analyses of gene expression and biological responses to occur telemetrically, with the information potentially delivered to the investigator over large distances as simple, preprocessed fluorescence images. Having previously deployed transgenic plant biosensors to evaluate responses to orbital spaceflight, we wish to develop both the plants

Cloning-free regulated monitoring of reporter and gene expression

Directory of Open Access Journals (Sweden)

Demirkaya Omer

2009-03-01

Full Text Available Abstract Background The majority of the promoters, their regulatory elements, and their variations in the human genome remain unknown. Reporter gene technology for transcriptional activity is a widely used tool for the study of promoter structure, gene regulation, and signaling pathways. Construction of transcriptional reporter vectors, including use of cis-acting sequences, requires cloning and time-demanding manipulations, particularly with introduced mutations. Results In this report, we describe a cloning-free strategy to generate transcriptionally-controllable linear reporter constructs. This approach was applied in common transcriptional models of inflammatory response and the interferon system. In addition, it was used to delineate minimal transcriptional activity of selected ribosomal protein promoters. The approach was tested for conversion of genes into TetO-inducible/repressible expression cassettes. Conclusion The simple introduction and tuning of any transcriptional control in the linear DNA product renders promoter activation and regulated gene studies simple and versatile.

A novel TaqMan® assay for Nosema ceranae quantification in honey bee, based on the protein coding gene Hsp70.

Science.gov (United States)

Cilia, Giovanni; Cabbri, Riccardo; Maiorana, Giacomo; Cardaio, Ilaria; Dall'Olio, Raffaele; Nanetti, Antonio

2018-04-01

Nosema ceranae is now a widespread honey bee pathogen with high incidence in apiculture. Rapid and reliable detection and quantification methods are a matter of concern for research community, nowadays mainly relying on the use of biomolecular techniques such as PCR, RT-PCR or HRMA. The aim of this technical paper is to provide a new qPCR assay, based on the highly-conserved protein coding gene Hsp70, to detect and quantify the microsporidian Nosema ceranae affecting the western honey bee Apis mellifera. The validation steps to assess efficiency, sensitivity, specificity and robustness of the assay are described also. Copyright © 2018 Elsevier GmbH. All rights reserved.

Automated 5 ' nuclease assay for detection of virulence factors in porcine Escherichia coli

DEFF Research Database (Denmark)

Frydendahl, K.; Imberechts, H.; Lehmann, S.

2001-01-01

(STa, STb, EAST1) and heat labile LT) enterotoxins and the verocytotoxin variant 2e (VT2e). To correctly identify false negative results, an endogenous internal control targeting the E. coil 16S rRNA gene was incorporated in each test tube. The assay was evaluated using a collection of E. coil...... reference strains which have previously been examined with phenotypical assays or DNA hybridization. Furthermore, the assay was evaluated by testing porcine E. coil field strains, previously characterized. The 5' nuclease assay correctly detected the presence of virulence genes in all reference strains....... When testing field strains there was generally excellent agreement with results obtained by laboratories in Belgium and Germany. In conclusion, the 5' nuclease assay developed is a fast and specific tool for detection of E. coli virulence genes in the veterinary diagnostic laboratory....

Sensitive detection of novel Indian isolate of BTV 21 using ns1 gene based real-time PCR assay

Directory of Open Access Journals (Sweden)

Gaya Prasad

2013-06-01

Full Text Available Aim: The study was conducted to develop ns1 gene based sensitive real-time RT-PCR assay for diagnosis of India isolates of bluetongue virus (BTV. Materials and Methods: The BTV serotype 21 isolate (KMNO7 was isolated from Andhra Pradesh and propagated in BHK-21 cell line in our laboratory. The Nucleic acid (dsRNA of virus was extracted using Trizol method and cDNA was prepared using a standard protocol. The cDNA was allowed to ns1 gene based group specific PCR to confirm the isolate as BTV. The viral RNA was diluted 10 folds and the detection limit of ns1 gene based RT-PCR was determined. Finally the tenfold diluted viral RNA was subjected to real-time RT-PCR using ns1 gene primer and Taq man probe to standardized the reaction and determine the detection limit. Results: The ns1 gene based group specific PCR showed a single 366bp amplicon in agarose gel electrophoresis confirmed the sample as BTV. The ns1 gene RT-PCR using tenfold diluted viral RNA showed the detection limit of 70.0 fg in 1%agarose gel electrophoresis. The ns1 gene based real time RT-PCR was successfully standardized and the detection limit was found to be 7.0 fg. Conclusion: The ns1 gene based real-time RT-PCR was successfully standardized and it was found to be 10 times more sensitive than conventional RT-PCR. Key words: bluetongue, BTV21, RT-PCR, Real time RT-PCR, ns1 gene [Vet World 2013; 6(8.000: 554-557

Novel Multiplex PCR Assay for Detection of Chlorhexidine-Quaternary Ammonium, Mupirocin, and Methicillin Resistance Genes, with Simultaneous Discrimination of Staphylococcus aureus from Coagulase-Negative Staphylococci.

Science.gov (United States)

McClure, Jo-Ann; Zaal DeLongchamp, Johanna; Conly, John M; Zhang, Kunyan

2017-06-01

Methicillin-resistant Staphylococcus aureus (MRSA) is a clinically significant pathogen that is resistant to a wide variety of antibiotics and responsible for a large number of nosocomial infections worldwide. The Agency for Healthcare Research and Quality and the Centers for Disease Control and Prevention recently recommended the adoption of universal mupirocin-chlorhexidine decolonization of all admitted intensive care unit patients rather than MRSA screening with targeted treatments, which raises a serious concern about the selection of resistance to mupirocin and chlorhexidine in strains of staphylococci. Thus, a simple, rapid, and reliable approach is paramount in monitoring the prevalence of resistance to these agents. We developed a simple multiplex PCR assay capable of screening Staphylococcus isolates for the presence of antiseptic resistance genes for chlorhexidine and quaternary ammonium compounds, as well as mupirocin and methicillin resistance genes, while simultaneously discriminating S. aureus from coagulase-negative staphylococci (CoNS). The assay incorporates 7 PCR targets, including the Staphylococcus 16S rRNA gene (specifically detecting Staphylococcus spp.), nuc (distinguishing S. aureus from CoNS), mecA (distinguishing MRSA from methicillin-susceptible S. aureus ), mupA and mupB (identifying high-level mupirocin resistance), and qac and smr (identifying chlorhexidine and quaternary ammonium resistance). Our assay demonstrated 100% sensitivity, specificity, and accuracy in a total of 23 variant antiseptic- and/or antibiotic-resistant control strains. Further validation of our assay using 378 randomly selected and previously well-characterized local clinical isolates confirmed its feasibility and practicality. This may prove to be a useful tool for multidrug-resistant Staphylococcus monitoring in clinical laboratories, particularly in the wake of increased chlorhexidine and mupirocin treatments. Copyright © 2017 American Society for Microbiology.

Optimization of Phenotyping Assays for the Model Monocot Setaria viridis.

Science.gov (United States)

Acharya, Biswa R; Roy Choudhury, Swarup; Estelle, Aiden B; Vijayakumar, Anitha; Zhu, Chuanmei; Hovis, Laryssa; Pandey, Sona

2017-01-01

Setaria viridis (green foxtail) is an important model plant for the study of C4 photosynthesis in panicoid grasses, and is fast emerging as a system of choice for the study of plant development, domestication, abiotic stress responses and evolution. Basic research findings in Setaria are expected to advance research not only in this species and its close relative S. italica (foxtail millet), but also in other panicoid grasses, many of which are important food or bioenergy crops. Here we report on the standardization of multiple growth and development assays for S. viridis under controlled conditions, and in response to several phytohormones and abiotic stresses. We optimized these assays at three different stages of the plant's life: seed germination and post-germination growth using agar plate-based assays, early seedling growth and development using germination pouch-based assays, and adult plant growth and development under environmentally controlled growth chambers and greenhouses. These assays will be useful for the community to perform large scale phenotyping analyses, mutant screens, comparative physiological analysis, and functional characterization of novel genes of Setaria or other related agricultural crops. Precise description of various growth conditions, effective treatment conditions and description of the resultant phenotypes will help expand the use of S. viridis as an effective model system.

Optimization of Phenotyping Assays for the Model Monocot Setaria viridis

Directory of Open Access Journals (Sweden)

Biswa R. Acharya

2017-12-01

Full Text Available Setaria viridis (green foxtail is an important model plant for the study of C4 photosynthesis in panicoid grasses, and is fast emerging as a system of choice for the study of plant development, domestication, abiotic stress responses and evolution. Basic research findings in Setaria are expected to advance research not only in this species and its close relative S. italica (foxtail millet, but also in other panicoid grasses, many of which are important food or bioenergy crops. Here we report on the standardization of multiple growth and development assays for S. viridis under controlled conditions, and in response to several phytohormones and abiotic stresses. We optimized these assays at three different stages of the plant’s life: seed germination and post-germination growth using agar plate-based assays, early seedling growth and development using germination pouch-based assays, and adult plant growth and development under environmentally controlled growth chambers and greenhouses. These assays will be useful for the community to perform large scale phenotyping analyses, mutant screens, comparative physiological analysis, and functional characterization of novel genes of Setaria or other related agricultural crops. Precise description of various growth conditions, effective treatment conditions and description of the resultant phenotypes will help expand the use of S. viridis as an effective model system.

Developmentally regulated expression of reporter gene in adult ...

Indian Academy of Sciences (India)

pression of reporter gene in adult brain specific GAL4 enhancer traps of. Drosophila ... genes based on their expression pattern, thus enabling us to overcome the ... order association and storage centres of olfactory learning and memory, and ...

Detection and removal of spatial bias in multiwell assays.

Science.gov (United States)

Lachmann, Alexander; Giorgi, Federico M; Alvarez, Mariano J; Califano, Andrea

2016-07-01

Multiplex readout assays are now increasingly being performed using microfluidic automation in multiwell format. For instance, the Library of Integrated Network-based Cellular Signatures (LINCS) has produced gene expression measurements for tens of thousands of distinct cell perturbations using a 384-well plate format. This dataset is by far the largest 384-well gene expression measurement assay ever performed. We investigated the gene expression profiles of a million samples from the LINCS dataset and found that the vast majority (96%) of the tested plates were affected by a significant 2D spatial bias. Using a novel algorithm combining spatial autocorrelation detection and principal component analysis, we could remove most of the spatial bias from the LINCS dataset and show in parallel a dramatic improvement of similarity between biological replicates assayed in different plates. The proposed methodology is fully general and can be applied to any highly multiplexed assay performed in multiwell format. ac2248@columbia.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

In Vitro Bioluminescence Assay to Characterize Circadian Rhythm in Mammary Epithelial Cells.

Science.gov (United States)

Fang, Mingzhu; Kang, Hwan-Goo; Park, Youngil; Estrella, Brian; Zarbl, Helmut

2017-09-28

The circadian rhythm is a fundamental physiological process present in all organisms that regulates biological processes ranging from gene expression to sleep behavior. In vertebrates, circadian rhythm is controlled by a molecular oscillator that functions in both the suprachiasmatic nucleus (SCN; central pacemaker) and individual cells comprising most peripheral tissues. More importantly, disruption of circadian rhythm by exposure to light-at-night, environmental stressors and/or toxicants is associated with increased risk of chronic diseases and aging. The ability to identify agents that can disrupt central and/or peripheral biological clocks, and agents that can prevent or mitigate the effects of circadian disruption, has significant implications for prevention of chronic diseases. Although rodent models can be used to identify exposures and agents that induce or prevent/mitigate circadian disruption, these experiments require large numbers of animals. In vivo studies also require significant resources and infrastructure, and require researchers to work all night. Thus, there is an urgent need for a cell-type appropriate in vitro system to screen for environmental circadian disruptors and enhancers in cell types from different organs and disease states. We constructed a vector that drives transcription of the destabilized luciferase in eukaryotic cells under the control of the human PERIOD 2 gene promoter. This circadian reporter construct was stably transfected into human mammary epithelial cells, and circadian responsive reporter cells were selected to develop the in vitro bioluminescence assay. Here, we present a detailed protocol to establish and validate the assay. We further provide details for proof of concept experiments demonstrating the ability of our in vitro assay to recapitulate the in vivo effects of various chemicals on the cellular biological clock. The results indicate that the assay can be adapted to a variety of cell types to screen for both

Real-time sequence-validated loop-mediated isothermal amplification assays for detection of Middle East respiratory syndrome coronavirus (MERS-CoV.

Directory of Open Access Journals (Sweden)

Sanchita Bhadra

Full Text Available The Middle East respiratory syndrome coronavirus (MERS-CoV, an emerging human coronavirus, causes severe acute respiratory illness with a 35% mortality rate. In light of the recent surge in reported infections we have developed asymmetric five-primer reverse transcription loop-mediated isothermal amplification (RT-LAMP assays for detection of MERS-CoV. Isothermal amplification assays will facilitate the development of portable point-of-care diagnostics that are crucial for management of emerging infections. The RT-LAMP assays are designed to amplify MERS-CoV genomic loci located within the open reading frame (ORF1a and ORF1b genes and upstream of the E gene. Additionally we applied one-step strand displacement probes (OSD for real-time sequence-specific verification of LAMP amplicons. Asymmetric amplification effected by incorporating a single loop primer in each assay accelerated the time-to-result of the OSD-RT-LAMP assays. The resulting assays could detect 0.02 to 0.2 plaque forming units (PFU (5 to 50 PFU/ml of MERS-CoV in infected cell culture supernatants within 30 to 50 min and did not cross-react with common human respiratory pathogens.

Selection of non-destructive assay methods: Neutron counting or calorimetric assay?

International Nuclear Information System (INIS)

Cremers, T.L.; Wachter, J.R.

1994-01-01

The transition of DOE facilities from production to D ampersand D has lead to more measurements of product, waste, scrap, and other less attractive materials. Some of these materials are difficult to analyze by either neutron counting or calorimetric assay. To determine the most efficacious analysis method, variety of materials, impure salts and hydrofluorination residues have been assayed by both calorimetric assay and neutron counting. New data will be presented together with a review of published data. The precision and accuracy of these measurements are compared to chemistry values and are reported. The contribution of the gamma ray isotopic determination measurement to the overall error of the calorimetric assay or neutron assay is examined and discussed. Other factors affecting selection of the most appropriate non-destructive assay method are listed and considered

Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

Science.gov (United States)

Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

2017-07-25

Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

Development of a dot blot assay using gene probes for the detection of enteroviruses in water

International Nuclear Information System (INIS)

Margolin, A.B.

1986-01-01

Enteric viruses are viruses which replicate in the intestinal tract of man and animals. One mode of transmission for enteric viruses is the fecal-oral route. Drinking water which has been contaminated with sewage or sewage effluent has been implicated as a means for the spread of enteric viruses. Current methods for the detection of enteric viruses in water requires the use of animal cell culture. This technique has several drawbacks. More rapid techniques, such as fluorescent antibody or radioimmunoassay do not have the needed sensitivity to detect the low levels of virus found in contaminated water. An alternative technique for the detection of viruses in water was sought. Recent advances in recombinant DNA technology now makes it possible to detect viruses without the use of cell culture or antibodies. Gene probes that hybridize to the RNA of poliovirus and hepatitis A virus were tested for their ability to detect different enteric viruses. The probes were labeled with 32 P dCTP and 32 P dATP to a specific activity greater then 1.0 x 10 9 cpm/ug DNA. One infectious unit of poliovirus and hepatitis A virus was detected using labeled cDNA probes. Upon comparison, the dot blot assay was as sensitive as tissue culture for the detection of poliovirus in beef extract, secondary effluent, and tap water. Environmental samples, such as secondary effluent, reclaimed wastewater and unchlorinated drinking water were also assayed for poliovirus and hepatitis A virus with the use of gene probes. The results presented here offer an alternative method for screening water samples for the presence of enteric viruses

Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii

DEFF Research Database (Denmark)

Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida

2002-01-01

A method for reliable quantification of Pneumocystis carinii in research models of P. carinii pneumonia (PCP) that is more convenient and reproducible than microscopic enumeration of organisms would greatly facilitate investigations of this organism. We developed a rapid quantitative touchdown (QTD......) PCR assay for detecting P. carinii f. sp. carinii, the subspecies of P. carinii commonly used in research models of PCP. The assay was based on the single-copy dihydrofolate reductase gene and was able to detect ... 6 log values for standards containing > or =5 copies/tube. Application of the assay to a series of 10-fold dilutions of P. carinii organisms isolated from rat lung demonstrated that it was reproducibly quantitative over 5 log values (r = 0.99). The assay was applied to a recently reported in vitro...

Evaluation of the Branched-Chain DNA Assay for Measurement of RNA in Formalin-Fixed Tissues

Science.gov (United States)

Knudsen, Beatrice S.; Allen, April N.; McLerran, Dale F.; Vessella, Robert L.; Karademos, Jonathan; Davies, Joan E.; Maqsodi, Botoul; McMaster, Gary K.; Kristal, Alan R.

2008-01-01

We evaluated the branched-chain DNA (bDNA) assay QuantiGene Reagent System to measure RNA in formalin-fixed, paraffin-embedded (FFPE) tissues. The QuantiGene Reagent System does not require RNA isolation, avoids enzymatic preamplification, and has a simple workflow. Five selected genes were measured by bDNA assay; quantitative polymerase chain reaction (qPCR) was used as a reference method. Mixed-effect statistical models were used to partition the overall variance into components attributable to xenograft, sample, and assay. For FFPE tissues, the coefficients of reliability were significantly higher for the bDNA assay (93–100%) than for qPCR (82.4–95%). Correlations between qPCRFROZEN, the gold standard, and bDNAFFPE ranged from 0.60 to 0.94, similar to those from qPCRFROZEN and qPCRFFPE. Additionally, the sensitivity of the bDNA assay in tissue homogenates was 10-fold higher than in purified RNA. In 9- to 13-year-old blocks with poor RNA quality, the bDNA assay allowed the correct identification of the overexpression of known cancer genes. In conclusion, the QuantiGene Reagent System is considerably more reliable, reproducible, and sensitive than qPCR, providing an alternative method for the measurement of gene expression in FFPE tissues. It also appears to be well suited for the clinical analysis of FFPE tissues with diagnostic or prognostic gene expression biomarker panels for use in patient treatment and management. PMID:18276773

An ultrasensitive colorimeter assay strategy for p53 mutation assisted by nicking endonuclease signal amplification.

Science.gov (United States)

Lin, Zhenyu; Yang, Weiqiang; Zhang, Guiyun; Liu, Qida; Qiu, Bin; Cai, Zongwei; Chen, Guonan

2011-08-28

A novel catalytic colorimetric assay assisted by nicking endonuclease signal amplification (NESA) was developed. With the signal amplification, the detection limit of the p53 target gene can be as low as 1 pM, which is nearly 5 orders of magnitude lower than that of other previously reported colorimetric DNA detection strategies based on catalytic DNAzyme.

A comparison of assays measuring the viability of Legionella ...

Science.gov (United States)

Background: The relatively high prevalence of Legionella pneumophila in premise plumbing systems has been widely reported. Published reports indicate Legionella has a comparatively high resistance to chlorine and moreover has the ability to grow in phagocytic amoeba which could provide additional protection in chlorinated drinking water distribution systems. Copper-Silver (Cu-Ag) ionization treatment systems are commercially available for use in large building water systems to help control the risks from Legionella bacteria. The objectives of this study were to develop and optimize Legionella viability assays and use them to investigate the viability of Legionella bacteria after exposure to water treated with coppper and silver ions. Methods: Log phase L. pneumophila cells were used in all experiments and were generated by incubation at 35C for 48 hours in buffered yeast extract broth. Viability assays used included plating on buffered charcoal yeast extract agar to determine the number of culturable cells and treating cells with propidium monoazide (PMA) or ethidium monoazide (EMA) followed by quantitative PCR targeting mip gene of L. pneumophila. The qPCR viability assays were optimized using L. pneumophila inactivated by heat treatment at 65C for 60 min. The effectiveness of Cu-Ag ionization treatment was studied by inoculating L. pneumonia at 105 CFU/mL in water collected directly from a building water system that employed this technology and incubat

Validation of a next-generation sequencing assay for clinical molecular oncology.

Science.gov (United States)

Cottrell, Catherine E; Al-Kateb, Hussam; Bredemeyer, Andrew J; Duncavage, Eric J; Spencer, David H; Abel, Haley J; Lockwood, Christina M; Hagemann, Ian S; O'Guin, Stephanie M; Burcea, Lauren C; Sawyer, Christopher S; Oschwald, Dayna M; Stratman, Jennifer L; Sher, Dorie A; Johnson, Mark R; Brown, Justin T; Cliften, Paul F; George, Bijoy; McIntosh, Leslie D; Shrivastava, Savita; Nguyen, Tudung T; Payton, Jacqueline E; Watson, Mark A; Crosby, Seth D; Head, Richard D; Mitra, Robi D; Nagarajan, Rakesh; Kulkarni, Shashikant; Seibert, Karen; Virgin, Herbert W; Milbrandt, Jeffrey; Pfeifer, John D

2014-01-01

Currently, oncology testing includes molecular studies and cytogenetic analysis to detect genetic aberrations of clinical significance. Next-generation sequencing (NGS) allows rapid analysis of multiple genes for clinically actionable somatic variants. The WUCaMP assay uses targeted capture for NGS analysis of 25 cancer-associated genes to detect mutations at actionable loci. We present clinical validation of the assay and a detailed framework for design and validation of similar clinical assays. Deep sequencing of 78 tumor specimens (≥ 1000× average unique coverage across the capture region) achieved high sensitivity for detecting somatic variants at low allele fraction (AF). Validation revealed sensitivities and specificities of 100% for detection of single-nucleotide variants (SNVs) within coding regions, compared with SNP array sequence data (95% CI = 83.4-100.0 for sensitivity and 94.2-100.0 for specificity) or whole-genome sequencing (95% CI = 89.1-100.0 for sensitivity and 99.9-100.0 for specificity) of HapMap samples. Sensitivity for detecting variants at an observed 10% AF was 100% (95% CI = 93.2-100.0) in HapMap mixes. Analysis of 15 masked specimens harboring clinically reported variants yielded concordant calls for 13/13 variants at AF of ≥ 15%. The WUCaMP assay is a robust and sensitive method to detect somatic variants of clinical significance in molecular oncology laboratories, with reduced time and cost of genetic analysis allowing for strategic patient management. Copyright © 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Chromatin immunoprecipitation assays revealed CREB and serine 133 phospho-CREB binding to the CART gene proximal promoter.

Science.gov (United States)

Rogge, George A; Shen, Li-Ling; Kuhar, Michael J

2010-07-16

Both over expression of cyclic AMP response element binding protein (CREB) in the nucleus accumbens (NAc), and intra-accumbal injection of cocaine- and amphetamine-regulated transcript (CART) peptides, have been shown to decrease cocaine reward. Also, over expression of CREB in the rat NAc increased CART mRNA and peptide levels, but it is not known if this was due to a direct action of P-CREB on the CART gene promoter. The goal of this study was to test if CREB and P-CREB bound directly to the CRE site in the CART promoter, using chromatin immunoprecipitation (ChIP) assays. ChIP assay with anti-CREB antibodies showed an enrichment of the CART promoter fragment containing the CRE region over IgG precipitated material, a non-specific control. Forskolin, which was known to increase CART mRNA levels in GH3 cells, was utilized to show that the drug increased levels of P-CREB protein and P-CREB binding to the CART promoter CRE-containing region. A region of the c-Fos promoter containing a CRE cis-regulatory element was previously shown to bind P-CREB, and it was used here as a positive control. These data suggest that the effects of CREB over expression on blunting cocaine reward could be, at least in part, attributed to the increased expression of the CART gene by direct interaction of P-CREB with the CART promoter CRE site, rather than by some indirect action. Copyright (c) 2010 Elsevier B.V. All rights reserved.

A BAC-bacterial recombination method to generate physically linked multiple gene reporter DNA constructs

Directory of Open Access Journals (Sweden)

Gong Shiaochin

2009-03-01

Full Text Available Abstract Background Reporter gene mice are valuable animal models for biological research providing a gene expression readout that can contribute to cellular characterization within the context of a developmental process. With the advancement of bacterial recombination techniques to engineer reporter gene constructs from BAC genomic clones and the generation of optically distinguishable fluorescent protein reporter genes, there is an unprecedented capability to engineer more informative transgenic reporter mouse models relative to what has been traditionally available. Results We demonstrate here our first effort on the development of a three stage bacterial recombination strategy to physically link multiple genes together with their respective fluorescent protein (FP reporters in one DNA fragment. This strategy uses bacterial recombination techniques to: (1 subclone genes of interest into BAC linking vectors, (2 insert desired reporter genes into respective genes and (3 link different gene-reporters together. As proof of concept, we have generated a single DNA fragment containing the genes Trap, Dmp1, and Ibsp driving the expression of ECFP, mCherry, and Topaz FP reporter genes, respectively. Using this DNA construct, we have successfully generated transgenic reporter mice that retain two to three gene readouts. Conclusion The three stage methodology to link multiple genes with their respective fluorescent protein reporter works with reasonable efficiency. Moreover, gene linkage allows for their common chromosomal integration into a single locus. However, the testing of this multi-reporter DNA construct by transgenesis does suggest that the linkage of two different genes together, despite their large size, can still create a positional effect. We believe that gene choice, genomic DNA fragment size and the presence of endogenous insulator elements are critical variables.

A BAC-bacterial recombination method to generate physically linked multiple gene reporter DNA constructs.

Science.gov (United States)

Maye, Peter; Stover, Mary Louise; Liu, Yaling; Rowe, David W; Gong, Shiaochin; Lichtler, Alexander C

2009-03-13

Reporter gene mice are valuable animal models for biological research providing a gene expression readout that can contribute to cellular characterization within the context of a developmental process. With the advancement of bacterial recombination techniques to engineer reporter gene constructs from BAC genomic clones and the generation of optically distinguishable fluorescent protein reporter genes, there is an unprecedented capability to engineer more informative transgenic reporter mouse models relative to what has been traditionally available. We demonstrate here our first effort on the development of a three stage bacterial recombination strategy to physically link multiple genes together with their respective fluorescent protein (FP) reporters in one DNA fragment. This strategy uses bacterial recombination techniques to: (1) subclone genes of interest into BAC linking vectors, (2) insert desired reporter genes into respective genes and (3) link different gene-reporters together. As proof of concept, we have generated a single DNA fragment containing the genes Trap, Dmp1, and Ibsp driving the expression of ECFP, mCherry, and Topaz FP reporter genes, respectively. Using this DNA construct, we have successfully generated transgenic reporter mice that retain two to three gene readouts. The three stage methodology to link multiple genes with their respective fluorescent protein reporter works with reasonable efficiency. Moreover, gene linkage allows for their common chromosomal integration into a single locus. However, the testing of this multi-reporter DNA construct by transgenesis does suggest that the linkage of two different genes together, despite their large size, can still create a positional effect. We believe that gene choice, genomic DNA fragment size and the presence of endogenous insulator elements are critical variables.

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

Directory of Open Access Journals (Sweden)

Bechard Matthew E.

2003-01-01

Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli.

Science.gov (United States)

Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

2003-01-01

Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

Gene polymorphisms against DNA damage induced by hydrogen peroxide in leukocytes of healthy humans through comet assay: a quasi-experimental study

Directory of Open Access Journals (Sweden)

Klautau-Guimarães Maria N

2010-05-01

Full Text Available Abstract Background Normal cellular metabolism is well established as the source of endogenous reactive oxygen species which account for the background levels of oxidative DNA damage detected in normal tissue. Hydrogen peroxide imposes an oxidative stress condition on cells that can result in DNA damage, leading to mutagenesis and cell death. Several potentially significant genetic variants related to oxidative stress have already been identified, and angiotensin I-converting enzyme (ACE inhibitors have been reported as possible antioxidant agents that can reduce vascular oxidative stress in cardiovascular events. Methods We investigate the influences of haptoglobin, manganese superoxide dismutase (MnSOD Val9Ala, catalase (CAT -21A/T, glutathione peroxidase 1 (GPx-1 Pro198Leu, ACE (I/D and gluthatione S-transferases GSTM1 and GSTT1 gene polymorphisms against DNA damage and oxidative stress. These were induced by exposing leukocytes from peripheral blood of healthy humans (N = 135 to hydrogen peroxide (H2O2, and the effects were tested by comet assay. Blood samples were submitted to genotyping and comet assay (before and after treatment with H2O2 at 250 μM and 1 mM. Results After treatment with H2O2 at 250 μM, the GPx-1 polymorphism significantly influenced results of comet assay and a possible association of the Pro/Leu genotype with higher DNA damage was found. The highest or lowest DNA damage also depended on interaction between GPX-1/ACE and Hp/GSTM1T1 polymorphisms when hydrogen peroxide treatment increased oxidative stress. Conclusions The GPx-1 polymorphism and the interactions between GPX-1/ACE and Hp/GSTM1T1 can be determining factors for DNA oxidation provoked by hydrogen peroxide, and thus for higher susceptibility to or protection against oxidative stress suffered by healthy individuals.

Assaying locomotor, learning, and memory deficits in Drosophila models of neurodegeneration.

Science.gov (United States)

Ali, Yousuf O; Escala, Wilfredo; Ruan, Kai; Zhai, R Grace

2011-03-11

Advances in genetic methods have enabled the study of genes involved in human neurodegenerative diseases using Drosophila as a model system. Most of these diseases, including Alzheimer's, Parkinson's and Huntington's disease are characterized by age-dependent deterioration in learning and memory functions and movement coordination. Here we use behavioral assays, including the negative geotaxis assay and the aversive phototaxic suppression assay (APS assay), to show that some of the behavior characteristics associated with human neurodegeneration can be recapitulated in flies. In the negative geotaxis assay, the natural tendency of flies to move against gravity when agitated is utilized to study genes or conditions that may hinder locomotor capacities. In the APS assay, the learning and memory functions are tested in positively-phototactic flies trained to associate light with aversive bitter taste and hence avoid this otherwise natural tendency to move toward light. Testing these trained flies 6 hours post-training is used to assess memory functions. Using these assays, the contribution of any genetic or environmental factors toward developing neurodegeneration can be easily studied in flies.

Human CRF2 α and β splice variants: pharmacological characterization using radioligand binding and a luciferase gene expression assay

International Nuclear Information System (INIS)

Ardati, A.; Goetschy, V.; Gottowick, J.; Henriot, S.; Deuschle, U.; Kilpatrick, G.J.; Valdenaire, O.

1999-01-01

Corticotropin releasing factor (CRF) receptors belong to the super-family of G protein-coupled receptors. These receptors are classified into two subtypes (CRF 1 and CRF 2 ). Both receptors are positively coupled to adenylyl cyclase but they have a distinct pharmacology and distribution in brain. Two isoforms belonging to the CRF 2 subtype receptors, CRF 2α and CRF 2β , have been identified in rat and man. The neuropeptides CRF and urocortin mediate their actions through this CRF G protein-coupled receptor family. In this report, we describe the pharmacological characterization of the recently identified hCRF 2β receptor. We have used radioligand binding with [ 125 I]-tyr 0 -sauvagine and a gene expression assay in which the firefly luciferase gene expression is under the control of cAMP responsive elements. Association kinetics of [ 125 I]-tyr 0 -sauvagine binding to the hCRF 2β receptor were monophasic while dissociation kinetics were biphasic, in agreement with the kinetics results obtained with the hCRF 2α receptor. Saturation binding analysis revealed two affinity states in HEK 293 cells with binding parameters in accord with those determined kinetically and with parameters obtained with the hCRF 2α receptor. A non-hydrolysable GTP analog, Gpp(NH)p, reduced the high affinity binding of [ 125 I]-tyr 0 -sauvagine to both hCRF 2 receptor isoforms in a similar manner. The rank order of potency of CRF agonist peptides in competition experiments was identical for both hCRF 2 α-helical CRF (9-41) oCRF). Similarly, agonist potency was similar for the two isoforms when studied using the luciferase gene reporter system. The peptide antagonist α-helical CRF (9-41) exhibited a non-competitive antagonism of urocortin-stimulated luciferase expression with both hCRF 2 receptor isoforms. Taken together, these results indicate that the pharmacological profiles of the CRF 2 splice variants are identical. This indicates that the region of the N-terminus that varies

Determination of Interference During In Vitro Pyrogen Detection: Development and Characterization of a Cell-Based Assay.

Science.gov (United States)

Palma, Linda; Rossetti, Francesca; Dominici, Sabrina; Buondelmonte, Costantina; Rocchi, Marco B L; Rizzardi, Gian P; Vallanti, Giuliana; Magnani, Mauro

Contamination of pharmaceutical products and medical devices with pyrogens such as endotoxins is the most common cause of systemic inflammation and, in worst cases, of septic shock. Thus, quantification of pyrogens is crucial. The limulus amebocyte lysate (LAL)-based assays are the reference tests for in vitro endotoxin detection, in association with the in vivo rabbit pyrogen test (RPT), according to European Pharmacopoeia (EP 2.6.14), and U.S. Pharmacopoeia (USP ). However, several substances interfere with LAL assay, while RPT is not accurate, not quantitative, and raises ethical limits. Biological assays, as monocyte activation tests, have been developed and included in European Pharmacopoeia (EP 7.0; 04/2010:20630) guidelines as an alternative to RPT and proved relevant to the febrile reaction in vivo. Because this reaction is carried out by endogenous mediators under the transcriptional control of nuclear factor-kappaB (NF-kappaB), we sought to determine whether a NF-kappaB reporter-gene assay, based on MonoMac-6 (MM6) cells, could reconcile the basic mechanism of innate immune response with the relevance of monocytoid cell lines to the organism reaction to endotoxins. This article describes both optimization and characterization of the reporter cells-based assay, which overall proved the linearity, accuracy, and precision of the test, and demonstrated the sensitivity of the assay to 0.24 EU/mL endotoxin, close to the pyrogenic threshold in humans. Moreover, the assay was experimentally compared to the LAL test in the evaluation of selected interfering samples. The good performance of the MM6 reporter test demonstrates the suitability of this assay to evaluate interfering or false-positive samples.

Gene doping detection: evaluation of approach for direct detection of gene transfer using erythropoietin as a model system.

Science.gov (United States)

Baoutina, A; Coldham, T; Bains, G S; Emslie, K R

2010-08-01

As clinical gene therapy has progressed toward realizing its potential, concern over misuse of the technology to enhance performance in athletes is growing. Although 'gene doping' is banned by the World Anti-Doping Agency, its detection remains a major challenge. In this study, we developed a methodology for direct detection of the transferred genetic material and evaluated its feasibility for gene doping detection in blood samples from athletes. Using erythropoietin (EPO) as a model gene and a simple in vitro system, we developed real-time PCR assays that target sequences within the transgene complementary DNA corresponding to exon/exon junctions. As these junctions are absent in the endogenous gene due to their interruption by introns, the approach allows detection of trace amounts of a transgene in a large background of the endogenous gene. Two developed assays and one commercial gene expression assay for EPO were validated. On the basis of ability of these assays to selectively amplify transgenic DNA and analysis of literature on testing of gene transfer in preclinical and clinical gene therapy, it is concluded that the developed approach would potentially be suitable to detect gene doping through gene transfer by analysis of small volumes of blood using regular out-of-competition testing.

Endocrine disruptive effects of chemicals eluted from nitrile-butadiene rubber gloves using reporter gene assay systems.

Science.gov (United States)

Satoh, Kanako; Nonaka, Ryouichi; Ohyama, Ken-ichi; Nagai, Fumiko; Ogata, Akio; Iida, Mitsuru

2008-03-01

Disposable gloves made of nitrile-butadiene rubber (NBR) are used for contact with foodstuffs rather than polyvinyl chloride gloves containing di(2-ethylhexyl)phthalate (DEHP), because endocrine-disruptive effects are suspected for phthalate diesters including DEHP. However, 4,4'-butylidenebis(6-t-butyl-m-cresol) (BBBC), 2,4-di-t-butylphenol, and 2,2,4-trimetyl-1,3-pentanediol diisobutyrate can be eluted from NBR gloves, and possibly also detected in food. In this study, we examined the endocrine-disrupting effects of these chemicals via androgen receptor (AR) and estrogen receptor (ER)-mediated pathways using stably transfected reporter gene cell lines expressing AR (AR-EcoScreen system) and ER (MVLN cells), respectively. We also examined the binding activities of these chemicals to AR and ER. The IC50 value of BBBC for antagonistic androgen was in the range of 10(-6)M. The strength of inhibition was about 5 times that of a known androgen antagonist, 1,1'-(2,2-dichloroethylidene)bis[4-chlorobenzene] (p,p'-DDE), and similar to that of bisphenol A. The IC50 value of BBBC for antagonistic estrogen was in the range of 10(-6)M. These results suggest that BBBC and its structural homologue, 4,4'-thiobis(6-t-butyl-m-cresol) are androgen and estrogen antagonists. It is therefore necessary to study these chemicals in vivo, and clarify their effect on the endocrine system.

Differential gene expression responses distinguish contact and respiratory sensitizers and nonsensitizing irritants in the local lymph node assay.

Science.gov (United States)

Adenuga, David; Woolhiser, Michael R; Gollapudi, B Bhaskar; Boverhof, Darrell R

2012-04-01

Genomic approaches have the potential to enhance the specificity and predictive accuracy of existing toxicology endpoints, including those for chemical sensitization. The present study was conducted to determine whether gene expression responses can distinguish contact sensitizers (1-chloro-2,4-dinitrobenzene [DNCB] and hexyl cinnamic aldehyde [HCA]), respiratory sensitizers (ortho-phthalaldehyde and trimellitic anhydride [TMA]), and nonsensitizing irritants (methyl salicylate [MS] and nonanoic acid [NA]) in the local lymph node assay (LLNA). Female Balb/c mice received doses of each chemical as per the standard LLNA dosing regimen on days 1, 2, and 3. Auricular lymph nodes were analyzed for tritiated thymidine ((3)HTdR) incorporation on day 6 and for gene expression responses on days 6 and 10. All chemicals induced dose-dependent increases in stimulation index, which correlated strongly with the number of differentially expressed genes. A majority of genes modulated by the irritants were similarly altered by the sensitizers, consistent with the irritating effects of the sensitizers. However, a select number of responses involved with immune-specific functions, such as dendritic cell activation, were unique to the sensitizers and may offer the ability to distinguish sensitizers from irritants. Genes for the mast cell proteases 1 and 8, Lgals7, Tim2, Aicda, Il4, and Akr1c18 were more strongly regulated by respiratory sensitizers compared with contact sensitizers and may represent potential biomarkers for discriminating between contact and respiratory sensitizers. Collectively, these data suggest that gene expression responses may serve as useful biomarkers to distinguish between respiratory and contact sensitizers and nonsensitizing irritants in the LLNA.

Comparison of mRNA Splicing Assay Protocols across Multiple Laboratories

DEFF Research Database (Denmark)

Whiley, Phillip J; de la Hoya, Miguel; Thomassen, Mads

2014-01-01

Accurate evaluation of unclassified sequence variants in cancer predisposition genes is essential for clinical management and depends on a multifactorial analysis of clinical, genetic, pathologic, and bioinformatic variables and assays of transcript length and abundance. The integrity of assay data...

Reactivity of human sera in a sensitive, high-throughput pseudovirus-based papillomavirus neutralization assay for HPV16 and HPV18

International Nuclear Information System (INIS)

Pastrana, Diana V.; Buck, Christopher B.; Pang, Y.-Y. S.; Thompson, Cynthia D.; Castle, Philip E.; FitzGerald, Peter C.; Krueger Kjaer, Susanne; Lowy, Douglas R.; Schiller, John T.

2004-01-01

Sensitive high-throughput neutralization assays, based upon pseudoviruses carrying a secreted alkaline phosphatase (SEAP) reporter gene, were developed and validated for human papillomavirus (HPV)16, HPV18, and bovine papillomavirus 1 (BPV1). SEAP pseudoviruses were produced by transient transfection of codon-modified papillomavirus structural genes into an SV40 T antigen expressing line derived from 293 cells, yielding sufficient pseudovirus from one flask for thousands of titrations. In a 96-well plate format, in this initial characterization, the assay was reproducible and appears to be as sensitive as, but more specific than, a standard papillomavirus-like particle (VLP)-based enzyme-linked immunosorbent assay (ELISA). The neutralization assay detected type-specific HPV16 or HPV18 neutralizing antibodies (titers of 160-10240) in sera of the majority of a group of women infected with the corresponding HPV type, but not in virgin women. Sera from HPV16 VLP vaccinees had high anti-HPV16 neutralizing titers (mean: 45000; range: 5120-163840), but no anti-HPV18 neutralizing activity. The SEAP pseudovirus-based neutralization assay should be a practical method for quantifying potentially protective antibody responses in HPV natural history and prophylactic vaccine studies

Rapid genotyping assays for the 4-base pair deletion of canine MDR1/ABCB1 gene and low frequency of the mutant allele in Border Collie dogs.

Science.gov (United States)

Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu

2012-01-01

P-glycoprotein, encoded by the MDR1 or ABCB1 gene, is an integral component of the blood-brain barrier as an efflux pump for xenobiotics crucial in limiting drug uptake into the central nervous system. Dogs homozygous for a 4-base pair deletion of the canine MDR1 gene show altered expression or function of P-glycoprotein, resulting in neurotoxicosis after administration of the substrate drugs. In the present study, the usefulness of microchip electrophoresis for genotyping assays detecting this deletion mutation was evaluated. Mutagenically separated polymerase chain reaction (MS-PCR) and real-time PCR assays were newly developed and evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies dogs in Japan to determine the allele frequency in this breed. Microchip electrophoresis showed advantages in detection sensitivity and time saving over other modes of electrophoresis. The MS-PCR assay clearly discriminated all genotypes. Real-time PCR assay was most suitable for a large-scale survey due to its high throughput and rapidity. The genotyping survey demonstrated that the carrier and mutant allele frequencies were 0.49% and 0.25%, respectively, suggesting that the mutant allele frequency in Border Collies is markedly low compared to that in the susceptible dog breeds such as rough and smooth Collies.

Visualization of ecdysteroid activity using a reporter gene in the crustacean, Daphnia.

Science.gov (United States)

Asada, Miki; Kato, Yasuhiko; Matsuura, Tomoaki; Watanabe, Hajime

2014-02-01

Ecdysone is a hormone known to play a pivotal role in crustaceans and insects. In order to evaluate the ecdysone activities in the environment and within the organism, we have developed a biomonitoring Daphnia strain by introducing a reporter gene. In this study, the ecdysone response element was inserted in the upstream region of a reporter gene, and the DNA construct was injected into Daphnia eggs. The expression of the reporter gene was detected during the early embryonic development stage. In addition, when the eggs expressing the reporter gene were exposed to ecdysone, there was enhanced expression of the reporter gene at detectable levels, while the presence of an antagonist led to its downregulation. These results suggested that this system could be potentially developed for monitoring ecdysone activities in media. Copyright © 2013 Elsevier Ltd. All rights reserved.

Mechanosensitive promoter region in the human HB-GAM gene

DEFF Research Database (Denmark)

Liedert, Astrid; Kassem, Moustapha; Claes, Lutz

2009-01-01

Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...

Advances in study of perpes simplex virus type 1-thymidine kinase reporter gene imaging

International Nuclear Information System (INIS)

Liu Ying; Lan Xiaoli; Zhang Yongxue

2007-01-01

Radionuclide reporter gene imaging is an effect way to provide qualitative and quantitative information for gene therapy. There are three systems of reporter gene including kinase reporter gene. perpes simplex virus type 1-thymidine kinase (HSV1-tk) has perfect physical and chemical characteristic which is suit for imaging as reporter gene. It has been widely investigated and intensively researched. Two substrates of HSV1-tk are purine nucleosite derivant and acyclovir derivant, which can also be used as reporter probes of HSV1-tk. (authors)

Construction of a novel multi-gene assay (42-gene classifier) for prediction of late recurrence in ER-positive breast cancer patients.

Science.gov (United States)

Tsunashima, Ryo; Naoi, Yasuto; Shimazu, Kenzo; Kagara, Naofumi; Shimoda, Masashi; Tanei, Tomonori; Miyake, Tomohiro; Kim, Seung Jin; Noguchi, Shinzaburo

2018-05-04

Prediction models for late (> 5 years) recurrence in ER-positive breast cancer need to be developed for the accurate selection of patients for extended hormonal therapy. We attempted to develop such a prediction model focusing on the differences in gene expression between breast cancers with early and late recurrence. For the training set, 779 ER-positive breast cancers treated with tamoxifen alone for 5 years were selected from the databases (GSE6532, GSE12093, GSE17705, and GSE26971). For the validation set, 221 ER-positive breast cancers treated with adjuvant hormonal therapy for 5 years with or without chemotherapy at our hospital were included. Gene expression was assayed by DNA microarray analysis (Affymetrix U133 plus 2.0). With the 42 genes differentially expressed in early and late recurrence breast cancers in the training set, a prediction model (42GC) for late recurrence was constructed. The patients classified by 42GC into the late recurrence-like group showed a significantly (P = 0.006) higher late recurrence rate as expected but a significantly (P = 1.62 × E-13) lower rate for early recurrence than non-late recurrence-like group. These observations were confirmed for the validation set, i.e., P = 0.020 for late recurrence and P = 5.70 × E-5 for early recurrence. We developed a unique prediction model (42GC) for late recurrence by focusing on the biological differences between breast cancers with early and late recurrence. Interestingly, patients in the late recurrence-like group by 42GC were at low risk for early recurrence.

Advances of reporter gene monitoring stem cell therapy

International Nuclear Information System (INIS)

Zhou Xiang; Yin Hongyan; Zhang Yifan

2010-01-01

Stem cell therapy research has made great progress, demonstrating a broad application prospects. However, stem cell therapy as a new disease treatment, there are still many problems to be solved. Reporter gene imaging is a rapid development in recent years, a non-invasive, sensitive method of monitoring of stem cells, in particular radionuclide reporter gene imaging has high sensitivity and specificity of the advantages of strong and can carry out imaging of deep tissue and repeat imaging, is a tracer in vivo conditions, the most promising stem cell transplantation technique, showing good prospects for development. (authors)

Extreme assay sensitivity in molecular diagnostics further unveils intratumour heterogeneity in metastatic colorectal cancer as well as artifactual low-frequency mutations in the KRAS gene.

Science.gov (United States)

Mariani, Sara; Bertero, Luca; Osella-Abate, Simona; Di Bello, Cristiana; Francia di Celle, Paola; Coppola, Vittoria; Sapino, Anna; Cassoni, Paola; Marchiò, Caterina

2017-07-25

Gene mutations in the RAS family rule out metastatic colorectal carcinomas (mCRCs) from anti-EGFR therapies. We report a retrospective analysis by Sequenom Massarray and fast COLD-PCR followed by Sanger sequencing on 240 mCRCs. By Sequenom, KRAS and NRAS exons 2-3-4 were mutated in 52.9% (127/240) of tumours, while BRAF codon 600 mutations reached 5% (12/240). Fast COLD-PCR found extra mutations at KRAS exon 2 in 15/166 (9%) of samples, previously diagnosed by Sequenom as wild-type or mutated at RAS (exons 3-4) or BRAF genes. After UDG digestion results were reproduced in 2/12 analysable subclonally mutated samples leading to a frequency of true subclonal KRAS mutations of 1.2% (2.1% of the previous Sequenom wild-type subgroup). In 10 out of 12 samples, the subclonal KRAS mutations disappeared (9 out of 12) or turned to a different sequence variant (1 out of 12). mCRC can harbour coexisting multiple gene mutations. High sensitivity assays allow the detection of a small subset of patients harbouring true subclonal KRAS mutations. However, DNA changes with mutant allele frequencies <3% detected in formalin-fixed paraffin-embedded samples may be artifactual in a non-negligible fraction of cases. UDG pre-treatment of DNA is mandatory to identify true DNA changes in archival samples and avoid misinterpretation due to artifacts.

Development of kits for radioimmunometric assays for tumour markers. Final report of a co-ordinated research project 1997-2001

International Nuclear Information System (INIS)

2002-08-01

Many tumour marker assays have been reported over the years and their role is well recognized and acknowledged in the follow-up of known cancer cases. However, their true potential for use in primary diagnosis or screening of high risk groups is still to be fully realized due to the need to achieve better specificity. Among the various tumour markers, the one for prostate cancer - prostate specific antigen (PSA) - appears to have better specificity, coming close to a tumour specific antigen. Prostate cancer is a commonly encountered cancer in men, and can be effectively treated if detected early. PSA levels in serum appear to provide good correlation with tumour burden. Estimation of free PSA in serum is reported to further improve the diagnosis. In several developed countries routine screening of men above 50 years of age for prostate cancer using serum PSA as marker is recommended. Radioimmunometric assay techniques offer themselves as attractive candidates for measurement of tumour markers. They are robust, economical and didactic, thus eminently suitable for technology transfer, training and teaching. Preparation of primary reagents is relatively easy. The methodology is flexible. As a result of co-operation projects of the IAEA, many developing Member States have built up indigenous capabilities to perform radioimmunometric assays, which can be extended to development of kits for tumour marker assays. Considering the need for indigenous development of capabilities to produce reliable kits for radioimmunometric assays for PSA, in 1997 the IAEA initiated a Co-ordinated Research Project (CRP) on Development of Kits for Radioimmunometric Assays for Tumour Markers. Even though the focus of the project was PSA, it was expected that the expertise to be gained by the participants would also help them undertake development of kits for other tumour markers, essentially using the same methodology. Ten laboratories from Europe, Asia, Africa and the Americas participated

Multiplex real-time PCR assay for Legionella species.

Science.gov (United States)

Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja

2015-12-01

Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

Alpha-fetoprotein-targeted reporter gene expression imaging in hepatocellular carcinoma.

Science.gov (United States)

Kim, Kwang Il; Chung, Hye Kyung; Park, Ju Hui; Lee, Yong Jin; Kang, Joo Hyun

2016-07-21

Hepatocellular carcinoma (HCC) is one of the most common cancers in Eastern Asia, and its incidence is increasing globally. Numerous experimental models have been developed to better our understanding of the pathogenic mechanism of HCC and to evaluate novel therapeutic approaches. Molecular imaging is a convenient and up-to-date biomedical tool that enables the visualization, characterization and quantification of biologic processes in a living subject. Molecular imaging based on reporter gene expression, in particular, can elucidate tumor-specific events or processes by acquiring images of a reporter gene's expression driven by tumor-specific enhancers/promoters. In this review, we discuss the advantages and disadvantages of various experimental HCC mouse models and we present in vivo images of tumor-specific reporter gene expression driven by an alpha-fetoprotein (AFP) enhancer/promoter system in a mouse model of HCC. The current mouse models of HCC development are established by xenograft, carcinogen induction and genetic engineering, representing the spectrum of tumor-inducing factors and tumor locations. The imaging analysis approach of reporter genes driven by AFP enhancer/promoter is presented for these different HCC mouse models. Such molecular imaging can provide longitudinal information about carcinogenesis and tumor progression. We expect that clinical application of AFP-targeted reporter gene expression imaging systems will be useful for the detection of AFP-expressing HCC tumors and screening of increased/decreased AFP levels due to disease or drug treatment.

Prevalence of H63D, S65C and C282Y hereditary hemochromatosis gene mutations in Slovenian population by an improved high-throughput genotyping assay

Directory of Open Access Journals (Sweden)

Rupreht Ruth

2007-11-01

Full Text Available Abstract Background Hereditary hemochromatosis (HH is a common genetic disease characterized by excessive iron overload that leads to multi-organ failure. Although the most prevalent genotype in HH is homozygosity for C282Y mutation of the HFE gene, two additional mutations, H63D and S65C, appear to be associated with a milder form of HH. The aim of this study was to develop a high-throughput assay for HFE mutations screening based on TaqMan technology and to determine the frequencies of HFE mutations in the Slovenian population. Methods Altogether, 1282 randomly selected blood donors from different Slovenian regions and 21 HH patients were analyzed for the presence of HFE mutations by an in-house developed real-time PCR assay based on TaqMan technology using shorter non-interfering fluorescent single nucleotide polymorphism (SNP-specific MGB probes. The assay was validated by RFLP analysis and DNA sequencing. Results The genotyping assay of the H63D, S65C and C282Y mutations in the HFE gene, based on TaqMan technology proved to be fast, reliable, with a high-throughput capability and 100% concordant with genotypes obtained by RFLP and DNA sequencing. The observed frequency of C282Y homozygotes in the group of HH patients was only 48%, others were of the heterogeneous HFE genotype. Among 1282 blood donors tested, the observed H63D, S65C and C282Y allele frequency were 12.8% (95% confidence interval (CI 11.5 – 14.2%, 1.8% (95% CI 1.4 – 2.5% and 3.6% (95% CI 3.0 – 4.5%, respectively. Approximately 33% of the tested subjects had at least one of the three HH mutations, and 1% of them were C282Y homozygotes or compound heterozygotes C282Y/H63D or C282Y/S65C, presenting an increased risk for iron overload disease. A significant variation in H63D allele frequency was observed for one of the Slovenian regions. Conclusion The improved real-time PCR assay for H63D, S65C and C282Y mutations detection is accurate, fast, cost-efficient and ready for

Tackling heterogeneity: a leaf disc-based assay for the high-throughput screening of transient gene expression in tobacco.

Directory of Open Access Journals (Sweden)

Natalia Piotrzkowski

Full Text Available Transient Agrobacterium-mediated gene expression assays for Nicotiana tabacum (N. tabacum are frequently used because they facilitate the comparison of multiple expression constructs regarding their capacity for maximum recombinant protein production. However, for three model proteins, we found that recombinant protein accumulation (rpa was significantly influenced by leaf age and leaf position effects. The ratio between the highest and lowest amount of protein accumulation (max/min ratio was found to be as high as 11. Therefore, construct-based impacts on the rpa level that are less than 11-fold will be masked by background noise. To address this problem, we developed a leaf disc-based screening assay and infiltration device that allows the rpa level in a whole tobacco plant to be reliably and reproducibly determined. The prototype of the leaf disc infiltration device allows 14 Agrobacterium-mediated infiltration events to be conducted in parallel. As shown for three model proteins, the average max/min rpa ratio was reduced to 1.4 using this method, which allows for a sensitive comparison of different genetic elements affecting recombinant protein expression.

Application of a loop-mediated isothermal amplification (LAMP) assay targeting cox1 gene for the detection of Clonorchis sinensis in human fecal samples.

Science.gov (United States)

Rahman, S M Mazidur; Song, Hyun Beom; Jin, Yan; Oh, Jin-Kyoung; Lim, Min Kyung; Hong, Sung-Tae; Choi, Min-Ho

2017-10-01

Clonorchiasis is prevalent in the Far East, and a major health problem in endemic areas. Infected persons may experience, if not treated, serious complications such as bile stone formation, pyogenic cholangitis, and even cholangiocarcinoma. Early diagnosis and treatment are important to prevent serious complications and, therefore, the simple and reliable diagnostic method is necessary to control clonorchiasis in endemic areas, where resources for the diagnosis are limited. The loop-mediated isothermal amplification (LAMP) assay has been applied for the detection of Clonorchis sinensis DNA. Six primers targeting eight locations on the cytochrome c oxidase subunit 1 gene of C. sinensis were designed for species-specific amplification using the LAMP assay. The LAMP assay was sensitive enough to detect as little as 100 fg of C. sinensis genomic DNA and the detection limit in 100 mg of stool was as low as one egg. The assay was highly specific because no cross-reactivity was observed with the DNA of other helminths, protozoa or Escherichia coli. Then, LAMP assay was applied to human fecal samples collected from an endemic area of clonorchiasis in Korea. Using samples showing consistent results by both Kato-Katz method and real-time PCR as reference standards, the LAMP assay showed 97.1% (95% CI, 90.1-99.2) of sensitivity and 100% (95% CI, 92.9-100) of specificity. In stool samples with more than 100 eggs per gram of feces, the sensitivity achieved 100%. To detect C. sinensis in human fecal samples, the LAMP assay was applied and achieved high sensitivity and specificity. The LAMP assay can be utilized in field laboratories as a powerful tool for diagnosis and epidemiological survey of clonorchiasis.

Non-invasive imaging using reporter genes altering cellular water permeability

Science.gov (United States)

Mukherjee, Arnab; Wu, Di; Davis, Hunter C.; Shapiro, Mikhail G.

2016-12-01

Non-invasive imaging of gene expression in live, optically opaque animals is important for multiple applications, including monitoring of genetic circuits and tracking of cell-based therapeutics. Magnetic resonance imaging (MRI) could enable such monitoring with high spatiotemporal resolution. However, existing MRI reporter genes based on metalloproteins or chemical exchange probes are limited by their reliance on metals or relatively low sensitivity. Here we introduce a new class of MRI reporters based on the human water channel aquaporin 1. We show that aquaporin overexpression produces contrast in diffusion-weighted MRI by increasing tissue water diffusivity without affecting viability. Low aquaporin levels or mixed populations comprising as few as 10% aquaporin-expressing cells are sufficient to produce MRI contrast. We characterize this new contrast mechanism through experiments and simulations, and demonstrate its utility in vivo by imaging gene expression in tumours. Our results establish an alternative class of sensitive, metal-free reporter genes for non-invasive imaging.

Establishment of an efficient virus-induced gene silencing (VIGS) assay in Arabidopsis by Agrobacterium-mediated rubbing infection.

Science.gov (United States)

Manhães, Ana Marcia E de A; de Oliveira, Marcos V V; Shan, Libo

2015-01-01

Several VIGS protocols have been established for high-throughput functional genomic screens as it bypasses the time-consuming and laborious process of generation of transgenic plants. The silencing efficiency in this approach is largely hindered by a technically demanding step in which the first pair of newly emerged true leaves at the 2-week-old stage are infiltrated with a needleless syringe. To further optimize VIGS efficiency and achieve rapid inoculation for a large-scale functional genomic study, here we describe a protocol of an efficient VIGS assay in Arabidopsis using Agrobacterium-mediated rubbing infection. The Agrobacterium inoculation is performed by simply rubbing the leaves with Filter Agent Celite(®) 545. The highly efficient and uniform silencing effect was indicated by the development of a visibly albino phenotype due to silencing of the Cloroplastos alterados 1 (CLA1) gene in the newly emerged leaves. In addition, the albino phenotype could be observed in stems and flowers, indicating its potential application for gene functional studies in the late vegetative development and flowering stages.

Analytical validation of the PAM50-based Prosigna Breast Cancer Prognostic Gene Signature Assay and nCounter Analysis System using formalin-fixed paraffin-embedded breast tumor specimens

International Nuclear Information System (INIS)

Nielsen, Torsten; Storhoff, James; Wallden, Brett; Schaper, Carl; Ferree, Sean; Liu, Shuzhen; Gao, Dongxia; Barry, Garrett; Dowidar, Naeem; Maysuria, Malini

2014-01-01

NanoString’s Prosigna™ Breast Cancer Prognostic Gene Signature Assay is based on the PAM50 gene expression signature. The test outputs a risk of recurrence (ROR) score, risk category, and intrinsic subtype (Luminal A/B, HER2-enriched, Basal-like). The studies described here were designed to validate the analytical performance of the test on the nCounter Analysis System across multiple laboratories. Analytical precision was measured by testing five breast tumor RNA samples across 3 sites. Reproducibility was measured by testing replicate tissue sections from 43 FFPE breast tumor blocks across 3 sites following independent pathology review at each site. The RNA input range was validated by comparing assay results at the extremes of the specified range to the nominal RNA input level. Interference was evaluated by including non-tumor tissue into the test. The measured standard deviation (SD) was less than 1 ROR unit within the analytical precision study and the measured total SD was 2.9 ROR units within the reproducibility study. The ROR scores for RNA inputs at the extremes of the range were the same as those at the nominal input level. Assay results were stable in the presence of moderate amounts of surrounding non-tumor tissue (<70% by area). The analytical performance of NanoString’s Prosigna assay has been validated using FFPE breast tumor specimens across multiple clinical testing laboratories

Assays for Qualification and Quality Stratification of Clinical Biospecimens Used in Research: A Technical Report from the ISBER Biospecimen Science Working Group.

Science.gov (United States)

Betsou, Fay; Bulla, Alexandre; Cho, Sang Yun; Clements, Judith; Chuaqui, Rodrigo; Coppola, Domenico; De Souza, Yvonne; De Wilde, Annemieke; Grizzle, William; Guadagni, Fiorella; Gunter, Elaine; Heil, Stacey; Hodgkinson, Verity; Kessler, Joseph; Kiehntopf, Michael; Kim, Hee Sung; Koppandi, Iren; Shea, Katheryn; Singh, Rajeev; Sobel, Marc; Somiari, Stella; Spyropoulos, Demetri; Stone, Mars; Tybring, Gunnel; Valyi-Nagy, Klara; Van den Eynden, Gert; Wadhwa, Lalita

2016-10-01

This technical report presents quality control (QC) assays that can be performed in order to qualify clinical biospecimens that have been biobanked for use in research. Some QC assays are specific to a disease area. Some QC assays are specific to a particular downstream analytical platform. When such a qualification is not possible, QC assays are presented that can be performed to stratify clinical biospecimens according to their biomolecular quality.

Activity, polypeptide and gene identification of thylakoid Ndh complex in trees: potential physiological relevance of fluorescence assays.

Science.gov (United States)

Serrot, Patricia H; Sabater, Bartolomé; Martín, Mercedes

2012-09-01

Three evergreen (Laurus nobilis, Viburnum tinus and Thuja plicata) and two autumnal abscission deciduous trees (Cydonia oblonga and Prunus domestica) have been investigated for the presence (zymogram and immunodetection) and functionality (post-illumination chlorophyll fluorescence) of the thylakoid Ndh complex. The presence of encoding ndh genes has also been investigated in T. plicata. Western assays allowed tentative identification of zymogram NADH dehydrogenase bands corresponding to the Ndh complex after native electrophoresis of solubilized fractions from L. nobilis, V. tinus, C. oblonga and P. domestica leaves, but not in those of T. plicata. However, Ndh subunits were detected after SDS-PAGE of thylakoid solubilized proteins of T. plicata. The leaves of the five plants showed the post-illumination chlorophyll fluorescence increase dependent on the presence of active Ndh complex. The fluorescence increase was higher in autumn in deciduous, but not in evergreen trees, which suggests that the thylakoid Ndh complex could be involved in autumnal leaf senescence. Two ndhB genes were sequenced from T. plicata that differ at the 350 bp 3' end sequence. Comparison with the mRNA revealed that ndhB genes have a 707-bp type II intron between exons 1 (723 bp) and 2 (729 bp) and that the UCA 259th codon is edited to UUA in mRNA. Phylogenetically, the ndhB genes of T. plicata group close to those of Metasequoia, Cryptomeria, Taxodium, Juniperus and Widdringtonia in the cupresaceae branch and are 5' end shortened by 18 codons with respect to that of angiosperms. Copyright © Physiologia Plantarum 2012.

Enhancement of gene expression under hypoxic conditions using fragments of the human vascular endothelial growth factor and the erythropoietin genes

International Nuclear Information System (INIS)

Shibata, Toru; Akiyama, Nobutake; Noda, Makoto; Sasai, Keisuke; Hiraoka, Masahiro

1998-01-01

Purpose: Selective gene expression in response to tumor hypoxia may provide new avenues, not only for radiotherapy and chemotherapy, but also for gene therapy. In this study, we have assessed the extent of hypoxia responsiveness of various DNA constructs by the luciferase assay to help design vectors suitable for cancer therapy. Materials and Methods: Reporter plasmids were constructed with fragments of the human vascular endothelial growth factor (VEGF) and the erythropoietin (Epo) genes encompassing the putative hypoxia-responsive elements (HRE) and the pGL3 promoter vector. Test plasmids and the control pRL-CMV plasmid were cotransfected into tumor cells by the calcium phosphate method. After 6 h hypoxic treatment, the reporter assay was performed. Results: The construct pGL3/VEGF containing the 385 bp fragment of the 5' flanking region in human VEGF gene showed significant increases in luciferase activity in response to hypoxia. The hypoxic/aerobic ratios were about 3-4, and 8-12 for murine and human tumor cells, respectively. Despite the very high degree of conservation among the HREs of mammalian VEGF genes, murine cells showed lower responsiveness than human cells. We next tested the construct pGL3/Epo containing the 150 bp fragment of the 3' flanking region in the Epo gene. Luciferase activity of pGL3/Epo was increased with hypoxia only in human cell lines. The insertion of 5 copies of the 35-bp fragments derived from the VEGF HREs and 32 bp of the E1b minimal promoter resulted in maximal enhancement of hypoxia responsiveness. Conclusions: The constructs with VEGF or Epo fragments containing HRE may be useful for inducing specific gene expression in hypoxic cells. Especially, the application of multiple copies of the HREs and an E1b minimal promoter appears to have the advantage of great improvement in hypoxia responsiveness

Terminator Operon Reporter: combining a transcription termination switch with reporter technology for improved gene synthesis and synthetic biology applications.

Science.gov (United States)

Zampini, Massimiliano; Mur, Luis A J; Rees Stevens, Pauline; Pachebat, Justin A; Newbold, C James; Hayes, Finbarr; Kingston-Smith, Alison

2016-05-25

Synthetic biology is characterized by the development of novel and powerful DNA fabrication methods and by the application of engineering principles to biology. The current study describes Terminator Operon Reporter (TOR), a new gene assembly technology based on the conditional activation of a reporter gene in response to sequence errors occurring at the assembly stage of the synthetic element. These errors are monitored by a transcription terminator that is placed between the synthetic gene and reporter gene. Switching of this terminator between active and inactive states dictates the transcription status of the downstream reporter gene to provide a rapid and facile readout of the accuracy of synthetic assembly. Designed specifically and uniquely for the synthesis of protein coding genes in bacteria, TOR allows the rapid and cost-effective fabrication of synthetic constructs by employing oligonucleotides at the most basic purification level (desalted) and without the need for costly and time-consuming post-synthesis correction methods. Thus, TOR streamlines gene assembly approaches, which are central to the future development of synthetic biology.

Evaluation of multiplex ligation-dependent probe amplification analysis versus multiplex polymerase chain reaction assays in the detection of dystrophin gene rearrangements in an Iranian population subset

Directory of Open Access Journals (Sweden)

Nayereh Nouri

2014-01-01

Full Text Available Background: The Duchenne muscular dystrophy (DMD gene is located in the short arm of the X chromosome (Xp21. It spans 2.4 Mb of the human genomic DNA and is composed of 79 exons. Mutations in the Dystrophin gene result in DMD and Becker muscular dystrophy. In this study, the efficiency of multiplex ligation-dependent probe amplification (MLPA over multiplex polymerase chain reaction (PCR assays in an Iranian population was investigated. Materials and Methods: Multiplex PCR assays and MLPA analysis were carried out in 74 patients affected with DMD. Results: Multiplex PCR detected deletions in 51% of the patients with DMD. MLPA analysis could determine all the deletions detected by the multiplex PCR. Additionally, MLPA was able to identify one more deletion and duplication in patients without detectable mutations by multiplex PCR. Moreover, MLPA precisely determined the exact size of the deletions. Conclusion: Although MLPA analysis is more sensitive for detection of deletions and duplications in the dystrophin gene, multiplex PCR might be used for the initial analysis of the boys affected with DMD in the Iranian population as it was able to detect 95% of the rearrangements in patients with DMD.

Immunological Monitoring to Rationally Guide AAV Gene Therapy

Directory of Open Access Journals (Sweden)

Cedrik Michael Britten

2013-09-01

Full Text Available Recent successes with adeno-associated virus (AAV-based gene therapies fuel the hope for new treatments for hereditary diseases. Pre-existing as well as therapy-induced immune responses against both AAV and the encoded transgenes have been described and may impact on safety and efficacy of gene-therapy approaches. Consequently, monitoring of vector- and transgene-specific immunity is mandated and may rationally guide clinical development. Next to the humoral immune response, the cellular response is central in our understanding of the host reaction in gene therapy. But in contrast to the monitoring of antibodies, which has matured over many decades, sensitive and robust monitoring of T cells is a relatively new development. To make cellular immune assessments fit for purpose, investigators need to know, control and report the critical assay variables that influence the results. In addition, the quality of immune assays needs to be continuously adjusted to allow for exploratory hypothesis generation in early stages and confirmatory hypothesis validation in later stages of clinical development. The concept of immune assay harmonization which includes use of field-wide benchmarks, harmonization guidelines, and external quality control can support the context-specific evolution of immune assays. Multi-center studies pose particular challenges to sample logistics and quality control of sample specimens. Cooperative groups need to define if immune assessments should be performed in one central facility, in peripheral labs or including a combination of both. Finally, engineered reference samples that contain a defined number of antigen-specific T cells may become broadly applicable tools to control assay performance over time or across institutions.

An assay to monitor HIV-1 protease activity for the identification of novel inhibitors in T-cells.

Directory of Open Access Journals (Sweden)

Brett J Hilton

Full Text Available The emergence of resistant HIV strains, together with the severe side-effects of existing drugs and lack of development of effective anti-HIV vaccines highlight the need for novel antivirals, as well as innovative methods to facilitate their discovery. Here, we have developed an assay in T-cells to monitor the proteolytic activity of the HIV-1 protease (PR. The assay is based on the inducible expression of HIV-1 PR fused within the Gal4 DNA-binding and transactivation domains. The fusion protein binds to the Gal4 responsive element and activates the downstream reporter, enhanced green fluorescent protein (eGFP gene only in the presence of an effective PR Inhibitor (PI. Thus, in this assay, eGFP acts as a biosensor of PR activity, making it ideal for flow cytometry based screening. Furthermore, the assay was developed using retroviral technology in T-cells, thus providing an ideal environment for the screening of potential novel PIs in a cell-type that represents the natural milieu of HIV infection. Clones with the highest sensitivity, and robust, reliable and reproducible reporter activity, were selected. The assay is easily adaptable to other PR variants, a multiplex platform, as well as to high-throughput plate reader based assays and will greatly facilitate the search for novel peptide and chemical compound based PIs in T-cells.

Microbead agglutination based assays

KAUST Repository

Kodzius, Rimantas

2013-01-21

We report a simple and rapid room temperature assay for point-of-care (POC) testing that is based on specific agglutination. Agglutination tests are based on aggregation of microbeads in the presence of a specific analyte thus enabling the macroscopic observation. Such tests are most often used to explore antibody-antigen reactions. Agglutination has been used for protein assays using a biotin/streptavidin system as well as a hybridization based assay. The agglutination systems are prone to selftermination of the linking analyte, prone to active site saturation and loss of agglomeration at high analyte concentrations. We investigated the molecular target/ligand interaction, explaining the common agglutination problems related to analyte self-termination, linkage of the analyte to the same bead instead of different microbeads. We classified the agglutination process into three kinds of assays: a two- component assay, a three-component assay and a stepped three- component assay. Although we compared these three kinds of assays for recognizing DNA and protein molecules, the assay can be used for virtually any molecule, including ions and metabolites. In total, the optimized assay permits detecting analytes with high sensitivity in a short time, 5 min, at room temperature. Such a system is appropriate for POC testing.

Fatty acid cosubstrates provide β-oxidation precursors for rhamnolipid biosynthesis in Pseudomonas aeruginosa, as evidenced by isotope tracing and gene expression assays.

Science.gov (United States)

Zhang, Lin; Veres-Schalnat, Tracey A; Somogyi, Arpad; Pemberton, Jeanne E; Maier, Raina M

2012-12-01

Rhamnolipids have multiple potential applications as "green" surfactants for industry, remediation, and medicine. As a result, they have been intensively investigated to add to our understanding of their biosynthesis and improve yields. Several studies have noted that the addition of a fatty acid cosubstrate increases rhamnolipid yields, but a metabolic explanation has not been offered, partly because biosynthesis studies to date have used sugar or sugar derivatives as the carbon source. The objective of this study was to investigate the role of fatty acid cosubstrates in improving rhamnolipid biosynthesis. A combination of stable isotope tracing and gene expression assays was used to identify lipid precursors and potential lipid metabolic pathways used in rhamnolipid synthesis when fatty acid cosubstrates are present. To this end, we compared the rhamnolipids produced and their yields using either glucose alone or glucose and octadecanoic acid-d(35) as cosubstrates. Using a combination of sugar and fatty acids, the rhamnolipid yield was significantly higher (i.e., doubled) than when glucose was used alone. Two patterns of deuterium incorporation (either 1 or 15 deuterium atoms) in a single Rha-C(10) lipid chain were observed for octadecanoic acid-d(35) treatment, indicating that in the presence of a fatty acid cosubstrate, both de novo fatty acid synthesis and β-oxidation are used to provide lipid precursors for rhamnolipids. Gene expression assays showed a 200- to 600-fold increase in the expression of rhlA and rhlB rhamnolipid biosynthesis genes and a more modest increase of 3- to 4-fold of the fadA β-oxidation pathway gene when octadecanoic acid was present. Taken together, these results suggest that the simultaneous use of de novo fatty acid synthesis and β-oxidation pathways allows for higher production of lipid precursors, resulting in increased rhamnolipid yields.

Translating tumor biology into personalized treatment planning: analytical performance characteristics of the Oncotype DX Colon Cancer Assay.

Science.gov (United States)

Clark-Langone, Kim M; Sangli, Chithra; Krishnakumar, Jayadevi; Watson, Drew

2010-12-23

The Oncotype DX Colon Cancer Assay is a new diagnostic test for determining the likelihood of recurrence in stage II colon cancer patients after surgical resection using fixed paraffin embedded (FPE) primary colon tumor tissue. Like the Oncotype DX Breast Cancer Assay, this is a high complexity, multi-analyte, reverse transcription (RT) polymerase chain reaction (PCR) assay that measures the expression levels of specific cancer-related genes. By capturing the biology underlying each patient's tumor, the Oncotype DX Colon Cancer Assay provides a Recurrence Score (RS) that reflects an individualized risk of disease recurrence. Here we describe its analytical performance using pre-determined performance criteria, which is a critical component of molecular diagnostic test validation. All analytical measurements met pre-specified performance criteria. PCR amplification efficiency for all 12 assays was high, ranging from 96% to 107%, while linearity was demonstrated over an 11 log2 concentration range for all assays. Based on estimated components of variance for FPE RNA pools, analytical reproducibility and precision demonstrated low SDs for individual genes (0.16 to 0.32 CTs), gene groups (≤ 0.05 normalized/aggregate CTs) and RS (≤ 1.38 RS units). Analytical performance characteristics shown here for both individual genes and gene groups in the Oncotype DX Colon Cancer Assay demonstrate consistent translation of specific biology of individual tumors into clinically useful diagnostic information. The results of these studies illustrate how the analytical capability of the Oncotype DX Colon Cancer Assay has enabled clinical validation of a test to determine individualized recurrence risk after colon cancer surgery.

Methylated genes as new cancer biomarkers

DEFF Research Database (Denmark)

Brunner, Nils; Duffy, M.J; Napieralski, R.

2009-01-01

Aberrant hypermethylation of promoter regions in specific genes is a key event in the formation and progression of cancer. In at least some situations, these aberrant alterations occur early in the formation of malignancy and appear to be tumour specific. Multiple reports have suggested that meas......Aberrant hypermethylation of promoter regions in specific genes is a key event in the formation and progression of cancer. In at least some situations, these aberrant alterations occur early in the formation of malignancy and appear to be tumour specific. Multiple reports have suggested...... that measurement of the methylation status of the promoter regions of specific genes can aid early detection of cancer, determine prognosis and predict therapy responses. Promising DNA methylation biomarkers include the use of methylated GSTP1 for aiding the early diagnosis of prostate cancer, methylated PITX2...... for predicting outcome in lymph node-negative breast cancer patients and methylated MGMT in predicting benefit from alkylating agents in patients with glioblastomas. However, prior to clinical utilisation, these findings require validation in prospective clinical studies. Furthermore, assays for measuring gene...

Molecular MR imaging of cancer gene therapy. Ferritin transgene reporter takes the stage

International Nuclear Information System (INIS)

Hasegawa, Sumitaka; Furukawa, Takako; Saga, Tsuneo

2010-01-01

Molecular imaging using magnetic resonance (MR) imaging has been actively investigated and made rapid progress in the past decade. Applied to cancer gene therapy, the technique's high spatial resolution allows evaluation of gene delivery into target tissues. Because noninvasive monitoring of the duration, location, and magnitude of transgene expression in tumor tissues or cells provides useful information for assessing therapeutic efficacy and optimizing protocols, molecular imaging is expected to become a critical step in the success of cancer gene therapy in the near future. We present a brief overview of the current status of molecular MR imaging, especially in vivo reporter gene imaging using ferritin and other reporters, discuss its application to cancer gene therapy, and present our research of MR imaging detection of electroporation-mediated cancer gene therapy using the ferritin reporter gene. (author)

Potential economic impact of the 21-gene expression assay on the treatment of breast cancer in brazil Potencial impacto econômico do painel de expressão de 21 genes no tratamento adjuvante do câncer de mama no Brasil

Directory of Open Access Journals (Sweden)

Carlos Eduardo Bacchi

2010-01-01

Full Text Available OBJECTIVE: The 21-gene expression assay may support the decision regarding use of chemotherapy in early breast cancer. We sought to investigate the potential impact of incorporating the 21-gene expression assay into private practice in Brazil, from the perspective of third party payers. METHODS: We conducted a web-based survey with 30 (of a total of approximately 700 Brazilian medical oncologists, who were stratified by State according to the proportion of patients with breast cancer and private health insurance. We evaluated the possible treatment of first choice for patients with lymph-node-negative, estrogen-receptor-positive breast cancer, regardless of menopausal status. Interviewees were not aware of the objective of the study. Responses permitted a quantitative assessment of the care patterns regarding use of different chemotherapy regimens, type of premedication, use of growth factors, and use of intravenous antibiotics for febrile neutropenia. We calculated medication costs using the manufacturer's recommended prices. Other direct medical expenses, indirect medical costs, and non-medical costs were not included. RESULTS: Considering a hypothetical cohort of 100 patients without access to the 21-gene expression assay, the survey showed that 84 patients would receive chemotherapy. Reclassifying patient eligibility for chemotherapy according to the 21-gene expression assay would lower this number to 49. For a hypothetical cohort of 100 patients with access to the test, US$ 79,361.43 would be saved in main direct medical costs. Such results, however, would greatly vary according to tumor size: the 21-gene expression assay could increase direct medical costs in T1 tumors, and decrease costs in cases with T >2 cm. CONCLUSION: Considering the current price for the 21-gene expression assay in Brazil, our economic analysis suggests that such testing is an overall cost-saving, from the perspective of third party payers. Further, optimal use of

PCR-based detection of gene transfer vectors: application to gene doping surveillance.

Science.gov (United States)

Perez, Irene C; Le Guiner, Caroline; Ni, Weiyi; Lyles, Jennifer; Moullier, Philippe; Snyder, Richard O

2013-12-01

Athletes who illicitly use drugs to enhance their athletic performance are at risk of being banned from sports competitions. Consequently, some athletes may seek new doping methods that they expect to be capable of circumventing detection. With advances in gene transfer vector design and therapeutic gene transfer, and demonstrations of safety and therapeutic benefit in humans, there is an increased probability of the pursuit of gene doping by athletes. In anticipation of the potential for gene doping, assays have been established to directly detect complementary DNA of genes that are top candidates for use in doping, as well as vector control elements. The development of molecular assays that are capable of exposing gene doping in sports can serve as a deterrent and may also identify athletes who have illicitly used gene transfer for performance enhancement. PCR-based methods to detect foreign DNA with high reliability, sensitivity, and specificity include TaqMan real-time PCR, nested PCR, and internal threshold control PCR.

Reporter gene bioassays in environmental analysis.

Science.gov (United States)

Köhler, S; Belkin, S; Schmid, R D

2000-01-01

In parallel to the continuous development of increasingly more sophisticated physical and chemical analytical technologies for the detection of environmental pollutants, there is a progressively more urgent need also for bioassays which report not only on the presence of a chemical but also on its bioavailability and its biological effects. As a partial fulfillment of that need, there has been a rapid development of biosensors based on genetically engineered bacteria. Such microorganisms typically combine a promoter-operator, which acts as the sensing element, with reporter gene(s) coding for easily detectable proteins. These sensors have the ability to detect global parameters such as stress conditions, toxicity or DNA-damaging agents as well as specific organic and inorganic compounds. The systems described in this review, designed to detect different groups of target chemicals, vary greatly in their detection limits, specificity, response times and more. These variations reflect on their potential applicability which, for most of the constructs described, is presently rather limited. Nevertheless, present trends promise that additional improvements will make microbial biosensors an important tool for future environmental analysis.

Sterol regulatory element-binding proteins are regulators of the rat thyroid peroxidase gene in thyroid cells.

Directory of Open Access Journals (Sweden)

Christine Rauer

Full Text Available Sterol regulatory element-binding proteins (SREBPs-1c and -2, which were initially discovered as master transcriptional regulators of lipid biosynthesis and uptake, were recently identified as novel transcriptional regulators of the sodium-iodide symporter gene in the thyroid, which is essential for thyroid hormone synthesis. Based on this observation that SREBPs play a role for thyroid hormone synthesis, we hypothesized that another gene involved in thyroid hormone synthesis, the thyroid peroxidase (TPO gene, is also a target of SREBP-1c and -2. Thyroid epithelial cells treated with 25-hydroxycholesterol, which is known to inhibit SREBP activation, had about 50% decreased mRNA levels of TPO. Similarly, the mRNA level of TPO was reduced by about 50% in response to siRNA mediated knockdown of both, SREBP-1 and SREBP-2. Reporter gene assays revealed that overexpression of active SREBP-1c and -2 causes a strong transcriptional activation of the rat TPO gene, which was localized to an approximately 80 bp region in the intron 1 of the rat TPO gene. In vitro- and in vivo-binding of both, SREBP-1c and SREBP-2, to this region in the rat TPO gene could be demonstrated using gel-shift assays and chromatin immunoprecipitation. Mutation analysis of the 80 bp region of rat TPO intron 1 revealed two isolated and two overlapping SREBP-binding elements from which one, the overlapping SRE+609/InvSRE+614, was shown to be functional in reporter gene assays. In connection with recent findings that the rat NIS gene is also a SREBP target gene in the thyroid, the present findings suggest that SREBPs may be possible novel targets for pharmacological modulation of thyroid hormone synthesis.

Application of a loop-mediated isothermal amplification (LAMP assay targeting cox1 gene for the detection of Clonorchis sinensis in human fecal samples.

Directory of Open Access Journals (Sweden)

S M Mazidur Rahman

2017-10-01

Full Text Available Clonorchiasis is prevalent in the Far East, and a major health problem in endemic areas. Infected persons may experience, if not treated, serious complications such as bile stone formation, pyogenic cholangitis, and even cholangiocarcinoma. Early diagnosis and treatment are important to prevent serious complications and, therefore, the simple and reliable diagnostic method is necessary to control clonorchiasis in endemic areas, where resources for the diagnosis are limited.The loop-mediated isothermal amplification (LAMP assay has been applied for the detection of Clonorchis sinensis DNA. Six primers targeting eight locations on the cytochrome c oxidase subunit 1 gene of C. sinensis were designed for species-specific amplification using the LAMP assay. The LAMP assay was sensitive enough to detect as little as 100 fg of C. sinensis genomic DNA and the detection limit in 100 mg of stool was as low as one egg. The assay was highly specific because no cross-reactivity was observed with the DNA of other helminths, protozoa or Escherichia coli. Then, LAMP assay was applied to human fecal samples collected from an endemic area of clonorchiasis in Korea. Using samples showing consistent results by both Kato-Katz method and real-time PCR as reference standards, the LAMP assay showed 97.1% (95% CI, 90.1-99.2 of sensitivity and 100% (95% CI, 92.9-100 of specificity. In stool samples with more than 100 eggs per gram of feces, the sensitivity achieved 100%.To detect C. sinensis in human fecal samples, the LAMP assay was applied and achieved high sensitivity and specificity. The LAMP assay can be utilized in field laboratories as a powerful tool for diagnosis and epidemiological survey of clonorchiasis.

Premarket evaluations of the IMDx C. difficile for Abbott m2000 Assay and the BD Max Cdiff Assay.

Science.gov (United States)

Stellrecht, K A; Espino, A A; Maceira, V P; Nattanmai, S M; Butt, S A; Wroblewski, D; Hannett, G E; Musser, K A

2014-05-01

Clostridium difficile-associated diarrhea is a well-recognized complication of antibiotic use. Historically, diagnosing C. difficile has been difficult, as antigen assays are insensitive and culture-based methods require several days to yield results. Nucleic acid amplification tests (NAATs) are quickly becoming the standard of care. We compared the performance of two automated investigational/research use only (IUO/RUO) NAATs for the detection of C. difficile toxin genes, the IMDx C. difficile for Abbott m2000 Assay (IMDx) and the BD Max Cdiff Assay (Max). A prospective analysis of 111 stool specimens received in the laboratory for C. difficile testing by the laboratory's test of record (TOR), the BD GeneOhm Cdiff Assay, and a retrospective analysis of 88 specimens previously determined to be positive for C. difficile were included in the study. One prospective specimen was excluded due to loss to follow-up discrepancy analysis. Of the remaining 198 specimens, 90 were positive by all three methods, 9 were positive by TOR and Max, and 3 were positive by TOR only. One negative specimen was initially inhibitory by Max. The remaining 95 specimens were negative by all methods. Toxigenic C. difficile culture was performed on the 12 discrepant samples. True C. difficile-positive status was defined as either positive by all three amplification assays or positive by toxigenic culture. Based on this definition, the sensitivity and specificity were 96.9% and 95% for Max and 92.8% and 100% for IMDx. In summary, both highly automated systems demonstrated excellent performance, and each has individual benefits, which will ensure that they will both have a niche in clinical laboratories.

Exploiting Pre-rRNA Processing in Diamond Blackfan Anemia Gene Discovery and Diagnosis

Science.gov (United States)

Farrar, Jason E.; Quarello, Paola; Fisher, Ross; O’Brien, Kelly A.; Aspesi, Anna; Parrella, Sara; Henson, Adrianna L.; Seidel, Nancy E.; Atsidaftos, Eva; Prakash, Supraja; Bari, Shahla; Garelli, Emanuela; Arceci, Robert J.; Dianzani, Irma; Ramenghi, Ugo; Vlachos, Adrianna; Lipton, Jeffrey M.; Bodine, David M.; Ellis, Steven R.

2014-01-01

Diamond Blackfan anemia (DBA), a syndrome primarily characterized by anemia and physical abnormalities, is one among a group of related inherited bone marrow failure syndromes (IBMFS) which share overlapping clinical features. Heterozygous mutations or single-copy deletions have been identified in 12 ribosomal protein genes in approximately 60% of DBA cases, with the genetic etiology unexplained in most remaining patients. Unlike many IBMFS, for which functional screening assays complement clinical and genetic findings, suspected DBA in the absence of typical alterations of the known genes must frequently be diagnosed after exclusion of other IBMFS. We report here a novel deletion in a child that presented such a diagnostic challenge and prompted development of a novel functional assay that can assist in the diagnosis of a significant fraction of patients with DBA. The ribosomal proteins affected in DBA are required for pre-rRNA processing, a process which can be interrogated to monitor steps in the maturation of 40S and 60S ribosomal subunits. In contrast to prior methods used to assess pre-rRNA processing, the assay reported here, based on capillary electrophoresis measurement of the maturation of rRNA in pre-60S ribosomal subunits, would be readily amenable to use in diagnostic laboratories. In addition to utility as a diagnostic tool, we applied this technique to gene discovery in DBA, resulting in the identification of RPL31 as a novel DBA gene. PMID:25042156

Targeted resequencing and variant validation using pxlence PCR assays

Directory of Open Access Journals (Sweden)

Frauke Coppieters

2016-01-01

Full Text Available The advent of next-generation sequencing technologies had a profound impact on molecular diagnostics. PCR is a popular method for target enrichment of disease gene panels. Using our proprietary primer-design pipeline, primerXL, we have created almost one million assays covering over 98% of the human exome. Here we describe the assay specification and both in silico and wet-lab validation of a selected set of 2294 assays using both next-generation sequencing and Sanger sequencing. Using a universal PCR protocol without optimization, these assays result in high coverage uniformity and limited non-specific coverage. In addition, data indicates a positive correlation between the predictive in silico specificity score and the amount of assay non-specific coverage.

Cytochrome P4501A induction in avian hepatocyte cultures exposed to polychlorinated biphenyls: Comparisons with AHR1-mediated reporter gene activity and in ovo toxicity

Energy Technology Data Exchange (ETDEWEB)

Manning, Gillian E., E-mail: gmann017@uottawa.ca [Centre for Advanced Research in Environmental Genomics, Department of Biology, University of Ottawa, Ottawa, ON, Canada K1N 6N5 (Canada); Environment Canada, National Wildlife Research Centre, Ottawa, ON, Canada K1A 0H3 (Canada); Mundy, Lukas J., E-mail: lukas.mundy@ec.gc.ca [Centre for Advanced Research in Environmental Genomics, Department of Biology, University of Ottawa, Ottawa, ON, Canada K1N 6N5 (Canada); Environment Canada, National Wildlife Research Centre, Ottawa, ON, Canada K1A 0H3 (Canada); Crump, Doug, E-mail: doug.crump@ec.gc.ca [Environment Canada, National Wildlife Research Centre, Ottawa, ON, Canada K1A 0H3 (Canada); Jones, Stephanie P., E-mail: stephanie.jones@ec.gc.ca [Environment Canada, National Wildlife Research Centre, Ottawa, ON, Canada K1A 0H3 (Canada); Chiu, Suzanne, E-mail: suzanne.chiu@ec.gc.ca [Environment Canada, National Wildlife Research Centre, Ottawa, ON, Canada K1A 0H3 (Canada); Klein, Jeff, E-mail: jeffery@well-labs.com [Wellington Laboratories Inc., Research Division, Guelph, ON, Canada N1G 3chsM5 (Canada); Konstantinov, Alex, E-mail: alex@well-labs.com [Wellington Laboratories Inc., Research Division, Guelph, ON, Canada N1G 3chsM5 (Canada); Potter, Dave, E-mail: dpotter@well-labs.com [Wellington Laboratories Inc., Research Division, Guelph, ON, Canada N1G 3chsM5 (Canada); Kennedy, Sean W., E-mail: sean.kennedy@ec.gc.ca [Centre for Advanced Research in Environmental Genomics, Department of Biology, University of Ottawa, Ottawa, ON, Canada K1N 6N5 (Canada); Environment Canada, National Wildlife Research Centre, Ottawa, ON, Canada K1A 0H3 (Canada)

2013-01-01

Avian-specific toxic equivalency factors (TEFs) were developed by the World Health Organization to simplify environmental risk assessments of dioxin-like compounds (DLCs), but TEFs do not account for differences in the toxic and biochemical potencies of DLCs among species of birds. Such variability may be due to differences in species sensitivity to individual DLCs. The sensitivity of avian species to DLCs was recently associated with the identity of amino acids 324 and 380 in the aryl hydrocarbon receptor 1 (AHR1) ligand binding domain. A luciferase reporter gene (LRG) assay, measuring AHR1-mediated induction of a cytochrome P450 1A5 (CYP1A5) reporter gene, in combination with a species' AHR1 ligand binding domain sequence, were also shown to predict avian species sensitivity to polychlorinated biphenyls (PCBs) and PCB relative potency in a given species. The goals of the present study were to (1) characterize the concentration-dependent effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin and PCBs 126, 77, 105 and 118 on induction of ethoxyresorufin O-deethylase (EROD) activity and CYP1A4/5 mRNA in chicken, ring-necked pheasant and Japanese quail embryo hepatocytes and (2) compare these in vitro results to those previously generated by the LRG assay and in ovo toxicity studies. EROD activity and CYP1A4/5 mRNA expression data support and complement the findings of the LRG assay. CYP1A enzyme activity and mRNA expression were significantly correlated both with luciferase activity and in ovo toxicity induced by PCBs. Relative potency values were generally similar between the LRG and EROD assays and indicate that the relative potency of some PCBs may differ among species. -- Highlights: ► The chicken isn't the most sensitive species to CYP1A induction by PCB 105 and 118. ► The relative potency of PCBs differs between avian species. ► EROD activity was correlated with luciferase activity from the LRG assay. ► EROD activity was a better predictor of

Cytochrome P4501A induction in avian hepatocyte cultures exposed to polychlorinated biphenyls: Comparisons with AHR1-mediated reporter gene activity and in ovo toxicity

International Nuclear Information System (INIS)

Manning, Gillian E.; Mundy, Lukas J.; Crump, Doug; Jones, Stephanie P.; Chiu, Suzanne; Klein, Jeff; Konstantinov, Alex; Potter, Dave; Kennedy, Sean W.

2013-01-01

Avian-specific toxic equivalency factors (TEFs) were developed by the World Health Organization to simplify environmental risk assessments of dioxin-like compounds (DLCs), but TEFs do not account for differences in the toxic and biochemical potencies of DLCs among species of birds. Such variability may be due to differences in species sensitivity to individual DLCs. The sensitivity of avian species to DLCs was recently associated with the identity of amino acids 324 and 380 in the aryl hydrocarbon receptor 1 (AHR1) ligand binding domain. A luciferase reporter gene (LRG) assay, measuring AHR1-mediated induction of a cytochrome P450 1A5 (CYP1A5) reporter gene, in combination with a species' AHR1 ligand binding domain sequence, were also shown to predict avian species sensitivity to polychlorinated biphenyls (PCBs) and PCB relative potency in a given species. The goals of the present study were to (1) characterize the concentration-dependent effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin and PCBs 126, 77, 105 and 118 on induction of ethoxyresorufin O-deethylase (EROD) activity and CYP1A4/5 mRNA in chicken, ring-necked pheasant and Japanese quail embryo hepatocytes and (2) compare these in vitro results to those previously generated by the LRG assay and in ovo toxicity studies. EROD activity and CYP1A4/5 mRNA expression data support and complement the findings of the LRG assay. CYP1A enzyme activity and mRNA expression were significantly correlated both with luciferase activity and in ovo toxicity induced by PCBs. Relative potency values were generally similar between the LRG and EROD assays and indicate that the relative potency of some PCBs may differ among species. -- Highlights: ► The chicken isn't the most sensitive species to CYP1A induction by PCB 105 and 118. ► The relative potency of PCBs differs between avian species. ► EROD activity was correlated with luciferase activity from the LRG assay. ► EROD activity was a better predictor of toxicity than CYP

Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data

DEFF Research Database (Denmark)

Kannan, Soumya; Sams, Thomas; Maury, Jérôme

2018-01-01

activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system......Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds......, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter...

Development of fluorescent methods for DNA methyltransferase assay

Science.gov (United States)

Li, Yueying; Zou, Xiaoran; Ma, Fei; Tang, Bo; Zhang, Chun-yang

2017-03-01

DNA methylation modified by DNA methyltransferase (MTase) plays an important role in regulating gene transcription, cell growth and proliferation. The aberrant DNA MTase activity may lead to a variety of human diseases including cancers. Therefore, accurate and sensitive detection of DNA MTase activity is crucial to biomedical research, clinical diagnostics and therapy. However, conventional DNA MTase assays often suffer from labor-intensive operations and time-consuming procedures. Alternatively, fluorescent methods have significant advantages of simplicity and high sensitivity, and have been widely applied for DNA MTase assay. In this review, we summarize the recent advances in the development of fluorescent methods for DNA MTase assay. These emerging methods include amplification-free and the amplification-assisted assays. Moreover, we discuss the challenges and future directions of this area.

A tissue biopsy-based epigenetic multiplex PCR assay for prostate cancer detection

Directory of Open Access Journals (Sweden)

Van Neste Leander

2012-06-01

Full Text Available Abstract Background PSA-directed prostate cancer screening leads to a high rate of false positive identifications and an unnecessary biopsy burden. Epigenetic biomarkers have proven useful, exhibiting frequent and abundant inactivation of tumor suppressor genes through such mechanisms. An epigenetic, multiplex PCR test for prostate cancer diagnosis could provide physicians with better tools to help their patients. Biomarkers like GSTP1, APC and RASSF1 have demonstrated involvement with prostate cancer, with the latter two genes playing prominent roles in the field effect. The epigenetic states of these genes can be used to assess the likelihood of cancer presence or absence. Results An initial test cohort of 30 prostate cancer-positive samples and 12 cancer-negative samples was used as basis for the development and optimization of an epigenetic multiplex assay based on the GSTP1, APC and RASSF1 genes, using methylation specific PCR (MSP. The effect of prostate needle core biopsy sample volume and age of formalin-fixed paraffin-embedded (FFPE samples was evaluated on an independent follow-up cohort of 51 cancer-positive patients. Multiplexing affects copy number calculations in a consistent way per assay. Methylation ratios are therefore altered compared to the respective singleplex assays, but the correlation with patient outcome remains equivalent. In addition, tissue-biopsy samples as small as 20 μm can be used to detect methylation in a reliable manner. The age of FFPE-samples does have a negative impact on DNA quality and quantity. Conclusions The developed multiplex assay appears functionally similar to individual singleplex assays, with the benefit of lower tissue requirements, lower cost and decreased signal variation. This assay can be applied to small biopsy specimens, down to 20 microns, widening clinical applicability. Increasing the sample volume can compensate the loss of DNA quality and quantity in older samples.

Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.

Science.gov (United States)

Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

2015-12-10

D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.

Random assay in radioimmunoassay: Feasibility and application compared with batch assay

Energy Technology Data Exchange (ETDEWEB)

Lee, Jung Min; Lee, Hwan Hee; Park, Sohyun; Kim, Tae Sung; Kim, Seok Ki [Dept. of Nuclear MedicineNational Cancer Center, Goyang (Korea, Republic of)

2016-12-15

The batch assay has been conventionally used for radioimmunoassay (RIA) because of its technical robustness and practical convenience. However, it has limitations in terms of the relative lag of report time due to the necessity of multiple assays in a small number of samples compared with the random assay technique. In this study, we aimed to verify whether the random assay technique can be applied in RIA and is feasible in daily practice. The coefficients of variation (CVs) of eight standard curves within a single kit were calculated in a CA-125 immunoradiometric assay (IRMA) for the reference of the practically ideal CV of the CA-125 kit. Ten standard curves of 10 kits from 2 prospectively collected lots (pLot) and 85 standard curves of 85 kits from 3 retrospectively collected lots (Lot) were obtained. Additionally, the raw measurement data of both 170 control references and 1123 patients' sera were collected retrospectively between December 2015 and January 2016. A standard curve of the first kit of each lot was used as a master standard curve for a random assay. The CVs of inter-kits were analyzed in each lot, respectively. All raw measurements were normalized by decay and radioactivity. The CA-125 values from control samples and patients' sera were compared using the original batch assay and random assay. In standard curve analysis, the CVs of inter-kits in pLots and Lots were comparable to those within a single kit. The CVs from the random assay with normalization were similar to those from the batch assay in the control samples (CVs % of low/high concentration; Lot1 2.71/1.91, Lot2 2.35/1.83, Lot3 2.83/2.08 vs. Lot1 2.05/1.21, Lot2 1.66/1.48, Lot3 2.41/2.14). The ICCs between the batch assay and random assay using patients' sera were satisfactory (Lot1 1.00, Lot2 0.999, Lot3 1.00). The random assay technique could be successfully applied to the conventional CA-125 IRMA kits. The random assay showed strong agreement with the batch assay. The

Associations between metabolic syndrome, breast cancer recurrence, and the 21-gene recurrence score assay.

Science.gov (United States)

Muniz, Jeanette; Kidwell, Kelley M; Henry, N Lynn

2016-06-01

The 21-gene recurrence score (RS) assay is prognostic in estrogen receptor-positive (HR+), HER2-negative, node-negative breast cancer (BC). The interaction between RS and host factors including metabolic syndrome (MS) is unclear. MS conditions such as obesity have been associated with worse BC prognosis. The aim of this study was to identify associations between presence of MS conditions and RS group or breast cancer recurrence. Demographic, pathologic, and treatment data, MS criteria, and menopausal status were abstracted from medical records of women with stage I-II, HR+, HER2-negative BC evaluated with the RS assay at a single institution since 2005. MS was defined as presence of ≥3 of the following within 2 years of diagnosis: body mass index ≥27.7 kg/m(2); hypertension; impaired fasting glucose; HDL <50 mg/dL; hypertriglyceridemia. Of 533 eligible women, 22 % had MS. MS was more common in post- vs premenopausal women (30 vs 9 %; P < 0.0001). There was no significant association between RS group and overall MS status or any individual criterion, controlling for stage, and no association after stratification by menopausal status. Postmenopausal status was associated with higher RS group (P = 0.039), independent of stage. With 4.2-year median follow-up, no association between disease recurrence and MS was identified. Although MS has been associated with worse BC outcomes, we were unable to identify associations between RS group and MS criteria. Identification of prognostic factors other than RS that underlie this higher risk will be important for optimizing breast cancer treatment decision-making in patients with MS.

Feasibility of sodium/iodide symporter gene as a new imaging reporter gene: comparison with HSV1-tk

International Nuclear Information System (INIS)

Shin, Jae Hoon; Chung, June-Key; Lee, Yong Jin; Kim, Kwang Il; Kang, Joo Hyun; Jeong, Jae Min; Lee, Dong Soo; Kim, Chul Woo; Lee, Myung Chul

2004-01-01

Positron emission tomography (PET) imaging reporter genes, such as HSV1-tk and D 2 receptor genes, make it possible to visualise gene expression non-invasively and repetitively in vivo. However, these systems require the synthesis of complicated substrates and the availability of expensive PET equipment. Expression of the sodium/iodide symporter (NIS) gene can be easily monitored with radioiodines and technetium-99m using a gamma camera. To evaluate the possibility of using NIS as an imaging reporter gene, we compared its characteristics with those of the conventional HSV1-tk gene. The CM cell line was made by transfecting the HSV1-tk gene into CT-26 (mouse colon carcinoma cell line). The CTN and CMN cell lines were then made by transfecting the NIS gene into CT-26 and CM. We measured the uptake of iodine-125 iodovinyldeoxyuridine ([ 125 I]IVDU) and 125 I to evaluate the expression of the HSV1-tk and NIS genes, respectively. Each cell line was injected into four flank sites in Balb/c mice. The biodistribution study was performed after intravenously injecting [ 125 I]IVDU and 131 I, and 131 I scintigraphy was performed for the evaluation of NIS expression. In vitro studies indicated that CTN and CMN had 40- to 79-fold and 150- to 256-fold higher uptake of 125 I than CT-26 and CM, respectively. Furthermore, CM and CMN showed 57- to 69-fold higher uptake of [ 125 I]IVDU than CT-26 and CTN. NIS gene expression and 125 I accumulation were found to be directly correlated (R 2 =0.923), as were HSV1-tk gene expression and [ 125 I]IVDU accumulation (R 2 =0.956). Calculated signal per unit NIS and HSV1-tk mRNA expression was 23,240±3,755 cpm and 34,039±5,346 cpm, respectively. In vivo study indicated that CTN and CMN had 2.3- and 5.8-fold higher uptake of 131 I than CT-26 and CM, and 1.8- and 3.5-fold higher uptake of [ 125 I]IVDU than CT-26 and CTN. Scintigraphy using 131 I easily visualised CTN and CMN tumours. In conclusion, the NIS gene may be viewed as an imaging

Establishment of recombinase polymerase amplification assay for five hemorrhagic fever-related viruses

Directory of Open Access Journals (Sweden)

Xue-feng CAO

2017-08-01

Full Text Available Objective To establish a one-step recombinase polymerase amplification (RPA method for pathogen screening and rapid detection in the field targeting for five hemorrhagic fever related viruses (Zaire ebola virus, Sudan ebola virus, Marburg virus, Lassa virus and Yellow fever virus. Methods The specific nucleic acid (NA fragments of each virus were selected as target genes by genome sequence analysis, and the primers and probes for RPA assays were designed according to the sequence. A series of diluted template genes were used for RPA detection to determine the sensitivity. The hemorrhagic fever-related viral nucleic acids were used for RPA detection to determine the specificity. The amplification experiments were carried out at different temperature ranging from 37℃ to 42℃ to validate the reaction temperature range. Results The RPA reaction systems of the five hemorrhagic fever viruses could effectively amplify the target genes, the sensitivities were between 1.5×102 and 1.5×103 copies. No cross reactions existed with the other hemorrhagic fever-related viral genes. Meanwhile, RPA assay could effectively amplify the target genes at 37-42℃. Conclusion The isothermal RPA assays of five hemorrhagic fever viruses are established, which may amply target genes fast and react at a wide temperature range, and be potentially useful for in field pathogens detection. DOI: 10.11855/j.issn.0577-7402.2017.06.09

Endogenous Reference Genes and Their Quantitative Real-Time PCR Assays for Genetically Modified Bread Wheat (Triticum aestivum L.) Detection.

Science.gov (United States)

Yang, Litao; Quan, Sheng; Zhang, Dabing

2017-01-01

Endogenous reference genes (ERG) and their derivate analytical methods are standard requirements for analysis of genetically modified organisms (GMOs). Development and validation of suitable ERGs is the primary step for establishing assays that monitoring the genetically modified (GM) contents in food/feed samples. Herein, we give a review of the ERGs currently used for GM wheat analysis, such as ACC1, PKABA1, ALMT1, and Waxy-D1, as well as their performances in GM wheat analysis. Also, we discussed one model for developing and validating one ideal RG for one plant species based on our previous research work.

Translating tumor biology into personalized treatment planning: analytical performance characteristics of the Oncotype DX® Colon Cancer Assay

International Nuclear Information System (INIS)

Clark-Langone, Kim M; Sangli, Chithra; Krishnakumar, Jayadevi; Watson, Drew

2010-01-01

The Oncotype DX ® Colon Cancer Assay is a new diagnostic test for determining the likelihood of recurrence in stage II colon cancer patients after surgical resection using fixed paraffin embedded (FPE) primary colon tumor tissue. Like the Oncotype DX Breast Cancer Assay, this is a high complexity, multi-analyte, reverse transcription (RT) polymerase chain reaction (PCR) assay that measures the expression levels of specific cancer-related genes. By capturing the biology underlying each patient's tumor, the Oncotype DX Colon Cancer Assay provides a Recurrence Score (RS) that reflects an individualized risk of disease recurrence. Here we describe its analytical performance using pre-determined performance criteria, which is a critical component of molecular diagnostic test validation. All analytical measurements met pre-specified performance criteria. PCR amplification efficiency for all 12 assays was high, ranging from 96% to 107%, while linearity was demonstrated over an 11 log 2 concentration range for all assays. Based on estimated components of variance for FPE RNA pools, analytical reproducibility and precision demonstrated low SDs for individual genes (0.16 to 0.32 C T s), gene groups (≤0.05 normalized/aggregate C T s) and RS (≤1.38 RS units). Analytical performance characteristics shown here for both individual genes and gene groups in the Oncotype DX Colon Cancer Assay demonstrate consistent translation of specific biology of individual tumors into clinically useful diagnostic information. The results of these studies illustrate how the analytical capability of the Oncotype DX Colon Cancer Assay has enabled clinical validation of a test to determine individualized recurrence risk after colon cancer surgery

Translating tumor biology into personalized treatment planning: analytical performance characteristics of the Oncotype DX® Colon Cancer Assay

Directory of Open Access Journals (Sweden)

Krishnakumar Jayadevi

2010-12-01

Full Text Available Abstract Background The Oncotype DX® Colon Cancer Assay is a new diagnostic test for determining the likelihood of recurrence in stage II colon cancer patients after surgical resection using fixed paraffin embedded (FPE primary colon tumor tissue. Like the Oncotype DX Breast Cancer Assay, this is a high complexity, multi-analyte, reverse transcription (RT polymerase chain reaction (PCR assay that measures the expression levels of specific cancer-related genes. By capturing the biology underlying each patient's tumor, the Oncotype DX Colon Cancer Assay provides a Recurrence Score (RS that reflects an individualized risk of disease recurrence. Here we describe its analytical performance using pre-determined performance criteria, which is a critical component of molecular diagnostic test validation. Results All analytical measurements met pre-specified performance criteria. PCR amplification efficiency for all 12 assays was high, ranging from 96% to 107%, while linearity was demonstrated over an 11 log2 concentration range for all assays. Based on estimated components of variance for FPE RNA pools, analytical reproducibility and precision demonstrated low SDs for individual genes (0.16 to 0.32 CTs, gene groups (≤0.05 normalized/aggregate CTs and RS (≤1.38 RS units. Conclusions Analytical performance characteristics shown here for both individual genes and gene groups in the Oncotype DX Colon Cancer Assay demonstrate consistent translation of specific biology of individual tumors into clinically useful diagnostic information. The results of these studies illustrate how the analytical capability of the Oncotype DX Colon Cancer Assay has enabled clinical validation of a test to determine individualized recurrence risk after colon cancer surgery.

Improvement of the green fluorescent protein reporter system in Leishmania spp. for the in vitro and in vivo screening of antileishmanial drugs.

Science.gov (United States)

Pulido, Sergio A; Muñoz, Diana L; Restrepo, Adriana M; Mesa, Carol V; Alzate, Juan F; Vélez, Iván D; Robledo, Sara M

2012-04-01

Development of new therapeutic approaches for leishmaniasis treatment requires new high throughput screening methodologies for the antileishmanial activity of the new compounds both in vitro and in vivo. Reporter genes as the GFP have become one of the most promissory and widely used tools for drug screening in several models, since it offers live imaging, high sensibility, specificity and flexibility; additionally, the use of GFP as a reporter gene in screening assays eliminates all the drawbacks presented in conventional assays and also those technical problems found using other reporter genes. The utility of the GFP as a reporter gene in drug screening assays with Leishmania parasites depends on the homogeneity and stability of the GFP transfected strains. Stable expression of the GFP in the Old World Leishmania species has been demonstrated using integration vectors; however, no reports exist yet about the success of this methodology in the New World species. Here we report the generation of New World Leishmania strains expressing the GFP protein from an integration vector, which replaces one copy of the 18S RNA in the chromosome with the GFP coding sequence by homologous recombination. We also prove that the expression of the integrated GFP is stable and homogeneous in the transfected parasites after months in culture without selective pressure or during its use in hamster infection assays. The fluorescent strains are useful for in vitro, ex vivo and in vivo drug screening assays since no considerable variations in virulence or infectivity where seen attributable to the genetic manipulation during both in vitro and in vivo infection experiments. The platform described here for drug testing assays based on the use of stable fluorescent Leishmania strains coupled to flow cytometry and fluorescent microscopy is more sensitive, more specific and faster than conventional assays used normally for the evaluation of compounds with potential antileishmanial activity

Molecular surveillance of true nontypeable Haemophilus influenzae: an evaluation of PCR screening assays.

Science.gov (United States)

Binks, Michael J; Temple, Beth; Kirkham, Lea-Ann; Wiertsema, Selma P; Dunne, Eileen M; Richmond, Peter C; Marsh, Robyn L; Leach, Amanda J; Smith-Vaughan, Heidi C

2012-01-01

Unambiguous identification of nontypeable Haemophilus influenzae (NTHi) is not possible by conventional microbiology. Molecular characterisation of phenotypically defined NTHi isolates suggests that up to 40% are Haemophilus haemolyticus (Hh); however, the genetic similarity of NTHi and Hh limits the power of simple molecular techniques such as PCR for species discrimination. Here we assess the ability of previously published and novel PCR-based assays to identify true NTHi. Sixty phenotypic NTHi isolates, classified by a dual 16S rRNA gene PCR algorithm as NTHi (n = 22), Hh (n = 27) or equivocal (n = 11), were further characterised by sequencing of the 16S rRNA and recA genes then interrogated by PCR-based assays targeting the omp P2, omp P6, lgtC, hpd, 16S rRNA, fucK and iga genes. The sequencing data and PCR results were used to define NTHi for this study. Two hpd real time PCR assays (hpd#1 and hpd#3) and the conventional iga PCR assay were equally efficient at differentiating study-defined NTHi from Hh, each with a receiver operator characteristic curve area of 0.90 [0.83; 0.98]. The hpd#1 and hpd#3 assays were completely specific against a panel of common respiratory bacteria, unlike the iga PCR, and the hpd#3 assay was able to detect below 10 copies per reaction. Our data suggest an evolutionary continuum between NTHi and Hh and therefore no single gene target could completely differentiate NTHi from Hh. The hpd#3 real time PCR assay proved to be the superior method for discrimination of NTHi from closely related Haemophilus species with the added potential for quantification of H. influenzae directly from specimens. We suggest the hpd#3 assay would be suitable for routine NTHi surveillance and to assess the impact of antibiotics and vaccines, on H. influenzae carriage rates, carriage density, and disease.

Molecular surveillance of true nontypeable Haemophilus influenzae: an evaluation of PCR screening assays.

Directory of Open Access Journals (Sweden)

Michael J Binks

Full Text Available BACKGROUND: Unambiguous identification of nontypeable Haemophilus influenzae (NTHi is not possible by conventional microbiology. Molecular characterisation of phenotypically defined NTHi isolates suggests that up to 40% are Haemophilus haemolyticus (Hh; however, the genetic similarity of NTHi and Hh limits the power of simple molecular techniques such as PCR for species discrimination. METHODOLOGY/PRINCIPAL FINDINGS: Here we assess the ability of previously published and novel PCR-based assays to identify true NTHi. Sixty phenotypic NTHi isolates, classified by a dual 16S rRNA gene PCR algorithm as NTHi (n = 22, Hh (n = 27 or equivocal (n = 11, were further characterised by sequencing of the 16S rRNA and recA genes then interrogated by PCR-based assays targeting the omp P2, omp P6, lgtC, hpd, 16S rRNA, fucK and iga genes. The sequencing data and PCR results were used to define NTHi for this study. Two hpd real time PCR assays (hpd#1 and hpd#3 and the conventional iga PCR assay were equally efficient at differentiating study-defined NTHi from Hh, each with a receiver operator characteristic curve area of 0.90 [0.83; 0.98]. The hpd#1 and hpd#3 assays were completely specific against a panel of common respiratory bacteria, unlike the iga PCR, and the hpd#3 assay was able to detect below 10 copies per reaction. CONCLUSIONS/SIGNIFICANCE: Our data suggest an evolutionary continuum between NTHi and Hh and therefore no single gene target could completely differentiate NTHi from Hh. The hpd#3 real time PCR assay proved to be the superior method for discrimination of NTHi from closely related Haemophilus species with the added potential for quantification of H. influenzae directly from specimens. We suggest the hpd#3 assay would be suitable for routine NTHi surveillance and to assess the impact of antibiotics and vaccines, on H. influenzae carriage rates, carriage density, and disease.

Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report

Directory of Open Access Journals (Sweden)

Lee SH

2016-04-01

Full Text Available Sin Hang Lee,1,21Pathology Department, Milford Hospital, Milford, CT, USA; 2Milford Molecular Diagnostics, Milford, CT, USA Abstract: Lyme disease (LD, the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. Keywords: Lyme disease, Borrelia burgdorferi, homeologous 16S rRNA genes, DNA sequencing

Biomonitoring of genotoxic risk in radar facility workers: comparison of the comet assay with micronucleus assay and chromatid breakage assay

International Nuclear Information System (INIS)

Garaj-Vrhovac, V.; Kopjar, N.

2003-01-01

Genotoxic risks of occupational exposure in a radar facility were evaluated by using alkaline comet assay, micronucleus assay and chromatid breakage assay on peripheral blood leukocytes in exposed subjects and corresponding controls. Results show that occupational exposure to microwave radiation correlates with an increase of genome damage in somatic cells. The levels of DNA damage in exposed subjects determined by using alkaline comet assay were increased compared to control and showed interindividual variations. Incidence of micronuclei was also significantly increased compared to baseline control values. After short exposure of cultured lymphocytes to bleomycin, cells of occupationally exposed subjects responded with high numbers of chromatid breaks. Although the level of chromosome damage generated by bleomycin varied greatly between individuals, in exposed subjects a significantly elevated number of chromatid breaks was observed. Our results support data reported in literature indicating that microwave radiation represents a potential DNA-damaging hazard. Alkaline comet assay is confirmed as a sensitive and highly reproducible technique for detection of primary DNA damage inflicted in somatic cells. Micronucleus assay was confirmed as reliable bio-markers of effect and chromatid breakage assay as sensitive bio-marker of individual cancer susceptibility. The results obtained also confirm the necessity to improve measures and to perform accurate health surveillance of individuals occupationally exposed to microwave radiation

Using the 2A Protein Coexpression System: Multicistronic 2A Vectors Expressing Gene(s) of Interest and Reporter Proteins.

Science.gov (United States)

Luke, Garry A; Ryan, Martin D

2018-01-01

To date, a huge range of different proteins-many with cotranslational and posttranslational subcellular localization signals-have been coexpressed together with various reporter proteins in vitro and in vivo using 2A peptides. The pros and cons of 2A co-expression technology are considered below, followed by a simple example of a "how to" protocol to concatenate multiple genes of interest, together with a reporter gene, into a single gene linked via 2As for easy identification or selection of transduced cells.

Development and optimization of a cell-based assay for the selection of synthetic compounds that potentiate bone morphogenetic protein-2 activity.

Science.gov (United States)

Okada, Motohiro; Sangadala, Sreedhara; Liu, Yunshan; Yoshida, Munehito; Reddy, Boojala Vijay B; Titus, Louisa; Boden, Scott D

2009-12-01

The requirement of large amounts of the recombinant human bone morphogenetic protein-2 (BMP-2) produces a huge translational barrier for its routine clinical use due to high cost. This leads to an urgent need to develop alternative methods to lower costs and/or increase efficacies for using BMP-2. In this study, we describe the development and optimization of a cell-based assay that is sensitive, reproducible, and reliable in identifying reagents that potentiate the effects of BMP-2 in inducing transdifferentiation of C2C12 myoblasts into the osteoblastic phenotype. The assay is based on a BMP-responsive Smad1-driven luciferase reporter gene. LIM mineralization protein-1 (LMP-1) is a novel intracellular LIM domain protein that has been shown by our group to enhance cellular responsiveness to BMP-2. Our previous report elucidated that the binding of LMP-1 with the WW2 domain in Smad ubiquitin regulatory factor-1 (Smurf1) rescues the osteogenic Smads from degradation. Here, using the optimized cell-based assay, we first evaluated the activity of the recombinantly prepared proteins, LMP-1, and its mutant (LMP-1DeltaSmurf1) that lacks the Smurf1-WW2 domain-binding motif. Both the wild type and the mutant proteins were engineered to contain an 11-amino acid HIV-TAT protein derived membrane transduction domain to aid the cellular delivery of recombinant proteins. The cell-based reporter assay confirmed that LMP-1 potentiates the BMP-induced stimulation of C2C12 cells towards the osteoblastic phenotype. The potentiating effect of LMP-1 was significantly reduced when a specific-motif known to interact with Smurf1 was mutated. We validated the results obtained in the reporter assay by also monitoring the expression of mRNA for osteocalcin and alkaline phosphatase (ALP) which is widely accepted osteoblast differentiation marker genes. Finally, we provide further confirmation of our results by measuring the activity of alkaline phosphatase in support of the accuracy and

Hormone Receptor Expression Analyses in Neoplastic and Non-Neoplastic Canine Mammary Tissue by a Bead Based Multiplex Branched DNA Assay: A Gene Expression Study in Fresh Frozen and Formalin-Fixed, Paraffin-Embedded Samples.

Directory of Open Access Journals (Sweden)

Annika Mohr

Full Text Available Immunohistochemistry (IHC is currently considered the method of choice for steroid hormone receptor status evaluation in human breast cancer and, therefore, it is commonly utilized for assessing canine mammary tumors. In case of low hormone receptor expression, IHC is limited and thus is complemented by molecular analyses. In the present study, a multiplex bDNA assay was evaluated as a method for hormone receptor gene expression detection in canine mammary tissues. Estrogen receptor (ESR1, progesterone receptor (PGR, prolactin receptor (PRLR and growth hormone receptor (GHR gene expressions were evaluated in neoplastic and non-neoplastic canine mammary tissues. A set of 119 fresh frozen and 180 formalin-fixed, paraffin-embedded (FFPE was comparatively analyzed and used for assay evaluation. Furthermore, a possible association between the hormone receptor expression in different histological subtypes of canine malignant mammary tumors and the castration status, breed and invasive growth of the tumor were analyzed. The multiplex bDNA assay proved to be more sensitive for fresh frozen specimens. Hormone receptor expression found was significantly decreased in malignant mammary tumors in comparison to non-neoplastic tissue and benign mammary tumors. Among the histological subtypes the lowest gene expression levels of ESR1, PGR and PRLR were found in solid, anaplastic and ductal carcinomas. In summary, the evaluation showed that the measurement of hormone receptors with the multiplex bDNA assay represents a practicable method for obtaining detailed quantitative information about gene expression in canine mammary tissue for future studies. Still, comparison with IHC or quantitative real-time PCR is needed for further validation of the present method.

Lead Slowing-Down Spectrometry for Spent Fuel Assay: FY11 Status Report

International Nuclear Information System (INIS)

Warren, Glen A.; Casella, Andrew M.; Haight, R.C.; Anderson, Kevin K.; Danon, Yaron; Hatchett, D.; Becker, Bjorn; Devlin, M.; Imel, G.R.; Beller, D.; Gavron, A.; Kulisek, Jonathan A.; Bowyer, Sonya M.; Gesh, Christopher J.; O'Donnell, J.M.

2011-01-01

Executive Summary Developing a method for the accurate, direct, and independent assay of the fissile isotopes in bulk materials (such as used fuel) from next-generation domestic nuclear fuel cycles is a goal of the Office of Nuclear Energy, Fuel Cycle R and D, Material Protection and Control Technology (MPACT) Campaign. To meet this goal, MPACT supports a multi-institutional collaboration to study the feasibility of Lead Slowing Down Spectroscopy (LSDS). This technique is an active nondestructive assay method that has the potential to provide independent, direct measurement of Pu and U isotopic masses in used fuel with an uncertainty considerably lower than the approximately 10% typical of today's confirmatory assay methods. This document is a progress report for FY2011 collaboration activities. Progress made by the collaboration in FY2011 continues to indicate the promise of LSDS techniques applied to used fuel. PNNL developed an empirical model based on calibration of the LSDS to responses generated from well-characterized used fuel. The empirical model demonstrated the potential for the direct and independent assay of the sum of the masses of 239Pu and 241Pu to within approximately 3% over a wide used fuel parameter space. Similar results were obtained using a perturbation approach developed by LANL. Benchmark measurements have been successfully conducted at LANL and at RPI using their respective LSDS instruments. The ISU and UNLV collaborative effort is focused on the fabrication and testing of prototype fission chambers lined with ultra-depleted 238U and 232Th, and uranium deposition on a stainless steel disc using spiked U3O8 from room temperature ionic liquid was successful, with improving thickness obtained. In FY2012, the collaboration plans a broad array of activities. PNNL will focus on optimizing its empirical model and minimizing its reliance on calibration data, as well continuing efforts on developing an analytical model. Additional measurements are

Human CRF{sub 2} {alpha} and {beta} splice variants: pharmacological characterization using radioligand binding and a luciferase gene expression assay

Energy Technology Data Exchange (ETDEWEB)

Ardati, A. [Rhone-Poulenc Rorer, Cardiovascular Biology, NW4, 500 Arcola Road, Collegeville, PA (United States); Goetschy, V.; Gottowick, J.; Henriot, S.; Deuschle, U.; Kilpatrick, G.J. [Central Nervous System, Pharma Division, F. Hoffmann-La Roche AG, CH-4070 Basel (Switzerland); Valdenaire, O. [Cardiovascular Research, Pharma Division, F. Hoffmann-La Roche AG, CH-4070 Basel (Switzerland)

1999-03-14

Corticotropin releasing factor (CRF) receptors belong to the super-family of G protein-coupled receptors. These receptors are classified into two subtypes (CRF{sub 1} and CRF{sub 2}). Both receptors are positively coupled to adenylyl cyclase but they have a distinct pharmacology and distribution in brain. Two isoforms belonging to the CRF{sub 2} subtype receptors, CRF{sub 2{alpha}} and CRF{sub 2{beta}}, have been identified in rat and man. The neuropeptides CRF and urocortin mediate their actions through this CRF G protein-coupled receptor family. In this report, we describe the pharmacological characterization of the recently identified hCRF{sub 2{beta}} receptor. We have used radioligand binding with [{sup 125}I]-tyr{sup 0}-sauvagine and a gene expression assay in which the firefly luciferase gene expression is under the control of cAMP responsive elements. Association kinetics of [{sup 125}I]-tyr{sup 0}-sauvagine binding to the hCRF{sub 2{beta}} receptor were monophasic while dissociation kinetics were biphasic, in agreement with the kinetics results obtained with the hCRF{sub 2{alpha}} receptor. Saturation binding analysis revealed two affinity states in HEK 293 cells with binding parameters in accord with those determined kinetically and with parameters obtained with the hCRF{sub 2{alpha}} receptor. A non-hydrolysable GTP analog, Gpp(NH)p, reduced the high affinity binding of [{sup 125}I]-tyr{sup 0}-sauvagine to both hCRF{sub 2} receptor isoforms in a similar manner. The rank order of potency of CRF agonist peptides in competition experiments was identical for both hCRF{sub 2}{alpha}-helical CRF{sub (9-41)}oCRF). Similarly, agonist potency was similar for the two isoforms when studied using the luciferase gene reporter system. The peptide antagonist {alpha}-helical CRF{sub (9-41)} exhibited a non-competitive antagonism of urocortin-stimulated luciferase expression with both hCRF{sub 2} receptor isoforms. Taken together, these results indicate that the

Gene protein detection platform--a comparison of a new human epidermal growth factor receptor 2 assay with conventional immunohistochemistry and fluorescence in situ hybridization platforms.

Science.gov (United States)

Stålhammar, Gustav; Farrajota, Pedro; Olsson, Ann; Silva, Cristina; Hartman, Johan; Elmberger, Göran

2015-08-01

Human epidermal growth factor receptor 2 (HER2) immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) are widely used semiquantitative assays for selecting breast cancer patients for HER2 antibody therapy. However, both techniques have been shown to have disadvantages. Our aim was to test a recent automated technique of combined IHC and brightfield dual in situ hybridization-gene protein detection platform (GPDP)-in breast cancer HER2 protein, gene, and chromosome 17 centromere status evaluations, comparing the results in accordance to the American Society of Clinical Oncology/College of American Pathologists recommendations for HER2 testing in breast cancer from both 2007 and 2013. The GPDP technique performance was evaluated on 52 consecutive whole slide invasive breast cancer cases with HER2 IHC 2/3+ scoring results. Applying in turns the American Society of Clinical Oncology/College of American Pathologists recommendations for HER2 testing in breast cancer from 2007 and 2013 to both FISH and GPDP DISH assays, the HER2 gene amplification results showed 100% concordance among amplified/nonamplified cases, but there was a shift in 4 cases toward positive from equivocal results and toward equivocal from negative results. This might be related to the emphasis on the average HER2 copy number in the 2013 criteria. HER2 expression by IVD market IHC kit (Pathway®) has a strong correlation with GPDP HER2 protein, including a full concordance for all cases scored as 3+ and a reduction from 2+ to 1+ in 7 cases corresponding to nonamplified cases. Gene protein detection platform HER2 protein "solo" could have spared the need for 7 FISH studies. In addition, the platform offered advantages on interpretation reassurance including selecting areas for counting gene signals paralleled with protein IHC expression, on heterogeneity detection, interpretation time, technical time, and tissue expense. Copyright © 2015 Elsevier Inc. All rights reserved.

[Myocardial single photon emission tomography imaging of reporter gene expression in rabbits].

Science.gov (United States)

Liu, Ying; Lan, Xiao-li; Zhang, Liang; Wu, Tao; Jiang, Ri-feng; Zhang, Yong-xue

2009-06-01

To explore the feasibility of single photon emission computed tomography (SPECT) detection of heart reporter gene expression and observed the optimal transfecting titer and imaging time by using herpes simplex virus 1-thymidine kinase (HSV1-tk) as reporter gene and 131I-2'-fluoro-2'-deoxy-1-beta-D-arabinofuranosyl-5-iodouracil (131I-FIAU) as reporter probe in rabbit myocardium. The recombinant Ad-tk carrying HSV1-tk gene and adenovirus (Ad) as vector was constructed and intramyocardially injected to rabbits at various concentrations (1 x 10(9) pfu, 5 x 10(8) pfu, 1 x 10(8) pfu, 5 x 10(7) pfu, 1 x 10(7) pfu). Two days later, rabbits were injected with 600 microCi 131I-FIAU in ear-margin vein and then underwent SPECT myocardium imaging for detection of HSV1-tk expression at 6 h, 24 h, 48 h and 72 h after injection, rabbits with 1 x 10(9) pfu Ad-tk injection were imaged at 96 h and 120 h. Rabbits were sacrificed after imaging and the total myocardial 131I-FIAU accumulation was quantified in percent of injected dose per gram myocardium (% ID/g). The myocardial Ad-tk expression was determined with RT-PCR. Reporter gene was detected by SPECT imaging in the injection site while not detected in the control myocardium and site remote from injection. RT-PCR results also evidenced HSV1-tk express in the injection site. The SPECT target/nontarget ratio was correlated with ex vivo gamma-counting (r2 = 0.933, Ppfu by SPECT imaging. The cardiac SPECT reporter gene imaging with HSV1-tk as reporter gene and 131I-FIAU as reporter probe is feasible.

Safeguards and Non-destructive Assay

International Nuclear Information System (INIS)

Carchon, R.; Bruggeman, M.

2001-01-01

SCK-CEN's programme on safeguards and non-destructive assay includes: (1) various activities to assure nuclear materials accountancy; (2) contributes to the implementation of Integrated Safeguards measures in Belgium and to assist the IAEA through the Belgian Support Programme; (3) renders services to internal and external customers in the field of safeguards; (4) improves passive neutron coincidence counting techniques for waste assay and safeguards verification measurements by R and D on correlation algorithms implemented via software or dedicated hardware; (5) improves gamma assay techniques for waste assay by implementing advanced scanning techniques and different correlation algorithms; and (6) develops numerical calibration techniques. Major achievements in these areas in 2000 are reported

A multiplex real-time PCR assay targeting virulence and resistance genes in Salmonella enterica serotype Typhimurium

Directory of Open Access Journals (Sweden)

Brisabois Anne

2011-06-01

Full Text Available Abstract Background Typhimurium is the main serotype of Salmonella enterica subsp. enterica implicated in food-borne diseases worldwide. This study aimed to detect the prevalence of ten markers combined in a macro-array based on multiplex real-time PCR. We targeted characteristic determinants located on pathogenicity islands (SPI-2 to -5, virulence plasmid pSLT and Salmonella genomic island 1 (SGI1 as well as a specific 16S-23S rRNA intergenic spacer sequence of definitive type 104 (DT104. To investigate antimicrobial resistance, the study also targeted the presence of genes involved in sulfonamide (sul1 and beta-lactam (blaTEM resistance. Finally, the intI1 determinant encoding integrase from class 1 integron was also investigated. Results A total of 538 unrelated S. Typhimurium strains isolated between 1999 and 2009 from various sources, including food animals, food products, human and environmental samples were studied. Based on the combined presence or absence of these markers, we distinguished 34 different genotypes, including three major genotypes encountered in 75% of the studied strains, Although SPI determinants were almost always detected, SGI1, intI1, sul1 and blaTEM determinants were found 47%, 52%, 54% and 12% of the time respectively, varying according to isolation source. Low-marker patterns were most often detected in poultry sources whereas full-marker patterns were observed in pig, cattle and human sources. Conclusion The GeneDisc® assay developed in this study madeit easier to explore variability within serotype Typhimurium by analyzing ten relevant gene determinants in a large collection of strains. This real-time multiplex method constitutes a valuable tool for strains characterization on epidemiological purposes.

Rapid detection of pathological mutations and deletions of the haemoglobin beta gene (HBB) by High Resolution Melting (HRM) analysis and Gene Ratio Analysis Copy Enumeration PCR (GRACE-PCR).

Science.gov (United States)

Turner, Andrew; Sasse, Jurgen; Varadi, Aniko

2016-10-19

Inherited disorders of haemoglobin are the world's most common genetic diseases, resulting in significant morbidity and mortality. The large number of mutations associated with the haemoglobin beta gene (HBB) makes gene scanning by High Resolution Melting (HRM) PCR an attractive diagnostic approach. However, existing HRM-PCR assays are not able to detect all common point mutations and have only a very limited ability to detect larger gene rearrangements. The aim of the current study was to develop a HBB assay, which can be used as a screening test in highly heterogeneous populations, for detection of both point mutations and larger gene rearrangements. The assay is based on a combination of conventional HRM-PCR and a novel Gene Ratio Analysis Copy Enumeration (GRACE) PCR method. HRM-PCR was extensively optimised, which included the use of an unlabelled probe and incorporation of universal bases into primers to prevent interference from common non-pathological polymorphisms. GRACE-PCR was employed to determine HBB gene copy numbers relative to a reference gene using melt curve analysis to detect rearrangements in the HBB gene. The performance of the assay was evaluated by analysing 410 samples. A total of 44 distinct pathological genotypes were detected. In comparison with reference methods, the assay has a sensitivity of 100 % and a specificity of 98 %. We have developed an assay that detects both point mutations and larger rearrangements of the HBB gene. This assay is quick, sensitive, specific and cost effective making it suitable as an initial screening test that can be used for highly heterogeneous cohorts.

Cytokinesis-block micronucleus assay evolves into a 'cytome' assay of chromosomal instability, mitotic dysfunction and cell death

International Nuclear Information System (INIS)

Fenech, Michael

2006-01-01

The cytokinesis-block micronucleus (CBMN) assay was originally developed as an ideal system for measuring micronuclei (MNi) however it can also be used to measure nucleoplasmic bridges (NPBs), nuclear buds (NBUDs), cell death (necrosis or apoptosis) and nuclear division rate. Current evidence suggests that (a) NPBs originate from dicentric chromosomes in which the centromeres have been pulled to the opposite poles of the cell at anaphase and are therefore indicative of DNA mis-repair, chromosome rearrangement or telomere end-fusions, (b) NPBs may break to form MNi, (c) the nuclear budding process is the mechanism by which cells remove amplified and/or excess DNA and is therefore a marker of gene amplification and/or altered gene dosage, (d) cell cycle checkpoint defects result in micronucleus formation and (e) hypomethylation of DNA, induced nutritionally or by inhibition of DNA methyl transferase can lead to micronucleus formation either via chromosome loss or chromosome breakage. The strong correlation between micronucleus formation, nuclear budding and NPBs (r = 0.75-0.77, P < 0.001) induced by either folic acid deficiency or exposure to ionising radiation is supportive of the hypothesis that folic acid deficiency and/or ionising radiation cause genomic instability and gene amplification by the initiation of breakage-fusion-bridge cycles. In its comprehensive mode, the CBMN assay measures all cells including necrotic and apoptotic cells as well as number of nuclei per cell to provide a measure of cytotoxicity and mitotic activity. The CBMN assay has in fact evolved into a 'cytome' method for measuring comprehensively chromosomal instability phenotype and altered cellular viability caused by genetic defects and/or nutrional deficiencies and/or exogenous genotoxins thus opening up an exciting future for the use of this methodology in the emerging fields of nutrigenomics and toxicogenomics and their combinations

A quantitative and direct PCR assay for the subspecies-specific detection of Clavibacter michiganensis subsp. michiganensis based on a ferredoxin reductase gene.

Science.gov (United States)

Cho, Min Seok; Lee, Jang Ha; Her, Nam Han; Kim, Changkug; Seol, Young-Joo; Hahn, Jang Ho; Baeg, Ji Hyoun; Kim, Hong Gi; Park, Dong Suk

2012-06-01

The Gram-positive bacterium Clavibacter michiganensis subsp. michiganensis is the causal agent of canker disease in tomato. Because it is very important to control newly introduced inoculum sources from commercial materials, the specific detection of this pathogen in seeds and seedlings is essential for effective disease control. In this study, a novel and efficient assay for the detection and quantitation of C. michiganensis subsp. michiganensis in symptomless tomato and red pepper seeds was developed. A pair of polymerase chain reaction (PCR) primers (Cmm141F/R) was designed to amplify a specific 141 bp fragment on the basis of a ferredoxin reductase gene of C. michiganensis subsp. michiganensis NCPPB 382. The specificity of the primer set was evaluated using purified DNA from 16 isolates of five C. michiganensis subspecies, one other Clavibacter species, and 17 other reference bacteria. The primer set amplified a single band of expected size from the genomic DNA obtained from the C. michiganensis subsp. michiganensis strains but not from the other C. michiganensis subspecies or from other Clavibacter species. The detection limit was a single cloned copy of the ferredoxin reductase gene of C. michiganensis subsp. michiganensis. In conclusion, this quantitative direct PCR assay can be applied as a practical diagnostic method for epidemiological research and the sanitary management of seeds and seedlings with a low level or latent infection of C. michiganensis subsp. michiganensis.

Evaluation of LINE-1 mobility in neuroblastoma cells by in vitro retrotransposition reporter assay: FACS analysis can detect only the tip of the iceberg of the inserted L1 elements

International Nuclear Information System (INIS)

Del Re, Brunella; Marcantonio, Pamela; Capri, Miriam; Giorgi, Gianfranco

2010-01-01

Long Interspersed Nuclear Elements (L1) are retroelements generally repressed in most differentiated somatic cells. Their activity has been observed in some undifferentiated and tumour cells and could be involved in tumour onset and progression. Growing evidences show that the L1 activation can occur in neuronal precursor cells during differentiation process. Neuroblastoma is a tumour originating from neuronal precursor cells, and, although the molecular basis of its progression is still poorly understood, the implication of L1 activation has not yet been investigated. In this study L1 mobility in neuroblastoma BE(2)C cells was assessed using the in vitro retrotransposition assay consisting in an episomal EGFP-tagged L1 RP element, whose mobility can be evaluated by cytofluorimetric analysis (FACS) of EGFP expression. FACS results have shown a low retrotransposition activity. To detect L1 RP integrated in transcriptionally repressed genomic sites, both a cell treatment with a stimulator of reporter gene promoter, and a quantitative Real-Time PCR analysis were performed. A retrotransposition activity ten and one thousand times that of FACS was found, respectively. These results point out that the real rate of L1 retrotransposition events in tumour cells might be considerably higher than that reported so far by evaluating only the reporter gene expression.

Neutron Resonance Transmission Analysis (NRTA): A Nondestructive Assay Technique for the Next Generation Safeguards Initiative’s Plutonium Assay Challenge

Energy Technology Data Exchange (ETDEWEB)

J. W. Sterbentz; D. L. Chichester

2010-12-01

This is an end-of-year report for a project funded by the National Nuclear Security Administration's Office of Nuclear Safeguards (NA-241). The goal of this project is to investigate the feasibility of using Neutron Resonance Transmission Analysis (NRTA) to assay plutonium in commercial light-water-reactor spent fuel. This project is part of a larger research effort within the Next-Generation Safeguards Initiative (NGSI) to evaluate methods for assaying plutonium in spent fuel, the Plutonium Assay Challenge. The first-year goals for this project were modest and included: 1) developing a zero-order MCNP model for the NRTA technique, simulating data results presented in the literature, 2) completing a preliminary set of studies investigating important design and performance characteristics for the NRTA measurement technique, and 3) documentation of this work in an end of the year report (this report). Research teams at Los Alamos National Laboratory (LANL), Lawrence Berkeley National Laboratory (LBNL), Pacific Northwest National Laboratory (PNNL), and at several universities are also working to investigate plutonium assay methods for spent-fuel safeguards. While the NRTA technique is well proven in the scientific literature for assaying individual spent fuel pins, it is a newcomer to the current NGSI efforts studying Pu assay method techniques having just started in March 2010; several analytical techniques have been under investigation within this program for two to three years or more. This report summarizes a nine month period of work.

Development of an objective gene expression panel as an alternative to self-reported symptom scores in human influenza challenge trials.

Science.gov (United States)

Muller, Julius; Parizotto, Eneida; Antrobus, Richard; Francis, James; Bunce, Campbell; Stranks, Amanda; Nichols, Marshall; McClain, Micah; Hill, Adrian V S; Ramasamy, Adaikalavan; Gilbert, Sarah C

2017-06-08

Influenza challenge trials are important for vaccine efficacy testing. Currently, disease severity is determined by self-reported scores to a list of symptoms which can be highly subjective. A more objective measure would allow for improved data analysis. Twenty-one volunteers participated in an influenza challenge trial. We calculated the daily sum of scores (DSS) for a list of 16 influenza symptoms. Whole blood collected at baseline and 24, 48, 72 and 96 h post challenge was profiled on Illumina HT12v4 microarrays. Changes in gene expression most strongly correlated with DSS were selected to train a Random Forest model and tested on two independent test sets consisting of 41 individuals profiled on a different microarray platform and 33 volunteers assayed by qRT-PCR. 1456 probes are significantly associated with DSS at 1% false discovery rate. We selected 19 genes with the largest fold change to train a random forest model. We observed good concordance between predicted and actual scores in the first test set (r = 0.57; RMSE = -16.1%) with the greatest agreement achieved on samples collected approximately 72 h post challenge. Therefore, we assayed samples collected at baseline and 72 h post challenge in the second test set by qRT-PCR and observed good concordance (r = 0.81; RMSE = -36.1%). We developed a 19-gene qRT-PCR panel to predict DSS, validated on two independent datasets. A transcriptomics based panel could provide a more objective measure of symptom scoring in future influenza challenge studies. Trial registration Samples were obtained from a clinical trial with the ClinicalTrials.gov Identifier: NCT02014870, first registered on December 5, 2013.

Confinement Vessel Assay System: Calibration and Certification Report

Energy Technology Data Exchange (ETDEWEB)

Frame, Katherine C. [Los Alamos National Laboratory; Bourne, Mark M. [Los Alamos National Laboratory; Crooks, William J. [Los Alamos National Laboratory; Evans, Louise [Los Alamos National Laboratory; Gomez, Cipriano [Retired CMR-OPS: OPERATIONS; Mayo, Douglas R. [Los Alamos National Laboratory; Miko, David K. [Los Alamos National Laboratory; Salazar, William R. [Los Alamos National Laboratory; Stange, Sy [Los Alamos National Laboratory; Vigil, Georgiana M. [Los Alamos National Laboratory

2012-07-17

Los Alamos National Laboratory has a number of spherical confinement vessels (CVs) remaining from tests involving nuclear materials. These vessels have an inner diameter of 6 feet with 1 to 2 inch thick steel walls. The goal of the Confinement Vessel Disposition (CVD) project is to remove debris and reduce contamination inside the vessels. The Confinement Vessel Assay System (CVAS) was developed to measure the amount of SNM in CVs before and after cleanout. Prior to cleanout, the system will be used to perform a verification measurement of each vessel. After cleanout, the system will be used to perform safeguards-quality assays of {le} 100-g {sup 239}Pu equivalent in a vessel for safeguards termination. The system was calibrated in three different mass regions (low, medium, and high) to cover the entire plutonium mass range that will be assayed. The low mass calibration and medium mass calibration were verified for material positioned in the center of an empty vessel. The systematic uncertainty due to position bias was estimated using an MCNPX model to simulate the response of the system to material localized at various points along the inner surface of the vessel. The background component due to cosmic ray spallation was determined by performing measurements of an empty vessel and comparing to measurements in the same location with no vessel present. The CVAS has been tested and calibrated in preparation for verification and safeguards measurements of CVs before and after cleanout.

Confinement Vessel Assay System: Calibration and Certification Report

International Nuclear Information System (INIS)

Frame, Katherine C.; Bourne, Mark M.; Crooks, William J.; Evans, Louise; Gomez, Cipriano; Mayo, Douglas R.; Miko, David K.; Salazar, William R.; Stange, Sy; Vigil, Georgiana M.

2012-01-01

Los Alamos National Laboratory has a number of spherical confinement vessels (CVs) remaining from tests involving nuclear materials. These vessels have an inner diameter of 6 feet with 1 to 2 inch thick steel walls. The goal of the Confinement Vessel Disposition (CVD) project is to remove debris and reduce contamination inside the vessels. The Confinement Vessel Assay System (CVAS) was developed to measure the amount of SNM in CVs before and after cleanout. Prior to cleanout, the system will be used to perform a verification measurement of each vessel. After cleanout, the system will be used to perform safeguards-quality assays of (le) 100-g 239 Pu equivalent in a vessel for safeguards termination. The system was calibrated in three different mass regions (low, medium, and high) to cover the entire plutonium mass range that will be assayed. The low mass calibration and medium mass calibration were verified for material positioned in the center of an empty vessel. The systematic uncertainty due to position bias was estimated using an MCNPX model to simulate the response of the system to material localized at various points along the inner surface of the vessel. The background component due to cosmic ray spallation was determined by performing measurements of an empty vessel and comparing to measurements in the same location with no vessel present. The CVAS has been tested and calibrated in preparation for verification and safeguards measurements of CVs before and after cleanout.

Environmental Application of Reporter-Genes Based Biosensors for Chemical Contamination Screening

Directory of Open Access Journals (Sweden)

Matejczyk Marzena

2014-12-01

Full Text Available The paper presents results of research concerning possibilities of applications of reporter-genes based microorganisms, including the selective presentation of defects and advantages of different new scientific achievements of methodical solutions in genetic system constructions of biosensing elements for environmental research. The most robust and popular genetic fusion and new trends in reporter genes technology – such as LacZ (β-galactosidase, xylE (catechol 2,3-dioxygenase, gfp (green fluorescent proteins and its mutated forms, lux (prokaryotic luciferase, luc (eukaryotic luciferase, phoA (alkaline phosphatase, gusA and gurA (β-glucuronidase, antibiotics and heavy metals resistance are described. Reporter-genes based biosensors with use of genetically modified bacteria and yeast successfully work for genotoxicity, bioavailability and oxidative stress assessment for detection and monitoring of toxic compounds in drinking water and different environmental samples, surface water, soil, sediments.

Serotype determination of Salmonella by xTAG assay.

Science.gov (United States)

Zheng, Zhibei; Zheng, Wei; Wang, Haoqiu; Pan, Jincao; Pu, Xiaoying

2017-10-01

Currently, no protocols or commercial kits are available to determine the serotypes of Salmonella by using Luminex MAGPIX®. In this study, an xTAG assay for serotype determination of Salmonella suitable for Luminex MAGPIX® is described and 228 Salmonella isolates were serotype determined by this xTAG assay. The xTAG assay consists of two steps: 1) Multiplex PCR to amplify simultaneously O, H and Vi antigen genes of Salmonella, and 2) Magplex-TAG™ microsphere hybridization to identify accurately the specific PCR products of different antigens. Compared with the serotyping results of traditional serum agglutination test, the sensitivity and specificity of the xTAG assay were 95.1% and 100%, respectively. The agreement rate of these two assays was 95.2%. Compared with Luminex xMAP® Salmonella Serotyping Assay (SSA) kit, the advantages of this xTAG assay are: First, the magnetic beads make it applicable to both the Luminex®100/200™ and MAGPIX® systems. Second, only primers rather than both primers and probes are needed in the xTAG assay, and the process of coupling antigen-specific oligonucleotide probes to beads is circumvented, which make the xTAG assay convenient to be utilized by other laboratories. The xTAG assay may serve as a rapid alternative or complementary method for traditional Salmonella serotyping tests, especially for laboratories that utilize the MAGPIX® systems. Copyright © 2017 Elsevier B.V. All rights reserved.

Performance of the Xpert HIV-1 Viral Load Assay: a Systematic Review and Meta-analysis.

Science.gov (United States)

Nash, Madlen; Huddart, Sophie; Badar, Sayema; Baliga, Shrikala; Saravu, Kavitha; Pai, Madhukar

2018-04-01

Viral load (VL) is the preferred treatment-monitoring approach for HIV-positive patients. However, more rapid, near-patient, and low-complexity assays are needed to scale up VL testing. The Xpert HIV-1 VL assay (Cepheid, Sunnyvale, CA) is a new, automated molecular test, and it can leverage the GeneXpert systems that are being used widely for tuberculosis diagnosis. We systematically reviewed the evidence on the performance of this new tool in comparison to established reference standards. A total of 12 articles (13 studies) in which HIV patient VLs were compared between Xpert HIV VL assay and a reference standard VL assay were identified. Study quality was generally high, but substantial variability was observed in the number and type of agreement measures reported. Correlation coefficients between Xpert and reference assays were high, with a pooled Pearson correlation ( n = 8) of 0.94 (95% confidence interval [CI], 0.89, 0.97) and Spearman correlation ( n = 3) of 0.96 (95% CI, 0.86, 0.99). Bland-Altman metrics ( n = 11) all were within 0.35 log copies/ml of perfect agreement. Overall, Xpert HIV-1 VL performed well compared to current reference tests. The minimal training and infrastructure requirements for the Xpert HIV-1 VL assay make it attractive for use in resource-constrained settings, where point-of-care VL testing is most needed. Copyright © 2018 Nash et al.

Methylated genes as new cancer biomarkers.

LENUS (Irish Health Repository)

Duffy, M J

2012-02-01

Aberrant hypermethylation of promoter regions in specific genes is a key event in the formation and progression of cancer. In at least some situations, these aberrant alterations occur early in the formation of malignancy and appear to be tumour specific. Multiple reports have suggested that measurement of the methylation status of the promoter regions of specific genes can aid early detection of cancer, determine prognosis and predict therapy responses. Promising DNA methylation biomarkers include the use of methylated GSTP1 for aiding the early diagnosis of prostate cancer, methylated PITX2 for predicting outcome in lymph node-negative breast cancer patients and methylated MGMT in predicting benefit from alkylating agents in patients with glioblastomas. However, prior to clinical utilisation, these findings require validation in prospective clinical studies. Furthermore, assays for measuring gene methylation need to be standardised, simplified and evaluated in external quality assurance programmes. It is concluded that methylated genes have the potential to provide a new generation of cancer biomarkers.

Analysis of a cis-Acting Element Involved in Regulation by Estrogen of Human Angiotensinogen Gene Expression.

Science.gov (United States)

Zhao, Yan-Yan; Sun, Kai-Lai; Ashok, Kumar

1998-01-01

The work was aimed to identify the estrogen responsive element in the human angiotensinogen gene. The nucleotide sequence between the transcription initiation site and TATA box in angiotensinogen gene promoter was found to be strongly homologous with the consensus estrogen responsive element. This sequence was confirmed as the estrogen responsive element (HAG ERE) by electrophoretic mobility shift assay. The recombinant expression vectors were constructed in which chloramphenicol acetyltransferase (CAT) reporter gene was driven by angiotensinogen core promoter with HAG ERE of by TK core promoter with multiplied HAG ERE, and were used in cotransfection with the human estrogen receptor expression vector into HepG(2) cells; CAT assays showed an increase of the CAT activity on 17beta-estradiol treatment in those transfectants. These results suggest that the human angiotensinogen gene is transcriptionally up-regulated by estrogen through the estrogen responsive element near TATA box of the promoter.

Determining Physical Mechanisms of Gene Expression Regulation from Single Cell Gene Expression Data

OpenAIRE

Ezer, Daphne; Moignard, Victoria; G?ttgens, Berthold; Adryan, Boris

2016-01-01

Many genes are expressed in bursts, which can contribute to cell-to-cell heterogeneity. It is now possible to measure this heterogeneity with high throughput single cell gene expression assays (single cell qPCR and RNA-seq). These experimental approaches generate gene expression distributions which can be used to estimate the kinetic parameters of gene expression bursting, namely the rate that genes turn on, the rate that genes turn off, and the rate of transcription. We construct a complete ...

A paper-based resonance energy transfer nucleic acid hybridization assay using upconversion nanoparticles as donors and quantum dots as acceptors.

Science.gov (United States)

Doughan, Samer; Uddayasankar, Uvaraj; Krull, Ulrich J

2015-06-09

Monodisperse aqueous upconverting nanoparticles (UCNPs) were covalently immobilized on aldehyde modified cellulose paper via reduction amination to develop a luminescence resonance energy transfer (LRET)-based nucleic acid hybridization assay. This first account of covalent immobilization of UCNPs on paper for a bioassay reports an optically responsive method that is sensitive, reproducible and robust. The immobilized UCNPs were decorated with oligonucleotide probes to capture HPRT1 housekeeping gene fragments, which in turn brought reporter conjugated quantum dots (QDs) in close proximity to the UCNPs for LRET. This sandwich assay could detect unlabeled oligonucleotide target, and had a limit of detection of 13 fmol and a dynamic range spanning nearly 3 orders of magnitude. The use of QDs, which are excellent LRET acceptors, demonstrated improved sensitivity, limit of detection, dynamic range and selectivity compared to similar assays that have used molecular fluorophores as acceptors. The selectivity of the assay was attributed to the decoration of the QDs with polyethylene glycol to eliminate non-specific adsorption. The kinetics of hybridization were determined to be diffusion limited and full signal development occurred within 3 min. Copyright © 2015 Elsevier B.V. All rights reserved.

Wheat-specific gene, ribosomal protein l21, used as the endogenous reference gene for qualitative and real-time quantitative polymerase chain reaction detection of transgenes.

Science.gov (United States)

Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai

2014-10-29

Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.

A common variant of staphylococcal cassette chromosome mec type IVa in isolates from Copenhagen, Denmark, is not detected by the BD GeneOhm methicillin-resistant Staphylococcus aureus assay

DEFF Research Database (Denmark)

Bartels, Mette Damkjaer; Boye, Kit; Rohde, Susanne Mie

2009-01-01

Rapid tests for detection of methicillin-resistant Staphylococcus aureus (MRSA) carriage are important to limit the transmission of MRSA in the health care setting. We evaluated the performance of the BD GeneOhm MRSA real-time PCR assay using a diverse collection of MRSA isolates, mainly from Cop...

Targeting Gene-Viro-Therapy with AFP driving Apoptin gene shows potent antitumor effect in hepatocarcinoma

Directory of Open Access Journals (Sweden)

Zhang Kang-Jian

2012-02-01

Full Text Available Abstract Background Gene therapy and viral therapy are used for cancer therapy for many years, but the results are less than satisfactory. Our aim was to construct a new recombinant adenovirus which is more efficient to kill hepatocarcinoma cells but more safe to normal cells. Methods By using the Cancer Targeting Gene-Viro-Therapy strategy, Apoptin, a promising cancer therapeutic gene was inserted into the double-regulated oncolytic adenovirus AD55 in which E1A gene was driven by alpha fetoprotein promoter along with a 55 kDa deletion in E1B gene to form AD55-Apoptin. The anti-tumor effects and safety were examined by western blotting, virus yield assay, real time polymerase chain reaction, 3-(4,5-dimethylthiazol-2-yl-2, 5-diphenyltetrazolium bromide assay, Hoechst33342 staining, Fluorescence-activated cell sorting, xenograft tumor model, Immunohistochemical assay, liver function analysis and Terminal deoxynucleotidyl transferase mediated dUTP Nick End Labeling assay. Results The recombinant virus AD55-Apoptin has more significant antitumor effect for hepatocelluar carcinoma cell lines (in vitro than that of AD55 and even ONYX-015 but no or little impair on normal cell lines. Furthermore, it also shows an obvious in vivo antitumor effect on the Huh-7 liver carcinoma xenograft in nude mice with bigger beginning tumor volume till about 425 mm3 but has no any damage on the function of liver. The induction of apoptosis is involved in AD55-Apoptin induced antitumor effects. Conclusion The AD55-Apoptin can be a potential anti-hepatoma agent with remarkable antitumor efficacy as well as higher safety in cancer targeting gene-viro-therapy system.

A homeodomain transcription factor gene, PfMSX, activates expression of Pif gene in the pearl oyster Pinctada fucata.

Directory of Open Access Journals (Sweden)

Mi Zhao

Full Text Available We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.

A Homeodomain Transcription Factor Gene, PfMSX, Activates Expression of Pif Gene in the Pearl Oyster Pinctada fucata

Science.gov (United States)

Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

2014-01-01

We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5′ flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster. PMID:25099698

A homeodomain transcription factor gene, PfMSX, activates expression of Pif gene in the pearl oyster Pinctada fucata.

Science.gov (United States)

Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

2014-01-01

We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.

Performance validation of commercially available mobile waste-assay systems: Preliminary report

International Nuclear Information System (INIS)

Schanfein, M.; Bonner, C.; Maez, R.

1997-01-01

Prior to disposal, nuclear waste must be accurately characterized to identify and quantify the radioactive content to reduce the radioactive hazard to the public. Validation of the waste-assay systems' performance is critical for establishing the credibility of the assay results for storage and disposal purposes. Canberra Nuclear has evaluated regulations worldwide and identified standard, modular, neutron- and gamma-waste-assay systems that can be used to characterize a large portion of existing and newly generated transuranic (TRU) and low-level waste. Before making claims of guaranteeing any system's performance for specific waste types, the standardized systems' performance be evaluated. 7 figs., 11 tabs

Performance validation of commercially available mobile waste-assay systems: Preliminary report

Energy Technology Data Exchange (ETDEWEB)

Schanfein, M.; Bonner, C.; Maez, R. [Los Alamos National Lab., NM (United States)] [and others

1997-11-01

Prior to disposal, nuclear waste must be accurately characterized to identify and quantify the radioactive content to reduce the radioactive hazard to the public. Validation of the waste-assay systems` performance is critical for establishing the credibility of the assay results for storage and disposal purposes. Canberra Nuclear has evaluated regulations worldwide and identified standard, modular, neutron- and gamma-waste-assay systems that can be used to characterize a large portion of existing and newly generated transuranic (TRU) and low-level waste. Before making claims of guaranteeing any system`s performance for specific waste types, the standardized systems` performance be evaluated. 7 figs., 11 tabs.

Real-time PCR detection of aldoxime dehydratase genes in nitrile-degrading microorganisms.

Science.gov (United States)

Dooley-Cullinane, Tríona Marie; O'Reilly, Catherine; Coffey, Lee

2017-02-01

Aldoxime dehydratase catalyses the conversion of aldoximes to their corresponding nitriles. Utilization of the aldoxime-nitrile metabolising enzyme pathway can facilitate the move towards a greener chemistry. In this work, a real-time PCR assay was developed for the detection of aldoxime dehydratase genes in aldoxime/nitrile metabolising microorganisms which have been purified from environmental sources. A conventional PCR assay was also designed allowing gene confirmation via sequencing. Aldoxime dehydratase genes were identified in 30 microorganisms across 11 genera including some not previously shown to harbour the gene. The assay displayed a limit of detection of 1 pg/μL DNA or 7 CFU/reaction. This real-time PCR assay should prove valuable in the high-throughput screening of micro-organisms for novel aldoxime dehydratase genes towards pharmaceutical and industrial applications.

Identification of a p53-response element in the promoter of the proline oxidase gene

International Nuclear Information System (INIS)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-01-01

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

Functional analysis of a novel human serotonin transporter gene promoter in immortalized raphe cells

DEFF Research Database (Denmark)

Mortensen, O V; Thomassen, M; Larsen, M B

1999-01-01

were found to possess the additional 379 bp fragment. The integrity of the promoter was furthermore confirmed by genomic Southern blotting. The promoter activity was analyzed by reporter gene assays in neuronal and non-neuronal serotonergic cell lines. In immortalized serotonergic raphe neurons, RN46A...

Radiochemotherapy of hepatocarcinoma via lentivirus-mediated transfer of human sodium iodide symporter gene and herpes simplex virus thymidine kinase gene

Energy Technology Data Exchange (ETDEWEB)

Chen Libo, E-mail: libochen888@hotmail.com [Department of Nuclear Medicine, Shanghai Sixth People' s Hospital, Shanghai Jiao Tong University, Shanghai 200233 (China); Guo Guoying [Xinyuan Institute of Medicine and Biotechnology, School of Life Sciences, Zhejiang Sci-Tech University, Hangzhou 310018 (China); Liu Tianjing; Guo Lihe [Division of Biochemistry and Cell Biology, Shanghai Institute for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Zhu Ruisen [Department of Nuclear Medicine, Shanghai Sixth People' s Hospital, Shanghai Jiao Tong University, Shanghai 200233 (China)

2011-07-15

Herpes simplex virus thymidine kinase (HSV-TK) gene/ganciclovir (GCV) system has been widely used as a traditional gene therapy modality, and the sodium/iodide symporter gene (NIS) has been found to be a novel therapeutic gene. Since the therapeutic effects of radioiodine therapy or prodrug chemotherapy on cancers following NIS or HSV-TK gene transfer need to be enhanced, this study was designed to investigate the feasibility of radiochemotherapy for hepatocarcinoma via coexpression of NIS gene and HSV-TK gene. Methods: HepG2 cells were stably transfected with NIS, TK and GFP gene via recombinant lentiviral vector and named HepG2/NTG. Gene expression was examined by reverse transcriptase polymerase chain reaction, fluorescence imaging and iodide uptake. The therapeutic effects were assessed by MTT assay and clonogenic assay. Results: HepG2/NTG cells concentrated {sup 125}I{sup -} up to 76-fold higher than the wild-type cells within 20 min, and the efflux happened with a T{sub 1/2eff} of less than 10 min. The iodide uptake in HepG2/NTG cells was specifically inhibited by sodium perchlorate. Dose-dependent toxicity to HepG2/NTG cells by either GCV or {sup 131}I was revealed by clonogenic assay and MTT assay, respectively. The survival rate of HepG2/NTG cells decreased to 49.7%{+-}2.5%, 43.4%{+-}2.8% and 8.6%{+-}1.2% after exposure to {sup 131}I, GCV and combined therapy, respectively. Conclusion: We demonstrate that radiochemotherapy of hepatocarcinoma via lentiviral-mediated coexpression of NIS gene and HSV-TK gene leads to stronger killing effect than single treatment, and in vivo studies are needed to verify these findings.

Radiochemotherapy of hepatocarcinoma via lentivirus-mediated transfer of human sodium iodide symporter gene and herpes simplex virus thymidine kinase gene

International Nuclear Information System (INIS)

Chen Libo; Guo Guoying; Liu Tianjing; Guo Lihe; Zhu Ruisen

2011-01-01

Herpes simplex virus thymidine kinase (HSV-TK) gene/ganciclovir (GCV) system has been widely used as a traditional gene therapy modality, and the sodium/iodide symporter gene (NIS) has been found to be a novel therapeutic gene. Since the therapeutic effects of radioiodine therapy or prodrug chemotherapy on cancers following NIS or HSV-TK gene transfer need to be enhanced, this study was designed to investigate the feasibility of radiochemotherapy for hepatocarcinoma via coexpression of NIS gene and HSV-TK gene. Methods: HepG2 cells were stably transfected with NIS, TK and GFP gene via recombinant lentiviral vector and named HepG2/NTG. Gene expression was examined by reverse transcriptase polymerase chain reaction, fluorescence imaging and iodide uptake. The therapeutic effects were assessed by MTT assay and clonogenic assay. Results: HepG2/NTG cells concentrated 125 I - up to 76-fold higher than the wild-type cells within 20 min, and the efflux happened with a T 1/2eff of less than 10 min. The iodide uptake in HepG2/NTG cells was specifically inhibited by sodium perchlorate. Dose-dependent toxicity to HepG2/NTG cells by either GCV or 131 I was revealed by clonogenic assay and MTT assay, respectively. The survival rate of HepG2/NTG cells decreased to 49.7%±2.5%, 43.4%±2.8% and 8.6%±1.2% after exposure to 131 I, GCV and combined therapy, respectively. Conclusion: We demonstrate that radiochemotherapy of hepatocarcinoma via lentiviral-mediated coexpression of NIS gene and HSV-TK gene leads to stronger killing effect than single treatment, and in vivo studies are needed to verify these findings.

Nondestructive assay methods for irradiated nuclear fuels

International Nuclear Information System (INIS)

Hsue, S.T.; Crane, T.W.; Talbert, W.L. Jr.; Lee, J.C.

1978-01-01

This report is a review of the status of nondestructive assay (NDA) methods used to determine burnup and fissile content of irradiated nuclear fuels. The gamma-spectroscopy method measures gamma activities of certain fission products that are proportional to the burnup. Problems associated with this method are migration of the fission products and gamma-ray attenuation through the relatively dense fuel material. The attenuation correction is complicated by generally unknown activity distributions within the assemblies. The neutron methods, which usually involve active interrogation and prompt or delayed signal counting, are designed to assay the fissile content of the spent-fuel elements. Systems to assay highly enriched spent-fuel assemblies have been tested extensively. Feasibility studies have been reported of systems to assay light-water reactor spent-fuel assemblies. The slowing-down spectrometer and neutron resonance absorption methods can distinguish between the uranium and plutonium fissile contents, but they are limited to the assay of individual rods. We have summarized the status of NDA techniques for spent-fuel assay and present some subjects in need of further investigation. Accuracy of the burnup calculations for power reactors is also reviewed

A High Throughput Screening Assay for Anti-Mycobacterial Small Molecules Based on Adenylate Kinase Release as a Reporter of Cell Lysis.

Directory of Open Access Journals (Sweden)

Lauren Forbes

Full Text Available Mycobacterium tuberculosis (Mtb is well-established to be one of the most important bacterial pathogens for which new antimicrobial therapies are needed. Herein, we describe the development of a high throughput screening assay for the identification of molecules that are bactericidal against Mycobacteria. The assay utilizes the release of the intracellular enzyme adenylate kinase into the culture medium as a reporter of mycobacterial cell death. We demonstrate that the assay is selective for mycobactericidal molecules and detects anti-mycobacterial activity at concentrations below the minimum inhibitory concentration of many molecules. Thus, the AK assay is more sensitive than traditional growth assays. We have validated the AK assay in the HTS setting using the Mtb surrogate organism M. smegmatis and libraries of FDA approved drugs as well as a commercially available Diversity set. The screen of the FDA-approved library demonstrated that the AK assay is able to identify the vast majority of drugs with known mycobactericidal activity. Importantly, our screen of the Diversity set revealed that the increased sensitivity of the AK assay increases the ability of M. smegmatis-based screens to detect molecules with relatively poor activity against M. smegmatis but good to excellent activity against Mtb.

The pivotal role of multimodality reporter sensors in drug discovery: from cell based assays to real time molecular imaging.

Science.gov (United States)

Ray, Pritha

2011-04-01

Development and marketing of new drugs require stringent validation that are expensive and time consuming. Non-invasive multimodality molecular imaging using reporter genes holds great potential to expedite these processes at reduced cost. New generations of smarter molecular imaging strategies such as Split reporter, Bioluminescence resonance energy transfer, Multimodality fusion reporter technologies will further assist to streamline and shorten the drug discovery and developmental process. This review illustrates the importance and potential of molecular imaging using multimodality reporter genes in drug development at preclinical phases.

A novel binary T-vector with the GFP reporter gene for promoter characterization.

Directory of Open Access Journals (Sweden)

Shu-Ye Jiang

Full Text Available Several strategies have been developed to clone PCR fragments into desired vectors. However, most of commercially available T-vectors are not binary vectors and cannot be directly used for Agrobacterium-mediated plant genetic transformation. In this study, a novel binary T-vector was constructed by integrating two AhdI restriction sites into the backbone vector pCAMBIA 1300. The T-vector also contains a GFP reporter gene and thus, can be used to analyze promoter activity by monitoring the reporter gene. On the other hand, identification and characterization of various promoters not only benefit the functional annotation of their genes but also provide alternative candidates to be used to drive interesting genes for plant genetic improvement by transgenesis. More than 1,000 putative pollen-specific rice genes have been identified in a genome-wide level. Among them, 67 highly expressed genes were further characterized. One of the pollen-specific genes LOC_Os10g35930 was further surveyed in its expression patterns with more details by quantitative real-time reverse-transcription PCR (qRT-PCR analysis. Finally, its promoter activity was further investigated by analyzing transgenic rice plants carrying the promoter::GFP cassette, which was constructed from the newly developed T-vector. The reporter GFP gene expression in these transgenic plants showed that the promoter was active only in mature but not in germinated pollens.

Drosophila tools and assays for the study of human diseases

Directory of Open Access Journals (Sweden)

Berrak Ugur

2016-03-01

Full Text Available Many of the internal organ systems of Drosophila melanogaster are functionally analogous to those in vertebrates, including humans. Although humans and flies differ greatly in terms of their gross morphological and cellular features, many of the molecular mechanisms that govern development and drive cellular and physiological processes are conserved between both organisms. The morphological differences are deceiving and have led researchers to undervalue the study of invertebrate organs in unraveling pathogenic mechanisms of diseases. In this review and accompanying poster, we highlight the physiological and molecular parallels between fly and human organs that validate the use of Drosophila to study the molecular pathogenesis underlying human diseases. We discuss assays that have been developed in flies to study the function of specific genes in the central nervous system, heart, liver and kidney, and provide examples of the use of these assays to address questions related to human diseases. These assays provide us with simple yet powerful tools to study the pathogenic mechanisms associated with human disease-causing genes.

Biological Education of IVFRU and FIAU for HSV1-TK Reporter Gene Monitoring

Energy Technology Data Exchange (ETDEWEB)

Hong, Su Hee; Kim, Eun Jung; Lee, Eun Ah; Lee, Jong Chan; Choi, Tae Hyun; Lee, Kyo Chul; An, Gwang Il; Cheon, Gi Jeong [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)

2006-07-01

The Herpes Simplex Virus Type1-thymidine kinase (HSV1-TK) system is a useful gene therapy monitoring method. HSV1-TK is one of the most widely used effector gene systems used for imaging gene expression, in association with its use as a reporter gene. It has resulted the development of a number of radiolabeled HSV1-TK substrates for the non-invasive detection of HSV1-TK expression. In non-invasive imaging of the HSV1-TK system, many nucleoside derivatives have been developed as prodrugs for tumor proliferation imaging or as anti-viral drugs. Prodrug activation or sucide gene therapy has been shown to be successful in potentiating the therapeutic index by sensitizing genetically modified tumor cells to various prodrugs or enhancing the action of commonly used chemotherapeutic agents. The most studied prodrug activation approaches involve transfection of tumors with HSV1-TK gene. (Z)-5-(2-iodovinyl)-2'-fluoro- 2'-deoxyuridine (IVFRU) possesses a 2'-fluoro substituent in the ribose configuration, is considered to protect IVFRU from enzyme mediated degradation in vivo. It is obviously potential substrates for HSV1-TK imaging. 2'-Fiuoro-2'-deoxy-1-{beta}-D-arabinofuranosyl- 5-iodo-uridine (FIAU), an anticancer drug widely used in clinical practice, is an analogue of thymidine. In a series of studies using adenovirus vector for gene transfer described the appropriate combination of exogenously introduced HSV1-TK as a 'marker/reporter gene' and radiolabelled FIAU as a 'marker substrate/reporter probe' for monitoring gene therapy and gene expression.

Biological Education of IVFRU and FIAU for HSV1-TK Reporter Gene Monitoring

International Nuclear Information System (INIS)

Hong, Su Hee; Kim, Eun Jung; Lee, Eun Ah; Lee, Jong Chan; Choi, Tae Hyun; Lee, Kyo Chul; An, Gwang Il; Cheon, Gi Jeong

2006-01-01

The Herpes Simplex Virus Type1-thymidine kinase (HSV1-TK) system is a useful gene therapy monitoring method. HSV1-TK is one of the most widely used effector gene systems used for imaging gene expression, in association with its use as a reporter gene. It has resulted the development of a number of radiolabeled HSV1-TK substrates for the non-invasive detection of HSV1-TK expression. In non-invasive imaging of the HSV1-TK system, many nucleoside derivatives have been developed as prodrugs for tumor proliferation imaging or as anti-viral drugs. Prodrug activation or sucide gene therapy has been shown to be successful in potentiating the therapeutic index by sensitizing genetically modified tumor cells to various prodrugs or enhancing the action of commonly used chemotherapeutic agents. The most studied prodrug activation approaches involve transfection of tumors with HSV1-TK gene. (Z)-5-(2-iodovinyl)-2'-fluoro- 2'-deoxyuridine (IVFRU) possesses a 2'-fluoro substituent in the ribose configuration, is considered to protect IVFRU from enzyme mediated degradation in vivo. It is obviously potential substrates for HSV1-TK imaging. 2'-Fiuoro-2'-deoxy-1-β-D-arabinofuranosyl- 5-iodo-uridine (FIAU), an anticancer drug widely used in clinical practice, is an analogue of thymidine. In a series of studies using adenovirus vector for gene transfer described the appropriate combination of exogenously introduced HSV1-TK as a 'marker/reporter gene' and radiolabelled FIAU as a 'marker substrate/reporter probe' for monitoring gene therapy and gene expression

Retinoid X receptor and peroxisome proliferator-activated receptor activate an estrogen responsive gene independent of the estrogen receptor.

Science.gov (United States)

Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H

1997-03-14

Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.

Radioactive waste package assay facility. Volume 1. Application of assay technology

International Nuclear Information System (INIS)

Findlay, D.J.S.; Green, T.H.; Molesworth, T.V.; Staniforth, D.; Strachan, N.R.; Rogers, J.D.; Wise, M.O.; Forrest, K.R.

1992-01-01

This report, in three volumes, covers the work carried out by Taylor Woodrow Construction Ltd., and two major sub-contractors: Harwell Laboratory (AEA Technology) and Siemens Plessey Controls Ltd., on the development of a radioactive waste package assay facility, for cemented 500 litre intermediate level waste drums. In volume 1, the reasons for assay are considered together with the various techniques that can be used, and the information that can be obtained. The practical problems associated with the use of the various techniques in an integrated assay facility are identified, and the key parameters defined. Engineering and operational features are examined and provisional designs proposed for facilities at three throughput levels: 15,000, 750 and 30 drums per year respectively. The capital and operating costs for such facilities have been estimated. A number of recommendations are made for further work. 16 refs., 14 figs., 13 tabs

Identification of copper-induced genes in Pseudomonas fluorescens and use of a reporter strain to monitor bioavailable copper in soil

DEFF Research Database (Denmark)

Tom-Petersen, Andreas; Hosbond, Carsten; Nybroe, Ole

2001-01-01

-amended soil microcosms in a concentration-dependent manner. The chelator EDTA reduced the availability of Cu to P. fluorescens in soil. This showed that complex-bound Cu is not necessarily available to bacteria, We compared chemical analysis of soluble Cu and the reporter assay on soil solutions from Cu-containing......-Cu15, the gene interrupted by the transposon encoded a protein carrying a Cu-binding domain but with low homology to known proteins. DF57-Cu15 was the most suitable Cu reporter due to its high specific response and tolerance to Cu in pure culture. DF57-Cu15 responded to soil solutions from Cu...... soil microcosms supplemented with either manure or straw. Organic matter increased the amount of soluble Cu but not the amount of bioavailable Cu. Probably, Cu binds with high affinity to organic constituents in pig manure or barley straw. Hence, determination of soluble Cu by chemical analysis cannot...

Identification of target genes of transcription factor activator protein 2 gamma in breast cancer cells

International Nuclear Information System (INIS)

Ailan, He; Shuanglin, Xiang; Xiangwen, Xiao; Daolong, Ren; Lu, Gan; Xiaofeng, Ding; Xi, Qiao; Xingwang, Hu; Rushi, Liu; Jian, Zhang

2009-01-01

Activator protein 2 gamma (AP-2γ) is a member of the transcription factor activator protein-2 (AP-2) family, which is developmentally regulated and plays a role in human neoplasia. AP-2γ has been found to be overexpressed in most breast cancers, and have a dual role to inhibit tumor initiation and promote tumor progression afterwards during mammary tumorigensis. To identify the gene targets that mediate its effects, we performed chromatin immunoprecipitation (ChIP) to isolate AP-2γ binding sites on genomic DNA from human breast cancer cell line MDA-MB-453. 20 novel DNA fragments proximal to potential AP-2γ targets were obtained. They are categorized into functional groups of carcinogenesis, metabolism and others. A combination of sequence analysis, reporter gene assays, quantitative real-time PCR, electrophoretic gel mobility shift assays and immunoblot analysis further confirmed the four AP-2γ target genes in carcinogenesis group: ErbB2, CDH2, HPSE and IGSF11. Our results were consistent with the previous reports that ErbB2 was the target gene of AP-2γ. Decreased expression and overexpression of AP-2γ in human breast cancer cells significantly altered the expression of these four genes, indicating that AP-2γ directly regulates them. This suggested that AP-2γ can coordinate the expression of a network of genes, involving in carcinogenesis, especially in breast cancer. They could serve as therapeutic targets against breast cancers in the future

Development of a GeXP-multiplex PCR assay for the simultaneous detection and differentiation of six cattle viruses.

Directory of Open Access Journals (Sweden)

Qing Fan

Full Text Available Foot-and-mouth disease virus (FMDV, Bluetongue virus (BTV, Vesicular stomatitis Virus (VSV, Bovine viral diarrheal (BVDV, Bovine rotavirus (BRV, and Bovine herpesvirus 1 (IBRV are common cattle infectious viruses that cause a great economic loss every year in many parts of the world. A rapid and high-throughput GenomeLab Gene Expression Profiler (GeXP analyzer-based multiplex PCR assay was developed for the simultaneous detection and differentiation of these six cattle viruses. Six pairs of chimeric primers consisting of both the gene-specific primer and a universal primer were designed and used for amplification. Then capillary electrophoresis was used to separate the fluorescent labeled PCR products according to the amplicons size. The specificity of GeXP-multiplex PCR assay was examined with samples of the single template and mixed template of six viruses. The sensitivity was evaluated using the GeXP-multiplex PCR assay on serial 10-fold dilutions of ssRNAs obtained via in vitro transcription. To further evaluate the reliability, 305 clinical samples were tested by the GeXP-multiplex PCR assay. The results showed that the corresponding virus specific fragments of genes were amplified. The detection limit of the GeXP-multiplex PCR assay was 100 copies/μL in a mixed sample of ssRNAs containing target genes of six different cattle viruses, whereas the detection limit for the Gexp-mono PCR assay for a single target gene was 10 copies/μL. In detection of viruses in 305 clinical samples, the results of GeXP were consistent with simplex real-time PCR. Analysis of positive samples by sequencing demonstrated that the GeXP-multiplex PCR assay had no false positive samples of nonspecific amplification. In conclusion, this GeXP-multiplex PCR assay is a high throughput, specific, sensitive, rapid and simple method for the detection and differentiation of six cattle viruses. It is an effective tool that can be applied for the rapid differential diagnosis

Identification of listeria species isolated in Tunisia by Microarray based assay : results of a preliminary study

International Nuclear Information System (INIS)

Hmaied, Fatma; Helel, Salma; Barkallah, Insaf; Leberre, V.; Francois, J.M.; Kechrid, A.

2008-01-01

Microarray-based assay is a new molecular approach for genetic screening and identification of microorganisms. We have developed a rapid microarray-based assay for the reliable detection and discrimination of Listeria spp. in food and clinical isolates from Tunisia. The method used in the present study is based on the PCR amplification of a virulence factor gene (iap gene). the PCR mixture contained cyanine Cy5labeled dCTP. Therefore, The PCR products were fluorescently labeled. The presence of multiple species-specific sequences within the iap gene enabled us to design different oligoprobes per species. The species-specific sequences of the iap gene used in this study were obtained from genBank and then aligned for phylogenetic analysis in order to identify and retrieve the sequences of homologues of the amplified iap gene analysed. 20 probes were used for detection and identification of 22 food isolates and clinical isolates of Listeria spp (L. monocytogenes, L. ivanovi), L. welshimeri, L. seeligeri, and L. grayi). Each bacterial gene was identified by hybridization to oligoprobes specific for each Listeria species and immobilized on a glass surface. The microarray analysis showed that 5 clinical isolates and 2 food isolates were identified listeria monocytogenes. Concerning the remaining 15 food isolates; 13 were identified listeria innocua and 2 isolates could not be identified by microarray based assay. Further phylogenetic and molecular analysis are required to design more species-specific probes for the identification of Listeria spp. Microarray-based assay is a simple and rapid method used for Listeria species discrimination

Improving risk stratification among veterans diagnosed with prostate cancer: impact of the 17-gene prostate score assay.

Science.gov (United States)

Lynch, Julie A; Rothney, Megan P; Salup, Raoul R; Ercole, Cesar E; Mathur, Sharad C; Duchene, David A; Basler, Joseph W; Hernandez, Javier; Liss, Michael A; Porter, Michael P; Wright, Jonathan L; Risk, Michael C; Garzotto, Mark; Efimova, Olga; Barrett, Laurie; Berse, Brygida; Kemeter, Michael J; Febbo, Phillip G; Dash, Atreya

2018-01-01

Active surveillance (AS) has been widely implemented within Veterans Affairs' medical centers (VAMCs) as a standard of care for low-risk prostate cancer (PCa). Patient characteristics such as age, race, and Agent Orange (AO) exposure may influence advisability of AS in veterans. The 17-gene assay may improve risk stratification and management selection. To compare management strategies for PCa at 6 VAMCs before and after introduction of the Oncotype DX Genomic Prostate Score (GPS) assay. We reviewed records of patients diagnosed with PCa between 2013 and 2014 to identify management patterns in an untested cohort. From 2015 to 2016, these patients received GPS testing in a prospective study. Charts from 6 months post biopsy were reviewed for both cohorts to compare management received in the untested and tested cohorts. Men who just received their diagnosis and have National Comprehensive Cancer Network (NCCN) very low-, low-, and select cases of intermediate-risk PCa. Patient characteristics were generally similar in the untested and tested cohorts. AS utilization was 12% higher in the tested cohort compared with the untested cohort. In men younger than 60 years, utilization of AS in tested men was 33% higher than in untested men. AS in tested men was higher across all NCCN risk groups and races, particular in low-risk men (72% vs 90% for untested vs tested, respectively). Tested veterans exposed to AO received less AS than untested veterans. Tested nonexposed veterans received 19% more AS than untested veterans. Median GPS results did not significantly differ as a factor of race or AO exposure. Men who receive GPS testing are more likely to utilize AS within the year post diagnosis, regardless of age, race, and NCCN risk group. Median GPS was similar across racial groups and AO exposure groups, suggesting similar biology across these groups. The GPS assay may be a useful tool to refine risk assessment of PCa and increase rates of AS among clinically and

[Quantitative fluorogenic real-time PCR assay for respiratory syncytial virus detection].

Science.gov (United States)

Zhang, Qi-wei; You, Shang-you; Sun, Ji-min; Wu, Qi; Yu, Chun-hua; Zhang, Chu-yu

2005-07-01

To Establish a rapid and objective quantitative fluorogenic real-time PCR assay for early detection of human respiratory syncytial virus (hRSV). Two pairs of primers and one TaqMan Fluorogenic probe that are specific for the recognition of the most conservative N gene of hRSV for virus detection with LighCycler PCR in 93 nasopharyngeal secretion specimens collected from infants and young children. The assay was compared with virus isolation, routine PCR, nested PCR, and enzyme-linked immunosorbent assay (ELISA). This TaqMan assay had a sensitivity of 1 x 10(2) cDNA copies/microl with a dynamic range between 1 x 10(2) and 1 x 10(7) cDNA copies/microl, which was the same as that of nested PCR, but 10 times more sensitive than routine PCR. The specificity of the assay was evaluated by comparing hRSV with polivirus type 1, coxsackie virus type 2, influenza A, influenza B and adenovirus type 7. A PCR product of the expected size (195 bp) was produced and fluorescence signal detected for hRSV, but not for any of the other viruses. The results in LightCycler and Rotor-Gene instrument were consistent. Forty-four specimens (43.9%) were hRSV-positive with this assay and 4 (4/93,4.3%) were hRSV-positive with ELISA, showing rather low correlation between the two methods. No visible relation was found between the concentration of hRSV RNA and severity of the disease. This assay is rapid, sensitive, specific and quantitative, and has the potential of wide application for early diagnosis of hRSV infection and evaluation of the therapeutic effect.

Genetic components for radiosensitivity. Gene expression in radiosensitive monocygotic twins. Final report

International Nuclear Information System (INIS)

Dikomey, Ekkehard

2012-01-01

The underlying hypothesis of this project was that the variation of individual radiosensitivity is determined by the different expression of single gens. This concept was tested using 60 monozygotic twin pairs, followed by an evaluation with 80 prostate cancer patients. Radiosensitivity was assessed for both G0- as well as G2-phase using chromosomal assays. G0- radiosensitivity is determined by lethal chromosomal aberrations and reflects the individual amount of cell killing, while G2-sensitivity is determined by chromatid breaks and is taken as an indicator of individual cancer risk. For both populations, G0- and G2-radiosensitivity are characterized by substantial variation with a CV of 11 and 14% or 27 and 21%, respectively. While the mean G0-sensitivity is the same for both populations, there is a slight difference for G2. The slightly higher value of G2-sensitivity found for prostate cancer patients might result from the higher age of this group. For both populations gene expression profiles were determined using the Affymetrix chip HG-U133+2.0. Overall gene expression was characterized by a huge variation covering more than four decades. However, for single genes, expression showed little variation with CV generally ranging only between 2 and 8%. Analysis of data using several different methods revealed that variation of both G0- as well as G2-radiosensitivity cannot be ascribed to the different expression of single genes. For twins, random forests can be used to identify 8 to 10 genes than are relevant either for G0- or G2-radiosensitivity. However, these genes cannot be confirmed by an evaluation with 80 prostate cancer patients. This finding clearly demonstrates that the hypothesis, due to which variation of individual radiosensitivity is caused by different expression of single genes, has to be rejected. It appears more likely that this parameter is determined by complex interactions of several genes in functional networks. (orig.)

SPECT imaging of cardiac reporter gene expression in living rabbits

International Nuclear Information System (INIS)

Liu Ying; Lan Xiaoli; Zhang Liang; Wu Tao; Jiang Rifeng; Zhang Yongxue

2009-01-01

This work is to demonstrate feasibility of imaging the expression of herpes simplex virus 1-thymidine kinase (HSVI-tk) reporter gene in rabbits myocardium by using the reporter probe 131 I-2'-fluoro-2'-deoxy-l-β-D-arabinofuranosyl-5-iodouracil ( 131 I-FIAU) and SPECT. Rabbits of the study group received intramyocardial injection of Ad5-tk and control group received aseptic saline injection. Two sets of experiments were performed on the study group. Rabbits of the 1st set were injected with 131 I-FIAU 600 μCi at Day 2 after intramyocardial transfection of Ad5-tk in 1xl0 9 , 5x10 8 , 1x10 8 , 5x10 7 and 1x10 7 pfu, and heart SPECT imaging was done at different hours. Rabbits of the 2nd were transferred various titers of Ad5-tk (1x10 9 , 5x10 8 , 1x10 8 , 5x10 7 , 1x10 7 pfu) to determine the threshold and optimal viral titer needed for detection of gene expression. Two days later, 131 I-FIAU was injected and heart SPECT imaging was performed at 6, 24 and 48 h, before killing them for gamma counting of the hearts. Reverse transcription-polymerase chain reaction (RT-PCR) was used to verify the transferred HSVI-tk gene expression. Semi-quantitative analysis derived of region of interest (ROI) of SPECT images and RT-PCR images was performed and the relationship of SPECT images with ex vivo gamma counting and mRNA level were evaluated. SPECT images conformed 131 I-FIAU accumulation in rabbits injected with Ad5-tk in the anterolateral wall. The optimal images quality was obtained at 24-48 h for different viral titers. The highest radioactivity in the focal myocardium was seen at 6 h, and then declined with time. The threshold was 5x10 7 pfu of virus titer. The result could be set better in 1-5x10 8 pfu by SPECT analysis and gamma counting. ROI-derived semi-quantitative study on SPECT images correlated well with ex vivo gamma counting and mRNA levels from RT-PCR analysis. The HSVI-tk/ 131 I-FIAU reporter gene/reporter probe system is feasible for cardiac SPECT reporter

Early Infantile Leigh-like Gene Defects Have a Poor Prognosis: Report and Review

Directory of Open Access Journals (Sweden)

Majid Alfadhel

2017-10-01

Full Text Available Solute carrier family 19 (thiamine transporter, member 3 ( SCL19A3 gene defect produces an autosomal recessive neurodegenerative disorder associated with different phenotypes and acronyms. One of the common presentations is early infantile lethal Leigh-like syndrome. We report a case of early infantile Leigh-like SLC19A3 gene defects of patients who died at 4 months of age with no response to a high dose of biotin and thiamine. In addition, we report a novel mutation that was not reported previously. Finally, we review the literature regarding early infantile Leigh-like SLC19A3 gene defects and compare the literature with our patient.

Genotyping assay for differentiation of wild-type and vaccine viruses in subjects immunized with live attenuated influenza vaccine.

Directory of Open Access Journals (Sweden)

Victoria Matyushenko

Full Text Available Live attenuated influenza vaccines (LAIVs are considered as safe and effective tool to control influenza in different age groups, especially in young children. An important part of the LAIV safety evaluation is the detection of vaccine virus replication in the nasopharynx of the vaccinees, with special attention to a potential virus transmission to the unvaccinated close contacts. Conducting LAIV clinical trials in some geographical regions with year-round circulation of influenza viruses warrants the development of robust and reliable tools for differentiating vaccine viruses from wild-type influenza viruses in nasal pharyngeal wash (NPW specimens of vaccinated subjects. Here we report the development of genotyping assay for the detection of wild-type and vaccine-type influenza virus genes in NPW specimens of young children immunized with Russian-backbone seasonal trivalent LAIV using Sanger sequencing from newly designed universal primers. The new primer set allowed amplification and sequencing of short fragments of viral genes in NPW specimens and appeared to be more sensitive than conventional real-time RT-PCR protocols routinely used for the detection and typing/subtyping of influenza virus in humans. Furthermore, the new assay is capable of defining the origin of wild-type influenza virus through BLAST search with the generated sequences of viral genes fragments.

Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein.

Science.gov (United States)

Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj

2011-10-01

The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.

Presence and Functionality of Mating Type Genes in the Supposedly Asexual Filamentous Fungus Aspergillus oryzae

Science.gov (United States)

Wada, Ryuta; Maruyama, Jun-ichi; Yamaguchi, Haruka; Yamamoto, Nanase; Wagu, Yutaka; Paoletti, Mathieu; Archer, David B.; Dyer, Paul S.

2012-01-01

The potential for sexual reproduction in Aspergillus oryzae was assessed by investigating the presence and functionality of MAT genes. Previous genome studies had identified a MAT1-1 gene in the reference strain RIB40. We now report the existence of a complementary MAT1-2 gene and the sequencing of an idiomorphic region from A. oryzae strain AO6. This allowed the development of a PCR diagnostic assay, which detected isolates of the MAT1-1 and MAT1-2 genotypes among 180 strains assayed, including industrial tane-koji isolates. Strains used for sake and miso production showed a near-1:1 ratio of the MAT1-1 and MAT1-2 mating types, whereas strains used for soy sauce production showed a significant bias toward the MAT1-2 mating type. MAT1-1 and MAT1-2 isogenic strains were then created by genetic manipulation of the resident idiomorph, and gene expression was compared by DNA microarray and quantitative real-time PCR (qRT-PCR) methodologies under conditions in which MAT genes were expressed. Thirty-three genes were found to be upregulated more than 10-fold in either the MAT1-1 host strain or the MAT1-2 gene replacement strain relative to each other, showing that both the MAT1-1 and MAT1-2 genes functionally regulate gene expression in A. oryzae in a mating type-dependent manner, the first such report for a supposedly asexual fungus. MAT1-1 expression specifically upregulated an α-pheromone precursor gene, but the functions of most of the genes affected were unknown. The results are consistent with a heterothallic breeding system in A. oryzae, and prospects for the discovery of a sexual cycle are discussed. PMID:22327593

Evaluation of GenoType NTM-DR Assay for Identification of Mycobacterium chimaera.

Science.gov (United States)

Mok, Simone; Rogers, Thomas R; Fitzgibbon, Margaret

2017-06-01

Identification of species within the Mycobacterium avium complex (MAC) is difficult, and most current diagnostic laboratory tests cannot distinguish between species included in the complex. Differentiation of species within the MAC is important, as Mycobacterium chimaera has recently emerged as a major cause of invasive cardiovascular infections following open heart surgery. A new commercial diagnostic assay, GenoType NTM-DR ver. 1.0, is intended to differentiate between three species within the MAC, namely, Mycobacterium avium , Mycobacterium intracellulare , and Mycobacterium chimaera In this study, we investigated an archival collection of 173 MAC isolates using 16S rRNA and 16S-23S internal transcribed spacer (ITS) gene sequencing, and GenoType NTM-DR was evaluated for identifying M. chimaera and other species belonging to the MAC. Species identification of 157/173 (91%) isolates with the GenoType NTM-DR assay was in agreement with 16S rRNA and 16S-23S ITS gene sequencing results. Misidentification occurred with 16 isolates which belonged to four species included in the MAC that are rarely encountered in clinical specimens. Despite some limitations of this assay, GenoType NTM-DR had 100% specificity for identifying M. chimaera This novel assay will enable diagnostic laboratories to differentiate species belonging to the Mycobacterium avium complex and to accurately identify M. chimaera It can produce rapid results and is also more cost efficient than gene sequencing methods. Copyright © 2017 American Society for Microbiology.

Efficient photoreceptor-targeted gene expression in vivo by recombinant adeno-associated virus.

Science.gov (United States)

Flannery, J G; Zolotukhin, S; Vaquero, M I; LaVail, M M; Muzyczka, N; Hauswirth, W W

1997-06-24

We describe a general approach for achieving efficient and cell type-specific expression of exogenous genes in photoreceptor cells of the mammalian retina. Recombinant adeno-associated virus (rAAV) vectors were used to transfer the bacterial lacZ gene or a synthetic green fluorescent protein gene (gfp) to mouse or rat retinas after injection into the subretinal space. Using a proximal murine rod opsin promoter (+86 to -385) to drive expression, reporter gene product was found exclusively in photoreceptors, not in any other retinal cell type or in the adjacent retinal pigment epithelium. GFP-expressing photoreceptors typically encompassed 10-20% of the total retinal area after a single 2-microl injection. Photoreceptors were transduced with nearly 100% efficiency in the region directly surrounding the injection site. We estimate approximately 2.5 million photoreceptors were transduced as a result of the single subretinal inoculation. This level of gene transfer and expression suggests the feasibility of genetic therapy for retinal disease. The gfp-containing rAAV stock was substantially free of both adenovirus and wild-type AAV, as judged by plaque assay and infectious center assay, respectively. Thus, highly purified, helper virus-free rAAV vectors can achieve high-frequency tissue-specific transduction of terminally differentiated, postmitotic photoreceptor cells.

Knockdown resistance (kdr)-like mutations in the voltage-gated sodium channel of a malaria vector Anopheles stephensi and PCR assays for their detection.

Science.gov (United States)

Singh, Om P; Dykes, Cherry L; Lather, Manila; Agrawal, Om P; Adak, Tridibes

2011-03-14

Knockdown resistance (kdr) in insects, resulting from mutation(s) in the voltage-gated sodium channel (vgsc) gene is one of the mechanisms of resistance against DDT and pyrethroid-group of insecticides. The most common mutation(s) associated with knockdown resistance in insects, including anophelines, has been reported to be present at residue Leu1014 in the IIS6 transmembrane segment of the vgsc gene. This study reports the presence of two alternative kdr-like mutations, L1014S and L1014F, at this residue in a major malaria vector Anopheles stephensi and describes new PCR assays for their detection. Part of the vgsc (IIS4-S5 linker-to-IIS6 transmembrane segment) of An. stephensi collected from Alwar (Rajasthan, India) was PCR-amplified from genomic DNA, sequenced and analysed for the presence of deduced amino acid substitution(s). Analysis of DNA sequences revealed the presence of two alternative non-synonymous point mutations at L1014 residue in the IIS6 transmembrane segment of vgsc, i.e., T>C mutation on the second position and A>T mutation on the third position of the codon, leading to Leu (TTA)-to-Ser (TCA) and -Phe (TTT) amino acid substitutions, respectively. Polymerase chain reaction (PCR) assays were developed for identification of each of these two point mutations. Genotyping of An. stephensi mosquitoes from Alwar by PCR assays revealed the presence of both mutations, with a high frequency of L1014S. The PCR assays developed for detection of the kdr mutations were specific as confirmed by DNA sequencing of PCR-genotyped samples. Two alternative kdr-like mutations, L1014S and L1014F, were detected in An. stephensi with a high allelic frequency of L1014S. The occurrence of L1014S is being reported for the first time in An. stephensi. Two specific PCR assays were developed for detection of two kdr-like mutations in An. stephensi.

Fluorescence-Based Reporters for Detection of Mutagenesis in E. coli.

Science.gov (United States)

Standley, Melissa; Allen, Jennifer; Cervantes, Layla; Lilly, Joshua; Camps, Manel

2017-01-01

Mutagenesis in model organisms following exposure to chemicals is used as an indicator of genotoxicity. Mutagenesis assays are also used to study mechanisms of DNA homeostasis. This chapter focuses on detection of mutagenesis in prokaryotes, which boils down to two approaches: reporter inactivation (forward mutation assay) and reversion of an inactivating mutation (reversion mutation assay). Both methods are labor intensive, involving visual screening, quantification of colonies on solid media, or determining a Poisson distribution in liquid culture. Here, we present two reversion reporters for in vivo mutagenesis that produce a quantitative output, and thus have the potential to greatly reduce the amount of test chemical and labor involved in these assays. This output is obtained by coupling a TEM β lactamase-based reversion assay with GFP fluorescence, either by placing the two genes on the same plasmid or by fusing them translationally and interrupting the N-terminus of the chimeric ORF with a stop codon. We also describe a reporter aimed at facilitating the monitoring of continuous mutagenesis in mutator strains. This reporter couples two reversion markers, allowing the temporal separation of mutation events in time, thus providing information about the dynamics of mutagenesis in mutator strains. Here, we describe these reporter systems, provide protocols for use, and demonstrate their key functional features using error-prone Pol I mutagenesis as a source of mutations. © 2017 Elsevier Inc. All rights reserved.

Green fluorescent protein (GFP color reporter gene visualizes parvovirus B19 non-structural segment 1 (NS1 transfected endothelial modification.

Directory of Open Access Journals (Sweden)

Thomas Wurster

Full Text Available BACKGROUND: Human Parvovirus B19 (PVB19 has been associated with myocarditis putative due to endothelial infection. Whether PVB19 infects endothelial cells and causes a modification of endothelial function and inflammation and, thus, disturbance of microcirculation has not been elucidated and could not be visualized so far. METHODS AND FINDINGS: To examine the PVB19-induced endothelial modification, we used green fluorescent protein (GFP color reporter gene in the non-structural segment 1 (NS1 of PVB19. NS1-GFP-PVB19 or GFP plasmid as control were transfected in an endothelial-like cell line (ECV304. The endothelial surface expression of intercellular-adhesion molecule-1 (CD54/ICAM-1 and extracellular matrix metalloproteinase inducer (EMMPRIN/CD147 were evaluated by flow cytometry after NS-1-GFP or control-GFP transfection. To evaluate platelet adhesion on NS-1 transfected ECs, we performed a dynamic adhesion assay (flow chamber. NS-1 transfection causes endothelial activation and enhanced expression of ICAM-1 (CD54: mean ± standard deviation: NS1-GFP vs. control-GFP: 85.3 ± 11.2 vs. 61.6 ± 8.1; P<0.05 and induces endothelial expression of EMMPRIN/CD147 (CD147: mean ± SEM: NS1-GFP vs. control-GFP: 114 ± 15.3 vs. 80 ± 0.91; P<0.05 compared to control-GFP transfected cells. Dynamic adhesion assays showed that adhesion of platelets is significantly enhanced on NS1 transfected ECs when compared to control-GFP (P<0.05. The transfection of ECs was verified simultaneously through flow cytometry, immunofluorescence microscopy and polymerase chain reaction (PCR analysis. CONCLUSIONS: GFP color reporter gene shows transfection of ECs and may help to visualize NS1-PVB19 induced endothelial activation and platelet adhesion as well as an enhanced monocyte adhesion directly, providing in vitro evidence of possible microcirculatory dysfunction in PVB19-induced myocarditis and, thus, myocardial tissue damage.

Neurospora crassa tox-1 Gene Encodes a pH- and Temperature-Tolerant Mini-Cellulase.

Science.gov (United States)

Xiao, Yue; Zhang, Qiongsi; Luo, Yiquan; Zhang, Ying; Luo, Xi; Wang, Yuchuan; Cao, Weiguo; Pinto, Vito De; Liu, Qiuyun; Li, Gang

2016-06-15

Cellulases that endure extreme conditions are essential in various industrial sectors. This study reports a mini-cellulase gene tox-1 from Neurospora crassa. The gene tox-1 was cloned in Escherichia coli after chimerization with the YebF gene and substitutions of certain isoleucine and valine with leucine residues. The yeast transformants could grow on rice straw-agar medium. The 44-amino acid peptide and its two mutant variants displayed potent cellulase activities in Congo Red assay and enzymatic assays. Conservative replacements with leucine have substantially increased the stabilities and half-lives of the peptides at alkaline pH and low and high temperatures and also the tolerance to organic solvents and surfactants, on the basis of activities toward cellose. The small size of the mini-cellulase would allow for commercially viable automatic chemical peptide synthesis. This work suggests that conservative leucine replacements may serve as a general strategy in the engineering of more robust enzymes with special features with little loss of activities.

Comprehensive analysis of sperm DNA fragmentation by five different assays: TUNEL assay, SCSA, SCD test and alkaline and neutral Comet assay.

Science.gov (United States)

Ribas-Maynou, J; García-Peiró, A; Fernández-Encinas, A; Abad, C; Amengual, M J; Prada, E; Navarro, J; Benet, J

2013-09-01

Sperm DNA fragmentation (SDF) is becoming an important test to assess male infertility. Several different tests are available, but no consensus has yet been reached as to which tests are most predictive of infertility. Few publications have reported a comprehensive analysis comparing these methods within the same population. The objective of this study was to analyze the differences between the five most common methodologies, to study their correlations and to establish their cut-off values, sensitivity and specificity in predicting male infertility. We found differences in SDF between fertile donors and infertile patients in TUNEL, SCSA, SCD and alkaline Comet assays, but none with the neutral Comet assay. The alkaline COMET assay was the best in predicting male infertility followed by TUNEL, SCD and SCSA, whereas the neutral COMET assay had no predictive power. For our patient population, threshold values for infertility were 20.05% for TUNEL assay, 18.90% for SCSA, 22.75% for the SCD test, 45.37% for alkaline Comet and 34.37% for neutral Comet. This work establishes in a comprehensive study that the all techniques except neutral Comet are useful to distinguish fertile and infertile men. © 2013 American Society of Andrology and European Academy of Andrology.

Comparison of loop-mediated isothermal amplification (LAMP) and nested-PCR assay targeting the RE and B1 gene for detection of Toxoplasma gondii in blood samples of children with leukaemia.

Science.gov (United States)

Fallahi, Shirzad; Seyyed Tabaei, Seyyed Javad; Pournia, Yadollah; Zebardast, Nozhat; Kazemi, Bahram

2014-07-01

Toxoplasmosis diagnosis constitutes an important measure for disease prevention and control. In this paper, a newly described DNA amplification technique, loop-mediated isothermal amplification (LAMP), and nested-PCR targeting the repeated element (RE) and B1 gene, were compared to each other for the detection of Toxoplasma gondii DNA in blood samples of children with leukaemia. One hundred ten blood samples from these patients were analyzed by LAMP and nested-PCR. Out of 50 seropositive samples (IgM+, IgG+), positive results were obtained with 92% and 86% on RE, B1-LAMP and 82% and 68% on RE, B1-nested PCR analyses, respectively. Of the 50 seronegative samples, three, two and one samples were detected positive by RE-LAMP, B1-LAMP and RE-nested PCR assays, respectively, while none were detected positive by B1-nested PCR. None of the 10 IgM-, IgG+ samples was detected positive after testing LAMP and nested-PCR assays in duplicate. This is the first report of a study in which the LAMP method was applied with high sensitivity and efficacy for the diagnosis of T. gonii in blood samples of children with leukaemia. Copyright © 2014 Elsevier Inc. All rights reserved.

Comparison of mRNA splicing assay protocols across multiple laboratories: recommendations for best practice in standardized clinical testing.

Science.gov (United States)

Whiley, Phillip J; de la Hoya, Miguel; Thomassen, Mads; Becker, Alexandra; Brandão, Rita; Pedersen, Inge Sokilde; Montagna, Marco; Menéndez, Mireia; Quiles, Francisco; Gutiérrez-Enríquez, Sara; De Leeneer, Kim; Tenés, Anna; Montalban, Gemma; Tserpelis, Demis; Yoshimatsu, Toshio; Tirapo, Carole; Raponi, Michela; Caldes, Trinidad; Blanco, Ana; Santamariña, Marta; Guidugli, Lucia; de Garibay, Gorka Ruiz; Wong, Ming; Tancredi, Mariella; Fachal, Laura; Ding, Yuan Chun; Kruse, Torben; Lattimore, Vanessa; Kwong, Ava; Chan, Tsun Leung; Colombo, Mara; De Vecchi, Giovanni; Caligo, Maria; Baralle, Diana; Lázaro, Conxi; Couch, Fergus; Radice, Paolo; Southey, Melissa C; Neuhausen, Susan; Houdayer, Claude; Fackenthal, Jim; Hansen, Thomas Van Overeem; Vega, Ana; Diez, Orland; Blok, Rien; Claes, Kathleen; Wappenschmidt, Barbara; Walker, Logan; Spurdle, Amanda B; Brown, Melissa A

2014-02-01

Accurate evaluation of unclassified sequence variants in cancer predisposition genes is essential for clinical management and depends on a multifactorial analysis of clinical, genetic, pathologic, and bioinformatic variables and assays of transcript length and abundance. The integrity of assay data in turn relies on appropriate assay design, interpretation, and reporting. We conducted a multicenter investigation to compare mRNA splicing assay protocols used by members of the ENIGMA (Evidence-Based Network for the Interpretation of Germline Mutant Alleles) consortium. We compared similarities and differences in results derived from analysis of a panel of breast cancer 1, early onset (BRCA1) and breast cancer 2, early onset (BRCA2) gene variants known to alter splicing (BRCA1: c.135-1G>T, c.591C>T, c.594-2A>C, c.671-2A>G, and c.5467+5G>C and BRCA2: c.426-12_8delGTTTT, c.7988A>T, c.8632+1G>A, and c.9501+3A>T). Differences in protocols were then assessed to determine which elements were critical in reliable assay design. PCR primer design strategies, PCR conditions, and product detection methods, combined with a prior knowledge of expected alternative transcripts, were the key factors for accurate splicing assay results. For example, because of the position of primers and PCR extension times, several isoforms associated with BRCA1, c.594-2A>C and c.671-2A>G, were not detected by many sites. Variation was most evident for the detection of low-abundance transcripts (e.g., BRCA2 c.8632+1G>A Δ19,20 and BRCA1 c.135-1G>T Δ5q and Δ3). Detection of low-abundance transcripts was sometimes addressed by using more analytically sensitive detection methods (e.g., BRCA2 c.426-12_8delGTTTT ins18bp). We provide recommendations for best practice and raise key issues to consider when designing mRNA assays for evaluation of unclassified sequence variants.

High-throughput gene expression profiling of memory differentiation in primary human T cells

Directory of Open Access Journals (Sweden)

Russell Kate

2008-08-01

Full Text Available Abstract Background The differentiation of naive T and B cells into memory lymphocytes is essential for immunity to pathogens. Therapeutic manipulation of this cellular differentiation program could improve vaccine efficacy and the in vitro expansion of memory cells. However, chemical screens to identify compounds that induce memory differentiation have been limited by 1 the lack of reporter-gene or functional assays that can distinguish naive and memory-phenotype T cells at high throughput and 2 a suitable cell-line representative of naive T cells. Results Here, we describe a method for gene-expression based screening that allows primary naive and memory-phenotype lymphocytes to be discriminated based on complex genes signatures corresponding to these differentiation states. We used ligation-mediated amplification and a fluorescent, bead-based detection system to quantify simultaneously 55 transcripts representing naive and memory-phenotype signatures in purified populations of human T cells. The use of a multi-gene panel allowed better resolution than any constituent single gene. The method was precise, correlated well with Affymetrix microarray data, and could be easily scaled up for high-throughput. Conclusion This method provides a generic solution for high-throughput differentiation screens in primary human T cells where no single-gene or functional assay is available. This screening platform will allow the identification of small molecules, genes or soluble factors that direct memory differentiation in naive human lymphocytes.

Detection of gene copy number aberrations in mantle cell lymphoma by a single quantitative multiplex PCR assay: clinicopathological relevance and prognosis value.

Science.gov (United States)

Jardin, Fabrice; Picquenot, Jean-Michel; Parmentier, Françoise; Ruminy, Philippe; Cornic, Marie; Penther, Dominique; Bertrand, Philippe; Lanic, Hélène; Cassuto, Ophélie; Humbrecht, Catherine; Lemasle, Emilie; Wautier, Agathe; Bastard, Christian; Tilly, Hervé

2009-09-01

The t(11;14)(q13;q32) is the hallmark of mantle cell lymphoma (MCL). Additional genetic alterations occur in the majority of cases. This study aimed to design a polymerase chain reaction (PCR) assay to determine the incidence and relevance of recurrent gene copy number aberrations in this disease. Forty-two MCL cases with frozen- or paraffin-embedded (FFPE) tissues were selected. Three different quantitative Multiplex PCR of Short Fluorescent Fragments (QMPSF) assays were designed to simultaneously analyse eight genes (CDKN2A, RB1, ATM, CDK2, TP53, MYC, CDKN1B, MDM2), to analyse the 9p21 locus (CDKN2A/CDKN2B) and FFPE tissues. Gains of MYC, CDK2, CDKN1B, and MDM2 were observed in 10% of cases. Losses of RB1, CDKN2A, ATM or TP53 were observed in 38%, 31%, 24% and 10% of cases, respectively. Analysis of the 9p21 locus indicated that, in most cases, tumours displayed a complete inactivation of p14(ARF)/p15I(NK4B)/p16I(NK4A). CDKN2A and MYC aberrations were associated with a high MCL international prognostic index (MIPI). CDK2/MDM2 gains and CDKN2A/TP53 losses correlated with an unfavourable outcome. PCR experiments with frozen and FFPE-tissues indicated that our approach is valid in a routine diagnostic setting, providing a powerful tool that could be used for patient stratification in combination with MIPI in future clinical trials.

GMO detection in food and feed through screening by visual loop-mediated isothermal amplification assays.

Science.gov (United States)

Wang, Cong; Li, Rong; Quan, Sheng; Shen, Ping; Zhang, Dabing; Shi, Jianxin; Yang, Litao

2015-06-01

Isothermal DNA/RNA amplification techniques are the primary methodology for developing on-spot rapid nucleic acid amplification assays, and the loop-mediated isothermal amplification (LAMP) technique has been developed and applied in the detection of foodborne pathogens, plant/animal viruses, and genetically modified (GM) food/feed contents. In this study, one set of LAMP assays targeting on eight frequently used universal elements, marker genes, and exogenous target genes, such as CaMV35S promoter, FMV35S promoter, NOS, bar, cry1Ac, CP4 epsps, pat, and NptII, were developed for visual screening of GM contents in plant-derived food samples with high efficiency and accuracy. For these eight LAMP assays, their specificity was evaluated by testing commercial GM plant events and their limits of detection were also determined, which are 10 haploid genome equivalents (HGE) for FMV35S promoter, cry1Ac, and pat assays, as well as five HGE for CaMV35S promoter, bar, NOS terminator, CP4 epsps, and NptII assays. The screening applicability of these LAMP assays was further validated successfully using practical canola, soybean, and maize samples. The results suggested that the established visual LAMP assays are applicable and cost-effective for GM screening in plant-derived food samples.

An extended data mining method for identifying differentially expressed assay-specific signatures in functional genomic studies

Directory of Open Access Journals (Sweden)

Rollins Derrick K

2010-12-01

Full Text Available Abstract Background Microarray data sets provide relative expression levels for thousands of genes for a small number, in comparison, of different experimental conditions called assays. Data mining techniques are used to extract specific information of genes as they relate to the assays. The multivariate statistical technique of principal component analysis (PCA has proven useful in providing effective data mining methods. This article extends the PCA approach of Rollins et al. to the development of ranking genes of microarray data sets that express most differently between two biologically different grouping of assays. This method is evaluated on real and simulated data and compared to a current approach on the basis of false discovery rate (FDR and statistical power (SP which is the ability to correctly identify important genes. Results This work developed and evaluated two new test statistics based on PCA and compared them to a popular method that is not PCA based. Both test statistics were found to be effective as evaluated in three case studies: (i exposing E. coli cells to two different ethanol levels; (ii application of myostatin to two groups of mice; and (iii a simulated data study derived from the properties of (ii. The proposed method (PM effectively identified critical genes in these studies based on comparison with the current method (CM. The simulation study supports higher identification accuracy for PM over CM for both proposed test statistics when the gene variance is constant and for one of the test statistics when the gene variance is non-constant. Conclusions PM compares quite favorably to CM in terms of lower FDR and much higher SP. Thus, PM can be quite effective in producing accurate signatures from large microarray data sets for differential expression between assays groups identified in a preliminary step of the PCA procedure and is, therefore, recommended for use in these applications.

Suitability of a Saccharomyces cerevisiae-based assay to assess the toxicity of pyrimethanil sprayed soils via surface runoff: comparison with standard aquatic and soil toxicity assays.

Science.gov (United States)

Gil, Fátima N; Moreira-Santos, Matilde; Chelinho, Sónia; Pereira, Carla; Feliciano, Joana R; Leitão, Jorge H; Sousa, José P; Ribeiro, Rui; Viegas, Cristina A

2015-02-01

The present study is aimed at evaluating whether a gene expression assay with the microbial eukaryotic model Saccharomyces cerevisiae could be used as a suitable warning tool for the rapid preliminary screening of potential toxic effects on organisms due to scenarios of soil and water contamination with pyrimethanil. The assay consisted of measuring changes in the expression of the selected pyrimethanil-responsive genes ARG3 and ARG5,6 in a standardized yeast population. Evaluation was held by assessing the toxicity of surface runoff, a major route of pesticide exposure in aquatic systems due to non-point-source pollution, which was simulated with a pyrimethanil formulation at a semifield scale mimicking worst-case scenarios of soil contamination (e.g. accident or improper disposal). Yeast cells 2-h exposure to the runoff samples led to a significant 2-fold increase in the expression of both indicator genes. These results were compared with those from assays with organisms relevant for the aquatic and soil compartments, namely the nematode Caenorhabditis elegans (reproduction), the freshwater cladoceran Daphnia magna (survival and reproduction), the benthic midge Chironomus riparius (growth), and the soil invertebrates Folsomia candida and Enchytraeus crypticus (survival and reproduction). Under the experimental conditions used to simulate accidental discharges into soil, runoff waters were highly toxic to the standard test organisms, except for C. elegans. Overall, results point out the usefulness of the yeast assay to provide a rapid preview of the toxicity level in preliminary screenings of environmental samples in situations of inadvertent high pesticide contamination. Advantages and limitations of this novel method are discussed. Copyright © 2014 Elsevier B.V. All rights reserved.

Circadian expression of clock genes and clock-controlled genes in the rat retina

NARCIS (Netherlands)

Kamphuis, Willem; Cailotto, Cathy; Dijk, Frederike; Bergen, Arthur; Buijs, Ruud M.

2005-01-01

The circadian expression patterns of genes encoding for proteins that make up the core of the circadian clock were measured in rat retina using real-time quantitative PCR (qPCR). Transcript levels of several genes previously used for normalization of qPCR assays were determined and the effect of

International Network for Comparison of HIV Neutralization Assays: The NeutNet Report

NARCIS (Netherlands)

Fenyö, Eva Maria; Heath, Alan; Dispinseri, Stefania; Holmes, Harvey; Lusso, Paolo; Zolla-Pazner, Susan; Donners, Helen; Heyndrickx, Leo; Alcami, Jose; Bongertz, Vera; Jassoy, Christian; Malnati, Mauro; Montefiori, David; Moog, Christiane; Morris, Lynn; Osmanov, Saladin; Polonis, Victoria; Sattentau, Quentin; Schuitemaker, Hanneke; Sutthent, Ruengpung; Wrin, Terri; Scarlatti, Gabriella

2009-01-01

BACKGROUND: Neutralizing antibody assessments play a central role in human immunodeficiency virus type-1 (HIV-1) vaccine development but it is unclear which assay, or combination of assays, will provide reliable measures of correlates of protection. To address this, an international collaboration

Improved assay to detect Plasmodium falciparum using an uninterrupted, semi-nested PCR and quantitative lateral flow analysis

Science.gov (United States)

2013-01-01

Background A rapid, non-invasive, and inexpensive point-of-care (POC) diagnostic for malaria followed by therapeutic intervention would improve the ability to control infection in endemic areas. Methods A semi-nested PCR amplification protocol is described for quantitative detection of Plasmodium falciparum and is compared to a traditional nested PCR. The approach uses primers that target the P. falciparum dihydrofolate reductase gene. Results This study demonstrates that it is possible to perform an uninterrupted, asymmetric, semi-nested PCR assay with reduced assay time to detect P. falciparum without compromising the sensitivity and specificity of the assay using saliva as a testing matrix. Conclusions The development of this PCR allows nucleic acid amplification without the need to transfer amplicon from the first PCR step to a second reaction tube with nested primers, thus reducing both the chance of contamination and the time for analysis to PCR amplicon yield was adapted to lateral flow detection using the quantitative up-converting phosphor (UCP) reporter technology. This approach provides a basis for migration of the assay to a POC microfluidic format. In addition the assay was successfully evaluated with oral samples. Oral fluid collection provides a simple non-invasive method to collect clinical samples. PMID:23433252

A Continuous, Fluorogenic Sirtuin 2 Deacylase Assay

DEFF Research Database (Denmark)

Galleano, Iacopo; Schiedel, Matthias; Jung, Manfred

2016-01-01

and kinetic insight regarding sirtuin inhibitors, it is important to have access to efficient assays. In this work, we report readily synthesized fluorogenic substrates enabling enzyme-economical evaluation of SIRT2 inhibitors in a continuous assay format as well as evaluation of the properties of SIRT2...

Measurement of Gene Expression in Archival Paraffin-Embedded Tissues

Science.gov (United States)

Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C.; Shak, Steven; Kiefer, Michael C.; Esteban, Jose M.; Baker, Joffre B.

2004-01-01

Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10-μm FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests. PMID:14695316

Immunosuppressive potential of bardoxolone methyl using a modified murine local lymph node assay (LLNA).

Science.gov (United States)

Kitsukawa, Mika; Tsuchiyama, Hiromi; Maeda, Akihisa; Oshida, Keiyu; Miyamoto, Yohei

2014-08-01

2-Cyano-3, 12-dioxooleana-1, 9-dien-28-oic acid methyl ester (CDDO-Me; bardoxolone methyl) is one of the synthetic oleanane triterpenoids (SOs). It is known that it is the strongest Nrf2/ARE signaling inducer of SOs and slightly inhibits immune response. Little was known about the immunomodulatory action of CDDO-Me in vivo. We assessed its immunosuppressive potential by using the modified mouse lymph node assay (LLNA) including immunosuppression-related gene expression analysis. In the modified LLNA, CDDO-Me showed a significant decrease in lymph node weight and changes in expressions of the immunosuppression-related genes, Zfp459 and Fmo2. It has been already reported that a decrease in lymph node weight was induced by several types of immunosuppressive chemicals such as calcineurin inhibitors, antimetabolites, steroids, and alkylators. In addition, changes in Zfp459 and Fmo2 expression was reported in response after only treatment of antimetabolites. From these results, CDDO-Me is considered to have an immunosuppressive action and similar mechanism to antimetabolites.

Microbead agglutination based assays

KAUST Repository

Kodzius, Rimantas; Castro, David; Foulds, Ian G.; Parameswaran, Ash M.; Sumanpreet, K. Chhina

2013-01-01

We report a simple and rapid room temperature assay for point-of-care (POC) testing that is based on specific agglutination. Agglutination tests are based on aggregation of microbeads in the presence of a specific analyte thus enabling

Relationship between XspI Site Polymorphisms of LDL-R Gene and Serum IL-2 and IL-10 in Patients with Hypercholesterolemia.

Science.gov (United States)

Zhang, Mingming; Lu, Yamin; Liu, Xin; Zhang, Xiaobin; Zhang, Cuigai; Gao, Wei; Tie, Yanqing

2016-11-01

Relationship has been identified in sporadic reports between polymorphisms and hypercholesterolemia. However, the relationship between inflammatory cytokines and polymorphism of low-density lipoprotein receptor (LDL-R) gene in hypercholesterolemia is unclear. This study aimed to explore the relationship and significance between polymorphisms of LDL-R gene and serum Interleukin-2 (IL-2), IL-10 in patients with hypercholesterolemia. PCR-RFLP and direct DNA sequencing assay were employed to determine polymorphism of LDL-R gene in 900 patients with hypercholesterolemia and 400 healthy cases. ELISA was applied to assay serum concentration of IL-2 and IL-10. Blood lipid indexes were tested in all cases. Compared with the healthy controls, level of IL-2 increased significantly, while IL-10 decreased significantly (P hypercholesterolemia. © 2016 Wiley Periodicals, Inc.

Rapid detection of microbial DNA by a novel isothermal genome exponential amplification reaction (GEAR) assay.

Science.gov (United States)

Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan

2012-04-20

In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.