WorldWideScience

Sample records for replicating dna molecules

  1. Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

    NARCIS (Netherlands)

    Tanner, Nathan A.; Loparo, Joseph J.; Oijen, Antoine M. van

    2009-01-01

    We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides. The

  2. DNA replication at the single-molecule level

    NARCIS (Netherlands)

    Stratmann, S.A.; Oijen, A.M. van

    2014-01-01

    A cell can be thought of as a highly sophisticated micro factory: in a pool of billions of molecules – metabolites, structural proteins, enzymes, oligonucleotides – multi-subunit complexes assemble to perform a large number of basic cellular tasks, such as DNA replication, RNA/protein synthesis or

  3. [Single-molecule detection and characterization of DNA replication based on DNA origami].

    Science.gov (United States)

    Wang, Qi; Fan, Youjie; Li, Bin

    2014-08-01

    To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

  4. Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

    Science.gov (United States)

    Gahlon, Hailey L; Romano, Louis J; Rueda, David

    2017-11-20

    Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

  5. Genetic exchanges caused by ultraviolet photoproducts in phage lamda DNA molecules: the role of DNA replication

    International Nuclear Information System (INIS)

    Lin, P.F.; Howard-Flanders, P.; Yale Univ., New Haven, Conn.

    1976-01-01

    Genetic recombination induced by structural damage in DNA molecules was investigated in E. coli K12(lamda) lysogens infected with genetically marked phage lamda. Photoproducts were induced in the phage DNA before infection by exposing them either to 313 nm light in the presence of acetophenone or to 254 nm light. To test the role of the replication of the damage phage DNA on the frequency of the induced recombination , both heteroimmune and homoimmune crosses were performed, and scored for P + recombinants. In heteroimmune crosses, recombination was less frequent in infected cells exposed to visible light and in wild type cells able to perform excision repair than in excision-defective lysogens. Therefore, much of the induced recombination can be attributed to the pyrimidine dimers in the phage DNA. In homoimmune crosses, replication of the phage DNA containing ultraviolet photoproducts was represented by lamda immunity, and was further blocked by the lack of the P gene product needed for replication. The 254 nm photoproducts increased the frequency of recombination in these homoimmune crosses, even though phage DNA replication was blocked. Irradiation with 313 nm light and acetophenone M, which produces dimers and unknown photoproducts, was not as effective per dimer as the 254 nm light. It is concluded from these results that certain unidentified 254 nm photoproducts can cause recombination even in the absence of DNA replication. They are not pyrimidine dimers, as they are not susceptible to excision repair or photoreactivation. In contrast, pyrimidine dimers appear to cause recombination only when the DNA containing them undergoes replication. (orig./MG) [de

  6. Repair of human DNA in molecules that replicate or remain unreplicated following ultraviolet irradiation

    International Nuclear Information System (INIS)

    Waters, R.

    1980-01-01

    The extent of DNA replication, the incidence of uv induced pyrimidine dimers and the repair replication observed after their excision was monitored in human fibroblasts uv irradiated with single or split uv doses. The excision repair processes were measured in molecules that remained unreplicated or in those that replicated after the latter uv irradiation. Less DNA replication was observed after a split as opposed to single uv irradiation. Furthermore, a split dose did not modify the excision parameters measured after a single irradiation, regardless of whether the DNA had replicated or not

  7. Real-time single-molecule observation of rolling-circle DNA replication

    NARCIS (Netherlands)

    Tanner, Nathan A.; Loparo, Joseph J.; Hamdan, Samir M.; Jergic, Slobodan; Dixon, Nicholas E.; Oijen, Antoine M. van

    2009-01-01

    We present a simple technique for visualizing replication of individual DNA molecules in real time. By attaching a rolling-circle substrate to a TIRF microscope-mounted flow chamber, we are able to monitor the progression of single-DNA synthesis events and accurately measure rates and processivities

  8. Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

    KAUST Repository

    Shirbini, Afnan

    2017-05-01

    Single-molecule DNA flow-stretching assays have been a powerful approach to study various aspects on the mechanism of DNA replication for more than a decade. This technique depends on flow-induced force on a bead attached to a surface-tethered DNA. The difference in the elastic property between double-strand DNA (long) and single-strand DNA (short) at low regime force allows the observation of the beads motion when the dsDNA is converted to ssDNA by the replisome machinery during DNA replication. Here, I aim to develop an assay to track in real-time the encounter of the bacteriophage T7 replisome with abasic lesion site inserted on the leading strand template. I optimized methods to construct the DNA substrate that contains the abasic site and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image the encounter of the T7 replisome with abasic site and to characterize how the interactions between the helicase and the polymerase could influence the polymerase proofreading ability and its direct bypass of this highly common DNA damage type.

  9. Single-molecule analysis of DNA replication in Xenopus egg extracts

    NARCIS (Netherlands)

    Yardimci, Hasan; Loveland, Anna B.; van Oijen, Antoine M.; Walter, Johannes C.; Mechali, Marcel

    The recent advent in single-molecule imaging and manipulation methods has made a significant impact on the understanding of molecular mechanisms underlying many essential cellular processes. Single-molecule techniques such as electron microscopy and DNA fiber assays have been employed to study the

  10. Modeling inhomogeneous DNA replication kinetics.

    Directory of Open Access Journals (Sweden)

    Michel G Gauthier

    Full Text Available In eukaryotic organisms, DNA replication is initiated at a series of chromosomal locations called origins, where replication forks are assembled proceeding bidirectionally to replicate the genome. The distribution and firing rate of these origins, in conjunction with the velocity at which forks progress, dictate the program of the replication process. Previous attempts at modeling DNA replication in eukaryotes have focused on cases where the firing rate and the velocity of replication forks are homogeneous, or uniform, across the genome. However, it is now known that there are large variations in origin activity along the genome and variations in fork velocities can also take place. Here, we generalize previous approaches to modeling replication, to allow for arbitrary spatial variation of initiation rates and fork velocities. We derive rate equations for left- and right-moving forks and for replication probability over time that can be solved numerically to obtain the mean-field replication program. This method accurately reproduces the results of DNA replication simulation. We also successfully adapted our approach to the inverse problem of fitting measurements of DNA replication performed on single DNA molecules. Since such measurements are performed on specified portion of the genome, the examined DNA molecules may be replicated by forks that originate either within the studied molecule or outside of it. This problem was solved by using an effective flux of incoming replication forks at the model boundaries to represent the origin activity outside the studied region. Using this approach, we show that reliable inferences can be made about the replication of specific portions of the genome even if the amount of data that can be obtained from single-molecule experiments is generally limited.

  11. Single-molecule studies of DNA replication : Visualization of DNA replication by the T7 bacteriophage replisome at a single-molecule level

    NARCIS (Netherlands)

    Geertsema, Hylkje

    2014-01-01

    De replicatie van DNA speelt een centrale rol in het overbrengen van genetische informatie van cel naar cel. Ons DNA wordt gerepliceerd door een machine van verschillende eiwitten, die elk een verschillende taak hebben maar nauw samenwerken. Eén eiwit zorgt er bijvoorbeeld voor dat het dubbelstrengs

  12. Mechanisms of DNA replication termination.

    Science.gov (United States)

    Dewar, James M; Walter, Johannes C

    2017-08-01

    Genome duplication is carried out by pairs of replication forks that assemble at origins of replication and then move in opposite directions. DNA replication ends when converging replication forks meet. During this process, which is known as replication termination, DNA synthesis is completed, the replication machinery is disassembled and daughter molecules are resolved. In this Review, we outline the steps that are likely to be common to replication termination in most organisms, namely, fork convergence, synthesis completion, replisome disassembly and decatenation. We briefly review the mechanism of termination in the bacterium Escherichia coli and in simian virus 40 (SV40) and also focus on recent advances in eukaryotic replication termination. In particular, we discuss the recently discovered E3 ubiquitin ligases that control replisome disassembly in yeast and higher eukaryotes, and how their activity is regulated to avoid genome instability.

  13. Replicating animal mitochondrial DNA

    Directory of Open Access Journals (Sweden)

    Emily A. McKinney

    2013-01-01

    Full Text Available The field of mitochondrial DNA (mtDNA replication has been experiencing incredible progress in recent years, and yet little is certain about the mechanism(s used by animal cells to replicate this plasmid-like genome. The long-standing strand-displacement model of mammalian mtDNA replication (for which single-stranded DNA intermediates are a hallmark has been intensively challenged by a new set of data, which suggests that replication proceeds via coupled leading-and lagging-strand synthesis (resembling bacterial genome replication and/or via long stretches of RNA intermediates laid on the mtDNA lagging-strand (the so called RITOLS. The set of proteins required for mtDNA replication is small and includes the catalytic and accessory subunits of DNA polymerase y, the mtDNA helicase Twinkle, the mitochondrial single-stranded DNA-binding protein, and the mitochondrial RNA polymerase (which most likely functions as the mtDNA primase. Mutations in the genes coding for the first three proteins are associated with human diseases and premature aging, justifying the research interest in the genetic, biochemical and structural properties of the mtDNA replication machinery. Here we summarize these properties and discuss the current models of mtDNA replication in animal cells.

  14. DNA replication and cancer

    DEFF Research Database (Denmark)

    Boyer, Anne-Sophie; Walter, David; Sørensen, Claus Storgaard

    2016-01-01

    A dividing cell has to duplicate its DNA precisely once during the cell cycle to preserve genome integrity avoiding the accumulation of genetic aberrations that promote diseases such as cancer. A large number of endogenous impacts can challenge DNA replication and cells harbor a battery of pathways...... causing DNA replication stress and genome instability. Further, we describe cellular and systemic responses to these insults with a focus on DNA replication restart pathways. Finally, we discuss the therapeutic potential of exploiting intrinsic replicative stress in cancer cells for targeted therapy....

  15. Modeling DNA Replication.

    Science.gov (United States)

    Bennett, Joan

    1998-01-01

    Recommends the use of a model of DNA made out of Velcro to help students visualize the steps of DNA replication. Includes a materials list, construction directions, and details of the demonstration using the model parts. (DDR)

  16. Eukaryotic DNA Replication Fork.

    Science.gov (United States)

    Burgers, Peter M J; Kunkel, Thomas A

    2017-06-20

    This review focuses on the biogenesis and composition of the eukaryotic DNA replication fork, with an emphasis on the enzymes that synthesize DNA and repair discontinuities on the lagging strand of the replication fork. Physical and genetic methodologies aimed at understanding these processes are discussed. The preponderance of evidence supports a model in which DNA polymerase ε (Pol ε) carries out the bulk of leading strand DNA synthesis at an undisturbed replication fork. DNA polymerases α and δ carry out the initiation of Okazaki fragment synthesis and its elongation and maturation, respectively. This review also discusses alternative proposals, including cellular processes during which alternative forks may be utilized, and new biochemical studies with purified proteins that are aimed at reconstituting leading and lagging strand DNA synthesis separately and as an integrated replication fork.

  17. Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

    KAUST Repository

    Shirbini, Afnan

    2017-01-01

    and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image

  18. Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

    Science.gov (United States)

    Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

    2018-01-01

    Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

  19. Replication of kinetoplast minicircle DNA

    International Nuclear Information System (INIS)

    Sheline, C.T.

    1989-01-01

    These studies describe the isolation and characterization of early minicircle replication intermediates from Crithidia fasciculata, and Leishmania tarentolae, the mitochondrial localization of a type II topoisomerase (TIImt) in C. fasciculata, and the implication of the aforementioned TIImt in minicircle replication in L. tarentolae. Early minicircle replication intermediates from C. fasciculata were identified and characterized using isolated kinetoplasts to incorporate radiolabeled nucleotides into its DNA. The pulse-label in an apparent theta-type intermediate chase into two daughter molecules. A uniquely gapped, ribonucleotide primed, knotted molecule represents the leading strand in the model proposed, and a highly gapped molecule represents the lagging strand. This theta intermediate is repaired in vitro to a doubly nicked catenated dimer which was shown to result from the replication of a single parental molecule. Very similar intermediates were found in the heterogeneous population of minicircles of L. tarentolae. The sites of the Leishmania specific discontinuities were mapped and shown to lie within the universally conserved sequence blocks in identical positions as compared to C. fasciculata and Trypanosoma equiperdum

  20. DNA Replication Profiling Using Deep Sequencing.

    Science.gov (United States)

    Saayman, Xanita; Ramos-Pérez, Cristina; Brown, Grant W

    2018-01-01

    Profiling of DNA replication during progression through S phase allows a quantitative snap-shot of replication origin usage and DNA replication fork progression. We present a method for using deep sequencing data to profile DNA replication in S. cerevisiae.

  1. The Inherent Asymmetry of DNA Replication.

    Science.gov (United States)

    Snedeker, Jonathan; Wooten, Matthew; Chen, Xin

    2017-10-06

    Semiconservative DNA replication has provided an elegant solution to the fundamental problem of how life is able to proliferate in a way that allows cells, organisms, and populations to survive and replicate many times over. Somewhat lost, however, in our admiration for this mechanism is an appreciation for the asymmetries that occur in the process of DNA replication. As we discuss in this review, these asymmetries arise as a consequence of the structure of the DNA molecule and the enzymatic mechanism of DNA synthesis. Increasing evidence suggests that asymmetries in DNA replication are able to play a central role in the processes of adaptation and evolution by shaping the mutagenic landscape of cells. Additionally, in eukaryotes, recent work has demonstrated that the inherent asymmetries in DNA replication may play an important role in the process of chromatin replication. As chromatin plays an essential role in defining cell identity, asymmetries generated during the process of DNA replication may play critical roles in cell fate decisions related to patterning and development.

  2. Replication of bacteriophage lambda DNA

    International Nuclear Information System (INIS)

    Tsurimoto, T.; Matsubara, K.

    1983-01-01

    In this paper results of studies on the mechanism of bacteriophage lambda replication using molecular biological and biochemical approaches are reported. The purification of the initiator proteins, O and P, and the role of the O and P proteins in the initiation of lambda DNA replication through interactions with specific DNA sequences are described. 47 references, 15 figures

  3. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.

    1979-01-01

    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  4. Mechanisms of bacterial DNA replication restart

    Science.gov (United States)

    Windgassen, Tricia A; Wessel, Sarah R; Bhattacharyya, Basudeb

    2018-01-01

    Abstract Multi-protein DNA replication complexes called replisomes perform the essential process of copying cellular genetic information prior to cell division. Under ideal conditions, replisomes dissociate only after the entire genome has been duplicated. However, DNA replication rarely occurs without interruptions that can dislodge replisomes from DNA. Such events produce incompletely replicated chromosomes that, if left unrepaired, prevent the segregation of full genomes to daughter cells. To mitigate this threat, cells have evolved ‘DNA replication restart’ pathways that have been best defined in bacteria. Replication restart requires recognition and remodeling of abandoned replication forks by DNA replication restart proteins followed by reloading of the replicative DNA helicase, which subsequently directs assembly of the remaining replisome subunits. This review summarizes our current understanding of the mechanisms underlying replication restart and the proteins that drive the process in Escherichia coli (PriA, PriB, PriC and DnaT). PMID:29202195

  5. Direct Visualization of DNA Replication Dynamics in Zebrafish Cells.

    Science.gov (United States)

    Kuriya, Kenji; Higashiyama, Eriko; Avşar-Ban, Eriko; Tamaru, Yutaka; Ogata, Shin; Takebayashi, Shin-ichiro; Ogata, Masato; Okumura, Katsuzumi

    2015-12-01

    Spatiotemporal regulation of DNA replication in the S-phase nucleus has been extensively studied in mammalian cells because it is tightly coupled with the regulation of other nuclear processes such as transcription. However, little is known about the replication dynamics in nonmammalian cells. Here, we analyzed the DNA replication processes of zebrafish (Danio rerio) cells through the direct visualization of replicating DNA in the nucleus and on DNA fiber molecules isolated from the nucleus. We found that zebrafish chromosomal DNA at the nuclear interior was replicated first, followed by replication of DNA at the nuclear periphery, which is reminiscent of the spatiotemporal regulation of mammalian DNA replication. However, the relative duration of interior DNA replication in zebrafish cells was longer compared to mammalian cells, possibly reflecting zebrafish-specific genomic organization. The rate of replication fork progression and ori-to-ori distance measured by the DNA combing technique were ∼ 1.4 kb/min and 100 kb, respectively, which are comparable to those in mammalian cells. To our knowledge, this is a first report that measures replication dynamics in zebrafish cells.

  6. Chromosomal DNA replication of Vicia faba cells

    International Nuclear Information System (INIS)

    Ikushima, Takaji

    1976-01-01

    The chromosomal DNA replication of higher plant cells has been investigated by DNA fiber autoradiography. The nuclear DNA fibers of Vicia root meristematic cells are organized into many tandem arrays of replication units or replicons which exist as clusters with respect to replication. DNA is replicated bidirectionally from the initiation points at the average rate of 0.15 μm/min at 20 0 C, and the average interinitiation interval is about 16 μm. The manner of chromosomal DNA replication in this higher plant is similar to that found in other eukaryotic cells at a subchromosomal level. (auth.)

  7. Intrinsically bent DNA in replication origins and gene promoters.

    Science.gov (United States)

    Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A

    2008-06-24

    Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.

  8. Dynamic behavior of DNA replication domains

    NARCIS (Netherlands)

    Manders, E. M.; Stap, J.; Strackee, J.; van Driel, R.; Aten, J. A.

    1996-01-01

    Like many nuclear processes, DNA replication takes place in distinct domains that are scattered throughout the S-phase nucleus. Recently we have developed a fluorescent double-labeling procedure that allows us to visualize nascent DNA simultaneously with "newborn" DNA that had replicated earlier in

  9. Synchronization of DNA array replication kinetics

    Science.gov (United States)

    Manturov, Alexey O.; Grigoryev, Anton V.

    2016-04-01

    In the present work we discuss the features of the DNA replication kinetics at the case of multiplicity of simultaneously elongated DNA fragments. The interaction between replicated DNA fragments is carried out by free protons that appears at the every nucleotide attachment at the free end of elongated DNA fragment. So there is feedback between free protons concentration and DNA-polymerase activity that appears as elongation rate dependence. We develop the numerical model based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) for DNA elongation process with conditions pointed above and we study the possibility of the DNA polymerases movement synchronization. The results obtained numerically can be useful for DNA polymerase movement detection and visualization of the elongation process in the case of massive DNA replication, eg, under PCR condition or for DNA "sequencing by synthesis" sequencing devices evaluation.

  10. Enzymatic recognition of DNA replication origins

    International Nuclear Information System (INIS)

    Stayton, M.M.; Bertsch, L.; Biswas, S.

    1983-01-01

    In this paper we discuss the process of recognition of the complementary-strand origin with emphasis on RNA polymerase action in priming M13 DNA replication, the role of primase in G4 DNA replication, and the function of protein n, a priming protein, during primosome assembly. These phage systems do not require several of the bacterial DNA replication enzymes, particularly those involved in the regulation of chromosome copy number of the initiatiion of replication of duplex DNA. 51 references, 13 figures, 1 table

  11. Human Parvovirus B19 Utilizes Cellular DNA Replication Machinery for Viral DNA Replication.

    Science.gov (United States)

    Zou, Wei; Wang, Zekun; Xiong, Min; Chen, Aaron Yun; Xu, Peng; Ganaie, Safder S; Badawi, Yomna; Kleiboeker, Steve; Nishimune, Hiroshi; Ye, Shui Qing; Qiu, Jianming

    2018-03-01

    Human parvovirus B19 (B19V) infection of human erythroid progenitor cells (EPCs) induces a DNA damage response and cell cycle arrest at late S phase, which facilitates viral DNA replication. However, it is not clear exactly which cellular factors are employed by this single-stranded DNA virus. Here, we used microarrays to systematically analyze the dynamic transcriptome of EPCs infected with B19V. We found that DNA metabolism, DNA replication, DNA repair, DNA damage response, cell cycle, and cell cycle arrest pathways were significantly regulated after B19V infection. Confocal microscopy analyses revealed that most cellular DNA replication proteins were recruited to the centers of viral DNA replication, but not the DNA repair DNA polymerases. Our results suggest that DNA replication polymerase δ and polymerase α are responsible for B19V DNA replication by knocking down its expression in EPCs. We further showed that although RPA32 is essential for B19V DNA replication and the phosphorylated forms of RPA32 colocalized with the replicating viral genomes, RPA32 phosphorylation was not necessary for B19V DNA replication. Thus, this report provides evidence that B19V uses the cellular DNA replication machinery for viral DNA replication. IMPORTANCE Human parvovirus B19 (B19V) infection can cause transient aplastic crisis, persistent viremia, and pure red cell aplasia. In fetuses, B19V infection can result in nonimmune hydrops fetalis and fetal death. These clinical manifestations of B19V infection are a direct outcome of the death of human erythroid progenitors that host B19V replication. B19V infection induces a DNA damage response that is important for cell cycle arrest at late S phase. Here, we analyzed dynamic changes in cellular gene expression and found that DNA metabolic processes are tightly regulated during B19V infection. Although genes involved in cellular DNA replication were downregulated overall, the cellular DNA replication machinery was tightly

  12. DNA replication stress restricts ribosomal DNA copy number

    Science.gov (United States)

    Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin

    2017-01-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

  13. DNA replication stress restricts ribosomal DNA copy number.

    Science.gov (United States)

    Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L

    2017-09-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  14. DNA replication stress restricts ribosomal DNA copy number.

    Directory of Open Access Journals (Sweden)

    Devika Salim

    2017-09-01

    Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  15. Modes of DNA repair and replication

    International Nuclear Information System (INIS)

    Hanawalt, P.; Kondo, S.

    1979-01-01

    Modes of DNA repair and replication require close coordination as well as some overlap of enzyme functions. Some classes of recovery deficient mutants may have defects in replication rather than repair modes. Lesions such as the pyrimidine dimers produced by ultraviolet light irradiation are the blocks to normal DNA replication in vivo and in vitro. The DNA synthesis by the DNA polymerase 1 of E. coli is blocked at one nucleotide away from the dimerized pyrimidines in template strands. Thus, some DNA polymerases seem to be unable to incorporate nucleotides opposite to the non-pairing lesions in template DNA strands. The lesions in template DNA strands may block the sequential addition of nucleotides in the synthesis of daughter strands. Normal replication utilizes a constitutive ''error-free'' mode that copies DNA templates with high fidelity, but which may be totally blocked at a lesion that obscures the appropriate base pairing specificity. It might be expected that modified replication system exhibits generally high error frequency. The error rate of DNA polymerases may be controlled by the degree of phosphorylation of the enzyme. Inducible SOS system is controlled by recA genes that also control the pathways for recombination. It is possible that SOS system involves some process other than the modification of a blocked replication apparatus to permit error-prone transdimer synthesis. (Yamashita, S.)

  16. Targeting DNA Replication Stress for Cancer Therapy

    Directory of Open Access Journals (Sweden)

    Jun Zhang

    2016-08-01

    Full Text Available The human cellular genome is under constant stress from extrinsic and intrinsic factors, which can lead to DNA damage and defective replication. In normal cells, DNA damage response (DDR mediated by various checkpoints will either activate the DNA repair system or induce cellular apoptosis/senescence, therefore maintaining overall genomic integrity. Cancer cells, however, due to constitutive growth signaling and defective DDR, may exhibit “replication stress” —a phenomenon unique to cancer cells that is described as the perturbation of error-free DNA replication and slow-down of DNA synthesis. Although replication stress has been proven to induce genomic instability and tumorigenesis, recent studies have counterintuitively shown that enhancing replicative stress through further loosening of the remaining checkpoints in cancer cells to induce their catastrophic failure of proliferation may provide an alternative therapeutic approach. In this review, we discuss the rationale to enhance replicative stress in cancer cells, past approaches using traditional radiation and chemotherapy, and emerging approaches targeting the signaling cascades induced by DNA damage. We also summarize current clinical trials exploring these strategies and propose future research directions including the use of combination therapies, and the identification of potential new targets and biomarkers to track and predict treatment responses to targeting DNA replication stress.

  17. Molecular Mechanisms of DNA Replication Checkpoint Activation

    Directory of Open Access Journals (Sweden)

    Bénédicte Recolin

    2014-03-01

    Full Text Available The major challenge of the cell cycle is to deliver an intact, and fully duplicated, genetic material to the daughter cells. To this end, progression of DNA synthesis is monitored by a feedback mechanism known as replication checkpoint that is untimely linked to DNA replication. This signaling pathway ensures coordination of DNA synthesis with cell cycle progression. Failure to activate this checkpoint in response to perturbation of DNA synthesis (replication stress results in forced cell division leading to chromosome fragmentation, aneuploidy, and genomic instability. In this review, we will describe current knowledge of the molecular determinants of the DNA replication checkpoint in eukaryotic cells and discuss a model of activation of this signaling pathway crucial for maintenance of genomic stability.

  18. MYC and the Control of DNA Replication

    Science.gov (United States)

    Dominguez-Sola, David; Gautier, Jean

    2014-01-01

    The MYC oncogene is a multifunctional protein that is aberrantly expressed in a significant fraction of tumors from diverse tissue origins. Because of its multifunctional nature, it has been difficult to delineate the exact contributions of MYC’s diverse roles to tumorigenesis. Here, we review the normal role of MYC in regulating DNA replication as well as its ability to generate DNA replication stress when overexpressed. Finally, we discuss the possible mechanisms by which replication stress induced by aberrant MYC expression could contribute to genomic instability and cancer. PMID:24890833

  19. Chromatin challenges during DNA replication and repair

    DEFF Research Database (Denmark)

    Groth, Anja; Rocha, Walter; Verreault, Alain

    2007-01-01

    Inheritance and maintenance of the DNA sequence and its organization into chromatin are central for eukaryotic life. To orchestrate DNA-replication and -repair processes in the context of chromatin is a challenge, both in terms of accessibility and maintenance of chromatin organization. To meet...... the challenge of maintenance, cells have evolved efficient nucleosome-assembly pathways and chromatin-maturation mechanisms that reproduce chromatin organization in the wake of DNA replication and repair. The aim of this Review is to describe how these pathways operate and to highlight how the epigenetic...... landscape may be stably maintained even in the face of dramatic changes in chromatin structure....

  20. Iterated function systems for DNA replication

    Science.gov (United States)

    Gaspard, Pierre

    2017-10-01

    The kinetic equations of DNA replication are shown to be exactly solved in terms of iterated function systems, running along the template sequence and giving the statistical properties of the copy sequences, as well as the kinetic and thermodynamic properties of the replication process. With this method, different effects due to sequence heterogeneity can be studied, in particular, a transition between linear and sublinear growths in time of the copies, and a transition between continuous and fractal distributions of the local velocities of the DNA polymerase along the template. The method is applied to the human mitochondrial DNA polymerase γ without and with exonuclease proofreading.

  1. Single molecular biology: coming of age in DNA replication.

    Science.gov (United States)

    Liu, Xiao-Jing; Lou, Hui-Qiang

    2017-09-20

    DNA replication is an essential process of the living organisms. To achieve precise and reliable replication, DNA polymerases play a central role in DNA synthesis. Previous investigations have shown that the average rates of DNA synthesis on the leading and lagging strands in a replisome must be similar to avoid the formation of significant gaps in the nascent strands. The underlying mechanism has been assumed to be coordination between leading- and lagging-strand polymerases. However, Kowalczykowski's lab members recently performed single molecule techniques in E. coli and showed the real-time behavior of a replisome. The leading- and lagging-strand polymerases function stochastically and independently. Furthermore, when a DNA polymerase is paused, the helicase slows down in a self-regulating fail-safe mechanism, akin to a ''dead-man's switch''. Based on the real-time single-molecular observation, the authors propose that leading- and lagging-strand polymerases synthesize DNA stochastically within a Gaussian distribution. Along with the development and application of single-molecule techniques, we will witness a new age of DNA replication and other biological researches.

  2. Rolling replication of UV-irradiated duplex DNA in the phi X174 replicative-form----single-strand replication system in vitro

    International Nuclear Information System (INIS)

    Shavitt, O.; Livneh, Z.

    1989-01-01

    Cloning of the phi X174 viral origin of replication into phage M13mp8 produced an M13-phi X174 chimera, the DNA of which directed efficient replicative-form----single-strand rolling replication in vitro. This replication assay was performed with purified phi X174-encoded gene A protein, Escherichia coli rep helicase, single-stranded DNA-binding protein, and DNA polymerase III holoenzyme. The nicking of replicative-form I (RFI) DNA by gene A protein was essentially unaffected by the presence of UV lesions in the DNA. However, unwinding of UV-irradiated DNA by the rep helicase was inhibited twofold as compared with unwinding of the unirradiated substrate. UV irradiation of the substrate DNA caused a strong inhibition in its ability to direct DNA synthesis. However, even DNA preparations that contained as many as 10 photodimers per molecule still supported the synthesis of progeny full-length single-stranded DNA. The appearance of full-length radiolabeled products implied at least two full rounds of replication, since the first round released the unlabeled plus viral strand of the duplex DNA. Pretreatment of the UV-irradiated DNA substrate with purified pyrimidine dimer endonuclease from Micrococcus luteus, which converted photodimer-containing supercoiled RFI DNA into relaxed, nicked RFII DNA and thus prevented its replication, reduced DNA synthesis by 70%. Analysis of radiolabeled replication products by agarose gel electrophoresis followed by autoradiography revealed that this decrease was due to a reduction in the synthesis of progeny full-length single-stranded DNA. This implies that 70 to 80% of the full-length DNA products produced in this system were synthesized on molecules that carried photodimers

  3. Inhibition of DNA replication by ultraviolet light

    International Nuclear Information System (INIS)

    Edenberg, H.J.

    1976-01-01

    DNA replication in ultraviolet-irradiated HeLa cells was studied by two different techniques: measurements of the kinetics of semiconservative DNA synthesis, and DNA fiber autoradiography. In examining the kinetics of semiconservative DNA synthesis, density label was used to avoid measuring the incorporation due to repair replication. The extent of inhibition varied with time. After doses of less than 10 J/m 2 the rate was initially depressed but later showed some recovery. After higher doses, a constant, low rate of synthesis was seen for at least the initial 6 h. An analysis of these data indicated that the inhibition of DNA synthesis could be explained by replication forks halting at pyrimidine dimers. DNA fiber autoradiography was used to further characterize replication after ultraviolet irradiation. The average length of labeled segments in irradiated cells increased in the time immediately after irradiation, and then leveled off. This is the predicted pattern if DNA synthesis in each replicon continued at its previous rate until a lesion is reached, and then halted. The frequency of lesions that block synthesis is approximately the same as the frequency of pyrimidine dimers

  4. Repair replication in replicating and nonreplicating DNA after irradiation with uv light

    Energy Technology Data Exchange (ETDEWEB)

    Slor, H.; Cleaver, J.E.

    1978-06-01

    Ultraviolet light induces more pyrimidine dimers and more repair replication in DNA that replicates within 2 to 3 h of irradiation than in DNA that does not replicate during this period. This difference may be due to special conformational changes in DNA and chromatin that might be associated with semiconservative DNA replication.

  5. DNA replication stress and cancer chemotherapy.

    Science.gov (United States)

    Kitao, Hiroyuki; Iimori, Makoto; Kataoka, Yuki; Wakasa, Takeshi; Tokunaga, Eriko; Saeki, Hiroshi; Oki, Eiji; Maehara, Yoshihiko

    2018-02-01

    DNA replication is one of the fundamental biological processes in which dysregulation can cause genome instability. This instability is one of the hallmarks of cancer and confers genetic diversity during tumorigenesis. Numerous experimental and clinical studies have indicated that most tumors have experienced and overcome the stresses caused by the perturbation of DNA replication, which is also referred to as DNA replication stress (DRS). When we consider therapeutic approaches for tumors, it is important to exploit the differences in DRS between tumor and normal cells. In this review, we introduce the current understanding of DRS in tumors and discuss the underlying mechanism of cancer therapy from the aspect of DRS. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  6. Replication of DNA during barley endosperm development

    DEFF Research Database (Denmark)

    Giese, H.

    1992-01-01

    The incorporation of [6-H-3]-thymidine into DNA of developing barley end sperm was examined by autoradiography of cross sections of seeds and DNA analysis. The majority of nuclear divisions took place in the very young endosperm, but as late as 25 days after anthesis there was evidence for DNA...... replication. The DNA content of the endosperm increases during development and in response to nitrogen application in parallel to the storage protein synthesis profile. The hordein genes were hypersensitive to DNase I treatment throughout development....

  7. Signal replication in a DNA nanostructure

    Science.gov (United States)

    Mendoza, Oscar; Houmadi, Said; Aimé, Jean-Pierre; Elezgaray, Juan

    2017-01-01

    Logic circuits based on DNA strand displacement reaction are the basic building blocks of future nanorobotic systems. The circuits tethered to DNA origami platforms present several advantages over solution-phase versions where couplings are always diffusion-limited. Here we consider a possible implementation of one of the basic operations needed in the design of these circuits, namely, signal replication. We show that with an appropriate preparation of the initial state, signal replication performs in a reproducible way. We also show the existence of side effects concomitant to the high effective concentrations in tethered circuits, such as slow leaky reactions and cross-activation.

  8. Nonequilibrium Phase Transitions Associated with DNA Replication

    Science.gov (United States)

    2011-02-11

    polymerases) catalyzing the growth of a DNA primer strand (the nascent chain of nucleotides complementary to the template strand) based on the Watson ...the fraction (error rate) of monomers for which y, where y is the correct Watson - Crick complementary base of , can be obtained by ¼ X...Nonequilibrium Phase Transitions Associated with DNA Replication Hyung-June Woo* and Anders Wallqvist Biotechnology High Performance Computing

  9. RAD51 interconnects between DNA replication, DNA repair and immunity.

    Science.gov (United States)

    Bhattacharya, Souparno; Srinivasan, Kalayarasan; Abdisalaam, Salim; Su, Fengtao; Raj, Prithvi; Dozmorov, Igor; Mishra, Ritu; Wakeland, Edward K; Ghose, Subroto; Mukherjee, Shibani; Asaithamby, Aroumougame

    2017-05-05

    RAD51, a multifunctional protein, plays a central role in DNA replication and homologous recombination repair, and is known to be involved in cancer development. We identified a novel role for RAD51 in innate immune response signaling. Defects in RAD51 lead to the accumulation of self-DNA in the cytoplasm, triggering a STING-mediated innate immune response after replication stress and DNA damage. In the absence of RAD51, the unprotected newly replicated genome is degraded by the exonuclease activity of MRE11, and the fragmented nascent DNA accumulates in the cytosol, initiating an innate immune response. Our data suggest that in addition to playing roles in homologous recombination-mediated DNA double-strand break repair and replication fork processing, RAD51 is also implicated in the suppression of innate immunity. Thus, our study reveals a previously uncharacterized role of RAD51 in initiating immune signaling, placing it at the hub of new interconnections between DNA replication, DNA repair, and immunity. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Mammalian RAD52 Functions in Break-Induced Replication Repair of Collapsed DNA Replication Forks

    DEFF Research Database (Denmark)

    Sotiriou, Sotirios K; Kamileri, Irene; Lugli, Natalia

    2016-01-01

    Human cancers are characterized by the presence of oncogene-induced DNA replication stress (DRS), making them dependent on repair pathways such as break-induced replication (BIR) for damaged DNA replication forks. To better understand BIR, we performed a targeted siRNA screen for genes whose...... RAD52 facilitates repair of collapsed DNA replication forks in cancer cells....

  11. DNA replication and repair in Tilapia cells

    International Nuclear Information System (INIS)

    Yew, F.H.; Chang, L.M.

    1984-01-01

    The effect of ultraviolet radiation on a cell line established from the warm water fish Tilapia has been assessed by measuring the rate of DNA synthesis, excision repair, post-replication repair and cell survival. The cells tolerate ultraviolet radiation better than mammalian cells with respect to DNA synthesis, post-replication repair and cell survival. They are also efficient in excision repair, which in other fish cell lines has been found to be at a low level or absent. Their response to the inhibitors hydroxyurea and 1-β-D-arabinofuranosylcytosine is less sensitive than that of other cell lines, yet the cells seem to have very small pools of DNA precursor. (author)

  12. Replication of each copy of the yeast 2 micron DNA plasmid occurs during the S phase.

    Science.gov (United States)

    Zakian, V A; Brewer, B J; Fangman, W L

    1979-08-01

    Saccharomyces cerevisiae contains 50-100 copies per cell of a circular plasmid called 2 micron DNA. Replication of this DNA was studied in two ways. The distribution of replication events among 2 micron DNA molecules was examined by density transfer experiments with asynchronous cultures. The data show that 2 micron DNA replication is similar to chromosomal DNA replication: essentially all 2 micron duplexes were of hybrid density at one cell doubling after the density transfer, with the majority having one fully dense strand and one fully light strand. The results show that replication of 2 micron DNA occurs by a semiconservative mechanism where each of the plasmid molecules replicates once each cell cycle. 2 micron DNA is the only known example of a multiple-copy, extrachromosomal DNA in which every molecule replicates in each cell cycle. Quantitative analysis of the data indicates that 2 micron DNA replication is limited to a fraction of the cell cycle. The period in the cell cycle when 2 micron DNA replicates was examined directly with synchronous cell cultures. Synchronization was accomplished by sequentially arresting cells in G1 phase using the yeast pheromone alpha-factor and incubating at the restrictive temperature for a cell cycle (cdc 7) mutant. Replication was monitored by adding 3H-uracil to cells previously labeled with 14C-uracil, and determining the 3H/14C ratio for purified DNA species. 2 micron DNA replication did not occur during the G1 arrest periods. However, the population of 2 micron DNA doubled during the synchronous S phase at the permissive temperature, with most of the replication occurring in the first third of S phase. Our results indicate that a mechanism exists which insures that the origin of replication of each 2 micron DNA molecule is activated each S phase. As with chromosomal DNA, further activation is prevented until the next cell cycle. We propose that the mechanism which controls the replication initiation of each 2 micron DNA

  13. Timing, coordination, and rhythm: Acrobatics at the DNA replication fork

    KAUST Repository

    Hamdan, Samir

    2010-04-09

    In DNA replication, the antiparallel nature of the parental duplex imposes certain constraints on the activity of the DNA polymerases that synthesize new DNA. The leading-strand polymerase advances in a continuous fashion, but the lagging-strand polymerase is forced to restart at short intervals. In several prokaryotic systems studied so far, this problem is solved by the formation of a loop in the lagging strand of the replication fork to reorient the lagging-strand DNA polymerase so that it advances in parallel with the leading-strand polymerase. The replication loop grows and shrinks during each cycle of Okazaki fragment synthesis. The timing of Okazaki fragment synthesis and loop formation is determined by a subtle interplay of enzymatic activities at the fork. Recent developments in single-molecule techniques have enabled the direct observation of these processes and have greatly contributed to a better understanding of the dynamic nature of the replication fork. Here, we will review recent experimental advances, present the current models, and discuss some of the exciting developments in the field. 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Timing, coordination, and rhythm: Acrobatics at the DNA replication fork

    KAUST Repository

    Hamdan, Samir; van Oijen, Antoine M.

    2010-01-01

    In DNA replication, the antiparallel nature of the parental duplex imposes certain constraints on the activity of the DNA polymerases that synthesize new DNA. The leading-strand polymerase advances in a continuous fashion, but the lagging-strand polymerase is forced to restart at short intervals. In several prokaryotic systems studied so far, this problem is solved by the formation of a loop in the lagging strand of the replication fork to reorient the lagging-strand DNA polymerase so that it advances in parallel with the leading-strand polymerase. The replication loop grows and shrinks during each cycle of Okazaki fragment synthesis. The timing of Okazaki fragment synthesis and loop formation is determined by a subtle interplay of enzymatic activities at the fork. Recent developments in single-molecule techniques have enabled the direct observation of these processes and have greatly contributed to a better understanding of the dynamic nature of the replication fork. Here, we will review recent experimental advances, present the current models, and discuss some of the exciting developments in the field. 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. The Role of the Transcriptional Response to DNA Replication Stress.

    Science.gov (United States)

    Herlihy, Anna E; de Bruin, Robertus A M

    2017-03-02

    During DNA replication many factors can result in DNA replication stress. The DNA replication stress checkpoint prevents the accumulation of replication stress-induced DNA damage and the potential ensuing genome instability. A critical role for post-translational modifications, such as phosphorylation, in the replication stress checkpoint response has been well established. However, recent work has revealed an important role for transcription in the cellular response to DNA replication stress. In this review, we will provide an overview of current knowledge of the cellular response to DNA replication stress with a specific focus on the DNA replication stress checkpoint transcriptional response and its role in the prevention of replication stress-induced DNA damage.

  16. The Role of the Transcriptional Response to DNA Replication Stress

    Science.gov (United States)

    Herlihy, Anna E.; de Bruin, Robertus A.M.

    2017-01-01

    During DNA replication many factors can result in DNA replication stress. The DNA replication stress checkpoint prevents the accumulation of replication stress-induced DNA damage and the potential ensuing genome instability. A critical role for post-translational modifications, such as phosphorylation, in the replication stress checkpoint response has been well established. However, recent work has revealed an important role for transcription in the cellular response to DNA replication stress. In this review, we will provide an overview of current knowledge of the cellular response to DNA replication stress with a specific focus on the DNA replication stress checkpoint transcriptional response and its role in the prevention of replication stress-induced DNA damage. PMID:28257104

  17. Termination of DNA replication forks: "Breaking up is hard to do".

    Science.gov (United States)

    Bailey, Rachael; Priego Moreno, Sara; Gambus, Agnieszka

    2015-01-01

    To ensure duplication of the entire genome, eukaryotic DNA replication initiates from thousands of replication origins. The replication forks move through the chromatin until they encounter forks from neighboring origins. During replication fork termination forks converge, the replisomes disassemble and topoisomerase II resolves the daughter DNA molecules. If not resolved efficiently, terminating forks result in genomic instability through the formation of pathogenic structures. Our recent findings shed light onto the mechanism of replisome disassembly upon replication fork termination. We have shown that termination-specific polyubiquitylation of the replicative helicase component - Mcm7, leads to dissolution of the active helicase in a process dependent on the p97/VCP/Cdc48 segregase. The inhibition of terminating helicase disassembly resulted in a replication termination defect. In this extended view we present hypothetical models of replication fork termination and discuss remaining and emerging questions in the DNA replication termination field.

  18. From structure to mechanism—understanding initiation of DNA replication

    Science.gov (United States)

    Riera, Alberto; Barbon, Marta; Noguchi, Yasunori; Reuter, L. Maximilian; Schneider, Sarah; Speck, Christian

    2017-01-01

    DNA replication results in the doubling of the genome prior to cell division. This process requires the assembly of 50 or more protein factors into a replication fork. Here, we review recent structural and biochemical insights that start to explain how specific proteins recognize DNA replication origins, load the replicative helicase on DNA, unwind DNA, synthesize new DNA strands, and reassemble chromatin. We focus on the minichromosome maintenance (MCM2–7) proteins, which form the core of the eukaryotic replication fork, as this complex undergoes major structural rearrangements in order to engage with DNA, regulate its DNA-unwinding activity, and maintain genome stability. PMID:28717046

  19. Organization of Replication of Ribosomal DNA in Saccharomyces cerevisiae

    NARCIS (Netherlands)

    Linskens, Maarten H.K.; Huberman, Joel A.

    1988-01-01

    Using recently developed replicon mapping techniques, we have analyzed the replication of the ribosomal DNA in Saccharomyces cerevisiae. The results show that (i) the functional origin of replication colocalizes with an autonomously replicating sequence element previously mapped to the

  20. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  1. Studies on the mechanism of replication of adenovirus DNA. III. Electron microscopy of replicating DNA

    NARCIS (Netherlands)

    Ellens, D.J.; Sussenbach, J.S.; Jansz, H.S.

    1974-01-01

    Replicating Ad5 DNA was isolated from nuclei of infected KB cells and studied by electron microscopy. Branched as well as unbranched linear intermediates were observed containing extended regions of single-stranded DNA. The relationship between the branched and unbranched structures was studied

  2. Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.

    Science.gov (United States)

    Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang

    2017-12-01

    Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.

  3. DNA replication and cancer: From dysfunctional replication origin activities to therapeutic opportunities.

    Science.gov (United States)

    Boyer, Anne-Sophie; Walter, David; Sørensen, Claus Storgaard

    2016-06-01

    A dividing cell has to duplicate its DNA precisely once during the cell cycle to preserve genome integrity avoiding the accumulation of genetic aberrations that promote diseases such as cancer. A large number of endogenous impacts can challenge DNA replication and cells harbor a battery of pathways to promote genome integrity during DNA replication. This includes suppressing new replication origin firing, stabilization of replicating forks, and the safe restart of forks to prevent any loss of genetic information. Here, we describe mechanisms by which oncogenes can interfere with DNA replication thereby causing DNA replication stress and genome instability. Further, we describe cellular and systemic responses to these insults with a focus on DNA replication restart pathways. Finally, we discuss the therapeutic potential of exploiting intrinsic replicative stress in cancer cells for targeted therapy. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Replicative DNA polymerase mutations in cancer☆

    Science.gov (United States)

    Heitzer, Ellen; Tomlinson, Ian

    2014-01-01

    Three DNA polymerases — Pol α, Pol δ and Pol ɛ — are essential for DNA replication. After initiation of DNA synthesis by Pol α, Pol δ or Pol ɛ take over on the lagging and leading strand respectively. Pol δ and Pol ɛ perform the bulk of replication with very high fidelity, which is ensured by Watson–Crick base pairing and 3′exonuclease (proofreading) activity. Yeast models have shown that mutations in the exonuclease domain of Pol δ and Pol ɛ homologues can cause a mutator phenotype. Recently, we identified germline exonuclease domain mutations (EDMs) in human POLD1 and POLE that predispose to ‘polymerase proofreading associated polyposis’ (PPAP), a disease characterised by multiple colorectal adenomas and carcinoma, with high penetrance and dominant inheritance. Moreover, somatic EDMs in POLE have also been found in sporadic colorectal and endometrial cancers. Tumors with EDMs are microsatellite stable and show an ‘ultramutator’ phenotype, with a dramatic increase in base substitutions. PMID:24583393

  5. Replicative DNA polymerase mutations in cancer.

    Science.gov (United States)

    Heitzer, Ellen; Tomlinson, Ian

    2014-02-01

    Three DNA polymerases - Pol α, Pol δ and Pol ɛ - are essential for DNA replication. After initiation of DNA synthesis by Pol α, Pol δ or Pol ɛ take over on the lagging and leading strand respectively. Pol δ and Pol ɛ perform the bulk of replication with very high fidelity, which is ensured by Watson-Crick base pairing and 3'exonuclease (proofreading) activity. Yeast models have shown that mutations in the exonuclease domain of Pol δ and Pol ɛ homologues can cause a mutator phenotype. Recently, we identified germline exonuclease domain mutations (EDMs) in human POLD1 and POLE that predispose to 'polymerase proofreading associated polyposis' (PPAP), a disease characterised by multiple colorectal adenomas and carcinoma, with high penetrance and dominant inheritance. Moreover, somatic EDMs in POLE have also been found in sporadic colorectal and endometrial cancers. Tumors with EDMs are microsatellite stable and show an 'ultramutator' phenotype, with a dramatic increase in base substitutions. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  6. Loss of maintenance DNA methylation results in abnormal DNA origin firing during DNA replication

    Energy Technology Data Exchange (ETDEWEB)

    Haruta, Mayumi [Department of Cell Biology, Graduate School of Medical Sciences, Nagoya City University, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan); Shimada, Midori, E-mail: midorism@med.nagoya-cu.ac.jp [Department of Cell Biology, Graduate School of Medical Sciences, Nagoya City University, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan); Nishiyama, Atsuya; Johmura, Yoshikazu [Department of Cell Biology, Graduate School of Medical Sciences, Nagoya City University, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan); Le Tallec, Benoît; Debatisse, Michelle [Institut Curie, Centre de Recherche, 26 rue d’Ulm, CNRS UMR 3244, 75248 ParisCedex 05 (France); Nakanishi, Makoto, E-mail: mkt-naka@med.nagoya-cu.ac.jp [Department of Cell Biology, Graduate School of Medical Sciences, Nagoya City University, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan)

    2016-01-22

    The mammalian maintenance methyltransferase DNMT1 [DNA (cytosine-5-)-methyltransferase 1] mediates the inheritance of the DNA methylation pattern during replication. Previous studies have shown that depletion of DNMT1 causes a severe growth defect and apoptosis in differentiated cells. However, the detailed mechanisms behind this phenomenon remain poorly understood. Here we show that conditional ablation of Dnmt1 in murine embryonic fibroblasts (MEFs) resulted in an aberrant DNA replication program showing an accumulation of late-S phase replication and causing severely defective growth. Furthermore, we found that the catalytic activity and replication focus targeting sequence of DNMT1 are required for a proper DNA replication program. Taken together, our findings suggest that the maintenance of DNA methylation by DNMT1 plays a critical role in proper regulation of DNA replication in mammalian cells. - Highlights: • DNMT1 depletion results in an abnormal DNA replication program. • Aberrant DNA replication is independent of the DNA damage checkpoint in DNMT1cKO. • DNMT1 catalytic activity and RFT domain are required for proper DNA replication. • DNMT1 catalytic activity and RFT domain are required for cell proliferation.

  7. Loss of maintenance DNA methylation results in abnormal DNA origin firing during DNA replication

    International Nuclear Information System (INIS)

    Haruta, Mayumi; Shimada, Midori; Nishiyama, Atsuya; Johmura, Yoshikazu; Le Tallec, Benoît; Debatisse, Michelle; Nakanishi, Makoto

    2016-01-01

    The mammalian maintenance methyltransferase DNMT1 [DNA (cytosine-5-)-methyltransferase 1] mediates the inheritance of the DNA methylation pattern during replication. Previous studies have shown that depletion of DNMT1 causes a severe growth defect and apoptosis in differentiated cells. However, the detailed mechanisms behind this phenomenon remain poorly understood. Here we show that conditional ablation of Dnmt1 in murine embryonic fibroblasts (MEFs) resulted in an aberrant DNA replication program showing an accumulation of late-S phase replication and causing severely defective growth. Furthermore, we found that the catalytic activity and replication focus targeting sequence of DNMT1 are required for a proper DNA replication program. Taken together, our findings suggest that the maintenance of DNA methylation by DNMT1 plays a critical role in proper regulation of DNA replication in mammalian cells. - Highlights: • DNMT1 depletion results in an abnormal DNA replication program. • Aberrant DNA replication is independent of the DNA damage checkpoint in DNMT1cKO. • DNMT1 catalytic activity and RFT domain are required for proper DNA replication. • DNMT1 catalytic activity and RFT domain are required for cell proliferation.

  8. Function of BRCA1 at a DNA Replication Origin

    National Research Council Canada - National Science Library

    Lieberman, Paul

    2004-01-01

    ... and allow efficient repair of damaged DNA. In this proposal, we present preliminary data that BRCA1 functions in a DNA checkpoint response for the origin of Epstein-Barr Virus DNA replication (Ori P...

  9. Loss of maintenance DNA methylation results in abnormal DNA origin firing during DNA replication.

    Science.gov (United States)

    Haruta, Mayumi; Shimada, Midori; Nishiyama, Atsuya; Johmura, Yoshikazu; Le Tallec, Benoît; Debatisse, Michelle; Nakanishi, Makoto

    2016-01-22

    The mammalian maintenance methyltransferase DNMT1 [DNA (cytosine-5-)-methyltransferase 1] mediates the inheritance of the DNA methylation pattern during replication. Previous studies have shown that depletion of DNMT1 causes a severe growth defect and apoptosis in differentiated cells. However, the detailed mechanisms behind this phenomenon remain poorly understood. Here we show that conditional ablation of Dnmt1 in murine embryonic fibroblasts (MEFs) resulted in an aberrant DNA replication program showing an accumulation of late-S phase replication and causing severely defective growth. Furthermore, we found that the catalytic activity and replication focus targeting sequence of DNMT1 are required for a proper DNA replication program. Taken together, our findings suggest that the maintenance of DNA methylation by DNMT1 plays a critical role in proper regulation of DNA replication in mammalian cells. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Structural aspects of DNA in its replication and repair

    International Nuclear Information System (INIS)

    Mitra, S.; Pal, B.C.; Foote, R.S.; Bates, R.C.; Bhattacharyya, A.; Snow, E.T.; Wobbe, C.R.; Morse, C.C.; Snyder, C.E.

    1984-01-01

    The research objective of this laboratory is to investigate the structure of DNA, the mechanism of DNA replication and its regulation, and the mechanism and role of repair of the altered DNA in the expression of heritable changes. This research has two broad aims, namely investigation of (a) the regulation of DNA replication in mammals, using parvovirus DNA as a model system and (b) the role of DNA repair in mutagenesis and carcinogenesis induced by simple alkylating mutagens

  11. Education: DNA replication using microscale natural convection.

    Science.gov (United States)

    Priye, Aashish; Hassan, Yassin A; Ugaz, Victor M

    2012-12-07

    There is a need for innovative educational experiences that unify and reinforce fundamental principles at the interface between the physical, chemical, and life sciences. These experiences empower and excite students by helping them recognize how interdisciplinary knowledge can be applied to develop new products and technologies that benefit society. Microfluidics offers an incredibly versatile tool to address this need. Here we describe our efforts to create innovative hands-on activities that introduce chemical engineering students to molecular biology by challenging them to harness microscale natural convection phenomena to perform DNA replication via the polymerase chain reaction (PCR). Experimentally, we have constructed convective PCR stations incorporating a simple design for loading and mounting cylindrical microfluidic reactors between independently controlled thermal plates. A portable motion analysis microscope enables flow patterns inside the convective reactors to be directly visualized using fluorescent bead tracers. We have also developed a hands-on computational fluid dynamics (CFD) exercise based on modeling microscale thermal convection to identify optimal geometries for DNA replication. A cognitive assessment reveals that these activities strongly impact student learning in a positive way.

  12. Geminin: a major DNA replication safeguard in higher eukaryotes

    DEFF Research Database (Denmark)

    Melixetian, Marina; Helin, Kristian

    2004-01-01

    Eukaryotes have evolved multiple mechanisms to restrict DNA replication to once per cell cycle. These mechanisms prevent relicensing of origins of replication after initiation of DNA replication in S phase until the end of mitosis. Most of our knowledge of mechanisms controlling prereplication...

  13. Uncoupling of Sister Replisomes during Eukaryotic DNA Replication

    NARCIS (Netherlands)

    Yardimci, Hasan; Loveland, Anna B.; Habuchi, Satoshi; van Oijen, Antoine M.; Walter, Johannes C.

    2010-01-01

    The duplication of eukaryotic genomes involves the replication of DNA from multiple origins of replication. In S phase, two sister replisomes assemble at each active origin, and they replicate DNA in opposite directions. Little is known about the functional relationship between sister replisomes.

  14. Enzymatic properties of the bacteriophage phi X174 A protein on superhelical phi X174 DNA: a model for the termination of the rolling circle DNA replication

    NARCIS (Netherlands)

    van der Ende, A.; Langeveld, S. A.; Teertstra, R.; van Arkel, G. A.; Weisbeek, P. J.

    1981-01-01

    Incubation of phi X174 replication form I DNA with the A* protein of phi X174 in the presence of MN2+ results in the formation of three different types of DNA molecules: open circular form DNA (RFII), linear form DNA (RFIII) and the relaxed covalently closed form DNA (RFIV). The RFII and RFIII DNAs

  15. Topology of a Membrane Associated Regulator of Prokaryotic DNA Replication

    National Research Council Canada - National Science Library

    Firshein, William

    1998-01-01

    This proposal has focused on a broad host range plasmid, RK2, as a model system to study how a pair of initiation proteins encoded by the plasmid for DNA replication function when replication occurs...

  16. Mitochondrial DNA replication: a PrimPol perspective

    Science.gov (United States)

    Bailey, Laura J.

    2017-01-01

    PrimPol, (primase–polymerase), the most recently identified eukaryotic polymerase, has roles in both nuclear and mitochondrial DNA maintenance. PrimPol is capable of acting as a DNA polymerase, with the ability to extend primers and also bypass a variety of oxidative and photolesions. In addition, PrimPol also functions as a primase, catalysing the preferential formation of DNA primers in a zinc finger-dependent manner. Although PrimPol's catalytic activities have been uncovered in vitro, we still know little about how and why it is targeted to the mitochondrion and what its key roles are in the maintenance of this multicopy DNA molecule. Unlike nuclear DNA, the mammalian mitochondrial genome is circular and the organelle has many unique proteins essential for its maintenance, presenting a differing environment within which PrimPol must function. Here, we discuss what is currently known about the mechanisms of DNA replication in the mitochondrion, the proteins that carry out these processes and how PrimPol is likely to be involved in assisting this vital cellular process. PMID:28408491

  17. From structure to mechanism-understanding initiation of DNA replication.

    Science.gov (United States)

    Riera, Alberto; Barbon, Marta; Noguchi, Yasunori; Reuter, L Maximilian; Schneider, Sarah; Speck, Christian

    2017-06-01

    DNA replication results in the doubling of the genome prior to cell division. This process requires the assembly of 50 or more protein factors into a replication fork. Here, we review recent structural and biochemical insights that start to explain how specific proteins recognize DNA replication origins, load the replicative helicase on DNA, unwind DNA, synthesize new DNA strands, and reassemble chromatin. We focus on the minichromosome maintenance (MCM2-7) proteins, which form the core of the eukaryotic replication fork, as this complex undergoes major structural rearrangements in order to engage with DNA, regulate its DNA-unwinding activity, and maintain genome stability. © 2017 Riera et al.; Published by Cold Spring Harbor Laboratory Press.

  18. Induction of UV-resistant DNA replication in Escherichia coli: Induced stable DNA replication as an SOS function

    International Nuclear Information System (INIS)

    Kogoma, T.; Torrey, T.A.; Connaughton, M.J.

    1979-01-01

    The striking similarity between the treatments that induce SOS functions and those that result in stable DNA replication (continuous DNA replication in the absence of protein synthesis) prompted us to examine the possibility of stable DNA replication being a recA + lexA + -dependent SOS function. In addition to the treatments previously reported, ultraviolet (UV) irradiation or treatment with mitomycin C was also found to induce stable DNA replication. The thermal treatment of tif-1 strains did not result in detectable levels of stable DNA replication, but nalidixic acid readily induced the activity in these strains. The induction of stable DNA replication with nalidixic acid was severely suppressed in tif-1 lex A mutant strains. The inhibitory activity of lexA3 was negated by the presence of the spr-5l mutation, an intragenic suppressor of lexA3. Induced stable DNA replication was found to be considerably more resistant to UV irradiation than normal replication both in a uvr A6 strain and a uvr + strain. The UV-resistant replication occurred mostly in the semiconservative manner. The possible roles of stable DNA replication in repair of damaged DNA are discussed. (orig.)

  19. X-irradiation affects all DNA replication intermediates when inhibiting replication initiation

    International Nuclear Information System (INIS)

    Loenn, U.; Karolinska Hospital, Stockholm

    1982-01-01

    When a human melanoma line was irradiated with 10 Gy, there was, after 30 to 60 min, a gradual reduction in the DNA replication rate. Ten to twelve hours after the irradiation, the DNA replication had returned to near normal rate. The results showed tht low dose-rate X-irradiation inhibits preferentially the formation of small DNA replication intermediates. There is no difference between the inhibition of these replication intermediates formed only in the irradiated cells and those formed also in untreated cells. (U.K.)

  20. An isolated Hda-clamp complex is functional in the regulatory inactivation of DnaA and DNA replication.

    Science.gov (United States)

    Kawakami, Hironori; Su'etsugu, Masayuki; Katayama, Tsutomu

    2006-10-01

    In Escherichia coli, a complex consisting of Hda and the DNA-loaded clamp-subunit of the DNA polymerase III holoenzyme promotes hydrolysis of DnaA-ATP. The resultant ADP-DnaA is inactive for initiation of chromosomal DNA replication, thereby repressing excessive initiations. As the cellular content of the clamp is 10-100 times higher than that of Hda, most Hda molecules might be complexed with the clamp in vivo. Although Hda predominantly forms irregular aggregates when overexpressed, in the present study we found that co-overexpression of the clamp with Hda enhances Hda solubility dramatically and we efficiently isolated the Hda-clamp complex. A single molecule of the complex appears to consist of two Hda molecules and a single clamp. The complex is competent in DnaA-ATP hydrolysis and DNA replication in the presence of DNA and the clamp deficient subassembly of the DNA polymerase III holoenzyme (pol III*). These findings indicate that the clamp contained in the complex is loaded onto DNA through an interaction with the pol III* and that the Hda activity is preserved in these processes. The complex consisting of Hda and the DNA-unloaded clamp may play a specific role in a process proceeding to the DnaA-ATP hydrolysis in vivo.

  1. Anaphase onset before complete DNA replication with intact checkpoint responses

    DEFF Research Database (Denmark)

    Torres-Rosell, Jordi; De Piccoli, Giacomo; Cordon-Preciado, Violeta

    2007-01-01

    Cellular checkpoints prevent mitosis in the presence of stalled replication forks. Whether checkpoints also ensure the completion of DNA replication before mitosis is unknown. Here, we show that in yeast smc5-smc6 mutants, which are related to cohesin and condensin, replication is delayed, most...

  2. Difference Raman spectroscopy of DNA molecules

    International Nuclear Information System (INIS)

    Anokhin, Andrey S; Yuzyuk, Yury I; Gorelik, Vladimir S; Dovbeshko, Galina I; Pyatyshev, Alexander Yu

    2015-01-01

    In this paper the micro-Raman spectra of calf DNA for different points of DNA sample have been recorded. The Raman spectra were made with help of difference Raman spectroscopy technique. Raman spectra were recorded with high spatial resolution from different points of the wet and dry samples in different spectral range (100÷4000cm −1 ) using two lasers: argon (514.5 nm) and helium -neon (632.8 nm). The significant differences in the Raman spectra for dry and wet DNA and for different points of DNA molecules were observed. The obtained data on difference Raman scattering spectra of DNA molecules may be used for identification of DNA types and for analysis of genetic information associated with the molecular structure of this molecule

  3. DNA replication after mutagenic treatment in Hordeum vulgare.

    Science.gov (United States)

    Kwasniewska, Jolanta; Kus, Arita; Swoboda, Monika; Braszewska-Zalewska, Agnieszka

    2016-12-01

    The temporal and spatial properties of DNA replication in plants related to DNA damage and mutagenesis is poorly understood. Experiments were carried out to explore the relationships between DNA replication, chromatin structure and DNA damage in nuclei from barley root tips. We quantitavely analysed the topological organisation of replication foci using pulse EdU labelling during the S phase and its relationship with the DNA damage induced by mutagenic treatment with maleic hydrazide (MH), nitroso-N-methyl-urea (MNU) and gamma ray. Treatment with mutagens did not change the characteristic S-phase patterns in the nuclei; however, the frequencies of the S-phase-labelled cells after treatment differed from those observed in the control cells. The analyses of DNA replication in barley nuclei were extended to the micronuclei induced by mutagens. Replication in the chromatin of the micronuclei was rare. The results of simultanous TUNEL reaction to identify cells with DNA strand breaks and the labelling of the S-phase cells with EdU revealed the possibility of DNA replication occurring in damaged nuclei. For the first time, the intensity of EdU fluorescence to study the rate of DNA replication was analysed. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. A rolling circle replication mechanism produces multimeric lariats of mitochondrial DNA in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Samantha C Lewis

    2015-02-01

    Full Text Available Mitochondrial DNA (mtDNA encodes respiratory complex subunits essential to almost all eukaryotes; hence respiratory competence requires faithful duplication of this molecule. However, the mechanism(s of its synthesis remain hotly debated. Here we have developed Caenorhabditis elegans as a convenient animal model for the study of metazoan mtDNA synthesis. We demonstrate that C. elegans mtDNA replicates exclusively by a phage-like mechanism, in which multimeric molecules are synthesized from a circular template. In contrast to previous mammalian studies, we found that mtDNA synthesis in the C. elegans gonad produces branched-circular lariat structures with multimeric DNA tails; we were able to detect multimers up to four mtDNA genome unit lengths. Further, we did not detect elongation from a displacement-loop or analogue of 7S DNA, suggesting a clear difference from human mtDNA in regard to the site(s of replication initiation. We also identified cruciform mtDNA species that are sensitive to cleavage by the resolvase RusA; we suggest these four-way junctions may have a role in concatemer-to-monomer resolution. Overall these results indicate that mtDNA synthesis in C. elegans does not conform to any previously documented metazoan mtDNA replication mechanism, but instead are strongly suggestive of rolling circle replication, as employed by bacteriophages. As several components of the metazoan mitochondrial DNA replisome are likely phage-derived, these findings raise the possibility that the rolling circle mtDNA replication mechanism may be ancestral among metazoans.

  5. Enzymes involved in organellar DNA replication in photosynthetic eukaryotes.

    Science.gov (United States)

    Moriyama, Takashi; Sato, Naoki

    2014-01-01

    Plastids and mitochondria possess their own genomes. Although the replication mechanisms of these organellar genomes remain unclear in photosynthetic eukaryotes, several organelle-localized enzymes related to genome replication, including DNA polymerase, DNA primase, DNA helicase, DNA topoisomerase, single-stranded DNA maintenance protein, DNA ligase, primer removal enzyme, and several DNA recombination-related enzymes, have been identified. In the reference Eudicot plant Arabidopsis thaliana, the replication-related enzymes of plastids and mitochondria are similar because many of them are dual targeted to both organelles, whereas in the red alga Cyanidioschyzon merolae, plastids and mitochondria contain different replication machinery components. The enzymes involved in organellar genome replication in green plants and red algae were derived from different origins, including proteobacterial, cyanobacterial, and eukaryotic lineages. In the present review, we summarize the available data for enzymes related to organellar genome replication in green plants and red algae. In addition, based on the type and distribution of replication enzymes in photosynthetic eukaryotes, we discuss the transitional history of replication enzymes in the organelles of plants.

  6. The hunt for origins of DNA replication in multicellular eukaryotes

    DEFF Research Database (Denmark)

    Urban, J. M.; Foulk, M. S.; Casella, Cinzia

    2015-01-01

    Origins of DNA replication (ORIs) occur at defined regions in the genome. Although DNA sequence defines the position of ORIs in budding yeast, the factors for ORI specification remain elusive in metazoa. Several methods have been used recently to map ORIs in metazoan genomes with the hope...... that features for ORI specification might emerge. These methods are reviewed here with analysis of their advantages and shortcomings. The various factors that may influence ORI selection for initiation of DNA replication are discussed....

  7. Regulated eukaryotic DNA replication origin firing with purified proteins.

    Science.gov (United States)

    Yeeles, Joseph T P; Deegan, Tom D; Janska, Agnieszka; Early, Anne; Diffley, John F X

    2015-03-26

    Eukaryotic cells initiate DNA replication from multiple origins, which must be tightly regulated to promote precise genome duplication in every cell cycle. To accomplish this, initiation is partitioned into two temporally discrete steps: a double hexameric minichromosome maintenance (MCM) complex is first loaded at replication origins during G1 phase, and then converted to the active CMG (Cdc45-MCM-GINS) helicase during S phase. Here we describe the reconstitution of budding yeast DNA replication initiation with 16 purified replication factors, made from 42 polypeptides. Origin-dependent initiation recapitulates regulation seen in vivo. Cyclin-dependent kinase (CDK) inhibits MCM loading by phosphorylating the origin recognition complex (ORC) and promotes CMG formation by phosphorylating Sld2 and Sld3. Dbf4-dependent kinase (DDK) promotes replication by phosphorylating MCM, and can act either before or after CDK. These experiments define the minimum complement of proteins, protein kinase substrates and co-factors required for regulated eukaryotic DNA replication.

  8. Assembly of Slx4 signaling complexes behind DNA replication forks.

    Science.gov (United States)

    Balint, Attila; Kim, TaeHyung; Gallo, David; Cussiol, Jose Renato; Bastos de Oliveira, Francisco M; Yimit, Askar; Ou, Jiongwen; Nakato, Ryuichiro; Gurevich, Alexey; Shirahige, Katsuhiko; Smolka, Marcus B; Zhang, Zhaolei; Brown, Grant W

    2015-08-13

    Obstructions to replication fork progression, referred to collectively as DNA replication stress, challenge genome stability. In Saccharomyces cerevisiae, cells lacking RTT107 or SLX4 show genome instability and sensitivity to DNA replication stress and are defective in the completion of DNA replication during recovery from replication stress. We demonstrate that Slx4 is recruited to chromatin behind stressed replication forks, in a region that is spatially distinct from that occupied by the replication machinery. Slx4 complex formation is nucleated by Mec1 phosphorylation of histone H2A, which is recognized by the constitutive Slx4 binding partner Rtt107. Slx4 is essential for recruiting the Mec1 activator Dpb11 behind stressed replication forks, and Slx4 complexes are important for full activity of Mec1. We propose that Slx4 complexes promote robust checkpoint signaling by Mec1 by stably recruiting Dpb11 within a discrete domain behind the replication fork, during DNA replication stress. © 2015 The Authors.

  9. Initiation of DNA replication requires actin dynamics and formin activity.

    Science.gov (United States)

    Parisis, Nikolaos; Krasinska, Liliana; Harker, Bethany; Urbach, Serge; Rossignol, Michel; Camasses, Alain; Dewar, James; Morin, Nathalie; Fisher, Daniel

    2017-11-02

    Nuclear actin regulates transcriptional programmes in a manner dependent on its levels and polymerisation state. This dynamics is determined by the balance of nucleocytoplasmic shuttling, formin- and redox-dependent filament polymerisation. Here, using Xenopus egg extracts and human somatic cells, we show that actin dynamics and formins are essential for DNA replication. In proliferating cells, formin inhibition abolishes nuclear transport and initiation of DNA replication, as well as general transcription. In replicating nuclei from transcriptionally silent Xenopus egg extracts, we identified numerous actin regulators, and disruption of actin dynamics abrogates nuclear transport, preventing NLS (nuclear localisation signal)-cargo release from RanGTP-importin complexes. Nuclear formin activity is further required to promote loading of cyclin-dependent kinase (CDK) and proliferating cell nuclear antigen (PCNA) onto chromatin, as well as initiation and elongation of DNA replication. Therefore, actin dynamics and formins control DNA replication by multiple direct and indirect mechanisms. © 2017 The Authors.

  10. USP7 is a SUMO deubiquitinase essential for DNA replication

    DEFF Research Database (Denmark)

    Lecona, Emilio; Rodriguez-Acebes, Sara; Specks, Julia

    2016-01-01

    Post-translational modification of proteins by ubiquitin (Ub) and Ub-like modifiers regulates DNA replication. We have previously shown that chromatin around replisomes is rich in SUMO and poor in Ub, whereas mature chromatin exhibits an opposite pattern. How this SUMO-rich, Ub-poor environment...... is maintained at sites of DNA replication in mammalian cells remains unexplored. Here we identify USP7 as a replisome-enriched SUMO deubiquitinase that is essential for DNA replication. By acting on SUMO and SUMOylated proteins, USP7 counteracts their ubiquitination. Inhibition or genetic deletion of USP7 leads...... to the accumulation of Ub on SUMOylated proteins, which are displaced away from replisomes. Our findings provide a model explaining the differential accumulation of SUMO and Ub at replication forks and identify an essential role of USP7 in DNA replication that should be considered in the development of USP7...

  11. Chromatin Constrains the Initiation and Elongation of DNA Replication.

    Science.gov (United States)

    Devbhandari, Sujan; Jiang, Jieqing; Kumar, Charanya; Whitehouse, Iestyn; Remus, Dirk

    2017-01-05

    Eukaryotic chromosomal DNA is faithfully replicated in a complex series of cell-cycle-regulated events that are incompletely understood. Here we report the reconstitution of DNA replication free in solution with purified proteins from the budding yeast Saccharomyces cerevisiae. The system recapitulates regulated bidirectional origin activation; synthesis of leading and lagging strands by the three replicative DNA polymerases Pol α, Pol δ, and Pol ε; and canonical maturation of Okazaki fragments into continuous daughter strands. We uncover a dual regulatory role for chromatin during DNA replication: promoting origin dependence and determining Okazaki fragment length by restricting Pol δ progression. This system thus provides a functional platform for the detailed mechanistic analysis of eukaryotic chromosome replication. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Targeting the OB-Folds of Replication Protein A with Small Molecules

    Directory of Open Access Journals (Sweden)

    Victor J. Anciano Granadillo

    2010-01-01

    Full Text Available Replication protein A (RPA is the main eukaryotic single-strand (ss DNA-binding protein involved in DNA replication and repair. We have identified and developed two classes of small molecule inhibitors (SMIs that show in vitro inhibition of the RPA-DNA interaction. We present further characterization of these SMIs with respect to their target binding, mechanism of action, and specificity. Both reversible and irreversible modes of inhibition are observed for the different classes of SMIs with one class found to specifically interact with DNA-binding domains A and B (DBD-A/B of RPA. In comparison with other oligonucleotide/oligosaccharide binding-fold (OB-fold containing ssDNA-binding proteins, one class of SMIs displayed specificity for the RPA protein. Together these data demonstrate that the specific targeting of a protein-DNA interaction can be exploited towards interrogating the cellular activity of RPA as well as increasing the efficacy of DNA-damaging chemotherapeutics used in cancer treatment.

  13. Adenoviral DNA replication: DNA sequences and enzymes required for initiation in vitro

    International Nuclear Information System (INIS)

    Stillman, B.W.; Tamanoi, F.

    1983-01-01

    In this paper evidence is provided that the 140,000-dalton DNA polymerase is encoded by the adenoviral genome and is required for the initiation of DNA replication in vitro. The DNA sequences in the template DNA that are required for the initiation of replication have also been identified, using both plasmid DNAs and synthetic oligodeoxyribonucleotides. 48 references, 7 figures, 1 table

  14. Cell lethality after selective irradiation of the DNA replication fork

    International Nuclear Information System (INIS)

    Hofer, K.G.; Warters, R.L.

    1985-01-01

    It has been suggested that nascent DNA located at the DNA replication fork may exhibit enhanced sensitivity to radiation damage. To evaluate this hypothesis, Chinese hamster ovary cells (CHO) were labeled with 125 I-iododeoxyuridine ( 125 IUdR) either in the presence or absence of aphidicolin. Aphidicolin (5 μg/ml) reduced cellular 125 IUdR incorporation to 3-5% of the control value. The residual 125 I incorporation appeared to be restricted to low molecular weight (sub-replicon sized) fragments of DNA which were more sensitive to micrococcal nuclease attack and less sensitive to high salt DNase I digestion than randomly labeled DNA. These findings suggest that DNA replicated in the presence of aphidicolin remains localized at the replication fork adjacent to the nuclear matrix. Based on these observations an attempt was made to compare the lethal consequences of 125 I decays at the replication fork to that of 125 I decays randomly distributed over the entire genome. Regardless of the distribution of decay events, all treatment groups exhibited identical dose-response curves (D 0 : 101 125 I decays/cell). Since differential irradiation of the replication complex did not result in enhanced cell lethality, it can be concluded that neither the nascent DNA nor the protein components (replicative enzymes, nuclear protein matrix) associated with the DNA replication site constitute key radiosensitive targets within the cellular genome. (orig.)

  15. Specificity and function of Archaeal DNA replication initiator proteins

    DEFF Research Database (Denmark)

    Samson, Rachel Y.; Xu, Yanqun; Gadelha, Catarina

    2013-01-01

    Chromosomes with multiple DNA replication origins are a hallmark of Eukaryotes and some Archaea. All eukaryal nuclear replication origins are defined by the origin recognition complex (ORC) that recruits the replicative helicase MCM(2-7) via Cdc6 and Cdt1. We find that the three origins...... to investigate the role of ATP binding and hydrolysis in initiator function in vivo and in vitro. We find that the ATP-bound form of Orc1-1 is proficient for replication and implicates hydrolysis of ATP in downregulation of origin activity. Finally, we reveal that ATP and DNA binding by Orc1-1 remodels...

  16. RAD52 Facilitates Mitotic DNA Synthesis Following Replication Stress

    DEFF Research Database (Denmark)

    Bhowmick, Rahul; Minocherhomji, Sheroy; Hickson, Ian D

    2016-01-01

    Homologous recombination (HR) is necessary to counteract DNA replication stress. Common fragile site (CFS) loci are particularly sensitive to replication stress and undergo pathological rearrangements in tumors. At these loci, replication stress frequently activates DNA repair synthesis in mitosis...... replication stress at CFS loci during S-phase. In contrast, MiDAS is RAD52 dependent, and RAD52 is required for the timely recruitment of MUS81 and POLD3 to CFSs in early mitosis. Our results provide further mechanistic insight into MiDAS and define a specific function for human RAD52. Furthermore, selective...

  17. Nano-manipulation of single DNA molecules

    International Nuclear Information System (INIS)

    Hu Jun; Shanghai Jiaotong Univ., Shanghai; Lv Junhong; Wang Guohua; Wang Ying; Li Minqian; Zhang Yi; Li Bin; Li Haikuo; An Hongjie

    2004-01-01

    Nano-manipulation of single atoms and molecules is a critical technique in nanoscience and nanotechnology. This review paper will focus on the recent development of the manipulation of single DNA molecules based on atomic force microscopy (AFM). Precise manipulation has been realized including varied manipulating modes such as 'cutting', 'pushing', 'folding', 'kneading', 'picking up', 'dipping', etc. The cutting accuracy is dominated by the size of the AFM tip, which is usually 10 nm or less. Single DNA fragments can be cut and picked up and then amplified by single molecule PCR. Thus positioning isolation and sequencing can be performed. (authors)

  18. Timing, Coordination, and Rhythm : Acrobatics at the DNA Replication Fork

    NARCIS (Netherlands)

    Hamdan, Samir M.; Oijen, Antoine M. van

    2010-01-01

    In DNA replication, the antiparallel nature of the parental duplex imposes certain constraints on the activity of the DNA polymerases that synthesize new DNA. The leading-strand polymerase advances in a continuous fashion, but the lagging-strand polymerase is forced to restart at short intervals. In

  19. Test of models for replication of SV40 DNA following UV irradiation

    International Nuclear Information System (INIS)

    Barnett, S.W.

    1983-01-01

    The replication of SV40 DNA immediately after irradiation of infected monkey cells has been examined. SV40 DNA synthesis is inhibited in a UV fluence-dependent fashion, and the synthesis of completely replicated (Form I) SV40 molecules is more severely inhibited than is total SV40 DNA synthesis. Two models for DNA replication-inhibition have been tested. Experimental results have been compared to those predicted by mathematical models derived to describe two possible molecular mechanisms of replication inhibition. No effect of UV irradiation on the uptake and phosphorylation of 3 H-thymidine nor on the size of the intracellular deoxythymidine triphosphate pool of SV40-infected cells have been observed, validating the use of 3 H-thymidine incorporation as a measure of DNA synthesis in this system. In vitro studies have been performed to further investigate the mechanism of dimer-specific inhibition of completion of SV40 DNA synthesis observed in in vivo. The results of these studies are consistent with a mechanism of discontinuous synthesis past dimer sites, but it is equally possible that the mechanism of DNA replication of UV-damaged DNA in the in vitro system is different from that which occurs in vivo

  20. DNA replication restart and cellular dynamics of Hef helicase/nuclease protein in Haloferax volcanii.

    Science.gov (United States)

    Lestini, Roxane; Delpech, Floriane; Myllykallio, Hannu

    2015-11-01

    Understanding how frequently spontaneous replication arrests occur and how archaea deal with these arrests are very interesting and challenging research topics. Here we will described how genetic and imaging studies have revealed the central role of the archaeal helicase/nuclease Hef belonging to the XPF/MUS81/FANCM family of endonucleases in repair of arrested replication forks. Special focus will be on description of a recently developed combination of genetic and imaging tools to study the dynamic localization of a functional Hef::GFP (Green Fluorescent Protein) fusion protein in the living cells of halophilic archaea Haloferax volcanii. As Archaea provide an excellent and unique model for understanding how DNA replication is regulated to allow replication of a circular DNA molecule either from single or multiple replication origins, we will also summarize recent studies that have revealed peculiar features regarding DNA replication, particularly in halophilic archaea. We strongly believe that fundamental knowledge of our on-going studies will shed light on the evolutionary history of the DNA replication machinery and will help to establish general rules concerning replication restart and the key role of recombination proteins not only in bacteria, yeast and higher eukaryotes but also in archaea. Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  1. Sequential steps in DNA replication are inhibited to ensure reduction of ploidy in meiosis

    Science.gov (United States)

    Hua, Hui; Namdar, Mandana; Ganier, Olivier; Gregan, Juraj; Méchali, Marcel; Kearsey, Stephen E.

    2013-01-01

    Meiosis involves two successive rounds of chromosome segregation without an intervening S phase. Exit from meiosis I is distinct from mitotic exit, in that replication origins are not licensed by Mcm2-7 chromatin binding, but spindle disassembly occurs during a transient interphase-like state before meiosis II. The absence of licensing is assumed to explain the block to DNA replication, but this has not been formally tested. Here we attempt to subvert this block by expressing the licensing control factors Cdc18 and Cdt1 during the interval between meiotic nuclear divisions. Surprisingly, this leads only to a partial round of DNA replication, even when these factors are overexpressed and effect clear Mcm2-7 chromatin binding. Combining Cdc18 and Cdt1 expression with modulation of cyclin-dependent kinase activity, activation of Dbf4-dependent kinase, or deletion of the Spd1 inhibitor of ribonucleotide reductase has little additional effect on the extent of DNA replication. Single-molecule analysis indicates this partial round of replication results from inefficient progression of replication forks, and thus both initiation and elongation replication steps may be inhibited in late meiosis. In addition, DNA replication or damage during the meiosis I–II interval fails to arrest meiotic progress, suggesting absence of checkpoint regulation of meiosis II entry. PMID:23303250

  2. Mcm10 regulates DNA replication elongation by stimulating the CMG replicative helicase.

    Science.gov (United States)

    Lõoke, Marko; Maloney, Michael F; Bell, Stephen P

    2017-02-01

    Activation of the Mcm2-7 replicative DNA helicase is the committed step in eukaryotic DNA replication initiation. Although Mcm2-7 activation requires binding of the helicase-activating proteins Cdc45 and GINS (forming the CMG complex), an additional protein, Mcm10, drives initial origin DNA unwinding by an unknown mechanism. We show that Mcm10 binds a conserved motif located between the oligonucleotide/oligosaccharide fold (OB-fold) and A subdomain of Mcm2. Although buried in the interface between these domains in Mcm2-7 structures, mutations predicted to separate the domains and expose this motif restore growth to conditional-lethal MCM10 mutant cells. We found that, in addition to stimulating initial DNA unwinding, Mcm10 stabilizes Cdc45 and GINS association with Mcm2-7 and stimulates replication elongation in vivo and in vitro. Furthermore, we identified a lethal allele of MCM10 that stimulates initial DNA unwinding but is defective in replication elongation and CMG binding. Our findings expand the roles of Mcm10 during DNA replication and suggest a new model for Mcm10 function as an activator of the CMG complex throughout DNA replication. © 2017 Lõoke et al.; Published by Cold Spring Harbor Laboratory Press.

  3. Mechanisms and regulation of DNA replication initiation in eukaryotes.

    Science.gov (United States)

    Parker, Matthew W; Botchan, Michael R; Berger, James M

    2017-04-01

    Cellular DNA replication is initiated through the action of multiprotein complexes that recognize replication start sites in the chromosome (termed origins) and facilitate duplex DNA melting within these regions. In a typical cell cycle, initiation occurs only once per origin and each round of replication is tightly coupled to cell division. To avoid aberrant origin firing and re-replication, eukaryotes tightly regulate two events in the initiation process: loading of the replicative helicase, MCM2-7, onto chromatin by the origin recognition complex (ORC), and subsequent activation of the helicase by its incorporation into a complex known as the CMG. Recent work has begun to reveal the details of an orchestrated and sequential exchange of initiation factors on DNA that give rise to a replication-competent complex, the replisome. Here, we review the molecular mechanisms that underpin eukaryotic DNA replication initiation - from selecting replication start sites to replicative helicase loading and activation - and describe how these events are often distinctly regulated across different eukaryotic model organisms.

  4. Diversity of the DNA Replication System in the Archaea Domain

    Directory of Open Access Journals (Sweden)

    Felipe Sarmiento

    2014-01-01

    Full Text Available The precise and timely duplication of the genome is essential for cellular life. It is achieved by DNA replication, a complex process that is conserved among the three domains of life. Even though the cellular structure of archaea closely resembles that of bacteria, the information processing machinery of archaea is evolutionarily more closely related to the eukaryotic system, especially for the proteins involved in the DNA replication process. While the general DNA replication mechanism is conserved among the different domains of life, modifications in functionality and in some of the specialized replication proteins are observed. Indeed, Archaea possess specific features unique to this domain. Moreover, even though the general pattern of the replicative system is the same in all archaea, a great deal of variation exists between specific groups.

  5. Functions of Ubiquitin and SUMO in DNA Replication and Replication Stress

    Science.gov (United States)

    García-Rodríguez, Néstor; Wong, Ronald P.; Ulrich, Helle D.

    2016-01-01

    Complete and faithful duplication of its entire genetic material is one of the essential prerequisites for a proliferating cell to maintain genome stability. Yet, during replication DNA is particularly vulnerable to insults. On the one hand, lesions in replicating DNA frequently cause a stalling of the replication machinery, as most DNA polymerases cannot cope with defective templates. This situation is aggravated by the fact that strand separation in preparation for DNA synthesis prevents common repair mechanisms relying on strand complementarity, such as base and nucleotide excision repair, from working properly. On the other hand, the replication process itself subjects the DNA to a series of hazardous transformations, ranging from the exposure of single-stranded DNA to topological contortions and the generation of nicks and fragments, which all bear the risk of inducing genomic instability. Dealing with these problems requires rapid and flexible responses, for which posttranslational protein modifications that act independently of protein synthesis are particularly well suited. Hence, it is not surprising that members of the ubiquitin family, particularly ubiquitin itself and SUMO, feature prominently in controlling many of the defensive and restorative measures involved in the protection of DNA during replication. In this review we will discuss the contributions of ubiquitin and SUMO to genome maintenance specifically as they relate to DNA replication. We will consider cases where the modifiers act during regular, i.e., unperturbed stages of replication, such as initiation, fork progression, and termination, but also give an account of their functions in dealing with lesions, replication stalling and fork collapse. PMID:27242895

  6. Chromatin Controls DNA Replication Origin Selection, Lagging-Strand Synthesis, and Replication Fork Rates.

    Science.gov (United States)

    Kurat, Christoph F; Yeeles, Joseph T P; Patel, Harshil; Early, Anne; Diffley, John F X

    2017-01-05

    The integrity of eukaryotic genomes requires rapid and regulated chromatin replication. How this is accomplished is still poorly understood. Using purified yeast replication proteins and fully chromatinized templates, we have reconstituted this process in vitro. We show that chromatin enforces DNA replication origin specificity by preventing non-specific MCM helicase loading. Helicase activation occurs efficiently in the context of chromatin, but subsequent replisome progression requires the histone chaperone FACT (facilitates chromatin transcription). The FACT-associated Nhp6 protein, the nucleosome remodelers INO80 or ISW1A, and the lysine acetyltransferases Gcn5 and Esa1 each contribute separately to maximum DNA synthesis rates. Chromatin promotes the regular priming of lagging-strand DNA synthesis by facilitating DNA polymerase α function at replication forks. Finally, nucleosomes disrupted during replication are efficiently re-assembled into regular arrays on nascent DNA. Our work defines the minimum requirements for chromatin replication in vitro and shows how multiple chromatin factors might modulate replication fork rates in vivo. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Replication stress activates DNA repair synthesis in mitosis

    DEFF Research Database (Denmark)

    Minocherhomji, Sheroy; Ying, Songmin; Bjerregaard, Victoria A

    2015-01-01

    Oncogene-induced DNA replication stress has been implicated as a driver of tumorigenesis. Many chromosomal rearrangements characteristic of human cancers originate from specific regions of the genome called common fragile sites (CFSs). CFSs are difficult-to-replicate loci that manifest as gaps...... into mitotic prophase triggers the recruitment of MUS81 to CFSs. The nuclease activity of MUS81 then promotes POLD3-dependent DNA synthesis at CFSs, which serves to minimize chromosome mis-segregation and non-disjunction. We propose that the attempted condensation of incompletely duplicated loci in early...... mitosis serves as the trigger for completion of DNA replication at CFS loci in human cells. Given that this POLD3-dependent mitotic DNA synthesis is enhanced in aneuploid cancer cells that exhibit intrinsically high levels of chromosomal instability (CIN(+)) and replicative stress, we suggest...

  8. Diversification of DnaA dependency for DNA replication in cyanobacterial evolution.

    Science.gov (United States)

    Ohbayashi, Ryudo; Watanabe, Satoru; Ehira, Shigeki; Kanesaki, Yu; Chibazakura, Taku; Yoshikawa, Hirofumi

    2016-05-01

    Regulating DNA replication is essential for all living cells. The DNA replication initiation factor DnaA is highly conserved in prokaryotes and is required for accurate initiation of chromosomal replication at oriC. DnaA-independent free-living bacteria have not been identified. The dnaA gene is absent in plastids and some symbiotic bacteria, although it is not known when or how DnaA-independent mechanisms were acquired. Here, we show that the degree of dependency of DNA replication on DnaA varies among cyanobacterial species. Deletion of the dnaA gene in Synechococcus elongatus PCC 7942 shifted DNA replication from oriC to a different site as a result of the integration of an episomal plasmid. Moreover, viability during the stationary phase was higher in dnaA disruptants than in wild-type cells. Deletion of dnaA did not affect DNA replication or cell growth in Synechocystis sp. PCC 6803 or Anabaena sp. PCC 7120, indicating that functional dependency on DnaA was already lost in some nonsymbiotic cyanobacterial lineages during diversification. Therefore, we proposed that cyanobacteria acquired DnaA-independent replication mechanisms before symbiosis and such an ancestral cyanobacterium was the sole primary endosymbiont to form a plastid precursor.

  9. Chromatin maturation depends on continued DNA-replication

    International Nuclear Information System (INIS)

    Schlaeger, E.J.; Puelm, W.; Knippers, R.

    1983-01-01

    The structure of [ 3 H]thymidine pulse-labeled chromatin in lymphocytes differs from that of non-replicating chromatin by several operational criteria which are related to the higher nuclease sensitivity of replicating chromatin. These structural features of replicating chromatin rapidly disappear when the [ 3 H]thymidine pulse is followed by a chase in the presence of an excess of non-radioactive thymidine. However, when the rate of DNA replication is reduced, as in cycloheximide-treated lymphocytes, chromatin maturation is retarded. No chromatin maturation is observed when nuclei from pulse-labeled lymphocytes are incubated in vitro in the absence of DNA precursors. In contrast, when these nuclei are incubated under conditions known to be optimal for DNA replication, the structure of replicating chromatin is efficiently converted to that of 'mature', non-replicating chromatin. The authors conclude that the properties of nascent DNA and/or the distance from the replication fork are important factors in chromatin maturation. (Auth.)

  10. Preirradiation of host (monkey) cells mitigates the effects of UV upon simian virus 40 DNA replication

    International Nuclear Information System (INIS)

    Scaria, A.; Edenberg, H.J.

    1987-01-01

    The authors examined the effects of preirradiation of host (monkey) cells upon the replication of UV-damaged SV40. Control cells and cells preirradiated with low fluences of UV were infected with undamaged SV40, and the immediate effects of a subsequent irradiation were determined. UV inhibited total SV40 DNA synthesis in both preirradiated and control cells, but the extent of inhibition was less in the preirradiated cells. A test fluence of 60 J/m 2 to SV40 replicating in preirradiated cells reduced synthesis only as much as a test fluence of 25 J/m 2 in control cells. The fraction of recently replicated SV40 molecules that re-entered the replication pool and subsequently completed one round of replication in the first 2 h after UV was also decreased less in the preirradiated cells. Thus preirradiation of the host cell mitigates the immediate inhibitory effects of a subsequent UV exposure upon SV40 replication. (Auth.)

  11. Structural properties of replication origins in yeast DNA sequences

    International Nuclear Information System (INIS)

    Cao Xiaoqin; Zeng Jia; Yan Hong

    2008-01-01

    Sequence-dependent DNA flexibility is an important structural property originating from the DNA 3D structure. In this paper, we investigate the DNA flexibility of the budding yeast (S. Cerevisiae) replication origins on a genome-wide scale using flexibility parameters from two different models, the trinucleotide and the tetranucleotide models. Based on analyzing average flexibility profiles of 270 replication origins, we find that yeast replication origins are significantly rigid compared with their surrounding genomic regions. To further understand the highly distinctive property of replication origins, we compare the flexibility patterns between yeast replication origins and promoters, and find that they both contain significantly rigid DNAs. Our results suggest that DNA flexibility is an important factor that helps proteins recognize and bind the target sites in order to initiate DNA replication. Inspired by the role of the rigid region in promoters, we speculate that the rigid replication origins may facilitate binding of proteins, including the origin recognition complex (ORC), Cdc6, Cdt1 and the MCM2-7 complex

  12. Mechanisms of mutagenesis: DNA replication in the presence of DNA damage.

    Science.gov (United States)

    Liu, Binyan; Xue, Qizhen; Tang, Yong; Cao, Jia; Guengerich, F Peter; Zhang, Huidong

    2016-01-01

    Environmental mutagens cause DNA damage that disturbs replication and produces mutations, leading to cancer and other diseases. We discuss mechanisms of mutagenesis resulting from DNA damage, from the level of DNA replication by a single polymerase to the complex DNA replisome of some typical model organisms (including bacteriophage T7, T4, Sulfolobus solfataricus, Escherichia coli, yeast and human). For a single DNA polymerase, DNA damage can affect replication in three major ways: reducing replication fidelity, causing frameshift mutations, and blocking replication. For the DNA replisome, protein interactions and the functions of accessory proteins can yield rather different results even with a single DNA polymerase. The mechanism of mutation during replication performed by the DNA replisome is a long-standing question. Using new methods and techniques, the replisomes of certain organisms and human cell extracts can now be investigated with regard to the bypass of DNA damage. In this review, we consider the molecular mechanism of mutagenesis resulting from DNA damage in replication at the levels of single DNA polymerases and complex DNA replisomes, including translesion DNA synthesis. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. A new MCM modification cycle regulates DNA replication initiation.

    Science.gov (United States)

    Wei, Lei; Zhao, Xiaolan

    2016-03-01

    The MCM DNA helicase is a central regulatory target during genome replication. MCM is kept inactive during G1, and it initiates replication after being activated in S phase. During this transition, the only known chemical change to MCM is the gain of multisite phosphorylation that promotes cofactor recruitment. Because replication initiation is intimately linked to multiple biological cues, additional changes to MCM can provide further regulatory points. Here, we describe a yeast MCM SUMOylation cycle that regulates replication. MCM subunits undergo SUMOylation upon loading at origins in G1 before MCM phosphorylation. MCM SUMOylation levels then decline as MCM phosphorylation levels rise, thus suggesting an inhibitory role of MCM SUMOylation during replication. Indeed, increasing MCM SUMOylation impairs replication initiation, partly through promoting the recruitment of a phosphatase that decreases MCM phosphorylation and activation. We propose that MCM SUMOylation counterbalances kinase-based regulation, thus ensuring accurate control of replication initiation.

  14. Synthetic peptide inhibitors of DNA replication in Staphylococcus aureus

    DEFF Research Database (Denmark)

    Løbner-Olesen, Anders; Kjelstrup, Susanne

    F counterselection was developed to directly select for compounds able to disrupt selected interactions. We have subsequently constructed a cyclic peptide library for intracellular synthesis of cyclic peptides using known technology. Several cyclic peptides were able to interfere with oligomerization of Dna......N (), DnaB and DnaX (). Three peptides identified as inhibitors of DnaN have been purified. Two of these peptides inhibited growth as well as DNA replication in S. aureus. The minimal inhibitory concentration (MIC) of the peptides was approximately 50 g/ml. Overexpression of DnaN reduced the inhibitory...

  15. Replication of chromosomal and episomal DNA in X-ray-damaged human cells: A cis- or trans-acting mechanism

    International Nuclear Information System (INIS)

    Cleaver, J.E.; Rose, R.; Mitchell, D.L.

    1990-01-01

    Episomal plasmids and viruses in mammalian cells present small targets for X-ray-induced DNA damage. At doses up to 100 Gy, DNA strand breaks or endonuclease III-sensitive sites were not discernible in 10.3-kb Epstein-Barr virus-based plasmid DNA or in 4.9-kb defective simian virus 40 DNA. DNA replication in these small molecules, however, was inhibited strongly by X-ray doses of greater than or equal to 20 Gy, decreasing to only 20 to 40% of control values. Inhibition was relieved slightly by growth in caffeine but was increased by growth in 3-aminobenzamide. Inhibition of DNA replication in episomal DNA molecules that are too small to sustain significant damage directly to their DNA may be due to either (a) a trans-acting diffusible factor that transfers the consequences of DNA breakage to episomes and to other replicating molecules, (b) a cis-acting mechanism in which episomes are structurally linked to genomic chromatin, and replication of both episomal and chromosomal replicons is under common control, or (c) radiation damage on other cellular structures unrelated to DNA. The resolution of these cellular mechanisms may shed light on the X-ray-resistant replication in ataxia-telangiectasia and may suggest strategies for molecular characterization of potential trans- or cis-acting factors

  16. The Escherichia coli Tus-Ter replication fork barrier causes site-specific DNA replication perturbation in yeast

    DEFF Research Database (Denmark)

    Larsen, Nicolai B; Sass, Ehud; Suski, Catherine

    2014-01-01

    Replication fork (RF) pausing occurs at both 'programmed' sites and non-physiological barriers (for example, DNA adducts). Programmed RF pausing is required for site-specific DNA replication termination in Escherichia coli, and this process requires the binding of the polar terminator protein, Tus...... as a versatile, site-specific, heterologous DNA replication-perturbing system, with a variety of potential applications....

  17. The DNA Replication Stress Hypothesis of Alzheimer’s Disease

    Directory of Open Access Journals (Sweden)

    Yuri B. Yurov

    2011-01-01

    Full Text Available A well-recognized theory of Alzheimer’s disease (AD pathogenesis suggests ectopic cell cycle events to mediate neurodegeneration. Vulnerable neurons of the AD brain exhibit biomarkers of cell cycle progression and DNA replication suggesting a reentry into the cell cycle. Chromosome reduplication without proper cell cycle completion and mitotic division probably causes neuronal cell dysfunction and death. However, this theory seems to require some inputs in accordance with the generally recognized amyloid cascade theory as well as to explain causes and consequences of genomic instability (aneuploidy in the AD brain. We propose that unscheduled and incomplete DNA replication (replication stress destabilizes (epigenomic landscape in the brain and leads to DNA replication “catastrophe” causing cell death during the S phase (replicative cell death. DNA replication stress can be a key element of the pathogenetic cascade explaining the interplay between ectopic cell cycle events and genetic instabilities in the AD brain. Abnormal cell cycle reentry and somatic genome variations can be used for updating the cell cycle theory introducing replication stress as a missing link between cell genetics and neurobiology of AD.

  18. Effects of benzo[a]pyrene-DNA adducts on a reconstituted replication system

    International Nuclear Information System (INIS)

    Brown, W.C.; Romano, L.J.

    1991-01-01

    The authors have used a partially reconstituted replication system consisting of T7 DNA polymerase and T7 gene 4 protein to examine the effect of benzo[a]pyrene (B[a]P) adducts on DNA synthesis and gene 4 protein activities. The gene 4 protein is required for T7 DNA replication because of its ability to act as both a primase and helicase. They show here that total synthesis decreases as the level of adducts per molecule of DNA increases, suggesting that the B[a]P adducts are blocking an aspect of the replication process. By challenging synthesis on oligonucleotide-primed B[a]P-modified DNA with unmodified DNA, they present evidence that the T7 DNA polymerase freely dissociates after encountering an adduct. Prior studies have shown that the gene 4 protein alone does not dissociate from the template during translocation upon encountering an adduct. However, when gene 4 protein primed DNA synthesis is challenged, they observe an increase in synthesis but to a lesser extent than observed on oligonucleotide-primed synthesis. Finally, they have examined DNA synthesis on duplex templates and show the B[a]P adducts inhibit synthesis by the T7 DNA polymerase and gene 4 protein to the same extent regardless of whether the adducts are positioned in the leading or lagging strand, while synthesis by the polymerase alone is inhibited only when the adducts are in the template strand

  19. A Paper Model of DNA Structure and Replication.

    Science.gov (United States)

    Sigismondi, Linda A.

    1989-01-01

    A paper model which is designed to give students a hands-on experience during lecture and blackboard instruction on DNA structure is provided. A list of materials, paper patterns, and procedures for using the models to teach DNA structure and replication are given. (CW)

  20. Porcine circovirus: transcription and rolling-circle DNA replication

    Science.gov (United States)

    This review summarizes the molecular studies pertaining to porcine circovirus (PCV) transcription and DNA replication. The genome of PCV is circular, single-stranded DNA and contains 1759-1768 nucleotides. Both the genome-strand (packaged in the virus particle) and the complementary-strand (synthesi...

  1. Insights into the Initiation of Eukaryotic DNA Replication.

    Science.gov (United States)

    Bruck, Irina; Perez-Arnaiz, Patricia; Colbert, Max K; Kaplan, Daniel L

    2015-01-01

    The initiation of DNA replication is a highly regulated event in eukaryotic cells to ensure that the entire genome is copied once and only once during S phase. The primary target of cellular regulation of eukaryotic DNA replication initiation is the assembly and activation of the replication fork helicase, the 11-subunit assembly that unwinds DNA at a replication fork. The replication fork helicase, called CMG for Cdc45-Mcm2-7, and GINS, assembles in S phase from the constituent Cdc45, Mcm2-7, and GINS proteins. The assembly and activation of the CMG replication fork helicase during S phase is governed by 2 S-phase specific kinases, CDK and DDK. CDK stimulates the interaction between Sld2, Sld3, and Dpb11, 3 initiation factors that are each required for the initiation of DNA replication. DDK, on the other hand, phosphorylates the Mcm2, Mcm4, and Mcm6 subunits of the Mcm2-7 complex. Sld3 recruits Cdc45 to Mcm2-7 in a manner that depends on DDK, and recent work suggests that Sld3 binds directly to Mcm2-7 and also to single-stranded DNA. Furthermore, recent work demonstrates that Sld3 and its human homolog Treslin substantially stimulate DDK phosphorylation of Mcm2. These data suggest that the initiation factor Sld3/Treslin coordinates the assembly and activation of the eukaryotic replication fork helicase by recruiting Cdc45 to Mcm2-7, stimulating DDK phosphorylation of Mcm2, and binding directly to single-stranded DNA as the origin is melted.

  2. Small molecule inhibitors of HCV replication from Pomegranate

    Science.gov (United States)

    Reddy, B. Uma; Mullick, Ranajoy; Kumar, Anuj; Sudha, Govindarajan; Srinivasan, Narayanaswamy; Das, Saumitra

    2014-06-01

    Hepatitis C virus (HCV) is the causative agent of end-stage liver disease. Recent advances in the last decade in anti HCV treatment strategies have dramatically increased the viral clearance rate. However, several limitations are still associated, which warrant a great need of novel, safe and selective drugs against HCV infection. Towards this objective, we explored highly potent and selective small molecule inhibitors, the ellagitannins, from the crude extract of Pomegranate (Punica granatum) fruit peel. The pure compounds, punicalagin, punicalin, and ellagic acid isolated from the extract specifically blocked the HCV NS3/4A protease activity in vitro. Structural analysis using computational approach also showed that ligand molecules interact with the catalytic and substrate binding residues of NS3/4A protease, leading to inhibition of the enzyme activity. Further, punicalagin and punicalin significantly reduced the HCV replication in cell culture system. More importantly, these compounds are well tolerated ex vivo and`no observed adverse effect level' (NOAEL) was established upto an acute dose of 5000 mg/kg in BALB/c mice. Additionally, pharmacokinetics study showed that the compounds are bioavailable. Taken together, our study provides a proof-of-concept approach for the potential use of antiviral and non-toxic principle ellagitannins from pomegranate in prevention and control of HCV induced complications.

  3. Centromeric DNA replication reconstitution reveals DNA loops and ATR checkpoint suppression.

    Science.gov (United States)

    Aze, Antoine; Sannino, Vincenzo; Soffientini, Paolo; Bachi, Angela; Costanzo, Vincenzo

    2016-06-01

    Half of the human genome is made up of repetitive DNA. However, mechanisms underlying replication of chromosome regions containing repetitive DNA are poorly understood. We reconstituted replication of defined human chromosome segments using bacterial artificial chromosomes in Xenopus laevis egg extract. Using this approach we characterized the chromatin assembly and replication dynamics of centromeric alpha-satellite DNA. Proteomic analysis of centromeric chromatin revealed replication-dependent enrichment of a network of DNA repair factors including the MSH2-6 complex, which was required for efficient centromeric DNA replication. However, contrary to expectations, the ATR-dependent checkpoint monitoring DNA replication fork arrest could not be activated on highly repetitive DNA due to the inability of the single-stranded DNA binding protein RPA to accumulate on chromatin. Electron microscopy of centromeric DNA and supercoil mapping revealed the presence of topoisomerase I-dependent DNA loops embedded in a protein matrix enriched for SMC2-4 proteins. This arrangement suppressed ATR signalling by preventing RPA hyper-loading, facilitating replication of centromeric DNA. These findings have important implications for our understanding of repetitive DNA metabolism and centromere organization under normal and stressful conditions.

  4. Replication and Transcription of Eukaryotic DNA in Esherichia coli

    Science.gov (United States)

    Morrow, John F.; Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Goodman, Howard M.; Helling, Robert B.

    1974-01-01

    Fragments of amplified Xenopus laevis DNA, coding for 18S and 28S ribosomal RNA and generated by EcoRI restriction endonuclease, have been linked in vitro to the bacterial plasmid pSC101; and the recombinant molecular species have been introduced into E. coli by transformation. These recombinant plasmids, containing both eukaryotic and prokaryotic DNA, replicate stably in E. coli. RNA isolated from E. coli minicells harboring the plasmids hybridizes to amplified X. laevis rDNA. Images PMID:4600264

  5. In vitro-reconstituted nucleoids can block mitochondrial DNA replication and transcription.

    Science.gov (United States)

    Farge, Géraldine; Mehmedovic, Majda; Baclayon, Marian; van den Wildenberg, Siet M J L; Roos, Wouter H; Gustafsson, Claes M; Wuite, Gijs J L; Falkenberg, Maria

    2014-07-10

    The mechanisms regulating the number of active copies of mtDNA are still unclear. A mammalian cell typically contains 1,000-10,000 copies of mtDNA, which are packaged into nucleoprotein complexes termed nucleoids. The main protein component of these structures is mitochondrial transcription factor A (TFAM). Here, we reconstitute nucleoid-like particles in vitro and demonstrate that small changes in TFAM levels dramatically impact the fraction of DNA molecules available for transcription and DNA replication. Compaction by TFAM is highly cooperative, and at physiological ratios of TFAM to DNA, there are large variations in compaction, from fully compacted nucleoids to naked DNA. In compacted nucleoids, TFAM forms stable protein filaments on DNA that block melting and prevent progression of the replication and transcription machineries. Based on our observations, we suggest that small variations in the TFAM-to-mtDNA ratio may be used to regulate mitochondrial gene transcription and DNA replication. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  6. DNA replication origins-where do we begin?

    Science.gov (United States)

    Prioleau, Marie-Noëlle; MacAlpine, David M

    2016-08-01

    For more than three decades, investigators have sought to identify the precise locations where DNA replication initiates in mammalian genomes. The development of molecular and biochemical approaches to identify start sites of DNA replication (origins) based on the presence of defining and characteristic replication intermediates at specific loci led to the identification of only a handful of mammalian replication origins. The limited number of identified origins prevented a comprehensive and exhaustive search for conserved genomic features that were capable of specifying origins of DNA replication. More recently, the adaptation of origin-mapping assays to genome-wide approaches has led to the identification of tens of thousands of replication origins throughout mammalian genomes, providing an unprecedented opportunity to identify both genetic and epigenetic features that define and regulate their distribution and utilization. Here we summarize recent advances in our understanding of how primary sequence, chromatin environment, and nuclear architecture contribute to the dynamic selection and activation of replication origins across diverse cell types and developmental stages. © 2016 Prioleau and MacAlpine; Published by Cold Spring Harbor Laboratory Press.

  7. DNA replication origins—where do we begin?

    Science.gov (United States)

    Prioleau, Marie-Noëlle; MacAlpine, David M.

    2016-01-01

    For more than three decades, investigators have sought to identify the precise locations where DNA replication initiates in mammalian genomes. The development of molecular and biochemical approaches to identify start sites of DNA replication (origins) based on the presence of defining and characteristic replication intermediates at specific loci led to the identification of only a handful of mammalian replication origins. The limited number of identified origins prevented a comprehensive and exhaustive search for conserved genomic features that were capable of specifying origins of DNA replication. More recently, the adaptation of origin-mapping assays to genome-wide approaches has led to the identification of tens of thousands of replication origins throughout mammalian genomes, providing an unprecedented opportunity to identify both genetic and epigenetic features that define and regulate their distribution and utilization. Here we summarize recent advances in our understanding of how primary sequence, chromatin environment, and nuclear architecture contribute to the dynamic selection and activation of replication origins across diverse cell types and developmental stages. PMID:27542827

  8. DNA is a co-factor for its own replication in Xenopus egg extracts

    NARCIS (Netherlands)

    Lebofsky, Ronald; van Oijen, Antoine M.; Walter, Johannes C.

    Soluble Xenopus egg extracts efficiently replicate added plasmids using a physiological mechanism, and thus represent a powerful system to understand vertebrate DNA replication. Surprisingly, DNA replication in this system is highly sensitive to plasmid concentration, being undetectable below

  9. Mechanism of Archaeal MCM Helicase Recruitment to DNA Replication Origins

    Science.gov (United States)

    Samson, Rachel Y.; Abeyrathne, Priyanka D.; Bell, Stephen D.

    2015-01-01

    Summary Cellular DNA replication origins direct the recruitment of replicative helicases via the action of initiator proteins belonging to the AAA+ superfamily of ATPases. Archaea have a simplified subset of the eukaryotic DNA replication machinery proteins and possess initiators that appear ancestral to both eukaryotic Orc1 and Cdc6. We have reconstituted origin-dependent recruitment of the homohexameric archaeal MCM in vitro with purified recombinant proteins. Using this system, we reveal that archaeal Orc1-1 fulfills both Orc1 and Cdc6 functions by binding to a replication origin and directly recruiting MCM helicase. We identify the interaction interface between these proteins and reveal how ATP binding by Orc1-1 modulates recruitment of MCM. Additionally, we provide evidence that an open-ring form of the archaeal MCM homohexamer is loaded at origins. PMID:26725007

  10. DNA moves sequentially towards the nuclear matrix during DNA replication in vivo

    Directory of Open Access Journals (Sweden)

    Aranda-Anzaldo Armando

    2011-01-01

    Full Text Available Abstract Background In the interphase nucleus of metazoan cells DNA is organized in supercoiled loops anchored to a nuclear matrix (NM. There is varied evidence indicating that DNA replication occurs in replication factories organized upon the NM and that DNA loops may correspond to the actual replicons in vivo. In normal rat liver the hepatocytes are arrested in G0 but they synchronously re-enter the cell cycle after partial-hepatectomy leading to liver regeneration in vivo. We have previously determined in quiescent rat hepatocytes that a 162 kbp genomic region containing members of the albumin gene family is organized into five structural DNA loops. Results In the present work we tracked down the movement relative to the NM of DNA sequences located at different points within such five structural DNA loops during the S phase and after the return to cellular quiescence during liver regeneration. Our results indicate that looped DNA moves sequentially towards the NM during replication and then returns to its original position in newly quiescent cells, once the liver regeneration has been achieved. Conclusions Looped DNA moves in a sequential fashion, as if reeled in, towards the NM during DNA replication in vivo thus supporting the notion that the DNA template is pulled progressively towards the replication factories on the NM so as to be replicated. These results provide further evidence that the structural DNA loops correspond to the actual replicons in vivo.

  11. DNA Replication Control During Drosophila Development: Insights into the Onset of S Phase, Replication Initiation, and Fork Progression

    Science.gov (United States)

    Hua, Brian L.; Orr-Weaver, Terry L.

    2017-01-01

    Proper control of DNA replication is critical to ensure genomic integrity during cell proliferation. In addition, differential regulation of the DNA replication program during development can change gene copy number to influence cell size and gene expression. Drosophila melanogaster serves as a powerful organism to study the developmental control of DNA replication in various cell cycle contexts in a variety of differentiated cell and tissue types. Additionally, Drosophila has provided several developmentally regulated replication models to dissect the molecular mechanisms that underlie replication-based copy number changes in the genome, which include differential underreplication and gene amplification. Here, we review key findings and our current understanding of the developmental control of DNA replication in the contexts of the archetypal replication program as well as of underreplication and differential gene amplification. We focus on the use of these latter two replication systems to delineate many of the molecular mechanisms that underlie the developmental control of replication initiation and fork elongation. PMID:28874453

  12. USP7 is a SUMO deubiquitinase essential for DNA replication

    Science.gov (United States)

    Lecona, Emilio; Rodriguez-Acebes, Sara; Specks, Julia; Lopez-Contreras, Andres J; Ruppen, Isabel; Murga, Matilde; Muñoz, Javier; Mendez, Juan; Fernandez-Capetillo, Oscar

    2016-01-01

    Post-translational modification of proteins by ubiquitin (Ub) and Ub-like modifiers regulates various aspects of DNA replication. We previously showed that the chromatin around replisomes is rich in SUMO and depleted in Ub, whereas an opposite pattern is observed in mature chromatin. How this SUMO-rich/Ub-low environment is maintained at sites of DNA replication is not known. Here we identify USP7 as a replisome-enriched SUMO deubiquitinase that is essential for DNA replication. By acting on SUMO and SUMOylated proteins, USP7 counteracts their ubiquitination. Chemical inhibition or genetic deletion of USP7 leads to the accumulation of Ub on SUMOylated proteins, which are displaced to chromatin away from replisomes. Our findings provide a model to explain the differential accumulation of SUMO and Ub at replication forks, and identify an essential role of USP7 in DNA replication that should be taken into account for the use of USP7 inhibitors as anticancer agents. PMID:26950370

  13. Inhibition of DNA glycosylases via small molecule purine analogs.

    Directory of Open Access Journals (Sweden)

    Aaron C Jacobs

    Full Text Available Following the formation of oxidatively-induced DNA damage, several DNA glycosylases are required to initiate repair of the base lesions that are formed. Recently, NEIL1 and other DNA glycosylases, including OGG1 and NTH1 were identified as potential targets in combination chemotherapeutic strategies. The potential therapeutic benefit for the inhibition of DNA glycosylases was validated by demonstrating synthetic lethality with drugs that are commonly used to limit DNA replication through dNTP pool depletion via inhibition of thymidylate synthetase and dihydrofolate reductase. Additionally, NEIL1-associated synthetic lethality has been achieved in combination with Fanconi anemia, group G. As a prelude to the development of strategies to exploit the potential benefits of DNA glycosylase inhibition, it was necessary to develop a reliable high-throughput screening protocol for this class of enzymes. Using NEIL1 as the proof-of-principle glycosylase, a fluorescence-based assay was developed that utilizes incision of site-specifically modified oligodeoxynucleotides to detect enzymatic activity. This assay was miniaturized to a 1536-well format and used to screen small molecule libraries for inhibitors of the combined glycosylase/AP lyase activities. Among the top hits of these screens were several purine analogs, whose postulated presence in the active site of NEIL1 was consistent with the paradigm of NEIL1 recognition and excision of damaged purines. Although a subset of these small molecules could inhibit other DNA glycosylases that excise oxidatively-induced DNA adducts, they could not inhibit a pyrimidine dimer-specific glycosylase.

  14. Distribution of DNA replication proteins in Drosophila cells

    Science.gov (United States)

    Easwaran, Hariharan P; Leonhardt, Heinrich; Cardoso, M Cristina

    2007-01-01

    Background DNA replication in higher eukaryotic cells is organized in discrete subnuclear sites called replication foci (RF). During the S phase, most replication proteins assemble at the RF by interacting with PCNA via a PCNA binding domain (PBD). This has been shown to occur for many mammalian replication proteins, but it is not known whether this mechanism is conserved in evolution. Results Fluorescent fusions of mammalian replication proteins, Dnmt1, HsDNA Lig I and HsPCNA were analyzed for their ability to target to RF in Drosophila cells. Except for HsPCNA, none of the other proteins and their deletions showed any accumulation at RF in Drosophila cells. We hypothesized that in Drosophila cells there might be some other peptide sequence responsible for targeting proteins to RF. To test this, we identified the DmDNA Lig I and compared the protein sequence with HsDNA Lig I. The two orthologs shared the PBD suggesting a functionally conserved role for this domain in the Drosophila counterpart. A series of deletions of DmDNA Lig I were analyzed for their ability to accumulate at RF in Drosophila and mammalian cells. Surprisingly, no accumulation at RF was observed in Drosophila cells, while in mammalian cells DmDNA Lig I accumulated at RF via its PBD. Further, GFP fusions with the PBD domains from Dnmt1, HsDNA Lig I and DmDNA Lig I, were able to target to RF only in mammalian cells but not in Drosophila cells. Conclusion We show that S phase in Drosophila cells is characterized by formation of RF marked by PCNA like in mammalian cells. However, other than PCNA none of the replication proteins and their deletions tested here showed accumulation at RF in Drosophila cells while the same proteins and deletions are capable of accumulating at RF in mammalian cells. We hypothesize that unlike mammalian cells, in Drosophila cells, replication proteins do not form long-lasting interactions with the replication machinery, and rather perform their functions via very

  15. Maintaining epigenetic inheritance during DNA replication in plants

    Directory of Open Access Journals (Sweden)

    Francisco eIglesias

    2016-02-01

    Full Text Available Biotic and abiotic stresses alter the pattern of gene expression in plants. Depending on the frequency and duration of stress events, the effects on the transcriptional state of genes are remembered temporally or transmitted to daughter cells and, in some instances, even to offspring (transgenerational epigenetic inheritance. This memory effect, which can be found even in the absence of the original stress, has an epigenetic basis, through molecular mechanisms that take place at the chromatin and DNA level but do not imply changes in the DNA sequence. Many epigenetic mechanisms have been described and involve covalent modifications on the DNA and histones, such as DNA methylation, histone acetylation and methylation, and RNAi dependent silencing mechanisms. Some of these chromatin modifications need to be stable through cell division in order to be truly epigenetic. During DNA replication, histones are recycled during the formation of the new nucleosomes and this process is tightly regulated. Perturbations to the DNA replication process and/or the recycling of histones lead to epigenetic changes. In this mini-review, we discuss recent evidence aimed at linking DNA replication process to epigenetic inheritance in plants.

  16. Electron microscope autoradiography of isolated DNA molecules

    International Nuclear Information System (INIS)

    Delain, Etienne; Bouteille, Michel

    1980-01-01

    Autoradiographs of 3 H-thymidine-labelled DNA molecules were observed with an electron microscope. After ten months of exposure significant labelling was obtained with tritiated T7 DNA molecules which had a specific activity of 630,000 cpm/μg. Although isolated DNA molecules were not stretched out to such an extent that they could be rigorously compared to straight 'hot lines', the resolution was estimated and found to be similar to that obtained by autoradiography on thin plastic sections. The H.D. value was of the order of 1600A. From the known specific activity of the macromolecules, it was possible to compare the expected number of disintegrations from the samples to the number of grains obtained on the autoradiograms. This enabled us to calculate 1/ The absolute autoradiographic efficiency and 2/ The per cent ratio of thymidine residues labelled with tritium. These results throw some light on the resolution and sensitivity of electron microscope autoradiography of shadowed isolated macromolecules as compared to thin plastic sections

  17. DNA Replication in Engineered Escherichia coli Genomes with Extra Replication Origins.

    Science.gov (United States)

    Milbredt, Sarah; Farmani, Neda; Sobetzko, Patrick; Waldminghaus, Torsten

    2016-10-21

    The standard outline of bacterial genomes is a single circular chromosome with a single replication origin. From the bioengineering perspective, it appears attractive to extend this basic setup. Bacteria with split chromosomes or multiple replication origins have been successfully constructed in the last few years. The characteristics of these engineered strains will largely depend on the respective DNA replication patterns. However, the DNA replication has not been investigated systematically in engineered bacteria with multiple origins or split replicons. Here we fill this gap by studying a set of strains consisting of (i) E. coli strains with an extra copy of the native replication origin (oriC), (ii) E. coli strains with an extra copy of the replication origin from the secondary chromosome of Vibrio cholerae (oriII), and (iii) a strain in which the E. coli chromosome is split into two linear replicons. A combination of flow cytometry, microarray-based comparative genomic hybridization (CGH), and modeling revealed silencing of extra oriC copies and differential timing of ectopic oriII copies compared to the native oriC. The results were used to derive construction rules for future multiorigin and multireplicon projects.

  18. Mammalian RAD52 Functions in Break-Induced Replication Repair of Collapsed DNA Replication Forks.

    Science.gov (United States)

    Sotiriou, Sotirios K; Kamileri, Irene; Lugli, Natalia; Evangelou, Konstantinos; Da-Ré, Caterina; Huber, Florian; Padayachy, Laura; Tardy, Sebastien; Nicati, Noemie L; Barriot, Samia; Ochs, Fena; Lukas, Claudia; Lukas, Jiri; Gorgoulis, Vassilis G; Scapozza, Leonardo; Halazonetis, Thanos D

    2016-12-15

    Human cancers are characterized by the presence of oncogene-induced DNA replication stress (DRS), making them dependent on repair pathways such as break-induced replication (BIR) for damaged DNA replication forks. To better understand BIR, we performed a targeted siRNA screen for genes whose depletion inhibited G1 to S phase progression when oncogenic cyclin E was overexpressed. RAD52, a gene dispensable for normal development in mice, was among the top hits. In cells in which fork collapse was induced by oncogenes or chemicals, the Rad52 protein localized to DRS foci. Depletion of Rad52 by siRNA or knockout of the gene by CRISPR/Cas9 compromised restart of collapsed forks and led to DNA damage in cells experiencing DRS. Furthermore, in cancer-prone, heterozygous APC mutant mice, homozygous deletion of the Rad52 gene suppressed tumor growth and prolonged lifespan. We therefore propose that mammalian RAD52 facilitates repair of collapsed DNA replication forks in cancer cells. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  19. Nuclear mitochondrial DNA activates replication in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Laurent Chatre

    Full Text Available The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in.

  20. DNA replication and post-replication repair in U.V.-sensitive mouse neuroblastoma cells

    International Nuclear Information System (INIS)

    Lavin, M.F.; McCombe, P.; Kidson, C.

    1976-01-01

    Mouse neuroblastoma cells differentiated when grown in the absence of serum; differentiation was reversed on the addition of serum. Differentiated cells were more sensitive to U.V.-radiation than proliferating cells. Whereas addition of serum to differentiated neuroblastoma cells normally resulted in immediate, synchronous entry into S phase, irradiation just before the addition of serum resulted in a long delay in the onset of DNA replication. During this lag period, incorporated 3 H-thymidine appeared in the light density region of CsCl gradients, reflecting either repair synthesis or abortive replication. Post-replication repair (gap-filling) was found to be present in proliferating cells and at certain times in differentiated cells. It is suggested that the sensitivity of differentiated neuroblastoma cells to U.V.-radiation may have been due to ineffective post-replication repair or to deficiencies in more than one repair mechanism, with reduction in repair capacity beyond a critical threshold. (author)

  1. Checkpoint independence of most DNA replication origins in fission yeast.

    Science.gov (United States)

    Mickle, Katie L; Ramanathan, Sunita; Rosebrock, Adam; Oliva, Anna; Chaudari, Amna; Yompakdee, Chulee; Scott, Donna; Leatherwood, Janet; Huberman, Joel A

    2007-12-19

    In budding yeast, the replication checkpoint slows progress through S phase by inhibiting replication origin firing. In mammals, the replication checkpoint inhibits both origin firing and replication fork movement. To find out which strategy is employed in the fission yeast, Schizosaccharomyces pombe, we used microarrays to investigate the use of origins by wild-type and checkpoint-mutant strains in the presence of hydroxyurea (HU), which limits the pool of deoxyribonucleoside triphosphates (dNTPs) and activates the replication checkpoint. The checkpoint-mutant cells carried deletions either of rad3 (which encodes the fission yeast homologue of ATR) or cds1 (which encodes the fission yeast homologue of Chk2). Our microarray results proved to be largely consistent with those independently obtained and recently published by three other laboratories. However, we were able to reconcile differences between the previous studies regarding the extent to which fission yeast replication origins are affected by the replication checkpoint. We found (consistent with the three previous studies after appropriate interpretation) that, in surprising contrast to budding yeast, most fission yeast origins, including both early- and late-firing origins, are not significantly affected by checkpoint mutations during replication in the presence of HU. A few origins (approximately 3%) behaved like those in budding yeast: they replicated earlier in the checkpoint mutants than in wild type. These were located primarily in the heterochromatic subtelomeric regions of chromosomes 1 and 2. Indeed, the subtelomeric regions defined by the strongest checkpoint restraint correspond precisely to previously mapped subtelomeric heterochromatin. This observation implies that subtelomeric heterochromatin in fission yeast differs from heterochromatin at centromeres, in the mating type region, and in ribosomal DNA, since these regions replicated at least as efficiently in wild-type cells as in checkpoint

  2. Checkpoint independence of most DNA replication origins in fission yeast

    Science.gov (United States)

    Mickle, Katie L; Ramanathan, Sunita; Rosebrock, Adam; Oliva, Anna; Chaudari, Amna; Yompakdee, Chulee; Scott, Donna; Leatherwood, Janet; Huberman, Joel A

    2007-01-01

    Background In budding yeast, the replication checkpoint slows progress through S phase by inhibiting replication origin firing. In mammals, the replication checkpoint inhibits both origin firing and replication fork movement. To find out which strategy is employed in the fission yeast, Schizosaccharomyces pombe, we used microarrays to investigate the use of origins by wild-type and checkpoint-mutant strains in the presence of hydroxyurea (HU), which limits the pool of deoxyribonucleoside triphosphates (dNTPs) and activates the replication checkpoint. The checkpoint-mutant cells carried deletions either of rad3 (which encodes the fission yeast homologue of ATR) or cds1 (which encodes the fission yeast homologue of Chk2). Results Our microarray results proved to be largely consistent with those independently obtained and recently published by three other laboratories. However, we were able to reconcile differences between the previous studies regarding the extent to which fission yeast replication origins are affected by the replication checkpoint. We found (consistent with the three previous studies after appropriate interpretation) that, in surprising contrast to budding yeast, most fission yeast origins, including both early- and late-firing origins, are not significantly affected by checkpoint mutations during replication in the presence of HU. A few origins (~3%) behaved like those in budding yeast: they replicated earlier in the checkpoint mutants than in wild type. These were located primarily in the heterochromatic subtelomeric regions of chromosomes 1 and 2. Indeed, the subtelomeric regions defined by the strongest checkpoint restraint correspond precisely to previously mapped subtelomeric heterochromatin. This observation implies that subtelomeric heterochromatin in fission yeast differs from heterochromatin at centromeres, in the mating type region, and in ribosomal DNA, since these regions replicated at least as efficiently in wild-type cells as in

  3. Checkpoint independence of most DNA replication origins in fission yeast

    Directory of Open Access Journals (Sweden)

    Scott Donna

    2007-12-01

    Full Text Available Abstract Background In budding yeast, the replication checkpoint slows progress through S phase by inhibiting replication origin firing. In mammals, the replication checkpoint inhibits both origin firing and replication fork movement. To find out which strategy is employed in the fission yeast, Schizosaccharomyces pombe, we used microarrays to investigate the use of origins by wild-type and checkpoint-mutant strains in the presence of hydroxyurea (HU, which limits the pool of deoxyribonucleoside triphosphates (dNTPs and activates the replication checkpoint. The checkpoint-mutant cells carried deletions either of rad3 (which encodes the fission yeast homologue of ATR or cds1 (which encodes the fission yeast homologue of Chk2. Results Our microarray results proved to be largely consistent with those independently obtained and recently published by three other laboratories. However, we were able to reconcile differences between the previous studies regarding the extent to which fission yeast replication origins are affected by the replication checkpoint. We found (consistent with the three previous studies after appropriate interpretation that, in surprising contrast to budding yeast, most fission yeast origins, including both early- and late-firing origins, are not significantly affected by checkpoint mutations during replication in the presence of HU. A few origins (~3% behaved like those in budding yeast: they replicated earlier in the checkpoint mutants than in wild type. These were located primarily in the heterochromatic subtelomeric regions of chromosomes 1 and 2. Indeed, the subtelomeric regions defined by the strongest checkpoint restraint correspond precisely to previously mapped subtelomeric heterochromatin. This observation implies that subtelomeric heterochromatin in fission yeast differs from heterochromatin at centromeres, in the mating type region, and in ribosomal DNA, since these regions replicated at least as efficiently in wild

  4. DNA replication: stalling a fork for imprinting and switching

    DEFF Research Database (Denmark)

    Egel, Richard

    2004-01-01

    Mating-type switching in fission yeast has long been known to be directed by a DNA 'imprint'. This imprint has now been firmly characterized as a protected site-specific and strand-specific nick. New work also links the widely conserved Swi1-Swi3 complex to the protection of stalled replication...

  5. Quantitative live imaging of endogenous DNA replication in mammalian cells.

    Directory of Open Access Journals (Sweden)

    Andrew Burgess

    Full Text Available Historically, the analysis of DNA replication in mammalian tissue culture cells has been limited to static time points, and the use of nucleoside analogues to pulse-label replicating DNA. Here we characterize for the first time a novel Chromobody cell line that specifically labels endogenous PCNA. By combining this with high-resolution confocal time-lapse microscopy, and with a simplified analysis workflow, we were able to produce highly detailed, reproducible, quantitative 4D data on endogenous DNA replication. The increased resolution allowed accurate classification and segregation of S phase into early-, mid-, and late-stages based on the unique subcellular localization of endogenous PCNA. Surprisingly, this localization was slightly but significantly different from previous studies, which utilized over-expressed GFP tagged forms of PCNA. Finally, low dose exposure to Hydroxyurea caused the loss of mid- and late-S phase localization patterns of endogenous PCNA, despite cells eventually completing S phase. Taken together, these results indicate that this simplified method can be used to accurately identify and quantify DNA replication under multiple and various experimental conditions.

  6. Potential biomarkers of DNA replication stress in cancer

    DEFF Research Database (Denmark)

    Ren, Liqun; Chen, Long; Wu, Wei

    2017-01-01

    Oncogene activation is an established driver of tumorigenesis. An apparently inevitable consequence of oncogene activation is the generation of DNA replication stress (RS), a feature common to most cancer cells. RS, in turn, is a causal factor in the development of chromosome instability (CIN...

  7. DNA breaks early in replication in B cell cancers

    Science.gov (United States)

    Research by scientists at the NCI has identified a new class of DNA sites in cells that break early in the replication process. They found that these break sites correlate with damage often seen in B cell cancers, such as diffuse large B cell lymphoma.

  8. DNA replication stress as a hallmark of cancer.

    Science.gov (United States)

    Macheret, Morgane; Halazonetis, Thanos D

    2015-01-01

    Human cancers share properties referred to as hallmarks, among which sustained proliferation, escape from apoptosis, and genomic instability are the most pervasive. The sustained proliferation hallmark can be explained by mutations in oncogenes and tumor suppressors that regulate cell growth, whereas the escape from apoptosis hallmark can be explained by mutations in the TP53, ATM, or MDM2 genes. A model to explain the presence of the three hallmarks listed above, as well as the patterns of genomic instability observed in human cancers, proposes that the genes driving cell proliferation induce DNA replication stress, which, in turn, generates genomic instability and selects for escape from apoptosis. Here, we review the data that support this model, as well as the mechanisms by which oncogenes induce replication stress. Further, we argue that DNA replication stress should be considered as a hallmark of cancer because it likely drives cancer development and is very prevalent.

  9. DNA replication and repair of Tilapia cells: Pt. 2

    International Nuclear Information System (INIS)

    Chen, J.D.; Yew, F.H.

    1988-01-01

    TO-2 is a fish cell line derived from the Tilapia ovary. It grows over a wide range of temperature (15-34 0 C). We report the effects of temperature on DNA replication and u.v. repair in TO-2 cells. When the cells were moved from 31 0 C to the sublethal high temperature of 37 0 C, the rate of DNA synthesis first decreased to 60%, then speedy recovery soon set in, and after 8h at 37 0 C the rate of DNA synthesis overshot the 31 0 C control level by 180%. When moved to low temperature (18 0 C) Tilapia cells also showed an initial suppression of DNA synthesis before settling at 30% of the control level. U.V. reduced but could not block DNA synthesis completely. The inhibition was overcome in 3h at 37, 31 and 25 0 C, but not at 18 0 C. Initiation of nascent DNA synthesis was blocked at 4Jm -2 in TO-2 cells compared with ≤ 1Jm -2 in mammalian cells. After 9Jm -2 u.v. irradiation, low molecular weight DNA replication intermediates started to accumulate. TO-2 cells showed low levels of u.v.-induced excision repair. (author)

  10. Mechanisms for the initiation of bacteriophage T7 DNA replication

    International Nuclear Information System (INIS)

    Fuller, C.W.; Beauchamp, B.B.; Engler, M.J.; Lechner, R.L.; Matson, S.W.; Tabor, S.; White, J.H.; Richardson, C.C.

    1983-01-01

    Genetic analysis of bacteriophage T7 has shown that the products of phage genes 1, 2, 3, 4, 5, and 6 are required for phage DNA synthesis in vivo. T7 RNA polymerase is the translation product of gene 1. This RNA polymerase is required for transcription of most of the phage genome, including genes 2 through 6. T7 RNA polymerase promoters consist of a highly conserved 23-bp DNA sequence. There are 17 such promoters in the T7 DNA molecule, all of which direct transcription from the same strand of the DNA. 70 references, 11 figures

  11. Regulation of Small Mitochondrial DNA Replicative Advantage by Ribonucleotide Reductase in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Elliot Bradshaw

    2017-09-01

    Full Text Available Small mitochondrial genomes can behave as selfish elements by displacing wild-type genomes regardless of their detriment to the host organism. In the budding yeast Saccharomyces cerevisiae, small hypersuppressive mtDNA transiently coexist with wild-type in a state of heteroplasmy, wherein the replicative advantage of the small mtDNA outcompetes wild-type and produces offspring without respiratory capacity in >95% of colonies. The cytosolic enzyme ribonucleotide reductase (RNR catalyzes the rate-limiting step in dNTP synthesis and its inhibition has been correlated with increased petite colony formation, reflecting loss of respiratory function. Here, we used heteroplasmic diploids containing wild-type (rho+ and suppressive (rho− or hypersuppressive (HS rho− mitochondrial genomes to explore the effects of RNR activity on mtDNA heteroplasmy in offspring. We found that the proportion of rho+ offspring was significantly increased by RNR overexpression or deletion of its inhibitor, SML1, while reducing RNR activity via SML1 overexpression produced the opposite effects. In addition, using Ex Taq and KOD Dash polymerases, we observed a replicative advantage for small over large template DNA in vitro, but only at low dNTP concentrations. These results suggest that dNTP insufficiency contributes to the replicative advantage of small mtDNA over wild-type and cytosolic dNTP synthesis by RNR is an important regulator of heteroplasmy involving small mtDNA molecules in yeast.

  12. Plasticity of DNA replication initiation in Epstein-Barr virus episomes.

    Directory of Open Access Journals (Sweden)

    Paolo Norio

    2004-06-01

    Full Text Available In mammalian cells, the activity of the sites of initiation of DNA replication appears to be influenced epigenetically, but this regulation is not fully understood. Most studies of DNA replication have focused on the activity of individual initiation sites, making it difficult to evaluate the impact of changes in initiation activity on the replication of entire genomic loci. Here, we used single molecule analysis of replicated DNA (SMARD to study the latent duplication of Epstein-Barr virus (EBV episomes in human cell lines. We found that initiation sites are present throughout the EBV genome and that their utilization is not conserved in different EBV strains. In addition, SMARD shows that modifications in the utilization of multiple initiation sites occur across large genomic regions (tens of kilobases in size. These observations indicate that individual initiation sites play a limited role in determining the replication dynamics of the EBV genome. Long-range mechanisms and the genomic context appear to play much more important roles, affecting the frequency of utilization and the order of activation of multiple initiation sites. Finally, these results confirm that initiation sites are extremely redundant elements of the EBV genome. We propose that these conclusions also apply to mammalian chromosomes.

  13. Specificity and Function of Archaeal DNA Replication Initiator Proteins

    Directory of Open Access Journals (Sweden)

    Rachel Y. Samson

    2013-02-01

    Full Text Available Chromosomes with multiple DNA replication origins are a hallmark of Eukaryotes and some Archaea. All eukaryal nuclear replication origins are defined by the origin recognition complex (ORC that recruits the replicative helicase MCM(2-7 via Cdc6 and Cdt1. We find that the three origins in the single chromosome of the archaeon Sulfolobus islandicus are specified by distinct initiation factors. While two origins are dependent on archaeal homologs of eukaryal Orc1 and Cdc6, the third origin is instead reliant on an archaeal Cdt1 homolog. We exploit the nonessential nature of the orc1-1 gene to investigate the role of ATP binding and hydrolysis in initiator function in vivo and in vitro. We find that the ATP-bound form of Orc1-1 is proficient for replication and implicates hydrolysis of ATP in downregulation of origin activity. Finally, we reveal that ATP and DNA binding by Orc1-1 remodels the protein’s structure rather than that of the DNA template.

  14. Evolution of DNA replication protein complexes in eukaryotes and Archaea.

    Directory of Open Access Journals (Sweden)

    Nicholas Chia

    Full Text Available BACKGROUND: The replication of DNA in Archaea and eukaryotes requires several ancillary complexes, including proliferating cell nuclear antigen (PCNA, replication factor C (RFC, and the minichromosome maintenance (MCM complex. Bacterial DNA replication utilizes comparable proteins, but these are distantly related phylogenetically to their archaeal and eukaryotic counterparts at best. METHODOLOGY/PRINCIPAL FINDINGS: While the structures of each of the complexes do not differ significantly between the archaeal and eukaryotic versions thereof, the evolutionary dynamic in the two cases does. The number of subunits in each complex is constant across all taxa. However, they vary subtly with regard to composition. In some taxa the subunits are all identical in sequence, while in others some are homologous rather than identical. In the case of eukaryotes, there is no phylogenetic variation in the makeup of each complex-all appear to derive from a common eukaryotic ancestor. This is not the case in Archaea, where the relationship between the subunits within each complex varies taxon-to-taxon. We have performed a detailed phylogenetic analysis of these relationships in order to better understand the gene duplications and divergences that gave rise to the homologous subunits in Archaea. CONCLUSION/SIGNIFICANCE: This domain level difference in evolution suggests that different forces have driven the evolution of DNA replication proteins in each of these two domains. In addition, the phylogenies of all three gene families support the distinctiveness of the proposed archaeal phylum Thaumarchaeota.

  15. DNA-binding proteins essential for protein-primed bacteriophage ø29 DNA replication

    Directory of Open Access Journals (Sweden)

    Margarita Salas

    2016-08-01

    Full Text Available Bacillus subtilis phage Φ29 has a linear, double-stranded DNA 19 kb long with an inverted terminal repeat of 6 nucleotides and a protein covalently linked to the 5’ ends of the DNA. This protein, called terminal protein (TP, is the primer for the initiation of replication, a reaction catalyzed by the viral DNA polymerase at the two DNA ends. The DNA polymerase further elongates the nascent DNA chain in a processive manner, coupling strand displacement with elongation. The viral protein p5 is a single-stranded DNA binding protein (SSB that binds to the single strands generated by strand displacement during the elongation process. Viral protein p6 is a double-stranded DNA binding protein (DBP that preferentially binds to the origins of replication at the Φ29 DNA ends and is required for the initiation of replication. Both SSB and DBP are essential for Φ29 DNA amplification. This review focuses on the role of these phage DNA-binding proteins in Φ29 DNA replication both in vitro and in vivo, as well as on the implication of several B. subtilis DNA-binding proteins in different processes of the viral cycle. We will revise the enzymatic activities of the Φ29 DNA polymerase: TP-deoxynucleotidylation, processive DNA polymerization coupled to strand displacement, 3’-5’ exonucleolysis and pyrophosphorolysis. The resolution of the Φ29 DNA polymerase structure has shed light on the translocation mechanism and the determinants responsible for processivity and strand displacement. These two properties have made Φ29 DNA polymerase one of the main enzymes used in the current DNA amplification technologies. The determination of the structure of Φ29 TP revealed the existence of three domains: the priming domain, where the primer residue Ser232, as well as Phe230, involved in the determination of the initiating nucleotide, are located, the intermediate domain, involved in DNA polymerase binding, and the N-terminal domain, responsible for DNA binding

  16. Phosphorylated RPA recruits PALB2 to stalled DNA replication forks to facilitate fork recovery.

    Science.gov (United States)

    Murphy, Anar K; Fitzgerald, Michael; Ro, Teresa; Kim, Jee Hyun; Rabinowitsch, Ariana I; Chowdhury, Dipanjan; Schildkraut, Carl L; Borowiec, James A

    2014-08-18

    Phosphorylation of replication protein A (RPA) by Cdk2 and the checkpoint kinase ATR (ATM and Rad3 related) during replication fork stalling stabilizes the replisome, but how these modifications safeguard the fork is not understood. To address this question, we used single-molecule fiber analysis in cells expressing a phosphorylation-defective RPA2 subunit or lacking phosphatase activity toward RPA2. Deregulation of RPA phosphorylation reduced synthesis at forks both during replication stress and recovery from stress. The ability of phosphorylated RPA to stimulate fork recovery is mediated through the PALB2 tumor suppressor protein. RPA phosphorylation increased localization of PALB2 and BRCA2 to RPA-bound nuclear foci in cells experiencing replication stress. Phosphorylated RPA also stimulated recruitment of PALB2 to single-strand deoxyribonucleic acid (DNA) in a cell-free system. Expression of mutant RPA2 or loss of PALB2 expression led to significant DNA damage after replication stress, a defect accentuated by poly-ADP (adenosine diphosphate) ribose polymerase inhibitors. These data demonstrate that phosphorylated RPA recruits repair factors to stalled forks, thereby enhancing fork integrity during replication stress. © 2014 Murphy et al.

  17. Initiation of DNA replication: functional and evolutionary aspects

    Science.gov (United States)

    Bryant, John A.; Aves, Stephen J.

    2011-01-01

    Background The initiation of DNA replication is a very important and highly regulated step in the cell division cycle. It is of interest to compare different groups of eukaryotic organisms (a) to identify the essential molecular events that occur in all eukaryotes, (b) to start to identify higher-level regulatory mechanisms that are specific to particular groups and (c) to gain insights into the evolution of initiation mechanisms. Scope This review features a wide-ranging literature survey covering replication origins, origin recognition and usage, modification of origin usage (especially in response to plant hormones), assembly of the pre-replication complex, loading of the replisome, genomics, and the likely origin of these mechanisms and proteins in Archaea. Conclusions In all eukaryotes, chromatin is organized for DNA replication as multiple replicons. In each replicon, replication is initiated at an origin. With the exception of those in budding yeast, replication origins, including the only one to be isolated so far from a plant, do not appear to embody a specific sequence; rather, they are AT-rich, with short tracts of locally bent DNA. The proteins involved in initiation are remarkably similar across the range of eukaryotes. Nevertheless, their activity may be modified by plant-specific mechanisms, including regulation by plant hormones. The molecular features of initiation are seen in a much simpler form in the Archaea. In particular, where eukaryotes possess a number of closely related proteins that form ‘hetero-complexes’ (such as the origin recognition complex and the MCM complex), archaeans typically possess one type of protein (e.g. one MCM) that forms a homo-complex. This suggests that several eukaryotic initiation proteins have evolved from archaeal ancestors by gene duplication and divergence. PMID:21508040

  18. Evidence that DNA polymerase δ contributes to initiating leading strand DNA replication in Saccharomyces cerevisiae.

    Science.gov (United States)

    Garbacz, Marta A; Lujan, Scott A; Burkholder, Adam B; Cox, Phillip B; Wu, Qiuqin; Zhou, Zhi-Xiong; Haber, James E; Kunkel, Thomas A

    2018-02-27

    To investigate nuclear DNA replication enzymology in vivo, we have studied Saccharomyces cerevisiae strains containing a pol2-16 mutation that inactivates the catalytic activities of DNA polymerase ε (Pol ε). Although pol2-16 mutants survive, they present very tiny spore colonies, increased doubling time, larger than normal cells, aberrant nuclei, and rapid acquisition of suppressor mutations. These phenotypes reveal a severe growth defect that is distinct from that of strains that lack only Pol ε proofreading (pol2-4), consistent with the idea that Pol ε is the major leading-strand polymerase used for unstressed DNA replication. Ribonucleotides are incorporated into the pol2-16 genome in patterns consistent with leading-strand replication by Pol δ when Pol ε is absent. More importantly, ribonucleotide distributions at replication origins suggest that in strains encoding all three replicases, Pol δ contributes to initiation of leading-strand replication. We describe two possible models.

  19. Plasmid P1 replication: negative control by repeated DNA sequences.

    OpenAIRE

    Chattoraj, D; Cordes, K; Abeles, A

    1984-01-01

    The incompatibility locus, incA, of the unit-copy plasmid P1 is contained within a fragment that is essentially a set of nine 19-base-pair repeats. One or more copies of the fragment destabilizes the plasmid when present in trans. Here we show that extra copies of incA interfere with plasmid DNA replication and that a deletion of most of incA increases plasmid copy number. Thus, incA is not essential for replication but is required for its control. When cloned in a high-copy-number vector, pi...

  20. Formation and repair of DNA-protein cross-links (DPCs) in newly replicated DNA

    International Nuclear Information System (INIS)

    Chiu, S.; Friedman, L.R.; Oleinick, N.L.

    1987-01-01

    DPCs preferentially involve proteins of the nuclear matrix, the site of replication and transcription. To elucidate the relationship with replication, the formation and repair of DPCs has been studied in newly replicated DNA. Log-phase V79 cells were pulsed with /sup 3/H-TdR (10-20 μCi/ml) for 30-90 sec at 22 0 followed by up to a 60 min chase at 37 0 . Irradiation (0-100 Gy) immediately after the pulse increases the labeled DNA in DPCs with a dose-dependence that is unaffected by the initial level of labeled DPC or by chase time. When cells are irradiated before the pulse, DNA synthesis is inhibited; however, release of pulse-labeled DPCs appears normal. The data suggest that during replication, DNA is cross-linked to (matrix) protein, contributing to background DPCs

  1. Apoptosis-like yeast cell death in response to DNA damage and replication defects

    Energy Technology Data Exchange (ETDEWEB)

    Burhans, William C.; Weinberger, Martin; Marchetti, Maria A.; Ramachandran, Lakshmi; D' Urso, Gennaro; Huberman, Joel A

    2003-11-27

    In budding (Saccharomyces cerevisiae) and fission (Schizosaccharomyces pombe) yeast and other unicellular organisms, DNA damage and other stimuli can induce cell death resembling apoptosis in metazoans, including the activation of a recently discovered caspase-like molecule in budding yeast. Induction of apoptotic-like cell death in yeasts requires homologues of cell cycle checkpoint proteins that are often required for apoptosis in metazoan cells. Here, we summarize these findings and our unpublished results which show that an important component of metazoan apoptosis recently detected in budding yeast - reactive oxygen species (ROS) - can also be detected in fission yeast undergoing an apoptotic-like cell death. ROS were detected in fission and budding yeast cells bearing conditional mutations in genes encoding DNA replication initiation proteins and in fission yeast cells with mutations that deregulate cyclin-dependent kinases (CDKs). These mutations may cause DNA damage by permitting entry of cells into S phase with a reduced number of replication forks and/or passage through mitosis with incompletely replicated chromosomes. This may be relevant to the frequent requirement for elevated CDK activity in mammalian apoptosis, and to the recent discovery that the initiation protein Cdc6 is destroyed during apoptosis in mammals and in budding yeast cells exposed to lethal levels of DNA damage. Our data indicate that connections between apoptosis-like cell death and DNA replication or CDK activity are complex. Some apoptosis-like pathways require checkpoint proteins, others are inhibited by them, and others are independent of them. This complexity resembles that of apoptotic pathways in mammalian cells, which are frequently deregulated in cancer. The greater genetic tractability of yeasts should help to delineate these complex pathways and their relationships to cancer and to the effects of apoptosis-inducing drugs that inhibit DNA replication.

  2. Apoptosis-like yeast cell death in response to DNA damage and replication defects

    International Nuclear Information System (INIS)

    Burhans, William C.; Weinberger, Martin; Marchetti, Maria A.; Ramachandran, Lakshmi; D'Urso, Gennaro; Huberman, Joel A.

    2003-01-01

    In budding (Saccharomyces cerevisiae) and fission (Schizosaccharomyces pombe) yeast and other unicellular organisms, DNA damage and other stimuli can induce cell death resembling apoptosis in metazoans, including the activation of a recently discovered caspase-like molecule in budding yeast. Induction of apoptotic-like cell death in yeasts requires homologues of cell cycle checkpoint proteins that are often required for apoptosis in metazoan cells. Here, we summarize these findings and our unpublished results which show that an important component of metazoan apoptosis recently detected in budding yeast - reactive oxygen species (ROS) - can also be detected in fission yeast undergoing an apoptotic-like cell death. ROS were detected in fission and budding yeast cells bearing conditional mutations in genes encoding DNA replication initiation proteins and in fission yeast cells with mutations that deregulate cyclin-dependent kinases (CDKs). These mutations may cause DNA damage by permitting entry of cells into S phase with a reduced number of replication forks and/or passage through mitosis with incompletely replicated chromosomes. This may be relevant to the frequent requirement for elevated CDK activity in mammalian apoptosis, and to the recent discovery that the initiation protein Cdc6 is destroyed during apoptosis in mammals and in budding yeast cells exposed to lethal levels of DNA damage. Our data indicate that connections between apoptosis-like cell death and DNA replication or CDK activity are complex. Some apoptosis-like pathways require checkpoint proteins, others are inhibited by them, and others are independent of them. This complexity resembles that of apoptotic pathways in mammalian cells, which are frequently deregulated in cancer. The greater genetic tractability of yeasts should help to delineate these complex pathways and their relationships to cancer and to the effects of apoptosis-inducing drugs that inhibit DNA replication

  3. DNA replication stress: from molecular mechanisms to human disease.

    Science.gov (United States)

    Muñoz, Sergio; Méndez, Juan

    2017-02-01

    The genome of proliferating cells must be precisely duplicated in each cell division cycle. Chromosomal replication entails risks such as the possibility of introducing breaks and/or mutations in the genome. Hence, DNA replication requires the coordinated action of multiple proteins and regulatory factors, whose deregulation causes severe developmental diseases and predisposes to cancer. In recent years, the concept of "replicative stress" (RS) has attracted much attention as it impinges directly on genomic stability and offers a promising new avenue to design anticancer therapies. In this review, we summarize recent progress in three areas: (1) endogenous and exogenous factors that contribute to RS, (2) molecular mechanisms that mediate the cellular responses to RS, and (3) the large list of diseases that are directly or indirectly linked to RS.

  4. Studies on the effects of persistent RNA priming on DNA replication and genomic stability

    OpenAIRE

    Stuckey, Ruth

    2014-01-01

    [EN]: DNA replication and transcription take place on the same DNA template, and the correct interplay between these processes ensures faithful genome duplication. DNA replication must be highly coordinated with other cell cycle events, such as segregation of fully replicated DNA in order to maintain genomic integrity. Transcription generates RNA:DNA hybrids, transient intermediate structures that are degraded by the ribonuclease H (RNaseH) class of enzymes. RNA:DNA hybrids can form R-loops, ...

  5. Involvement of DNA gyrase in replication and transcription of bacteriophage T7 DNA

    International Nuclear Information System (INIS)

    De Wyngaert, M.A.; Hinkle, D.C.

    1979-01-01

    Growth of bacteriophage T7 is inhibited by the antibiotic coumermycin A 1 , an inhibitor of the Escherichia coli DNA gyrase. Since growth of the phage is insensitive to the antibiotic in strains containing a coumermycin-resistent DNA gyrase, this enzyme appears to be required for phage growth. We have investigated the effect of coumermycin on the kinetics of DNA, RNA, and protein synthesis during T7 infection. DNA synthesis is completely inhibited by the antibiotic. In addition, coumermycin significantly inhibits transcription of late but not early genes. Thus, E. coli DNA gyrase may play an important role in transcription as well as in replication of T7 DNA

  6. A Polycomb complex remains bound through DNA replication in the absence of other eukaryotic proteins

    KAUST Repository

    Lengsfeld, Bettina M.; Berry, Kayla N.; Ghosh, Sharmistha; Takahashi, Masateru; Francis, Nicole J.

    2012-01-01

    Propagation of chromatin states through DNA replication is central to epigenetic regulation and can involve recruitment of chromatin proteins to replicating chromatin through interactions with replication fork components. Here we show using a fully reconstituted T7 bacteriophage system that eukaryotic proteins are not required to tether the Polycomb complex PRC1 to templates during DNA replication. Instead, DNA binding by PRC1 can withstand passage of a simple replication fork.

  7. A Polycomb complex remains bound through DNA replication in the absence of other eukaryotic proteins

    KAUST Repository

    Lengsfeld, Bettina M.

    2012-09-17

    Propagation of chromatin states through DNA replication is central to epigenetic regulation and can involve recruitment of chromatin proteins to replicating chromatin through interactions with replication fork components. Here we show using a fully reconstituted T7 bacteriophage system that eukaryotic proteins are not required to tether the Polycomb complex PRC1 to templates during DNA replication. Instead, DNA binding by PRC1 can withstand passage of a simple replication fork.

  8. DNA-psoralen interaction: a single molecule experiment.

    Science.gov (United States)

    Rocha, M S; Viana, N B; Mesquita, O N

    2004-11-15

    By attaching one end of a single lambda-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the lambda-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particularly interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.

  9. The rolling-circle melting-pot model for porcine circovirus DNA replication

    Science.gov (United States)

    A stem-loop structure, formed by a pair of inverted repeats during DNA replication, is a conserved feature at the origin of DNA replication (Ori) among plant and animal viruses, bacteriophages and plasmids that replicate their genomes via the rolling-circle replication (RCR) mechanism. Porcine circo...

  10. Studies on the mechanism of replication of adenovirus DNA. IV. Discontinuous DNA chain propagation

    NARCIS (Netherlands)

    Vlak, J.M.; Rozijn, Th.H.; Sussenbach, J.S.

    The replication of adenovirus type 5 DNA occurs by discontinuous chain propagation via short pieces of DNA. These pieces accumulate if the infected cells are treated with hydroxyurea. They have a sedimentation coefficient of 11 S corresponding to a molecular weight of about 700,000, and they contain

  11. Diversity of DNA β, a satellite molecule associated with some monopartite begomoviruses

    International Nuclear Information System (INIS)

    Briddon, Rob W.; Bull, Simon E.; Amin, Imran; Idris, Ali M.; Mansoor, Shahid; Bedford, Ian D.; Dhawan, Poonam; Rishi, Narayan; Siwatch, Surender S.; Abdel-Salam, Aly M.; Brown, Judith K.; Zafar, Yusuf; Markham, Peter G.

    2003-01-01

    DNA β molecules are symptom-modulating, single-stranded DNA satellites associated with monopartite begomoviruses (family Geminiviridae). Such molecules have thus far been shown to be associated with Ageratum yellow vein virus from Singapore and Cotton leaf curl Multan virus from Pakistan. Here, 26 additional DNA β molecules, associated with diverse plant species obtained from different geographical locations, were cloned and sequenced. These molecules were shown to be widespread in the Old World, where monopartite begomoviruses are known to occur. Analysis of the sequences revealed a highly conserved organization for DNA β molecules consisting of a single conserved open reading frame, an adenine-rich region, and a region of high sequence conservation [the satellite conserved region (SCR)]. The SCR contains a potential hairpin structure with the loop sequence TAA/GTATTAC; similar to the origins of replication of geminiviruses and nanoviruses. Two major groups of DNA β satellites were resolved by phylogenetic analyses. One group originated from hosts within the Malvaceae and the second from a more diverse group of plants within the Solanaceae and Compositae. Within the two clusters, DNA β molecules showed relatedness based both on host and geographic origin. These findings strongly support coadaptation of DNA β molecules with their respective helper begomoviruses

  12. Histone Modification Associated with Initiation of DNA Replication | Center for Cancer Research

    Science.gov (United States)

    Before cells are able to divide, they must first duplicate their chromosomes accurately. DNA replication and packaging of DNA into chromosomes by histone proteins need to be coordinated by the cell to ensure proper transmission of genetic and epigenetic information to the next generation. Mammalian DNA replication begins at specific chromosomal sites, called replication

  13. Identification of genes involved in DNA replication of the Autographa californica baculovirus

    NARCIS (Netherlands)

    Kool, M.; Ahrens, C. H.; Goldbach, R. W.; Rohrmann, G. F.; Vlak, J. M.

    1994-01-01

    By use of a transient replication assay, nine genes involved in DNA replication were identified in the genome of the Autographa californica baculovirus. Six genes encoding helicase, DNA polymerase, IE-1, LEF-1, LEF-2, and LEF-3 are essential for DNA replication while three genes encoding P35, IE-2,

  14. A novel class of mutations that affect DNA replication in E. coli

    DEFF Research Database (Denmark)

    Nordman, Jared; Skovgaard, Ole; Wright, Andrew

    2007-01-01

    Over-initiation of DNA replication in cells containing the cold-sensitive dnaA(cos) allele has been shown to lead to extensive DNA damage, potentially due to head-to-tail replication fork collisions that ultimately lead to replication fork collapse, growth stasis and/or cell death. Based on the a...

  15. Fork rotation and DNA precatenation are restricted during DNA replication to prevent chromosomal instability.

    Science.gov (United States)

    Schalbetter, Stephanie A; Mansoubi, Sahar; Chambers, Anna L; Downs, Jessica A; Baxter, Jonathan

    2015-08-18

    Faithful genome duplication and inheritance require the complete resolution of all intertwines within the parental DNA duplex. This is achieved by topoisomerase action ahead of the replication fork or by fork rotation and subsequent resolution of the DNA precatenation formed. Although fork rotation predominates at replication termination, in vitro studies have suggested that it also occurs frequently during elongation. However, the factors that influence fork rotation and how rotation and precatenation may influence other replication-associated processes are unknown. Here we analyze the causes and consequences of fork rotation in budding yeast. We find that fork rotation and precatenation preferentially occur in contexts that inhibit topoisomerase action ahead of the fork, including stable protein-DNA fragile sites and termination. However, generally, fork rotation and precatenation are actively inhibited by Timeless/Tof1 and Tipin/Csm3. In the absence of Tof1/Timeless, excessive fork rotation and precatenation cause extensive DNA damage following DNA replication. With Tof1, damage related to precatenation is focused on the fragile protein-DNA sites where fork rotation is induced. We conclude that although fork rotation and precatenation facilitate unwinding in hard-to-replicate contexts, they intrinsically disrupt normal chromosome duplication and are therefore restricted by Timeless/Tipin.

  16. A journey through the microscopic ages of DNA replication.

    Science.gov (United States)

    Reinhart, Marius; Cardoso, M Cristina

    2017-05-01

    Scientific discoveries and technological advancements are inseparable but not always take place in a coherent chronological manner. In the next, we will provide a seemingly unconnected and serendipitous series of scientific facts that, in the whole, converged to unveil DNA and its duplication. We will not cover here the many and fundamental contributions from microbial genetics and in vitro biochemistry. Rather, in this journey, we will emphasize the interplay between microscopy development culminating on super resolution fluorescence microscopy (i.e., nanoscopy) and digital image analysis and its impact on our understanding of DNA duplication. We will interlace the journey with landmark concepts and experiments that have brought the cellular DNA replication field to its present state.

  17. Optimal control of gene mutation in DNA replication.

    Science.gov (United States)

    Yu, Juanyi; Li, Jr-Shin; Tarn, Tzyh-Jong

    2012-01-01

    We propose a molecular-level control system view of the gene mutations in DNA replication from the finite field concept. By treating DNA sequences as state variables, chemical mutagens and radiation as control inputs, one cell cycle as a step increment, and the measurements of the resulting DNA sequence as outputs, we derive system equations for both deterministic and stochastic discrete-time, finite-state systems of different scales. Defining the cost function as a summation of the costs of applying mutagens and the off-trajectory penalty, we solve the deterministic and stochastic optimal control problems by dynamic programming algorithm. In addition, given that the system is completely controllable, we find that the global optimum of both base-to-base and codon-to-codon deterministic mutations can always be achieved within a finite number of steps.

  18. Stwl modifies chromatin compaction and is required to maintain DNA integrity in the presence of perturbed DNA replication

    NARCIS (Netherlands)

    Yi, X.; Vries, de H.I.; Siudeja, K.; Rana, A.; Lemstra, W.; Brunsting, J.F.; Kok, R.J.M.; Smulders, Y.M.; Schaefer, M.; Dijk, F.; Shang, Y.F.; Eggen, B.J.L.; Kampinga, H.H.; Sibon, O.C.M.

    2009-01-01

    Hydroxyurea, a well-known DNA replication inhibitor, induces cell cycle arrest and intact checkpoint functions are required to survive DNA replication stress induced by this genotoxic agent. Perturbed DNA synthesis also results in elevated levels of DNA damage. It is unclear how organisms prevent

  19. Stwl Modifies Chromatin Compaction and Is Required to Maintain DNA Integrity in the Presence of Perturbed DNA Replication

    NARCIS (Netherlands)

    Yi, Xia; Vries, Hilda I. de; Siudeja, Katarzyna; Rana, Anil; Lemstra, Willy; Brunsting, Jeanette F.; Kok, Rob M.; Smulders, Yvo M.; Schaefer, Matthias; Dijk, Freark; Shang, Yongfeng; Eggen, Bart J.L.; Kampinga, Harm H.; Sibon, Ody C.M.

    Hydroxyurea, a well-known DNA replication inhibitor, induces cell cycle arrest and intact checkpoint functions are required to survive DNA replication stress induced by this genotoxic agent. Perturbed DNA synthesis also results in elevated levels of DNA damage. It is unclear how organisms prevent

  20. DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.

    Science.gov (United States)

    Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao

    2016-04-01

    RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.

  1. Extraction of ultrashort DNA molecules from herbarium specimens.

    Science.gov (United States)

    Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

    2017-02-01

    DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

  2. Varicella-zoster virus (VZV) origin of DNA replication oriS influences origin-dependent DNA replication and flanking gene transcription.

    Science.gov (United States)

    Khalil, Mohamed I; Sommer, Marvin H; Hay, John; Ruyechan, William T; Arvin, Ann M

    2015-07-01

    The VZV genome has two origins of DNA replication (oriS), each of which consists of an AT-rich sequence and three origin binding protein (OBP) sites called Box A, C and B. In these experiments, the mutation in the core sequence CGC of the Box A and C not only inhibited DNA replication but also inhibited both ORF62 and ORF63 expression in reporter gene assays. In contrast the Box B mutation did not influence DNA replication or flanking gene transcription. These results suggest that efficient DNA replication enhances ORF62 and ORF63 transcription. Recombinant viruses carrying these mutations in both sites and one with a deletion of the whole oriS were constructed. Surprisingly, the recombinant virus lacking both copies of oriS retained the capacity to replicate in melanoma and HELF cells suggesting that VZV has another origin of DNA replication. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. The logic of DNA replication in double-stranded DNA viruses: insights from global analysis of viral genomes.

    Science.gov (United States)

    Kazlauskas, Darius; Krupovic, Mart; Venclovas, Česlovas

    2016-06-02

    Genomic DNA replication is a complex process that involves multiple proteins. Cellular DNA replication systems are broadly classified into only two types, bacterial and archaeo-eukaryotic. In contrast, double-stranded (ds) DNA viruses feature a much broader diversity of DNA replication machineries. Viruses differ greatly in both completeness and composition of their sets of DNA replication proteins. In this study, we explored whether there are common patterns underlying this extreme diversity. We identified and analyzed all major functional groups of DNA replication proteins in all available proteomes of dsDNA viruses. Our results show that some proteins are common to viruses infecting all domains of life and likely represent components of the ancestral core set. These include B-family polymerases, SF3 helicases, archaeo-eukaryotic primases, clamps and clamp loaders of the archaeo-eukaryotic type, RNase H and ATP-dependent DNA ligases. We also discovered a clear correlation between genome size and self-sufficiency of viral DNA replication, the unanticipated dominance of replicative helicases and pervasive functional associations among certain groups of DNA replication proteins. Altogether, our results provide a comprehensive view on the diversity and evolution of replication systems in the DNA virome and uncover fundamental principles underlying the orchestration of viral DNA replication. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Single Molecule Scanning of DNA Radiation Oxidative Damage, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — This proposal will develop an assay to map genomic DNA, at the single molecule level and in a nanodevice, for oxidative DNA damage arising from radiation exposure;...

  5. Dpb11 may function with RPA and DNA to initiate DNA replication.

    Science.gov (United States)

    Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P; Kaplan, Daniel L

    2017-01-01

    Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation.

  6. SMC1-Mediated Intra-S-Phase Arrest Facilitates Bocavirus DNA Replication

    Science.gov (United States)

    Luo, Yong; Deng, Xuefeng; Cheng, Fang; Li, Yi

    2013-01-01

    Activation of a host DNA damage response (DDR) is essential for DNA replication of minute virus of canines (MVC), a member of the genus Bocavirus of the Parvoviridae family; however, the mechanism by which DDR contributes to viral DNA replication is unknown. In the current study, we demonstrate that MVC infection triggers the intra-S-phase arrest to slow down host cellular DNA replication and to recruit cellular DNA replication factors for viral DNA replication. The intra-S-phase arrest is regulated by ATM (ataxia telangiectasia-mutated kinase) signaling in a p53-independent manner. Moreover, we demonstrate that SMC1 (structural maintenance of chromosomes 1) is the key regulator of the intra-S-phase arrest induced during infection. Either knockdown of SMC1 or complementation with a dominant negative SMC1 mutant blocks both the intra-S-phase arrest and viral DNA replication. Finally, we show that the intra-S-phase arrest induced during MVC infection was caused neither by damaged host cellular DNA nor by viral proteins but by replicating viral genomes physically associated with the DNA damage sensor, the Mre11-Rad50-Nbs1 (MRN) complex. In conclusion, the feedback loop between MVC DNA replication and the intra-S-phase arrest is mediated by ATM-SMC1 signaling and plays a critical role in MVC DNA replication. Thus, our findings unravel the mechanism underlying DDR signaling-facilitated MVC DNA replication and demonstrate a novel strategy of DNA virus-host interaction. PMID:23365434

  7. Biophysics of DNA-Protein Interactions From Single Molecules to Biological Systems

    CERN Document Server

    Williams, Mark C

    2011-01-01

    This book presents a concise overview of current research on the biophysics of DNA-protein interactions. A wide range of new and classical methods are presented by authors investigating physical mechanisms by which proteins interact with DNA. For example, several chapters address the mechanisms by which proteins search for and recognize specific binding sites on DNA, a process critical for cellular function. Single molecule methods such as force spectroscopy as well as fluorescence imaging and tracking are described in these chapters as well as other parts of the book that address the dynamics of protein-DNA interactions. Other important topics include the mechanisms by which proteins engage DNA sequences and/or alter DNA structure. These simple but important model interactions are then placed in the broader biological context with discussion of larger protein-DNA complexes . Topics include replication forks, recombination complexes, DNA repair interactions, and ultimately, methods to understand the chromatin...

  8. Replicative DNA polymerase δ but not ε proofreads errors in Cis and in Trans.

    Directory of Open Access Journals (Sweden)

    Carrie L Flood

    2015-03-01

    Full Text Available It is now well established that in yeast, and likely most eukaryotic organisms, initial DNA replication of the leading strand is by DNA polymerase ε and of the lagging strand by DNA polymerase δ. However, the role of Pol δ in replication of the leading strand is uncertain. In this work, we use a reporter system in Saccharomyces cerevisiae to measure mutation rates at specific base pairs in order to determine the effect of heterozygous or homozygous proofreading-defective mutants of either Pol ε or Pol δ in diploid strains. We find that wild-type Pol ε molecules cannot proofread errors created by proofreading-defective Pol ε molecules, whereas Pol δ can not only proofread errors created by proofreading-defective Pol δ molecules, but can also proofread errors created by Pol ε-defective molecules. These results suggest that any interruption in DNA synthesis on the leading strand is likely to result in completion by Pol δ and also explain the higher mutation rates observed in Pol δ-proofreading mutants compared to Pol ε-proofreading defective mutants. For strains reverting via AT→GC, TA→GC, CG→AT, and GC→AT mutations, we find in addition a strong effect of gene orientation on mutation rate in proofreading-defective strains and demonstrate that much of this orientation dependence is due to differential efficiencies of mispair elongation. We also find that a 3'-terminal 8 oxoG, unlike a 3'-terminal G, is efficiently extended opposite an A and is not subject to proofreading. Proofreading mutations have been shown to result in tumor formation in both mice and humans; the results presented here can help explain the properties exhibited by those proofreading mutants.

  9. Adenovirus DNA replication in vitro is stimulated by RNA from uninfected HeLa cells

    NARCIS (Netherlands)

    Vliet, P.C. van der; Dam, D. van; Kwant, M.M.

    1984-01-01

    Adenovirus DNA replication was studied in a partially reconstituted system consisting of purified viral proteins (DNA-binding protein, precursor terminal protein and Ad DNA polymerase) and a nuclear extract from uninfected HeLa cells. Optimal DNA replication required the presence of a heat-stable,

  10. RPA binds histone H3-H4 and functions in DNA replication-coupled nucleosome assembly.

    Science.gov (United States)

    Liu, Shaofeng; Xu, Zhiyun; Leng, He; Zheng, Pu; Yang, Jiayi; Chen, Kaifu; Feng, Jianxun; Li, Qing

    2017-01-27

    DNA replication-coupled nucleosome assembly is essential to maintain genome integrity and retain epigenetic information. Multiple involved histone chaperones have been identified, but how nucleosome assembly is coupled to DNA replication remains elusive. Here we show that replication protein A (RPA), an essential replisome component that binds single-stranded DNA, has a role in replication-coupled nucleosome assembly. RPA directly binds free H3-H4. Assays using a synthetic sequence that mimics freshly unwound single-stranded DNA at replication fork showed that RPA promotes DNA-(H3-H4) complex formation immediately adjacent to double-stranded DNA. Further, an RPA mutant defective in H3-H4 binding exhibited attenuated nucleosome assembly on nascent chromatin. Thus, we propose that RPA functions as a platform for targeting histone deposition to replication fork, through which RPA couples nucleosome assembly with ongoing DNA replication. Copyright © 2017, American Association for the Advancement of Science.

  11. DNA damage tolerance pathway involving DNA polymerase ι and the tumor suppressor p53 regulates DNA replication fork progression.

    Science.gov (United States)

    Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa

    2016-07-26

    DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.

  12. DNA intercalator stimulates influenza transcription and virus replication

    Directory of Open Access Journals (Sweden)

    Poon Leo LM

    2011-03-01

    Full Text Available Abstract Influenza A virus uses its host transcription machinery to facilitate viral RNA synthesis, an event that is associated with cellular RNA polymerase II (RNAPII. In this study, various RNAPII transcription inhibitors were used to investigate the effect of RNAPII phosphorylation status on viral RNA transcription. A low concentration of DNA intercalators, such as actinomycin D (ActD, was found to stimulate viral polymerase activity and virus replication. This effect was not observed in cells treated with RNAPII kinase inhibitors. In addition, the loss of RNAPIIa in infected cells was due to the shift of nonphosphorylated RNAPII (RNAPIIa to hyperphosphorylated RNAPII (RNAPIIo.

  13. Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

    Science.gov (United States)

    Dimitrov, Valentin V.

    2009-01-01

    This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

  14. Escherichia coli DnaE Polymerase Couples Pyrophosphatase Activity to DNA Replication.

    Directory of Open Access Journals (Sweden)

    Fabio Lapenta

    Full Text Available DNA Polymerases generate pyrophosphate every time they catalyze a step of DNA elongation. This elongation reaction is generally believed as thermodynamically favoured by the hydrolysis of pyrophosphate, catalyzed by inorganic pyrophosphatases. However, the specific action of inorganic pyrophosphatases coupled to DNA replication in vivo was never demonstrated. Here we show that the Polymerase-Histidinol-Phosphatase (PHP domain of Escherichia coli DNA Polymerase III α subunit features pyrophosphatase activity. We also show that this activity is inhibited by fluoride, as commonly observed for inorganic pyrophosphatases, and we identified 3 amino acids of the PHP active site. Remarkably, E. coli cells expressing variants of these catalytic residues of α subunit feature aberrant phenotypes, poor viability, and are subject to high mutation frequencies. Our findings indicate that DNA Polymerases can couple DNA elongation and pyrophosphate hydrolysis, providing a mechanism for the control of DNA extension rate, and suggest a promising target for novel antibiotics.

  15. pUL34 binding near the human cytomegalovirus origin of lytic replication enhances DNA replication and viral growth.

    Science.gov (United States)

    Slayton, Mark; Hossain, Tanvir; Biegalke, Bonita J

    2018-05-01

    The human cytomegalovirus (HCMV) UL34 gene encodes sequence-specific DNA-binding proteins (pUL34) which are required for viral replication. Interactions of pUL34 with DNA binding sites represses transcription of two viral immune evasion genes, US3 and US9. 12 additional predicted pUL34-binding sites are present in the HCMV genome (strain AD169) with three binding sites concentrated near the HCMV origin of lytic replication (oriLyt). We used ChIP-seq analysis of pUL34-DNA interactions to confirm that pUL34 binds to the oriLyt region during infection. Mutagenesis of the UL34-binding sites in an oriLyt-containing plasmid significantly reduced viral-mediated oriLyt-dependent DNA replication. Mutagenesis of these sites in the HCMV genome reduced the replication efficiencies of the resulting viruses. Protein-protein interaction analyses demonstrated that pUL34 interacts with the viral proteins IE2, UL44, and UL84, that are essential for viral DNA replication, suggesting that pUL34-DNA interactions in the oriLyt region are involved in the DNA replication cascade. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. Inhibition of DNA replication, DNA repair synthesis, and DNA polymerases α and δ by butylphenyl deoxyguanosine triphosphate

    International Nuclear Information System (INIS)

    Dreslor, S.L.; Frattini, M.G.

    1987-01-01

    Semiconservative DNA replication in growing mammalian cells and ultraviolet (UV)-induced DNA repair synthesis in nongrowing mammalian cells are mediated by one or both of the aphidicolin-sensitive DNA polymerases, α and/or δ. They have studied the inhibition of replication and repair synthesis in permeable human cells by N 2 (p-n-butylphenyl)-2'-deoxyguanosine-5'-triphosphate (BuPh dGTP), an agent which inhibits polymerase α strongly and polymerase δ weakly. Both processes are inhibited by BuPh-dGTP in competition with dGTP. The K/sub i/'s are, for replication, 2-3 μM and, for repair synthesis, 3-4 μM, consistent with the involvement of the same DNA polymerase in both processes. Inhibition of isolated human polymerase α by BuPh-dGTP is also competitive with dGTP, but the K/sub i/ is approximately 10 nM, several hundred-fold lower than the K/sub i/'s of replication and repair synthesis. Isolated polymerase δ is inhibited by BuPh-dGTP at doses similar to those which inhibit replication and repair synthesis, however, attempts to determine the K/sub i/ of polymerase δ were hampered by the finding that the dependence of δ activity on deoxyribunucleotide concentration is parabolic at low doses. This behavior differs from the behavior of polymerase α and of cellular DNA replication and repair synthesis, all of which show a simple, hyperbolic relationship between activity and deoxyribonucleotide concentration. Thus, inhibition of DNA replication and UV induced DNA repair synthesis by BuPh dGTP is quantitatively similar to DNA polymerase δ, but some other characteristics of the cellular processes are more similar to those of polymerase α

  17. 3D replicon distributions arise from stochastic initiation and domino-like DNA replication progression.

    Science.gov (United States)

    Löb, D; Lengert, N; Chagin, V O; Reinhart, M; Casas-Delucchi, C S; Cardoso, M C; Drossel, B

    2016-04-07

    DNA replication dynamics in cells from higher eukaryotes follows very complex but highly efficient mechanisms. However, the principles behind initiation of potential replication origins and emergence of typical patterns of nuclear replication sites remain unclear. Here, we propose a comprehensive model of DNA replication in human cells that is based on stochastic, proximity-induced replication initiation. Critical model features are: spontaneous stochastic firing of individual origins in euchromatin and facultative heterochromatin, inhibition of firing at distances below the size of chromatin loops and a domino-like effect by which replication forks induce firing of nearby origins. The model reproduces the empirical temporal and chromatin-related properties of DNA replication in human cells. We advance the one-dimensional DNA replication model to a spatial model by taking into account chromatin folding in the nucleus, and we are able to reproduce the spatial and temporal characteristics of the replication foci distribution throughout S-phase.

  18. Mechanism of Error-Free DNA Replication Past Lucidin-Derived DNA Damage by Human DNA Polymerase κ.

    Science.gov (United States)

    Yockey, Oliver P; Jha, Vikash; Ghodke, Pratibha P; Xu, Tianzuo; Xu, Wenyan; Ling, Hong; Pradeepkumar, P I; Zhao, Linlin

    2017-11-20

    DNA damage impinges on genetic information flow and has significant implications in human disease and aging. Lucidin-3-O-primeveroside (LuP) is an anthraquinone derivative present in madder root, which has been used as a coloring agent and food additive. LuP can be metabolically converted to genotoxic compound lucidin, which subsequently forms lucidin-specific N 2 -2'-deoxyguanosine (N 2 -dG) and N 6 -2'-deoxyadenosine (N 6 -dA) DNA adducts. Lucidin is mutagenic and carcinogenic in rodents but has low carcinogenic risks in humans. To understand the molecular mechanism of low carcinogenicity of lucidin in humans, we performed DNA replication assays using site-specifically modified oligodeoxynucleotides containing a structural analogue (LdG) of lucidin-N 2 -dG DNA adduct and determined the crystal structures of DNA polymerase (pol) κ in complex with LdG-bearing DNA and an incoming nucleotide. We examined four human pols (pol η, pol ι, pol κ, and Rev1) in their efficiency and accuracy during DNA replication with LdG; these pols are key players in translesion DNA synthesis. Our results demonstrate that pol κ efficiently and accurately replicates past the LdG adduct, whereas DNA replication by pol η, pol ι is compromised to different extents. Rev1 retains its ability to incorporate dCTP opposite the lesion albeit with decreased efficiency. Two ternary crystal structures of pol κ illustrate that the LdG adduct is accommodated by pol κ at the enzyme active site during insertion and postlesion-extension steps. The unique open active site of pol κ allows the adducted DNA to adopt a standard B-form for accurate DNA replication. Collectively, these biochemical and structural data provide mechanistic insights into the low carcinogenic risk of lucidin in humans.

  19. An Mcm10 Mutant Defective in ssDNA Binding Shows Defects in DNA Replication Initiation.

    Science.gov (United States)

    Perez-Arnaiz, Patricia; Kaplan, Daniel L

    2016-11-20

    Mcm10 is an essential protein that functions to initiate DNA replication after the formation of the replication fork helicase. In this manuscript, we identified a budding yeast Mcm10 mutant (Mcm10-m2,3,4) that is defective in DNA binding in vitro. Moreover, this Mcm10-m2,3,4 mutant does not stimulate the phosphorylation of Mcm2 by Dbf4-dependent kinase (DDK) in vitro. When we expressed wild-type levels of mcm10-m2,3,4 in budding yeast cells, we observed a severe growth defect and a substantially decreased DNA replication. We also observed a substantially reduced replication protein A- chromatin immunoprecipitation signal at origins of replication, reduced levels of DDK-phosphorylated Mcm2, and diminished Go, Ichi, Ni, and San (GINS) association with Mcm2-7 in vivo. mcm5-bob1 bypasses the growth defect conferred by DDK-phosphodead Mcm2 in budding yeast. However, the growth defect observed by expressing mcm10-m2,3,4 is not bypassed by the mcm5-bob1 mutation. Furthermore, origin melting and GINS association with Mcm2-7 are substantially decreased for cells expressing mcm10-m2,3,4 in the mcm5-bob1 background. Thus, the origin melting and GINS-Mcm2-7 interaction defects we observed for mcm10-m2,3,4 are not explained by decreased Mcm2 phosphorylation by DDK, since the defects persist in an mcm5-bob1 background. These data suggest that DNA binding by Mcm10 is essential for the initiation of DNA replication. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. The cellular Mre11 protein interferes with adenovirus E4 mutant DNA replication

    International Nuclear Information System (INIS)

    Mathew, Shomita S.; Bridge, Eileen

    2007-01-01

    Adenovirus type 5 (Ad5) relocalizes and degrades the host DNA repair protein Mre11, and efficiently initiates viral DNA replication. Mre11 associates with Ad E4 mutant DNA replication centers and is important for concatenating viral genomes. We have investigated the role of Mre11 in the E4 mutant DNA replication defect. RNAi-mediated knockdown of Mre11 dramatically rescues E4 mutant DNA replication in cells that do or do not concatenate viral genomes, suggesting that Mre11 inhibits DNA replication independent of genome concatenation. The mediator of DNA damage checkpoint 1 (Mdc1) protein is involved in recruiting and sustaining Mre11 at sites of DNA damage following ionizing radiation. We observe foci formation by Mdc1 in response to viral infection, indicating that this damage response protein is activated. However, knockdown of Mdc1 does not prevent Mre11 from localizing at viral DNA replication foci or rescue E4 mutant DNA replication. Our results are consistent with a model in which Mre11 interferes with DNA replication when it is localized at viral DNA replication foci

  1. Elg1 forms an alternative RFC complex important for DNA replication and genome integrity

    NARCIS (Netherlands)

    Bellaoui, Mohammed; Chang, Michael; Ou, Jiongwen; Xu, Hong; Boone, Charles; Brown, Grant W

    2003-01-01

    Genome-wide synthetic genetic interaction screens with mutants in the mus81 and mms4 replication fork-processing genes identified a novel replication factor C (RFC) homolog, Elg1, which forms an alternative RFC complex with Rfc2-5. This complex is distinct from the DNA replication RFC, the DNA

  2. Characterization of the adenoassociated virus Rep protein complex formed on the viral origin of DNA replication

    International Nuclear Information System (INIS)

    Li Zengi; Brister, J. Rodney; Im, Dong-Soo; Muzyczka, Nicholas

    2003-01-01

    Interaction between the adenoassociated virus (AAV) replication proteins, Rep68 and 78, and the viral terminal repeats (TRs) is mediated by a DNA sequence termed the Rep-binding element (RBE). This element is necessary for Rep-mediated unwinding of duplex DNA substrates, directs Rep catalyzed cleavage of the AAV origin of DNA replication, and is required for viral transcription and proviral integration. Six discrete Rep complexes with the AAV TR substrates have been observed in vitro, and cross-linking studies suggest these complexes contain one to six molecules of Rep. However, the functional relationship between Rep oligomerization and biochemical activity is unclear. Here we have characterized Rep complexes that form on the AAV TR. Both Rep68 and Rep78 appear to form the same six complexes with the AAV TR, and ATP seems to stimulate formation of specific, higher order complexes. When the sizes of these Rep complexes were estimated on native polyacrylamide gels, the four slower migrating complexes were larger than predicted by an amount equivalent to one or two TRs. To resolve this discrepancy, the molar ratio of protein and DNA was calculated for the three largest complexes. Data from these experiments indicated that the larger complexes included multiple TRs in addition to multiple Rep molecules and that the Rep-to-TR ratio was approximately 2. The two largest complexes were also associated with increased Rep-mediated, origin cleavage activity. Finally, we characterized a second, Rep-mediated cleavage event that occurs adjacent to the normal nicking site, but on the opposite strand. This second site nicking event effectively results in double-stranded DNA cleavage at the normal nicking site

  3. Quantifying DNA melting transitions using single-molecule force spectroscopy

    International Nuclear Information System (INIS)

    Calderon, Christopher P; Chen, W-H; Harris, Nolan C; Kiang, C-H; Lin, K-J

    2009-01-01

    We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

  4. Quantifying DNA melting transitions using single-molecule force spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Calderon, Christopher P [Department of Computational and Applied Mathematics, Rice University, Houston, TX (United States); Chen, W-H; Harris, Nolan C; Kiang, C-H [Department of Physics and Astronomy, Rice University, Houston, TX (United States); Lin, K-J [Department of Chemistry, National Chung Hsing University, Taichung, Taiwan (China)], E-mail: chkiang@rice.edu

    2009-01-21

    We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

  5. Regulation of DNA replication in irradiated cells by trans-acting factors

    International Nuclear Information System (INIS)

    Wang, Y.; Huq, M.S.; Cheng, X.; Iliakis, G.

    1995-01-01

    We compared DNA replication activity in cytoplasmic extracts prepared from irradiated and nonirradiated HeLa cells using a simian virus 40 (SV40)-based in vitro replication assay. The assay measures semi-conservative DNA replication in a plasmid carrying the SV40 origin of replication and requires SV40 T antigen as the sole noncellular protein. The plasmid DNA used in the replication reaction is never exposed to radiation. We find that replication of plasmid DNA is significantly reduced when cytoplasmic extracts from irradiated cells are used. Since plasmid replication proceeds to completion in extracts from irradiated cells, the observed reduction in the overall replication activity is probably due to a reduction in the efficiency of initiation events. The degree of inhibition of DNA replication after exposure to 10, 30 and 50 Gy X rays as measured in vitro using this assay is similar to that measured in intact cells immediately before processing for extract preparation. These observations are compatible with the induction or activation by ionizing radiation of a factor(s) that inhibits in trans DNA replication. The results contribute to our understanding of the mechanism(s) developed by the cells to regulate DNA replication when exposed to clastogenic agents. Such processes may be of significance in the restoration of DNA integrity, and may define yet another checkpoint operating during S at the level of clusters of replicons. 26 refs., 4 figs

  6. Partial Purification of a Megadalton DNA Replication Complex by Free Flow Electrophoresis.

    Directory of Open Access Journals (Sweden)

    Caroline M Li

    Full Text Available We describe a gentle and rapid method to purify the intact multiprotein DNA replication complex using free flow electrophoresis (FFE. In particular, we applied FFE to purify the human cell DNA synthesome, which is a multiprotein complex that is fully competent to carry-out all phases of the DNA replication process in vitro using a plasmid containing the simian virus 40 (SV40 origin of DNA replication and the viral large tumor antigen (T-antigen protein. The isolated native DNA synthesome can be of use in studying the mechanism by which mammalian DNA replication is carried-out and how anti-cancer drugs disrupt the DNA replication or repair process. Partially purified extracts from HeLa cells were fractionated in a native, liquid based separation by FFE. Dot blot analysis showed co-elution of many proteins identified as part of the DNA synthesome, including proliferating cell nuclear antigen (PCNA, DNA topoisomerase I (topo I, DNA polymerase δ (Pol δ, DNA polymerase ɛ (Pol ɛ, replication protein A (RPA and replication factor C (RFC. Previously identified DNA synthesome proteins co-eluted with T-antigen dependent and SV40 origin-specific DNA polymerase activity at the same FFE fractions. Native gels show a multiprotein PCNA containing complex migrating with an apparent relative mobility in the megadalton range. When PCNA containing bands were excised from the native gel, mass spectrometric sequencing analysis identified 23 known DNA synthesome associated proteins or protein subunits.

  7. Partial Purification of a Megadalton DNA Replication Complex by Free Flow Electrophoresis.

    Science.gov (United States)

    Li, Caroline M; Miao, Yunan; Lingeman, Robert G; Hickey, Robert J; Malkas, Linda H

    2016-01-01

    We describe a gentle and rapid method to purify the intact multiprotein DNA replication complex using free flow electrophoresis (FFE). In particular, we applied FFE to purify the human cell DNA synthesome, which is a multiprotein complex that is fully competent to carry-out all phases of the DNA replication process in vitro using a plasmid containing the simian virus 40 (SV40) origin of DNA replication and the viral large tumor antigen (T-antigen) protein. The isolated native DNA synthesome can be of use in studying the mechanism by which mammalian DNA replication is carried-out and how anti-cancer drugs disrupt the DNA replication or repair process. Partially purified extracts from HeLa cells were fractionated in a native, liquid based separation by FFE. Dot blot analysis showed co-elution of many proteins identified as part of the DNA synthesome, including proliferating cell nuclear antigen (PCNA), DNA topoisomerase I (topo I), DNA polymerase δ (Pol δ), DNA polymerase ɛ (Pol ɛ), replication protein A (RPA) and replication factor C (RFC). Previously identified DNA synthesome proteins co-eluted with T-antigen dependent and SV40 origin-specific DNA polymerase activity at the same FFE fractions. Native gels show a multiprotein PCNA containing complex migrating with an apparent relative mobility in the megadalton range. When PCNA containing bands were excised from the native gel, mass spectrometric sequencing analysis identified 23 known DNA synthesome associated proteins or protein subunits.

  8. Autonomous replication of plasmids bearing monkey DNA origin-enriched sequences

    International Nuclear Information System (INIS)

    Frappier, L.; Zannis-Hadjopoulos, M.

    1987-01-01

    Twelve clones of origin-enriched sequences (ORS) isolated from early replicating monkey (CV-1) DNA were examined for transient episomal replication in transfected CV-1, COS-7, and HeLa cells. Plasmid DNA was isolated at time intervals after transfection and screened by the Dpn I resistance assay or by the bromodeoxyuridine substitution assay to differentiate between input and replicated DNA. The authors have identified four monkey ORS (ORS3, -8, -9, and -12) that can support plasmid replication in mammalian cells. This replication is carried out in a controlled and semiconservative manner characteristic of mammalian replicons. ORS replication was most efficient in HeLa cells. Electron microscopy showed ORS8 and ORS12 plasmids of the correct size with replication bubbles. Using a unique restriction site in ORS12, we have mapped the replication bubble within the monkey DNA sequence

  9. USP7/HAUSP: A SUMO deubiquitinase at the heart of DNA replication.

    Science.gov (United States)

    Smits, Veronique A J; Freire, Raimundo

    2016-09-01

    DNA replication is both highly conserved and controlled. Problematic DNA replication can lead to genomic instability and therefore carcinogenesis. Numerous mechanisms work together to achieve this tight control and increasing evidence suggests that post-translational modifications (phosphorylation, ubiquitination, SUMOylation) of DNA replication proteins play a pivotal role in this process. Here we discuss such modifications in the light of a recent article that describes a novel role for the deubiquitinase (DUB) USP7/HAUSP in the control of DNA replication. USP7 achieves this function by an unusual and novel mechanism, namely deubiquitination of SUMOylated proteins at the replication fork, making USP7 also a SUMO DUB (SDUB). This work extends previous observations of increased levels of SUMO and low levels of ubiquitin at the on-going replication fork. Here, we discuss this novel study, its contribution to the DNA replication and genomic stability field and what questions arise from this work. © 2016 WILEY Periodicals, Inc.

  10. DNA replication in ultraviolet light irradiated Chinese hamster cells: the nature of replicon inhibition and post-replication repair

    International Nuclear Information System (INIS)

    Doniger, J.

    1978-01-01

    DNA replication in ultraviolet light irradiated Chinese hamster cells was studied using techniques of DNA fiber autoradiography and alkaline sucrose sedimentation. Bidirectionally growing replicons were observed in the autoradiograms independent of the irradiation conditions. After a dose of 5 J/m 2 at 254 nm the rate of fork progression was the same as in unirradiated cells, while the rate of replication was reduced by 50%. After a dose of 10J/m 2 the rate of fork progression was reduced 40%, while the replication rate was only 25% of normal. Therefore, at low doses of ultraviolet light irradiation, the inhibition of DNA replication is due to reduction in the number of functioning replicons, while at higher doses the rate of fork progression is also slowed. Those replicons which no longer function after irradiation are blocked in fork movement rather than replicon initiation. After irradiation, pulse label was first incorporated into short nascent strands, the average size of which was approximately equal to the distance between pyrimidine dimers. Under conditions where post-replication repair occurs these short strands were eventually joined into larger pieces. Finally, the data show that slowing post-replication repair with caffeine does not slow fork movement. The results presented here support the post-replication repair model of 'gapped synthesis' and rule out a major role for 'replicative bypass'. (author)

  11. Single-molecule chemical reactions on DNA origami

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther; Tørring, Thomas; Rotaru, Alexandru

    2010-01-01

    as templates for building materials with new functional properties. Relatively large nanocomponents such as nanoparticles and biomolecules can also be integrated into DNA nanostructures and imaged. Here, we show that chemical reactions with single molecules can be performed and imaged at a local position...... on a DNA origami scaffold by atomic force microscopy. The high yields and chemoselectivities of successive cleavage and bond-forming reactions observed in these experiments demonstrate the feasibility of post-assembly chemical modification of DNA nanostructures and their potential use as locally......DNA nanotechnology and particularly DNA origami, in which long, single-stranded DNA molecules are folded into predetermined shapes, can be used to form complex self-assembled nanostructures. Although DNA itself has limited chemical, optical or electronic functionality, DNA nanostructures can serve...

  12. Replication stalling by catalytically impaired Twinkle induces mitochondrial DNA rearrangements in cultured cells

    NARCIS (Netherlands)

    Pohjoismaki, J.L.; Goffart, S.; Spelbrink, J.N.

    2011-01-01

    Pathological mitochondrial DNA (mtDNA) rearrangements have been proposed to result from repair of double-strand breaks caused by blockage of mitochondrial DNA (mtDNA) replication. As mtDNA deletions are seen only in post-mitotic tissues, it has been suggested that they are selected out in actively

  13. Mechanisms Governing DDK Regulation of the Initiation of DNA Replication

    Directory of Open Access Journals (Sweden)

    Larasati

    2016-12-01

    Full Text Available The budding yeast Dbf4-dependent kinase (DDK complex—comprised of cell division cycle (Cdc7 kinase and its regulatory subunit dumbbell former 4 (Dbf4—is required to trigger the initiation of DNA replication through the phosphorylation of multiple minichromosome maintenance complex subunits 2-7 (Mcm2-7. DDK is also a target of the radiation sensitive 53 (Rad53 checkpoint kinase in response to replication stress. Numerous investigations have determined mechanistic details, including the regions of Mcm2, Mcm4, and Mcm6 phosphorylated by DDK, and a number of DDK docking sites. Similarly, the way in which the Rad53 forkhead-associated 1 (FHA1 domain binds to DDK—involving both canonical and non-canonical interactions—has been elucidated. Recent work has revealed mutual promotion of DDK and synthetic lethal with dpb11-1 3 (Sld3 roles. While DDK phosphorylation of Mcm2-7 subunits facilitates their interaction with Sld3 at origins, Sld3 in turn stimulates DDK phosphorylation of Mcm2. Details of a mutually antagonistic relationship between DDK and Rap1-interacting factor 1 (Rif1 have also recently come to light. While Rif1 is able to reverse DDK-mediated Mcm2-7 complex phosphorylation by targeting the protein phosphatase glycogen 7 (Glc7 to origins, there is evidence to suggest that DDK can counteract this activity by binding to and phosphorylating Rif1.

  14. DNA transformations of Candida tropicalis with replicating and integrative vectors.

    Science.gov (United States)

    Sanglard, D; Fiechter, A

    1992-12-01

    The alkane-assimilating yeast Candida tropicalis was used as a host for DNA transformations. A stable ade2 mutant (Ha900) obtained by UV-mutagenesis was used as a recipient for different vectors carrying selectable markers. A first vector, pMK16, that was developed for the transformation of C. albicans and carries an ADE2 gene marker and a Candida autonomously replicating sequence (CARS) element promoting autonomous replication, was compatible for transforming Ha900. Two transformant types were observed: (i) pink transformants which easily lose pMK16 under non-selective growth conditions; (ii) white transformants, in which the same plasmid exhibited a higher mitotic stability. In both cases pMK16 could be rescued from these cells in Escherichia coli. A second vector, pADE2, containing the isolated C. tropicalis ADE2, gene, was used to transform Ha900. This vector integrated in the yeast genome at homologous sites of the ade2 locus. Different integration types were observed at one or both ade2 alleles in single or in tandem repeats.

  15. DNA replication error-induced extinction of diploid yeast.

    Science.gov (United States)

    Herr, Alan J; Kennedy, Scott R; Knowels, Gary M; Schultz, Eric M; Preston, Bradley D

    2014-03-01

    Genetic defects in DNA polymerase accuracy, proofreading, or mismatch repair (MMR) induce mutator phenotypes that accelerate adaptation of microbes and tumor cells. Certain combinations of mutator alleles synergistically increase mutation rates to levels that drive extinction of haploid cells. The maximum tolerated mutation rate of diploid cells is unknown. Here, we define the threshold for replication error-induced extinction (EEX) of diploid Saccharomyces cerevisiae. Double-mutant pol3 alleles that carry mutations for defective DNA polymerase-δ proofreading (pol3-01) and accuracy (pol3-L612M or pol3-L612G) induce strong mutator phenotypes in heterozygous diploids (POL3/pol3-01,L612M or POL3/pol3-01,L612G). Both pol3-01,L612M and pol3-01,L612G alleles are lethal in the homozygous state; cells with pol3-01,L612M divide up to 10 times before arresting at random stages in the cell cycle. Antimutator eex mutations in the pol3 alleles suppress this lethality (pol3-01,L612M,eex or pol3-01,L612G,eex). MMR defects synergize with pol3-01,L612M,eex and pol3-01,L612G,eex alleles, increasing mutation rates and impairing growth. Conversely, inactivation of the Dun1 S-phase checkpoint kinase suppresses strong pol3-01,L612M,eex and pol3-01,L612G,eex mutator phenotypes as well as the lethal pol3-01,L612M phenotype. Our results reveal that the lethal error threshold in diploids is 10 times higher than in haploids and likely determined by homozygous inactivation of essential genes. Pronounced loss of fitness occurs at mutation rates well below the lethal threshold, suggesting that mutator-driven cancers may be susceptible to drugs that exacerbate replication errors.

  16. GEMC1 is a TopBP1-interacting protein required for chromosomal DNA replication.

    Science.gov (United States)

    Balestrini, Alessia; Cosentino, Claudia; Errico, Alessia; Garner, Elizabeth; Costanzo, Vincenzo

    2010-05-01

    Many of the factors required for chromosomal DNA replication have been identified in unicellular eukaryotes. However, DNA replication is poorly understood in multicellular organisms. Here, we report the identification of GEMC1 (geminin coiled-coil containing protein 1), a novel vertebrate protein required for chromosomal DNA replication. GEMC1 is highly conserved in vertebrates and is preferentially expressed in proliferating cells. Using Xenopus laevis egg extract we show that Xenopus GEMC1 (xGEMC1) binds to the checkpoint and replication factor TopBP1, which promotes binding of xGEMC1 to chromatin during pre-replication complex (pre-RC) formation. We demonstrate that xGEMC1 interacts directly with replication factors such as Cdc45 and the kinase Cdk2-CyclinE, through which it is heavily phosphorylated. Phosphorylated xGEMC1 stimulates initiation of DNA replication, whereas depletion of xGEMC1 prevents the onset of DNA replication owing to the impairment of Cdc45 loading onto chromatin. Similarly, inhibition of GEMC1 expression with morpholino and siRNA oligos prevents DNA replication in embryonic and somatic vertebrate cells. These data suggest that GEMC1 promotes initiation of chromosomal DNA replication in multicellular organisms by mediating TopBP1- and Cdk2-dependent recruitment of Cdc45 onto replication origins.

  17. GEMC1 is a TopBP1 interacting protein required for chromosomal DNA replication

    Science.gov (United States)

    Balestrini, Alessia; Cosentino, Claudia; Errico, Alessia; Garner, Elizabeth; Costanzo, Vincenzo

    2010-01-01

    Many factors required for chromosomal DNA replication have been identified in unicellular eukaryotes. However, DNA replication in complex multicellular organisms is poorly understood. Here, we report the identification of GEMC1, a novel vertebrate protein required for chromosomal DNA replication. GEMC1 is highly conserved in vertebrates and is preferentially expressed in proliferating cells. Using Xenopus egg extract we show that Xenopus GEMC1 (xGEMC1) binds to checkpoint and replication factor TopBP1, which promotes xGEMC1 binding to chromatin during pre-replication complex (pre-RC) formation. We demonstrate that xGEMC1 directly interacts with replication factors such as Cdc45 and Cdk2-CyclinE by which it is heavily phosphorylated. Phosphorylated xGEMC1 stimulates initiation of DNA replication whereas depletion of xGEMC1 prevents DNA replication onset due to impairment of Cdc45 loading onto chromatin. Likewise, inhibition of GEMC1 expression by morpholino and siRNA oligos prevents DNA replication in embryonic and somatic vertebrate cells. These data suggest that GEMC1 promotes initiation of chromosomal DNA replication in higher eukaryotes by mediating TopBP1 and Cdk2 dependent recruitment of Cdc45 onto replication origins. PMID:20383140

  18. DNA analysis by single molecule stretching in nanofluidic biochips

    DEFF Research Database (Denmark)

    Abad, E.; Juarros, A.; Retolaza, A.

    2011-01-01

    Imprint Lithography (NIL) technology combined with a conventional anodic bonding of the silicon base and Pyrex cover. Using this chip, we have performed single molecule imaging on a bench-top fluorescent microscope system. Lambda phage DNA was used as a model sample to characterize the chip. Single molecules of λ-DNA......Stretching single DNA molecules by confinement in nanofluidic channels has attracted a great interest during the last few years as a DNA analysis tool. We have designed and fabricated a sealed micro/nanofluidic device for DNA stretching applications, based on the use of the high throughput Nano...... stained with the fluorescent dye YOYO-1 were stretched in the nanochannel array and the experimental results were analysed to determine the extension factor of the DNA in the chip and the geometrical average of the nanochannel inner diameter. The determination of the extension ratio of the chip provides...

  19. Role of exonucleolytic processing and polymerase-DNA association in bypass of lesions during replication in vitro. Significance for SOS-targeted mutagenesis

    International Nuclear Information System (INIS)

    Shwartz, H.; Shavitt, O.; Livneh, Z.

    1988-01-01

    The role of exonuclease activity in trans-lesion DNA replication with Escherichia coli DNA polymerase III holoenzyme was investigated. RecA protein inhibited the 3'----5' exonuclease activity of the polymerase 2-fold when assayed in the absence of replication and had no effect on turnover of dNTPs into dNMPs. In contrast, single-stranded DNA-binding protein, which had no effect on the exonuclease activity in the absence of replication, showed a pronounced 7-fold suppression of the 3'----5' exonuclease activity during replication. The excision of incorporated dNMP alpha S residues from DNA by the 3'----5' exonuclease activity of DNA polymerase III holoenzyme was inhibited 10-20-fold; still no increase in bypass of pyrimidine photodimers was observed. Thus, in agreement with our previous results in which the exonuclease activity was inhibited at the protein level, inhibition at the DNA level also did not increase bypass of photodimers. Fractionation of the replication mixture after termination of DNA synthesis on a Bio-Gel A-5m column under conditions which favor polymerase-DNA binding yielded a termination complex which could perform turnover of dNTPs into dNMPs. Adding challenge-primed single-stranded DNA to the complex yielded a burst of DNA synthesis which was promoted most likely by DNA polymerase III holoenzyme molecules transferred from the termination complex to the challenge DNA thus demonstrating the instability of the polymerase-DNA association. Addition of a fresh sample of DNA polymerase III holoenzyme to purified termination products, which consist primarily of partially replicated molecules with nascent chains terminated at UV lesions, did not result in any net DNA synthesis as expected

  20. Analysis of JC virus DNA replication using a quantitative and high-throughput assay

    International Nuclear Information System (INIS)

    Shin, Jong; Phelan, Paul J.; Chhum, Panharith; Bashkenova, Nazym; Yim, Sung; Parker, Robert; Gagnon, David; Gjoerup, Ole; Archambault, Jacques; Bullock, Peter A.

    2014-01-01

    Progressive Multifocal Leukoencephalopathy (PML) is caused by lytic replication of JC virus (JCV) in specific cells of the central nervous system. Like other polyomaviruses, JCV encodes a large T-antigen helicase needed for replication of the viral DNA. Here, we report the development of a luciferase-based, quantitative and high-throughput assay of JCV DNA replication in C33A cells, which, unlike the glial cell lines Hs 683 and U87, accumulate high levels of nuclear T-ag needed for robust replication. Using this assay, we investigated the requirement for different domains of T-ag, and for specific sequences within and flanking the viral origin, in JCV DNA replication. Beyond providing validation of the assay, these studies revealed an important stimulatory role of the transcription factor NF1 in JCV DNA replication. Finally, we show that the assay can be used for inhibitor testing, highlighting its value for the identification of antiviral drugs targeting JCV DNA replication. - Highlights: • Development of a high-throughput screening assay for JCV DNA replication using C33A cells. • Evidence that T-ag fails to accumulate in the nuclei of established glioma cell lines. • Evidence that NF-1 directly promotes JCV DNA replication in C33A cells. • Proof-of-concept that the HTS assay can be used to identify pharmacological inhibitor of JCV DNA replication

  1. Analysis of JC virus DNA replication using a quantitative and high-throughput assay

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Jong; Phelan, Paul J.; Chhum, Panharith; Bashkenova, Nazym; Yim, Sung; Parker, Robert [Department of Developmental, Molecular and Chemical Biology, Tufts University School of Medicine, Boston, MA 02111 (United States); Gagnon, David [Institut de Recherches Cliniques de Montreal (IRCM), 110 Pine Avenue West, Montreal, Quebec, Canada H2W 1R7 (Canada); Department of Biochemistry and Molecular Medicine, Université de Montréal, Montréal, Quebec (Canada); Gjoerup, Ole [Molecular Oncology Research Institute, Tufts Medical Center, Boston, MA 02111 (United States); Archambault, Jacques [Institut de Recherches Cliniques de Montreal (IRCM), 110 Pine Avenue West, Montreal, Quebec, Canada H2W 1R7 (Canada); Department of Biochemistry and Molecular Medicine, Université de Montréal, Montréal, Quebec (Canada); Bullock, Peter A., E-mail: Peter.Bullock@tufts.edu [Department of Developmental, Molecular and Chemical Biology, Tufts University School of Medicine, Boston, MA 02111 (United States)

    2014-11-15

    Progressive Multifocal Leukoencephalopathy (PML) is caused by lytic replication of JC virus (JCV) in specific cells of the central nervous system. Like other polyomaviruses, JCV encodes a large T-antigen helicase needed for replication of the viral DNA. Here, we report the development of a luciferase-based, quantitative and high-throughput assay of JCV DNA replication in C33A cells, which, unlike the glial cell lines Hs 683 and U87, accumulate high levels of nuclear T-ag needed for robust replication. Using this assay, we investigated the requirement for different domains of T-ag, and for specific sequences within and flanking the viral origin, in JCV DNA replication. Beyond providing validation of the assay, these studies revealed an important stimulatory role of the transcription factor NF1 in JCV DNA replication. Finally, we show that the assay can be used for inhibitor testing, highlighting its value for the identification of antiviral drugs targeting JCV DNA replication. - Highlights: • Development of a high-throughput screening assay for JCV DNA replication using C33A cells. • Evidence that T-ag fails to accumulate in the nuclei of established glioma cell lines. • Evidence that NF-1 directly promotes JCV DNA replication in C33A cells. • Proof-of-concept that the HTS assay can be used to identify pharmacological inhibitor of JCV DNA replication.

  2. Reactivation of DNA replication of the parvovirus MVM in UV preirradiated mouse cells

    Energy Technology Data Exchange (ETDEWEB)

    Vos, J.M.; Rommelaere, J. (Universite Libre de Bruxelles, Rhode-St-Genese (Belgium))

    1982-07-01

    The parvovirus Minute-Virus-of-Mice (MVM) was used to probe the DNA replication activities expressed by mouse fibroblasts. This system allowed us to study quantitatively the effect of UV-induced DNA lesions on the progression of DNA replication in vivo. MVM was UV-irradiated prior to infection. Pyrimidine dimers induced in the viral genome account for the reduced level of intracellular viral DNA synthesis, assuming that most of these lesions block viral DNA replication in unirradiated cells. The inhibition of damaged MVM DNA synthesis is less severe if the host cells themselves are irradiated prior to virus infection. This stimulation of viral DNA replication in pretreated cells might account for the UV-enhanced viral reactivation phenomenon, i.e. the increased survival of nuclear-replicating viruses propagated in cells preexposed to various genotoxic agents.

  3. Reactivation of DNA replication of the parvovirus MVM in UV preirradiated mouse cells

    International Nuclear Information System (INIS)

    Vos, J.M.; Rommelaere, Jean

    1982-01-01

    The parvovirus Minute-Virus-of-Mice (MVM) was used to probe the DNA replication activities expressed by mouse fibroblasts. This system allowed us to study quantitatively the effect of UV-induced DNA lesions on the progression of DNA replication in vivo. MVM was UV-irradiated prior to infection. Pyrimidine dimers induced in the viral genome account for the reduced level of intracellular viral DNA synthesis, assuming that most of these lesions block viral DNA replication in unirradiated cells. The inhibition of damaged MVM DNA synthesis is less severe if the host cells themselves are irradiated prior to virus infection. This stimulation of viral DNA replication in pretreated cells might account for the UV-enhanced viral reactivation phenomenon, i.e. the increased survival of nuclear-replicating viruses propagated in cells preexposed to various genotoxic agents [fr

  4. Ancient mtDNA genetic variants modulate mtDNA transcription and replication.

    Directory of Open Access Journals (Sweden)

    Sarit Suissa

    2009-05-01

    Full Text Available Although the functional consequences of mitochondrial DNA (mtDNA genetic backgrounds (haplotypes, haplogroups have been demonstrated by both disease association studies and cell culture experiments, it is not clear which of the mutations within the haplogroup carry functional implications and which are "evolutionary silent hitchhikers". We set forth to study the functionality of haplogroup-defining mutations within the mtDNA transcription/replication regulatory region by in vitro transcription, hypothesizing that haplogroup-defining mutations occurring within regulatory motifs of mtDNA could affect these processes. We thus screened >2500 complete human mtDNAs representing all major populations worldwide for natural variation in experimentally established protein binding sites and regulatory regions comprising a total of 241 bp in each mtDNA. Our screen revealed 77/241 sites showing point mutations that could be divided into non-fixed (57/77, 74% and haplogroup/sub-haplogroup-defining changes (i.e., population fixed changes, 20/77, 26%. The variant defining Caucasian haplogroup J (C295T increased the binding of TFAM (Electro Mobility Shift Assay and the capacity of in vitro L-strand transcription, especially of a shorter transcript that maps immediately upstream of conserved sequence block 1 (CSB1, a region associated with RNA priming of mtDNA replication. Consistent with this finding, cybrids (i.e., cells sharing the same nuclear genetic background but differing in their mtDNA backgrounds harboring haplogroup J mtDNA had a >2 fold increase in mtDNA copy number, as compared to cybrids containing haplogroup H, with no apparent differences in steady state levels of mtDNA-encoded transcripts. Hence, a haplogroup J regulatory region mutation affects mtDNA replication or stability, which may partially account for the phenotypic impact of this haplogroup. Our analysis thus demonstrates, for the first time, the functional impact of particular mtDNA

  5. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos

    2015-09-01

    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  6. A Molecular Toolbox to Engineer Site-Specific DNA Replication Perturbation.

    Science.gov (United States)

    Larsen, Nicolai B; Hickson, Ian D; Mankouri, Hocine W

    2018-01-01

    Site-specific arrest of DNA replication is a useful tool for analyzing cellular responses to DNA replication perturbation. The E. coli Tus-Ter replication barrier can be reconstituted in eukaryotic cells as a system to engineer an unscheduled collision between a replication fork and an "alien" impediment to DNA replication. To further develop this system as a versatile tool, we describe a set of reagents and a detailed protocol that can be used to engineer Tus-Ter barriers into any locus in the budding yeast genome. Because the Tus-Ter complex is a bipartite system with intrinsic DNA replication-blocking activity, the reagents and protocols developed and validated in yeast could also be optimized to engineer site-specific replication fork barriers into other eukaryotic cell types.

  7. Repair of DNA in replicated and unreplicated portions of the human genome

    International Nuclear Information System (INIS)

    Waters, R.

    1979-01-01

    Portions of the human genome that have replicated after ultraviolet light irradiation and those that remain unreplicated have both been examined for the distribution of pyrimidine dimers and the extent of repair replication following their removal. The data indicate that the number of unrepaired dimers and the extent of repair replication seen after their excision are equal in the replicated and unreplicated DNA. Furthermore, the daughter strand of replicated DNA is larger than the average interdimer distance found in the parental strand. Hence, DNA replication in normal human fibroblasts is clearly capable of getting past pyrimidine dimers, and a preferential repair of such lesions in DNA that is about to be or has been replicated does not operate to any visible extent in these cells. (author)

  8. A Molecular Toolbox to Engineer Site-Specific DNA Replication Perturbation

    DEFF Research Database (Denmark)

    Larsen, Nicolai B; Hickson, Ian D; Mankouri, Hocine W

    2018-01-01

    " impediment to DNA replication. To further develop this system as a versatile tool, we describe a set of reagents and a detailed protocol that can be used to engineer Tus-Ter barriers into any locus in the budding yeast genome. Because the Tus-Ter complex is a bipartite system with intrinsic DNA replication......Site-specific arrest of DNA replication is a useful tool for analyzing cellular responses to DNA replication perturbation. The E. coli Tus-Ter replication barrier can be reconstituted in eukaryotic cells as a system to engineer an unscheduled collision between a replication fork and an "alien......-blocking activity, the reagents and protocols developed and validated in yeast could also be optimized to engineer site-specific replication fork barriers into other eukaryotic cell types....

  9. Deciphering DNA replication dynamics in eukaryotic cell populations in relation with their averaged chromatin conformations

    Science.gov (United States)

    Goldar, A.; Arneodo, A.; Audit, B.; Argoul, F.; Rappailles, A.; Guilbaud, G.; Petryk, N.; Kahli, M.; Hyrien, O.

    2016-03-01

    We propose a non-local model of DNA replication that takes into account the observed uncertainty on the position and time of replication initiation in eukaryote cell populations. By picturing replication initiation as a two-state system and considering all possible transition configurations, and by taking into account the chromatin’s fractal dimension, we derive an analytical expression for the rate of replication initiation. This model predicts with no free parameter the temporal profiles of initiation rate, replication fork density and fraction of replicated DNA, in quantitative agreement with corresponding experimental data from both S. cerevisiae and human cells and provides a quantitative estimate of initiation site redundancy. This study shows that, to a large extent, the program that regulates the dynamics of eukaryotic DNA replication is a collective phenomenon that emerges from the stochastic nature of replication origins initiation.

  10. Distinct functions of human RecQ helicases during DNA replication.

    Science.gov (United States)

    Urban, Vaclav; Dobrovolna, Jana; Janscak, Pavel

    2017-06-01

    DNA replication is the most vulnerable process of DNA metabolism in proliferating cells and therefore it is tightly controlled and coordinated with processes that maintain genomic stability. Human RecQ helicases are among the most important factors involved in the maintenance of replication fork integrity, especially under conditions of replication stress. RecQ helicases promote recovery of replication forks being stalled due to different replication roadblocks of either exogenous or endogenous source. They prevent generation of aberrant replication fork structures and replication fork collapse, and are involved in proper checkpoint signaling. The essential role of human RecQ helicases in the genome maintenance during DNA replication is underlined by association of defects in their function with cancer predisposition. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Strand-Specific Analysis of DNA Synthesis and Proteins Association with DNA Replication Forks in Budding Yeast.

    Science.gov (United States)

    Yu, Chuanhe; Gan, Haiyun; Zhang, Zhiguo

    2018-01-01

    DNA replication initiates at DNA replication origins after unwinding of double-strand DNA(dsDNA) by replicative helicase to generate single-stranded DNA (ssDNA) templates for the continuous synthesis of leading-strand and the discontinuous synthesis of lagging-strand. Therefore, methods capable of detecting strand-specific information will likely yield insight into the association of proteins at leading and lagging strand of DNA replication forks and the regulation of leading and lagging strand synthesis during DNA replication. The enrichment and Sequencing of Protein-Associated Nascent DNA (eSPAN), which measure the relative amounts of proteins at nascent leading and lagging strands of DNA replication forks, is a step-wise procedure involving the chromatin immunoprecipitation (ChIP) of a protein of interest followed by the enrichment of protein-associated nascent DNA through BrdU immunoprecipitation. The isolated ssDNA is then subjected to strand-specific sequencing. This method can detect whether a protein is enriched at leading or lagging strand of DNA replication forks. In addition to eSPAN, two other strand-specific methods, (ChIP-ssSeq), which detects potential protein-ssDNA binding and BrdU-IP-ssSeq, which can measure synthesis of both leading and lagging strand, were developed along the way. These methods can provide strand-specific and complementary information about the association of the target protein with DNA replication forks as well as synthesis of leading and lagging strands genome wide. Below, we describe the detailed eSPAN, ChIP-ssSeq, and BrdU-IP-ssSeq protocols.

  12. DNA Copy-Number Control through Inhibition of Replication Fork Progression

    Directory of Open Access Journals (Sweden)

    Jared T. Nordman

    2014-11-01

    Full Text Available Proper control of DNA replication is essential to ensure faithful transmission of genetic material and prevent chromosomal aberrations that can drive cancer progression and developmental disorders. DNA replication is regulated primarily at the level of initiation and is under strict cell-cycle regulation. Importantly, DNA replication is highly influenced by developmental cues. In Drosophila, specific regions of the genome are repressed for DNA replication during differentiation by the SNF2 domain-containing protein SUUR through an unknown mechanism. We demonstrate that SUUR is recruited to active replication forks and mediates the repression of DNA replication by directly inhibiting replication fork progression instead of functioning as a replication fork barrier. Mass spectrometry identification of SUUR-associated proteins identified the replicative helicase member CDC45 as a SUUR-associated protein, supporting a role for SUUR directly at replication forks. Our results reveal that control of eukaryotic DNA copy number can occur through the inhibition of replication fork progression.

  13. Human FEN1 Expression and Solubility Patterson in DNA Replication and Repair

    National Research Council Canada - National Science Library

    Carrier, Richard

    1999-01-01

    Flap endo-/exonuclease (FEN1) is a highly conserved protein shown to be one of 10 essential human proteins required for the production of form I DNA following DNA replication from the simian virus 40 (SV40...

  14. How to read and write mechanical information in DNA molecules

    Science.gov (United States)

    Schiessel, Helmut

    In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.

  15. Isolation of proteins involved in the replication of adenoviral DNA in vitro

    International Nuclear Information System (INIS)

    Lichy, J.H.; Nagata, K.; Friefeld, B.R.; Enomoto, T.; Field, J.; Guggenheimer, R.A.; Ikeda, J.E.; Horwitz, M.S.; Hurwitz, J.

    1983-01-01

    The simple mechanism of replication of adenoviral DNA has made adenovirus an especially useful model system for studies of eukaryotic replication mechanisms. The availability of this in vitro system that replicates exogenously added Ad DNA-pro has made it possible to characterize the factors involved in replication. The results presented in this paper summarize our further fractionation of the in vitro system. First, the properties of two factors purified from the uninfected nuclear extract are described. Second, the separation of the pTP/Ad Pol complex into subunits and the properties of the isolated subunits are presented. The 140K protein is shown to possess the Ad DNA polymerase activity. The results suggest that the only DNA polymerase required for adenoviral DNA replication in vitro is the 140K Ad DNA polymerase and that this enzyme is probably a viral gene product. 50 references, 10 figures, 3 tables

  16. Fidelity of DNA Replication in Normal and Malignant Human Breast Cells.

    Science.gov (United States)

    1997-08-01

    enzyme) into the multiple cloning site (MCS). This template will not only replicate inside a mammalian cell (utilizing the E-B virus origin), and...Maniatis, T. Commonly used techniques in molecular cloning . In: Molecular cloning : REFERENCES a laboratory manual, 2nd edition. Cold Spring Harbor...A vatit"Y Of DNA synthesis and the typt of DNA replica~tion Products " celular prca including DNA rsplicatlon. DNA repsair. R~NA formed in experiments

  17. RADX interacts with single-stranded DNA to promote replication fork stability

    DEFF Research Database (Denmark)

    Schubert, Lisa; Ho, Teresa; Hoffmann, Saskia

    2017-01-01

    Single-stranded DNA (ssDNA) regions form as an intermediate in many DNA-associated transactions. Multiple cellular proteins interact with ssDNA via the oligonucleotide/oligosaccharide-binding (OB) fold domain. The heterotrimeric, multi-OB fold domain-containing Replication Protein A (RPA) complex...... ssDNA-binding activities is critical for avoiding these defects. Our findings establish RADX as an important component of cellular pathways that promote DNA replication integrity under basal and stressful conditions by means of multiple ssDNA-binding proteins....

  18. Multiple regulatory systems coordinate DNA replication with cell growth in Bacillus subtilis.

    Directory of Open Access Journals (Sweden)

    Heath Murray

    2014-10-01

    Full Text Available In many bacteria the rate of DNA replication is linked with cellular physiology to ensure that genome duplication is coordinated with growth. Nutrient-mediated growth rate control of DNA replication initiation has been appreciated for decades, however the mechanism(s that connects these cell cycle activities has eluded understanding. In order to help address this fundamental question we have investigated regulation of DNA replication in the model organism Bacillus subtilis. Contrary to the prevailing view we find that changes in DnaA protein level are not sufficient to account for nutrient-mediated growth rate control of DNA replication initiation, although this regulation does require both DnaA and the endogenous replication origin. We go on to report connections between DNA replication and several essential cellular activities required for rapid bacterial growth, including respiration, central carbon metabolism, fatty acid synthesis, phospholipid synthesis, and protein synthesis. Unexpectedly, the results indicate that multiple regulatory systems are involved in coordinating DNA replication with cell physiology, with some of the regulatory systems targeting oriC while others act in a oriC-independent manner. We propose that distinct regulatory systems are utilized to control DNA replication in response to diverse physiological and chemical changes.

  19. Multiple regulatory systems coordinate DNA replication with cell growth in Bacillus subtilis.

    Science.gov (United States)

    Murray, Heath; Koh, Alan

    2014-10-01

    In many bacteria the rate of DNA replication is linked with cellular physiology to ensure that genome duplication is coordinated with growth. Nutrient-mediated growth rate control of DNA replication initiation has been appreciated for decades, however the mechanism(s) that connects these cell cycle activities has eluded understanding. In order to help address this fundamental question we have investigated regulation of DNA replication in the model organism Bacillus subtilis. Contrary to the prevailing view we find that changes in DnaA protein level are not sufficient to account for nutrient-mediated growth rate control of DNA replication initiation, although this regulation does require both DnaA and the endogenous replication origin. We go on to report connections between DNA replication and several essential cellular activities required for rapid bacterial growth, including respiration, central carbon metabolism, fatty acid synthesis, phospholipid synthesis, and protein synthesis. Unexpectedly, the results indicate that multiple regulatory systems are involved in coordinating DNA replication with cell physiology, with some of the regulatory systems targeting oriC while others act in a oriC-independent manner. We propose that distinct regulatory systems are utilized to control DNA replication in response to diverse physiological and chemical changes.

  20. Multiple Regulatory Systems Coordinate DNA Replication with Cell Growth in Bacillus subtilis

    Science.gov (United States)

    Murray, Heath; Koh, Alan

    2014-01-01

    In many bacteria the rate of DNA replication is linked with cellular physiology to ensure that genome duplication is coordinated with growth. Nutrient-mediated growth rate control of DNA replication initiation has been appreciated for decades, however the mechanism(s) that connects these cell cycle activities has eluded understanding. In order to help address this fundamental question we have investigated regulation of DNA replication in the model organism Bacillus subtilis. Contrary to the prevailing view we find that changes in DnaA protein level are not sufficient to account for nutrient-mediated growth rate control of DNA replication initiation, although this regulation does require both DnaA and the endogenous replication origin. We go on to report connections between DNA replication and several essential cellular activities required for rapid bacterial growth, including respiration, central carbon metabolism, fatty acid synthesis, phospholipid synthesis, and protein synthesis. Unexpectedly, the results indicate that multiple regulatory systems are involved in coordinating DNA replication with cell physiology, with some of the regulatory systems targeting oriC while others act in a oriC-independent manner. We propose that distinct regulatory systems are utilized to control DNA replication in response to diverse physiological and chemical changes. PMID:25340815

  1. Hda inactivation of DnaA is the predominant mechanism preventing hyperinitiation of Escherichia coli DNA replication.

    Science.gov (United States)

    Camara, Johanna E; Breier, Adam M; Brendler, Therese; Austin, Stuart; Cozzarelli, Nicholas R; Crooke, Elliott

    2005-08-01

    Initiation of DNA replication from the Escherichia coli chromosomal origin is highly regulated, assuring that replication occurs precisely once per cell cycle. Three mechanisms for regulation of replication initiation have been proposed: titration of free DnaA initiator protein by the datA locus, sequestration of newly replicated origins by SeqA protein and regulatory inactivation of DnaA (RIDA), in which active ATP-DnaA is converted to the inactive ADP-bound form. DNA microarray analyses showed that the level of initiation in rapidly growing cells that lack datA was indistinguishable from that in wild-type cells, and that the absence of SeqA protein caused only a modest increase in initiation, in agreement with flow-cytometry data. In contrast, cells lacking Hda overinitiated replication twofold, implicating RIDA as the predominant mechanism preventing extra initiation events in a cell cycle.

  2. A single molecule DNA flow stretching microscope for undergraduates

    NARCIS (Netherlands)

    Williams, Kelly; Grafe, Brendan; Burke, Kathryn M.; Tanner, Nathan; van Oijen, Antoine M.; Loparo, Joseph; Price, Allen C.

    2011-01-01

    The design of a simple, safe, and inexpensive single molecule flow stretching instrument is presented. The instrument uses a low cost upright microscope coupled to a webcam for imaging single DNA molecules that are tethered in an easy to construct microfluidic flow cell. The system requires no

  3. DNA Damage Reduces the Quality, but Not the Quantity of Human Papillomavirus 16 E1 and E2 DNA Replication

    Directory of Open Access Journals (Sweden)

    Molly L. Bristol

    2016-06-01

    Full Text Available Human papillomaviruses (HPVs are causative agents in almost all cervical carcinomas. HPVs are also causative agents in head and neck cancer, the cases of which are increasing rapidly. Viral replication activates the DNA damage response (DDR pathway; associated proteins are recruited to replication foci, and this pathway may serve to allow for viral genome amplification. Likewise, HPV genome double-strand breaks (DSBs could be produced during replication and could lead to linearization and viral integration. Many studies have shown that viral integration into the host genome results in unregulated expression of the viral oncogenes, E6 and E7, promoting HPV-induced carcinogenesis. Previously, we have demonstrated that DNA-damaging agents, such as etoposide, or knocking down viral replication partner proteins, such as topoisomerase II β binding protein I (TopBP1, does not reduce the level of DNA replication. Here, we investigated whether these treatments alter the quality of DNA replication by HPV16 E1 and E2. We confirm that knockdown of TopBP1 or treatment with etoposide does not reduce total levels of E1/E2-mediated DNA replication; however, the quality of replication is significantly reduced. The results demonstrate that E1 and E2 continue to replicate under genomically-stressed conditions and that this replication is mutagenic. This mutagenesis would promote the formation of substrates for integration of the viral genome into that of the host, a hallmark of cervical cancer.

  4. DNA Damage Reduces the Quality, but Not the Quantity of Human Papillomavirus 16 E1 and E2 DNA Replication.

    Science.gov (United States)

    Bristol, Molly L; Wang, Xu; Smith, Nathan W; Son, Minkyeong P; Evans, Michael R; Morgan, Iain M

    2016-06-22

    Human papillomaviruses (HPVs) are causative agents in almost all cervical carcinomas. HPVs are also causative agents in head and neck cancer, the cases of which are increasing rapidly. Viral replication activates the DNA damage response (DDR) pathway; associated proteins are recruited to replication foci, and this pathway may serve to allow for viral genome amplification. Likewise, HPV genome double-strand breaks (DSBs) could be produced during replication and could lead to linearization and viral integration. Many studies have shown that viral integration into the host genome results in unregulated expression of the viral oncogenes, E6 and E7, promoting HPV-induced carcinogenesis. Previously, we have demonstrated that DNA-damaging agents, such as etoposide, or knocking down viral replication partner proteins, such as topoisomerase II β binding protein I (TopBP1), does not reduce the level of DNA replication. Here, we investigated whether these treatments alter the quality of DNA replication by HPV16 E1 and E2. We confirm that knockdown of TopBP1 or treatment with etoposide does not reduce total levels of E1/E2-mediated DNA replication; however, the quality of replication is significantly reduced. The results demonstrate that E1 and E2 continue to replicate under genomically-stressed conditions and that this replication is mutagenic. This mutagenesis would promote the formation of substrates for integration of the viral genome into that of the host, a hallmark of cervical cancer.

  5. Automation of a single-DNA molecule stretching device

    DEFF Research Database (Denmark)

    Sørensen, Kristian Tølbøl; Lopacinska, Joanna M.; Tommerup, Niels

    2015-01-01

    We automate the manipulation of genomic-length DNA in a nanofluidic device based on real-time analysis of fluorescence images. In our protocol, individual molecules are picked from a microchannel and stretched with pN forces using pressure driven flows. The millimeter-long DNA fragments free...

  6. DNA molecules and human therapeutics | Danquah | African Journal ...

    African Journals Online (AJOL)

    Nucleic acid molecules are championing a new generation of reverse engineered biopharmaceuticals. In terms of potential application in gene medicine, plasmid DNA (pDNA) vectors have exceptional therapeutic and immunological profiles as they are free from safety concerns associated with viral vectors, display ...

  7. Knockdown of RMI1 impairs DNA repair under DNA replication stress.

    Science.gov (United States)

    Xu, Chang; Fang, Lianying; Kong, Yangyang; Xiao, Changyan; Yang, Mengmeng; Du, Li-Qing; Liu, Qiang

    2017-12-09

    RMI1 (RecQ-mediated genome instability protein 1) forms a conserved BTR complex with BLM, Topo IIIα, and RMI2, and its absence causes genome instability. It has been revealed that RMI1 localizes to nuclear foci with BLM and Topo IIIα in response to replication stress, and that RMI1 functions downstream of BLM in promoting replication elongation. However, the precise functions of RMI1 during replication stress are not completely understood. Here we report that RMI1 knockdown cells are hypersensitive to hydroxyurea (HU). Using comet assay, we show that RMI1 knockdown cells exhibit accumulation of broken DNAs after being released from HU treatment. Moreover, we demonstrate that RMI1 facilitates the recovery from activated checkpoint and resuming the cell cycle after replicative stress. Surprisingly, loss of RMI1 results in a failure of RAD51 loading onto DNA damage sites. These findings reveal the importance of RMI1 in response to replication stress, which could explain the molecular basis for its function in maintaining genome integrity. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Deciphering DNA replication dynamics in eukaryotic cell populations in relation with their averaged chromatin conformations

    DEFF Research Database (Denmark)

    Goldar, A.; Arneodo, A.; Audit, B.

    2016-01-01

    , and by taking into account the chromatin's fractal dimension, we derive an analytical expression for the rate of replication initiation. This model predicts with no free parameter the temporal profiles of initiation rate, replication fork density and fraction of replicated DNA, in quantitative agreement...

  9. Inhibition of in vitro SV40 DNA replication by ultraviolet light

    International Nuclear Information System (INIS)

    Gough, G.; Wood, R.W.

    1989-01-01

    Ultraviolet light-induced DNA damage was found to inhibit SV40 origin-dependent DNA synthesis carried out by soluble humancell extracts. Replication of SV40-based plasmids was reduced to approx. 35% of that in unirradiated controls after irradiation with 50-100 J/m 2 germicidal ultraviolet light, where an average of 3-6 pyrimidine dimer photoproducts were formed per plasmid circle. Inhibition of the DNA helicase activity of T antigen (required for initiation of replication in the in vitro system) was also investigated, and was only significant after much higher fluences, 1000-5000 J/m 2 . The data indicate that DNA damage by ultraviolet light inhibits DNA synthesis in cell-free extracts principally by affecting components of the replication complex other than the DNA helicase activity of T antigen. The soluble system could be used to biochemically investigate the possible bypass or tolerance of DNA damage during replication (author). 21 refs.; 2 figs

  10. Replication-mediated disassociation of replication protein A-XPA complex upon DNA damage: implications for RPA handing off.

    Science.gov (United States)

    Jiang, Gaofeng; Zou, Yue; Wu, Xiaoming

    2012-08-01

    RPA (replication protein A), the eukaryotic ssDNA (single-stranded DNA)-binding protein, participates in most cellular processes in response to genotoxic insults, such as NER (nucleotide excision repair), DNA, DSB (double-strand break) repair and activation of cell cycle checkpoint signalling. RPA interacts with XPA (xeroderma pigmentosum A) and functions in early stage of NER. We have shown that in cells the RPA-XPA complex disassociated upon exposure of cells to high dose of UV irradiation. The dissociation required replication stress and was partially attributed to tRPA hyperphosphorylation. Treatment of cells with CPT (camptothecin) and HU (hydroxyurea), which cause DSB DNA damage and replication fork collapse respectively and also leads to the disruption of RPA-XPA complex. Purified RPA and XPA were unable to form complex in vitro in the presence of ssDNA. We propose that the competition-based RPA switch among different DNA metabolic pathways regulates the dissociation of RPA with XPA in cells after DNA damage. The biological significances of RPA-XPA complex disruption in relation with checkpoint activation, DSB repair and RPA hyperphosphorylation are discussed.

  11. Replication-mediated disassociation of replication protein A–XPA complex upon DNA damage: implications for RPA handing off

    Science.gov (United States)

    Jiang, Gaofeng; Zou, Yue; Wu, Xiaoming

    2013-01-01

    RPA (replication protein A), the eukaryotic ssDNA (single-stranded DNA)-binding protein, participates in most cellular processes in response to genotoxic insults, such as NER (nucleotide excision repair), DNA, DSB (double-strand break) repair and activation of cell cycle checkpoint signalling. RPA interacts with XPA (xeroderma pigmentosum A) and functions in early stage of NER. We have shown that in cells the RPA–XPA complex disassociated upon exposure of cells to high dose of UV irradiation. The dissociation required replication stress and was partially attributed to tRPA hyperphosphorylation. Treatment of cells with CPT (camptothecin) and HU (hydroxyurea), which cause DSB DNA damage and replication fork collapse respectively and also leads to the disruption of RPA–XPA complex. Purified RPA and XPA were unable to form complex in vitro in the presence of ssDNA. We propose that the competition-based RPA switch among different DNA metabolic pathways regulates the dissociation of RPA with XPA in cells after DNA damage. The biological significances of RPA–XPA complex disruption in relation with checkpoint activation, DSB repair and RPA hyperphosphorylation are discussed. PMID:22578086

  12. Genomic mapping of single-stranded DNA in hydroxyurea-challenged yeasts identifies origins of replication.

    Science.gov (United States)

    Feng, Wenyi; Collingwood, David; Boeck, Max E; Fox, Lindsay A; Alvino, Gina M; Fangman, Walton L; Raghuraman, Mosur K; Brewer, Bonita J

    2006-02-01

    During DNA replication one or both strands transiently become single stranded: first at the sites where initiation of DNA synthesis occurs (known as origins of replication) and subsequently on the lagging strands of replication forks as discontinuous Okazaki fragments are generated. We report a genome-wide analysis of single-stranded DNA (ssDNA) formation in the presence of hydroxyurea during DNA replication in wild-type and checkpoint-deficient rad53 Saccharomyces cerevisiae cells. In wild-type cells, ssDNA was first observed at a subset of replication origins and later 'migrated' bi-directionally, suggesting that ssDNA formation is associated with continuously moving replication forks. In rad53 cells, ssDNA was observed at virtually every known origin, but remained there over time, suggesting that replication forks stall. Telomeric regions seemed to be particularly sensitive to the loss of Rad53 checkpoint function. Replication origins in Schizosaccharomyces pombe were also mapped using our method.

  13. Two subunits of human ORC are dispensable for DNA replication and proliferation.

    Science.gov (United States)

    Shibata, Etsuko; Kiran, Manjari; Shibata, Yoshiyuki; Singh, Samarendra; Kiran, Shashi; Dutta, Anindya

    2016-12-01

    The six-subunit Origin Recognition Complex (ORC) is believed to be an essential eukaryotic ATPase that binds to origins of replication as a ring-shaped heterohexamer to load MCM2-7 and initiate DNA replication. We have discovered that human cell lines in culture proliferate with intact chromosomal origins of replication after disruption of both alleles of ORC2 or of the ATPase subunit, ORC1 . The ORC1 or ORC2 -depleted cells replicate with decreased chromatin loading of MCM2-7 and become critically dependent on another ATPase, CDC6, for survival and DNA replication. Thus, either the ORC ring lacking a subunit, even its ATPase subunit, can load enough MCM2-7 in partnership with CDC6 to initiate DNA replication, or cells have an ORC-independent, CDC6-dependent mechanism to load MCM2-7 on origins of replication.

  14. Checkpoint independence of most DNA replication origins in fission yeast

    OpenAIRE

    Mickle, Katie L; Ramanathan, Sunita; Rosebrock, Adam; Oliva, Anna; Chaudari, Amna; Yompakdee, Chulee; Scott, Donna; Leatherwood, Janet; Huberman, Joel A

    2007-01-01

    Abstract Background In budding yeast, the replication checkpoint slows progress through S phase by inhibiting replication origin firing. In mammals, the replication checkpoint inhibits both origin firing and replication fork movement. To find out which strategy is employed in the fission yeast, Schizosaccharomyces pombe, we used microarrays to investigate the use of origins by wild-type and checkpoint-mutant strains in the presence of hydroxyurea (HU), which limits the pool of deoxyribonucleo...

  15. The actin-like MreB cytoskeleton organizes viral DNA replication in bacteria.

    Science.gov (United States)

    Muñoz-Espín, Daniel; Daniel, Richard; Kawai, Yoshikazu; Carballido-López, Rut; Castilla-Llorente, Virginia; Errington, Jeff; Meijer, Wilfried J J; Salas, Margarita

    2009-08-11

    Little is known about the organization or proteins involved in membrane-associated replication of prokaryotic genomes. Here we show that the actin-like MreB cytoskeleton of the distantly related bacteria Escherichia coli and Bacillus subtilis is required for efficient viral DNA replication. Detailed analyses of B. subtilis phage ϕ29 showed that the MreB cytoskeleton plays a crucial role in organizing phage DNA replication at the membrane. Thus, phage double-stranded DNA and components of the ϕ29 replication machinery localize in peripheral helix-like structures in a cytoskeleton-dependent way. Importantly, we show that MreB interacts directly with the ϕ29 membrane-protein p16.7, responsible for attaching viral DNA at the cell membrane. Altogether, the results reveal another function for the MreB cytoskeleton and describe a mechanism by which viral DNA replication is organized at the bacterial membrane.

  16. Multiple conformational states of DnaA protein regulate its interaction with DnaA boxes in the initiation of DNA replication.

    Science.gov (United States)

    Patel, Meera J; Bhatia, Lavesh; Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B

    2017-09-01

    DnaA protein is the initiator of genomic DNA replication in prokaryotes. It binds to specific DNA sequences in the origin of DNA replication and unwinds small AT-rich sequences downstream for the assembly of the replisome. The mechanism of activation of DnaA that enables it to bind and organize the origin DNA and leads to replication initiation remains unclear. In this study, we have developed double-labeled fluorescent DnaA probes to analyze conformational states of DnaA protein upon binding DNA, nucleotide, and Soj sporulation protein using Fluorescence Resonance Energy Transfer (FRET). Our studies demonstrate that DnaA protein undergoes large conformational changes upon binding to substrates and there are multiple distinct conformational states that enable it to initiate DNA replication. DnaA protein adopted a relaxed conformation by expanding ~15Å upon binding ATP and DNA to form the ATP·DnaA·DNA complex. Hydrolysis of bound ATP to ADP led to a contraction of DnaA within the complex. The relaxed conformation of DnaA is likely required for the formation of the multi-protein ATP·DnaA·DNA complex. In the initiation of sporulation, Soj binding to DnaA prevented relaxation of its conformation. Soj·ADP appeared to block the activation of DnaA, suggesting a mechanism for Soj·ADP in switching initiation of DNA replication to sporulation. Our studies demonstrate that multiple conformational states of DnaA protein regulate its binding to DNA in the initiation of DNA replication. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Soria, G; Mansilla, S; Belluscio, L; Speroni, J; D' Alessio, C; Gottifredi, V [Fundacion Leloir, Buenos Aires (Argentina); Essers, J; Kanaar, R [Erasmus Medical Center, Rotterdam (Netherlands)

    2009-07-01

    When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol {eta} ({eta}). The current model implies that Pol {eta} activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol {eta} behaviour after DNA-damage. We show that Pol {eta} is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol {eta} to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

  18. Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

    International Nuclear Information System (INIS)

    Soria, G.; Mansilla, S.; Belluscio, L.; Speroni, J.; D'Alessio, C.; Gottifredi, V.; Essers, J.; Kanaar, R.

    2009-01-01

    When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol η (eta). The current model implies that Pol η activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol η behaviour after DNA-damage. We show that Pol η is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol η to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

  19. Specific functions of the Rep and Rep׳ proteins of porcine circovirus during copy-release and rolling-circle DNA replication.

    Science.gov (United States)

    Cheung, Andrew K

    2015-07-01

    The roles of two porcine circovirus replication initiator proteins, Rep and Rep׳, in generating copy-release and rolling-circle DNA replication intermediates were determined. Rep uses the supercoiled closed-circular genome (ccc) to initiate leading-strand synthesis (identical to copy-release replication) and generates the single-stranded circular (ssc) genome from the displaced DNA strand. In the process, a minus-genome primer (MGP) necessary for complementary-strand synthesis, from ssc to ccc, is synthesized. Rep׳ cleaves the growing nascent-strand to regenerate the parent ccc molecule. In the process, a Rep׳-DNA hybrid containing the right palindromic sequence (at the origin of DNA replication) is generated. Analysis of the virus particle showed that it is composed of four components: ssc, MGP, capsid protein and a novel Rep-related protein (designated Protein-3). Copyright © 2015. Published by Elsevier Inc.

  20. Replication of vertebrate mitochondrial DNA entails transient ribonucleotide incorporation throughout the lagging strand.

    Science.gov (United States)

    Yasukawa, Takehiro; Reyes, Aurelio; Cluett, Tricia J; Yang, Ming-Yao; Bowmaker, Mark; Jacobs, Howard T; Holt, Ian J

    2006-11-15

    Using two-dimensional agarose gel electrophoresis, we show that mitochondrial DNA (mtDNA) replication of birds and mammals frequently entails ribonucleotide incorporation throughout the lagging strand (RITOLS). Based on a combination of two-dimensional agarose gel electrophoretic analysis and mapping of 5' ends of DNA, initiation of RITOLS replication occurs in the major non-coding region of vertebrate mtDNA and is effectively unidirectional. In some cases, conversion of nascent RNA strands to DNA starts at defined loci, the most prominent of which maps, in mammalian mtDNA, in the vicinity of the site known as the light-strand origin.

  1. ATPase activity measurement of DNA replicative helicase from Bacillus stearothermophilus by malachite green method.

    Science.gov (United States)

    Yang, Mu; Wang, Ganggang

    2016-09-15

    The DnaB helicase from Bacillus stearothermophilus (DnaBBst) was a model protein for studying the bacterial DNA replication. In this work, a non-radioactive method for measuring ATPase activity of DnaBBst helicase was described. The working parameters and conditions were optimized. Furthermore, this method was applied to investigate effects of DnaG primase, ssDNA and helicase loader protein (DnaI) on ATPase activity of DnaBBst. Our results showed this method was sensitive and efficient. Moreover, it is suitable for the investigation of functional interaction between DnaB and related factors. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. First-passage problems in DNA replication: effects of template tension on stepping and exonuclease activities of a DNA polymerase motor

    International Nuclear Information System (INIS)

    Sharma, Ajeet K; Chowdhury, Debashish

    2013-01-01

    A DNA polymerase (DNAP) replicates a template DNA strand. It also exploits the template as the track for its own motor-like mechanical movement. In the polymerase mode it elongates the nascent DNA by one nucleotide in each step. However, whenever it commits an error by misincorporating an incorrect nucleotide, it can switch to an exonuclease mode. In the latter mode it excises the wrong nucleotide before switching back to its polymerase mode. We develop a stochastic kinetic model of DNA replication that mimics an in vitro experiment where single-stranded DNA, subjected to a mechanical tension F, is converted to double-stranded DNA by a single DNAP. The F-dependence of the average rate of replication, which depends on the rates of both polymerase and exonuclease activities of the DNAP, is in good qualitative agreement with the corresponding experimental results. We introduce nine novel distinct conditional dwell times of a DNAP. Using the method of first-passage times, we also derive the exact analytical expressions for the probability distributions of these conditional dwell times. The predicted F-dependences of these distributions are, in principle, accessible to single-molecule experiments. (paper)

  3. The DNA Replication Checkpoint Directly Regulates MBF-Dependent G1/S Transcription▿

    OpenAIRE

    Dutta, Chaitali; Patel, Prasanta K.; Rosebrock, Adam; Oliva, Anna; Leatherwood, Janet; Rhind, Nicholas

    2008-01-01

    The DNA replication checkpoint transcriptionally upregulates genes that allow cells to adapt to and survive replication stress. Our results show that, in the fission yeast Schizosaccharomyces pombe, the replication checkpoint regulates the entire G1/S transcriptional program by directly regulating MBF, the G1/S transcription factor. Instead of initiating a checkpoint-specific transcriptional program, the replication checkpoint targets MBF to maintain the normal G1/S transcriptional program du...

  4. Genome-wide alterations of the DNA replication program during tumor progression

    Science.gov (United States)

    Arneodo, A.; Goldar, A.; Argoul, F.; Hyrien, O.; Audit, B.

    2016-08-01

    Oncogenic stress is a major driving force in the early stages of cancer development. Recent experimental findings reveal that, in precancerous lesions and cancers, activated oncogenes may induce stalling and dissociation of DNA replication forks resulting in DNA damage. Replication timing is emerging as an important epigenetic feature that recapitulates several genomic, epigenetic and functional specificities of even closely related cell types. There is increasing evidence that chromosome rearrangements, the hallmark of many cancer genomes, are intimately associated with the DNA replication program and that epigenetic replication timing changes often precede chromosomic rearrangements. The recent development of a novel methodology to map replication fork polarity using deep sequencing of Okazaki fragments has provided new and complementary genome-wide replication profiling data. We review the results of a wavelet-based multi-scale analysis of genomic and epigenetic data including replication profiles along human chromosomes. These results provide new insight into the spatio-temporal replication program and its dynamics during differentiation. Here our goal is to bring to cancer research, the experimental protocols and computational methodologies for replication program profiling, and also the modeling of the spatio-temporal replication program. To illustrate our purpose, we report very preliminary results obtained for the chronic myelogeneous leukemia, the archetype model of cancer. Finally, we discuss promising perspectives on using genome-wide DNA replication profiling as a novel efficient tool for cancer diagnosis, prognosis and personalized treatment.

  5. Highly parallel translation of DNA sequences into small molecules.

    Directory of Open Access Journals (Sweden)

    Rebecca M Weisinger

    Full Text Available A large body of in vitro evolution work establishes the utility of biopolymer libraries comprising 10(10 to 10(15 distinct molecules for the discovery of nanomolar-affinity ligands to proteins. Small-molecule libraries of comparable complexity will likely provide nanomolar-affinity small-molecule ligands. Unlike biopolymers, small molecules can offer the advantages of cell permeability, low immunogenicity, metabolic stability, rapid diffusion and inexpensive mass production. It is thought that such desirable in vivo behavior is correlated with the physical properties of small molecules, specifically a limited number of hydrogen bond donors and acceptors, a defined range of hydrophobicity, and most importantly, molecular weights less than 500 Daltons. Creating a collection of 10(10 to 10(15 small molecules that meet these criteria requires the use of hundreds to thousands of diversity elements per step in a combinatorial synthesis of three to five steps. With this goal in mind, we have reported a set of mesofluidic devices that enable DNA-programmed combinatorial chemistry in a highly parallel 384-well plate format. Here, we demonstrate that these devices can translate DNA genes encoding 384 diversity elements per coding position into corresponding small-molecule gene products. This robust and efficient procedure yields small molecule-DNA conjugates suitable for in vitro evolution experiments.

  6. Studying DNA looping by single-molecule FRET.

    Science.gov (United States)

    Le, Tung T; Kim, Harold D

    2014-06-28

    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

  7. Effects of Replication and Transcription on DNA Structure-Related Genetic Instability.

    Science.gov (United States)

    Wang, Guliang; Vasquez, Karen M

    2017-01-05

    Many repetitive sequences in the human genome can adopt conformations that differ from the canonical B-DNA double helix (i.e., non-B DNA), and can impact important biological processes such as DNA replication, transcription, recombination, telomere maintenance, viral integration, transposome activation, DNA damage and repair. Thus, non-B DNA-forming sequences have been implicated in genetic instability and disease development. In this article, we discuss the interactions of non-B DNA with the replication and/or transcription machinery, particularly in disease states (e.g., tumors) that can lead to an abnormal cellular environment, and how such interactions may alter DNA replication and transcription, leading to potential conflicts at non-B DNA regions, and eventually result in genetic stability and human disease.

  8. Aligned deposition and electrical measurements on single DNA molecules

    International Nuclear Information System (INIS)

    Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid

    2015-01-01

    A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)

  9. Developing DNA nanotechnology using single-molecule fluorescence.

    Science.gov (United States)

    Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal

    2014-06-17

    CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and

  10. Rifampicin and chloramphenicol effects on DNA replication in ultraviolet-damaged Escherichia coli B/r WP2 thy trp

    International Nuclear Information System (INIS)

    Doudney, C.O.

    1976-01-01

    The antibiotic rifampicin, which blocks specifically RNA synthesis, limited DNA replication in Escherichia coli strain B/r WP2 thy trp after an increase of about 50% when added to the incubation medium at the time of replication initiation after ultraviolet fluences of 20 J/m 2 or 25 J/m 2 . Chloramphenicol, which blocks protein synthesis, did not limit DNA replication when added at initiation or any time after. The prolonged lag in DNA replication caused by ultraviolet was not itself responsible for the rifampicin limitation. When a lag of 30 min was caused by starvation for thymine, DNA was synthesized after readdition of thymine to an increase of 100% or more in rifampicin-containing medium. When chloramphenicol was added to an ultraviolet-exposed culture, the limiting effect of rifampicin alone was suppressed. This effect held even with a higher fluence (32.5 J/m 2 ), after which the ability to make DNA in the presence of rifampicin alone was slight. Maximum effect was obtained when the chloramphenicol was added to the ultraviolet-exposed, rifampicin-containing culture immediately before initiation of DNA replication. When rifampicin was present at a concentration of 150 μg/ml (2.2 x 10 -4 M), 3 μg/ml of chloramphenicol (9.2 x 10 -6 M) was as effective as 160 μg/ml (5.0 x 10 -4 M), thus eliminating the possibility that direct stoichiometric interaction of rifampicin and chloramphenicol molecules caused the effect

  11. Role of the hydrophilic channels of simian virus 40 T-antigen helicase in DNA replication.

    Science.gov (United States)

    Wang, Weiping; Manna, David; Simmons, Daniel T

    2007-05-01

    The simian virus 40 (SV40) hexameric helicase consists of a central channel and six hydrophilic channels located between adjacent large tier domains within each hexamer. To study the function of the hydrophilic channels in SV40 DNA replication, a series of single-point substitutions were introduced at sites not directly involved in protein-protein contacts. The mutants were characterized biochemically in various ways. All mutants oligomerized normally in the absence of DNA. Interestingly, 8 of the 10 mutants failed to unwind an origin-containing DNA fragment and nine of them were totally unable to support SV40 DNA replication in vitro. The mutants fell into four classes based on their biochemical properties. Class A mutants bound DNA normally and had normal ATPase and helicase activities but failed to unwind origin DNA and support SV40 DNA replication. Class B mutants were compromised in single-stranded DNA and origin DNA binding at low protein concentrations. They were defective in helicase activity and unwinding of the origin and in supporting DNA replication. Class C and D mutants possessed higher-than-normal single-stranded DNA binding activity at low protein concentrations. The class C mutants failed to separate origin DNA and support DNA replication. The class D mutants unwound origin DNA normally but were compromised in their ability to support DNA replication. Taken together, these results suggest that the hydrophilic channels have an active role in the unwinding of SV40 DNA from the origin and the placement of the resulting single strands within the helicase.

  12. Inter-Fork Strand Annealing causes genomic deletions during the termination of DNA replication.

    Science.gov (United States)

    Morrow, Carl A; Nguyen, Michael O; Fower, Andrew; Wong, Io Nam; Osman, Fekret; Bryer, Claire; Whitby, Matthew C

    2017-06-06

    Problems that arise during DNA replication can drive genomic alterations that are instrumental in the development of cancers and many human genetic disorders. Replication fork barriers are a commonly encountered problem, which can cause fork collapse and act as hotspots for replication termination. Collapsed forks can be rescued by homologous recombination, which restarts replication. However, replication restart is relatively slow and, therefore, replication termination may frequently occur by an active fork converging on a collapsed fork. We find that this type of non-canonical fork convergence in fission yeast is prone to trigger deletions between repetitive DNA sequences via a mechanism we call Inter-Fork Strand Annealing (IFSA) that depends on the recombination proteins Rad52, Exo1 and Mus81, and is countered by the FANCM-related DNA helicase Fml1. Based on our findings, we propose that IFSA is a potential threat to genomic stability in eukaryotes.

  13. DNA repair and its coupling to DNA replication in eukaryotic cells. [UV, x ray

    Energy Technology Data Exchange (ETDEWEB)

    Cleaver, J.E.

    1978-01-01

    This review article with 184 references presents the view that mammalian cells have one major repair system, excision repair, with many branches (nucleotide excision repair, base excision repair, crosslink repair, etc.) and a multiplicity of enzymes. Any particular carcinogen makes a spectrum of damaged sites and each kind of damage may be repaired by one or more branches of excision repair. Excision repair is rarely complete, except at very low doses, and eukaryotic cells survive and replicate DNA despite the presence of unrepaired damage. An alteration in a specific biochemical pathway seen in damaged or mutant cells will not always be the primary consequence of damage or of the biochemical defect of the cells. Detailed kinetic data are required to understand comprehensively the various facets of excision repair and replication. Correlation between molecular events of repair and cytological and cellular changes such as chromosomal damage, mutagenesis, transformation, and carcinogenesis are also rudimentary.

  14. Chl1 DNA helicase regulates Scc2 deposition specifically during DNA-replication in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Soumya Rudra

    Full Text Available The conserved family of cohesin proteins that mediate sister chromatid cohesion requires Scc2, Scc4 for chromatin-association and Eco1/Ctf7 for conversion to a tethering competent state. A popular model, based on the notion that cohesins form huge ring-like structures, is that Scc2, Scc4 function is essential only during G1 such that sister chromatid cohesion results simply from DNA replisome passage through pre-loaded cohesin rings. In such a scenario, cohesin deposition during G1 is temporally uncoupled from Eco1-dependent establishment reactions that occur during S-phase. Chl1 DNA helicase (homolog of human ChlR1/DDX11 and BACH1/BRIP1/FANCJ helicases implicated in Fanconi anemia, breast and ovarian cancer and Warsaw Breakage Syndrome plays a critical role in sister chromatid cohesion, however, the mechanism through which Chl1 promotes cohesion remains poorly understood. Here, we report that Chl1 promotes Scc2 loading unto DNA such that both Scc2 and cohesin enrichment to chromatin are defective in chl1 mutant cells. The results further show that both Chl1 expression and chromatin-recruitment are tightly regulated through the cell cycle, peaking during S-phase. Importantly, kinetic ChIP studies reveals that Chl1 is required for Scc2 chromatin-association specifically during S-phase, but not during G1. Despite normal chromatin enrichment of both Scc2 and cohesin during G1, chl1 mutant cells exhibit severe chromosome segregation and cohesion defects--revealing that G1-loaded cohesins is insufficient to promote cohesion. Based on these findings, we propose a new model wherein S-phase cohesin loading occurs during DNA replication and in concert with both cohesion establishment and chromatin assembly reactions--challenging the notion that DNA replication fork navigates through or around pre-loaded cohesin rings.

  15. Human ribonuclease H1 resolves R-loops and thereby enables progression of the DNA replication fork.

    Science.gov (United States)

    Parajuli, Shankar; Teasley, Daniel C; Murali, Bhavna; Jackson, Jessica; Vindigni, Alessandro; Stewart, Sheila A

    2017-09-15

    Faithful DNA replication is essential for genome stability. To ensure accurate replication, numerous complex and redundant replication and repair mechanisms function in tandem with the core replication proteins to ensure DNA replication continues even when replication challenges are present that could impede progression of the replication fork. A unique topological challenge to the replication machinery is posed by RNA-DNA hybrids, commonly referred to as R-loops. Although R-loops play important roles in gene expression and recombination at immunoglobulin sites, their persistence is thought to interfere with DNA replication by slowing or impeding replication fork progression. Therefore, it is of interest to identify DNA-associated enzymes that help resolve replication-impeding R-loops. Here, using DNA fiber analysis, we demonstrate that human ribonuclease H1 (RNH1) plays an important role in replication fork movement in the mammalian nucleus by resolving R-loops. We found that RNH1 depletion results in accumulation of RNA-DNA hybrids, slowing of replication forks, and increased DNA damage. Our data uncovered a role for RNH1 in global DNA replication in the mammalian nucleus. Because accumulation of RNA-DNA hybrids is linked to various human cancers and neurodegenerative disorders, our study raises the possibility that replication fork progression might be impeded, adding to increased genomic instability and contributing to disease. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Tus-Ter as a tool to study site-specific DNA replication perturbation in eukaryotes

    DEFF Research Database (Denmark)

    Larsen, Nicolai B; Hickson, Ian D; Mankouri, Hocine W

    2014-01-01

    The high-affinity binding of the Tus protein to specific 21-bp sequences, called Ter, causes site-specific, and polar, DNA replication fork arrest in E coli. The Tus-Ter complex serves to coordinate DNA replication with chromosome segregation in this organism. A number of recent and ongoing studies...... have demonstrated that Tus-Ter can be used as a heterologous tool to generate site-specific perturbation of DNA replication when reconstituted in eukaryotes. Here, we review these recent findings and explore the molecular mechanism by which Tus-Ter mediates replication fork (RF) arrest in the budding...... yeast, S. cerevisiae. We propose that Tus-Ter is a versatile, genetically tractable, and regulatable RF blocking system that can be utilized for disrupting DNA replication in a diverse range of host cells....

  17. GINS complex protein Sld5 recruits SIK1 to activate MCM helicase during DNA replication.

    Science.gov (United States)

    Joshi, Kiranmai; Shah, Varun Jayeshkumar; Maddika, Subbareddy

    2016-12-01

    In eukaryotes, proper loading and activation of MCM helicase at chromosomal origins plays a central role in DNA replication. Activation of MCM helicase requires its association with CDC45-GINS complex, but the mechanism of how this complex activates MCM helicase is poorly understood. Here we identified SIK1 (salt-inducible kinase 1), an AMPK related protein kinase, as a molecular link that connects GINS complex with MCM helicase activity. We demonstrated that Sld5 a component of GINS complex interacts with SIK1 and recruits it to the sites of DNA replication at the onset of S phase. Depletion of SIK1 leads to defective DNA replication. Further, we showed that SIK1 phosphorylates MCM2 at five conserved residues at its N-terminus, which is essential for the activation of MCM helicase. Collectively, our results suggest SIK1 as a novel integral component of CMG replicative helicase during eukaryotic DNA replication. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Tus-Ter as a tool to study site-specific DNA replication perturbation in eukaryotes.

    Science.gov (United States)

    Larsen, Nicolai B; Hickson, Ian D; Mankouri, Hocine W

    2014-01-01

    The high-affinity binding of the Tus protein to specific 21-bp sequences, called Ter, causes site-specific, and polar, DNA replication fork arrest in E coli. The Tus-Ter complex serves to coordinate DNA replication with chromosome segregation in this organism. A number of recent and ongoing studies have demonstrated that Tus-Ter can be used as a heterologous tool to generate site-specific perturbation of DNA replication when reconstituted in eukaryotes. Here, we review these recent findings and explore the molecular mechanism by which Tus-Ter mediates replication fork (RF) arrest in the budding yeast, S. cerevisiae. We propose that Tus-Ter is a versatile, genetically tractable, and regulatable RF blocking system that can be utilized for disrupting DNA replication in a diverse range of host cells.

  19. Rv0004 is a new essential member of the mycobacterial DNA replication machinery.

    Science.gov (United States)

    Mann, Katherine M; Huang, Deborah L; Hooppaw, Anna J; Logsdon, Michelle M; Richardson, Kirill; Lee, Hark Joon; Kimmey, Jacqueline M; Aldridge, Bree B; Stallings, Christina L

    2017-11-01

    DNA replication is fundamental for life, yet a detailed understanding of bacterial DNA replication is limited outside the organisms Escherichia coli and Bacillus subtilis. Many bacteria, including mycobacteria, encode no identified homologs of helicase loaders or regulators of the initiator protein DnaA, despite these factors being essential for DNA replication in E. coli and B. subtilis. In this study we discover that a previously uncharacterized protein, Rv0004, from the human pathogen Mycobacterium tuberculosis is essential for bacterial viability and that depletion of Rv0004 leads to a block in cell cycle progression. Using a combination of genetic and biochemical approaches, we found that Rv0004 has a role in DNA replication, interacts with DNA and the replicative helicase DnaB, and affects DnaB-DnaA complex formation. We also identify a conserved domain in Rv0004 that is predicted to structurally resemble the N-terminal protein-protein interaction domain of DnaA. Mutation of a single conserved tryptophan within Rv0004's DnaA N-terminal-like domain leads to phenotypes similar to those observed upon Rv0004 depletion and can affect the association of Rv0004 with DnaB. In addition, using live cell imaging during depletion of Rv0004, we have uncovered a previously unappreciated role for DNA replication in coordinating mycobacterial cell division and cell size. Together, our data support that Rv0004 encodes a homolog of the recently identified DciA family of proteins found in most bacteria that lack the DnaC-DnaI helicase loaders in E. coli and B. subtilis. Therefore, the mechanisms of Rv0004 elucidated here likely apply to other DciA homologs and reveal insight into the diversity of bacterial strategies in even the most conserved biological processes.

  20. In situ enzymology of DNA replication and ultraviolet-induced DNA repair synthesis in permeable human cells

    International Nuclear Information System (INIS)

    Dresler, S.; Frattini, M.G.; Robinson-Hill, R.M.

    1988-01-01

    Using permeable diploid human fibroblasts, the authors have studied the deoxyribonucleoside triphosphate concentration dependences of ultraviolet- (UV-) induced DNA repair synthesis and semiconservative DNA replication. In both cell types (AG1518 and IMR-90) examined, the apparent K m values for dCTP, dGTP, and dTTP for DNA replication were between 1.2 and 2.9 μM. For UV-induced DNA repair synthesis, the apparent K m values were substantially lower, ranging from 0.11 to 0.44 μM for AG1518 cells and from 0.06 to 0.24 μM for IMR-90 cells. Recent data implicate DNA polymerase δ in UV-induced repair synthesis and suggest that DNA polymerases α and δ are both involved in semiconservative replication. They measured K m values for dGTP and dTTP for polymerases α and δ, for comparison with the values for replication and repair synthesis. The deoxyribonucleotide K m values for DNA polymerase δ are much greater than the K m values for UV-induced repair synthesis, suggesting that when polymerase δ functions in DNA repair, its characteristics are altered substantially either by association with accessory proteins or by direct posttranslational modification. In contrast, the deoxyribonucleotide binding characteristics of the DNA replication machinery differ little from those of the isolated DNA polymerases. The K m values for UV-induced repair synthesis are 5-80-fold lower than deoxyribonucleotide concentrations that have been reported for intact cultured diploid human fibroblasts. For replication, however, the K m for dGTP is only slightly lower than the average cellular dGTP concentration that has been reported for exponentially growing human fibroblasts. This finding is consistent with the concept that nucleotide compartmentation is required for the attainment of high rates of DNA replication in vivo

  1. Charge transport in polyguanine-polycytosine DNA molecules

    International Nuclear Information System (INIS)

    Wei, J H; Chan, K S

    2007-01-01

    A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules

  2. A role for the weak DnaA binding sites in bacterial replication origins

    DEFF Research Database (Denmark)

    Charbon, Godefroid; Løbner-Olesen, Anders

    2011-01-01

    DnaA initiates the chromosomal DNA replication in nearly all bacteria, and replication origins are characterized by binding sites for the DnaA protein (DnaA-boxes) along with an ‘AT-rich’ region. However, great variation in number, spatial organization and specificity of DnaA-boxes is observed...... between species. In the study by Taylor et al. (2011), new and unexpectedly weak DnaA-boxes were identified within the Caulobacter crescentus origin of replication (Cori). The position of weak and stronger DnaA-boxes follows a pattern seen in Escherichia coli oriC. This raises the possibility...... that bacterial origins might be more alike than previously thought....

  3. Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level

    KAUST Repository

    Raducanu, Vlad-Stefan

    2016-05-01

    Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners and the mechanism of facilitated diffusion along the DNA. The large numbers of interacting partners makes PCNA a necessary factor to consider when studying DNA replication, either in vitro or in vivo. The mechanism of facilitated diffusion along the DNA, i.e. sliding along the duplex, reduces the six degrees of freedom of the molecule, three degrees of freedom of translation and three degrees of freedom of rotation, to only two, translation along the duplex and rotational tracking of the helix. Through this mechanism PCNA can recruit its partner proteins and localize them to the right spot on the DNA, maybe in the right spatial orientation, more effectively and in coordination with other proteins. Passive loading of the closed PCNA ring on the DNA without free ends is a topologically forbidden process. Replication factor C (RFC) uses energy of ATP hydrolysis to mechanically open the PCNA ring and load it on the dsDNA. The first half of the introduction gives overview of PCNA and RFC and the loading mechanism of PCNA on dsDNA. The second half is dedicated to a diffusion model and to an algorithm for analyzing PCNA sliding. PCNA and RFC were successfully purified, simulations and a mean squared displacement analysis algorithm were run and showed good stability and experimental PCNA sliding data was analyzed and led to parameters similar to the ones in literature.

  4. Effect of 5-fluorodeoxyuridine on DNA replication in ultraviolet-irradiated HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Brozmanova, J.; Masek, F.; Synzynys, B.I.; Saenko, A.S.

    1985-11-05

    In HeLa cells precultivated for 6 hours with 5-fluorodeoxyuridine (FUdR) and for 18 hours in FUdR-free medium, DNA synthesis was much more resistant to UV irradiation than that of untreated cells. DNA synthesized in FUdR-pretreated and UV irradiated cells represents a semiconservative DNA replication and shows more rapid shift of the pulse-labelled chased DNA to high molecular weight. This DNA synthesis is not induced by synchronization of the cell cycle. It is assumed that either the changes of chromatine structure, or an enhanced level of some enzymes might be involved in the replication of the damaged template. (author).

  5. The escherichia coli chromosome replication initiator protein, DnaA

    DEFF Research Database (Denmark)

    Nyborg, Malene

    The experimental work presented in this thesis involve mutational analysis of the DNA binding domain of the DnaA protein and analysis of the A184V substitution in the ATP area of domain III and other amino acid substitutions found in the DnaA5 and DnaA4G proteins....

  6. RNase H and replication of ColE1 DNA in Escherichia coli.

    OpenAIRE

    Naito, S; Uchida, H

    1986-01-01

    Amber mutations within the rnh (RNase H) gene of Escherichia coli K-12 were isolated by selecting for bacteria capable of replicating in a sup+ background replication-defective cer-6 mutant of the ColE1 replicon. The cer-6 mutation is an alteration of one base pair located 160 nucleotides upstream of the unique replication origin of this plasmid. Subsequently, we determined the DNA alterations present within these mutants. ColE1 DNA replicated in rnh(Am) recA cells, indicating that (i) RNase ...

  7. Replication stress-induced chromosome breakage is correlated with replication fork progression and is preceded by single-stranded DNA formation.

    Science.gov (United States)

    Feng, Wenyi; Di Rienzi, Sara C; Raghuraman, M K; Brewer, Bonita J

    2011-10-01

    Chromosome breakage as a result of replication stress has been hypothesized to be the direct consequence of defective replication fork progression, or "collapsed" replication forks. However, direct and genome-wide evidence that collapsed replication forks give rise to chromosome breakage is still lacking. Previously we showed that a yeast replication checkpoint mutant mec1-1, after transient exposure to replication impediment imposed by hydroxyurea (HU), failed to complete DNA replication, accumulated single-stranded DNA (ssDNA) at the replication forks, and fragmented its chromosomes. In this study, by following replication fork progression genome-wide via ssDNA detection and by direct mapping of chromosome breakage after HU exposure, we have tested the hypothesis that the chromosome breakage in mec1 cells occurs at collapsed replication forks. We demonstrate that sites of chromosome breakage indeed correlate with replication fork locations. Moreover, ssDNA can be detected prior to chromosome breakage, suggesting that ssDNA accumulation is the common precursor to double strand breaks at collapsed replication forks.

  8. Small molecules, inhibitors of DNA-PK, targeting DNA repair and beyond

    Directory of Open Access Journals (Sweden)

    David eDavidson

    2013-01-01

    Full Text Available Many current chemotherapies function by damaging genomic DNA in rapidly dividing cells ultimately leading to cell death. This therapeutic approach differentially targets cancer cells that generally display rapid cell division compared to normal tissue cells. However, although these treatments are initially effective in arresting tumor growth and reducing tumor burden, resistance and disease progression eventually occur. A major mechanism underlying this resistance is increased levels of cellular DNA repair. Most cells have complex mechanisms in place to repair DNA damage that occurs due to environmental exposures or normal metabolic processes. These systems, initially overwhelmed when faced with chemotherapy induced DNA damage, become more efficient under constant selective pressure and as a result chemotherapies become less effective. Thus, inhibiting DNA repair pathways using target specific small molecule inhibitors may overcome cellular resistance to DNA damaging chemotherapies. Non-homologous end joining (NHEJ a major mechanism for the repair of double strand breaks (DSB in DNA is regulated in part by the serine/threonine kinase, DNA dependent protein kinase (DNA-PK. The DNA-PK holoenzyme acts as a scaffold protein tethering broken DNA ends and recruiting other repair molecules. It also has enzymatic activity that may be involved in DNA damage signaling. Because of its’ central role in repair of DSBs, DNA-PK has been the focus of a number of small molecule studies. In these studies specific DNA-PK inhibitors have shown efficacy in synergizing chemotherapies in vitro. However, compounds currently known to specifically inhibit DNA-PK are limited by poor pharmacokinetics: these compounds have poor solubility and have high metabolic lability in vivo leading to short serum half-lives. Future improvement in DNA-PK inhibition will likely be achieved by designing new molecules based on the recently reported crystallographic structure of DNA

  9. The mitochondrial outer membrane protein MDI promotes local protein synthesis and mtDNA replication.

    Science.gov (United States)

    Zhang, Yi; Chen, Yong; Gucek, Marjan; Xu, Hong

    2016-05-17

    Early embryonic development features rapid nuclear DNA replication cycles, but lacks mtDNA replication. To meet the high-energy demands of embryogenesis, mature oocytes are furnished with vast amounts of mitochondria and mtDNA However, the cellular machinery driving massive mtDNA replication in ovaries remains unknown. Here, we describe a Drosophila AKAP protein, MDI that recruits a translation stimulator, La-related protein (Larp), to the mitochondrial outer membrane in ovaries. The MDI-Larp complex promotes the synthesis of a subset of nuclear-encoded mitochondrial proteins by cytosolic ribosomes on the mitochondrial surface. MDI-Larp's targets include mtDNA replication factors, mitochondrial ribosomal proteins, and electron-transport chain subunits. Lack of MDI abolishes mtDNA replication in ovaries, which leads to mtDNA deficiency in mature eggs. Targeting Larp to the mitochondrial outer membrane independently of MDI restores local protein synthesis and rescues the phenotypes of mdi mutant flies. Our work suggests that a selective translational boost by the MDI-Larp complex on the outer mitochondrial membrane might be essential for mtDNA replication and mitochondrial biogenesis during oogenesis. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

  10. Cytology of DNA Replication Reveals Dynamic Plasticity of Large-Scale Chromatin Fibers.

    Science.gov (United States)

    Deng, Xiang; Zhironkina, Oxana A; Cherepanynets, Varvara D; Strelkova, Olga S; Kireev, Igor I; Belmont, Andrew S

    2016-09-26

    In higher eukaryotic interphase nuclei, the 100- to >1,000-fold linear compaction of chromatin is difficult to reconcile with its function as a template for transcription, replication, and repair. It is challenging to imagine how DNA and RNA polymerases with their associated molecular machinery would move along the DNA template without transient decondensation of observed large-scale chromatin "chromonema" fibers [1]. Transcription or "replication factory" models [2], in which polymerases remain fixed while DNA is reeled through, are similarly difficult to conceptualize without transient decondensation of these chromonema fibers. Here, we show how a dynamic plasticity of chromatin folding within large-scale chromatin fibers allows DNA replication to take place without significant changes in the global large-scale chromatin compaction or shape of these large-scale chromatin fibers. Time-lapse imaging of lac-operator-tagged chromosome regions shows no major change in the overall compaction of these chromosome regions during their DNA replication. Improved pulse-chase labeling of endogenous interphase chromosomes yields a model in which the global compaction and shape of large-Mbp chromatin domains remains largely invariant during DNA replication, with DNA within these domains undergoing significant movements and redistribution as they move into and then out of adjacent replication foci. In contrast to hierarchical folding models, this dynamic plasticity of large-scale chromatin organization explains how localized changes in DNA topology allow DNA replication to take place without an accompanying global unfolding of large-scale chromatin fibers while suggesting a possible mechanism for maintaining epigenetic programming of large-scale chromatin domains throughout DNA replication. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Inhibition of DNA2 nuclease as a therapeutic strategy targeting replication stress in cancer cells.

    Science.gov (United States)

    Kumar, S; Peng, X; Daley, J; Yang, L; Shen, J; Nguyen, N; Bae, G; Niu, H; Peng, Y; Hsieh, H-J; Wang, L; Rao, C; Stephan, C C; Sung, P; Ira, G; Peng, G

    2017-04-17

    Replication stress is a characteristic feature of cancer cells, which is resulted from sustained proliferative signaling induced by activation of oncogenes or loss of tumor suppressors. In cancer cells, oncogene-induced replication stress manifests as replication-associated lesions, predominantly double-strand DNA breaks (DSBs). An essential mechanism utilized by cells to repair replication-associated DSBs is homologous recombination (HR). In order to overcome replication stress and survive, cancer cells often require enhanced HR repair capacity. Therefore, the key link between HR repair and cellular tolerance to replication-associated DSBs provides us with a mechanistic rationale for exploiting synthetic lethality between HR repair inhibition and replication stress. DNA2 nuclease is an evolutionarily conserved essential enzyme in replication and HR repair. Here we demonstrate that DNA2 is overexpressed in pancreatic cancers, one of the deadliest and more aggressive forms of human cancers, where mutations in the KRAS are present in 90-95% of cases. In addition, depletion of DNA2 significantly reduces pancreatic cancer cell survival and xenograft tumor growth, suggesting the therapeutic potential of DNA2 inhibition. Finally, we develop a robust high-throughput biochemistry assay to screen for inhibitors of the DNA2 nuclease activity. The top inhibitors were shown to be efficacious against both yeast Dna2 and human DNA2. Treatment of cancer cells with DNA2 inhibitors recapitulates phenotypes observed upon DNA2 depletion, including decreased DNA double strand break end resection and attenuation of HR repair. Similar to genetic ablation of DNA2, chemical inhibition of DNA2 selectively attenuates the growth of various cancer cells with oncogene-induced replication stress. Taken together, our findings open a new avenue to develop a new class of anticancer drugs by targeting druggable nuclease DNA2. We propose DNA2 inhibition as new strategy in cancer therapy by targeting

  12. Absence of specificity in inhibition of DNA repair replication by DNA-binding agents, cocarcinogens, and steroids in human cells

    International Nuclear Information System (INIS)

    Cleaver, J.E.; Painter, R.B.

    1975-01-01

    Although many chemicals, including cocarcinogens, DNA-binding agents, and steroids, inhibit repair replication of ultraviolet-induced damage to DNA in human lymphocytes and proliferating cells in culture, none of these chemicals is specific. Our results show that all the chemicals we tested inhibit normal DNA synthesis as much as or more than they inhibit repair replication. There is thus no evidence in our results to support the hypothesis that cocarcinogens are specific inhibitors of DNA repair or that any of the chemicals studied might be useful adjuncts to tumor therapy merely because of specific inhibition of radiation repair mechanisms

  13. Acute inactivation of the replicative helicase in human cells triggers MCM8-9-dependent DNA synthesis

    DEFF Research Database (Denmark)

    Natsume, Toyoaki; Nishimura, Kohei; Minocherhomji, Sheroy

    2017-01-01

    stemming from replisome dissociation during DNA replication perturbation, we used a degron-based system for inducible proteolysis of a subunit of the replicative helicase. We show that MCM2-depleted cells activate a DNA damage response pathway and generate replication-associated DNA double-strand breaks...

  14. DNA Replication Is Required for Circadian Clock Function by Regulating Rhythmic Nucleosome Composition.

    Science.gov (United States)

    Liu, Xiao; Dang, Yunkun; Matsu-Ura, Toru; He, Yubo; He, Qun; Hong, Christian I; Liu, Yi

    2017-07-20

    Although the coupling between circadian and cell cycles allows circadian clocks to gate cell division and DNA replication in many organisms, circadian clocks were thought to function independently of cell cycle. Here, we show that DNA replication is required for circadian clock function in Neurospora. Genetic and pharmacological inhibition of DNA replication abolished both overt and molecular rhythmicities by repressing frequency (frq) gene transcription. DNA replication is essential for the rhythmic changes of nucleosome composition at the frq promoter. The FACT complex, known to be involved in histone disassembly/reassembly, is required for clock function and is recruited to the frq promoter in a replication-dependent manner to promote replacement of histone H2A.Z by H2A. Finally, deletion of H2A.Z uncoupled the dependence of the circadian clock on DNA replication. Together, these results establish circadian clock and cell cycle as interdependent coupled oscillators and identify DNA replication as a critical process in the circadian mechanism. Published by Elsevier Inc.

  15. Intragenic origins due to short G1 phases underlie oncogene-induced DNA replication stress.

    Science.gov (United States)

    Macheret, Morgane; Halazonetis, Thanos D

    2018-03-01

    Oncogene-induced DNA replication stress contributes critically to the genomic instability that is present in cancer. However, elucidating how oncogenes deregulate DNA replication has been impeded by difficulty in mapping replication initiation sites on the human genome. Here, using a sensitive assay to monitor nascent DNA synthesis in early S phase, we identified thousands of replication initiation sites in cells before and after induction of the oncogenes CCNE1 and MYC. Remarkably, both oncogenes induced firing of a novel set of DNA replication origins that mapped within highly transcribed genes. These ectopic origins were normally suppressed by transcription during G1, but precocious entry into S phase, before all genic regions had been transcribed, allowed firing of origins within genes in cells with activated oncogenes. Forks from oncogene-induced origins were prone to collapse, as a result of conflicts between replication and transcription, and were associated with DNA double-stranded break formation and chromosomal rearrangement breakpoints both in our experimental system and in a large cohort of human cancers. Thus, firing of intragenic origins caused by premature S phase entry represents a mechanism of oncogene-induced DNA replication stress that is relevant for genomic instability in human cancer.

  16. The Escherichia coli Tus-Ter replication fork barrier causes site-specific DNA replication perturbation in yeast.

    Science.gov (United States)

    Larsen, Nicolai B; Sass, Ehud; Suski, Catherine; Mankouri, Hocine W; Hickson, Ian D

    2014-04-07

    Replication fork (RF) pausing occurs at both 'programmed' sites and non-physiological barriers (for example, DNA adducts). Programmed RF pausing is required for site-specific DNA replication termination in Escherichia coli, and this process requires the binding of the polar terminator protein, Tus, to specific DNA sequences called Ter. Here, we demonstrate that Tus-Ter modules also induce polar RF pausing when engineered into the Saccharomyces cerevisiae genome. This heterologous RF barrier is distinct from a number of previously characterized, protein-mediated, RF pause sites in yeast, as it is neither Tof1-dependent nor counteracted by the Rrm3 helicase. Although the yeast replisome can overcome RF pausing at Tus-Ter modules, this event triggers site-specific homologous recombination that requires the RecQ helicase, Sgs1, for its timely resolution. We propose that Tus-Ter can be utilized as a versatile, site-specific, heterologous DNA replication-perturbing system, with a variety of potential applications.

  17. Hda, a novel DnaA-related protein, regulates the replication cycle in Escherichia coli.

    Science.gov (United States)

    Kato , J; Katayama, T

    2001-08-01

    The bacterial DnaA protein binds to the chromosomal origin of replication to trigger a series of initiation reactions, which leads to the loading of DNA polymerase III. In Escherichia coli, once this polymerase initiates DNA synthesis, ATP bound to DnaA is efficiently hydrolyzed to yield the ADP-bound inactivated form. This negative regulation of DnaA, which occurs through interaction with the beta-subunit sliding clamp configuration of the polymerase, functions in the temporal blocking of re-initiation. Here we show that the novel DnaA-related protein, Hda, from E.coli is essential for this regulatory inactivation of DnaA in vitro and in vivo. Our results indicate that the hda gene is required to prevent over-initiation of chromosomal replication and for cell viability. Hda belongs to the chaperone-like ATPase family, AAA(+), as do DnaA and certain eukaryotic proteins essential for the initiation of DNA replication. We propose that the once-per-cell-cycle rule of replication depends on the timely interaction of AAA(+) proteins that comprise the apparatus regulating the activity of the initiator of replication.

  18. Single-molecule mechanics of protein-labelled DNA handles

    Directory of Open Access Journals (Sweden)

    Vivek S. Jadhav

    2016-01-01

    Full Text Available DNA handles are often used as spacers and linkers in single-molecule experiments to isolate and tether RNAs, proteins, enzymes and ribozymes, amongst other biomolecules, between surface-modified beads for nanomechanical investigations. Custom DNA handles with varying lengths and chemical end-modifications are readily and reliably synthesized en masse, enabling force spectroscopic measurements with well-defined and long-lasting mechanical characteristics under physiological conditions over a large range of applied forces. Although these chemically tagged DNA handles are widely used, their further individual modification with protein receptors is less common and would allow for additional flexibility in grabbing biomolecules for mechanical measurements. In-depth information on reliable protocols for the synthesis of these DNA–protein hybrids and on their mechanical characteristics under varying physiological conditions are lacking in literature. Here, optical tweezers are used to investigate different protein-labelled DNA handles in a microfluidic environment under different physiological conditions. Digoxigenin (DIG-dsDNA-biotin handles of varying sizes (1000, 3034 and 4056 bp were conjugated with streptavidin or neutravidin proteins. The DIG-modified ends of these hybrids were bound to surface-modified polystyrene (anti-DIG beads. Using different physiological buffers, optical force measurements showed consistent mechanical characteristics with long dissociation times. These protein-modified DNA hybrids were also interconnected in situ with other tethered biotinylated DNA molecules. Electron-multiplying CCD (EMCCD imaging control experiments revealed that quantum dot–streptavidin conjugates at the end of DNA handles remain freely accessible. The experiments presented here demonstrate that handles produced with our protein–DNA labelling procedure are excellent candidates for grasping single molecules exposing tags suitable for molecular

  19. Differential association with cellular substructures of pseudorabies virus DNA during early and late phases of replication

    International Nuclear Information System (INIS)

    Ben-Porat, T.; Veach, R.A.; Blankenship, M.L.; Kaplan, A.S.

    1984-01-01

    Pseudorabies virus DNA synthesis can be divided into two phases, early and late, which can be distinguished from each other on the basis of the structures of the replicating DNA. The two types of replicating virus DNA can also be distinguished from each other on the basis of the cellular substructures with which each is associated. Analysis by electron microscopic autoradiography showed that during the first round of replication, nascent virus DNA was found in the vicinity of the nuclear membrane; during later rounds of replication the nascent virus DNA was located centrally within the nucleus. The degree of association of virus DNA synthesized at early and late phases with the nuclear matrix fractions also differed; a larger proportion of late than of early nascent virus DNA was associated with this fraction. While nascent cellular DNA only was associated in significant amounts with the nuclear matrix fraction, a large part (up to 40%) of all the virus DNA remained associated with this fraction. However, no retention of specific virus proteins in this fraction was observed. Except for two virus proteins, which were preferentially extracted from the nuclear matrix, approximately 20% of all virus proteins remained in the nuclear matrix fraction. The large proportion of virus DNA associated with the nuclear fraction indicated that virus DNA may be intimately associated with some proteins

  20. Antibacterial small molecules targeting the conserved TOPRIM domain of DNA gyrase.

    Directory of Open Access Journals (Sweden)

    Scott S Walker

    Full Text Available To combat the threat of antibiotic-resistant Gram-negative bacteria, novel agents that circumvent established resistance mechanisms are urgently needed. Our approach was to focus first on identifying bioactive small molecules followed by chemical lead prioritization and target identification. Within this annotated library of bioactives, we identified a small molecule with activity against efflux-deficient Escherichia coli and other sensitized Gram-negatives. Further studies suggested that this compound inhibited DNA replication and selection for resistance identified mutations in a subunit of E. coli DNA gyrase, a type II topoisomerase. Our initial compound demonstrated weak inhibition of DNA gyrase activity while optimized compounds demonstrated significantly improved inhibition of E. coli and Pseudomonas aeruginosa DNA gyrase and caused cleaved complex stabilization, a hallmark of certain bactericidal DNA gyrase inhibitors. Amino acid substitutions conferring resistance to this new class of DNA gyrase inhibitors reside exclusively in the TOPRIM domain of GyrB and are not associated with resistance to the fluoroquinolones, suggesting a novel binding site for a gyrase inhibitor.

  1. Activation of a yeast replication origin near a double-stranded DNA break.

    Science.gov (United States)

    Raghuraman, M K; Brewer, B J; Fangman, W L

    1994-03-01

    Irradiation in the G1 phase of the cell cycle delays the onset of DNA synthesis and transiently inhibits the activation of replication origins in mammalian cells. It has been suggested that this inhibition is the result of the loss of torsional tension in the DNA after it has been damaged. Because irradiation causes DNA damage at an undefined number of nonspecific sites in the genome, it is not known how cells respond to limited DNA damage, and how replication origins in the immediate vicinity of a damage site would behave. Using the sequence-specific HO endonuclease, we have created a defined double-stranded DNA break in a centromeric plasmid in G1-arrested cells of the yeast Saccharomyces cerevisiae. We show that replication does initiate at the origin on the cut plasmid, and that the plasmid replicates early in the S phase after linearization in vivo. These observations suggest that relaxation of a supercoiled DNA domain in yeast need not inactivate replication origins within that domain. Furthermore, these observations rule out the possibility that the late replication context associated with chromosomal termini is a consequence of DNA ends.

  2. Genetic variations in the DNA replication origins of human papillomavirus family correlate with their oncogenic potential.

    Science.gov (United States)

    Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B

    2018-04-01

    Human papillomaviruses (HPVs) encompass a large family of viruses that range from benign to highly carcinogenic. The crucial differences between benign and carcinogenic types of HPV remain unknown, except that the two HPV types differ in the frequency of DNA replication. We have systematically analyzed the mechanism of HPV DNA replication initiation in low-risk and high-risk HPVs. Our results demonstrate that HPV-encoded E2 initiator protein and its four binding sites in the replication origin play pivotal roles in determining the destiny of the HPV-infected cell. We have identified strain-specific single nucleotide variations in E2 binding sites found only in the high-risk HPVs. We have demonstrated that these variations result in attenuated formation of the E2-DNA complex. E2 binding to these sites is linked to the activation of the DNA replication origin as well as initiation of DNA replication. Both electrophoretic mobility shift assay and atomic force microscopy studies demonstrated that binding of E2 from either low- or high-risk HPVs with variant binding sequences lacked multimeric E2-DNA complex formation in vitro. These results provided a molecular basis of differential DNA replication in the two types of HPVs and pointed to a correlation with the development of cancer. Copyright © 2017. Published by Elsevier B.V.

  3. Inhibition of DNA replication and repair by anthralin or danthron in cultured human cells

    International Nuclear Information System (INIS)

    Clark, J.M.; Hanawalt, P.C.

    1982-01-01

    The comparative effects of the tumor promoter anthralin and its analog, danthron, on semiconservative DNA replication and DNA repair synthesis were studied in cultured human cells. Bromodeoxyuridine was used as density label together with 3 H-thymidine to distinguish replication from repair synthesis in isopycnic CsCl gradients. Anthralin at 1.1 microgram inhibited replication in T98G cells by 50%. In cells treated with 0.4 or 1.3 microM anthralin and additive effect was observed on the inhibition of replication by ultraviolet light (254 nm). In cells irradiated with 20 J/m2, 2.3 microM anthralin was required to inhibit repair synthesis by 50%. Thus there was no selective inhibitory effect of anthralin on repair synthesis. Danthron exhibited no detectable effect on either semiconservative replication or repair synthesis at concentrations below about 5.0 microM. Neither compound stimulated repair synthesis in the absence of ultraviolet irradiation. Thus, anthralin and danthron do not appear to react with DNA to form adducts that are subject to excision repair. Although both compounds appear to intercalate into supercoiled DNA in vitro to a limited extent, the degree of unwinding introduced by the respective drugs does not correlate with their relative effects on DNA synthesis in vivo. Therefore the inhibitory effect of anthralin on DNA replication and repair synthesis in T98G cells does not appear to result from the direct interaction of the drug with DNA

  4. DNA Replication and Cell Cycle Progression Regulatedby Long Range Interaction between Protein Complexes bound to DNA.

    Science.gov (United States)

    Matsson, L

    2001-12-01

    A nonstationary interaction that controlsDNA replication and the cell cycle isderived from many-body physics in achemically open T cell. The model predictsa long range force F'(ξ) =- (κ/2) ξ(1 - ξ)(2 - ξ)between thepre-replication complexes (pre-RCs) boundby the origins in DNA, ξ = ϕ/N being the relativedisplacement of pre-RCs, ϕ the number of pre-RCs, N the number of replicons to be replicated,and κ the compressibilitymodulus in the lattice of pre-RCs whichbehaves dynamically like an elasticallybraced string. Initiation of DNAreplication is induced at the thresholdϕ = N by a switch ofsign of F''(ξ), fromattraction (-) and assembly in the G(1) phase (0force at ϕ = 2N, from repulsion inS phase back to attraction in G(2), when all primed replicons havebeen duplicated once. F'(0) = 0corresponds to a resting cell in theabsence of driving force at ϕ= 0. The model thus ensures that the DNAcontent in G(2) cells is exactlytwice that of G(1) cells. The switch of interaction at the R-point, at which N pre-RCs have been assembled, starts the release of Rb protein thus also explaining the shift in the Rb phosphorylation from mitogen-dependent cyclinD to mitogen-independent cyclin E.Shape,slope and scale of the response curvesderived agree well with experimental datafrom dividing T cells and polymerising MTs,the variable length of which is due to anonlinear dependence of the growthamplitude on the initial concentrations oftubulin dimers and guanosine-tri-phosphate(GTP). The model also explains the dynamic instabilityin growing MTs.

  5. Single Molecule Screening of Disease DNA Without Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ji-Young [Iowa State Univ., Ames, IA (United States)

    2006-01-01

    The potential of single molecule detection as an analysis tool in biological and medical fields is well recognized today. This fast evolving technique will provide fundamental sensitivity to pick up individual pathogen molecules, and therefore contribute to a more accurate diagnosis and a better chance for a complete cure. Many studies are being carried out to successfully apply this technique in real screening fields. In this dissertation, several attempts are shown that have been made to test and refine the application of the single molecule technique as a clinical screening method. A basic applicability was tested with a 100% target content sample, using electrophoretic mobility and multiple colors as identification tools. Both electrophoretic and spectral information of individual molecule were collected within a second, while the molecule travels along the flow in a capillary. Insertion of a transmission grating made the recording of the whole spectrum of a dye-stained molecule possible without adding complicated instrumental components. Collecting two kinds of information simultaneously and combining them allowed more thorough identification, up to 98.8% accuracy. Probing mRNA molecules with fluorescently labeled cDNA via hybridization was also carried out. The spectral differences among target, probe, and hybrid were interpreted in terms of dispersion distances after transmission grating, and used for the identification of each molecule. The probes were designed to have the least background when they are free, but have strong fluorescence after hybridization via fluorescence resonance energy transfer. The mRNA-cDNA hybrids were further imaged in whole blood, plasma, and saliva, to test how far a crude preparation can be tolerated. Imaging was possible with up to 50% of clear bio-matrix contents, suggesting a simple lysis and dilution would be sufficient for imaging for some cells. Real pathogen DNA of human papillomavirus (HPV) type-I6 in human genomic DNA

  6. Dynamic Architecture of Eukaryotic DNA Replication Forks In Vivo, Visualized by Electron Microscopy.

    Science.gov (United States)

    Zellweger, Ralph; Lopes, Massimo

    2018-01-01

    The DNA replication process can be heavily perturbed by several different conditions of genotoxic stress, particularly relevant for cancer onset and therapy. The combination of psoralen crosslinking and electron microscopy has proven instrumental to reveal the fine architecture of in vivo DNA replication intermediates and to uncover their remodeling upon specific conditions of genotoxic stress. The replication structures are stabilized in vivo (by psoralen crosslinking) prior to extraction and enrichment procedures, allowing their visualization at the transmission electron microscope. This chapter outlines the procedures required to visualize and interpret in vivo replication intermediates of eukaryotic genomic DNA, and includes an improved method for enrichment of replication intermediates, compared to previously used BND-cellulose columns.

  7. Nuclear DNA Replication in Trypanosomatids: There Are No Easy Methods for Solving Difficult Problems.

    Science.gov (United States)

    da Silva, Marcelo S; Pavani, Raphael S; Damasceno, Jeziel D; Marques, Catarina A; McCulloch, Richard; Tosi, Luiz Ricardo Orsini; Elias, Maria Carolina

    2017-11-01

    In trypanosomatids, etiological agents of devastating diseases, replication is robust and finely controlled to maintain genome stability and function in stressful environments. However, these parasites encode several replication protein components and complexes that show potentially variant composition compared with model eukaryotes. This review focuses on the advances made in recent years regarding the differences and peculiarities of the replication machinery in trypanosomatids, including how such divergence might affect DNA replication dynamics and the replication stress response. Comparing the DNA replication machinery and processes of parasites and their hosts may provide a foundation for the identification of targets that can be used in the development of chemotherapies to assist in the eradication of diseases caused by these pathogens. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  8. How and why multiple MCMs are loaded at origins of DNA replication.

    Science.gov (United States)

    Das, Shankar P; Rhind, Nicholas

    2016-07-01

    Recent work suggests that DNA replication origins are regulated by the number of multiple mini-chromosome maintenance (MCM) complexes loaded. Origins are defined by the loading of MCM - the replicative helicase which initiates DNA replication and replication kinetics determined by origin's location and firing times. However, activation of MCM is heterogeneous; different origins firing at different times in different cells. Also, more MCMs are loaded in G1 than are used in S phase. These aspects of MCM biology are explained by the observation that multiple MCMs are loaded at origins. Having more MCMs at early origins makes them more likely to fire, effecting differences in origin efficiency that define replication timing. Nonetheless, multiple MCM loading raises new questions, such as how they are loaded, where these MCMs reside at origins, and how their presence affects replication timing. In this review, we address these questions and discuss future avenues of research. © 2016 WILEY Periodicals, Inc.

  9. Analysis of DNA interactions using single-molecule force spectroscopy.

    Science.gov (United States)

    Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert

    2013-06-01

    Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.

  10. DNA Replication Dynamics of the GGGGCC Repeat of the C9orf72 Gene.

    Science.gov (United States)

    Thys, Ryan Griffin; Wang, Yuh-Hwa

    2015-11-27

    DNA has the ability to form a variety of secondary structures in addition to the normal B-form DNA, including hairpins and quadruplexes. These structures are implicated in a number of neurological diseases and cancer. Expansion of a GGGGCC repeat located at C9orf72 is associated with familial amyotrophic lateral sclerosis and frontotemporal dementia. This repeat expands from two to 24 copies in normal individuals to several hundreds or thousands of repeats in individuals with the disease. Biochemical studies have demonstrated that as little as four repeats have the ability to form a stable DNA secondary structure known as a G-quadruplex. Quadruplex structures have the ability to disrupt normal DNA processes such as DNA replication and transcription. Here we examine the role of GGGGCC repeat length and orientation on DNA replication using an SV40 replication system in human cells. Replication through GGGGCC repeats leads to a decrease in overall replication efficiency and an increase in instability in a length-dependent manner. Both repeat expansions and contractions are observed, and replication orientation is found to influence the propensity for expansions or contractions. The presence of replication stress, such as low-dose aphidicolin, diminishes replication efficiency but has no effect on instability. Two-dimensional gel electrophoresis analysis demonstrates a replication stall with as few as 20 GGGGCC repeats. These results suggest that replication of the GGGGCC repeat at C9orf72 is perturbed by the presence of expanded repeats, which has the potential to result in further expansion, leading to disease. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Inhibition and recovery of the replication of depurinated parvovirus DNA in mouse fibroblasts

    International Nuclear Information System (INIS)

    Vos, J.M.; Avalosse, B.; Su, Z.Z.; Rommelaere, J.

    1984-01-01

    Apurinic sites were introduced in the single-stranded DNA of parvovirus minute-virus-of-mice (MVM) and their effect on viral DNA synthesis was measured in mouse fibroblasts. Approximately one apurinic site per viral genome, is sufficient to block its replication in untreated cells. The exposure of host cells to a sublethal dose of UV-light 15 hours prior to virus infection, enhances their ability to support the replication of depurinated MVM. Cell preirradiation induces the apparent overcome of 10-15% of viral DNA replication blocks. These results indicate that apurinic sites prevent mammalian cells from replicating single-stranded DNA unless a recovery process is activated by cell UV-irradiation

  12. The effect of DNA replication on mutation of the Saccharomyces cerevisiae CDC8 gene.

    Science.gov (United States)

    Zaborowska, D; Zuk, J

    1990-04-01

    Incubation in YPD medium under permissive conditions when DNA replication is going on, strongly stimulates the induction of cdc+ colonies of UV-irradiated cells of yeast strains HB23 (cdc8-1/cdc8-3), HB26 (cdc8-3/cdc8-3) and HB7 (cdc8-1/cdc8-1). Inhibition of DNA replication by hydroxyurea, araCMP, cycloheximide or caffeine or else by incubation in phosphate buffer pH 7.0, abolishes this stimulation. Thus the replication of DNA is strongly correlated with the high induction of cdc+ colonies by UV irradiation. It is postulated that these UV-induced cdc+ colonies arise as the result infidelity in DNA replication.

  13. Fidelity of DNA Replication in Normal and Malignant Human Breast Cells

    National Research Council Canada - National Science Library

    Sekowski, Jennifer

    1998-01-01

    In order to determine the degree to which the accumulation of mutations in breast cancer cells is due to a change in the fidelity of the cellular DNA replication machinery we have completed a series...

  14. Bacillus subtilis DNA polymerases, PolC and DnaE, are required for both leading and lagging strand synthesis in SPP1 origin-dependent DNA replication

    Science.gov (United States)

    Seco, Elena M.

    2017-01-01

    Abstract Firmicutes have two distinct replicative DNA polymerases, the PolC leading strand polymerase, and PolC and DnaE synthesizing the lagging strand. We have reconstituted in vitro Bacillus subtilis bacteriophage SPP1 θ-type DNA replication, which initiates unidirectionally at oriL. With this system we show that DnaE is not only restricted to lagging strand synthesis as previously suggested. DnaG primase and DnaE polymerase are required for initiation of DNA replication on both strands. DnaE and DnaG synthesize in concert a hybrid RNA/DNA ‘initiation primer’ on both leading and lagging strands at the SPP1 oriL region, as it does the eukaryotic Pol α complex. DnaE, as a RNA-primed DNA polymerase, extends this initial primer in a reaction modulated by DnaG and one single-strand binding protein (SSB, SsbA or G36P), and hands off the initiation primer to PolC, a DNA-primed DNA polymerase. Then, PolC, stimulated by DnaG and the SSBs, performs the bulk of DNA chain elongation at both leading and lagging strands. Overall, these modulations by the SSBs and DnaG may contribute to the mechanism of polymerase switch at Firmicutes replisomes. PMID:28575448

  15. Epigenetically-inherited centromere and neocentromere DNA replicates earliest in S-phase.

    Directory of Open Access Journals (Sweden)

    Amnon Koren

    2010-08-01

    Full Text Available Eukaryotic centromeres are maintained at specific chromosomal sites over many generations. In the budding yeast Saccharomyces cerevisiae, centromeres are genetic elements defined by a DNA sequence that is both necessary and sufficient for function; whereas, in most other eukaryotes, centromeres are maintained by poorly characterized epigenetic mechanisms in which DNA has a less definitive role. Here we use the pathogenic yeast Candida albicans as a model organism to study the DNA replication properties of centromeric DNA. By determining the genome-wide replication timing program of the C. albicans genome, we discovered that each centromere is associated with a replication origin that is the first to fire on its respective chromosome. Importantly, epigenetic formation of new ectopic centromeres (neocentromeres was accompanied by shifts in replication timing, such that a neocentromere became the first to replicate and became associated with origin recognition complex (ORC components. Furthermore, changing the level of the centromere-specific histone H3 isoform led to a concomitant change in levels of ORC association with centromere regions, further supporting the idea that centromere proteins determine origin activity. Finally, analysis of centromere-associated DNA revealed a replication-dependent sequence pattern characteristic of constitutively active replication origins. This strand-biased pattern is conserved, together with centromere position, among related strains and species, in a manner independent of primary DNA sequence. Thus, inheritance of centromere position is correlated with a constitutively active origin of replication that fires at a distinct early time. We suggest a model in which the distinct timing of DNA replication serves as an epigenetic mechanism for the inheritance of centromere position.

  16. Mutant p53 perturbs DNA replication checkpoint control through TopBP1 and Treslin.

    Science.gov (United States)

    Liu, Kang; Lin, Fang-Tsyr; Graves, Joshua D; Lee, Yu-Ju; Lin, Weei-Chin

    2017-05-09

    Accumulating evidence supports the gain-of-function of mutant forms of p53 (mutp53s). However, whether mutp53 directly perturbs the DNA replication checkpoint remains unclear. Previously, we have demonstrated that TopBP1 forms a complex with mutp53s and mediates their gain-of-function through NF-Y and p63/p73. Akt phosphorylates TopBP1 and induces its oligomerization, which inhibits its ATR-activating function. Here we show that various contact and conformational mutp53s bypass Akt to induce TopBP1 oligomerization and attenuate ATR checkpoint response during replication stress. The effect on ATR response caused by mutp53 can be exploited in a synthetic lethality strategy, as depletion of another ATR activator, DNA2, in mutp53-R273H-expressing cancer cells renders cells hypersensitive to cisplatin. Expression of mutp53-R273H also makes cancer cells more sensitive to DNA2 depletion or DNA2 inhibitors. In addition to ATR-activating function during replication stress, TopBP1 interacts with Treslin in a Cdk-dependent manner to initiate DNA replication during normal growth. We find that mutp53 also interferes with TopBP1 replication function. Several contact, but not conformational, mutp53s enhance the interaction between TopBP1 and Treslin and promote DNA replication despite the presence of a Cdk2 inhibitor. Together, these data uncover two distinct mechanisms by which mutp53 enhances DNA replication: ( i ) Both contact and conformational mutp53s can bind TopBP1 and attenuate the checkpoint response to replication stress, and ( ii ) during normal growth, contact (but not conformational) mutp53s can override the Cdk2 requirement to promote replication by facilitating the TopBP1/Treslin interaction.

  17. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

    Science.gov (United States)

    Laporta, Robert F.; Taichman, Lorne B.

    1982-06-01

    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  18. Genetic recombination in escherichia coli and its relationship with DNA replication

    International Nuclear Information System (INIS)

    Siddiqui, O.

    1974-01-01

    Relationship of DNA replication with genetic recombination in Escherichia Coli was investigated by mating Hfr donors labelled with H 3 -thymine, C 13 and N 15 to C 13 N 15 labelled recipients. The DNA extracted from the zygotes was analysed on CsCl density gradients. The results show that all of the biparentally labelled DNA arises from the single strand insertions of the donor DNA. (M.G.B.)

  19. Dynamics of DNA replication during premeiosis and early meiosis in wheat.

    Science.gov (United States)

    Rey, María-Dolores; Prieto, Pilar

    2014-01-01

    Meiosis is a specialised cell division that involves chromosome replication, two rounds of chromosome segregation and results in the formation of the gametes. Meiotic DNA replication generally precedes chromosome pairing, recombination and synapsis in sexually developing eukaryotes. In this work, replication has been studied during premeiosis and early meiosis in wheat using flow cytometry, which has allowed the quantification of the amount of DNA in wheat anther in each phase of the cell cycle during premeiosis and each stage of early meiosis. Flow cytometry has been revealed as a suitable and user-friendly tool to detect and quantify DNA replication during early meiosis in wheat. Chromosome replication was detected in wheat during premeiosis and early meiosis until the stage of pachytene, when chromosomes are associated in pairs to further recombine and correctly segregate in the gametes. In addition, the effect of the Ph1 locus, which controls chromosome pairing and affects replication in wheat, was also studied by flow cytometry. Here we showed that the Ph1 locus plays an important role on the length of meiotic DNA replication in wheat, particularly affecting the rate of replication during early meiosis in wheat.

  20. DNA replication machinery is required for development in Drosophila.

    Science.gov (United States)

    Kohzaki, Hidetsugu; Asano, Maki; Murakami, Yota

    2018-01-01

     In Drosophila , some factors involved in chromosome replication seem to be involved in gene amplification and endoreplication, which are actively utilized in particular tissue development, but direct evidence has not been shown. Therefore, we examined the effect of depletion of replication factors on these processes. First, we confirmed RNAi knockdown can be used for the depletion of replication factors by comparing the phenotypes of RNAi knockdown and deletion or point mutants of the components of DNA licensing factor, MCM2, MCM4 and Cdt1. Next, we found that tissue-specific RNAi knockdown of replication factors caused tissue-specific defects, probably due to defects in DNA replication. In particular, we found that depletion inhibited gene amplification of the chorion gene in follicle cells and endoreplication in salivary glands, showing that chromosomal DNA replication factors are required for these processes. Finally, using RNAi, we screened the genes for chromosomal DNA replication that affected tissue development. Interestingly, wing specific knockdown of Mcm10 induced wing formation defects. These results suggest that some components of chromosomal replication machinery are directly involved in tissue development.

  1. ATAD2 is an epigenetic reader of newly synthesized histone marks during DNA replication.

    Science.gov (United States)

    Koo, Seong Joo; Fernández-Montalván, Amaury E; Badock, Volker; Ott, Christopher J; Holton, Simon J; von Ahsen, Oliver; Toedling, Joern; Vittori, Sarah; Bradner, James E; Gorjánácz, Mátyás

    2016-10-25

    ATAD2 (ATPase family AAA domain-containing protein 2) is a chromatin regulator harboring an AAA+ ATPase domain and a bromodomain, previously proposed to function as an oncogenic transcription co-factor. Here we suggest that ATAD2 is also required for DNA replication. ATAD2 is co-expressed with genes involved in DNA replication in various cancer types and predominantly expressed in S phase cells where it localized on nascent chromatin (replication sites). Our extensive biochemical and cellular analyses revealed that ATAD2 is recruited to replication sites through a direct interaction with di-acetylated histone H4 at K5 and K12, indicative of newly synthesized histones during replication-coupled chromatin reassembly. Similar to ATAD2-depletion, ectopic expression of ATAD2 mutants that are deficient in binding to these di-acetylation marks resulted in reduced DNA replication and impaired loading of PCNA onto chromatin, suggesting relevance of ATAD2 in DNA replication. Taken together, our data show a novel function of ATAD2 in cancer and for the first time identify a reader of newly synthesized histone di-acetylation-marks during replication.

  2. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  3. The pathological consequences of impaired genome integrity in humans; disorders of the DNA replication machinery.

    Science.gov (United States)

    O'Driscoll, Mark

    2017-01-01

    Accurate and efficient replication of the human genome occurs in the context of an array of constitutional barriers, including regional topological constraints imposed by chromatin architecture and processes such as transcription, catenation of the helical polymer and spontaneously generated DNA lesions, including base modifications and strand breaks. DNA replication is fundamentally important for tissue development and homeostasis; differentiation programmes are intimately linked with stem cell division. Unsurprisingly, impairments of the DNA replication machinery can have catastrophic consequences for genome stability and cell division. Functional impacts on DNA replication and genome stability have long been known to play roles in malignant transformation through a variety of complex mechanisms, and significant further insights have been gained from studying model organisms in this context. Congenital hypomorphic defects in components of the DNA replication machinery have been and continue to be identified in humans. These disorders present with a wide range of clinical features. Indeed, in some instances, different mutations in the same gene underlie different clinical presentations. Understanding the origin and molecular basis of these features opens a window onto the range of developmental impacts of suboptimal DNA replication and genome instability in humans. Here, I will briefly overview the basic steps involved in DNA replication and the key concepts that have emerged from this area of research, before switching emphasis to the pathological consequences of defects within the DNA replication network; the human disorders. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  4. Analysis of JC virus DNA replication using a quantitative and high-throughput assay

    Science.gov (United States)

    Shin, Jong; Phelan, Paul J.; Chhum, Panharith; Bashkenova, Nazym; Yim, Sung; Parker, Robert; Gagnon, David; Gjoerup, Ole; Archambault, Jacques; Bullock, Peter A.

    2015-01-01

    Progressive Multifocal Leukoencephalopathy (PML) is caused by lytic replication of JC virus (JCV) in specific cells of the central nervous system. Like other polyomaviruses, JCV encodes a large T-antigen helicase needed for replication of the viral DNA. Here, we report the development of a luciferase-based, quantitative and high-throughput assay of JCV DNA replication in C33A cells, which, unlike the glial cell lines Hs 683 and U87, accumulate high levels of nuclear T-ag needed for robust replication. Using this assay, we investigated the requirement for different domains of T-ag, and for specific sequences within and flanking the viral origin, in JCV DNA replication. Beyond providing validation of the assay, these studies revealed an important stimulatory role of the transcription factor NF1 in JCV DNA replication. Finally, we show that the assay can be used for inhibitor testing, highlighting its value for the identification of antiviral drugs targeting JCV DNA replication. PMID:25155200

  5. Prereplicative complexes assembled in vitro support origin-dependent and independent DNA replication

    Science.gov (United States)

    On, Kin Fan; Beuron, Fabienne; Frith, David; Snijders, Ambrosius P; Morris, Edward P; Diffley, John F X

    2014-01-01

    Eukaryotic DNA replication initiates from multiple replication origins. To ensure each origin fires just once per cell cycle, initiation is divided into two biochemically discrete steps: the Mcm2-7 helicase is first loaded into prereplicative complexes (pre-RCs) as an inactive double hexamer by the origin recognition complex (ORC), Cdt1 and Cdc6; the helicase is then activated by a set of “firing factors.” Here, we show that plasmids containing pre-RCs assembled with purified proteins support complete and semi-conservative replication in extracts from budding yeast cells overexpressing firing factors. Replication requires cyclin-dependent kinase (CDK) and Dbf4-dependent kinase (DDK). DDK phosphorylation of Mcm2-7 does not by itself promote separation of the double hexamer, but is required for the recruitment of firing factors and replisome components in the extract. Plasmid replication does not require a functional replication origin; however, in the presence of competitor DNA and limiting ORC concentrations, replication becomes origin-dependent in this system. These experiments indicate that Mcm2-7 double hexamers can be precursors of replication and provide insight into the nature of eukaryotic DNA replication origins. PMID:24566989

  6. DNA adenine methylation is required to replicate both Vibrio cholerae chromosomes once per cell cycle.

    Science.gov (United States)

    Demarre, Gaëlle; Chattoraj, Dhruba K

    2010-05-06

    DNA adenine methylation is widely used to control many DNA transactions, including replication. In Escherichia coli, methylation serves to silence newly synthesized (hemimethylated) sister origins. SeqA, a protein that binds to hemimethylated DNA, mediates the silencing, and this is necessary to restrict replication to once per cell cycle. The methylation, however, is not essential for replication initiation per se but appeared so when the origins (oriI and oriII) of the two Vibrio cholerae chromosomes were used to drive plasmid replication in E. coli. Here we show that, as in the case of E. coli, methylation is not essential for oriI when it drives chromosomal replication and is needed for once-per-cell-cycle replication in a SeqA-dependent fashion. We found that oriII also needs SeqA for once-per-cell-cycle replication and, additionally, full methylation for efficient initiator binding. The requirement for initiator binding might suffice to make methylation an essential function in V. cholerae. The structure of oriII suggests that it originated from a plasmid, but unlike plasmids, oriII makes use of methylation for once-per-cell-cycle replication, the norm for chromosomal but not plasmid replication.

  7. DNA adenine methylation is required to replicate both Vibrio cholerae chromosomes once per cell cycle.

    Directory of Open Access Journals (Sweden)

    Gaëlle Demarre

    2010-05-01

    Full Text Available DNA adenine methylation is widely used to control many DNA transactions, including replication. In Escherichia coli, methylation serves to silence newly synthesized (hemimethylated sister origins. SeqA, a protein that binds to hemimethylated DNA, mediates the silencing, and this is necessary to restrict replication to once per cell cycle. The methylation, however, is not essential for replication initiation per se but appeared so when the origins (oriI and oriII of the two Vibrio cholerae chromosomes were used to drive plasmid replication in E. coli. Here we show that, as in the case of E. coli, methylation is not essential for oriI when it drives chromosomal replication and is needed for once-per-cell-cycle replication in a SeqA-dependent fashion. We found that oriII also needs SeqA for once-per-cell-cycle replication and, additionally, full methylation for efficient initiator binding. The requirement for initiator binding might suffice to make methylation an essential function in V. cholerae. The structure of oriII suggests that it originated from a plasmid, but unlike plasmids, oriII makes use of methylation for once-per-cell-cycle replication, the norm for chromosomal but not plasmid replication.

  8. Characterizing the Final Steps of Chromosomal Replication at the Single-molecule Level in the Model System Escherichia coli

    KAUST Repository

    Elshenawy, Mohamed M.

    2015-12-01

    In the circular Escherichia coli chromosome, two replisomes are assembled at the unique origin of replication and drive DNA synthesis in opposite directions until they meet in the terminus region across from the origin. Despite the difference in rates of the two replisomes, their arrival at the terminus is synchronized through a highly specialized system consisting of the terminator protein (Tus) bound to the termination sites (Ter). This synchronicity is mediated by the polarity of the Tus−Ter complex that stops replisomes from one direction (non-permissive face) but not the other (permissive face). Two oppositely oriented clusters of five Tus–Ters that each block one of the two replisomes create a “replication fork trap” for the first arriving replisome while waiting for the late arriving one. Despite extensive biochemical and structural studies, the molecular mechanism behind Tus−Ter polar arrest activity remained controversial. Moreover, none of the previous work provided answers for the long-standing discrepancy between the ability of Tus−Ter to permanently stop replisomes in vitro and its low efficiency in vivo. Here, I spearheaded a collaborative project that combined single-molecule DNA replication assays, X-ray crystallography and binding studies to provide a true molecular-level understanding of the underlying mechanism of Tus−Ter polar arrest activity. We showed that efficiency of Tus−Ter is determined by a head-to-head kinetic competition between rate of strand separation by the replisome and rate of rearrangement of Tus−Ter interactions during the melting of the first 6 base pairs of Ter. This rearrangement maintains Tus’s strong grip on the DNA and stops the advancing replisome from breaking into Tus−Ter central interactions, but only transiently. We further showed how this kinetic competition functions within the context of two mechanisms to impose permanent fork stoppage. The rate-dependent fork arrest activity of Tus

  9. In Vitro Whole Genome DNA Binding Analysis of the Bacterial Replication Initiator and Transcription Factor DnaA.

    Directory of Open Access Journals (Sweden)

    Janet L Smith

    2015-05-01

    Full Text Available DnaA, the replication initiation protein in bacteria, is an AAA+ ATPase that binds and hydrolyzes ATP and exists in a heterogeneous population of ATP-DnaA and ADP-DnaA. DnaA binds cooperatively to the origin of replication and several other chromosomal regions, and functions as a transcription factor at some of these regions. We determined the binding properties of Bacillus subtilis DnaA to genomic DNA in vitro at single nucleotide resolution using in vitro DNA affinity purification and deep sequencing (IDAP-Seq. We used these data to identify 269 binding regions, refine the consensus sequence of the DnaA binding site, and compare the relative affinity of binding regions for ATP-DnaA and ADP-DnaA. Most sites had a slightly higher affinity for ATP-DnaA than ADP-DnaA, but a few had a strong preference for binding ATP-DnaA. Of the 269 sites, only the eight strongest binding ones have been observed to bind DnaA in vivo, suggesting that other cellular factors or the amount of available DnaA in vivo restricts DnaA binding to these additional sites. Conversely, we found several chromosomal regions that were bound by DnaA in vivo but not in vitro, and that the nucleoid-associated protein Rok was required for binding in vivo. Our in vitro characterization of the inherent ability of DnaA to bind the genome at single nucleotide resolution provides a backdrop for interpreting data on in vivo binding and regulation of DnaA, and is an approach that should be adaptable to many other DNA binding proteins.

  10. Enhanced replication of damaged SV40 DNA in carcinogen-treated monkey cells

    International Nuclear Information System (INIS)

    Maga, J.A.; Dixon, K.

    1984-01-01

    Treatment of mammalian cells with certain chemical or physical carcinogens prior to infection with ultraviolet-irradiated virus results in enhanced survival or reactivation of the damaged virus. To investigate the molecular basis of this enhanced reactivation (ER), Simian virus 40 DNA replication in carcinogen-treated cells was examined. Treatment of monkey kidney cells with N-acetoxy-2-acetylamino-fluorene or UV radiation 24 h prior to infection with ultraviolet-irradiated Simian virus 40 leads to enhancement of viral DNA replication measured at 36 h after infection by [ 3 H]thymidine incorporation or hybridization. The enhancement of DNA replication is observed when cells are treated from 1 to 60 h before infection or 1 to 16 h after infection. The fact that enhancement is observed also when cells are treated after infection rules out the possiblity that enhancement occurs at the level of adsorption or penetration of the virus. Measurements of the time course of viral DNA replication indicate that pretreatment of cells does not alter the time of onset of viral DNA replication. It is concluded that ER of Simain virus 40 occurs at the level of viral DNA replication. (author)

  11. Variety of DNA Replication Activity Among Cyanobacteria Correlates with Distinct Respiration Activity in the Dark.

    Science.gov (United States)

    Ohbayashi, Ryudo; Yamamoto, Jun-Ya; Watanabe, Satoru; Kanesaki, Yu; Chibazakura, Taku; Miyagishima, Shin-Ya; Yoshikawa, Hirofumi

    2017-02-01

    Cyanobacteria exhibit light-dependent cell growth since most of their cellular energy is obtained by photosynthesis. In Synechococcus elongatus PCC 7942, one of the model cyanobacteria, DNA replication depends on photosynthetic electron transport. However, the critical signal for the regulatory mechanism of DNA replication has not been identified. In addition, conservation of this regulatory mechanism has not been investigated among cyanobacteria. To understand this regulatory signal and its dependence on light, we examined the regulation of DNA replication under both light and dark conditions among three model cyanobacteria, S. elongatus PCC 7942, Synechocystis sp. PCC 6803 and Anabaena sp. PCC 7120. Interestingly, DNA replication activity in Synechocystis and Anabaena was retained when cells were transferred to the dark, although it was drastically decreased in S. elongatus. Glycogen metabolism and respiration were higher in Synechocystis and Anabaena than in S. elongatus in the dark. Moreover, DNA replication activity in Synechocystis and Anabaena was reduced to the same level as that in S. elongatus by inhibition of respiratory electron transport after transfer to the dark. These results demonstrate that there is disparity in DNA replication occurring in the dark among cyanobacteria, which is caused by the difference in activity of respiratory electron transport. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  12. Inhibition of DNA replication by ozone in Chinese Hamster V79 cells

    International Nuclear Information System (INIS)

    Rasmussen, R.E.

    1986-01-01

    DNA replication in Chinese hamster lung fibroblasts, line V79, was depressed in a dose-dependent manner over an ozone concentration range of 1-10 ppm. When the cells were exposed for 1 h at concentrations up to 6 ppm, the rate of DNA replication, as measured by [ 3 H]thymidine incorporation, declined further during a 3-h period immediately following exposure. At higher ozone concentrations, at which more than 99.9% of the cells were killed, no further decline in DNA replication was seen beyond that immediately following exposure. Cultures exposed for 1 h to 10 mM ethyl methanesulfonate or to 10 J/m 2 of ultraviolet (UV) light showed a similar progressive decline in the rate of DNA replication. The inhibition of DNA replication by ozone resembled that seen after exposure of cells to chemical mutagens or radiation and did not resemble the inhibition produced by metabolic poisons. The results may indicate that ozone or its reaction products interact directly with DNA in a way that inhibits replication

  13. High-affinity DNA-binding Domains of Replication Protein A (RPA) Direct SMARCAL1-dependent Replication Fork Remodeling*

    Science.gov (United States)

    Bhat, Kamakoti P.; Bétous, Rémy; Cortez, David

    2015-01-01

    SMARCAL1 catalyzes replication fork remodeling to maintain genome stability. It is recruited to replication forks via an interaction with replication protein A (RPA), the major ssDNA-binding protein in eukaryotic cells. In addition to directing its localization, RPA also activates SMARCAL1 on some fork substrates but inhibits it on others, thereby conferring substrate specificity to SMARCAL1 fork-remodeling reactions. We investigated the mechanism by which RPA regulates SMARCAL1. Our results indicate that although an interaction between SMARCAL1 and RPA is essential for SMARCAL1 activation, the location of the interacting surface on RPA is not. Counterintuitively, high-affinity DNA binding of RPA DNA-binding domain (DBD) A and DBD-B near the fork junction makes it easier for SMARCAL1 to remodel the fork, which requires removing RPA. We also found that RPA DBD-C and DBD-D are not required for SMARCAL1 regulation. Thus, the orientation of the high-affinity RPA DBDs at forks dictates SMARCAL1 substrate specificity. PMID:25552480

  14. High-affinity DNA-binding domains of replication protein A (RPA) direct SMARCAL1-dependent replication fork remodeling.

    Science.gov (United States)

    Bhat, Kamakoti P; Bétous, Rémy; Cortez, David

    2015-02-13

    SMARCAL1 catalyzes replication fork remodeling to maintain genome stability. It is recruited to replication forks via an interaction with replication protein A (RPA), the major ssDNA-binding protein in eukaryotic cells. In addition to directing its localization, RPA also activates SMARCAL1 on some fork substrates but inhibits it on others, thereby conferring substrate specificity to SMARCAL1 fork-remodeling reactions. We investigated the mechanism by which RPA regulates SMARCAL1. Our results indicate that although an interaction between SMARCAL1 and RPA is essential for SMARCAL1 activation, the location of the interacting surface on RPA is not. Counterintuitively, high-affinity DNA binding of RPA DNA-binding domain (DBD) A and DBD-B near the fork junction makes it easier for SMARCAL1 to remodel the fork, which requires removing RPA. We also found that RPA DBD-C and DBD-D are not required for SMARCAL1 regulation. Thus, the orientation of the high-affinity RPA DBDs at forks dictates SMARCAL1 substrate specificity. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Inhibition of human Chk1 causes increased initiation of DNA replication, phosphorylation of ATR targets, and DNA breakage

    DEFF Research Database (Denmark)

    Syljuåsen, Randi G; Sørensen, Claus Storgaard; Hansen, Lasse Tengbjerg

    2005-01-01

    by increased amounts of nonextractable RPA protein, formation of single-stranded DNA, and induction of DNA strand breaks. Moreover, these responses were prevented by siRNA-mediated downregulation of Cdk2 or the replication initiation protein Cdc45, or by addition of the CDK inhibitor roscovitine. We propose...

  16. Effects of DNA polymerase inhibitors on replicative and repair DNA synthesis in ultraviolet-irradiated HeLa cells

    International Nuclear Information System (INIS)

    Morita, T.; Nakamura, H.; Tsutsui, Y.; Nishiyama, Y.; Yoshida, S.

    1982-01-01

    Aphidicolin specifically inhibits eukaryotic DNA polymerase α, while 2',3'-dideoxythymidine 5'-triphosphate (d 2 TTP) inhibits DNA polymerase ν and ν but not α. 1-ν-D-Arabinofuranosylcytosine 5'-triphosphate (araCTP) inhibits both DNA polymerase α and ν although to a different extent. Here we measured the effects of these inhibitors on repair DNA synthesis of U.V.-irradiated HeLa cells by two different methods. Firstly, aphidicolin, 1-ν-D-arabinofuranosylcytosine (araC, a precursor of araCTP) and 2',3'-dideoxythimidine (d 2 Thd, a precursor of d 2 TTP) were added directly to the culture medium. In this case, aphidicolin and araC strongly inhibited replicative DNA synthesis of HeLa cells, and they also inhibited repair synthesis after U.V.-irradiation but to a much lesser extent. In contrast, high concentrations of d 2 Thd inhibited repair DNA synthesis to a higher extent than replicative DNA synthesis. Secondly, the active form of inhibitor, d 2 TTP, was microinjected directly into cytoplasm or nuclei or U.V.-irradiated HeLa cells. Microinjection of d 2 TTP effectively inhibited repair synthesis. The microinjection of d 2 TTP, into either cytoplasm or nucleus, strongly inhibited replicative synthesis. These results might indicate that multiple DNA polymerases are involved in repair synthesis as well as in replicative synthesis

  17. High-fidelity DNA replication in Mycobacterium tuberculosis relies on a trinuclear zinc center.

    Science.gov (United States)

    Baños-Mateos, Soledad; van Roon, Anne-Marie M; Lang, Ulla F; Maslen, Sarah L; Skehel, J Mark; Lamers, Meindert H

    2017-10-11

    High-fidelity DNA replication depends on a proofreading 3'-5' exonuclease that is associated with the replicative DNA polymerase. The replicative DNA polymerase DnaE1 from the major pathogen Mycobacterium tuberculosis (Mtb) uses its intrinsic PHP-exonuclease that is distinct from the canonical DEDD exonucleases found in the Escherichia coli and eukaryotic replisomes. The mechanism of the PHP-exonuclease is not known. Here, we present the crystal structure of the Mtb DnaE1 polymerase. The PHP-exonuclease has a trinuclear zinc center, coordinated by nine conserved residues. Cryo-EM analysis reveals the entry path of the primer strand in the PHP-exonuclease active site. Furthermore, the PHP-exonuclease shows a striking similarity to E. coli endonuclease IV, which provides clues regarding the mechanism of action. Altogether, this work provides important insights into the PHP-exonuclease and reveals unique properties that make it an attractive target for novel anti-mycobacterial drugs.The polymerase and histidinol phosphatase (PHP) domain in the DNA polymerase DnaE1 is essential for mycobacterial high-fidelity DNA replication. Here, the authors determine the DnaE1 crystal structure, which reveals the PHP-exonuclease mechanism that can be exploited for antibiotic development.

  18. Chromium reduces the in vitro activity and fidelity of DNA replication mediated by the human cell DNA synthesome

    International Nuclear Information System (INIS)

    Dai Heqiao; Liu Jianying; Malkas, Linda H.; Catalano, Jennifer; Alagharu, Srilakshmi; Hickey, Robert J.

    2009-01-01

    Hexavalent chromium Cr(VI) is known to be a carcinogenic metal ion, with a complicated mechanism of action. It can be found within our environment in soil and water contaminated by manufacturing processes. Cr(VI) ion is readily taken up by cells, and is recognized to be both genotoxic and cytotoxic; following its reduction to the stable trivalent form of the ion, chromium(Cr(III)), within cells. This form of the ion is known to impede the activity of cellular DNA polymerase and polymerase-mediated DNA replication. Here, we report the effects of chromium on the activity and fidelity of the DNA replication process mediated by the human cell DNA synthesome. The DNA synthesome is a functional multiprotein complex that is fully competent to carry-out each phase of the DNA replication process. The IC 50 of Cr(III) toward the activity of DNA synthesome-associated DNA polymerases α, δ and ε is 15, 45 and 125 μM, respectively. Cr(III) inhibits synthesome-mediated DNA synthesis (IC 50 = 88 μM), and significantly reduces the fidelity of synthesome-mediated DNA replication. The mutation frequency induced by the different concentrations of Cr(III) ion used in our assays ranges from 2-13 fold higher than that which occurs spontaneously, and the types of mutations include single nucleotide substitutions, insertions, and deletions. Single nucleotide substitutions are the predominant type of mutation, and they occur primarily at GC base-pairs. Cr(III) ion produces a lower number of transition and a higher number of transversion mutations than occur spontaneously. Unlike Cr(III), Cr(VI) ion has little effect on the in vitro DNA synthetic activity and fidelity of the DNA synthesome, but does significantly inhibit DNA synthesis in intact cells. Cell growth and proliferation is also arrested by increasing concentrations of Cr(VI) ion. Our studies provide evidence indicating that the chromium ion induced decrease in the fidelity and activity of synthesome mediated DNA replication

  19. Single Molecule Study of DNA Organization and Recombination

    Science.gov (United States)

    Xiao, Botao

    We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force

  20. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  1. Susceptibility to bystander DNA damage is influenced by replication and transcriptional activity

    Science.gov (United States)

    Dickey, Jennifer S.; Baird, Brandon J.; Redon, Christophe E.; Avdoshina, Valeriya; Palchik, Guillermo; Wu, Junfang; Kondratyev, Alexei; Bonner, William M.; Martin, Olga A.

    2012-01-01

    Direct cellular DNA damage may lead to genome destabilization in unexposed, bystander, cells sharing the same milieu with directly damaged cells by means of the bystander effect. One proposed mechanism involves double strand break (DSB) formation in S phase cells at sites of single strand lesions in the DNA of replication complexes, which has a more open structure compared with neighboring DNA. The DNA in transcription complexes also has a more open structure, and hence may be susceptible to bystander DSB formation from single strand lesions. To examine whether transcription predisposes non-replicating cells to bystander effect-induced DNA DSBs, we examined two types of primary cells that exhibit high levels of transcription in the absence of replication, rat neurons and human lymphocytes. We found that non-replicating bystander cells with high transcription rates exhibited substantial levels of DNA DSBs, as monitored by γ-H2AX foci formation. Additionally, as reported in proliferating cells, TGF-β and NO were found to mimic bystander effects in cell populations lacking DNA synthesis. These results indicate that cell vulnerability to bystander DSB damage may result from transcription as well as replication. The findings offer insights into which tissues may be vulnerable to bystander genomic destabilization in vivo. PMID:22941641

  2. [The effects of TorR protein on initiation of DNA replication in Escherichia coli].

    Science.gov (United States)

    Yuan, Yao; Jiaxin, Qiao; Jing, Li; Hui, Li; Morigen, Morigen

    2015-03-01

    The two-component systems, which could sense and respond to environmental changes, widely exist in bacteria as a signal transduction pathway. The bacterial CckA/CtrA, ArcA/ArcB and PhoP/PhoQ two-component systems are associated with initiation of DNA replication and cell division, however, the effects of the TorS/TorR system on cell cycle and DNA replication remains unknown. The TorS/TorR system in Escherichia coli can sense changes in trimethylamine oxide (TMAO) concentration around the cells. However, it is unknown if it also affects initiation of DNA replication. We detected DNA replication patterns in ΔtorS and ΔtorR mutant strains by flow cytometry. We found that the average number of replication origins (oriCs) per cell and doubling time in ΔtorS mutants were the same while the average number of oriCs in ΔtorR mutants was increased compared with that in wild-type cells. These results indicated that absence of TorR led to an earlier initiation of DNA replication than that in wild-type cells. Strangely, neither overexpression of TorR nor co-expression of TorR and TorS could restore ΔtorR mutant phenotype to the wild type. However, overexpression of SufD in both wild type and ΔtorR mutants promoted initiation of DNA replication, while mutation of SufD delayed it in ΔtorR mutants. Thus, TorR may affect initiation of DNA replication indirectly through regulating gene expression of sufD.

  3. Physical interactions between bacteriophage and Escherichia coli proteins required for initiation of lambda DNA replication.

    Science.gov (United States)

    Liberek, K; Osipiuk, J; Zylicz, M; Ang, D; Skorko, J; Georgopoulos, C

    1990-02-25

    The process of initiation of lambda DNA replication requires the assembly of the proper nucleoprotein complex at the origin of replication, ori lambda. The complex is composed of both phage and host-coded proteins. The lambda O initiator protein binds specifically to ori lambda. The lambda P initiator protein binds to both lambda O and the host-coded dnaB helicase, giving rise to an ori lambda DNA.lambda O.lambda P.dnaB structure. The dnaK and dnaJ heat shock proteins have been shown capable of dissociating this complex. The thus freed dnaB helicase unwinds the duplex DNA template at the replication fork. In this report, through cross-linking, size chromatography, and protein affinity chromatography, we document some of the protein-protein interactions occurring at ori lambda. Our results show that the dnaK protein specifically interacts with both lambda O and lambda P, and that the dnaJ protein specifically interacts with the dnaB helicase.

  4. Multiple DNA binding proteins contribute to timing of chromosome replication in E. coli

    DEFF Research Database (Denmark)

    Riber, Leise; Frimodt-Møller, Jakob; Charbon, Godefroid

    2016-01-01

    Chromosome replication in Escherichia coli is initiated from a single origin, oriC. Initiation involves a number of DNA binding proteins, but only DnaA is essential and specific for the initiation process. DnaA is an AAA+ protein that binds both ATP and ADP with similar high affinities. Dna...... replication is initiated, or the time window in which all origins present in a single cell are initiated, i.e. initiation synchrony, or both. Overall, these DNA binding proteins modulate the initiation frequency from oriC by: (i) binding directly to oriC to affect DnaA binding, (ii) altering the DNA topology...... in or around oriC, (iii) altering the nucleotide bound status of DnaA by interacting with non-coding chromosomal sequences, distant from oriC, that are important for DnaA activity. Thus, although DnaA is the key protein for initiation of replication, other DNA-binding proteins act not only on ori...

  5. Effects of ionizing radiations on DNA replication in cultured mammalian cells

    International Nuclear Information System (INIS)

    Makino, F.; Okada, S.

    1975-01-01

    The dose-response curve of [ 3 H] thymidine incorporation into the acid-insoluble fraction of cultured mammalian cells, grown in the presence of 10 -4 M cold thymidine, is different from that of incorporation in the absence of cold thymidine. For quantitative estimation of net DNA synthesis in nonirradiated and irradiated cells, two methods were used: isolation of newly synthesized BUdR-labeled DNA by CsCl gradient centrifugation and a fluorometric estimation of DNA content in the synchronized population. Both methods showed that the depression of [ 3 H]thymidine incorporation in the presence of cold thymidine reflected a depression of net DNA synthesis. Radiosensitive steps in DNA synthesis were examined by the use of alkaline sucrose gradient centrifugation. The rate of replication along the DNA strands was inhibited to a lesser extent than that of over-all DNA synthesis. The labeling patterns of DNA exposed to [ 3 H]thymidine for 20 min indicated that ionizing radiation preferentially interfered with the formation of small-size 3 H-labeled DNA pieces. These results suggest that the initiation of DNA replication is more radiosensitive than the elongation of DNA strands whose replication has already been initiated. (U.S.)

  6. G-Quadruplexes in DNA Replication: A Problem or a Necessity?

    Science.gov (United States)

    Valton, Anne-Laure; Prioleau, Marie-Noëlle

    2016-11-01

    DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Characterizing the Final Steps of Chromosomal Replication at the Single-molecule Level in the Model System Escherichia coli

    KAUST Repository

    Elshenawy, Mohamed

    2015-01-01

    In the circular Escherichia coli chromosome, two replisomes are assembled at the unique origin of replication and drive DNA synthesis in opposite directions until they meet in the terminus region across from the origin. Despite the difference

  8. Global profiling of DNA replication timing and efficiency reveals that efficient replication/firing occurs late during S-phase in S. pombe.

    Directory of Open Access Journals (Sweden)

    Majid Eshaghi

    Full Text Available BACKGROUND: During S. pombe S-phase, initiation of DNA replication occurs at multiple sites (origins that are enriched with AT-rich sequences, at various times. Current studies of genome-wide DNA replication profiles have focused on the DNA replication timing and origin location. However, the replication and/or firing efficiency of the individual origins on the genomic scale remain unclear. METHODOLOGY/PRINCIPAL FINDINGS: Using the genome-wide ORF-specific DNA microarray analysis, we show that in S. pombe, individual origins fire with varying efficiencies and at different times during S-phase. The increase in DNA copy number plotted as a function of time is approximated to the near-sigmoidal model, when considering the replication start and end timings at individual loci in cells released from HU-arrest. Replication efficiencies differ from origin to origin, depending on the origin's firing efficiency. We have found that DNA replication is inefficient early in S-phase, due to inefficient firing at origins. Efficient replication occurs later, attributed to efficient but late-firing origins. Furthermore, profiles of replication timing in cds1Delta cells are abnormal, due to the failure in resuming replication at the collapsed forks. The majority of the inefficient origins, but not the efficient ones, are found to fire in cds1Delta cells after HU removal, owing to the firing at the remaining unused (inefficient origins during HU treatment. CONCLUSIONS/SIGNIFICANCE: Taken together, our results indicate that efficient DNA replication/firing occurs late in S-phase progression in cells after HU removal, due to efficient late-firing origins. Additionally, checkpoint kinase Cds1p is required for maintaining the efficient replication/firing late in S-phase. We further propose that efficient late-firing origins are essential for ensuring completion of DNA duplication by the end of S-phase.

  9. P-body proteins regulate transcriptional rewiring to promote DNA replication stress resistance.

    Science.gov (United States)

    Loll-Krippleber, Raphael; Brown, Grant W

    2017-09-15

    mRNA-processing (P-) bodies are cytoplasmic granules that form in eukaryotic cells in response to numerous stresses to serve as sites of degradation and storage of mRNAs. Functional P-bodies are critical for the DNA replication stress response in yeast, yet the repertoire of P-body targets and the mechanisms by which P-bodies promote replication stress resistance are unknown. In this study we identify the complete complement of mRNA targets of P-bodies during replication stress induced by hydroxyurea treatment. The key P-body protein Lsm1 controls the abundance of HHT1, ACF4, ARL3, TMA16, RRS1 and YOX1 mRNAs to prevent their toxic accumulation during replication stress. Accumulation of YOX1 mRNA causes aberrant downregulation of a network of genes critical for DNA replication stress resistance and leads to toxic acetaldehyde accumulation. Our data reveal the scope and the targets of regulation by P-body proteins during the DNA replication stress response.P-bodies form in response to stress and act as sites of mRNA storage and degradation. Here the authors identify the mRNA targets of P-bodies during DNA replication stress, and show that P-body proteins act to prevent toxic accumulation of these target transcripts.

  10. MMSET is dynamically regulated during cell-cycle progression and promotes normal DNA replication.

    Science.gov (United States)

    Evans, Debra L; Zhang, Haoxing; Ham, Hyoungjun; Pei, Huadong; Lee, SeungBaek; Kim, JungJin; Billadeau, Daniel D; Lou, Zhenkun

    2016-01-01

    The timely and precise duplication of cellular DNA is essential for maintaining genome integrity and is thus tightly-regulated. During mitosis and G1, the Origin Recognition Complex (ORC) binds to future replication origins, coordinating with multiple factors to load the minichromosome maintenance (MCM) complex onto future replication origins as part of the pre-replication complex (pre-RC). The pre-RC machinery, in turn, remains inactive until the subsequent S phase when it is required for replication fork formation, thereby initiating DNA replication. Multiple myeloma SET domain-containing protein (MMSET, a.k.a. WHSC1, NSD2) is a histone methyltransferase that is frequently overexpressed in aggressive cancers and is essential for normal human development. Several studies have suggested a role for MMSET in cell-cycle regulation; however, whether MMSET is itself regulated during cell-cycle progression has not been examined. In this study, we report that MMSET is degraded during S phase in a cullin-ring ligase 4-Cdt2 (CRL4(Cdt2)) and proteasome-dependent manner. Notably, we also report defects in DNA replication and a decreased association of pre-RC factors with chromatin in MMSET-depleted cells. Taken together, our results suggest a dynamic regulation of MMSET levels throughout the cell cycle, and further characterize the role of MMSET in DNA replication and cell-cycle progression.

  11. Environmental stress speeds up DNA replication in Pseudomonas putida in chemostat cultivations.

    Science.gov (United States)

    Lieder, Sarah; Jahn, Michael; Koepff, Joachim; Müller, Susann; Takors, Ralf

    2016-01-01

    Cellular response to different types of stress is the hallmark of the cell's strategy for survival. How organisms adjust their cell cycle dynamics to compensate for changes in environmental conditions is an important unanswered question in bacterial physiology. A cell using binary fission for reproduction passes through three stages during its cell cycle: a stage from cell birth to initiation of replication, a DNA replication phase and a period of cell division. We present a detailed analysis of durations of cell cycle phases, investigating their dynamics under environmental stress conditions. Applying continuous steady state cultivations (chemostats), the DNA content of a Pseudomonas putida KT2440 population was quantified with flow cytometry at distinct growth rates. Data-driven modeling revealed that under stress conditions, such as oxygen deprivation, solvent exposure and decreased iron availability, DNA replication was accelerated correlated to the severity of the imposed stress (up to 1.9-fold). Cells maintained constant growth rates by balancing the shortened replication phase with extended cell cycle phases before and after replication. Transcriptome data underpin the transcriptional upregulation of crucial genes of the replication machinery. Hence adaption of DNA replication speed appears to be an important strategy to withstand environmental stress. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing.

    Science.gov (United States)

    Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard

    2015-09-01

    Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.

  13. Recent advances in the genome-wide study of DNA replication origins in yeast

    Directory of Open Access Journals (Sweden)

    Chong ePeng

    2015-02-01

    Full Text Available DNA replication, one of the central events in the cell cycle, is the basis of biological inheritance. In order to be duplicated, a DNA double helix must be opened at defined sites, which are called DNA replication origins (ORIs. Unlike in bacteria, where replication initiates from a single replication origin, multiple origins are utilized in the eukaryotic genome. Among them, the ORIs in budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe have been best characterized. In recent years, advances in DNA microarray and next-generation sequencing technologies have increased the number of yeast species involved in ORIs research dramatically. The ORIs in some nonconventional yeast species such as Kluyveromyces lactis and Pichia pastoris have also been genome-widely identified. Relevant databases of replication origins in yeast were constructed, then the comparative genomic analysis can be carried out. Here, we review several experimental approaches that have been used to map replication origins in yeast and some of the available web resources related to yeast ORIs. We also discuss the sequence characteristics and chromosome structures of ORIs in the four yeast species, which can be utilized to improve the replication origins prediction.

  14. Recent advances in the genome-wide study of DNA replication origins in yeast

    Science.gov (United States)

    Peng, Chong; Luo, Hao; Zhang, Xi; Gao, Feng

    2015-01-01

    DNA replication, one of the central events in the cell cycle, is the basis of biological inheritance. In order to be duplicated, a DNA double helix must be opened at defined sites, which are called DNA replication origins (ORIs). Unlike in bacteria, where replication initiates from a single replication origin, multiple origins are utilized in the eukaryotic genomes. Among them, the ORIs in budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe have been best characterized. In recent years, advances in DNA microarray and next-generation sequencing technologies have increased the number of yeast species involved in ORIs research dramatically. The ORIs in some non-conventional yeast species such as Kluyveromyces lactis and Pichia pastoris have also been genome-widely identified. Relevant databases of replication origins in yeast were constructed, then the comparative genomic analysis can be carried out. Here, we review several experimental approaches that have been used to map replication origins in yeast and some of the available web resources related to yeast ORIs. We also discuss the sequence characteristics and chromosome structures of ORIs in the four yeast species, which can be utilized to improve yeast replication origins prediction. PMID:25745419

  15. DNA replication and repair of Tilapia cells: Pt. 2. Effects of temperature on DNA replication and ultraviolet repair in Tilapia ovary cells

    Energy Technology Data Exchange (ETDEWEB)

    Chen, J.D.; Yew, F.H.

    1988-02-01

    TO-2 is a fish cell line derived from the Tilapia ovary. It grows over a wide range of temperature (15-34/sup 0/C). We report the effects of temperature on DNA replication and u.v. repair in TO-2 cells. When the cells were moved from 31/sup 0/C to the sublethal high temperature of 37/sup 0/C, the rate of DNA synthesis first decreased to 60%, then speedy recovery soon set in, and after 8h at 37/sup 0/C the rate of DNA synthesis overshot the 31/sup 0/C control level by 180%. When moved to low temperature (18/sup 0/C) Tilapia cells also showed an initial suppression of DNA synthesis before settling at 30% of the control level. U.V. reduced but could not block DNA synthesis completely. The inhibition was overcome in 3h at 37, 31 and 25/sup 0/C, but not at 18/sup 0/C. Initiation of nascent DNA synthesis was blocked at 4Jm/sup -2/ in TO-2 cells compared with less than or equal to 1Jm/sup -2/ in mammalian cells. After 9Jm/sup -2/ u.v. irradiation, low molecular weight DNA replication intermediates started to accumulate. TO-2 cells showed low levels of u.v.-induced excision repair.

  16. Transcriptionally Driven DNA Replication Program of the Human Parasite Leishmania major

    Directory of Open Access Journals (Sweden)

    Rodrigo Lombraña

    2016-08-01

    Full Text Available Faithful inheritance of eukaryotic genomes requires the orchestrated activation of multiple DNA replication origins (ORIs. Although origin firing is mechanistically conserved, how origins are specified and selected for activation varies across different model systems. Here, we provide a complete analysis of the nucleosomal landscape and replication program of the human parasite Leishmania major, building on a better evolutionary understanding of replication organization in Eukarya. We found that active transcription is a driving force for the nucleosomal organization of the L. major genome and that both the spatial and the temporal program of DNA replication can be explained as associated to RNA polymerase kinetics. This simple scenario likely provides flexibility and robustness to deal with the environmental changes that impose alterations in the genetic programs during parasitic life cycle stages. Our findings also suggest that coupling replication initiation to transcription elongation could be an ancient solution used by eukaryotic cells for origin maintenance.

  17. Transcription-Replication Conflict Orientation Modulates R-Loop Levels and Activates Distinct DNA Damage Responses.

    Science.gov (United States)

    Hamperl, Stephan; Bocek, Michael J; Saldivar, Joshua C; Swigut, Tomek; Cimprich, Karlene A

    2017-08-10

    Conflicts between transcription and replication are a potent source of DNA damage. Co-transcriptional R-loops could aggravate such conflicts by creating an additional barrier to replication fork progression. Here, we use a defined episomal system to investigate how conflict orientation and R-loop formation influence genome stability in human cells. R-loops, but not normal transcription complexes, induce DNA breaks and orientation-specific DNA damage responses during conflicts with replication forks. Unexpectedly, the replisome acts as an orientation-dependent regulator of R-loop levels, reducing R-loops in the co-directional (CD) orientation but promoting their formation in the head-on (HO) orientation. Replication stress and deregulated origin firing increase the number of HO collisions leading to genome-destabilizing R-loops. Our findings connect DNA replication to R-loop homeostasis and suggest a mechanistic basis for genome instability resulting from deregulated DNA replication, observed in cancer and other disease states. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. An Adenovirus DNA Replication Factor, but Not Incoming Genome Complexes, Targets PML Nuclear Bodies.

    Science.gov (United States)

    Komatsu, Tetsuro; Nagata, Kyosuke; Wodrich, Harald

    2016-02-01

    Promyelocytic leukemia protein nuclear bodies (PML-NBs) are subnuclear domains implicated in cellular antiviral responses. Despite the antiviral activity, several nuclear replicating DNA viruses use the domains as deposition sites for the incoming viral genomes and/or as sites for viral DNA replication, suggesting that PML-NBs are functionally relevant during early viral infection to establish productive replication. Although PML-NBs and their components have also been implicated in the adenoviral life cycle, it remains unclear whether incoming adenoviral genome complexes target PML-NBs. Here we show using immunofluorescence and live-cell imaging analyses that incoming adenovirus genome complexes neither localize at nor recruit components of PML-NBs during early phases of infection. We further show that the viral DNA binding protein (DBP), an early expressed viral gene and essential DNA replication factor, independently targets PML-NBs. We show that DBP oligomerization is required to selectively recruit the PML-NB components Sp100 and USP7. Depletion experiments suggest that the absence of one PML-NB component might not affect the recruitment of other components toward DBP oligomers. Thus, our findings suggest a model in which an adenoviral DNA replication factor, but not incoming viral genome complexes, targets and modulates PML-NBs to support a conducive state for viral DNA replication and argue against a generalized concept that PML-NBs target incoming viral genomes. The immediate fate upon nuclear delivery of genomes of incoming DNA viruses is largely unclear. Early reports suggested that incoming genomes of herpesviruses are targeted and repressed by PML-NBs immediately upon nuclear import. Genome localization and/or viral DNA replication has also been observed at PML-NBs for other DNA viruses. Thus, it was suggested that PML-NBs may immediately sense and target nuclear viral genomes and hence serve as sites for deposition of incoming viral genomes and

  19. Single-molecule denaturation mapping of DNA in nanofluidic channels

    DEFF Research Database (Denmark)

    Reisner, Walter; Larsen, Niels Bent; Silahtaroglu, Asli

    2010-01-01

    Here we explore the potential power of denaturation mapping as a single-molecule technique. By partially denaturing YOYO (R)-1-labeled DNA in nanofluidic channels with a combination of formamide and local heating, we obtain a sequence-dependent "barcode" corresponding to a series of local dips...... and peaks in the intensity trace along the extended molecule. We demonstrate that this structure arises from the physics of local denaturation: statistical mechanical calculations of sequence-dependent melting probability can predict the barcode to be observed experimentally for a given sequence...

  20. Direct non transcriptional role of NF-Y in DNA replication.

    Science.gov (United States)

    Benatti, Paolo; Belluti, Silvia; Miotto, Benoit; Neusiedler, Julia; Dolfini, Diletta; Drac, Marjorie; Basile, Valentina; Schwob, Etienne; Mantovani, Roberto; Blow, J Julian; Imbriano, Carol

    2016-04-01

    NF-Y is a heterotrimeric transcription factor, which plays a pioneer role in the transcriptional control of promoters containing the CCAAT-box, among which genes involved in cell cycle regulation, apoptosis and DNA damage response. The knock-down of the sequence-specific subunit NF-YA triggers defects in S-phase progression, which lead to apoptotic cell death. Here, we report that NF-Y has a critical function in DNA replication progression, independent from its transcriptional activity. NF-YA colocalizes with early DNA replication factories, its depletion affects the loading of replisome proteins to DNA, among which Cdc45, and delays the passage from early to middle-late S phase. Molecular combing experiments are consistent with a role for NF-Y in the control of fork progression. Finally, we unambiguously demonstrate a direct non-transcriptional role of NF-Y in the overall efficiency of DNA replication, specifically in the DNA elongation process, using a Xenopus cell-free system. Our findings broaden the activity of NF-Y on a DNA metabolism other than transcription, supporting the existence of specific TFs required for proper and efficient DNA replication. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  1. Genetic response to metabolic fluctuations: correlation between central carbon metabolism and DNA replication in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Szalewska-Pałasz Agnieszka

    2011-03-01

    Full Text Available Abstract Background Until now, the direct link between central carbon metabolism and DNA replication has been demonstrated only in Bacillus. subtilis. Therefore, we asked if this is a specific phenomenon, characteristic for this bacterium and perhaps for its close relatives, or a more general biological rule. Results We found that temperature-sensitivity of mutants in particular genes coding for replication proteins could be suppressed by deletions of certain genes coding for enzymes of the central carbon metabolism. Namely, the effects of dnaA46(ts mutation could be suppressed by dysfunction of pta or ackA, effects of dnaB(ts by dysfunction of pgi or pta, effects of dnaE486(ts by dysfunction of tktB, effects of dnaG(ts by dysfunction of gpmA, pta or ackA, and effects of dnaN159(ts by dysfunction of pta or ackA. The observed suppression effects were not caused by a decrease in bacterial growth rate. Conclusions The genetic correlation exists between central carbon metabolism and DNA replication in the model Gram-negative bacterium, E. coli. This link exists at the steps of initiation and elongation of DNA replication, indicating the important global correlation between metabolic status of the cell and the events leading to cell reproduction.

  2. New criteria for selecting the origin of DNA replication in Wolbachia and closely related bacteria

    DEFF Research Database (Denmark)

    Ioannidis, Panagiotis; Dunning Hotopp, Julie C; Sapountzis, Panagiotis

    2007-01-01

    , the origin of DNA replication (ori) regions were identified in silico for Wolbachia strains and eleven other related bacteria belonging to Ehrlichia, Anaplasma, and Rickettsia genera. These features include DnaA-, CtrA- and IHF-binding sites as well as the flanking genes in C. crescentus. The Wolbachia ori...

  3. Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis

    NARCIS (Netherlands)

    Hamdan, Samir M.; Loparo, Joseph J.; Takahashi, Masateru; Richardson, Charles C.; Oijen, Antoine M. van

    2009-01-01

    In all organisms, the protein machinery responsible for the replication of DNA, the replisome, is faced with a directionality problem. The antiparallel nature of duplex DNA permits the leading-strand polymerase to advance in a continuous fashion, but forces the lagging-strand polymerase to

  4. Tousled-like kinases phosphorylate Asf1 to promote histone supply during DNA replication

    DEFF Research Database (Denmark)

    Klimovskaia, Ilnaz M; Young, Clifford; Strømme, Caroline B

    2014-01-01

    During DNA replication, nucleosomes are rapidly assembled on newly synthesized DNA to restore chromatin organization. Asf1, a key histone H3-H4 chaperone required for this process, is phosphorylated by Tousled-like kinases (TLKs). Here, we identify TLK phosphorylation sites by mass spectrometry...

  5. Checkpoint Kinase Rad53 Couples Leading- and Lagging-Strand DNA Synthesis under Replication Stress.

    Science.gov (United States)

    Gan, Haiyun; Yu, Chuanhe; Devbhandari, Sujan; Sharma, Sushma; Han, Junhong; Chabes, Andrei; Remus, Dirk; Zhang, Zhiguo

    2017-10-19

    The checkpoint kinase Rad53 is activated during replication stress to prevent fork collapse, an essential but poorly understood process. Here we show that Rad53 couples leading- and lagging-strand synthesis under replication stress. In rad53-1 cells stressed by dNTP depletion, the replicative DNA helicase, MCM, and the leading-strand DNA polymerase, Pol ε, move beyond the site of DNA synthesis, likely unwinding template DNA. Remarkably, DNA synthesis progresses further along the lagging strand than the leading strand, resulting in the exposure of long stretches of single-stranded leading-strand template. The asymmetric DNA synthesis in rad53-1 cells is suppressed by elevated levels of dNTPs in vivo, and the activity of Pol ε is compromised more than lagging-strand polymerase Pol δ at low dNTP concentrations in vitro. Therefore, we propose that Rad53 prevents the generation of excessive ssDNA under replication stress by coordinating DNA unwinding with synthesis of both strands. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. An assay system for factors involved in mammalian DNA replication

    International Nuclear Information System (INIS)

    Reinhard, P.; Maillart, P.; Schluchter, M.; Gautschi, J.R.; Schindler, R.

    1979-01-01

    An assay for cellular factors stimulating DNA synthesis by partially lysed CHO cells is presented. The assay is based on the observation that in highly lysed cells, DNA synthesis, as determined by [ 3 H]dTTP incorporation, was only 2-5% of that in gently lysed cells, and that this low level of DNA synthesis could be increased by a factor of approx. 50 by the addition of CHO cell extract (i.e. supernatant of a cell homogenate subjected to high-speed centrifugation.) (Auth.)

  7. The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows

    International Nuclear Information System (INIS)

    Shen Zigang; Huang Yibo; Li Bin; Zhang Yi

    2007-01-01

    Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)

  8. A Role of hIPI3 in DNA Replication Licensing in Human Cells.

    Science.gov (United States)

    Huang, Yining; Amin, Aftab; Qin, Yan; Wang, Ziyi; Jiang, Huadong; Liang, Lu; Shi, Linjing; Liang, Chun

    2016-01-01

    The yeast Ipi3p is required for DNA replication and cell viability in Sacharomyces cerevisiae. It is an essential component of the Rix1 complex (Rix1p/Ipi2p-Ipi1p-Ipi3p) that is required for the processing of 35S pre-rRNA in pre-60S ribosomal particles and for the initiation of DNA replication. The human IPI3 homolog is WDR18 (WD repeat domain 18), which shares significant homology with yIpi3p. Here we report that knockdown of hIPI3 resulted in substantial defects in the chromatin association of the MCM complex, DNA replication, cell cycle progression and cell proliferation. Importantly, hIPI3 silencing did not result in a reduction of the protein level of hCDC6, hMCM7, or the ectopically expressed GFP protein, indicating that protein synthesis was not defective in the same time frame of the DNA replication and cell cycle defects. Furthermore, the mRNA and protein levels of hIPI3 fluctuate in the cell cycle, with the highest levels from M phase to early G1 phase, similar to other pre-replicative (pre-RC) proteins. Moreover, hIPI3 interacts with other replication-initiation proteins, co-localizes with hMCM7 in the nucleus, and is important for the nuclear localization of hMCM7. We also found that hIPI3 preferentially binds to the origins of DNA replication including those at the c-Myc, Lamin-B2 and β-Globin loci. These results indicate that hIPI3 is involved in human DNA replication licensing independent of its role in ribosome biogenesis.

  9. Chromosomal Replication Complexity: A Novel DNA Metrics and Genome Instability Factor.

    Directory of Open Access Journals (Sweden)

    Andrei Kuzminov

    2016-10-01

    Full Text Available As the ratio of the copy number of the most replicated to the unreplicated regions in the same chromosome, the definition of chromosomal replication complexity (CRC appears to leave little room for variation, being either two during S-phase or one otherwise. However, bacteria dividing faster than they replicate their chromosome spike CRC to four and even eight. A recent experimental inquiry about the limits of CRC in Escherichia coli revealed two major reasons to avoid elevating it further: (i increased chromosomal fragmentation and (ii complications with subsequent double-strand break repair. Remarkably, examples of stable elevated CRC in eukaryotic chromosomes are well known under various terms like "differential replication," "underreplication," "DNA puffs," "onion-skin replication," or "re-replication" and highlight the phenomenon of static replication fork (sRF. To accurately describe the resulting "amplification by overinitiation," I propose a new term: "replification" (subchromosomal overreplication. In both prokaryotes and eukaryotes, replification, via sRF processing, causes double-strand DNA breaks and, with their repair elevating chromosomal rearrangements, represents a novel genome instability factor. I suggest how static replication bubbles could be stabilized and speculate that some tandem duplications represent such persistent static bubbles. Moreover, I propose how static replication bubbles could be transformed into tandem duplications, double minutes, or inverted triplications. Possible experimental tests of these models are discussed.

  10. Molecular genetic analysis of a vaccinia virus gene with an essential role in DNA replication

    International Nuclear Information System (INIS)

    Evans, E.V.A.

    1989-01-01

    The poxvirus, vaccinia, is large DNA virus which replicates in the cytoplasma of the host cell. The virus is believed to encode most or all of the functions required for the temporally regulated transcription and replication of its 186 kilobase genome. Physical and genetic autonomy from the host make vaccinia a useful eukaryotic organism in which to study replication genes and proteins, using a combination of biochemical and genetic techniques. Essential viral functions for replication are identified by conditional lethal mutants that fail to synthesize DNA at the non-permissive temperatures. One such group contains the non-complementing alleles ts17, ts24, ts69 (WR strain). Studies were undertaken to define the phenotype of ts mutants, and to identify and characterize the affected gene and protein. Mutant infection was essentially normal at 32 degree C, but at 39 degree C the mutants did not incorporate 3 H-thymidine into nascent viral DNA or synthesize late viral proteins. If mutant cultures were shifted to non-permissive conditions at the height of replication, DNA synthesis was halted rapidly, implying that the mutants are defective in DNA elongation. The gene affected in the WR mutants and in ts6389, a DNA-minus mutant of the IHD strain, was mapped by marker rescue and corresponds to open reading frame 5 (orfD5) of the viral HindIII D fragment

  11. DNA replication and repair in Tilapia cells. 1. The effect of ultraviolet radiation

    Energy Technology Data Exchange (ETDEWEB)

    Yew, F.H.; Chang, L.M. (National Taiwan Univ., Taipei (China))

    1984-12-01

    The effect of ultraviolet radiation on a cell line established from the warm water fish Tilapia has been assessed by measuring the rate of DNA synthesis, excision repair, post-replication repair and cell survival. The cells tolerate ultraviolet radiation better than mammalian cells with respect to DNA synthesis, post-replication repair and cell survival. They are also efficient in excision repair, which in other fish cell lines has been found to be at a low level or absent. Their response to the inhibitors hydroxyurea and 1-..beta..-D-arabinofuranosylcytosine is less sensitive than that of other cell lines, yet the cells seem to have very small pools of DNA precursor.

  12. Identification of Persistent RNA-DNA Hybrid Structures within the Origin of Replication of Human Cytomegalovirus

    OpenAIRE

    Prichard, Mark N.; Jairath, Sanju; Penfold, Mark E. T.; Jeor, Stephen St.; Bohlman, Marlene C.; Pari, Gregory S.

    1998-01-01

    Human cytomegalovirus (HCMV) lytic-phase DNA replication initiates at the cis-acting origin of replication, oriLyt. oriLyt is a structurally complex region containing repeat elements and transcription factor binding sites. We identified two site-specific alkali-labile regions within oriLyt which flank an alkali-resistant DNA segment. These alkali-sensitive regions were the result of the degradation of two RNA species embedded within oriLyt and covalently linked to viral DNA. The virus-associa...

  13. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Science.gov (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

    1985-11-01

    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  14. Differential sensitivity to aphidicolin of replicative DNA synthesis and ultraviolet-induced unscheduled DNA synthesis in vivo in mammalian cells

    International Nuclear Information System (INIS)

    Seki, Shuji; Hosogi, Nobuo; Oda, Takuzo

    1984-01-01

    In vivo in mammalian cells, ultraviolet-induced unscheduled DNA synthesis was less sensitive to aphidicolin than was replicative DNA synthesis. Replicative DNA synthesis in HeLa, HEp-2, WI-38 VA-13 and CV-1 cells was inhibited more than 97 % by aphidicolin at 10 μg/ml, whereas aphidicolin inhibition of DNA synthesis in ultraviolet-irradiated cells varied between 30 % and 90 % depending on cell types and assay conditions. Aphidicolin inhibition of unscheduled DNA synthesis (UDS) in HeLa cells increased gradually with increasing aphidicolin concentration and reached approximately 90 % at 100 μg/ml aphidicolin. A significant fraction of UDS in ultraviolet-irradiated HEp-2 cells was resistant to aphidicolin even at 300 μg/ml. Considered along with related information reported previously, the present results suggest that both aphidicolin-sensitive and insensitive DNA polymerases, DNA polymerase α and a non-α DNA polymerase (possibly DNA polymerase β), are involved in in situ UDS in these ultraviolet-irradiated cells. Comparison of staphylococcal nuclease sensitivity between DNAs repaired in the presence and in the absence of aphidicolin in HEp-2 cells suggested that the involvement of DNA polymerase α in UDS favored DNA synthesis in the intranucleosomal region. (author)

  15. DNA-binding proteins regulating pIP501 transfer and replication

    Directory of Open Access Journals (Sweden)

    Elisabeth Grohmann

    2016-08-01

    Full Text Available pIP501 is a Gram-positive broad-host-range model plasmid intensively used for studying plasmid replication and conjugative transfer. It is a multiple antibiotic resistance plasmid frequently found in clinical Enterococcus faecalis and Enterococcus faecium isolates. Replication of pIP501 proceeds unidirectionally by a theta mechanism. The minimal replicon of pIP501 is composed of the repR gene encoding the essential rate-limiting replication initiator protein RepR and the origin of replication, oriR, located downstream of repR. RepR is similar to RepE of related streptococcal plasmid pAMβ1, which has been shown to possess RNase activity cleaving free RNA molecules in close proximity of the initiation site of DNA synthesis. Replication of pIP501 is controlled by the concerted action of a small protein, CopR, and an antisense RNA, RNAIII. CopR has a dual role: It acts as transcriptional repressor at the repR promoter and prevents convergent transcription of RNAIII and repR mRNA (RNAII, thereby indirectly increasing RNAIII synthesis. CopR binds asymmetrically as a dimer at two consecutive binding sites upstream of and overlapping with the repR promoter. RNAIII induces transcriptional attenuation within the leader region of the repR mRNA (RNAII. Deletion of either control component causes a 10- to 20-fold increase of plasmid copy number, while simultaneous deletions have no additional effect. Conjugative transfer of pIP501 depends on a type IV secretion system (T4SS encoded in a single operon. Its transfer host-range is considerably broad, as it has been transferred to virtually all Gram-positive bacteria including filamentous streptomycetes and even the Gram-negative Escherichia coli. Expression of the 15 genes encoding the T4SS is tightly controlled by binding of the relaxase TraA, the transfer initiator protein, to the operon promoter, which overlaps with the origin of transfer (oriT. The T4SS operon encodes the DNA-binding proteins TraJ (VirD4

  16. Repair and replication of DNA in hereditary (bilateral) retinoblastoma cells after X-irradiation

    International Nuclear Information System (INIS)

    Cleaver, J.E.; Char, D.; Charles, W.C.; Rand, N.

    1982-01-01

    Fibroblasts from patients with hereditary retinoblastoma reportedly exhibit increased sensitivity to killing by X-rays. Although some human syndromes with similar or greater hypersensitivity to DNA-damaging agents (e.g., X-rays, ultraviolet light, and chemical carcinogens), such as xeroderma pigmentosum, are deficient in DNA repair, most do not have such clearly demonstrable defects in repair. Retinoblastoma cells appear to be normal in repairing single-strand breaks and performing repair replication after X-irradiation and also in synthesizing poly(adenosine diphosphoribose). Semiconservative DNA replication in these cells, however, is slightly more resistant than normal after X-irradiation, suggesting that continued replication of damaged parental DNA could contribute to the pathogenesis of the disease. This effect is small, however, and may be a consequence rather than a cause of the fundamental enzymatic abnormality in retinoblastoma that causes the tumorigenesis

  17. De novo and salvage pathway precursor incorporation during DNA replication at the nuclear matrix

    International Nuclear Information System (INIS)

    Panzeter, P.L.

    1988-01-01

    Total nuclear DNA can be empirically subdivided into low salt-soluble (LS) DNA (75-80%), high salt-soluble (HS) DNA (18-23%), and nuclear matrix-associated (NM) DNA which remains tightly bound to the nuclear matrix (∼2%). The most-newly replicated DNA is that associated with the nuclear matrix in regenerating rat liver. Analyses of the DNA fractions after various pulse times revealed that the salvage and de novo pathway DNA precursors investigated were incorporated preferentially into NM-DNA at early pulse times, after which the radioactivity became progressively incorporated into HS- and LS-DNA, respectively. These results support two models of nuclear matrix-associated DNA replication, proposed previously, and a third model presented in this dissertation. In addition, the incorporation of de novo pathway precursors lagged significantly (> 10 minutes) behind the incorporation of precursors entering through the salvage pathway. Channeling of salvage pathway precursors to DNA replication sites would explain the more rapid uptake of salvage precursors into NM-DNA than de novo precursors. To investigate the possibility of this heretofore in vitro phenomenon, the incorporation of the salvage precursor, ( 3 H)deoxythymidine, and the de novo precursor, ( 14 C)orotic acid, into NM-DNA and dTTP was examined in regenerating rat liver. There was no significant difference between the incorporation pattern of ( 14 C)orotic acid into NM-DNA thymine and that of ( 14 C)orotic acid into soluble dTTP. Contrastingly, the salvage pathway precursor, ( 3 H)deoxythymidine, labeled NM-DNA before labeling the dTTP pool

  18. Amplified Self-replication of DNA Origami Nanostructures through Multi-cycle Fast-annealing Process

    Science.gov (United States)

    Zhou, Feng; Zhuo, Rebecca; He, Xiaojin; Sha, Ruojie; Seeman, Nadrian; Chaikin, Paul

    We have developed a non-biological self-replication process using templated reversible association of components and irreversible linking with annealing and UV cycles. The current method requires a long annealing time, up to several days, to achieve the specific self-assembly of DNA nanostructures. In this work, we accomplished the self-replication with a shorter time and smaller replication rate per cycle. By decreasing the ramping time, we obtained the comparable replication yield within 90 min. Systematic studies show that the temperature and annealing time play essential roles in the self-replication process. In this manner, we can amplify the self-replication process to a factor of 20 by increasing the number of cycles within the same amount of time.

  19. Phosphorylated STAT5 directly facilitates parvovirus B19 DNA replication in human erythroid progenitors through interaction with the MCM complex.

    Science.gov (United States)

    Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming

    2017-05-01

    Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.

  20. Primer-Independent DNA Synthesis by a Family B DNA Polymerase from Self-Replicating Mobile Genetic Elements

    Directory of Open Access Journals (Sweden)

    Modesto Redrejo-Rodríguez

    2017-11-01

    Full Text Available Family B DNA polymerases (PolBs play a central role during replication of viral and cellular chromosomes. Here, we report the discovery of a third major group of PolBs, which we denote primer-independent PolB (piPolB, that might be a link between the previously known protein-primed and RNA/DNA-primed PolBs. PiPolBs are encoded by highly diverse mobile genetic elements, pipolins, integrated in the genomes of diverse bacteria and also present as circular plasmids in mitochondria. Biochemical characterization showed that piPolB displays efficient DNA polymerization activity that can use undamaged and damaged templates and is endowed with proofreading and strand displacement capacities. Remarkably, the protein is also capable of template-dependent de novo DNA synthesis, i.e., DNA-priming activity, thereby breaking the long-standing dogma that replicative DNA polymerases require a pre-existing primer for DNA synthesis. We suggest that piPolBs are involved in self-replication of pipolins and may also contribute to bacterial DNA damage tolerance.

  1. Sulfolobus Replication Factor C stimulates the activity of DNA Polymerase B1

    DEFF Research Database (Denmark)

    Xing, Xuanxuan; Zhang, Likui; Guo, Li

    2014-01-01

    the hyperthermophilic archaea of the genus Sulfolobus physically interacts with DNA polymerase B1 (PolB1) and enhances both the polymerase and 3'-5' exonuclease activities of PolB1 in an ATP-independent manner. Stimulation of the PolB1 activity by RFC is independent of the ability of RFC to bind DNA but is consistent...... with the ability of RFC to facilitate DNA binding by PolB1 through protein-protein interaction. These results suggest that Sulfolobus RFC may play a role in recruiting DNA polymerase for efficient primer extension, in addition to clamp loading, during DNA replication....

  2. DNA Damage Response Resulting from Replication Stress Induced by Synchronization of Cells by Inhibitors of DNA Replication: Analysis by Flow Cytometry.

    Science.gov (United States)

    Halicka, Dorota; Zhao, Hong; Li, Jiangwei; Garcia, Jorge; Podhorecka, Monika; Darzynkiewicz, Zbigniew

    2017-01-01

    Cell synchronization is often achieved by transient inhibition of DNA replication. When cultured in the presence of such inhibitors as hydroxyurea, aphidicolin or excess of thymidine the cells that become arrested at the entrance to S-phase upon release from the block initiate progression through S then G 2 and M. However, exposure to these inhibitors at concentrations commonly used to synchronize cells leads to activation of ATR and ATM protein kinases as well as phosphorylation of Ser139 of histone H2AX. This observation of DNA damage signaling implies that synchronization of cells by these inhibitors is inducing replication stress. Thus, a caution should be exercised while interpreting data obtained with use of cells synchronized this way since they do not represent unperturbed cell populations in a natural metabolic state. This chapter critically outlines virtues and vices of most cell synchronization methods. It also presents the protocol describing an assessment of phosphorylation of Ser139 on H2AX and activation of ATM in cells treated with aphidicolin, as a demonstrative of one of several DNA replication inhibitors that are being used for cell synchronization. Phosphorylation of Ser139H2AX and Ser1981ATM in individual cells is detected immunocytochemically with phospho-specific Abs and intensity of immunofluorescence is measured by flow cytometry. Concurrent measurement of cellular DNA content followed by multiparameter analysis allows one to correlate the extent of phosphorylation of these proteins in response to aphidicolin with the cell cycle phase.

  3. Periodic expression of nuclear and mitochondrial DNA replication genes during the trypanosomatid cell cycle.

    Science.gov (United States)

    Pasion, S G; Brown, G W; Brown, L M; Ray, D S

    1994-12-01

    In trypanosomatids, DNA replication in the nucleus and in the single mitochondrion (or kinetoplast) initiates nearly simultaneously, suggesting that the DNA synthesis (S) phases of the nucleus and the mitochondrion are coordinately regulated. To investigate the basis for the temporal link between nuclear and mitochondrial DNA synthesis phases the expression of the genes encoding DNA ligase I, the 51 and 28 kDa subunits of replication protein A, dihydrofolate reductase and the mitochondrial type II topoisomerase were analyzed during the cell cycle progression of synchronous cultures of Crithidia fasciculata. These DNA replication genes were all expressed periodically, with peak mRNA levels occurring just prior to or at the peak of DNA synthesis in the synchronized cultures. A plasmid clone (pdN-1) in which TOP2, the gene encoding the mitochondrial topoisomerase, was disrupted by the insertion of a NEO drug-resistance cassette was found to express both a truncated TOP2 mRNA and a truncated topoisomerase polypeptide. The truncated mRNA was also expressed periodically coordinate with the expression of the endogenous TOP2 mRNA indicating that cis elements necessary for periodic expression are contained within cloned sequences. The expression of both TOP2 and nuclear DNA replication genes at the G1/S boundary suggests that regulated expression of these genes may play a role in coordinating nuclear and mitochondrial S phases in trypanosomatids.

  4. A Network of Multi-Tasking Proteins at the DNA Replication Fork Preserves Genome Stability.

    Directory of Open Access Journals (Sweden)

    2005-12-01

    Full Text Available To elucidate the network that maintains high fidelity genome replication, we have introduced two conditional mutant alleles of DNA2, an essential DNA replication gene, into each of the approximately 4,700 viable yeast deletion mutants and determined the fitness of the double mutants. Fifty-six DNA2-interacting genes were identified. Clustering analysis of genomic synthetic lethality profiles of each of 43 of the DNA2-interacting genes defines a network (consisting of 322 genes and 876 interactions whose topology provides clues as to how replication proteins coordinate regulation and repair to protect genome integrity. The results also shed new light on the functions of the query gene DNA2, which, despite many years of study, remain controversial, especially its proposed role in Okazaki fragment processing and the nature of its in vivo substrates. Because of the multifunctional nature of virtually all proteins at the replication fork, the meaning of any single genetic interaction is inherently ambiguous. The multiplexing nature of the current studies, however, combined with follow-up supporting experiments, reveals most if not all of the unique pathways requiring Dna2p. These include not only Okazaki fragment processing and DNA repair but also chromatin dynamics.

  5. The role of RNase H2 in processing ribonucleotides incorporated during DNA replication.

    Science.gov (United States)

    Williams, Jessica S; Gehle, Daniel B; Kunkel, Thomas A

    2017-05-01

    Saccharomyces cerevisiae RNase H2 resolves RNA-DNA hybrids formed during transcription and it incises DNA at single ribonucleotides incorporated during nuclear DNA replication. To distinguish between the roles of these two activities in maintenance of genome stability, here we investigate the phenotypes of a mutant of yeast RNase H2 (rnh201-RED; ribonucleotide excision defective) that retains activity on RNA-DNA hybrids but is unable to cleave single ribonucleotides that are stably incorporated into the genome. The rnh201-RED mutant was expressed in wild type yeast or in a strain that also encodes a mutant allele of DNA polymerase ε (pol2-M644G) that enhances ribonucleotide incorporation during DNA replication. Similar to a strain that completely lacks RNase H2 (rnh201Δ), the pol2-M644G rnh201-RED strain exhibits replication stress and checkpoint activation. Moreover, like its null mutant counterpart, the double mutant pol2-M644G rnh201-RED strain and the single mutant rnh201-RED strain delete 2-5 base pairs in repetitive sequences at a high rate that is topoisomerase 1-dependent. The results highlight an important role for RNase H2 in maintaining genome integrity by removing single ribonucleotides incorporated during DNA replication. Published by Elsevier B.V.

  6. A conserved MCM single-stranded DNA binding element is essential for replication initiation.

    Science.gov (United States)

    Froelich, Clifford A; Kang, Sukhyun; Epling, Leslie B; Bell, Stephen P; Enemark, Eric J

    2014-04-01

    The ring-shaped MCM helicase is essential to all phases of DNA replication. The complex loads at replication origins as an inactive double-hexamer encircling duplex DNA. Helicase activation converts this species to two active single hexamers that encircle single-stranded DNA (ssDNA). The molecular details of MCM DNA interactions during these events are unknown. We determined the crystal structure of the Pyrococcus furiosus MCM N-terminal domain hexamer bound to ssDNA and define a conserved MCM-ssDNA binding motif (MSSB). Intriguingly, ssDNA binds the MCM ring interior perpendicular to the central channel with defined polarity. In eukaryotes, the MSSB is conserved in several Mcm2-7 subunits, and MSSB mutant combinations in S. cerevisiae Mcm2-7 are not viable. Mutant Mcm2-7 complexes assemble and are recruited to replication origins, but are defective in helicase loading and activation. Our findings identify an important MCM-ssDNA interaction and suggest it functions during helicase activation to select the strand for translocation. DOI: http://dx.doi.org/10.7554/eLife.01993.001.

  7. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p.

    Science.gov (United States)

    Brewer, Laurence R; Friddle, Raymond; Noy, Aleksandr; Baldwin, Enoch; Martin, Shelley S; Corzett, Michele; Balhorn, Rod; Baskin, Ronald J

    2003-10-01

    Mitochondrial and nuclear DNA are packaged by proteins in a very different manner. Although protein-DNA complexes called "nucleoids" have been identified as the genetic units of mitochondrial inheritance in yeast and man, little is known about their physical structure. The yeast mitochondrial protein Abf2p was shown to be sufficient to compact linear dsDNA, without the benefit of supercoiling, using optical and atomic force microscopy single molecule techniques. The packaging of DNA by Abf2p was observed to be very weak as evidenced by a fast Abf2p off-rate (k(off) = 0.014 +/- 0.001 s(-1)) and the extremely small forces (<0.6 pN) stabilizing the condensed protein-DNA complex. Atomic force microscopy images of individual complexes showed the 190-nm structures are loosely packaged relative to nuclear chromatin. This organization may leave mtDNA accessible for transcription and replication, while making it more vulnerable to damage.

  8. Methylation of DNA Ligase 1 by G9a/GLP Recruits UHRF1 to Replicating DNA and Regulates DNA Methylation.

    Science.gov (United States)

    Ferry, Laure; Fournier, Alexandra; Tsusaka, Takeshi; Adelmant, Guillaume; Shimazu, Tadahiro; Matano, Shohei; Kirsh, Olivier; Amouroux, Rachel; Dohmae, Naoshi; Suzuki, Takehiro; Filion, Guillaume J; Deng, Wen; de Dieuleveult, Maud; Fritsch, Lauriane; Kudithipudi, Srikanth; Jeltsch, Albert; Leonhardt, Heinrich; Hajkova, Petra; Marto, Jarrod A; Arita, Kyohei; Shinkai, Yoichi; Defossez, Pierre-Antoine

    2017-08-17

    DNA methylation is an essential epigenetic mark in mammals that has to be re-established after each round of DNA replication. The protein UHRF1 is essential for this process; it has been proposed that the protein targets newly replicated DNA by cooperatively binding hemi-methylated DNA and H3K9me2/3, but this model leaves a number of questions unanswered. Here, we present evidence for a direct recruitment of UHRF1 by the replication machinery via DNA ligase 1 (LIG1). A histone H3K9-like mimic within LIG1 is methylated by G9a and GLP and, compared with H3K9me2/3, more avidly binds UHRF1. Interaction with methylated LIG1 promotes the recruitment of UHRF1 to DNA replication sites and is required for DNA methylation maintenance. These results further elucidate the function of UHRF1, identify a non-histone target of G9a and GLP, and provide an example of a histone mimic that coordinates DNA replication and DNA methylation maintenance. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Single molecule DNA detection with an atomic vapor notch filter

    Energy Technology Data Exchange (ETDEWEB)

    Uhland, Denis; Rendler, Torsten; Widmann, Matthias; Lee, Sang-Yun [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Wrachtrup, Joerg; Gerhardt, Ilja [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Max Planck Institute for Solid State Research, Stuttgart (Germany)

    2015-12-01

    The detection of single molecules has facilitated many advances in life- and material-science. Commonly the fluorescence of dye molecules is detected, which are attached to a non-fluorescent structure under study. For fluorescence microscopy one desires to maximize the detection efficiency together with an efficient suppression of undesired laser leakage. Here we present the use of the narrow-band filtering properties of hot atomic sodium vapor to selectively filter the excitation light from the red-shifted fluorescence of dye labeled single-stranded DNA molecules. A statistical analysis proves an enhancement in detection efficiency of more than 15% in a confocal and in a wide-field configuration. (orig.)

  10. Coordinating repair of oxidative DNA damage with transcription and replication

    International Nuclear Information System (INIS)

    Cooper, P.K.

    2003-01-01

    Transcription-coupled repair (TCR) preferentially removes DNA lesions from template strands of active genes. Defects in TCR, which acts both on lesions removed by nucleotide excision repair (NER) and on oxidative lesions removed by base excision repair (BER), underlie the fatal developmental disorder Cockayne syndrome. Although its detailed mechanism remains unknown, TCR involves recognition of a stalled RNA polymerase (RNAP), removal or remodeling of RNAP to allow access to the lesion, and recruitment of repair enzymes. At a minimum, these early steps require a non-enzymatic function of the multifunctional repair protein XPG, the CSB protein with ATP-dependent chromatin remodeling activity, and the TFIIH complex (including the XPB and XPD helicases) that is also required for basal transcription initiation and NER. XPG exists in the cell in a complex with TFIIH, and in vitro evidence has suggested that it interacts with CSB. To address the mechanism of TCR, we are characterizing protein-DNA and protein-protein interactions of XPG. We show that XPG preferentially binds to double-stranded DNA containing bubbles resembling in size the unpaired regions associated with transcription. Two distinct domains of XPG are required for the observed strong binding specificity and stability. XPG both interacts directly with CSB and synergistically binds with it to bubble DNA, and it strongly stimulates the bubble DNA-dependent ATPase activity of CSB. Significantly for TCR, XPG also interacts directly with RNAP II, binds both the protein and nucleic acid components (the R-loop) of a stalled RNA polymerase, and forms a ternary complex with CSB and the stalled RNAP. These results are consistent with the model that XPG and CSB jointly interact with the DNA/chromatin structure in the vicinity of the stalled transcriptional apparatus and with the transcriptional machinery itself to remodel the chromatin and either move or remodel the blocked RNA polymerase to expose the lesion

  11. Abnormal regulation of DNA replication and increased lethality in ataxia telangiectasia cells exposed to carcinogenic agents

    International Nuclear Information System (INIS)

    Jaspers, N.G.; de Wit, J.; Regulski, M.R.; Bootsma, D.

    1982-01-01

    The effect of different carcinogenic agents on the rate of semiconservative DNA replication in normal and ataxia telangiectasis (AT) cells was investigated. The rate of DNA synthesis in all AT cell strains tested was depressed to a significantly lesser extent than in normal cells after exposure to X-rays under oxia or hypoxia or to bleomycin, agents to which AT cells are hypersensitive. In contrast, inhibition of DNA replication in normal human and AT cells was similar after treatment with some DNA-methylating agents or mitomycin C. Colony-forming ability of AT cells treated with these agents was not different from normal cells. Treatment with 4-nitroquinoline 1-oxide elicited a variable response in both AT and normal cell strains. In some strains, including those shown to be hypersensitive to the drug by other workers, the inhibition of DNA synthesis was more pronounced than in other cell strains, but no significant difference between AT and normal cells could be detected. The rejoining of DNA strand breaks induced by X-rays, measured by DNA elution techniques, occurred within l2 hr after treatment and could not be correlated with the difference in DNA synthesis inhibition in AT and normal cells. After low doses of X-rays, AT cells rejoined single-strand breaks slightly more slowly than did normal cells. The rate of DNA replication in X-irradiation AT and normal cells was not affected by nicotinamide, an inhibitor of poly(adenosine diphosphate ribose) synthesis. These data indicate that the diminished inhibition of DNA replication in carcinogen-treated AT cells (a) is a general characteristic of all AT cell strains, (b) correlates with AT cellular hypersensitivity, (c) is not directly caused by the bulk of the DNA strand breaks produced by carcinogenic agents, and (d) is not based on differences in the induction of poly(adenosine diphosphate ribose) synthesis between X-irradiated AT and normal cells

  12. Replication slippage of the thermophilic DNA polymerases B and D from the Euryarchaeota Pyrococcus abyssi

    Directory of Open Access Journals (Sweden)

    Melissa G. eCastillo-Lizardo

    2014-08-01

    Full Text Available Replication slippage or slipped-strand mispairing involves the misalignment of DNA strands during the replication of repeated DNA sequences, and can lead to genetic rearrangements such as microsatellite instability. Here, we show that PolB and PolD replicative DNA polymerases from the archaeal model Pyrococcus abyssi (Pab slip in vitro during replication of a single-stranded DNA template carrying a hairpin structure and short direct repeats. We find that this occurs in both their wild-type (exo+ and exonuclease deficient (exo- forms. The slippage behavior of PabPolB and PabPolD, probably due to limited strand displacement activity, resembles that observed for the high fidelity Pyrococcus furiosus (Pfu DNA polymerase. The presence of PabPCNA inhibited PabPolB and PabPolD slippage. We propose a model whereby PabPCNA stimulates strand displacement activity and polymerase progression through the hairpin, thus permitting the error-free replication of repetitive sequences.

  13. Functions of mammalian Cdc7 kinase in initiation/monitoring of DNA replication and development

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jung Min; Yamada, Masayuki; Masai, Hisao

    2003-11-27

    Cdc7 kinase plays an essential role in firing of replication origins by phosphorylating components of the replication complexes. Cdc7 kinase has also been implicated in S phase checkpoint signaling downstream of the ATR and Chk1 kinases. Inactivation of Cdc7 in yeast results in arrest of cell growth with 1C DNA content after completion of the ongoing DNA replication. In contrast, conditional inactivation of Cdc7 in undifferentiated mouse embryonic stem (ES) cells leads to growth arrest with rapid cessation of DNA synthesis, suggesting requirement of Cdc7 functions for continuation of ongoing DNA synthesis. Furthermore, loss of Cdc7 function induces recombinational repair (nuclear Rad51 foci) and G2/M checkpoint responses (inhibition of Cdc2 kinase). Eventually, p53 becomes highly activated and the cells undergo massive p53-dependent apoptosis. Thus, defective origin activation in mammalian cells can generate DNA replication checkpoint signals. Efficient removal of those cells in which replication has been perturbed, through cell death, may be beneficial to maintain the highest level of genetic integrity in totipotent stem cells. Partial, rather than total, loss of Cdc7 kinase expression results in retarded growth at both cellular and whole body levels, with especially profound impairment of germ cell development.

  14. Functions of mammalian Cdc7 kinase in initiation/monitoring of DNA replication and development

    International Nuclear Information System (INIS)

    Kim, Jung Min; Yamada, Masayuki; Masai, Hisao

    2003-01-01

    Cdc7 kinase plays an essential role in firing of replication origins by phosphorylating components of the replication complexes. Cdc7 kinase has also been implicated in S phase checkpoint signaling downstream of the ATR and Chk1 kinases. Inactivation of Cdc7 in yeast results in arrest of cell growth with 1C DNA content after completion of the ongoing DNA replication. In contrast, conditional inactivation of Cdc7 in undifferentiated mouse embryonic stem (ES) cells leads to growth arrest with rapid cessation of DNA synthesis, suggesting requirement of Cdc7 functions for continuation of ongoing DNA synthesis. Furthermore, loss of Cdc7 function induces recombinational repair (nuclear Rad51 foci) and G2/M checkpoint responses (inhibition of Cdc2 kinase). Eventually, p53 becomes highly activated and the cells undergo massive p53-dependent apoptosis. Thus, defective origin activation in mammalian cells can generate DNA replication checkpoint signals. Efficient removal of those cells in which replication has been perturbed, through cell death, may be beneficial to maintain the highest level of genetic integrity in totipotent stem cells. Partial, rather than total, loss of Cdc7 kinase expression results in retarded growth at both cellular and whole body levels, with especially profound impairment of germ cell development

  15. DNA replication is an integral part of the mouse oocyte's reprogramming machinery.

    Directory of Open Access Journals (Sweden)

    Bingyuan Wang

    Full Text Available Many of the structural and mechanistic requirements of oocyte-mediated nuclear reprogramming remain elusive. Previous accounts that transcriptional reprogramming of somatic nuclei in mouse zygotes may be complete in 24-36 hours, far more rapidly than in other reprogramming systems, raise the question of whether the mere exposure to the activated mouse ooplasm is sufficient to enact reprogramming in a nucleus. We therefore prevented DNA replication and cytokinesis, which ensue after nuclear transfer, in order to assess their requirement for transcriptional reprogramming of the key pluripotency genes Oct4 (Pou5f1 and Nanog in cloned mouse embryos. Using transcriptome and allele-specific analysis, we observed that hundreds of mRNAs, but not Oct4 and Nanog, became elevated in nucleus-transplanted oocytes without DNA replication. Progression through the first round of DNA replication was essential but not sufficient for transcriptional reprogramming of Oct4 and Nanog, whereas cytokinesis and thereby cell-cell interactions were dispensable for transcriptional reprogramming. Responses similar to clones also were observed in embryos produced by fertilization in vitro. Our results link the occurrence of reprogramming to a previously unappreciated requirement of oocyte-mediated nuclear reprogramming, namely DNA replication. Nuclear transfer alone affords no immediate transition from a somatic to a pluripotent gene expression pattern unless DNA replication is also in place. This study is therefore a resource to appreciate that the quest for always faster reprogramming methods may collide with a limit that is dictated by the cell cycle.

  16. A study on interaction of DNA molecules and carbon nanotubes for an effective ejection of the molecules

    International Nuclear Information System (INIS)

    Wu, N.; Wang, Q.

    2012-01-01

    The ejection of DNA molecules from carbon nanotubes is reported from interaction energy perspectives by molecular dynamics simulations. The critical ejection energy, which is to be applied to a DNA molecule for a successful ejection from a carbon nanotube, is investigated based on a study on the friction and binding energy between the DNA molecule and the tube. An effective ejection is realized by subjecting a kinetic energy on the DNA molecule that is larger than the solved critical ejection energy. In addition, the relationship between ejection energies and sizes of DNA molecules and carbon nanotubes is investigated. -- Highlights: ► Report the ejection of DNA molecules from CNTs from interaction energy perspectives. ► Develop a methodology for the critical energy of an effective ejection of a DNA molecule from a CNT. ► Present the relationship between critical ejection energies and sizes of DNA molecules and CNTs. ► Provide a general guidance on the ejection of encapsulated molecules from CNTs.

  17. Effect of Radiofrequency Radiation on DNA Duplex Stability and Replication.

    Science.gov (United States)

    1983-08-01

    Ando, T. A nuclease specific for heat-denatured DNA isolated from a product of Aspergillus oryzae . Biochim Biophys Acta 114:158-168 (1966). Blakeley...metabolic acti- vation. Mutation Res 64:315-328 (1979). Vogt,. V.M. Purification and further properties of single-strand-specific nuclease from Aspergillus oryzae . Eur J Biochem 33:192-200 (1973). 42

  18. Mismatch Repair Balances Leading and Lagging Strand DNA Replication Fidelity

    Science.gov (United States)

    2012-10-11

    Rev Mol Cell Biol 7: 335–346. 7. Li GM (2008) Mechanisms and functions of DNA mismatch repair. Cell Res 18: 85–98. 8. Pavlov YI, Mian IM, Kunkel TA...11: 165–170. 41. Li F, Tian L, Gu L, Li GM (2009) Evidence that nucleosomes inhibit mismatch repair in eukaryotic cells. J Biol Chem 284: 33056–33061

  19. A new structural framework for integrating replication protein A into DNA processing machinery

    Energy Technology Data Exchange (ETDEWEB)

    Brosey, Chris; Yan, Chunli; Tsutakawa, Susan; Heller, William; Rambo, Robert; Tainer, John; Ivanov, Ivaylo; Chazin, Walter

    2013-01-17

    By coupling the protection and organization of single-stranded DNA (ssDNA) with recruitment and alignment of DNA processing factors, replication protein A (RPA) lies at the heart of dynamic multi-protein DNA processing machinery. Nevertheless, how RPA coordinates biochemical functions of its eight domains remains unknown. We examined the structural biochemistry of RPA's DNA-binding activity, combining small-angle X-ray and neutron scattering with all-atom molecular dynamics simulations to investigate the architecture of RPA's DNA-binding core. The scattering data reveal compaction promoted by DNA binding; DNA-free RPA exists in an ensemble of states with inter-domain mobility and becomes progressively more condensed and less dynamic on binding ssDNA. Our results contrast with previous models proposing RPA initially binds ssDNA in a condensed state and becomes more extended as it fully engages the substrate. Moreover, the consensus view that RPA engages ssDNA in initial, intermediate and final stages conflicts with our data revealing that RPA undergoes two (not three) transitions as it binds ssDNA with no evidence for a discrete intermediate state. These results form a framework for understanding how RPA integrates the ssDNA substrate into DNA processing machinery, provides substrate access to its binding partners and promotes the progression and selection of DNA processing pathways.

  20. A subset of herpes simplex virus replication genes induces DNA amplification within the host cell genome

    Energy Technology Data Exchange (ETDEWEB)

    Heilbronn, R.; zur Hausen, H. (Deutsches Krebsforschungszentrum, Heidelberg (West Germany))

    1989-09-01

    Herpes simplex virus (HSV) induces DNA amplification of target genes within the host cell chromosome. To characterize the HSV genes that mediate the amplification effect, combinations of cloned DNA fragments covering the entire HSV genome were transiently transfected into simian virus 40 (SV40)-transformed hamster cells. This led to amplification of the integrated SV40 DNA sequences to a degree comparable to that observed after transfection of intact virion DNA. Transfection of combinations of subclones and of human cytomegalovirus immediate-early promoter-driven expression constructs for individual open reading frames led to the identification of sic HSV genes which together were necessary and sufficient for the induction of DNA amplification: UL30 (DNA polymerase), UL29 (major DNA-binding protein), UL5, UL8, UL42, and UL52. All of these genes encode proteins necessary for HSV DNA replication. However, an additional gene coding for an HSV origin-binding protein (UL9) was required for origin-dependent HSV DNA replication but was dispensable for SV40 DNA amplification. The results show that a subset of HSV replication genes is sufficient for the induction of DNA amplification. This opens the possibility that HSV expresses functions sufficient for DNA amplification but separate from those responsible for lytic viral growth. HSV infection may thereby induce DNA amplification within the host cell genome without killing the host by lytic viral growth. This may lead to persistence of a cell with a new genetic phenotype, which would have implications for the pathogenicity of the virus in vivo.

  1. TRAIP promotes DNA damage response during genome replication and is mutated in primordial dwarfism.

    Science.gov (United States)

    Harley, Margaret E; Murina, Olga; Leitch, Andrea; Higgs, Martin R; Bicknell, Louise S; Yigit, Gökhan; Blackford, Andrew N; Zlatanou, Anastasia; Mackenzie, Karen J; Reddy, Kaalak; Halachev, Mihail; McGlasson, Sarah; Reijns, Martin A M; Fluteau, Adeline; Martin, Carol-Anne; Sabbioneda, Simone; Elcioglu, Nursel H; Altmüller, Janine; Thiele, Holger; Greenhalgh, Lynn; Chessa, Luciana; Maghnie, Mohamad; Salim, Mahmoud; Bober, Michael B; Nürnberg, Peter; Jackson, Stephen P; Hurles, Matthew E; Wollnik, Bernd; Stewart, Grant S; Jackson, Andrew P

    2016-01-01

    DNA lesions encountered by replicative polymerases threaten genome stability and cell cycle progression. Here we report the identification of mutations in TRAIP, encoding an E3 RING ubiquitin ligase, in patients with microcephalic primordial dwarfism. We establish that TRAIP relocalizes to sites of DNA damage, where it is required for optimal phosphorylation of H2AX and RPA2 during S-phase in response to ultraviolet (UV) irradiation, as well as fork progression through UV-induced DNA lesions. TRAIP is necessary for efficient cell cycle progression and mutations in TRAIP therefore limit cellular proliferation, providing a potential mechanism for microcephaly and dwarfism phenotypes. Human genetics thus identifies TRAIP as a component of the DNA damage response to replication-blocking DNA lesions.

  2. Modulation of mutagenesis in eukaryotes by DNA replication fork dynamics and quality of nucleotide pools

    Science.gov (United States)

    Waisertreiger, Irina S.-R.; Liston, Victoria G.; Menezes, Miriam R.; Kim, Hyun-Min; Lobachev, Kirill S.; Stepchenkova, Elena I.; Tahirov, Tahir H.; Rogozin, Igor B.; Pavlov, Youri. I.

    2014-01-01

    The rate of mutations in eukaryotes depends on a plethora of factors and is not immediately derived from the fidelity of DNA polymerases (Pols). Replication of chromosomes containing the anti-parallel strands of duplex DNA occurs through the copying of leading and lagging strand templates by a trio of Pols α, δ and ε, with the assistance of Pol ζ and Y-family Pols at difficult DNA template structures or sites of DNA damage. The parameters of the synthesis at a given location are dictated by the quality and quantity of nucleotides in the pools, replication fork architecture, transcription status, regulation of Pol switches, and structure of chromatin. The result of these transactions is a subject of survey and editing by DNA repair. PMID:23055184

  3. Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy.

    Science.gov (United States)

    Hengel, Sarah R; Spies, M Ashley; Spies, Maria

    2017-09-21

    To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Both DNA Polymerases δ and ε Contact Active and Stalled Replication Forks Differently

    Science.gov (United States)

    Yu, Chuanhe; Gan, Haiyun

    2017-01-01

    ABSTRACT Three DNA polymerases, polymerases α, δ, and ε (Pol α, Pol δ, and Pol ε), are responsible for eukaryotic genome duplication. When DNA replication stress is encountered, DNA synthesis stalls until the stress is ameliorated. However, it is not known whether there is a difference in the association of each polymerase with active and stalled replication forks. Here, we show that each DNA polymerase has a distinct pattern of association with active and stalled replication forks. Pol α is enriched at extending Okazaki fragments of active and stalled forks. In contrast, although Pol δ contacts the nascent lagging strands of active and stalled forks, it binds to only the matured (and not elongating) Okazaki fragments of stalled forks. Pol ε has greater contact with the nascent single-stranded DNA (ssDNA) of the leading strand on active forks than on stalled forks. We propose that the configuration of DNA polymerases at stalled forks facilitates the resumption of DNA synthesis after stress removal. PMID:28784720

  5. Identification of Poxvirus Genome Uncoating and DNA Replication Factors with Mutually Redundant Roles.

    Science.gov (United States)

    Liu, Baoming; Panda, Debasis; Mendez-Rios, Jorge D; Ganesan, Sundar; Wyatt, Linda S; Moss, Bernard

    2018-04-01

    Genome uncoating is essential for replication of most viruses. For poxviruses, the process is divided into two stages: removal of the envelope, allowing early gene expression, and breaching of the core wall, allowing DNA release, replication, and late gene expression. Subsequent studies showed that the host proteasome and the viral D5 protein, which has an essential role in DNA replication, are required for vaccinia virus (VACV) genome uncoating. In a search for additional VACV uncoating proteins, we noted a report that described a defect in DNA replication and late expression when the gene encoding a 68-kDa ankyrin repeat/F-box protein (68k-ank), associated with the cellular SCF (Skp1, cullin1, F-box-containing complex) ubiquitin ligase complex, was deleted from the attenuated modified vaccinia virus Ankara (MVA). Here we showed that the 68k-ank deletion mutant exhibited diminished genome uncoating, formation of DNA prereplication sites, and degradation of viral cores as well as an additional, independent defect in DNA synthesis. Deletion of the 68k-ank homolog of VACV strain WR, however, was without effect, suggesting the existence of compensating genes. By inserting VACV genes into an MVA 68k-ank deletion mutant, we discovered that M2, a member of the poxvirus immune evasion (PIE) domain superfamily and a regulator of NF-κB, and C5, a member of the BTB/Kelch superfamily associated with cullin-3-based ligase complexes, independently rescued the 68k-ank deletion phenotype. Thus, poxvirus uncoating and DNA replication are intertwined processes involving at least three viral proteins with mutually redundant functions in addition to D5. IMPORTANCE Poxviruses comprise a family of large DNA viruses that infect vertebrates and invertebrates and cause diseases of medical and zoological importance. Poxviruses, unlike most other DNA viruses, replicate in the cytoplasm, and their large genomes usually encode 200 or more proteins with diverse functions. About 90 genes may

  6. Distinct functions of human RecQ helicases during DNA replication

    Czech Academy of Sciences Publication Activity Database

    Urban, Václav; Dobrovolná, Jana; Janščák, Pavel

    2017-01-01

    Roč. 225, červen (2017), s. 20-26 ISSN 0301-4622 R&D Projects: GA ČR(CZ) GA14-05743S; GA MŠk LH14037 Institutional support: RVO:68378050 Keywords : DNA replication * Replication stress * RecQ helicases * Genomic instability * Cancer Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biochemistry and molecular biology Impact factor: 2.402, year: 2016

  7. DNA damage by X-rays and their impact on replication processes

    International Nuclear Information System (INIS)

    Parplys, Ann Christin; Petermann, Eva; Petersen, Cordula; Dikomey, Ekkehard; Borgmann, Kerstin

    2012-01-01

    Background: Replication-dependent radiosensitization of tumors ranks among the most promising tools for future improvements in tumor therapy. However, cell cycle checkpoint signaling during S phase is a key for maintaining genomic stability after ionizing irradiation allowing DNA damage repair by stabilizing replication forks, inhibiting new origin firing and recruiting DNA repair proteins. As the impact of the different types of DNA damage induced by ionizing radiation on replication fork functionality has not been investigated, this study was performed in tumor cells treated with various agents that induce specific DNA lesions. Methods: U2OS cells were exposed to methyl methanesulfonate (MMS) to induce base damage, low or high concentrations of hydrogen peroxide for the induction of SSBs, Topotecan to induce DSBs at replication, Mitomycin C (MMC) to induce interstrand cross-links or ionizing irradiation to analyze all damages. Chk1 phosphorylation, origin firing and replication fork progression, and cell cycle distribution were analyzed. Results: In our system, the extent of Chk1 phosphorylation was dependent on the type of damage induced and prolonged Chk1 phosphorylation correlated with the inhibition of replication initiation. Ionizing radiation, high concentrations of hydrogen peroxide, and Topotecan affected replication elongation much more strongly that the other agents. Almost all agents induced a slight increase in the S phase population but subsequent G2 arrest was only observed in response to those agents that strongly inhibited replication elongation and caused prolonged Chk1 phosphorylation. Conclusions: Our data suggest that to improve radiotherapy, radiosensitivity in S phase could be increased by combining irradiation with agents that induce secondary DSB or inhibit checkpoint signaling, such as inhibitors of PARP or Chk1.

  8. Spermine attenuates the action of the DNA intercalator, actinomycin D, on DNA binding and the inhibition of transcription and DNA replication.

    Science.gov (United States)

    Wang, Sheng-Yu; Lee, Alan Yueh-Luen; Lee, Yueh-Luen; Lai, Yi-Hua; Chen, Jeremy J W; Wu, Wen-Lin; Yuann, Jeu-Ming P; Su, Wang-Lin; Chuang, Show-Mei; Hou, Ming-Hon

    2012-01-01

    The anticancer activity of DNA intercalators is related to their ability to intercalate into the DNA duplex with high affinity, thereby interfering with DNA replication and transcription. Polyamines (spermine in particular) are almost exclusively bound to nucleic acids and are involved in many cellular processes that require nucleic acids. Until now, the effects of polyamines on DNA intercalator activities have remained unclear because intercalation is the most important mechanism employed by DNA-binding drugs. Herein, using actinomycin D (ACTD) as a model, we have attempted to elucidate the effects of spermine on the action of ACTD, including its DNA-binding ability, RNA and DNA polymerase interference, and its role in the transcription and replication inhibition of ACTD within cells. We found that spermine interfered with the binding and stabilization of ACTD to DNA. The presence of increasing concentrations of spermine enhanced the transcriptional and replication activities of RNA and DNA polymerases, respectively, in vitro treated with ActD. Moreover, a decrease in intracellular polyamine concentrations stimulated by methylglyoxal-bis(guanylhydrazone) (MGBG) enhanced the ACTD-induced inhibition of c-myc transcription and DNA replication in several cancer cell lines. The results indicated that spermine attenuates ACTD binding to DNA and its inhibition of transcription and DNA replication both in vitro and within cells. Finally, a synergistic antiproliferative effect of MGBG and ACTD was observed in a cell viability assay. Our findings will be of significant relevance to future developments in combination with cancer therapy by enhancing the anticancer activity of DNA interactors through polyamine depletion.

  9. Spermine attenuates the action of the DNA intercalator, actinomycin D, on DNA binding and the inhibition of transcription and DNA replication.

    Directory of Open Access Journals (Sweden)

    Sheng-Yu Wang

    Full Text Available The anticancer activity of DNA intercalators is related to their ability to intercalate into the DNA duplex with high affinity, thereby interfering with DNA replication and transcription. Polyamines (spermine in particular are almost exclusively bound to nucleic acids and are involved in many cellular processes that require nucleic acids. Until now, the effects of polyamines on DNA intercalator activities have remained unclear because intercalation is the most important mechanism employed by DNA-binding drugs. Herein, using actinomycin D (ACTD as a model, we have attempted to elucidate the effects of spermine on the action of ACTD, including its DNA-binding ability, RNA and DNA polymerase interference, and its role in the transcription and replication inhibition of ACTD within cells. We found that spermine interfered with the binding and stabilization of ACTD to DNA. The presence of increasing concentrations of spermine enhanced the transcriptional and replication activities of RNA and DNA polymerases, respectively, in vitro treated with ActD. Moreover, a decrease in intracellular polyamine concentrations stimulated by methylglyoxal-bis(guanylhydrazone (MGBG enhanced the ACTD-induced inhibition of c-myc transcription and DNA replication in several cancer cell lines. The results indicated that spermine attenuates ACTD binding to DNA and its inhibition of transcription and DNA replication both in vitro and within cells. Finally, a synergistic antiproliferative effect of MGBG and ACTD was observed in a cell viability assay. Our findings will be of significant relevance to future developments in combination with cancer therapy by enhancing the anticancer activity of DNA interactors through polyamine depletion.

  10. Regional differences in DNA replication in nasal epithelium following acute ozone or cigarette smoke exposure

    International Nuclear Information System (INIS)

    Johnson, N.F.; Hotchkiss, J.A.; Harkema, J.R.; Henderson, R.F.; Mauderly, J.L.; Cuddihy, R.G.

    1988-01-01

    The epithelium of the anterior nasal cavity is composed of four cell types, squamous, respiratory, cuboidal, and olfactory cells. We monitored proliferation In these tissues by bromodeoxy-uridine (BrdUrd) incorporation; the labeled cells were identified by using a monoclonal antibody that recognizes BrdUrd. The respiratory, cuboidal and olfactory epithelia had low cell turnover (1-labeled ceIl/mm basal lamina). Squamous epithelium contained 40-labeled cells per mm basal lamina. Following exposure to diluted mainstream cigarette smoke, a transient, but marked increase in DNA replication was seen in the cuboidal epithelium. In contrast, ozone exposure was associated with DNA replication in the olfactory and respiratory epithelium, as well as in the cuboidal epithelium. These studies show that the sensitivity of nasal epithelium to irritants can be assayed by measuring DNA replication. (author)

  11. Regional differences in DNA replication in nasal epithelium following acute ozone or cigarette smoke exposure

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, N F; Hotchkiss, J A; Harkema, J R; Henderson, R F; Mauderly, J L; Cuddihy, R G

    1988-12-01

    The epithelium of the anterior nasal cavity is composed of four cell types, squamous, respiratory, cuboidal, and olfactory cells. We monitored proliferation In these tissues by bromodeoxy-uridine (BrdUrd) incorporation; the labeled cells were identified by using a monoclonal antibody that recognizes BrdUrd. The respiratory, cuboidal and olfactory epithelia had low cell turnover (1-labeled ceIl/mm basal lamina). Squamous epithelium contained 40-labeled cells per mm basal lamina. Following exposure to diluted mainstream cigarette smoke, a transient, but marked increase in DNA replication was seen in the cuboidal epithelium. In contrast, ozone exposure was associated with DNA replication in the olfactory and respiratory epithelium, as well as in the cuboidal epithelium. These studies show that the sensitivity of nasal epithelium to irritants can be assayed by measuring DNA replication. (author)

  12. USP37 deubiquitinates Cdt1 and contributes to regulate DNA replication.

    Science.gov (United States)

    Hernández-Pérez, Santiago; Cabrera, Elisa; Amoedo, Hugo; Rodríguez-Acebes, Sara; Koundrioukoff, Stephane; Debatisse, Michelle; Méndez, Juan; Freire, Raimundo

    2016-10-01

    DNA replication control is a key process in maintaining genomic integrity. Monitoring DNA replication initiation is particularly important as it needs to be coordinated with other cellular events and should occur only once per cell cycle. Crucial players in the initiation of DNA replication are the ORC protein complex, marking the origin of replication, and the Cdt1 and Cdc6 proteins, that license these origins to replicate by recruiting the MCM2-7 helicase. To accurately achieve its functions, Cdt1 is tightly regulated. Cdt1 levels are high from metaphase and during G1 and low in S/G2 phases of the cell cycle. This control is achieved, among other processes, by ubiquitination and proteasomal degradation. In an overexpression screen for Cdt1 deubiquitinating enzymes, we isolated USP37, to date the first ubiquitin hydrolase controlling Cdt1. USP37 overexpression stabilizes Cdt1, most likely a phosphorylated form of the protein. In contrast, USP37 knock down destabilizes Cdt1, predominantly during G1 and G1/S phases of the cell cycle. USP37 interacts with Cdt1 and is able to de-ubiquitinate Cdt1 in vivo and, USP37 is able to regulate the loading of MCM complexes onto the chromatin. In addition, downregulation of USP37 reduces DNA replication fork speed. Taken together, here we show that the deubiquitinase USP37 plays an important role in the regulation of DNA replication. Whether this is achieved via Cdt1, a central protein in this process, which we have shown to be stabilized by USP37, or via additional factors, remains to be tested. Copyright © 2016 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  13. Cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of the central zinc-binding domain of the human Mcm10 DNA-replication factor

    International Nuclear Information System (INIS)

    Jung, Nam Young; Bae, Won Jin; Chang, Jeong Ho; Kim, Young Chang; Cho, Yunje

    2008-01-01

    Mcm10 is a highly conserved nuclear protein that plays a key role in the initiation and elongation processes of DNA replication by providing a physical link between the Mcm2–7 complex and DNA polymerases. In this study, the central domain of human Mcm10 was crystallized using the hanging-drop vapour-diffusion method in the presence of PEG 3350. The initiation of eukaryotic DNA replication requires the tightly controlled assembly of a set of replication factors. Mcm10 is a highly conserved nuclear protein that plays a key role in the initiation and elongation processes of DNA replication by providing a physical link between the Mcm2–7 complex and DNA polymerases. The central domain, which contains the CCCH zinc-binding motif, is most conserved within Mcm10 and binds to DNA and several proteins, including proliferative cell nuclear antigen. In this study, the central domain of human Mcm10 was crystallized using the hanging-drop vapour-diffusion method in the presence of PEG 3350. An X-ray diffraction data set was collected to a resolution of 2.6 Å on a synchrotron beamline. The crystals formed belonged to space group R3, with unit-cell parameters a = b = 99.5, c = 133.0 Å. According to Matthews coefficient calculations, the crystals were predicted to contain six MCM10 central domain molecules in the asymmetric unit

  14. Exponential growth and selection in self-replicating materials from DNA origami rafts

    Science.gov (United States)

    He, Xiaojin; Sha, Ruojie; Zhuo, Rebecca; Mi, Yongli; Chaikin, Paul M.; Seeman, Nadrian C.

    2017-10-01

    Self-replication and evolution under selective pressure are inherent phenomena in life, and but few artificial systems exhibit these phenomena. We have designed a system of DNA origami rafts that exponentially replicates a seed pattern, doubling the copies in each diurnal-like cycle of temperature and ultraviolet illumination, producing more than 7 million copies in 24 cycles. We demonstrate environmental selection in growing populations by incorporating pH-sensitive binding in two subpopulations. In one species, pH-sensitive triplex DNA bonds enable parent-daughter templating, while in the second species, triplex binding inhibits the formation of duplex DNA templating. At pH 5.3, the replication rate of species I is ~1.3-1.4 times faster than that of species II. At pH 7.8, the replication rates are reversed. When mixed together in the same vial, the progeny of species I replicate preferentially at pH 7.8 similarly at pH 5.3, the progeny of species II take over the system. This addressable selectivity should be adaptable to the selection and evolution of multi-component self-replicating materials in the nanoscopic-to-microscopic size range.

  15. RPA-Binding Protein ETAA1 Is an ATR Activator Involved in DNA Replication Stress Response.

    Science.gov (United States)

    Lee, Yuan-Cho; Zhou, Qing; Chen, Junjie; Yuan, Jingsong

    2016-12-19

    ETAA1 (Ewing tumor-associated antigen 1), also known as ETAA16, was identified as a tumor-specific antigen in the Ewing family of tumors. However, the biological function of this protein remains unknown. Here, we report the identification of ETAA1 as a DNA replication stress response protein. ETAA1 specifically interacts with RPA (Replication protein A) via two conserved RPA-binding domains and is therefore recruited to stalled replication forks. Interestingly, further analysis of ETAA1 function revealed that ETAA1 participates in the activation of ATR signaling pathway via a conserved ATR-activating domain (AAD) located near its N terminus. Importantly, we demonstrate that both RPA binding and ATR activation are required for ETAA1 function at stalled replication forks to maintain genome stability. Therefore, our data suggest that ETAA1 is a new ATR activator involved in replication checkpoint control. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. GC-rich DNA elements enable replication origin activity in the methylotrophic yeast Pichia pastoris.

    Science.gov (United States)

    Liachko, Ivan; Youngblood, Rachel A; Tsui, Kyle; Bubb, Kerry L; Queitsch, Christine; Raghuraman, M K; Nislow, Corey; Brewer, Bonita J; Dunham, Maitreya J

    2014-03-01

    The well-studied DNA replication origins of the model budding and fission yeasts are A/T-rich elements. However, unlike their yeast counterparts, both plant and metazoan origins are G/C-rich and are associated with transcription start sites. Here we show that an industrially important methylotrophic budding yeast, Pichia pastoris, simultaneously employs at least two types of replication origins--a G/C-rich type associated with transcription start sites and an A/T-rich type more reminiscent of typical budding and fission yeast origins. We used a suite of massively parallel sequencing tools to map and dissect P. pastoris origins comprehensively, to measure their replication dynamics, and to assay the global positioning of nucleosomes across the genome. Our results suggest that some functional overlap exists between promoter sequences and G/C-rich replication origins in P. pastoris and imply an evolutionary bifurcation of the modes of replication initiation.

  17. GC-rich DNA elements enable replication origin activity in the methylotrophic yeast Pichia pastoris.

    Directory of Open Access Journals (Sweden)

    Ivan Liachko

    2014-03-01

    Full Text Available The well-studied DNA replication origins of the model budding and fission yeasts are A/T-rich elements. However, unlike their yeast counterparts, both plant and metazoan origins are G/C-rich and are associated with transcription start sites. Here we show that an industrially important methylotrophic budding yeast, Pichia pastoris, simultaneously employs at least two types of replication origins--a G/C-rich type associated with transcription start sites and an A/T-rich type more reminiscent of typical budding and fission yeast origins. We used a suite of massively parallel sequencing tools to map and dissect P. pastoris origins comprehensively, to measure their replication dynamics, and to assay the global positioning of nucleosomes across the genome. Our results suggest that some functional overlap exists between promoter sequences and G/C-rich replication origins in P. pastoris and imply an evolutionary bifurcation of the modes of replication initiation.

  18. Control of Initiation of DNA Replication in Bacillus subtilis and Escherichia coli

    Directory of Open Access Journals (Sweden)

    Katie H. Jameson

    2017-01-01

    Full Text Available Initiation of DNA Replication is tightly regulated in all cells since imbalances in chromosomal copy number are deleterious and often lethal. In bacteria such as Bacillus subtilis and Escherichia coli, at the point of cytokinesis, there must be two complete copies of the chromosome to partition into the daughter cells following division at mid-cell during vegetative growth. Under conditions of rapid growth, when the time taken to replicate the chromosome exceeds the doubling time of the cells, there will be multiple initiations per cell cycle and daughter cells will inherit chromosomes that are already undergoing replication. In contrast, cells entering the sporulation pathway in B. subtilis can do so only during a short interval in the cell cycle when there are two, and only two, chromosomes per cell, one destined for the spore and one for the mother cell. Here, we briefly describe the overall process of DNA replication in bacteria before reviewing initiation of DNA replication in detail. The review covers DnaA-directed assembly of the replisome at oriC and the multitude of mechanisms of regulation of initiation, with a focus on the similarities and differences between E. coli and B. subtilis.

  19. The fork and the kinase: a DNA replication tale from a CHK1 perspective.

    Science.gov (United States)

    González Besteiro, Marina A; Gottifredi, Vanesa

    2015-01-01

    Replication fork progression is being continuously hampered by exogenously introduced and naturally occurring DNA lesions and other physical obstacles. Checkpoint kinase 1 (Chk1) is activated at replication forks that encounter damaged DNA. Subsequently, Chk1 inhibits the initiation of new replication factories and stimulates the firing of dormant origins (those in the vicinity of stalled forks). Chk1 also avoids fork collapse into DSBs (double strand breaks) and promotes fork elongation. At the molecular level, the current model considers stalled forks as the site of Chk1 activation and the nucleoplasm as the location where Chk1 phosphorylates target proteins. This model certainly serves to explain how Chk1 modulates origin firing, but how Chk1 controls the fate of stalled forks is less clear. Interestingly, recent reports demonstrating that Chk1 phosphorylates chromatin-bound proteins and even holds kinase-independent functions might shed light on how Chk1 contributes to the elongation of damaged DNA. Indeed, such findings have unveiled a puzzling connection between Chk1 and DNA lesion bypass, which might be central to promoting fork elongation and checkpoint attenuation. In summary, Chk1 is a multifaceted and versatile signaling factor that acts at ongoing forks and replication origins to determine the extent and quality of the cellular response to replication stress. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Control of Initiation of DNA Replication in Bacillus subtilis and Escherichia coli

    Science.gov (United States)

    Jameson, Katie H.; Wilkinson, Anthony J.

    2017-01-01

    Initiation of DNA Replication is tightly regulated in all cells since imbalances in chromosomal copy number are deleterious and often lethal. In bacteria such as Bacillus subtilis and Escherichia coli, at the point of cytokinesis, there must be two complete copies of the chromosome to partition into the daughter cells following division at mid-cell during vegetative growth. Under conditions of rapid growth, when the time taken to replicate the chromosome exceeds the doubling time of the cells, there will be multiple initiations per cell cycle and daughter cells will inherit chromosomes that are already undergoing replication. In contrast, cells entering the sporulation pathway in B. subtilis can do so only during a short interval in the cell cycle when there are two, and only two, chromosomes per cell, one destined for the spore and one for the mother cell. Here, we briefly describe the overall process of DNA replication in bacteria before reviewing initiation of DNA replication in detail. The review covers DnaA-directed assembly of the replisome at oriC and the multitude of mechanisms of regulation of initiation, with a focus on the similarities and differences between E. coli and B. subtilis. PMID:28075389

  1. Effects of ultraviolet irradiation on the rate and sequence of DNA replication in synchronized Chinese hamster cells

    International Nuclear Information System (INIS)

    Meyn, R.E.; Hewitt, R.R.; Thomson, L.F.; Humphrey, R.M.

    1976-01-01

    The effects of ultraviolet light (uv) irradiation on the rate of DNA replication in synchronized Chinese hamster ovary (CHO) cells were investigated. A technique for measuring semiconservative DNA replication was employed that involved growing the cells in medium containing 5-bromodeoxyuridine and subsequently determining the amount of DNA that acquired hybrid buoyant density in CsCl density gradients. One of the advantages of this technique was that it allowed a characterization of the extent of DNA replication as well as rate after irradiation. It was found that while there was a dose-dependent reduction in the rate of DNA replication following uv-irradiation, doses of up to 10 J/m 2 (which produce many dimers per replicon) did not prevent the ultimate replication of the entire genome. Hence, we conclude that dimers cannot be absolute blocks to DNA replication. In order to account for the total genome replication observed, a mechanism must exist that allows genome replication between dimers. The degree of reduction in the rate of replication by uv was the same whether the cells were irradiated at the Gl-S boundary or 1 h into S-phase. Previous work had shown that cells in early S-phase are considerably more sensitive to uv than cells at the G1-S boundary. Experiments specifically designed to test for reiterative replication showed that uv does not induce a second round of DNA replication within the same S-phase

  2. DNA polymerase η modulates replication fork progression and DNA damage responses in platinum-treated human cells

    Science.gov (United States)

    Sokol, Anna M.; Cruet-Hennequart, Séverine; Pasero, Philippe; Carty, Michael P.

    2013-11-01

    Human cells lacking DNA polymerase η (polη) are sensitive to platinum-based cancer chemotherapeutic agents. Using DNA combing to directly investigate the role of polη in bypass of platinum-induced DNA lesions in vivo, we demonstrate that nascent DNA strands are up to 39% shorter in human cells lacking polη than in cells expressing polη. This provides the first direct evidence that polη modulates replication fork progression in vivo following cisplatin and carboplatin treatment. Severe replication inhibition in individual platinum-treated polη-deficient cells correlates with enhanced phosphorylation of the RPA2 subunit of replication protein A on serines 4 and 8, as determined using EdU labelling and immunofluorescence, consistent with formation of DNA strand breaks at arrested forks in the absence of polη. Polη-mediated bypass of platinum-induced DNA lesions may therefore represent one mechanism by which cancer cells can tolerate platinum-based chemotherapy.

  3. Involvement of specialized DNA polymerases Pol II, Pol IV and DnaE2 in DNA replication in the absence of Pol I in Pseudomonas putida

    International Nuclear Information System (INIS)

    Sidorenko, Julia; Jatsenko, Tatjana; Saumaa, Signe; Teras, Riho; Tark-Dame, Mariliis; Horak, Rita; Kivisaar, Maia

    2011-01-01

    The majority of bacteria possess a different set of specialized DNA polymerases than those identified in the most common model organism Escherichia coli. Here, we have studied the ability of specialized DNA polymerases to substitute Pol I in DNA replication in Pseudomonas putida. Our results revealed that P. putida Pol I-deficient cells have severe growth defects in LB medium, which is accompanied by filamentous cell morphology. However, growth of Pol I-deficient bacteria on solid rich medium can be restored by reduction of reactive oxygen species in cells. Also, mutants with improved growth emerge rapidly. Similarly to the initial Pol I-deficient P. putida, its adapted derivatives express a moderate mutator phenotype, which indicates that DNA replication carried out in the absence of Pol I is erroneous both in the original Pol I-deficient bacteria and the adapted derivatives. Analysis of the spectra of spontaneous Rif r mutations in P. putida strains lacking different DNA polymerases revealed that the presence of specialized DNA polymerases Pol II and Pol IV influences the frequency of certain base substitutions in Pol I-proficient and Pol I-deficient backgrounds in opposite ways. Involvement of another specialized DNA polymerase DnaE2 in DNA replication in Pol I-deficient bacteria is stimulated by UV irradiation of bacteria, implying that DnaE2-provided translesion synthesis partially substitutes the absence of Pol I in cells containing heavily damaged DNA.

  4. Physical manipulation of single-molecule DNA using microbead and its application to analysis of DNA-protein interaction

    International Nuclear Information System (INIS)

    Kurita, Hirofumi; Yasuda, Hachiro; Takashima, Kazunori; Katsura, Shinji; Mizuno, Akira

    2009-01-01

    We carried out an individual DNA manipulation using an optical trapping for a microbead. This manipulation system is based on a fluorescent microscopy equipped with an IR laser. Both ends of linear DNA molecule were labeled with a biotin and a thiol group, respectively. Then the biotinylated end was attached to a microbead, and the other was immobilized on a thiol-linkable glass surface. We controlled the form of an individual DNA molecule by moving the focal point of IR laser, which trapped the microbead. In addition, we applied single-molecule approach to analyze DNA hydrolysis. We also used microchannel for single-molecule observation of DNA hydrolysis. The shortening of DNA in length caused by enzymatic hydrolysis was observed in real-time. The single-molecule DNA manipulation should contribute to elucidate detailed mechanisms of DNA-protein interactions

  5. Replication of UV-irradiated DNA in human cell extracts: Evidence for mutagenic bypass of pyrimidine dimers

    International Nuclear Information System (INIS)

    Thomas, D.C.; Kunkel, T.A.

    1993-01-01

    The authors have examined the efficiency and fidelity of simian virus 40-origin-dependent replication of UV-irradiated double-stranded DNA in extracts of human cells. Using as a mutational target the α-complementation domain of the Escherichia coli lacZ gene in bacteriophage M13mp2DNA, replication of undamaged DNA in HeLa cell extracts was highly accurate, whereas replication of DNA irradiated with UV light (280-320 nm) was both less efficient and less accurate. Replication was inhibited by irradiation in a dose-dependent manner. Nonetheless, covalently closed, monomer-length circular products were generated that were resistant to digestion by Dpn I, showing that they resulted from semiconservative replication. These products were incised by T4 endonuclease V, whereas the undamaged replication products were not, suggesting that pyrimidine dimers were bypassed during replication. When replicated, UV-irradiated DNA was used to transfect an E. coli α-complementation host strain to score mutant M13mp2 plaques, the mutant plaque frequency was substantially higher than that obtained with either unirradiated, replicated DNA, or unreplicated, UV-irradiated DNA. Both the increased mutagenicity and the inhibition of replication associated with UV irradiation were reversed by treatment of the irradiated DNA with photolyase before replication. Sequence analysis of mutants resulting from replication of UV-irradiated DNA demonstrated that most mutants contained C → T transition errors at dipyrimidine sites. A few mutants contained 1-nt frameshift errors or tandem double CC → TT substitutions. The data are consistent with the interpretation that pyrimidine dimers are bypassed during replication by the multiprotein replication apparatus in human cell extracts and that this bypass is mutagenic primarily via misincorporation of dAMP opposite a cytosine (or uracil) in the dimer. 56 refs., 2 figs., 3 tabs

  6. NMR structure of the N-terminal domain of the replication initiator protein DnaA

    Energy Technology Data Exchange (ETDEWEB)

    Wemmer, David E.; Lowery, Thomas J.; Pelton, Jeffrey G.; Chandonia, John-Marc; Kim, Rosalind; Yokota, Hisao; Wemmer, David E.

    2007-08-07

    DnaA is an essential component in the initiation of bacterial chromosomal replication. DnaA binds to a series of 9 base pair repeats leading to oligomerization, recruitment of the DnaBC helicase, and the assembly of the replication fork machinery. The structure of the N-terminal domain (residues 1-100) of DnaA from Mycoplasma genitalium was determined by NMR spectroscopy. The backbone r.m.s.d. for the first 86 residues was 0.6 +/- 0.2 Angstrom based on 742 NOE, 50 hydrogen bond, 46 backbone angle, and 88 residual dipolar coupling restraints. Ultracentrifugation studies revealed that the domain is monomeric in solution. Features on the protein surface include a hydrophobic cleft flanked by several negative residues on one side, and positive residues on the other. A negatively charged ridge is present on the opposite face of the protein. These surfaces may be important sites of interaction with other proteins involved in the replication process. Together, the structure and NMR assignments should facilitate the design of new experiments to probe the protein-protein interactions essential for the initiation of DNA replication.

  7. RTEL1 contributes to DNA replication and repair and telomere maintenance.

    Science.gov (United States)

    Uringa, Evert-Jan; Lisaingo, Kathleen; Pickett, Hilda A; Brind'Amour, Julie; Rohde, Jan-Hendrik; Zelensky, Alex; Essers, Jeroen; Lansdorp, Peter M

    2012-07-01

    Telomere maintenance and DNA repair are important processes that protect the genome against instability. mRtel1, an essential helicase, is a dominant factor setting telomere length in mice. In addition, mRtel1 is involved in DNA double-strand break repair. The role of mRtel1 in telomere maintenance and genome stability is poorly understood. Therefore we used mRtel1-deficient mouse embryonic stem cells to examine the function of mRtel1 in replication, DNA repair, recombination, and telomere maintenance. mRtel1-deficient mouse embryonic stem cells showed sensitivity to a range of DNA-damaging agents, highlighting its role in replication and genome maintenance. Deletion of mRtel1 increased the frequency of sister chromatid exchange events and suppressed gene replacement, demonstrating the involvement of the protein in homologous recombination. mRtel1 localized transiently at telomeres and is needed for efficient telomere replication. Of interest, in the absence of mRtel1, telomeres in embryonic stem cells appeared relatively stable in length, suggesting that mRtel1 is required to allow extension by telomerase. We propose that mRtel1 is a key protein for DNA replication, recombination, and repair and efficient elongation of telomeres by telomerase.

  8. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    Science.gov (United States)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  9. Chromosomal Arrangement of Phosphorelay Genes Couples Sporulation and DNA Replication.

    Science.gov (United States)

    Narula, Jatin; Kuchina, Anna; Lee, Dong-Yeon D; Fujita, Masaya; Süel, Gürol M; Igoshin, Oleg A

    2015-07-16

    Genes encoding proteins in a common regulatory network are frequently located close to one another on the chromosome to facilitate co-regulation or couple gene expression to growth rate. Contrasting with these observations, here, we demonstrate a functional role for the arrangement of Bacillus subtilis sporulation network genes on opposite sides of the chromosome. We show that the arrangement of two sporulation network genes, one located close to the origin and the other close to the terminus, leads to a transient gene dosage imbalance during chromosome replication. This imbalance is detected by the sporulation network to produce cell-cycle coordinated pulses of the sporulation master regulator Spo0A∼P. This pulsed response allows cells to decide between sporulation and continued vegetative growth during each cell cycle spent in starvation. The simplicity of this coordination mechanism suggests that it may be widely applicable in a variety of gene regulatory and stress-response settings. VIDEO ABSTRACT. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Replication stress, DNA damage signalling, and cytomegalovirus infection in human medulloblastomas

    DEFF Research Database (Denmark)

    Bartek, Jiri; Fornara, Olesja; Merchut-Maya, Joanna Maria

    2017-01-01

    suppressor activation, across our medulloblastoma cohort. Most tumours showed high proliferation (Ki67 marker), variable oxidative DNA damage (8-oxoguanine lesions) and formation of 53BP1 nuclear 'bodies', the latter indicating (along with ATR-Chk1 signalling) endogenous replication stress. The bulk...... cell replication stress and DNA repair. Collectively, the scenario we report here likely fuels genomic instability and evolution of medulloblastoma resistance to standard-of-care genotoxic treatments....... eight established immunohistochemical markers to assess the status of the DDR machinery, we found pronounced endogenous DNA damage signalling (γH2AX marker) and robust constitutive activation of both the ATM-Chk2 and ATR-Chk1 DNA damage checkpoint kinase cascades, yet unexpectedly modest p53 tumour...

  11. Inhibition of DNA chain elongation in Chinese hamster cells by damage localized behind the replication fork

    Energy Technology Data Exchange (ETDEWEB)

    Ben-Hur, E [Israel Atomic Energy Commission, Beersheba. Nuclear Research Center-Negev; Hagan, M P [Armed Forces Radiobiology Research Inst., Bethesda, MD (USA)

    1984-05-01

    Chinese hamster fibroblasts were pulse labelled with 5-bromodeoxyuridine and exposed at time intervals (Tsub(i)) to near-ultraviolet (U.V.A.) light in the presence of a bisbenzimidazole derivative (Hoechst 33342). The sensitivity of the cells in terms of colony forming ability fluctuated depending on Tsub(i). Inhibition of DNA synthesis also depended on Tsub(i) and was maximal when Tsub(i)=O. Using the alkaline elution technique it was shown that the effect of a large dose of light was to inhibit both initiation and elongation of DNA chains. These effects were most pronounced for Tsub(i)=O. It is concluded that DNA damage in an active replicon can inhibit initiation of new replicons and that damage localized behind the replication fork can retard elongation of nascent DNA chains. This effect on chain elongation decreases with increased distance of the damage from the replication fork.

  12. How MCM loading and spreading specify eukaryotic DNA replication initiation sites [version 1; referees: 4 approved

    Directory of Open Access Journals (Sweden)

    Olivier Hyrien

    2016-08-01

    Full Text Available DNA replication origins strikingly differ between eukaryotic species and cell types. Origins are localized and can be highly efficient in budding yeast, are randomly located in early fly and frog embryos, which do not transcribe their genomes, and are clustered in broad (10-100 kb non-transcribed zones, frequently abutting transcribed genes, in mammalian cells. Nonetheless, in all cases, origins are established during the G1-phase of the cell cycle by the loading of double hexamers of the Mcm 2-7 proteins (MCM DHs, the core of the replicative helicase. MCM DH activation in S-phase leads to origin unwinding, polymerase recruitment, and initiation of bidirectional DNA synthesis. Although MCM DHs are initially loaded at sites defined by the binding of the origin recognition complex (ORC, they ultimately bind chromatin in much greater numbers than ORC and only a fraction are activated in any one S-phase. Data suggest that the multiplicity and functional redundancy of MCM DHs provide robustness to the replication process and affect replication time and that MCM DHs can slide along the DNA and spread over large distances around the ORC. Recent studies further show that MCM DHs are displaced along the DNA by collision with transcription complexes but remain functional for initiation after displacement. Therefore, eukaryotic DNA replication relies on intrinsically mobile and flexible origins, a strategy fundamentally different from bacteria but conserved from yeast to human. These properties of MCM DHs likely contribute to the establishment of broad, intergenic replication initiation zones in higher eukaryotes.

  13. How MCM loading and spreading specify eukaryotic DNA replication initiation sites.

    Science.gov (United States)

    Hyrien, Olivier

    2016-01-01

    DNA replication origins strikingly differ between eukaryotic species and cell types. Origins are localized and can be highly efficient in budding yeast, are randomly located in early fly and frog embryos, which do not transcribe their genomes, and are clustered in broad (10-100 kb) non-transcribed zones, frequently abutting transcribed genes, in mammalian cells. Nonetheless, in all cases, origins are established during the G1-phase of the cell cycle by the loading of double hexamers of the Mcm 2-7 proteins (MCM DHs), the core of the replicative helicase. MCM DH activation in S-phase leads to origin unwinding, polymerase recruitment, and initiation of bidirectional DNA synthesis. Although MCM DHs are initially loaded at sites defined by the binding of the origin recognition complex (ORC), they ultimately bind chromatin in much greater numbers than ORC and only a fraction are activated in any one S-phase. Data suggest that the multiplicity and functional redundancy of MCM DHs provide robustness to the replication process and affect replication time and that MCM DHs can slide along the DNA and spread over large distances around the ORC. Recent studies further show that MCM DHs are displaced along the DNA by collision with transcription complexes but remain functional for initiation after displacement. Therefore, eukaryotic DNA replication relies on intrinsically mobile and flexible origins, a strategy fundamentally different from bacteria but conserved from yeast to human. These properties of MCM DHs likely contribute to the establishment of broad, intergenic replication initiation zones in higher eukaryotes.

  14. The DNA replication checkpoint directly regulates MBF-dependent G1/S transcription.

    Science.gov (United States)

    Dutta, Chaitali; Patel, Prasanta K; Rosebrock, Adam; Oliva, Anna; Leatherwood, Janet; Rhind, Nicholas

    2008-10-01

    The DNA replication checkpoint transcriptionally upregulates genes that allow cells to adapt to and survive replication stress. Our results show that, in the fission yeast Schizosaccharomyces pombe, the replication checkpoint regulates the entire G(1)/S transcriptional program by directly regulating MBF, the G(1)/S transcription factor. Instead of initiating a checkpoint-specific transcriptional program, the replication checkpoint targets MBF to maintain the normal G(1)/S transcriptional program during replication stress. We propose a mechanism for this regulation, based on in vitro phosphorylation of the Cdc10 subunit of MBF by the Cds1 replication-checkpoint kinase. Replacement of two potential phosphorylation sites with phosphomimetic amino acids suffices to promote the checkpoint transcriptional program, suggesting that Cds1 phosphorylation directly regulates MBF-dependent transcription. The conservation of MBF between fission and budding yeast, and recent results implicating MBF as a target of the budding yeast replication checkpoint, suggests that checkpoint regulation of the MBF transcription factor is a conserved strategy for coping with replication stress. Furthermore, the structural and regulatory similarity between MBF and E2F, the metazoan G(1)/S transcription factor, suggests that this checkpoint mechanism may be broadly conserved among eukaryotes.

  15. The DNA Replication Checkpoint Directly Regulates MBF-Dependent G1/S Transcription▿

    Science.gov (United States)

    Dutta, Chaitali; Patel, Prasanta K.; Rosebrock, Adam; Oliva, Anna; Leatherwood, Janet; Rhind, Nicholas

    2008-01-01

    The DNA replication checkpoint transcriptionally upregulates genes that allow cells to adapt to and survive replication stress. Our results show that, in the fission yeast Schizosaccharomyces pombe, the replication checkpoint regulates the entire G1/S transcriptional program by directly regulating MBF, the G1/S transcription factor. Instead of initiating a checkpoint-specific transcriptional program, the replication checkpoint targets MBF to maintain the normal G1/S transcriptional program during replication stress. We propose a mechanism for this regulation, based on in vitro phosphorylation of the Cdc10 subunit of MBF by the Cds1 replication-checkpoint kinase. Replacement of two potential phosphorylation sites with phosphomimetic amino acids suffices to promote the checkpoint transcriptional program, suggesting that Cds1 phosphorylation directly regulates MBF-dependent transcription. The conservation of MBF between fission and budding yeast, and recent results implicating MBF as a target of the budding yeast replication checkpoint, suggests that checkpoint regulation of the MBF transcription factor is a conserved strategy for coping with replication stress. Furthermore, the structural and regulatory similarity between MBF and E2F, the metazoan G1/S transcription factor, suggests that this checkpoint mechanism may be broadly conserved among eukaryotes. PMID:18662996

  16. Phosphorylation of Minichromosome Maintenance 3 (MCM3) by Checkpoint Kinase 1 (Chk1) Negatively Regulates DNA Replication and Checkpoint Activation.

    Science.gov (United States)

    Han, Xiangzi; Mayca Pozo, Franklin; Wisotsky, Jacob N; Wang, Benlian; Jacobberger, James W; Zhang, Youwei

    2015-05-08

    Mechanisms controlling DNA replication and replication checkpoint are critical for the maintenance of genome stability and the prevention or treatment of human cancers. Checkpoint kinase 1 (Chk1) is a key effector protein kinase that regulates the DNA damage response and replication checkpoint. The heterohexameric minichromosome maintenance (MCM) complex is the core component of mammalian DNA helicase and has been implicated in replication checkpoint activation. Here we report that Chk1 phosphorylates the MCM3 subunit of the MCM complex at Ser-205 under normal growth conditions. Mutating the Ser-205 of MCM3 to Ala increased the length of DNA replication track and shortened the S phase duration, indicating that Ser-205 phosphorylation negatively controls normal DNA replication. Upon replicative stress treatment, the inhibitory phosphorylation of MCM3 at Ser-205 was reduced, and this reduction was accompanied with the generation of single strand DNA, the key platform for ataxia telangiectasia mutated and Rad3-related (ATR) activation. As a result, the replication checkpoint is activated. Together, these data provide significant insights into the regulation of both normal DNA replication and replication checkpoint activation through the novel phosphorylation of MCM3 by Chk1. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Relationship between DNA replication and DNA repair in human lymphocytes proliferating in vitro in the presence and in absence of mutagen

    International Nuclear Information System (INIS)

    Szyfter, K.; Wielgosz, M.Sz.; Kujawski, M.; Jaloszynski, P.; Zajaczek, S.

    1995-01-01

    The effects of mutagens on DNA replication and DNA repair were studied in peripheral blood lymphocytes (PBL) obtained from 21 healthy subjects, 2 samples from healthy heterozygote of ''Xeroderma pigmentosum'' (XP) and 2 samples from patient with clinically recognised XP. Inter-individual variations were found in DNA replication and in the level of spontaneous DNA repair measured under standard culture condition. Exposure of human PBL proliferating in vitro to B(a)P was followed by a partial inhibition of replicative DNA synthesis in all subjects and by an induction of DNA repair in healthy subjects. In XP patients DNA repair synthesis remained at the level attributed to spontaneous DNA repair. The response to mutagen varied individually. Results were analysed statistically. It was established that the studied indices of DNA synthesis correlate well with each other. The highest correlation was found between the levels of spontaneous and B(a)P-induced DNA repair. It is concluded that the level of spontaneous DNA repair is predictive for an estimation of cells ability to repair DNA damage. Inter-individual variations in the inhibition of DNA replication and in DNA repair synthesis are also dependent on the type of mutagen as shown by effects of other mutagens. Different effects of mutagen exposure on the inhibition of DNA replicative synthesis and induction of DNA repair can be explained by genetically controlled differences in the activity of enzymes responsible for mutagen processing and lesion removal. (author). 37 refs, 2 figs, 2 tabs

  18. Mutant analysis of Cdt1's function in suppressing nascent strand elongation during DNA replication in Xenopus egg extracts.

    Science.gov (United States)

    Nakazaki, Yuta; Tsuyama, Takashi; Azuma, Yutaro; Takahashi, Mikiko; Tada, Shusuke

    2017-09-02

    The initiation of DNA replication is strictly regulated by multiple mechanisms to ensure precise duplication of chromosomes. In higher eukaryotes, activity of the Cdt1 protein is temporally regulated during the cell cycle, and deregulation of Cdt1 induces DNA re-replication. In previous studies, we showed that excess Cdt1 inhibits DNA replication by suppressing progression of replication forks in Xenopus egg extracts. Here, we investigated the functional regions of Cdt1 that are required for the inhibition of DNA replication. We constructed a series of N-terminally or C-terminally deleted mutants of Cdt1 and examined their inhibitory effects on DNA replication in Xenopus egg extracts. Our results showed that the region spanning amino acids (a. a.) 255-620 is required for efficient inhibition of DNA replication, and that, within this region, a. a. 255-289 have a critical role in inhibition. Moreover, one of the Cdt1 mutants, Cdt1 R285A, was compromised with respect to the licensing activity but still inhibited DNA replication. This result suggests that Cdt1 has an unforeseen function in the negative regulation of DNA replication, and that this function is located within a molecular region that is distinct from those required for the licensing activity. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Photosensitized UVA-Induced Cross-Linking between Human DNA Repair and Replication Proteins and DNA Revealed by Proteomic Analysis

    Science.gov (United States)

    2016-01-01

    Long wavelength ultraviolet radiation (UVA, 320–400 nm) interacts with chromophores present in human cells to induce reactive oxygen species (ROS) that damage both DNA and proteins. ROS levels are amplified, and the damaging effects of UVA are exacerbated if the cells are irradiated in the presence of UVA photosensitizers such as 6-thioguanine (6-TG), a strong UVA chromophore that is extensively incorporated into the DNA of dividing cells, or the fluoroquinolone antibiotic ciprofloxacin. Both DNA-embedded 6-TG and ciprofloxacin combine synergistically with UVA to generate high levels of ROS. Importantly, the extensive protein damage induced by these photosensitizer+UVA combinations inhibits DNA repair. DNA is maintained in intimate contact with the proteins that effect its replication, transcription, and repair, and DNA–protein cross-links (DPCs) are a recognized reaction product of ROS. Cross-linking of DNA metabolizing proteins would compromise these processes by introducing physical blocks and by depleting active proteins. We describe a sensitive and statistically rigorous method to analyze DPCs in cultured human cells. Application of this proteomics-based analysis to cells treated with 6-TG+UVA and ciprofloxacin+UVA identified proteins involved in DNA repair, replication, and gene expression among those most vulnerable to cross-linking under oxidative conditions. PMID:27654267

  20. R-loops and initiation of DNA replication in human cells: a missing link?

    Directory of Open Access Journals (Sweden)

    Rodrigo eLombraña

    2015-04-01

    Full Text Available The unanticipated widespread occurrence of stable hybrid DNA/RNA structures (R-loops in human cells and the increasing evidence of their involvement in several human malignancies have invigorated the research on R-loop biology in recent years. Here we propose that physiological R-loop formation at CpG island promoters can contribute to DNA replication origin specification at these regions, the most efficient replication initiation sites in mammalian cells. Quite likely, this occurs by the strand-displacement reaction activating the formation of G-quadruplex structures that target the Origin Recognition Complex (ORC in the single-stranded conformation. In agreement with this, we found that R-loops co-localize with the ORC within the same CpG island region in a significant fraction of these efficient replication origins, precisely at the position displaying the highest density of G4 motifs. This scenario builds on the connection between transcription and replication in human cells and suggests that R-loop dysregulation at CpG island promoter-origins might contribute to the phenotype of DNA replication abnormalities and loss of genome integrity detected in cancer cells.

  1. Replication stress and oxidative damage contribute to aberrant constitutive activation of DNA damage signalling in human gliomas

    DEFF Research Database (Denmark)

    Bartkova, J; Hamerlik, P; Stockhausen, Marie

    2010-01-01

    brain and grade II astrocytomas, despite the degree of DDR activation was higher in grade II tumors. Markers indicative of ongoing DNA replication stress (Chk1 activation, Rad17 phosphorylation, replication protein A foci and single-stranded DNA) were present in GBM cells under high- or low...... and indicate that replication stress, rather than oxidative stress, fuels the DNA damage signalling in early stages of astrocytoma development.......Malignant gliomas, the deadliest of brain neoplasms, show rampant genetic instability and resistance to genotoxic therapies, implicating potentially aberrant DNA damage response (DDR) in glioma pathogenesis and treatment failure. Here, we report on gross, aberrant constitutive activation of DNA...

  2. RPA Stabilization of Single-Stranded DNA Is Critical for Break-Induced Replication.

    Science.gov (United States)

    Ruff, Patrick; Donnianni, Roberto A; Glancy, Eleanor; Oh, Julyun; Symington, Lorraine S

    2016-12-20

    DNA double-strand breaks (DSBs) are cytotoxic lesions that must be accurately repaired to maintain genome stability. Replication protein A (RPA) plays an important role in homology-dependent repair of DSBs by protecting the single-stranded DNA (ssDNA) intermediates formed by end resection and by facilitating Rad51 loading. We found that hypomorphic mutants of RFA1 that support intra-chromosomal homologous recombination are profoundly defective for repair processes involving long tracts of DNA synthesis, in particular break-induced replication (BIR). The BIR defects of the rfa1 mutants could be partially suppressed by eliminating the Sgs1-Dna2 resection pathway, suggesting that Dna2 nuclease attacks the ssDNA formed during end resection when not fully protected by RPA. Overexpression of Rad51 was also found to suppress the rfa1 BIR defects. We suggest that Rad51 binding to the ssDNA formed by excessive end resection and during D-loop migration can partially compensate for dysfunctional RPA. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  3. Disruption of mitochondrial DNA replication in Drosophila increases mitochondrial fast axonal transport in vivo.

    Directory of Open Access Journals (Sweden)

    Rehan M Baqri

    Full Text Available Mutations in mitochondrial DNA polymerase (pol gamma cause several progressive human diseases including Parkinson's disease, Alper's syndrome, and progressive external ophthalmoplegia. At the cellular level, disruption of pol gamma leads to depletion of mtDNA, disrupts the mitochondrial respiratory chain, and increases susceptibility to oxidative stress. Although recent studies have intensified focus on the role of mtDNA in neuronal diseases, the changes that take place in mitochondrial biogenesis and mitochondrial axonal transport when mtDNA replication is disrupted are unknown. Using high-speed confocal microscopy, electron microscopy and biochemical approaches, we report that mutations in pol gamma deplete mtDNA levels and lead to an increase in mitochondrial density in Drosophila proximal nerves and muscles, without a noticeable increase in mitochondrial fragmentation. Furthermore, there is a rise in flux of bidirectional mitochondrial axonal transport, albeit with slower kinesin-based anterograde transport. In contrast, flux of synaptic vesicle precursors was modestly decreased in pol gamma-alpha mutants. Our data indicate that disruption of mtDNA replication does not hinder mitochondrial biogenesis, increases mitochondrial axonal transport, and raises the question of whether high levels of circulating mtDNA-deficient mitochondria are beneficial or deleterious in mtDNA diseases.

  4. Histone H3 lysine 56 acetylation and the response to DNA replication fork damage

    DEFF Research Database (Denmark)

    Wurtele, Hugo; Kaiser, Gitte Schalck; Bacal, Julien

    2012-01-01

    but are only mildly affected by hydroxyurea. We demonstrate that, after exposure to MMS, H3K56ac-deficient cells cannot complete DNA replication and eventually segregate chromosomes with intranuclear foci containing the recombination protein Rad52. In addition, we provide evidence that these phenotypes...

  5. In germ cells of mouse embryonic ovaries, the decision to enter meiosis precedes premeiotic DNA replication

    NARCIS (Netherlands)

    Baltus, Andrew E.; Menke, Douglas B.; Hu, Yueh-Chiang; Goodheart, Mary L.; Carpenter, Anne E.; de Rooij, Dirk G.; Page, David C.

    2006-01-01

    The transition from mitosis to meiosis is a defining juncture in the life cycle of sexually reproducing organisms. In yeast, the decision to enter meiosis is made before the single round of DNA replication that precedes the two meiotic divisions. We present genetic evidence of an analogous decision

  6. Visual Representations of DNA Replication: Middle Grades Students' Perceptions and Interpretations

    Science.gov (United States)

    Patrick, Michelle D.; Carter, Glenda; Wiebe, Eric N.

    2005-01-01

    Visual representations play a critical role in the communication of science concepts for scientists and students alike. However, recent research suggests that novice students experience difficulty extracting relevant information from representations. This study examined students' interpretations of visual representations of DNA replication. Each…

  7. Baculovirus LEF-11 nuclear localization signal is important for viral DNA replication.

    Science.gov (United States)

    Chen, Tingting; Dong, Zhanqi; Hu, Nan; Hu, Zhigang; Dong, Feifan; Jiang, Yaming; Li, Jun; Chen, Peng; Lu, Cheng; Pan, Minhui

    2017-06-15

    Baculovirus LEF-11 is a small nuclear protein that is involved in viral late gene transcription and DNA replication. However, the characteristics of its nuclear localization signal and its impact on viral DNA replication are unknown. In the present study, systemic bioinformatics analysis showed that the baculovirus LEF-11 contains monopartite and bipartite classical nuclear localization signal sequences (cNLSs), which were also detected in a few alphabaculovirus species. Localization of representative LEF-11 proteins of four baculovirus genera indicated that the nuclear localization characteristics of baculovirus LEF-11 coincided with the predicted results. Moreover, Bombyx mori nucleopolyhedrovirus (BmNPV) LEF-11 could be transported into the nucleus during viral infection in the absence of a cNLSs. Further investigations demonstrated that the NLS of BmNPV LEF-11 is important for viral DNA replication. The findings of the present study indicate that the characteristics of the baculovirus LEF-11 protein and the NLS is essential to virus DNA replication and nuclear transport mechanisms. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Human FEN1 Expression and Solubility Patterson in DNA Replication and Repair

    National Research Council Canada - National Science Library

    Carrier, Richard

    1999-01-01

    .... I show that human FEN1 mRNA and protein levels increase in a cell cycle-dependent manner, with peak mRNA and protein levels attained coincident with S phase DNA replication in both primary and transformed cells...

  9. The interaction of linear and ring forms of DNA molecules with nanodiamonds synthesized by detonation

    International Nuclear Information System (INIS)

    Purtov, K V; Burakova, L P; Puzyr, A P; Bondar, V S

    2008-01-01

    Nanodiamonds synthesized by detonation have been found not to immobilize the ring form of pUC19 plasmid DNA. Linear pUC19 molecules with blunt ends, prepared by restriction of the initial ring form of pUC19 DNA, and linear 0.25-10 kb DNA fragments are adsorbed on nanodiamonds. The amount of adsorbed linear DNA molecules depends on the size of the molecules and the size of the nanodiamond clusters

  10. Recombination at DNA replication fork barriers is not universal and is differentially regulated by Swi1.

    Science.gov (United States)

    Pryce, David W; Ramayah, Soshila; Jaendling, Alessa; McFarlane, Ramsay J

    2009-03-24

    DNA replication stress has been implicated in the etiology of genetic diseases, including cancers. It has been proposed that genomic sites that inhibit or slow DNA replication fork progression possess recombination hotspot activity and can form potential fragile sites. Here we used the fission yeast, Schizosaccharomyces pombe, to demonstrate that hotspot activity is not a universal feature of replication fork barriers (RFBs), and we propose that most sites within the genome that form RFBs do not have recombination hotspot activity under nonstressed conditions. We further demonstrate that Swi1, the TIMELESS homologue, differentially controls the recombination potential of RFBs, switching between being a suppressor and an activator of recombination in a site-specific fashion.

  11. In vitro Assays for Eukaryotic Leading/Lagging Strand DNA Replication.

    Science.gov (United States)

    Schauer, Grant; Finkelstein, Jeff; O'Donnell, Mike

    2017-09-20

    The eukaryotic replisome is a multiprotein complex that duplicates DNA. The replisome is sculpted to couple continuous leading strand synthesis with discontinuous lagging strand synthesis, primarily carried out by DNA polymerases ε and δ, respectively, along with helicases, polymerase α-primase, DNA sliding clamps, clamp loaders and many other proteins. We have previously established the mechanisms by which the polymerases ε and δ are targeted to their 'correct' strands, as well as quality control mechanisms that evict polymerases when they associate with an 'incorrect' strand. Here, we provide a practical guide to differentially assay leading and lagging strand replication in vitro using pure proteins.

  12. RTEL1 contributes to DNA replication and repair and telomere maintenance.

    OpenAIRE

    Uringa, E.-J.; Lisaingo, K.; Pickett, H. A.; Brind'Amour, J.; Rohde, J.-H.; Zelensky, A.; Essers, J.; Lansdorp, P. M.

    2012-01-01

    textabstractTelomere maintenance and DNA repair are important processes that protect the genome against instability. mRtel1, an essential helicase, is a dominant factor setting telomere length in mice. In addition, mRtel1 is involved in DNA double-strand break repair. The role of mRtel1 in telomere maintenance and genome stability is poorly understood. Therefore we used mRtel1-deficient mouse embryonic stem cells to examine the function of mRtel1 in replication, DNA repair, recombination, and...

  13. The beta subunit modulates bypass and termination at UV lesions during in vitro replication with DNA polymerase III holoenzyme of Escherichia coli

    International Nuclear Information System (INIS)

    Shavitt, O.; Livneh, Z.

    1989-01-01

    The cycling time of DNA polymerase III holoenzyme during replication of UV-irradiated single-stranded (ss) DNA was longer than with unirradiated DNA (8 versus 3 min, respectively), most likely due to slow dissociation from lesion-terminated nascent DNA strands. Initiation of elongation on primed ssDNA was not significantly inhibited by the presence of UV lesions as indicated by the identical distribution of replication products synthesized at early and late reaction times and by the identical duration of the initial synthesis bursts on both unirradiated and UV-irradiated DNA templates. When replication was performed with DNA polymerase III* supplemented with increasing quantities of purified beta 2 subunit, the cycling time on UV-irradiated DNA decreased from 14.8 min at 1.7 nM beta 2 down to 6 min at 170 nM beta 2, a concentration in which beta 2 was in large excess over the polymerase. In parallel to the reduction in cycling time, also the bypass frequency of cyclobutane-photodimers decreased with increasing beta 2 concentration, and at 170 nM beta 2, bypass of photodimers was essentially eliminated. It has been shown that polymerase complexes with more than one beta 2 per polymerase molecule were formed at high beta 2 concentrations. It is plausible that polymerase complexes obtained under high beta 2 concentration dissociate from lesion-terminated primers faster than polymerase complexes formed at a low beta 2 concentration. This is expected to favor termination over bypass at pyrimidine photodimers and thus decrease their bypass frequency. These results suggest that the beta 2 subunit might act as a sensor for obstacles to replication caused by DNA damage, and that it terminates elongation at these sites by promoting dissociation. The intracellular concentration of beta 2 was estimated to be 250 nM

  14. Multiplex single-molecule interaction profiling of DNA barcoded proteins

    Science.gov (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.

    2014-01-01

    In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

  15. SV40 utilizes ATM kinase activity to prevent non-homologous end joining of broken viral DNA replication products.

    Directory of Open Access Journals (Sweden)

    Gregory A Sowd

    2014-12-01

    Full Text Available Simian virus 40 (SV40 and cellular DNA replication rely on host ATM and ATR DNA damage signaling kinases to facilitate DNA repair and elicit cell cycle arrest following DNA damage. During SV40 DNA replication, ATM kinase activity prevents concatemerization of the viral genome whereas ATR activity prevents accumulation of aberrant genomes resulting from breakage of a moving replication fork as it converges with a stalled fork. However, the repair pathways that ATM and ATR orchestrate to prevent these aberrant SV40 DNA replication products are unclear. Using two-dimensional gel electrophoresis and Southern blotting, we show that ATR kinase activity, but not DNA-PK(cs kinase activity, facilitates some aspects of double strand break (DSB repair when ATM is inhibited during SV40 infection. To clarify which repair factors associate with viral DNA replication centers, we examined the localization of DSB repair proteins in response to SV40 infection. Under normal conditions, viral replication centers exclusively associate with homology-directed repair (HDR and do not colocalize with non-homologous end joining (NHEJ factors. Following ATM inhibition, but not ATR inhibition, activated DNA-PK(cs and KU70/80 accumulate at the viral replication centers while CtIP and BLM, proteins that initiate 5' to 3' end resection during HDR, become undetectable. Similar to what has been observed during cellular DSB repair in S phase, these data suggest that ATM kinase influences DSB repair pathway choice by preventing the recruitment of NHEJ factors to replicating viral DNA. These data may explain how ATM prevents concatemerization of the viral genome and promotes viral propagation. We suggest that inhibitors of DNA damage signaling and DNA repair could be used during infection to disrupt productive viral DNA replication.

  16. SV40 Utilizes ATM Kinase Activity to Prevent Non-homologous End Joining of Broken Viral DNA Replication Products

    Science.gov (United States)

    Sowd, Gregory A.; Mody, Dviti; Eggold, Joshua; Cortez, David; Friedman, Katherine L.; Fanning, Ellen

    2014-01-01

    Simian virus 40 (SV40) and cellular DNA replication rely on host ATM and ATR DNA damage signaling kinases to facilitate DNA repair and elicit cell cycle arrest following DNA damage. During SV40 DNA replication, ATM kinase activity prevents concatemerization of the viral genome whereas ATR activity prevents accumulation of aberrant genomes resulting from breakage of a moving replication fork as it converges with a stalled fork. However, the repair pathways that ATM and ATR orchestrate to prevent these aberrant SV40 DNA replication products are unclear. Using two-dimensional gel electrophoresis and Southern blotting, we show that ATR kinase activity, but not DNA-PKcs kinase activity, facilitates some aspects of double strand break (DSB) repair when ATM is inhibited during SV40 infection. To clarify which repair factors associate with viral DNA replication centers, we examined the localization of DSB repair proteins in response to SV40 infection. Under normal conditions, viral replication centers exclusively associate with homology-directed repair (HDR) and do not colocalize with non-homologous end joining (NHEJ) factors. Following ATM inhibition, but not ATR inhibition, activated DNA-PKcs and KU70/80 accumulate at the viral replication centers while CtIP and BLM, proteins that initiate 5′ to 3′ end resection during HDR, become undetectable. Similar to what has been observed during cellular DSB repair in S phase, these data suggest that ATM kinase influences DSB repair pathway choice by preventing the recruitment of NHEJ factors to replicating viral DNA. These data may explain how ATM prevents concatemerization of the viral genome and promotes viral propagation. We suggest that inhibitors of DNA damage signaling and DNA repair could be used during infection to disrupt productive viral DNA replication. PMID:25474690

  17. Silencing of the pentose phosphate pathway genes influences DNA replication in human fibroblasts.

    Science.gov (United States)

    Fornalewicz, Karolina; Wieczorek, Aneta; Węgrzyn, Grzegorz; Łyżeń, Robert

    2017-11-30

    Previous reports and our recently published data indicated that some enzymes of glycolysis and the tricarboxylic acid cycle can affect the genome replication process by changing either the efficiency or timing of DNA synthesis in human normal cells. Both these pathways are connected with the pentose phosphate pathway (PPP pathway). The PPP pathway supports cell growth by generating energy and precursors for nucleotides and amino acids. Therefore, we asked if silencing of genes coding for enzymes involved in the pentose phosphate pathway may also affect the control of DNA replication in human fibroblasts. Particular genes coding for PPP pathway enzymes were partially silenced with specific siRNAs. Such cells remained viable. We found that silencing of the H6PD, PRPS1, RPE genes caused less efficient enterance to the S phase and decrease in efficiency of DNA synthesis. On the other hand, in cells treated with siRNA against G6PD, RBKS and TALDO genes, the fraction of cells entering the S phase was increased. However, only in the case of G6PD and TALDO, the ratio of BrdU incorporation to DNA was significantly changed. The presented results together with our previously published studies illustrate the complexity of the influence of genes coding for central carbon metabolism on the control of DNA replication in human fibroblasts, and indicate which of them are especially important in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. DNA lesions induced by replication stress trigger mitotic aberration and tetraploidy development.

    Directory of Open Access Journals (Sweden)

    Yosuke Ichijima

    Full Text Available During tumorigenesis, cells acquire immortality in association with the development of genomic instability. However, it is still elusive how genomic instability spontaneously generates during the process of tumorigenesis. Here, we show that precancerous DNA lesions induced by oncogene acceleration, which induce situations identical to the initial stages of cancer development, trigger tetraploidy/aneuploidy generation in association with mitotic aberration. Although oncogene acceleration primarily induces DNA replication stress and the resulting lesions in the S phase, these lesions are carried over into the M phase and cause cytokinesis failure and genomic instability. Unlike directly induced DNA double-strand breaks, DNA replication stress-associated lesions are cryptogenic and pass through cell-cycle checkpoints due to limited and ineffective activation of checkpoint factors. Furthermore, since damaged M-phase cells still progress in mitotic steps, these cells result in chromosomal mis-segregation, cytokinesis failure and the resulting tetraploidy generation. Thus, our results reveal a process of genomic instability generation triggered by precancerous DNA replication stress.

  19. The Infection Efficiency and Replication Ability of Circularized HBV DNA Optimized the Linear HBV DNA in Vitro and in Vivo

    Science.gov (United States)

    Li, Xiaosong; Zhu, Junke; Lai, Guoqi; Yan, Lei; Hu, Jieli; Chen, Juan; Tang, Ni; Huang, Ailong

    2015-01-01

    Studies on molecular mechanisms of the persist infection of hepatitis B virus have been hampered by a lack of a robust animal model. We successfully established a simple, versatile, and reproducible HBV persist infection model in vitro and in vivo with the circularized HBV DNA. The cells and mice were transfected or injected with circularized HBV DNA and pAAV/HBV1.2, respectively. At the indicated time, the cells, supernatants, serum samples, and liver tissues were collected for virological and serological detection. Both in vitro and in vivo, the circularized HBV DNA and pAAV/HBV1.2 could replicate and transcribe efficiently, but the infection effect of the former was superior to the latter (p HBV genome DNA into the mice robustly supported HBV infection and approximately 80% of HBV infected mice established persistent infection for at least 10 weeks. This study demonstrated that the infection efficiency and replication ability of the circularized structure of HBV DNA overmatched that of the expression plasmid containing the linear structure of HBV DNA in vitro and in vivo. Meanwhile, this research results could provide useful tools and methodology for further study of pathogenic mechanisms and potential antiviral treatments of human chronic HBV infection in vitro and in vivo. PMID:25751726

  20. Intrinsic bent DNA sites in the chromosomal replication origin of Xylella fastidiosa 9a5c

    Directory of Open Access Journals (Sweden)

    F. Gimenes

    2008-04-01

    Full Text Available The features of the nucleotide sequences in both replication and promoter regions have been investigated in many organisms. Intrinsically bent DNA sites associated with transcription have been described in several prokaryotic organisms. The aim of the present study was to investigate intrinsic bent DNA sites in the segment that holds the chromosomal replication origin, oriC, of Xylella fastidiosa 9a5c. Electrophoretic behavior analyses, as well as in silico analyses of both the 2-D projection and helical parameters, were performed. The chromosomal segment analyzed contains the initial sequence of the rpmH gene, an intergenic region, the dnaA gene, the oriC sequence, and the 5' partial sequence of the dnaN gene. The analysis revealed fragments with reduced electrophoretic mobility, which indicates the presence of curved DNA segments. The analysis of the helical parameter ENDS ratio revealed three bent DNA sites (b1, b2, and b3 located in the rpmH-dnaA intergenic region, the dnaA gene, and the oriC 5' end, respectively. The chromosomal segment of X. fastidiosa analyzed here is rich in phased AT tracts and in CAnT motifs. The 2-D projection indicated a segment whose structure was determined by the cumulative effect of all bent DNA sites. Further, the in silico analysis of the three different bacterial oriC sequences indicated similar negative roll and twist >34.00° values. The DnaA box sequences, and other motifs in them, may be associated with the intrinsic DNA curvature.

  1. Mechanisms of inhibition of DNA replication by ultraviolet light in normal human and xeroderma pigmentosum fibroblasts

    International Nuclear Information System (INIS)

    Kaufmann, W.K.; Cleaver, J.E.

    1981-01-01

    The inhibition of DNA replication in ultraviolet-irradiated human fibroblasts was characterized by quantitative analysis of radiation-induced alterations in the steady-state distribution of sizes of pulse-labeled, nascent DNA. Low, noncytotoxic fluences rapidly produced an inhibition of DNA synthesis in half-replicon-size replication intermediates. With time, the inhibition produced by low fluences spread progressively to include multi-replicon-size intermediates. The results indicate that ultraviolet radiation inhibits the initiation of DNA synthesis in replicons. Higher cytotoxic fluences inhibited DNA synthesis in operating replicons. Xeroderma pigmentosum fibroblasts with deficiencies in DNA excision repair exhibited an inhibition of replicon initiation after low radiation fluences, indicating the effect was not solely dependent upon operation of the nucleotidyl excision repair pathway. Owing to their inability to remove pyrimidine dimers ahead of DNA growing points, the repair-deficient cells also were more sensitive than normal cells to the ultraviolet-induced inhibition of chain elongation. Xeroderma pigmentosum cells belonging to the variant class were even more sensitive to inhibition of chain elongation despite their ability to remove pyrimidine dimers. The analysis suggested that normal and repair-deficient human fibroblasts either are able to rapidly bypass certain dimers or these dimers are not recognized by the chain elongation machinery. (author)

  2. DNA-binding polarity of human replication protein A positions nucleases in nucleotide excision repair.

    Science.gov (United States)

    de Laat, W L; Appeldoorn, E; Sugasawa, K; Weterings, E; Jaspers, N G; Hoeijmakers, J H

    1998-08-15

    The human single-stranded DNA-binding replication A protein (RPA) is involved in various DNA-processing events. By comparing the affinity of hRPA for artificial DNA hairpin structures with 3'- or 5'-protruding single-stranded arms, we found that hRPA binds ssDNA with a defined polarity; a strong ssDNA interaction domain of hRPA is positioned at the 5' side of its binding region, a weak ssDNA-binding domain resides at the 3' side. Polarity appears crucial for positioning of the excision repair nucleases XPG and ERCC1-XPF on the DNA. With the 3'-oriented side of hRPA facing a duplex ssDNA junction, hRPA interacts with and stimulates ERCC1-XPF, whereas the 5'-oriented side of hRPA at a DNA junction allows stable binding of XPG to hRPA. Our data pinpoint hRPA to the undamaged strand during nucleotide excision repair. Polarity of hRPA on ssDNA is likely to contribute to the directionality of other hRPA-dependent processes as well.

  3. Macrophage activation induced by Brucella DNA suppresses bacterial intracellular replication via enhancing NO production.

    Science.gov (United States)

    Liu, Ning; Wang, Lin; Sun, Changjiang; Yang, Li; Tang, Bin; Sun, Wanchun; Peng, Qisheng

    2015-12-01

    Brucella DNA can be sensed by TLR9 on endosomal membrane and by cytosolic AIM2-inflammasome to induce proinflammatory cytokine production that contributes to partially activate innate immunity. Additionally, Brucella DNA has been identified to be able to act as a major bacterial component to induce type I IFN. However, the role of Brucella DNA in Brucella intracellular growth remains unknown. Here, we showed that stimulation with Brucella DNA promote macrophage activation in TLR9-dependent manner. Activated macrophages can suppresses wild type Brucella intracellular replication at early stage of infection via enhancing NO production. We also reported that activated macrophage promotes bactericidal function of macrophages infected with VirB-deficient Brucella at the early or late stage of infection. This study uncovers a novel function of Brucella DNA, which can help us further elucidate the mechanism of Brucella intracellular survival. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Asynchronous DNA replication within the human β-globin gene locus

    International Nuclear Information System (INIS)

    Epner, E.; Forrester, W.C.; Groudine, M.

    1988-01-01

    The timing of DNA replication of the human β-globin gene locus has been studied by blot hybridization of newly synthesized BrdUrd-substituted DNA from cells in different stages of the S phase. Using probes that span >120 kilobases across the human β-globin gene locus, the authors show that the majority of this domain replicates in early S phase in the human erythroleukemia cell line K562 and in middle-to-late S phase in the lymphoid cell line Manca. However, in K562 cells three small regions display a strikingly different replication pattern than adjacent sequences. These islands, located in the inter-γ-globin gene region and approximately 20 kilobases 5' to the ε-globin gene and 20 kilobases 3' to the β-globin gene, replicate later and throughout S phase. A similar area is also present in the α-globin gene region in K562 cells. They suggest that these regions may represent sites of termination of replication forks

  5. Singlet Oxygen-Mediated Oxidation during UVA Radiation Alters the Dynamic of Genomic DNA Replication.

    Directory of Open Access Journals (Sweden)

    Dany Graindorge

    Full Text Available UVA radiation (320-400 nm is a major environmental agent that can exert its deleterious action on living organisms through absorption of the UVA photons by endogenous or exogenous photosensitizers. This leads to the production of reactive oxygen species (ROS, such as singlet oxygen (1O2 and hydrogen peroxide (H2O2, which in turn can modify reversibly or irreversibly biomolecules, such as lipids, proteins and nucleic acids. We have previously reported that UVA-induced ROS strongly inhibit DNA replication in a dose-dependent manner, but independently of the cell cycle checkpoints activation. Here, we report that the production of 1O2 by UVA radiation leads to a transient inhibition of replication fork velocity, a transient decrease in the dNTP pool, a quickly reversible GSH-dependent oxidation of the RRM1 subunit of ribonucleotide reductase and sustained inhibition of origin firing. The time of recovery post irradiation for each of these events can last from few minutes (reduction of oxidized RRM1 to several hours (replication fork velocity and origin firing. The quenching of 1O2 by sodium azide prevents the delay of DNA replication, the decrease in the dNTP pool and the oxidation of RRM1, while inhibition of Chk1 does not prevent the inhibition of origin firing. Although the molecular mechanism remains elusive, our data demonstrate that the dynamic of replication is altered by UVA photosensitization of vitamins via the production of singlet oxygen.

  6. Protein Phosphatase 1 Recruitment by Rif1 Regulates DNA Replication Origin Firing by Counteracting DDK Activity

    Directory of Open Access Journals (Sweden)

    Anoushka Davé

    2014-04-01

    Full Text Available The firing of eukaryotic origins of DNA replication requires CDK and DDK kinase activities. DDK, in particular, is involved in setting the temporal program of origin activation, a conserved feature of eukaryotes. Rif1, originally identified as a telomeric protein, was recently implicated in specifying replication timing in yeast and mammals. We show that this function of Rif1 depends on its interaction with PP1 phosphatases. Mutations of two PP1 docking motifs in Rif1 lead to early replication of telomeres in budding yeast and misregulation of origin firing in fission yeast. Several lines of evidence indicate that Rif1/PP1 counteract DDK activity on the replicative MCM helicase. Our data suggest that the PP1/Rif1 interaction is downregulated by the phosphorylation of Rif1, most likely by CDK/DDK. These findings elucidate the mechanism of action of Rif1 in the control of DNA replication and demonstrate a role of PP1 phosphatases in the regulation of origin firing.

  7. Transcriptionally Driven DNA Replication Program of the Human Parasite Leishmania major.

    Science.gov (United States)

    Lombraña, Rodrigo; Álvarez, Alba; Fernández-Justel, José Miguel; Almeida, Ricardo; Poza-Carrión, César; Gomes, Fábia; Calzada, Arturo; Requena, José María; Gómez, María

    2016-08-09

    Faithful inheritance of eukaryotic genomes requires the orchestrated activation of multiple DNA replication origins (ORIs). Although origin firing is mechanistically conserved, how origins are specified and selected for activation varies across different model systems. Here, we provide a complete analysis of the nucleosomal landscape and replication program of the human parasite Leishmania major, building on a better evolutionary understanding of replication organization in Eukarya. We found that active transcription is a driving force for the nucleosomal organization of the L. major genome and that both the spatial and the temporal program of DNA replication can be explained as associated to RNA polymerase kinetics. This simple scenario likely provides flexibility and robustness to deal with the environmental changes that impose alterations in the genetic programs during parasitic life cycle stages. Our findings also suggest that coupling replication initiation to transcription elongation could be an ancient solution used by eukaryotic cells for origin maintenance. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  8. Singlet Oxygen-Mediated Oxidation during UVA Radiation Alters the Dynamic of Genomic DNA Replication

    Science.gov (United States)

    Graindorge, Dany; Martineau, Sylvain; Machon, Christelle; Arnoux, Philippe; Guitton, Jérôme; Francesconi, Stefania; Frochot, Céline; Sage, Evelyne; Girard, Pierre-Marie

    2015-01-01

    UVA radiation (320–400 nm) is a major environmental agent that can exert its deleterious action on living organisms through absorption of the UVA photons by endogenous or exogenous photosensitizers. This leads to the production of reactive oxygen species (ROS), such as singlet oxygen (1O2) and hydrogen peroxide (H2O2), which in turn can modify reversibly or irreversibly biomolecules, such as lipids, proteins and nucleic acids. We have previously reported that UVA-induced ROS strongly inhibit DNA replication in a dose-dependent manner, but independently of the cell cycle checkpoints activation. Here, we report that the production of 1O2 by UVA radiation leads to a transient inhibition of replication fork velocity, a transient decrease in the dNTP pool, a quickly reversible GSH-dependent oxidation of the RRM1 subunit of ribonucleotide reductase and sustained inhibition of origin firing. The time of recovery post irradiation for each of these events can last from few minutes (reduction of oxidized RRM1) to several hours (replication fork velocity and origin firing). The quenching of 1O2 by sodium azide prevents the delay of DNA replication, the decrease in the dNTP pool and the oxidation of RRM1, while inhibition of Chk1 does not prevent the inhibition of origin firing. Although the molecular mechanism remains elusive, our data demonstrate that the dynamic of replication is altered by UVA photosensitization of vitamins via the production of singlet oxygen. PMID:26485711

  9. Set2 Methyltransferase Facilitates DNA Replication and Promotes Genotoxic Stress Responses through MBF-Dependent Transcription.

    Science.gov (United States)

    Pai, Chen-Chun; Kishkevich, Anastasiya; Deegan, Rachel S; Keszthelyi, Andrea; Folkes, Lisa; Kearsey, Stephen E; De León, Nagore; Soriano, Ignacio; de Bruin, Robertus Antonius Maria; Carr, Antony M; Humphrey, Timothy C

    2017-09-12

    Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB) binding factor (MBF)-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR) expression, reduced deoxyribonucleoside triphosphate (dNTP) synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Set2 Methyltransferase Facilitates DNA Replication and Promotes Genotoxic Stress Responses through MBF-Dependent Transcription

    Directory of Open Access Journals (Sweden)

    Chen-Chun Pai

    2017-09-01

    Full Text Available Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB binding factor (MBF-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR expression, reduced deoxyribonucleoside triphosphate (dNTP synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast.

  11. A unique epigenetic signature is associated with active DNA replication loci in human embryonic stem cells.

    Science.gov (United States)

    Li, Bing; Su, Trent; Ferrari, Roberto; Li, Jing-Yu; Kurdistani, Siavash K

    2014-02-01

    The cellular epigenetic landscape changes as pluripotent stem cells differentiate to somatic cells or when differentiated cells transform to a cancerous state. These epigenetic changes are commonly correlated with differences in gene expression. Whether active DNA replication is also associated with distinct chromatin environments in these developmentally and phenotypically diverse cell types has not been known. Here, we used BrdU-seq to map active DNA replication loci in human embryonic stem cells (hESCs), normal primary fibroblasts and a cancer cell line, and correlated these maps to the epigenome. In all cell lines, the majority of BrdU peaks were enriched in euchromatin and at DNA repetitive elements, especially at microsatellite repeats, and coincided with previously determined replication origins. The most prominent BrdU peaks were shared between all cells but a sizable fraction of the peaks were specific to each cell type and associated with cell type-specific genes. Surprisingly, the BrdU peaks that were common to all cell lines were associated with H3K18ac, H3K56ac, and H4K20me1 histone marks only in hESCs but not in normal fibroblasts or cancer cells. Depletion of the histone acetyltransferases for H3K18 and H3K56 dramatically decreased the number and intensity of BrdU peaks in hESCs. Our data reveal a unique epigenetic signature that distinguishes active replication loci in hESCs from normal somatic or malignant cells.

  12. Theoretical models for the regulation of DNA replication in fast-growing bacteria

    Science.gov (United States)

    Creutziger, Martin; Schmidt, Mischa; Lenz, Peter

    2012-09-01

    Growing in always changing environments, Escherichia coli cells are challenged by the task to coordinate growth and division. In particular, adaption of their growth program to the surrounding medium has to guarantee that the daughter cells obtain fully replicated chromosomes. Replication is therefore to be initiated at the right time, which is particularly challenging in media that support fast growth. Here, the mother cell initiates replication not only for the daughter but also for the granddaughter cells. This is possible only if replication occurs from several replication forks that all need to be correctly initiated. Despite considerable efforts during the last 40 years, regulation of this process is still unknown. Part of the difficulty arises from the fact that many details of the relevant molecular processes are not known. Here, we develop a novel theoretical strategy for dealing with this general problem: instead of analyzing a single model, we introduce a wide variety of 128 different models that make different assumptions about the unknown processes. By comparing the predictions of these models we are able to identify the key quantities that allow the experimental discrimination of the different models. Analysis of these quantities yields that out of the 128 models 94 are not consistent with available experimental data. From the remaining 34 models we are able to conclude that mass growth and DNA replication need either to be truly coupled, by coupling DNA replication initiation to the event of cell division, or to the amount of accumulated mass. Finally, we make suggestions for experiments to further reduce the number of possible regulation scenarios.

  13. Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

    DEFF Research Database (Denmark)

    Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

    2017-01-01

    Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so......-megabase- to megabase-sized DNA molecules were recovered from the gel and analysed by denaturation-renaturation optical mapping. Size-selected molecules from the same gel were sequenced by NGS. The optically mapped molecules and the NGS reads showed enrichment from regions defined by NotI restriction sites. We...... demonstrate that the unannotated genome can be characterized in a locus-specific manner via molecules partially overlapping with the annotated genome. The method is a promising tool for investigation of structural variants in enriched human genomic regions for both research and diagnostic purposes. Our...

  14. Fibre autoradiography of repair and replication in DNA from single cells: the effect of DNA synthesis inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Ockey, C.H.

    1982-04-01

    DNA fibre autoradiography, after incorporation of high specific activity /sup 3/H-thymidine and /sup 3/H-deoxycytidine, has been used to investigate repair in DNA fibres from single cells following UV, or methyl-methane sulphonate (MMS) treatment. Asynchronously growing human fibroblasts, leucocytes, and HeLa cells at different phases of the cell cycle have been investigated. Isotope incorporation in repair could be differentiated from that involved in replication by the distribution and density of silver grains along the DNA fibres. Grain distribution due to repair was continuous over long stretches of the fibres and was at a low density, occasionally interspersed with short slightly denser segments. Replication labelling on the other hand, was dense and usually in short tandem segments. Repair labelling was of a similar overall density in fibres from a single cell, but differed in intensity from cell to cell. In mutagen treated Go (leucocytes) of G/sub 1/ (HeLa cells), repair labelling was not increased by the presence of the DNA inhibitors, hydroxyurea (HU) or 5-fluorodeoxyuridine (FUdR). Repair was not detectable in S cells however without the use of these inhibitors to reduce endogenous nucleoside production. FUdR enhanced the repair labelling in S cells only slightly, while HU increased it beyond that observed in UV irradiated, HU treated, G/sub 1/ cells. The intensity of repair labelling in fibres from mutagen treated S cells appears to be proportional to the degree of reduction of DNA chain elongation in replicons.

  15. Persistent Amplification of DNA Damage Signal Involved in Replicative Senescence of Normal Human Diploid Fibroblasts

    Directory of Open Access Journals (Sweden)

    Masatoshi Suzuki

    2012-01-01

    Full Text Available Foci of phosphorylated histone H2AX and ATM are the surrogate markers of DNA double strand breaks. We previously reported that the residual foci increased their size after irradiation, which amplifies DNA damage signals. Here, we addressed whether amplification of DNA damage signal is involved in replicative senescence of normal human diploid fibroblasts. Large phosphorylated H2AX foci (>1.5 μm diameter were specifically detected in presenescent cells. The frequency of cells with large foci was well correlated with that of cells positive for senescence-associated β-galactosidase staining. Hypoxic cell culture condition extended replicative life span of normal human fibroblast, and we found that the formation of large foci delayed in those cells. Our immuno-FISH analysis revealed that large foci partially localized at telomeres in senescent cells. Importantly, large foci of phosphorylated H2AX were always colocalized with phosphorylated ATM foci. Furthermore, Ser15-phosphorylated p53 showed colocalization with the large foci. Since the treatment of senescent cells with phosphoinositide 3-kinase inhibitor, wortmannin, suppressed p53 phosphorylation, it is suggested that amplification of DNA damage signaling sustains persistent activation of ATM-p53 pathway, which is essential for replicative senescence.

  16. Inhibition of Cell Division and DNA Replication Impair Mouse-Naïve Pluripotency Exit.

    Science.gov (United States)

    Waisman, Ariel; Vazquez Echegaray, Camila; Solari, Claudia; Cosentino, María Soledad; Martyn, Iain; Deglincerti, Alessia; Ozair, Mohammad Zeeshan; Ruzo, Albert; Barañao, Lino; Miriuka, Santiago; Brivanlou, Ali; Guberman, Alejandra

    2017-09-01

    The cell cycle has gained attention as a key determinant for cell fate decisions, but the contribution of DNA replication and mitosis in stem cell differentiation has not been extensively studied. To understand if these processes act as "windows of opportunity" for changes in cell identity, we established synchronized cultures of mouse embryonic stem cells as they exit the ground state of pluripotency. We show that initial transcriptional changes in this transition do not require passage through mitosis and that conversion to primed pluripotency is linked to lineage priming in the G1 phase. Importantly, we demonstrate that impairment of DNA replication severely blocks transcriptional switch to primed pluripotency, even in the absence of p53 activity induced by the DNA damage response. Our data suggest an important role for DNA replication during mouse embryonic stem cell differentiation, which could shed light on why pluripotent cells are only receptive to differentiation signals during G1, that is, before the S phase. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Emerging critical roles of Fe-S clusters in DNA replication and repair

    Science.gov (United States)

    Fuss, Jill O.; Tsai, Chi-Lin; Ishida, Justin P.; Tainer, John A.

    2015-01-01

    Fe-S clusters are partners in the origin of life that predate cells, acetyl-CoA metabolism, DNA, and the RNA world. The double helix solved the mystery of DNA replication by base pairing for accurate copying. Yet, for genome stability necessary to life, the double helix has equally important implications for damage repair. Here we examine striking advances that uncover Fe-S cluster roles both in copying the genetic sequence by DNA polymerases and in crucial repair processes for genome maintenance, as mutational defects cause cancer and degenerative disease. Moreover, we examine an exciting, controversial role for Fe-S clusters in a third element required for life – the long-range coordination and regulation of replication and repair events. By their ability to delocalize electrons over both Fe and S centers, Fe-S clusters have unbeatable features for protein conformational control and charge transfer via double-stranded DNA that may fundamentally transform our understanding of life, replication, and repair. PMID:25655665

  18. Coordinated leading and lagging strand DNA synthesis by using the herpes simplex virus 1 replication complex and minicircle DNA templates.

    Science.gov (United States)

    Stengel, Gudrun; Kuchta, Robert D

    2011-01-01

    The origin-specific replication of the herpes simplex virus 1 genome requires seven proteins: the helicase-primase (UL5-UL8-UL52), the DNA polymerase (UL30-UL42), the single-strand DNA binding protein (ICP8), and the origin-binding protein (UL9). We reconstituted these proteins, excluding UL9, on synthetic minicircular DNA templates and monitored leading and lagging strand DNA synthesis using the strand-specific incorporation of dTMP and dAMP. Critical features of the assays that led to efficient leading and lagging stand synthesis included high helicase-primase concentrations and a lagging strand template whose sequence resembled that of the viral DNA. Depending on the nature of the minicircle template, the replication complex synthesized leading and lagging strand products at molar ratios varying between 1:1 and 3:1. Lagging strand products (∼0.2 to 0.6 kb) were significantly shorter than leading strand products (∼2 to 10 kb), and conditions that stimulated primer synthesis led to shorter lagging strand products. ICP8 was not essential; however, its presence stimulated DNA synthesis and increased the length of both leading and lagging strand products. Curiously, human DNA polymerase α (p70-p180 or p49-p58-p70-p180), which improves the utilization of RNA primers synthesized by herpesvirus primase on linear DNA templates, had no effect on the replication of the minicircles. The lack of stimulation by polymerase α suggests the existence of a macromolecular assembly that enhances the utilization of RNA primers and may functionally couple leading and lagging strand synthesis. Evidence for functional coupling is further provided by our observations that (i) leading and lagging strand synthesis produce equal amounts of DNA, (ii) leading strand synthesis proceeds faster under conditions that disable primer synthesis on the lagging strand, and (iii) conditions that accelerate helicase-catalyzed DNA unwinding stimulate decoupled leading strand synthesis but not

  19. Translesion synthesis DNA polymerases promote error-free replication through the minor-groove DNA adduct 3-deaza-3-methyladenine.

    Science.gov (United States)

    Yoon, Jung-Hoon; Roy Choudhury, Jayati; Park, Jeseong; Prakash, Satya; Prakash, Louise

    2017-11-10

    N3-Methyladenine (3-MeA) is formed in DNA by reaction with S -adenosylmethionine, the reactive methyl donor, and by reaction with alkylating agents. 3-MeA protrudes into the DNA minor groove and strongly blocks synthesis by replicative DNA polymerases (Pols). However, the mechanisms for replicating through this lesion in human cells remain unidentified. Here we analyzed the roles of translesion synthesis (TLS) Pols in the replication of 3-MeA-damaged DNA in human cells. Because 3-MeA has a short half-life in vitro , we used the stable 3-deaza analog, 3-deaza-3-methyladenine (3-dMeA), which blocks the DNA minor groove similarly to 3-MeA. We found that replication through the 3-dMeA adduct is mediated via three different pathways, dependent upon Polι/Polκ, Polθ, and Polζ. As inferred from biochemical studies, in the Polι/Polκ pathway, Polι inserts a nucleotide (nt) opposite 3-dMeA and Polκ extends synthesis from the inserted nt. In the Polθ pathway, Polθ carries out both the insertion and extension steps of TLS opposite 3-dMeA, and in the Polζ pathway, Polζ extends synthesis following nt insertion by an as yet unidentified Pol. Steady-state kinetic analyses indicated that Polι and Polθ insert the correct nt T opposite 3-dMeA with a much reduced catalytic efficiency and that both Pols exhibit a high propensity for inserting a wrong nt opposite this adduct. However, despite their low fidelity of synthesis opposite 3-dMeA, TLS opposite this lesion replicates DNA in a highly error-free manner in human cells. We discuss the implications of these observations for TLS mechanisms in human cells. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Molecular mechanisms of induced mutagenesis. Replication in vivo of bacteriophage phiX174 single-stranded, ultraviolet light-irradiated DNA in intact and irradiated host cells

    Energy Technology Data Exchange (ETDEWEB)

    Caillet-Fauquet, P; Defais, M; Radman, M [Brussels Univ. (Belgium)

    1977-11-25

    Genetic analysis has revealed that radiation and many chemical mutagens induce in bacteria an error-prone DNA repair process which is responsible for their mutagenic effect. The biochemical mechanism of this inducible error-prone repair has been studied by analysis of the first round of DNA synthesis on ultraviolet light-irradiated phiX174 DNA in both intact and ultraviolet light-irradiated host cells. Intracellular phiX174 DNA was extracted, subjected to isopycnic CsCl density-gradient analysis, hydroxylapatite chromatography and digestion by single-strand-specific endonuclease S/sub 1/. Ultraviolet light-induced photolesions in viral DNA cause a permanent blockage of DNA synthesis in intact Escherichia coli cells. However, when host cells were irradiated and incubated to induce fully the error-prone repair system, a significant fraction of irradiated phiX174 DNA molecules can be fully replicated. Thus, inducible error-prone repair in E.coli is manifested by an increased capacity for DNA synthesis on damaged phiX174 DNA. Chloramphenicol (100 ..mu.. g/ml), which is an inhibitor of the inducible error-prone DNA repair, is also an inhibitor of this particular inducible DNA synthesis.

  1. A Major Role of DNA Polymerase δ in Replication of Both the Leading and Lagging DNA Strands.

    Science.gov (United States)

    Johnson, Robert E; Klassen, Roland; Prakash, Louise; Prakash, Satya

    2015-07-16

    Genetic studies with S. cerevisiae Polδ (pol3-L612M) and Polε (pol2-M644G) mutant alleles, each of which display a higher rate for the generation of a specific mismatch, have led to the conclusion that Polε is the primary leading strand replicase and that Polδ is restricted to replicating the lagging strand template. Contrary to this widely accepted view, here we show that Polδ plays a major role in the replication of both DNA strands, and that the paucity of pol3-L612M-generated errors on the leading strand results from their more proficient removal. Thus, the apparent lack of Polδ contribution to leading strand replication is due to differential mismatch removal rather than differential mismatch generation. Altogether, our genetic studies with Pol3 and Pol2 mutator alleles support the conclusion that Polδ, and not Polε, is the major DNA polymerase for carrying out both leading and lagging DNA synthesis. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. DNA polymerase I is required for premeiotic DNA replication and sporulation but not for X-ray repair in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Budd, M.E.; Wittrup, K.D.; Bailey, J.E.; Campbell, J.L.

    1989-01-01

    We have used a set of seven temperature-sensitive mutants in the DNA polymerase I gene of Saccharomyces cerevisiae to investigate the role of DNA polymerase I in various aspects of DNA synthesis in vivo. Previously, we showed that DNA polymerase I is required for mitotic DNA replication. Here we extend our studies to several stages of meiosis and repair of X-ray-induced damage. We find that sporulation is blocked in all of the DNA polymerase temperature-sensitive mutants and that premeiotic DNA replication does not occur. Commitment to meiotic recombination is only 2% of wild-type levels. Thus, DNA polymerase I is essential for these steps. However, repair of X-ray-induced single-strand breaks is not defective in the DNA polymerase temperature-sensitive mutants, and DNA polymerase I is therefore not essential for repair of such lesions. These results suggest that DNA polymerase II or III or both, the two other nuclear