Directory of Open Access Journals (Sweden)
Desirée Villahermosa
2017-05-01
Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.
Optimization of sequence alignment for simple sequence repeat regions
Directory of Open Access Journals (Sweden)
Ogbonnaya Francis C
2011-07-01
Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs. SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. Findings To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type. When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. Conclusions The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic
Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K
2017-04-01
There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.
Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang
2016-09-01
Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.
International Nuclear Information System (INIS)
Janowski, M.; Merregaert, J.; Boniver, J.; Maisin, J.R.
1985-01-01
The proviral genome of a thymotropic and leukemogenic C57BL/Ka mouse retrovirus, RadLV/VL/sub 3/(T+L+), was cloned as a biologically active PstI insert in the bacterial plasmid pBR322. Its restriction map was compared to those, already known, of two nonthymotropic and nonleukemogenic viruses of the same mouse strain, the ecotropic BL/Ka(B) and the xenotropic constituent of the radiation leukemia virus complex (RadLV). Differences were observed in the pol gene and in the env gene. Moreover, the nucleotide sequence of the RadLV/VL/sub 3/(T+L+) long terminal repeat revealed the existence of two copies of a 42 bp long sequence, separated by 11 nucleotides and of which BL/Ka(B) possesses only one copy
Two tandemly repeated telomere-associated sequences in Nicotiana plumbaginifolia.
Chen, C M; Wang, C T; Wang, C J; Ho, C H; Kao, Y Y; Chen, C C
1997-12-01
Two tandemly repeated telomere-associated sequences, NP3R and NP4R, have been isolated from Nicotiana plumbaginifolia. The length of a repeating unit for NP3R and NP4R is 165 and 180 nucleotides respectively. The abundance of NP3R, NP4R and telomeric repeats is, respectively, 8.4 x 10(4), 6 x 10(3) and 1.5 x 10(6) copies per haploid genome of N. plumbaginifolia. Fluorescence in situ hybridization revealed that NP3R is located at the ends and/or in interstitial regions of all 10 chromosomes and NP4R on the terminal regions of three chromosomes in the haploid genome of N. plumbaginifolia. Sequence homology search revealed that not only are NP3R and NP4R homologous to HRS60 and GRS, respectively, two tandem repeats isolated from N. tabacum, but that NP3R and NP4R are also related to each other, suggesting that they originated from a common ancestral sequence. The role of these repeated sequences in chromosome healing is discussed based on the observation that two to three copies of a telomere-similar sequence were present in each repeating unit of NP3R and NP4R.
Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.
Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O
1987-06-01
The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.
Cytogenetic Diversity of Simple Sequences Repeats in Morphotypes of Brassica rapa ssp. chinensis.
Zheng, Jin-Shuang; Sun, Cheng-Zhen; Zhang, Shu-Ning; Hou, Xi-Lin; Bonnema, Guusje
2016-01-01
A significant fraction of the nuclear DNA of all eukaryotes is comprised of simple sequence repeats (SSRs). Although these sequences are widely used for studying genetic variation, linkage mapping and evolution, little attention had been paid to the chromosomal distribution and cytogenetic diversity of these sequences. In this paper, we report the distribution characterization of mono-, di-, and tri-nucleotide SSRs in Brassica rapa ssp. chinensis. Fluorescence in situ hybridization was used to characterize the cytogenetic diversity of SSRs among morphotypes of B. rapa ssp. chinensis. The proportion of different SSR motifs varied among morphotypes of B. rapa ssp. chinensis, with tri-nucleotide SSRs being more prevalent in the genome of B. rapa ssp. chinensis. We determined the chromosomal locations of mono-, di-, and tri-nucleotide repeat loci. The results showed that the chromosomal distribution of SSRs in the different morphotypes is non-random and motif-dependent, and allowed us to characterize the relative variability in terms of SSR numbers and similar chromosomal distributions in centromeric/peri-centromeric heterochromatin. The differences between SSR repeats with respect to abundance and distribution indicate that SSRs are a driving force in the genomic evolution of B. rapa species. Our results provide a comprehensive view of the SSR sequence distribution and evolution for comparison among morphotypes B. rapa ssp. chinensis.
Nucleotide sequence preservation of human mitochondrial DNA
International Nuclear Information System (INIS)
Monnat, R.J. Jr.; Loeb, L.A.
1985-01-01
Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms
Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Madura, K.; Prakash, S.
1986-01-01
The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes
simple sequence repeats (EST-SSR)
African Journals Online (AJOL)
Yomi
2012-01-19
Jan 19, 2012 ... 212 primer pairs selected, based on repeat patterns of n≥8 for di-, tri-, tetra- and penta-nucleotide repeat ... Cluster analysis revealed a high genetic similarity among the sugarcane (Saccharum spp.) breeding lines which could reduce the genetic gain in ..... The multiple allele characteristic of SSR com-.
Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire
2012-01-01
Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604
Novel expressed sequence tag- simple sequence repeats (EST ...
African Journals Online (AJOL)
Using different bioinformatic criteria, the SUCEST database was used to mine for simple sequence repeat (SSR) markers. Among 42,189 clusters, 1,425 expressed sequence tag- simple sequence repeats (EST-SSRs) were identified in silico. Trinucleotide repeats were the most abundant SSRs detected. Of 212 primer pairs ...
DNA Nucleotide Sequence Restricted by the RI Endonuclease
Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.
1972-01-01
The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974
Kumar, Pankaj; Chaitanya, Pasumarthy S; Nagarajaram, Hampapathalu A
2011-01-01
PSSRdb (Polymorphic Simple Sequence Repeats database) (http://www.cdfd.org.in/PSSRdb/) is a relational database of polymorphic simple sequence repeats (PSSRs) extracted from 85 different species of prokaryotes. Simple sequence repeats (SSRs) are the tandem repeats of nucleotide motifs of the sizes 1-6 bp and are highly polymorphic. SSR mutations in and around coding regions affect transcription and translation of genes. Such changes underpin phase variations and antigenic variations seen in some bacteria. Although SSR-mediated phase variation and antigenic variations have been well-studied in some bacteria there seems a lot of other species of prokaryotes yet to be investigated for SSR mediated adaptive and other evolutionary advantages. As a part of our on-going studies on SSR polymorphism in prokaryotes we compared the genome sequences of various strains and isolates available for 85 different species of prokaryotes and extracted a number of SSRs showing length variations and created a relational database called PSSRdb. This database gives useful information such as location of PSSRs in genomes, length variation across genomes, the regions harboring PSSRs, etc. The information provided in this database is very useful for further research and analysis of SSRs in prokaryotes.
Directory of Open Access Journals (Sweden)
Stéphanie Barthe
Full Text Available Simple sequence repeat (SSR markers are widely used tools for inferences about genetic diversity, phylogeography and spatial genetic structure. Their applications assume that variation among alleles is essentially caused by an expansion or contraction of the number of repeats and that, accessorily, mutations in the target sequences follow the stepwise mutation model (SMM. Generally speaking, PCR amplicon sizes are used as direct indicators of the number of SSR repeats composing an allele with the data analysis either ignoring the extent of allele size differences or assuming that there is a direct correlation between differences in amplicon size and evolutionary distance. However, without precisely knowing the kind and distribution of polymorphism within an allele (SSR and the associated flanking region (FR sequences, it is hard to say what kind of evolutionary message is conveyed by such a synthetic descriptor of polymorphism as DNA amplicon size. In this study, we sequenced several SSR alleles in multiple populations of three divergent tree genera and disentangled the types of polymorphisms contained in each portion of the DNA amplicon containing an SSR. The patterns of diversity provided by amplicon size variation, SSR variation itself, insertions/deletions (indels, and single nucleotide polymorphisms (SNPs observed in the FRs were compared. Amplicon size variation largely reflected SSR repeat number. The amount of variation was as large in FRs as in the SSR itself. The former contributed significantly to the phylogenetic information and sometimes was the main source of differentiation among individuals and populations contained by FR and SSR regions of SSR markers. The presence of mutations occurring at different rates within a marker's sequence offers the opportunity to analyse evolutionary events occurring on various timescales, but at the same time calls for caution in the interpretation of SSR marker data when the distribution of within
Repeated DNA sequences in fungi
Energy Technology Data Exchange (ETDEWEB)
Dutta, S K
1974-11-01
Several fungal species, representatives of all broad groups like basidiomycetes, ascomycetes and phycomycetes, were examined for the nature of repeated DNA sequences by DNA:DNA reassociation studies using hydroxyapatite chromatography. All of the fungal species tested contained 10 to 20 percent repeated DNA sequences. There are approximately 100 to 110 copies of repeated DNA sequences of approximately 4 x 10/sup 7/ daltons piece size of each. Repeated DNA sequence homoduplexes showed on average 5/sup 0/C difference of T/sub e/50 (temperature at which 50 percent duplexes dissociate) values from the corresponding homoduplexes of unfractionated whole DNA. It is suggested that a part of repetitive sequences in fungi constitutes mitochondrial DNA and a part of it constitutes nuclear DNA. (auth)
The International Nucleotide Sequence Database Collaboration.
Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu
2011-01-01
Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.
Statistical properties and fractals of nucleotide clusters in DNA sequences
International Nuclear Information System (INIS)
Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting
2004-01-01
Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences
Nallaseth, Ferez Soli
The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1
Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.
Directory of Open Access Journals (Sweden)
Charlotte Rehm
Full Text Available In prokaryotes simple sequence repeats (SSRs with unit sizes of 1-5 nucleotides (nt are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4 structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc, Xanthomonas axonopodis pv. citri str. 306 (Xac, and Nostoc sp. strain PCC7120 (Ana. In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.
Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.
Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S
2015-01-01
In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.
A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.
Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.
1996-01-01
A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having
The nucleotide sequences of two leghemoglobin genes from soybean
DEFF Research Database (Denmark)
Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O
1982-01-01
We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...
Directory of Open Access Journals (Sweden)
Natalie L. Dillon
2014-01-01
Full Text Available In this study, a collection of 24,840 expressed sequence tags (ESTs generated from five mango (Mangifera indica L. cDNA libraries was mined for EST-based simple sequence repeat (SSR markers. Over 1,000 ESTs with SSR motifs were detected from more than 24,000 EST sequences with di- and tri-nucleotide repeat motifs the most abundant. Of these, 25 EST-SSRs in genes involved in plant development, stress response, and fruit color and flavor development pathways were selected, developed into PCR markers and characterized in a population of 32 mango selections including M. indica varieties, and related Mangifera species. Twenty-four of the 25 EST-SSR markers exhibited polymorphisms, identifying a total of 86 alleles with an average of 5.38 alleles per locus, and distinguished between all Mangifera selections. Private alleles were identified for Mangifera species. These newly developed EST-SSR markers enhance the current 11 SSR mango genetic identity panel utilized by the Australian Mango Breeding Program. The current panel has been used to identify progeny and parents for selection and the application of this extended panel will further improve and help to design mango hybridization strategies for increased breeding efficiency.
Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
WEB-server for search of a periodicity in amino acid and nucleotide sequences
E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.
2017-12-01
A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.
The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.
Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L
1989-04-01
The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.
Wang, Zan; Yu, Guohui; Shi, Binbin; Wang, Xuemin; Qiang, Haiping; Gao, Hongwen
2014-01-01
Sufficient codominant genetic markers are needed for various genetic investigations in alfalfa since the species is an outcrossing autotetraploid. With the newly developed next generation sequencing technology, a large amount of transcribed sequences of alfalfa have been generated and are available for identifying SSR markers by data mining. A total of 54,278 alfalfa non-redundant unigenes were assembled through the Illumina HiSeqTM 2000 sequencing technology. Based on 3,903 unigene sequences, 4,493 SSRs were identified. Tri-nucleotide repeats (56.71%) were the most abundant motif class while AG/CT (21.7%), AGG/CCT (19.8%), AAC/GTT (10.3%), ATC/ATG (8.8%), and ACC/GGT (6.3%) were the subsequent top five nucleotide repeat motifs. Eight hundred and thirty- seven EST-SSR primer pairs were successfully designed. Of these, 527 (63%) primer pairs yielded clear and scored PCR products and 372 (70.6%) exhibited polymorphisms. High transferability was observed for ssp falcata at 99.2% (523) and 71.7% (378) in M. truncatula. In addition, 313 of 527 SSR marker sequences were in silico mapped onto the eight M. truncatula chromosomes. Thirty-six polymorphic SSR primer pairs were used in the genetic relatedness analysis of 30 Chinese alfalfa cultivated accessions generating a total of 199 scored alleles. The mean observed heterozygosity and polymorphic information content were 0.767 and 0.635, respectively. The codominant markers not only enriched the current resources of molecular markers in alfalfa, but also would facilitate targeted investigations in marker-trait association, QTL mapping, and genetic diversity analysis in alfalfa. PMID:24642969
Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.
Directory of Open Access Journals (Sweden)
Kouki Yonezawa
Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.
Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.
Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J
1989-10-11
The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.
Palindromic nucleotide analysis in human T cell receptor rearrangements.
Directory of Open Access Journals (Sweden)
Santosh K Srivastava
Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.
Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas
2011-01-01
Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.
Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.
Le Gall, O; Candresse, T; Brault, V; Dunez, J
1989-01-01
The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...
Nucleotide sequence of tomato ringspot virus RNA-2.
Rott, M E; Tremaine, J H; Rochon, D M
1991-07-01
The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.
Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A
2012-05-01
The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.
African Journals Online (AJOL)
In the present study, 78 mapped simple sequence repeat (SSR) markers representing 11 linkage groups of adzuki bean were evaluated for transferability to mungbean and related Vigna spp. 41 markers amplified characteristic bands in at least one Vigna species. The transferability percentage across the genotypes ranged ...
Nucleotide sequence composition and method for detection of neisseria gonorrhoeae
International Nuclear Information System (INIS)
Lo, A.; Yang, H.L.
1990-01-01
This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described
cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs
Energy Technology Data Exchange (ETDEWEB)
Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K
1983-01-01
Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.
Kapil, Aditi; Rai, Piyush Kant; Shanker, Asheesh
2014-01-01
Simple sequence repeats (SSRs) are regions in DNA sequence that contain repeating motifs of length 1-6 nucleotides. These repeats are ubiquitously present and are found in both coding and non-coding regions of genome. A total of 534 complete chloroplast genome sequences (as on 18 September 2014) of Viridiplantae are available at NCBI organelle genome resource. It provides opportunity to mine these genomes for the detection of SSRs and store them in the form of a database. In an attempt to properly manage and retrieve chloroplastic SSRs, we designed ChloroSSRdb which is a relational database developed using SQL server 2008 and accessed through ASP.NET. It provides information of all the three types (perfect, imperfect and compound) of SSRs. At present, ChloroSSRdb contains 124 430 mined SSRs, with majority lying in non-coding region. Out of these, PCR primers were designed for 118 249 SSRs. Tetranucleotide repeats (47 079) were found to be the most frequent repeat type, whereas hexanucleotide repeats (6414) being the least abundant. Additionally, in each species statistical analyses were performed to calculate relative frequency, correlation coefficient and chi-square statistics of perfect and imperfect SSRs. In accordance with the growing interest in SSR studies, ChloroSSRdb will prove to be a useful resource in developing genetic markers, phylogenetic analysis, genetic mapping, etc. Moreover, it will serve as a ready reference for mined SSRs in available chloroplast genomes of green plants. Database URL: www.compubio.in/chlorossrdb/ © The Author(s) 2014. Published by Oxford University Press.
Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián
2014-06-01
The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.
Complete nucleotide sequences of avian metapneumovirus subtype B genome.
Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro
2010-12-01
Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.
Nucleotide sequence composition and method for detection of neisseria gonorrhoeae
Energy Technology Data Exchange (ETDEWEB)
Lo, A.; Yang, H.L.
1990-02-13
This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.
Biswas, Manosh Kumar; Chai, Lijun; Mayer, Christoph; Xu, Qiang; Guo, Wenwu; Deng, Xiuxin
2012-05-01
The aim of this study was to develop a large set of microsatellite markers based on publicly available BAC-end sequences (BESs), and to evaluate their transferability, discriminating capacity of genotypes and mapping ability in Citrus. A set of 1,281 simple sequence repeat (SSR) markers were developed from the 46,339 Citrus clementina BAC-end sequences (BES), of them 20.67% contained SSR longer than 20 bp, corresponding to roughly one perfect SSR per 2.04 kb. The most abundant motifs were di-nucleotide (16.82%) repeats. Among all repeat motifs (TA/AT)n is the most abundant (8.38%), followed by (AG/CT)n (4.51%). Most of the BES-SSR are located in the non-coding region, but 1.3% of BES-SSRs were found to be associated with transposable element (TE). A total of 400 novel SSR primer pairs were synthesized and their transferability and polymorphism tested on a set of 16 Citrus and Citrus relative's species. Among these 333 (83.25%) were successfully amplified and 260 (65.00%) showed cross-species transferability with Poncirus trifoliata and Fortunella sp. These cross-species transferable markers could be useful for cultivar identification, for genomic study of Citrus, Poncirus and Fortunella sp. Utility of the developed SSR marker was demonstrated by identifying a set of 118 markers each for construction of linkage map of Citrus reticulata and Poncirus trifoliata. Genetic diversity and phylogenetic relationship among 40 Citrus and its related species were conducted with the aid of 25 randomly selected SSR primer pairs and results revealed that citrus genomic SSRs are superior to genic SSR for genetic diversity and germplasm characterization of Citrus spp.
International Nuclear Information System (INIS)
Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.
2006-01-01
Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)
2012-01-01
Background Apple is an economically important fruit crop worldwide. Developing a genetic linkage map is a critical step towards mapping and cloning of genes responsible for important horticultural traits in apple. To facilitate linkage map construction, we surveyed and characterized the distribution and frequency of perfect microsatellites in assembled contig sequences of the apple genome. Results A total of 28,538 SSRs have been identified in the apple genome, with an overall density of 40.8 SSRs per Mb. Di-nucleotide repeats are the most frequent microsatellites in the apple genome, accounting for 71.9% of all microsatellites. AT/TA repeats are the most frequent in genomic regions, accounting for 38.3% of all the G-SSRs, while AG/GA dimers prevail in transcribed sequences, and account for 59.4% of all EST-SSRs. A total set of 310 SSRs is selected to amplify eight apple genotypes. Of these, 245 (79.0%) are found to be polymorphic among cultivars and wild species tested. AG/GA motifs in genomic regions have detected more alleles and higher PIC values than AT/TA or AC/CA motifs. Moreover, AG/GA repeats are more variable than any other dimers in apple, and should be preferentially selected for studies, such as genetic diversity and linkage map construction. A total of 54 newly developed apple SSRs have been genetically mapped. Interestingly, clustering of markers with distorted segregation is observed on linkage groups 1, 2, 10, 15, and 16. A QTL responsible for malic acid content of apple fruits is detected on linkage group 8, and accounts for ~13.5% of the observed phenotypic variation. Conclusions This study demonstrates that di-nucleotide repeats are prevalent in the apple genome and that AT/TA and AG/GA repeats are the most frequent in genomic and transcribed sequences of apple, respectively. All SSR motifs identified in this study as well as those newly mapped SSRs will serve as valuable resources for pursuing apple genetic studies, aiding the apple breeding
Simple sequence repeats in Neurospora crassa: distribution, polymorphism and evolutionary inference
Directory of Open Access Journals (Sweden)
Park Jongsun
2008-01-01
Full Text Available Abstract Background Simple sequence repeats (SSRs have been successfully used for various genetic and evolutionary studies in eukaryotic systems. The eukaryotic model organism Neurospora crassa is an excellent system to study evolution and biological function of SSRs. Results We identified and characterized 2749 SSRs of 963 SSR types in the genome of N. crassa. The distribution of tri-nucleotide (nt SSRs, the most common SSRs in N. crassa, was significantly biased in exons. We further characterized the distribution of 19 abundant SSR types (AST, which account for 71% of total SSRs in the N. crassa genome, using a Poisson log-linear model. We also characterized the size variation of SSRs among natural accessions using Polymorphic Index Content (PIC and ANOVA analyses and found that there are genome-wide, chromosome-dependent and local-specific variations. Using polymorphic SSRs, we have built linkage maps from three line-cross populations. Conclusion Taking our computational, statistical and experimental data together, we conclude that 1 the distributions of the SSRs in the sequenced N. crassa genome differ systematically between chromosomes as well as between SSR types, 2 the size variation of tri-nt SSRs in exons might be an important mechanism in generating functional variation of proteins in N. crassa, 3 there are different levels of evolutionary forces in variation of amino acid repeats, and 4 SSRs are stable molecular markers for genetic studies in N. crassa.
Wang, Zan; Yan, Hongwei; Fu, Xinnian; Li, Xuehui; Gao, Hongwen
2013-04-01
Efficient and robust molecular markers are essential for molecular breeding in plant. Compared to dominant and bi-allelic markers, multiple alleles of simple sequence repeat (SSR) markers are particularly informative and superior in genetic linkage map and QTL mapping in autotetraploid species like alfalfa. The objective of this study was to enrich SSR markers directly from alfalfa expressed sequence tags (ESTs). A total of 12,371 alfalfa ESTs were retrieved from the National Center for Biotechnology Information. Total 774 SSR-containing ESTs were identified from 716 ESTs. On average, one SSR was found per 7.7 kb of EST sequences. Tri-nucleotide repeats (48.8 %) was the most abundant motif type, followed by di-(26.1 %), tetra-(11.5 %), penta-(9.7 %), and hexanucleotide (3.9 %). One hundred EST-SSR primer pairs were successfully designed and 29 exhibited polymorphism among 28 alfalfa accessions. The allele number per marker ranged from two to 21 with an average of 6.8. The PIC values ranged from 0.195 to 0.896 with an average of 0.608, indicating a high level of polymorphism of the EST-SSR markers. Based on the 29 EST-SSR markers, assessment of genetic diversity was conducted and found that Medicago sativa ssp. sativa was clearly different from the other subspecies. The high transferability of those EST-SSR markers was also found for relative species.
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.
Le Gall, O; Candresse, T; Brault, V; Dunez, J
1989-10-11
The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.
Kawano, Mitsuoki; Oshima, Taku; Kasai, Hiroaki; Mori, Hirotada
2002-07-01
Genome sequence analyses of Escherichia coli K-12 revealed four copies of long repetitive elements. These sequences are designated as long direct repeat (LDR) sequences. Three of the repeats (LDR-A, -B, -C), each approximately 500 bp in length, are located as tandem repeats at 27.4 min on the genetic map. Another copy (LDR-D), 450 bp in length and nearly identical to LDR-A, -B and -C, is located at 79.7 min, a position that is directly opposite the position of LDR-A, -B and -C. In this study, we demonstrate that LDR-D encodes a 35-amino-acid peptide, LdrD, the overexpression of which causes rapid cell killing and nucleoid condensation of the host cell. Northern blot and primer extension analysis showed constitutive transcription of a stable mRNA (approximately 370 nucleotides) encoding LdrD and an unstable cis-encoded antisense RNA (approximately 60 nucleotides), which functions as a trans-acting regulator of ldrD translation. We propose that LDR encodes a toxin-antitoxin module. LDR-homologous sequences are not pre-sent on any known plasmids but are conserved in Salmonella and other enterobacterial species.
International Nuclear Information System (INIS)
Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.
1988-01-01
Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases
International Nuclear Information System (INIS)
Kudo, Shinichi; Fukuda, Minoru
1989-01-01
Glycophorins A (GPA) and B (GPB) are two major sialoglycoproteins of the human erythrocyte membrane. Here the authors present a comparison of the genomic structures of GPA and GPB developed by analyzing DNA clones isolated from a K562 genomic library. Nucleotide sequences of exon-intron junctions and 5' and 3' flanking sequences revealed that the GPA and GPB genes consist of 7 and 5 exons, respectively, and both genes have >95% identical sequence from the 5' flanking region to the region ∼ 1 kilobase downstream from the exon encoding the transmembrane regions. In this homologous part of the genes, GPB lacks one exon due to a point mutation at the 5' splicing site of the third intron, which inactivates the 5' cleavage event of splicing and leads to ligation of the second to the fourth exon. Following these very homologous sequences, the genomic sequences for GPA and GPB diverge significantly and no homology can be detected in their 3' end sequences. The analysis of the Alu sequences and their flanking direct repeat sequences suggest that an ancestral genomic structure has been maintained in the GPA gene, whereas the GPB gene has arisen from the acquisition of 3' sequences different from those of the GPA gene by homologous recombination at the Alu repeats during or after gene duplication
Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta
Energy Technology Data Exchange (ETDEWEB)
Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))
1988-09-26
The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.
Tarantino, Mary E; Bilotti, Katharina; Huang, Ji; Delaney, Sarah
2015-08-21
Flap endonuclease 1 (FEN1) is a structure-specific nuclease responsible for removing 5'-flaps formed during Okazaki fragment maturation and long patch base excision repair. In this work, we use rapid quench flow techniques to examine the rates of 5'-flap removal on DNA substrates of varying length and sequence. Of particular interest are flaps containing trinucleotide repeats (TNR), which have been proposed to affect FEN1 activity and cause genetic instability. We report that FEN1 processes substrates containing flaps of 30 nucleotides or fewer at comparable single-turnover rates. However, for flaps longer than 30 nucleotides, FEN1 kinetically discriminates substrates based on flap length and flap sequence. In particular, FEN1 removes flaps containing TNR sequences at a rate slower than mixed sequence flaps of the same length. Furthermore, multiple-turnover kinetic analysis reveals that the rate-determining step of FEN1 switches as a function of flap length from product release to chemistry (or a step prior to chemistry). These results provide a kinetic perspective on the role of FEN1 in DNA replication and repair and contribute to our understanding of FEN1 in mediating genetic instability of TNR sequences. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Evaluation of Mammalian Interspersed Repeats to investigate the goat genome
Directory of Open Access Journals (Sweden)
P. Mariani
2010-01-01
Full Text Available Among the repeated sequences present in most eukaryotic genomes, SINEs (Short Interspersed Nuclear Elements are widely used to investigate evolution in the mammalian order (Buchanan et al., 1999. One family of these repetitive sequences, the MIR (Mammalian Interspersed Repeats; Jurka et al., 1995, is ubiquitous in all mammals.MIR elements are tRNA-derived SINEs and are identifiable by a conserved core region of about 70 nucleotides.
Zhang, Yanzhen; Ma, Ji; Yang, Bingxian; Li, Ruyi; Zhu, Wei; Sun, Lianli; Tian, Jingkui; Zhang, Lin
2014-05-01
Taxus chinensis var. mairei (Taxaceae) is a domestic variety of yew species in local China. This plant is one of the sources for paclitaxel, which is a promising antineoplastic chemotherapy drugs during the last decade. We have sequenced the complete nucleotide sequence of the chloroplast (cp) genome of T. chinensis var. mairei. The T. chinensis var. mairei cp genome is 129,513 bp in length, with 113 single copy genes and two duplicated genes (trnI-CAU, trnQ-UUG). Among the 113 single copy genes, 9 are intron-containing. Compared to other land plant cp genomes, the T. chinensis var. mairei cp genome has lost one of the large inverted repeats (IRs) found in angiosperms, fern, liverwort, and gymnosperm such as Cycas revoluta and Ginkgo biloba L. Compared to related species, the gene order of T. chinensis var. mairei has a large inversion of ~110kb including 91 genes (from rps18 to accD) with gene contents unarranged. Repeat analysis identified 48 direct and 2 inverted repeats 30 bp long or longer with a sequence identity greater than 90%. Repeated short segments were found in genes rps18, rps19 and clpP. Analysis also revealed 22 simple sequence repeat (SSR) loci and almost all are composed of A or T. Copyright © 2014 Elsevier B.V. All rights reserved.
Cloutier, Sylvie; Miranda, Evelyn; Ward, Kerry; Radovanovic, Natasa; Reimer, Elsa; Walichnowski, Andrzej; Datla, Raju; Rowland, Gordon; Duguid, Scott; Ragupathy, Raja
2012-08-01
Flax is an important oilseed crop in North America and is mostly grown as a fibre crop in Europe. As a self-pollinated diploid with a small estimated genome size of ~370 Mb, flax is well suited for fast progress in genomics. In the last few years, important genetic resources have been developed for this crop. Here, we describe the assessment and comparative analyses of 1,506 putative simple sequence repeats (SSRs) of which, 1,164 were derived from BAC-end sequences (BESs) and 342 from expressed sequence tags (ESTs). The SSRs were assessed on a panel of 16 flax accessions with 673 (58 %) and 145 (42 %) primer pairs being polymorphic in the BESs and ESTs, respectively. With 818 novel polymorphic SSR primer pairs reported in this study, the repertoire of available SSRs in flax has more than doubled from the combined total of 508 of all previous reports. Among nucleotide motifs, trinucleotides were the most abundant irrespective of the class, but dinucleotides were the most polymorphic. SSR length was also positively correlated with polymorphism. Two dinucleotide (AT/TA and AG/GA) and two trinucleotide (AAT/ATA/TAA and GAA/AGA/AAG) motifs and their iterations, different from those reported in many other crops, accounted for more than half of all the SSRs and were also more polymorphic (63.4 %) than the rest of the markers (42.7 %). This improved resource promises to be useful in genetic, quantitative trait loci (QTL) and association mapping as well as for anchoring the physical/genetic map with the whole genome shotgun reference sequence of flax.
Directory of Open Access Journals (Sweden)
Huaiyong Luo
Full Text Available The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.
Luo, Huaiyong; Wang, Xiaojie; Zhan, Gangming; Wei, Guorong; Zhou, Xinli; Zhao, Jing; Huang, Lili; Kang, Zhensheng
2015-01-01
The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst) causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs) are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.
Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)
International Nuclear Information System (INIS)
Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.
1994-01-01
The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs
Simple sequence repeat marker development and genetic mapping ...
Indian Academy of Sciences (India)
polymorphic SSR (simple sequence repeats) markers from libraries enriched for GA, CAA and AAT repeats, as well as 6 ... ers for quinoa was the development of a genetic linkage map ...... Weber J. L. 1990 Informativeness of human (dC-dA)n.
Directory of Open Access Journals (Sweden)
Bhattacharyya Madan K
2008-03-01
Full Text Available Abstract Background A series of Rps (resistance to Pytophthora sojae genes have been protecting soybean from the root and stem rot disease caused by the Oomycete pathogen, Phytophthora sojae. Five Rps genes were mapped to the Rps1 locus located near the 28 cM map position on molecular linkage group N of the composite genetic soybean map. Among these five genes, Rps1-k was introgressed from the cultivar, Kingwa. Rps1-k has been providing stable and broad-spectrum Phytophthora resistance in the major soybean-producing regions of the United States. Rps1-k has been mapped and isolated. More than one functional Rps1-k gene was identified from the Rps1-k locus. The clustering feature at the Rps1-k locus might have facilitated the expansion of Rps1-k gene numbers and the generation of new recognition specificities. The Rps1-k region was sequenced to understand the possible evolutionary steps that shaped the generation of Phytophthora resistance genes in soybean. Results Here the analyses of sequences of three overlapping BAC clones containing the 184,111 bp Rps1-k region are reported. A shotgun sequencing strategy was applied in sequencing the BAC contig. Sequence analysis predicted a few full-length genes including two Rps1-k genes, Rps1-k-1 and Rps1-k-2. Previously reported Rps1-k-3 from this genomic region 1 was evolved through intramolecular recombination between Rps1-k-1 and Rps1-k-2 in Escherichia coli. The majority of the predicted genes are truncated and therefore most likely they are nonfunctional. A member of a highly abundant retroelement, SIRE1, was identified from the Rps1-k region. The Rps1-k region is primarily composed of repetitive sequences. Sixteen simple repeat and 63 tandem repeat sequences were identified from the locus. Conclusion These data indicate that the Rps1 locus is located in a gene-poor region. The abundance of repetitive sequences in the Rps1-k region suggested that the location of this locus is in or near a
Directory of Open Access Journals (Sweden)
Shui-Lian He
Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang
2015-01-01
Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
The nucleotide sequence of human transition protein 1 cDNA
Energy Technology Data Exchange (ETDEWEB)
Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)
1988-08-11
The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.
Myotonin protein-kinase [AGC]n trinucleotide repeat in seven nonhuman primates
Energy Technology Data Exchange (ETDEWEB)
Novelli, G.; Sineo, L.; Pontieri, E. [Catholic Univ. of Rome (Italy)]|[Univ. of Milan (Italy)]|[Univ. Florence (Italy)] [and others
1994-09-01
Myotonic dystrophy (DM) is due to a genomic instability of a trinucleotide [AGC]n motif, located at the 3{prime} UTR region of a protein-kinase gene (myotonin protein kinase, MT-PK). The [AGC] repeat is meiotically and mitotically unstable, and it is directly related to the manifestations of the disorder. Although a gene dosage effect of the MT-PK has been demonstrated n DM muscle, the mechanism(s) by which the intragenic repeat expansion leads to disease is largely unknown. This non-standard mutational event could reflect an evolutionary mechanism widespread among animal genomes. We have isolated and sequenced the complete 3{prime}UTR region of the MT-PK gene in seven primates (macaque, orangutan, gorilla, chimpanzee, gibbon, owl monkey, saimiri), and examined by comparative sequence nucleotide analysis the [AGC]n intragenic repeat and the surrounding nucleotides. The genomic organization, including the [AGC]n repeat structure, was conserved in all examined species, excluding the gibbon (Hylobates agilis), in which the [AGC]n upstream sequence (GGAA) is replaced by a GA dinucleotide. The number of [AGC]n in the examined species ranged between 7 (gorilla) and 13 repeats (owl monkeys), with a polymorphism informative content (PIC) similar to that observed in humans. These results indicate that the 3{prime}UTR [AGC] repeat within the MT-PK gene is evolutionarily conserved, supporting that this region has important regulatory functions.
[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].
Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I
1985-11-01
The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.
Sequencing genes in silico using single nucleotide polymorphisms
Directory of Open Access Journals (Sweden)
Zhang Xinyi
2012-01-01
Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate
Identification, variation and transcription of pneumococcal repeat sequences
2011-01-01
Background Small interspersed repeats are commonly found in many bacterial chromosomes. Two families of repeats (BOX and RUP) have previously been identified in the genome of Streptococcus pneumoniae, a nasopharyngeal commensal and respiratory pathogen of humans. However, little is known about the role they play in pneumococcal genetics. Results Analysis of the genome of S. pneumoniae ATCC 700669 revealed the presence of a third repeat family, which we have named SPRITE. All three repeats are present at a reduced density in the genome of the closely related species S. mitis. However, they are almost entirely absent from all other streptococci, although a set of elements related to the pneumococcal BOX repeat was identified in the zoonotic pathogen S. suis. In conjunction with information regarding their distribution within the pneumococcal chromosome, this suggests that it is unlikely that these repeats are specialised sequences performing a particular role for the host, but rather that they constitute parasitic elements. However, comparing insertion sites between pneumococcal sequences indicates that they appear to transpose at a much lower rate than IS elements. Some large BOX elements in S. pneumoniae were found to encode open reading frames on both strands of the genome, whilst another was found to form a composite RNA structure with two T box riboswitches. In multiple cases, such BOX elements were demonstrated as being expressed using directional RNA-seq and RT-PCR. Conclusions BOX, RUP and SPRITE repeats appear to have proliferated extensively throughout the pneumococcal chromosome during the species' past, but novel insertions are currently occurring at a relatively slow rate. Through their extensive secondary structures, they seem likely to affect the expression of genes with which they are co-transcribed. Software for annotation of these repeats is freely available from ftp://ftp.sanger.ac.uk/pub/pathogens/strep_repeats/. PMID:21333003
Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.
2016-01-01
Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946
Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J
2016-01-15
Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Sharma, Ranu; Rawat, Vimal; Suresh, C G
2017-12-01
The nucleotide binding site-leucine rich repeat (NBS-LRR) proteins play an important role in the defense mechanisms against pathogens. Using bioinformatics approach, we identified and annotated 104 NBS-LRR genes in chickpea. Phylogenetic analysis points to their diversification into two families namely TIR-NBS-LRR and non-TIR-NBS-LRR. Gene architecture revealed intron gain/loss events in this resistance gene family during their independent evolution into two families. Comparative genomics analysis elucidated its evolutionary relationship with other fabaceae species. Around 50% NBS-LRRs reside in macro-syntenic blocks underlining positional conservation along with sequence conservation of NBS-LRR genes in chickpea. Transcriptome sequencing data provided evidence for their transcription and tissue-specific expression. Four cis -regulatory elements namely WBOX, DRE, CBF, and GCC boxes, that commonly occur in resistance genes, were present in the promoter regions of these genes. Further, the findings will provide a strong background to use candidate disease resistance NBS-encoding genes and identify their specific roles in chickpea.
Mukhopadhyaya, R; Sadaie, M R
1993-02-01
Human T-cell leukemia virus type I (HTLV-I) has been associated with adult T-cell leukemia/lymphoma and the chronic neurologic disorder tropical spastic paraparesis/HTLV-I-associated myelopathy (TSP/HAM). To study the genetic structure of the virus associated with TSP/HAM, we have obtained and sequenced a partial genomic clone from an HTLV-I-positive cell line established from cerebrospinal fluid (CSF) of a Jamaican patient with TSP/HAM. This clone consisted of a 4.3-kb viral sequence containing the 5' long terminal repeat (LTR), gag, and N-terminal portion of the pol gene, with an overall 1.3% sequence variation resulting from mostly nucleotide substitutions, as compared to the prototype HTLV-I ATK-1. The gag and pol regions showed only 1.4% and 1.2% nucleotide variations, respectively. However, the U3 region of the LTR showed the highest sequence variation (3.6%), where several changes appear to be common among certain TSP/HAM isolates. Several of these changes reside within the 21-bp boundaries and the Tax-responsive element. It would be important to determine if the observed changes are sufficient to cause neurologic disorders similar to the murine leukemia virus system or simply reflect the divergent pool of HTLV-I from different geographic locations. At this time, we cannot rule out the possibility that the observed changes have either direct or indirect significance for the HTLV-I pathogenesis in TSP/HAM.
Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito
2017-12-01
The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Cheng-Chong Chou
2004-11-01
Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.
Directory of Open Access Journals (Sweden)
Yu-Hoon Kim
2014-01-01
Full Text Available Identification of insect species is an important task in forensic entomology. For more convenient species identification, the nucleotide sequences of cytochrome c oxidase subunit I (COI gene have been widely utilized. We analyzed full-length COI nucleotide sequences of 10 Muscidae and 6 Sarcophagidae fly species collected in Korea. After DNA extraction from collected flies, PCR amplification and automatic sequencing of the whole COI sequence were performed. Obtained sequences were analyzed for a phylogenetic tree and a distance matrix. Our data showed very low intraspecific sequence distances and species-level monophylies. However, sequence comparison with previously reported sequences revealed a few inconsistencies or paraphylies requiring further investigation. To the best of our knowledge, this study is the first report of COI nucleotide sequences from Hydrotaea occulta, Muscina angustifrons, Muscina pascuorum, Ophyra leucostoma, Sarcophaga haemorrhoidalis, Sarcophaga harpax, and Phaonia aureola.
Directory of Open Access Journals (Sweden)
Tautz Diethard
2002-03-01
Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
Multineuronal Spike Sequences Repeat with Millisecond Precision
Directory of Open Access Journals (Sweden)
Koki eMatsumoto
2013-06-01
Full Text Available Cortical microcircuits are nonrandomly wired by neurons. As a natural consequence, spikes emitted by microcircuits are also nonrandomly patterned in time and space. One of the prominent spike organizations is a repetition of fixed patterns of spike series across multiple neurons. However, several questions remain unsolved, including how precisely spike sequences repeat, how the sequences are spatially organized, how many neurons participate in sequences, and how different sequences are functionally linked. To address these questions, we monitored spontaneous spikes of hippocampal CA3 neurons ex vivo using a high-speed functional multineuron calcium imaging technique that allowed us to monitor spikes with millisecond resolution and to record the location of spiking and nonspiking neurons. Multineuronal spike sequences were overrepresented in spontaneous activity compared to the statistical chance level. Approximately 75% of neurons participated in at least one sequence during our observation period. The participants were sparsely dispersed and did not show specific spatial organization. The number of sequences relative to the chance level decreased when larger time frames were used to detect sequences. Thus, sequences were precise at the millisecond level. Sequences often shared common spikes with other sequences; parts of sequences were subsequently relayed by following sequences, generating complex chains of multiple sequences.
Development of simple sequence repeat (SSR) markers that are ...
African Journals Online (AJOL)
Simple sequence repeats (SSRs) markers were developed through data mining of 3,803 expressed sequence tags (ESTs) previously published. A total of 144 di- to penta-type SSRs were identified and they were screened for polymorphism between two turnip cultivars, 'Tsuda' and 'Yurugi Akamaru'. Out of 90 EST-SSRs for ...
Kishine, Masahiro; Tsutsumi, Katsuji; Kitta, Kazumi
2017-12-01
Simple sequence repeat (SSR) is a popular tool for individual fingerprinting. The long-core motif (e.g. tetra-, penta-, and hexa-nucleotide) simple sequence repeats (SSRs) are preferred because they make it easier to separate and distinguish neighbor alleles. In the present study, a new set of 8 tetra-nucleotide SSRs in potato ( Solanum tuberosum ) is reported. By using these 8 markers, 72 out of 76 cultivars obtained from Japan and the United States were clearly discriminated, while two pairs, both of which arose from natural variation, showed identical profiles. The combined probability of identity between two random cultivars for the set of 8 SSR markers was estimated to be 1.10 × 10 -8 , confirming the usefulness of the proposed SSR markers for fingerprinting analyses of potato.
Waye, J S; Willard, H F
1986-09-01
The centromeric regions of all human chromosomes are characterized by distinct subsets of a diverse tandemly repeated DNA family, alpha satellite. On human chromosome 17, the predominant form of alpha satellite is a 2.7-kilobase-pair higher-order repeat unit consisting of 16 alphoid monomers. We present the complete nucleotide sequence of the 16-monomer repeat, which is present in 500 to 1,000 copies per chromosome 17, as well as that of a less abundant 15-monomer repeat, also from chromosome 17. These repeat units were approximately 98% identical in sequence, differing by the exclusion of precisely 1 monomer from the 15-monomer repeat. Homologous unequal crossing-over is suggested as a probable mechanism by which the different repeat lengths on chromosome 17 were generated, and the putative site of such a recombination event is identified. The monomer organization of the chromosome 17 higher-order repeat unit is based, in part, on tandemly repeated pentamers. A similar pentameric suborganization has been previously demonstrated for alpha satellite of the human X chromosome. Despite the organizational similarities, substantial sequence divergence distinguishes these subsets. Hybridization experiments indicate that the chromosome 17 and X subsets are more similar to each other than to the subsets found on several other human chromosomes. We suggest that the chromosome 17 and X alpha satellite subsets may be related components of a larger alphoid subfamily which have evolved from a common ancestral repeat into the contemporary chromosome-specific subsets.
DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats.
de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas
2015-11-16
Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Sequence determinants of human microsatellite variability
Directory of Open Access Journals (Sweden)
Jakobsson Mattias
2009-12-01
Full Text Available Abstract Background Microsatellite loci are frequently used in genomic studies of DNA sequence repeats and in population studies of genetic variability. To investigate the effect of sequence properties of microsatellites on their level of variability we have analyzed genotypes at 627 microsatellite loci in 1,048 worldwide individuals from the HGDP-CEPH cell line panel together with the DNA sequences of these microsatellites in the human RefSeq database. Results Calibrating PCR fragment lengths in individual genotypes by using the RefSeq sequence enabled us to infer repeat number in the HGDP-CEPH dataset and to calculate the mean number of repeats (as opposed to the mean PCR fragment length, under the assumption that differences in PCR fragment length reflect differences in the numbers of repeats in the embedded repeat sequences. We find the mean and maximum numbers of repeats across individuals to be positively correlated with heterozygosity. The size and composition of the repeat unit of a microsatellite are also important factors in predicting heterozygosity, with tetra-nucleotide repeat units high in G/C content leading to higher heterozygosity. Finally, we find that microsatellites containing more separate sets of repeated motifs generally have higher heterozygosity. Conclusions These results suggest that sequence properties of microsatellites have a significant impact in determining the features of human microsatellite variability.
Directory of Open Access Journals (Sweden)
Boulund Fredrik
2012-12-01
Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.
Dunn, Joshua G; Weissman, Jonathan S
2016-11-22
Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily
Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation
International Nuclear Information System (INIS)
Maat, J.
1978-01-01
A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)
Directory of Open Access Journals (Sweden)
Graner Andreas
2008-10-01
Full Text Available Abstract Background Barley has one of the largest and most complex genomes of all economically important food crops. The rise of new short read sequencing technologies such as Illumina/Solexa permits such large genomes to be effectively sampled at relatively low cost. Based on the corresponding sequence reads a Mathematically Defined Repeat (MDR index can be generated to map repetitive regions in genomic sequences. Results We have generated 574 Mbp of Illumina/Solexa sequences from barley total genomic DNA, representing about 10% of a genome equivalent. From these sequences we generated an MDR index which was then used to identify and mark repetitive regions in the barley genome. Comparison of the MDR plots with expert repeat annotation drawing on the information already available for known repetitive elements revealed a significant correspondence between the two methods. MDR-based annotation allowed for the identification of dozens of novel repeat sequences, though, which were not recognised by hand-annotation. The MDR data was also used to identify gene-containing regions by masking of repetitive sequences in eight de-novo sequenced bacterial artificial chromosome (BAC clones. For half of the identified candidate gene islands indeed gene sequences could be identified. MDR data were only of limited use, when mapped on genomic sequences from the closely related species Triticum monococcum as only a fraction of the repetitive sequences was recognised. Conclusion An MDR index for barley, which was obtained by whole-genome Illumina/Solexa sequencing, proved as efficient in repeat identification as manual expert annotation. Circumventing the labour-intensive step of producing a specific repeat library for expert annotation, an MDR index provides an elegant and efficient resource for the identification of repetitive and low-copy (i.e. potentially gene-containing sequences regions in uncharacterised genomic sequences. The restriction that a particular
Expansion of inverted repeat does not decrease substitution rates in Pelargonium plastid genomes.
Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K
2017-04-01
For species with minor inverted repeat (IR) boundary changes in the plastid genome (plastome), nucleotide substitution rates were previously shown to be lower in the IR than the single copy regions (SC). However, the impact of large-scale IR expansion/contraction on plastid nucleotide substitution rates among closely related species remains unclear. We included plastomes from 22 Pelargonium species, including eight newly sequenced genomes, and used both pairwise and model-based comparisons to investigate the impact of the IR on sequence evolution in plastids. Ten types of plastome organization with different inversions or IR boundary changes were identified in Pelargonium. Inclusion in the IR was not sufficient to explain the variation of nucleotide substitution rates. Instead, the rate heterogeneity in Pelargonium plastomes was a mixture of locus-specific, lineage-specific and IR-dependent effects. Our study of Pelargonium plastomes that vary in IR length and gene content demonstrates that the evolutionary consequences of retaining these repeats are more complicated than previously suggested. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Nucleotide sequence of the human N-myc gene
International Nuclear Information System (INIS)
Stanton, L.W.; Schwab, M.; Bishop, J.M.
1986-01-01
Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions
Sueldo, D.J.; Shimels, M.Z.; Spiridon, L.N.; Caldararu, O.; Petrescu, A.J.; Joosten, M.H.A.J.; Tameling, W.I.L.
2015-01-01
•Plant nucleotide-binding, leucine-rich repeat (NB-LRR) proteins confer immunity to pathogens possessing the corresponding avirulence proteins. Activation of NB-LRR proteins is often associated with induction of the hypersensitive response (HR), a form of programmed cell death. •NRC1 (NB-LRR
The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...
Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1
Energy Technology Data Exchange (ETDEWEB)
Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G
1988-03-25
Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.
SeqEntropy: genome-wide assessment of repeats for short read sequencing.
Directory of Open Access Journals (Sweden)
Hsueh-Ting Chu
Full Text Available BACKGROUND: Recent studies on genome assembly from short-read sequencing data reported the limitation of this technology to reconstruct the entire genome even at very high depth coverage. We investigated the limitation from the perspective of information theory to evaluate the effect of repeats on short-read genome assembly using idealized (error-free reads at different lengths. METHODOLOGY/PRINCIPAL FINDINGS: We define a metric H(k to be the entropy of sequencing reads at a read length k and use the relative loss of entropy ΔH(k to measure the impact of repeats for the reconstruction of whole-genome from sequences of length k. In our experiments, we found that entropy loss correlates well with de-novo assembly coverage of a genome, and a score of ΔH(k>1% indicates a severe loss in genome reconstruction fidelity. The minimal read lengths to achieve ΔH(k<1% are different for various organisms and are independent of the genome size. For example, in order to meet the threshold of ΔH(k<1%, a read length of 60 bp is needed for the sequencing of human genome (3.2 10(9 bp and 320 bp for the sequencing of fruit fly (1.8×10(8 bp. We also calculated the ΔH(k scores for 2725 prokaryotic chromosomes and plasmids at several read lengths. Our results indicate that the levels of repeats in different genomes are diverse and the entropy of sequencing reads provides a measurement for the repeat structures. CONCLUSIONS/SIGNIFICANCE: The proposed entropy-based measurement, which can be calculated in seconds to minutes in most cases, provides a rapid quantitative evaluation on the limitation of idealized short-read genome sequencing. Moreover, the calculation can be parallelized to scale up to large euakryotic genomes. This approach may be useful to tune the sequencing parameters to achieve better genome assemblies when a closely related genome is already available.
Nucleotide sequence alignment of hdcA from Gram-positive bacteria.
Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A
2016-03-01
The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].
Simulating efficiently the evolution of DNA sequences.
Schöniger, M; von Haeseler, A
1995-02-01
Two menu-driven FORTRAN programs are described that simulate the evolution of DNA sequences in accordance with a user-specified model. This general stochastic model allows for an arbitrary stationary nucleotide composition and any transition-transversion bias during the process of base substitution. In addition, the user may define any hypothetical model tree according to which a family of sequences evolves. The programs suggest the computationally most inexpensive approach to generate nucleotide substitutions. Either reproducible or non-repeatable simulations, depending on the method of initializing the pseudo-random number generator, can be performed. The corresponding options are offered by the interface menu.
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
2010-07-01
... may not include material other than part of the sequence listing. A fixed-width font should be used... integer expressing the number of bases or amino acid residues M. Type Whether presented sequence molecule is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type...
Base Sequence Context Effects on Nucleotide Excision Repair
Directory of Open Access Journals (Sweden)
Yuqin Cai
2010-01-01
Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.
The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.
Hammond, R W; Crosslin, J M
1995-04-01
The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.
simple sequence repeat (SSR) markers in genetic analysis of
African Journals Online (AJOL)
Yomi
2012-08-28
1998). Cross- species amplification of soybean (Glycine max) simple sequence repeats (SSRs) within the genus and other legume genera: implications for the transferability of SSRs in plants. Mol. Biol. Evol. 15:1275-1287.
Meiler, Arno; Klinger, Claudia; Kaufmann, Michael
2012-09-08
The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.
Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K
1982-11-11
The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).
Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.
Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y
1998-07-01
An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.
Comparative effectiveness of inter-simple sequence repeat and ...
African Journals Online (AJOL)
A study to compare the effectiveness of inter-simple sequence repeats (ISSR) and randomly amplified polymorphic DNA (RAPD) profiling was carried out with a total of 65 DNA samples using 12 species of Indian Garcinia. ISSR and RAPD profiling were performed with 19 and 12 primers, respectively. ISSR markers ...
Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl
2014-07-04
Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was
Alu repeats as markers for human population genetics
Energy Technology Data Exchange (ETDEWEB)
Batzer, M.A.; Alegria-Hartman, M. [Lawrence Livermore National Lab., CA (United States); Bazan, H. [Louisiana State Univ., New Orleans, LA (United States). Medical Center] [and others
1993-09-01
The Human-Specific (HS) subfamily of Alu sequences is comprised of a group of 500 nearly identical members which are almost exclusively restricted to the human genome. Individual subfamily members share an average of 97.9% nucleotide identity with each other and an average of 98.9% nucleotide identity with the HS subfamily consensus sequence. HS Alu family members are thought to be derived from a single source ``master`` gene, and have an average age of 2.8 million years. We have developed a Polymerase Chain Reaction (PCR) based assay using primers complementary to the 5 in. and 3 in. unique flanking DNA sequences from each HS Alu that allows the locus to be assayed for the presence or absence of an Alu repeat. Individual HS Alu sequences were found to be either monomorphic or dimorphic for the presence or absence of each repeat. The monomorphic HS Alu family members inserted in the human genome after the human/great ape divergence (which is thought to have occurred 4--6 million years ago), but before the radiation of modem man. The dimorphic HS Alu sequences inserted in the human genome after the radiation of modem man (within the last 200,000-one million years) and represent a unique source of information for human population genetics and forensic DNA analyses. These sites can be developed into Dimorphic Alu Sequence Tagged Sites (DASTS) for the Human Genome Project as well. HS Alu family member insertion dimorphism differs from other types of polymorphism (e.g. Variable Number of Tandem Repeat [VNTR] or Restriction Fragment Length Polymorphism [RFLP]) because individuals share HS Alu family member insertions based upon identity by descent from a common ancestor as a result of a single event which occurred one time within the human population. The VNTR and RFLP polymorphisms may arise multiple times within a population and are identical by state only.
SSRscanner: a program for reporting distribution and exact location of simple sequence repeats.
Anwar, Tamanna; Khan, Asad U
2006-02-20
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. These repeated DNA sequences are found in both prokaryotes and eukaryotes. They are distributed almost at random throughout the genome, ranging from mononucleotide to trinucleotide repeats. They are also found at longer lengths (> 6 repeating units) of tracts. Most of the computer programs that find SSRs do not report its exact position. A computer program SSRscanner was written to find out distribution, frequency and exact location of each SSR in the genome. SSRscanner is user friendly. It can search repeats of any length and produce outputs with their exact position on chromosome and their frequency of occurrence in the sequence. This program has been written in PERL and is freely available for non-commercial users by request from the authors. Please contact the authors by E-mail: huzzi99@hotmail.com.
Energy Technology Data Exchange (ETDEWEB)
Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.
1987-02-01
To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.
Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian
Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.
Simple sequence repeat (SSR)-based genetic variability among ...
African Journals Online (AJOL)
The objective of this study was to compare if simple sequence repeat (SSR) markers could correctly identify peanut genotypes with difference in specific leaf weight (SLW) and relative water content (RWC). Four peanut genotypes and two water regimes (FC and 1/3 available water; 1/3 AW) were arranged in factorial ...
Niu, Qingli; Marchand, Jordan; Yang, Congshan; Bonsergent, Claire; Guan, Guiquan; Yin, Hong; Malandrin, Laurence
2015-07-30
Sheep babesiosis occurs mainly in tropical and subtropical areas. The sheep parasite Babesia sp. Xinjiang is widespread in China, and our goal is to characterize rap-1 (rhoptry-associated protein 1) gene diversity and expression as a first step of a long term goal aiming at developing a recombinant subunit vaccine. Seven different rap-1a genes were amplified in Babesia sp. Xinjiang, using degenerate primers designed from conserved motifs. Rap-1b and rap-1c gene types could not be identified. In all seven rap-1a genes, the 5' regions exhibited identical sequences over 936 nt, and the 3' regions differed at 28 positions over 147 nt, defining two types of genes designated α and β. The remaining 3' part varied from 72 to 360 nt in length, depending on the gene. This region consists of a succession of two to ten 36 nt repeats, which explains the size differences. Even if the nucleotide sequences varied, 6 repeats encoded the same stretch of amino acids. Transcription of at least four α and two β genes was demonstrated by standard RT-PCR. Copyright © 2015 Elsevier B.V. All rights reserved.
Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum
Directory of Open Access Journals (Sweden)
White Frank F
2011-07-01
Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.
Baldo, A M; Les, D H; Strausbaugh, L D
1999-11-01
Simplified DNA sequence acquisition has provided many new data sets that are useful for phylogenetic reconstruction, including single- and multiple-copy nuclear and organellar genes. Although transcribed regions receive much attention, nontranscribed regions have recently been added to the repertoire of sequences suitable for phylogenetic studies, especially for closely related taxa. We evaluated the efficacy of a small portion of the histone repeat for phylogenetic reconstruction among Drosophila species. Histone repeats in invertebrates offer distinct advantages similar to those of widely used ribosomal repeats. First, the units are tandemly repeated and undergo concerted evolution. Second, histone repeats include both highly conserved coding and variable intergenic regions. This composition facilitates application of "universal" primers spanning potentially informative sites. We examined a small region of the histone repeat, including the intergenic spacer segments of coding regions from the divergently transcribed H2A and H2B histone genes. The spacer (about 230 bp) exists as a mosaic with highly conserved functional motifs interspersed with rapidly diverging regions; the former aid in alignment of the spacer. There are no ambiguities in alignment of coding regions. Coding and noncoding regions were analyzed together and separately for phylogenetic information. Parsimony, distance, and maximum-likelihood methods successfully retrieve the corroborated phylogeny for the taxa examined. This study demonstrates the resolving power of a small histone region which may now be added to the growing collection of phylogenetically useful DNA sequences.
Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.
Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid
2012-07-01
Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.
Directory of Open Access Journals (Sweden)
Peter Norberg
Full Text Available The complete nucleotide sequence of plasmids pMCBF1 and pMCBF6 was determined and analyzed. pMCBF1 and pMCBF6 form a novel clade within the IncP-1 plasmid family designated IncP-1 ς. The plasmids were exogenously isolated earlier from a marine biofilm. pMCBF1 (62 689 base pairs; bp and pMCBF6 (66 729 bp have identical backbones, but differ in their mercury resistance transposons. pMCBF1 carries Tn5053 and pMCBF6 carries Tn5058. Both are flanked by 5 bp direct repeats, typical of replicative transposition. Both insertions are in the vicinity of a resolvase gene in the backbone, supporting the idea that both transposons are "res-site hunters" that preferably insert close to and use external resolvase functions. The similarity of the backbones indicates recent insertion of the two transposons and the ongoing dynamics of plasmid evolution in marine biofilms. Both plasmids also carry the insertion sequence ISPst1, albeit without flanking repeats. ISPs1is located in an unusual site within the control region of the plasmid. In contrast to most known IncP-1 plasmids the pMCBF1/pMCBF6 backbone has no insert between the replication initiation gene (trfA and the vegetative replication origin (oriV. One pMCBF1/pMCBF6 block of about 2.5 kilo bases (kb has no similarity with known sequences in the databases. Furthermore, insertion of three genes with similarity to the multidrug efflux pump operon mexEF and a gene from the NodT family of the tripartite multi-drug resistance-nodulation-division (RND system in Pseudomonas aeruginosa was found. They do not seem to confer antibiotic resistance to the hosts of pMCBF1/pMCBF6, but the presence of RND on promiscuous plasmids may have serious implications for the spread of antibiotic multi-resistance.
Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1
Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef
The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for
Wang, Xinwang; Wadl, Phillip A; Wood-Jones, Alicia; Windham, Gary; Trigiano, Robert N; Scruggs, Mary; Pilgrim, Candace; Baird, Richard
2012-12-01
Simple sequence repeat (SSR) markers were developed from Aspergillus flavus expressed sequence tag (EST) database to conduct an analysis of genetic relationships of Aspergillus isolates from numerous host species and geographical regions, but primarily from the United States. Twenty-nine primers were designed from 362 tri-nucleotide EST-SSR sequences. Eighteen polymorphic loci were used to genotype 96 Aspergillus species isolates. The number of alleles detected per locus ranged from 2 to 24 with a mean of 8.2 alleles. Haploid diversity ranged from 0.28 to 0.91. Genetic distance matrix was used to perform principal coordinates analysis (PCA) and to generate dendrograms using unweighted pair group method with arithmetic mean (UPGMA). Two principal coordinates explained more than 75 % of the total variation among the isolates. One clade was identified for A. flavus isolates (n = 87) with the other Aspergillus species (n = 7) using PCA, but five distinct clusters were present when the others taxa were excluded from the analysis. Six groups were noted when the EST-SSR data were compared using UPGMA. However, the latter PCA or UPGMA comparison resulted in no direct associations with host species, geographical region or aflatoxin production. Furthermore, there was no direct correlation to visible morphological features such as sclerotial types. The isolates from Mississippi Delta region, which contained the largest percentage of isolates, did not show any unusual clustering except for isolates K32, K55, and 199. Further studies of these three isolates are warranted to evaluate their pathogenicity, aflatoxin production potential, additional gene sequences (e.g., RPB2), and morphological comparisons.
Ivanov, Peter A; Mukhamedzhanova, Anna A; Smirnov, Alexander A; Rodionova, Nina P; Karpova, Olga V; Atabekov, Joseph G
2011-04-01
A southeastern European isolate of Alternanthera mosaic virus (AltMV-MU) of the genus Potexvirus (family Flexiviridae) was purified from the ornamental plant Portulaca grandiflora. The complete nucleotide sequence (6606 nucleotides) of AltMV-MU genomic RNA was defined. The AltMV-MU genome is different from those of all isolates described earlier and is most closely related to genomes of partly sequenced portulaca isolates AltMV-Po (America) and AltMV-It (Italy). Phylogenetic analysis supports the view that AltMV-MU belongs to a new "portulaca" genotype distinguishable from the "phlox" genotype.
APE1 incision activity at abasic sites in tandem repeat sequences.
Li, Mengxia; Völker, Jens; Breslauer, Kenneth J; Wilson, David M
2014-05-29
Repetitive DNA sequences, such as those present in microsatellites and minisatellites, telomeres, and trinucleotide repeats (linked to fragile X syndrome, Huntington disease, etc.), account for nearly 30% of the human genome. These domains exhibit enhanced susceptibility to oxidative attack to yield base modifications, strand breaks, and abasic sites; have a propensity to adopt non-canonical DNA forms modulated by the positions of the lesions; and, when not properly processed, can contribute to genome instability that underlies aging and disease development. Knowledge on the repair efficiencies of DNA damage within such repetitive sequences is therefore crucial for understanding the impact of such domains on genomic integrity. In the present study, using strategically designed oligonucleotide substrates, we determined the ability of human apurinic/apyrimidinic endonuclease 1 (APE1) to cleave at apurinic/apyrimidinic (AP) sites in a collection of tandem DNA repeat landscapes involving telomeric and CAG/CTG repeat sequences. Our studies reveal the differential influence of domain sequence, conformation, and AP site location/relative positioning on the efficiency of APE1 binding and strand incision. Intriguingly, our data demonstrate that APE1 endonuclease efficiency correlates with the thermodynamic stability of the DNA substrate. We discuss how these results have both predictive and mechanistic consequences for understanding the success and failure of repair protein activity associated with such oxidatively sensitive, conformationally plastic/dynamic repetitive DNA domains. Published by Elsevier Ltd.
International Nuclear Information System (INIS)
Siebert, P.D.; Fukuda, M.
1987-01-01
The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes
D20S16 is a complex interspersed repeated sequence: Genetic and physical analysis of the locus
Energy Technology Data Exchange (ETDEWEB)
Bowden, D.W.; Krawchuk, M.D.; Howard, T.D. [Wake Forest Univ., Winston-Salem, NC (United States)] [and others
1995-01-20
The genomic structure of the D20S16 locus has been evaluated using genetic and physical methods. D20S16, originally detected with the probe CRI-L1214, is a highly informative, complex restriction fragment length polymorphism consisting of two separate allelic systems. The allelic systems have the characteristics of conventional VNTR polymorphisms and are separated by recombination ({theta} = 0.02, Z{sub max} = 74.82), as demonstrated in family studies. Most of these recombination events are meiotic crossovers and are maternal in origin, but two, including deletion of the locus in a cell line from a CEPH family member, occur without evidence for exchange of flanking markers. DNA sequence analysis suggests that the basis of the polymorphism is variable numbers of a 98-bp sequence tandemly repeated with 87 to 90% sequence similarity between repeats. The 98-bp repeat is a dimer of 49 bp sequence with 45 to 98% identity between the elements. In addition, nonpolymorphic genomic sequences adjacent to the polymorphic 98-bp repeat tracts are also repeated but are not polymorphic, i.e., show no individual to individual variation. Restriction enzyme mapping of cosmids containing the CRI-L1214 sequence suggests that there are multiple interspersed repeats of the CRI-L1214 sequence on chromosome 20. The results of dual-color fluorescence in situ hybridization experiments with interphase nuclei are also consistent with multiple repeats of an interspersed sequence on chromosome 20. 23 refs., 6 figs.
The nucleotide sequence of a Polish isolate of Tomato torrado virus.
Budziszewska, Marta; Obrepalska-Steplowska, Aleksandra; Wieczorek, Przemysław; Pospieszny, Henryk
2008-12-01
A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.
Directory of Open Access Journals (Sweden)
Meiler Arno
2012-09-01
Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.
2012-01-01
Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836
Accurate typing of short tandem repeats from genome-wide sequencing data and its applications.
Fungtammasan, Arkarachai; Ananda, Guruprasad; Hile, Suzanne E; Su, Marcia Shu-Wei; Sun, Chen; Harris, Robert; Medvedev, Paul; Eckert, Kristin; Makova, Kateryna D
2015-05-01
Short tandem repeats (STRs) are implicated in dozens of human genetic diseases and contribute significantly to genome variation and instability. Yet profiling STRs from short-read sequencing data is challenging because of their high sequencing error rates. Here, we developed STR-FM, short tandem repeat profiling using flank-based mapping, a computational pipeline that can detect the full spectrum of STR alleles from short-read data, can adapt to emerging read-mapping algorithms, and can be applied to heterogeneous genetic samples (e.g., tumors, viruses, and genomes of organelles). We used STR-FM to study STR error rates and patterns in publicly available human and in-house generated ultradeep plasmid sequencing data sets. We discovered that STRs sequenced with a PCR-free protocol have up to ninefold fewer errors than those sequenced with a PCR-containing protocol. We constructed an error correction model for genotyping STRs that can distinguish heterozygous alleles containing STRs with consecutive repeat numbers. Applying our model and pipeline to Illumina sequencing data with 100-bp reads, we could confidently genotype several disease-related long trinucleotide STRs. Utilizing this pipeline, for the first time we determined the genome-wide STR germline mutation rate from a deeply sequenced human pedigree. Additionally, we built a tool that recommends minimal sequencing depth for accurate STR genotyping, depending on repeat length and sequencing read length. The required read depth increases with STR length and is lower for a PCR-free protocol. This suite of tools addresses the pressing challenges surrounding STR genotyping, and thus is of wide interest to researchers investigating disease-related STRs and STR evolution. © 2015 Fungtammasan et al.; Published by Cold Spring Harbor Laboratory Press.
Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor
International Nuclear Information System (INIS)
Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.
1987-01-01
Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2
Directory of Open Access Journals (Sweden)
Glass John I
2010-07-01
Full Text Available Abstract Background Intragenic tandem repeats occur throughout all domains of life and impart functional and structural variability to diverse translation products. Repeat proteins confer distinctive surface phenotypes to many unicellular organisms, including those with minimal genomes such as the wall-less bacterial monoderms, Mollicutes. One such repeat pattern in this clade is distributed in a manner suggesting its exchange by horizontal gene transfer (HGT. Expanding genome sequence databases reveal the pattern in a widening range of bacteria, and recently among eucaryotic microbes. We examined the genomic flux and consequences of the motif by determining its distribution, predicted structural features and association with membrane-targeted proteins. Results Using a refined hidden Markov model, we document a 25-residue protein sequence motif tandemly arrayed in variable-number repeats in ORFs lacking assigned functions. It appears sporadically in unicellular microbes from disparate bacterial and eucaryotic clades, representing diverse lifestyles and ecological niches that include host parasitic, marine and extreme environments. Tracts of the repeats predict a malleable configuration of recurring domains, with conserved hydrophobic residues forming an amphipathic secondary structure in which hydrophilic residues endow extensive sequence variation. Many ORFs with these domains also have membrane-targeting sequences that predict assorted topologies; others may comprise reservoirs of sequence variants. We demonstrate expressed variants among surface lipoproteins that distinguish closely related animal pathogens belonging to a subgroup of the Mollicutes. DNA sequences encoding the tandem domains display dyad symmetry. Moreover, in some taxa the domains occur in ORFs selectively associated with mobile elements. These features, a punctate phylogenetic distribution, and different patterns of dispersal in genomes of related taxa, suggest that the
Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca
2015-01-01
Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450
Directory of Open Access Journals (Sweden)
Francesca Bertolini
Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.
Cahill, Matt J.
2010-07-12
Background: There are a growing number of next-generation sequencing technologies. At present, the most cost-effective options also produce the shortest reads. However, even for prokaryotes, there is uncertainty concerning the utility of these technologies for the de novo assembly of complete genomes. This reflects an expectation that short reads will be unable to resolve small, but presumably abundant, repeats. Methodology/Principal Findings: Using a simple model of repeat assembly, we develop and test a technique that, for any read length, can estimate the occurrence of unresolvable repeats in a genome, and thus predict the number of gaps that would need to be closed to produce a complete sequence. We apply this technique to 818 prokaryote genome sequences. This provides a quantitative assessment of the relative performance of various lengths. Notably, unpaired reads of only 150nt can reconstruct approximately 50% of the analysed genomes with fewer than 96 repeat-induced gaps. Nonetheless, there is considerable variation amongst prokaryotes. Some genomes can be assembled to near contiguity using very short reads while others require much longer reads. Conclusions: Given the diversity of prokaryote genomes, a sequencing strategy should be tailored to the organism under study. Our results will provide researchers with a practical resource to guide the selection of the appropriate read length. 2010 Cahill et al.
Directory of Open Access Journals (Sweden)
Matt J Cahill
Full Text Available BACKGROUND: There are a growing number of next-generation sequencing technologies. At present, the most cost-effective options also produce the shortest reads. However, even for prokaryotes, there is uncertainty concerning the utility of these technologies for the de novo assembly of complete genomes. This reflects an expectation that short reads will be unable to resolve small, but presumably abundant, repeats. METHODOLOGY/PRINCIPAL FINDINGS: Using a simple model of repeat assembly, we develop and test a technique that, for any read length, can estimate the occurrence of unresolvable repeats in a genome, and thus predict the number of gaps that would need to be closed to produce a complete sequence. We apply this technique to 818 prokaryote genome sequences. This provides a quantitative assessment of the relative performance of various lengths. Notably, unpaired reads of only 150nt can reconstruct approximately 50% of the analysed genomes with fewer than 96 repeat-induced gaps. Nonetheless, there is considerable variation amongst prokaryotes. Some genomes can be assembled to near contiguity using very short reads while others require much longer reads. CONCLUSIONS: Given the diversity of prokaryote genomes, a sequencing strategy should be tailored to the organism under study. Our results will provide researchers with a practical resource to guide the selection of the appropriate read length.
Cahill, Matt J.; Kö ser, Claudio U.; Ross, Nicholas E.; Archer, John A.C.
2010-01-01
Background: There are a growing number of next-generation sequencing technologies. At present, the most cost-effective options also produce the shortest reads. However, even for prokaryotes, there is uncertainty concerning the utility of these technologies for the de novo assembly of complete genomes. This reflects an expectation that short reads will be unable to resolve small, but presumably abundant, repeats. Methodology/Principal Findings: Using a simple model of repeat assembly, we develop and test a technique that, for any read length, can estimate the occurrence of unresolvable repeats in a genome, and thus predict the number of gaps that would need to be closed to produce a complete sequence. We apply this technique to 818 prokaryote genome sequences. This provides a quantitative assessment of the relative performance of various lengths. Notably, unpaired reads of only 150nt can reconstruct approximately 50% of the analysed genomes with fewer than 96 repeat-induced gaps. Nonetheless, there is considerable variation amongst prokaryotes. Some genomes can be assembled to near contiguity using very short reads while others require much longer reads. Conclusions: Given the diversity of prokaryote genomes, a sequencing strategy should be tailored to the organism under study. Our results will provide researchers with a practical resource to guide the selection of the appropriate read length. 2010 Cahill et al.
Steenbergh, P.H.; Sussenbach, J.S.
The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the
Directory of Open Access Journals (Sweden)
Boian S Alexandrov
Full Text Available Trinucleotide repeats sequences (TRS represent a common type of genomic DNA motif whose expansion is associated with a large number of human diseases. The driving molecular mechanisms of the TRS ongoing dynamic expansion across generations and within tissues and its influence on genomic DNA functions are not well understood. Here we report results for a novel and notable collective breathing behavior of genomic DNA of tandem TRS, leading to propensity for large local DNA transient openings at physiological temperature. Our Langevin molecular dynamics (LMD and Markov Chain Monte Carlo (MCMC simulations demonstrate that the patterns of openings of various TRSs depend specifically on their length. The collective propensity for DNA strand separation of repeated sequences serves as a precursor for outsized intermediate bubble states independently of the G/C-content. We report that repeats have the potential to interfere with the binding of transcription factors to their consensus sequence by altered DNA breathing dynamics in proximity of the binding sites. These observations might influence ongoing attempts to use LMD and MCMC simulations for TRS-related modeling of genomic DNA functionality in elucidating the common denominators of the dynamic TRS expansion mutation with potential therapeutic applications.
Nucleotide sequence of the melA gene, coding for alpha-galactosidase in Escherichia coli K-12.
Liljeström, P L; Liljeström, P
1987-01-01
Melibiose uptake and hydrolysis in E.coli is performed by the MelB and MelA proteins, respectively. We report the cloning and sequencing of the melA gene. The nucleotide sequence data showed that melA codes for a 450 amino acid long protein with a molecular weight of 50.6 kd. The sequence data also supported the assumption that the mel locus forms an operon with melA in proximal position. A comparison of MelA with alpha-galactosidase proteins from yeast and human origin showed that these prot...
37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.
2010-07-01
... mature protein, with the number 1. When presented, the amino acids preceding the mature protein, e.g... acids. (1) The amino acids in a protein or peptide sequence shall be listed using the three-letter... data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...
The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.
Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F
1992-12-01
The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.
Tandemly repeated sequence in 5'end of mtDNA control region of ...
African Journals Online (AJOL)
Extensive length variability was observed in 5' end sequence of the mitochondrial DNA control region of the Japanese Spanish mackerel (Scomberomorus niphonius). This length variability was due to the presence of varying numbers of a 56-bp tandemly repeated sequence and a 46-bp insertion/deletion (indel).
Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.
1998-01-01
Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304
International Nuclear Information System (INIS)
Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.
1987-01-01
Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative
Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme
2013-07-01
The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.
Repeat-aware modeling and correction of short read errors.
Yang, Xiao; Aluru, Srinivas; Dorman, Karin S
2011-02-15
High-throughput short read sequencing is revolutionizing genomics and systems biology research by enabling cost-effective deep coverage sequencing of genomes and transcriptomes. Error detection and correction are crucial to many short read sequencing applications including de novo genome sequencing, genome resequencing, and digital gene expression analysis. Short read error detection is typically carried out by counting the observed frequencies of kmers in reads and validating those with frequencies exceeding a threshold. In case of genomes with high repeat content, an erroneous kmer may be frequently observed if it has few nucleotide differences with valid kmers with multiple occurrences in the genome. Error detection and correction were mostly applied to genomes with low repeat content and this remains a challenging problem for genomes with high repeat content. We develop a statistical model and a computational method for error detection and correction in the presence of genomic repeats. We propose a method to infer genomic frequencies of kmers from their observed frequencies by analyzing the misread relationships among observed kmers. We also propose a method to estimate the threshold useful for validating kmers whose estimated genomic frequency exceeds the threshold. We demonstrate that superior error detection is achieved using these methods. Furthermore, we break away from the common assumption of uniformly distributed errors within a read, and provide a framework to model position-dependent error occurrence frequencies common to many short read platforms. Lastly, we achieve better error correction in genomes with high repeat content. The software is implemented in C++ and is freely available under GNU GPL3 license and Boost Software V1.0 license at "http://aluru-sun.ece.iastate.edu/doku.php?id = redeem". We introduce a statistical framework to model sequencing errors in next-generation reads, which led to promising results in detecting and correcting errors
Repeat Sequence Proteins as Matrices for Nanocomposites
Energy Technology Data Exchange (ETDEWEB)
Drummy, L.; Koerner, H; Phillips, D; McAuliffe, J; Kumar, M; Farmer, B; Vaia, R; Naik, R
2009-01-01
Recombinant protein-inorganic nanocomposites comprised of exfoliated Na+ montmorillonite (MMT) in a recombinant protein matrix based on silk-like and elastin-like amino acid motifs (silk elastin-like protein (SELP)) were formed via a solution blending process. Charged residues along the protein backbone are shown to dominate long-range interactions, whereas the SELP repeat sequence leads to local protein/MMT compatibility. Up to a 50% increase in room temperature modulus and a comparable decrease in high temperature coefficient of thermal expansion occur for cast films containing 2-10 wt.% MMT.
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-01-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...
Alu repeats as markers for forensic DNA analyses
Energy Technology Data Exchange (ETDEWEB)
Batzer, M.A.; Alegria-Hartman, M. [Lawrence Livermore National Lab., CA (United States); Kass, D.H. [Louisiana State Univ., New Orleans, LA (United States)] [and others
1994-01-01
The Human-Specific (HS) subfamily of Alu sequences is comprised of a group of 500 nearly identical members which are almost exclusively restricted to the human genome. Individual subfamily members share an average of 98.9% nucleotide identity with the HS subfamily consensus sequence, and have an average age of 2.8 million years. We have developed a Polymerase Chain Reaction (PCR) based assay using primers complementary to the 5 inch and 3 inch unique flanking DNA sequences from each HS Alu that allow the locus to be assayed for the presence or absence of the Alu repeat. The dimorphic HS Alu sequences probably inserted in the human genome after the radiation of modem humans (within the last 200,000-one million years) and represent a unique source of information for human population genetics and forensic DNA analyses. These sites can be developed into Dimorphic Alu Sequence Tagged Sites (DASTS) for the Human Genome Project. HS Alu family member insertions differ from other types of polymorphism (e.g. Variable Number of Tandem Repeat [VNTR] or Restriction Fragment Length Polymorphism [RFLP]) in that polymorphisms due to Alu insertions arise as a result of a unique event which has occurred only one time in the human population and spread through the population from that point. Therefore, individuals that share HS Alu repeats inherited these elements from a common ancestor. Most VNTR and RFLP polymorphisms may arise multiple times in parallel within a population.
The sequence of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus genome
Chen, X.; IJkel, W.F.J.; Tarchini, R.; Sun, X.; Sandbrink, H.; Wang, H.; Peters, S.; Zuidema, D.; Klein Lankhorst, R.; Vlak, J.M.; Hu, Z.
2001-01-01
The nucleotide sequence of the Helicoverpa armigera single-nucleocapsid nucleopolyhedrovirus (HaSNPV) DNA genome was determined and analysed. The circular genome encompasses 131 403 bp, has a G C content of 39.1 molnd contains five homologous regions with a unique pattern of repeats.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P
2005-05-01
The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.
Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui
2012-07-01
We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.
Kuznedelov, K D; Timoshkin, O A
1995-01-01
Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.
Nishizawa, M; Nishizawa, K
2000-10-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-04-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-01-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578
Directory of Open Access Journals (Sweden)
Paolo Annicchiarico
2016-07-01
Full Text Available Cultivar registration agencies typically require morphophysiological trait-based distinctness of candidate cultivars. This requirement is difficult to achieve for cultivars of major perennial forages because of their genetic structure and ever-increasing number of registered material, leading to possible rejection of agronomically valuable cultivars. This study aimed to explore the value of molecular markers applied to replicated bulked plants (three bulks of 100 independent plants each per cultivar to assess alfalfa ( L. subsp. cultivar distinctness. We compared genotyping-by-sequencing information based on 2902 polymorphic single-nucleotide polymorphism (SNP markers (>30 reads per DNA sample with morphophysiological information based on 11 traits and with simple-sequence repeat (SSR marker information from 41 polymorphic markers for their ability to distinguish 11 alfalfa landraces representative of the germplasm from northern Italy. Three molecular criteria, one based on cultivar differences for individual SSR bands and two based on overall SNP marker variation assessed either by statistically significant cultivar differences on principal component axes or discriminant analysis, distinctly outperformed the morphophysiological criterion. Combining the morphophysiological criterion with either molecular marker method increased discrimination among cultivars, since morphophysiological diversity was unrelated to SSR marker-based diversity ( = 0.04 and poorly related to SNP marker-based diversity ( = 0.23, < 0.15. The criterion based on statistically significant SNP allele frequency differences was less discriminating than morphophysiological variation. Marker-based distinctness, which can be assessed at low cost and without interactions with testing conditions, could validly substitute for (or complement morphophysiological distinctness in alfalfa cultivar registration schemes. It also has interest in sui generis registration systems aimed at
Roles of genes and Alu repeats in nonlinear correlations of HUMHBB DNA sequence
International Nuclear Information System (INIS)
Xiao Yi; Huang Yanzhao
2004-01-01
DNA sequences of different species and different portion of the DNA of the same species may have completely different correlation properties, but the origin of these correlations is still not very clear and is currently being investigated, especially in different particular cases. We report here a study of the DNA sequence of human beta globin region (HUMHBB) which has strong linear and nonlinear correlations. We studied the roles of two of the typical elements of DNA sequence, genes and Alu repeats, in the nonlinear correlations of HUMHBB. We find that there exist strong nonlinear correlations between the exons or introns in different genes and between the Alu repeats. They may be one of the major sources of the nonlinear correlations in HUMBHB
Directory of Open Access Journals (Sweden)
Eunyoung Seo
2016-08-01
Full Text Available Plants have evolved an elaborate innate immune system against invading pathogens. Within this system, intracellular nucleotide-binding leucine-rich repeat (NLR immune receptors are known play critical roles in effector-triggered immunity (ETI plant defense. We performed genome-wide identification and classification of NLR-coding sequences from the genomes of pepper, tomato, and potato using fixed criteria. We then compared genomic duplication and evolution features. We identified intact 267, 443, and 755 NLR-encoding genes in tomato, potato, and pepper genomes, respectively. Phylogenetic analyses and classification of Solanaceae NLRs revealed that the majority of NLR super family members fell into 14 subgroups, including a TIR-NLR (TNL subgroup and 13 non-TNL subgroups. Specific subgroups have expanded in each genome, with the expansion in pepper showing subgroup-specific physical clusters. Comparative analysis of duplications showed distinct duplication patterns within pepper and among Solanaceae plants suggesting subgroup- or species-specific gene duplication events after speciation, resulting in divergent evolution. Taken together, genome-wide analyses of NLR family members provide insights into their evolutionary history in Solanaceae. These findings also provide important foundational knowledge for understanding NLR evolution and will empower broader characterization of disease resistance genes to be used for crop breeding.
Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O
2004-01-01
Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Directory of Open Access Journals (Sweden)
Yuki Furuse
2015-11-01
Full Text Available Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.
Ma, Ji; Yang, Bingxian; Zhu, Wei; Sun, Lianli; Tian, Jingkui; Wang, Xumin
2013-10-10
Mahonia bealei (Berberidaceae) is a frequently-used traditional Chinese medicinal plant with efficient anti-inflammatory ability. This plant is one of the sources of berberine, a new cholesterol-lowering drug with anti-diabetic activity. We have sequenced the complete nucleotide sequence of the chloroplast (cp) genome of M. bealei. The complete cp genome of M. bealei is 164,792 bp in length, and has a typical structure with large (LSC 73,052 bp) and small (SSC 18,591 bp) single-copy regions separated by a pair of inverted repeats (IRs 36,501 bp) of large size. The Mahonia cp genome contains 111 unique genes and 39 genes are duplicated in the IR regions. The gene order and content of M. bealei are almost unarranged which is consistent with the hypothesis that large IRs stabilize cp genome and reduce gene loss-and-gain probabilities during evolutionary process. A large IR expansion of over 12 kb has occurred in M. bealei, 15 genes (rps19, rpl22, rps3, rpl16, rpl14, rps8, infA, rpl36, rps11, petD, petB, psbH, psbN, psbT and psbB) have expanded to have an additional copy in the IRs. The IR expansion rearrangement occurred via a double-strand DNA break and subsequence repair, which is different from the ordinary gene conversion mechanism. Repeat analysis identified 39 direct/inverted repeats 30 bp or longer with a sequence identity ≥ 90%. Analysis also revealed 75 simple sequence repeat (SSR) loci and almost all are composed of A or T, contributing to a distinct bias in base composition. Comparison of protein-coding sequences with ESTs reveals 9 putative RNA edits and 5 of them resulted in non-synonymous modifications in rpoC1, rps2, rps19 and ycf1. Phylogenetic analysis using maximum parsimony (MP) and maximum likelihood (ML) was performed on a dataset composed of 65 protein-coding genes from 25 taxa, which yields an identical tree topology as previous plastid-based trees, and provides strong support for the sister relationship between Ranunculaceae and Berberidaceae
Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G
2008-04-01
The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.
Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.
2008-01-01
The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283
Fenyk, Stepan; Townsend, Philip D.; Dixon, Christopher H.; Spies, Gerhard B.; de San Eustaquio Campillo, Alba; Slootweg, Erik J.; Westerhof, Lotte B.; Gawehns, Fleur K. K.; Knight, Marc R.; Sharples, Gary J.; Goverse, Aska; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.
2015-01-01
Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable cells to respond to pathogen attack. Several NLRs act in the nucleus; however, conserved nuclear targets that support their role in immunity are unknown. Previously, we noted a structural homology between the nucleotide-binding domain of NLRs and DNA replication origin-binding Cdc6/Orc1 proteins. Here we show that the NB-ARC (nucleotide-binding, Apaf-1, R-proteins, and CED-4) domain of the Rx1 NLR of potato binds nucleic acids. Rx1 induces ATP-dependent bending and melting of DNA in vitro, dependent upon a functional P-loop. In situ full-length Rx1 binds nuclear DNA following activation by its cognate pathogen-derived effector protein, the coat protein of potato virus X. In line with its obligatory nucleocytoplasmic distribution, DNA binding was only observed when Rx1 was allowed to freely translocate between both compartments and was activated in the cytoplasm. Immune activation induced by an unrelated NLR-effector pair did not trigger an Rx1-DNA interaction. DNA binding is therefore not merely a consequence of immune activation. These data establish a role for DNA distortion in Rx1 immune signaling and define DNA as a molecular target of an activated NLR. PMID:26306038
Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah
Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.
Gao, Chunsheng; Xin, Pengfei; Cheng, Chaohua; Tang, Qing; Chen, Ping; Wang, Changbiao; Zang, Gonggu; Zhao, Lining
2014-01-01
Cannabis sativa L. is an important economic plant for the production of food, fiber, oils, and intoxicants. However, lack of sufficient simple sequence repeat (SSR) markers has limited the development of cannabis genetic research. Here, large-scale development of expressed sequence tag simple sequence repeat (EST-SSR) markers was performed to obtain more informative genetic markers, and to assess genetic diversity in cannabis (Cannabis sativa L.). Based on the cannabis transcriptome, 4,577 SSRs were identified from 3,624 ESTs. From there, a total of 3,442 complementary primer pairs were designed as SSR markers. Among these markers, trinucleotide repeat motifs (50.99%) were the most abundant, followed by hexanucleotide (25.13%), dinucleotide (16.34%), tetranucloetide (3.8%), and pentanucleotide (3.74%) repeat motifs, respectively. The AAG/CTT trinucleotide repeat (17.96%) was the most abundant motif detected in the SSRs. One hundred and seventeen EST-SSR markers were randomly selected to evaluate primer quality in 24 cannabis varieties. Among these 117 markers, 108 (92.31%) were successfully amplified and 87 (74.36%) were polymorphic. Forty-five polymorphic primer pairs were selected to evaluate genetic diversity and relatedness among the 115 cannabis genotypes. The results showed that 115 varieties could be divided into 4 groups primarily based on geography: Northern China, Europe, Central China, and Southern China. Moreover, the coefficient of similarity when comparing cannabis from Northern China with the European group cannabis was higher than that when comparing with cannabis from the other two groups, owing to a similar climate. This study outlines the first large-scale development of SSR markers for cannabis. These data may serve as a foundation for the development of genetic linkage, quantitative trait loci mapping, and marker-assisted breeding of cannabis.
ARHGEF7 (Beta-PIX acts as guanine nucleotide exchange factor for leucine-rich repeat kinase 2.
Directory of Open Access Journals (Sweden)
Karina Haebig
Full Text Available BACKGROUND: Mutations within the leucine-rich repeat kinase 2 (LRRK2 gene are a common cause of familial and sporadic Parkinson's disease. The multidomain protein LRRK2 exhibits overall low GTPase and kinase activity in vitro. METHODOLOGY/PRINCIPAL FINDINGS: Here, we show that the rho guanine nucleotide exchange factor ARHGEF7 and the small GTPase CDC42 are interacting with LRRK2 in vitro and in vivo. GTPase activity of full-length LRRK2 increases in the presence of recombinant ARHGEF7. Interestingly, LRRK2 phosphorylates ARHGEF7 in vitro at previously unknown phosphorylation sites. We provide evidence that ARHGEF7 might act as a guanine nucleotide exchange factor for LRRK2 and that R1441C mutant LRRK2 with reduced GTP hydrolysis activity also shows reduced binding to ARHGEF7. CONCLUSIONS/SIGNIFICANCE: Downstream effects of phosphorylation of ARHGEF7 through LRRK2 could be (i a feedback control mechanism for LRRK2 activity as well as (ii an impact of LRRK2 on actin cytoskeleton regulation. A newly identified familial mutation N1437S, localized within the GTPase domain of LRRK2, further underlines the importance of the GTPase domain of LRRK2 in Parkinson's disease pathogenesis.
Wang, Q Z; Huang, M; Downie, S R; Chen, Z X
2016-05-23
Invasive plants tend to spread aggressively in new habitats and an understanding of their genetic diversity and population structure is useful for their management. In this study, expressed sequence tag-simple sequence repeat (EST-SSR) markers were developed for the invasive plant species Praxelis clematidea (Asteraceae) from 5548 Stevia rebaudiana (Asteraceae) expressed sequence tags (ESTs). A total of 133 microsatellite-containing ESTs (2.4%) were identified, of which 56 (42.1%) were hexanucleotide repeat motifs and 50 (37.6%) were trinucleotide repeat motifs. Of the 24 primer pairs designed from these 133 ESTs, 7 (29.2%) resulted in significant polymorphisms. The number of alleles per locus ranged from 5 to 9. The relatively high genetic diversity (H = 0.2667, I = 0.4212, and P = 100%) of P. clematidea was related to high gene flow (Nm = 1.4996) among populations. The coefficient of population differentiation (GST = 0.2500) indicated that most genetic variation occurred within populations. A Mantel test suggested that there was significant correlation between genetic distance and geographical distribution (r = 0.3192, P = 0.012). These results further support the transferability of EST-SSR markers between closely related genera of the same family.
Tandemly repeated sequence in 5'end of mtDNA control region of ...
African Journals Online (AJOL)
STORAGESEVER
2008-12-17
Dec 17, 2008 ... chain reaction (PCR). Japanese Spanish ... mainly covered general ecology and fishery biology. No study concerning the ... Conserved sequence blocks and the repeat units are indicated by boxes. performed using the exact ...
An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin
2017-09-11
Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica , about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N 50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both "Zheda 23" and "Zheda 83". Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species.
International Nuclear Information System (INIS)
Bhattacharya, Monolekha; Das, Amit Kumar
2011-01-01
Highlights: ► The regulatory sequences recognized by TcrX have been identified. ► The regulatory region comprises of inverted repeats segregated by 30 bp region. ► The mode of binding of TcrX with regulatory sequence is unique. ► In silico TcrX–DNA docked model binds one of the inverted repeats. ► Both phosphorylated and unphosphorylated TcrX binds regulatory sequence in vitro. -- Abstract: TcrY, a histidine kinase, and TcrX, a response regulator, constitute a two-component system in Mycobacterium tuberculosis. tcrX, which is expressed during iron scarcity, is instrumental in the survival of iron-dependent M. tuberculosis. However, the regulator of tcrX/Y has not been fully characterized. Crosslinking studies of TcrX reveal that it can form oligomers in vitro. Electrophoretic mobility shift assays (EMSAs) show that TcrX recognizes two regions in the promoter that are comprised of inverted repeats separated by ∼30 bp. The dimeric in silico model of TcrX predicts binding to one of these inverted repeat regions. Site-directed mutagenesis and radioactive phosphorylation indicate that D54 of TcrX is phosphorylated by H256 of TcrY. However, phosphorylated and unphosphorylated TcrX bind the regulatory sequence with equal efficiency, which was shown with an EMSA using the D54A TcrX mutant.
Richard, François D; Kajava, Andrey V
2014-06-01
The dramatic growth of sequencing data evokes an urgent need to improve bioinformatics tools for large-scale proteome analysis. Over the last two decades, the foremost efforts of computer scientists were devoted to proteins with aperiodic sequences having globular 3D structures. However, a large portion of proteins contain periodic sequences representing arrays of repeats that are directly adjacent to each other (so called tandem repeats or TRs). These proteins frequently fold into elongated fibrous structures carrying different fundamental functions. Algorithms specific to the analysis of these regions are urgently required since the conventional approaches developed for globular domains have had limited success when applied to the TR regions. The protein TRs are frequently not perfect, containing a number of mutations, and some of them cannot be easily identified. To detect such "hidden" repeats several algorithms have been developed. However, the most sensitive among them are time-consuming and, therefore, inappropriate for large scale proteome analysis. To speed up the TR detection we developed a rapid filter that is based on the comparison of composition and order of short strings in the adjacent sequence motifs. Tests show that our filter discards up to 22.5% of proteins which are known to be without TRs while keeping almost all (99.2%) TR-containing sequences. Thus, we are able to decrease the size of the initial sequence dataset enriching it with TR-containing proteins which allows a faster subsequent TR detection by other methods. The program is available upon request. Copyright © 2014 Elsevier Inc. All rights reserved.
Distribution and sequence homogeneity of an abundant satellite DNA in the beetle, Tenebrio molitor.
Davis, C A; Wyatt, G R
1989-01-01
The mealworm beetle, Tenebrio molitor, contains an unusually abundant and homogeneous satellite DNA which constitutes up to 60% of its genome. The satellite DNA is shown to be present in all of the chromosomes by in situ hybridization. 18 dimers of the repeat unit were cloned and sequenced. The consensus sequence is 142 nt long and lacks any internal repeat structure. Monomers of the sequence are very similar, showing on average a 2% divergence from the calculated consensus. Variant nucleotides are scattered randomly throughout the sequence although some variants are more common than others. Neighboring repeat units are no more alike than randomly chosen ones. The results suggest that some mechanism, perhaps gene conversion, is acting to maintain the homogeneity of the satellite DNA despite its abundance and distribution on all of the chromosomes. Images PMID:2762148
International Nuclear Information System (INIS)
Steenbergh, P.H.
1979-01-01
The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)
Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M
2002-12-01
There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.
Semenova, E.V.; Jore, M.M.; Westra, E.R.; Oost, van der J.; Brouns, S.J.J.
2011-01-01
Prokaryotic clustered regularly interspaced short palindromic repeat (CRISPR)/Cas (CRISPR-associated sequences) systems provide adaptive immunity against viruses when a spacer sequence of small CRISPR RNA (crRNA) matches a protospacer sequence in the viral genome. Viruses that escape CRISPR/Cas
Directory of Open Access Journals (Sweden)
Sukdeb Nandi
2010-03-01
Full Text Available Canine parvovirus 2 (CPV‑2 is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV‑2a, CPV‑2b and CPV‑2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV‑2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India
Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj
2010-01-01
Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.
MSDB: A Comprehensive Database of Simple Sequence Repeats.
Avvaru, Akshay Kumar; Saxena, Saketh; Sowpati, Divya Tej; Mishra, Rakesh Kumar
2017-06-01
Microsatellites, also known as Simple Sequence Repeats (SSRs), are short tandem repeats of 1-6 nt motifs present in all genomes, particularly eukaryotes. Besides their usefulness as genome markers, SSRs have been shown to perform important regulatory functions, and variations in their length at coding regions are linked to several disorders in humans. Microsatellites show a taxon-specific enrichment in eukaryotic genomes, and some may be functional. MSDB (Microsatellite Database) is a collection of >650 million SSRs from 6,893 species including Bacteria, Archaea, Fungi, Plants, and Animals. This database is by far the most exhaustive resource to access and analyze SSR data of multiple species. In addition to exploring data in a customizable tabular format, users can view and compare the data of multiple species simultaneously using our interactive plotting system. MSDB is developed using the Django framework and MySQL. It is freely available at http://tdb.ccmb.res.in/msdb. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Fenyk, Stepan; Townsend, Philip D; Dixon, Christopher H; Spies, Gerhard B; de San Eustaquio Campillo, Alba; Slootweg, Erik J; Westerhof, Lotte B; Gawehns, Fleur K K; Knight, Marc R; Sharples, Gary J; Goverse, Aska; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J
2015-10-09
Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable cells to respond to pathogen attack. Several NLRs act in the nucleus; however, conserved nuclear targets that support their role in immunity are unknown. Previously, we noted a structural homology between the nucleotide-binding domain of NLRs and DNA replication origin-binding Cdc6/Orc1 proteins. Here we show that the NB-ARC (nucleotide-binding, Apaf-1, R-proteins, and CED-4) domain of the Rx1 NLR of potato binds nucleic acids. Rx1 induces ATP-dependent bending and melting of DNA in vitro, dependent upon a functional P-loop. In situ full-length Rx1 binds nuclear DNA following activation by its cognate pathogen-derived effector protein, the coat protein of potato virus X. In line with its obligatory nucleocytoplasmic distribution, DNA binding was only observed when Rx1 was allowed to freely translocate between both compartments and was activated in the cytoplasm. Immune activation induced by an unrelated NLR-effector pair did not trigger an Rx1-DNA interaction. DNA binding is therefore not merely a consequence of immune activation. These data establish a role for DNA distortion in Rx1 immune signaling and define DNA as a molecular target of an activated NLR. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Simple sequence repeat (SSR) markers are effective for identifying ...
African Journals Online (AJOL)
DNA was extracted from newly formed leaves and amplified using 21 simple sequence repeat (SSR) markers (NH001c, NH002b, NH005b, NH007b, NH008b, NH009b, NH011b, NH013b, NH012a, NH014a, NH015a, NH017a, KA4b, KA5, KA14, KA16, KB16, KU10, BGA35, BGT23b and HGA8b). The data was analyzed by ...
Liu, San-Xu; Hou, Wei; Zhang, Xue-Yan; Peng, Chang-Jun; Yue, Bi-Song; Fan, Zhen-Xin; Li, Jing
2018-07-18
The Tibetan macaque, which is endemic to China, is currently listed as a Near Endangered primate species by the International Union for Conservation of Nature (IUCN). Short tandem repeats (STRs) refer to repetitive elements of genome sequence that range in length from 1-6 bp. They are found in many organisms and are widely applied in population genetic studies. To clarify the distribution characteristics of genome-wide STRs and understand their variation among Tibetan macaques, we conducted a genome-wide survey of STRs with next-generation sequencing of five macaque samples. A total of 1 077 790 perfect STRs were mined from our assembly, with an N50 of 4 966 bp. Mono-nucleotide repeats were the most abundant, followed by tetra- and di-nucleotide repeats. Analysis of GC content and repeats showed consistent results with other macaques. Furthermore, using STR analysis software (lobSTR), we found that the proportion of base pair deletions in the STRs was greater than that of insertions in the five Tibetan macaque individuals (Pgenome showed good amplification efficiency and could be used to study population genetics in Tibetan macaques. The neighbor-joining tree classified the five macaques into two different branches according to their geographical origin, indicating high genetic differentiation between the Huangshan and Sichuan populations. We elucidated the distribution characteristics of STRs in the Tibetan macaque genome and provided an effective method for screening polymorphic STRs. Our results also lay a foundation for future genetic variation studies of macaques.
Repeated-Sprint Sequences During Female Soccer Matches Using Fixed and Individual Speed Thresholds.
Nakamura, Fábio Y; Pereira, Lucas A; Loturco, Irineu; Rosseti, Marcelo; Moura, Felipe A; Bradley, Paul S
2017-07-01
Nakamura, FY, Pereira, LA, Loturco, I, Rosseti, M, Moura, FA, and Bradley, PS. Repeated-sprint sequences during female soccer matches using fixed and individual speed thresholds. J Strength Cond Res 31(7): 1802-1810, 2017-The main objective of this study was to characterize the occurrence of single sprint and repeated-sprint sequences (RSS) during elite female soccer matches, using fixed (20 km·h) and individually based speed thresholds (>90% of the mean speed from a 20-m sprint test). Eleven elite female soccer players from the same team participated in the study. All players performed a 20-m linear sprint test, and were assessed in up to 10 official matches using Global Positioning System technology. Magnitude-based inferences were used to test for meaningful differences. Results revealed that irrespective of adopting fixed or individual speed thresholds, female players produced only a few RSS during matches (2.3 ± 2.4 sequences using the fixed threshold and 3.3 ± 3.0 sequences using the individually based threshold), with most sequences composing of just 2 sprints. Additionally, central defenders performed fewer sprints (10.2 ± 4.1) than other positions (fullbacks: 28.1 ± 5.5; midfielders: 21.9 ± 10.5; forwards: 31.9 ± 11.1; with the differences being likely to almost certainly associated with effect sizes ranging from 1.65 to 2.72), and sprinting ability declined in the second half. The data do not support the notion that RSS occurs frequently during soccer matches in female players, irrespective of using fixed or individual speed thresholds to define sprint occurrence. However, repeated-sprint ability development cannot be ruled out from soccer training programs because of its association with match-related performance.
Directory of Open Access Journals (Sweden)
Andréia B. Poletto
2008-01-01
Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.
International Nuclear Information System (INIS)
Tschunko, A.H.; Loechel, R.H.; McLaren, N.C.; Allen, S.L.
1987-01-01
DNA sequence elimination and rearrangement occurs during the development of somatic cell lineages of eukaryotes and was first discovered over a century ago. However, the significance and mechanism of chromatin elimination are not understood. DNA elimination also occurs during the development of the somatic macronucleus from the germinal micronucleus in unicellular ciliated protozoa such as Tetrahymena thermophila. In this study foldback DNA from the micronucleus was used as a probe to isolate ten clones. All of those tested (4/4) contained sequences that were repetitive in the micronucleus and rearranged in the macronucleus. Inverted repeated sequences were present in one clone. This clone, pTtFBl, was subjected to a detailed analysis of its developmental fate. Subregions were subcloned and used as probes against Southern blots of micronuclear and macronuclear DNA. DNA was labeled with [ 33 P]-labeled dATP. The authors found that all subregions defined repeated sequence families in the micronuclear genome. A minimum of four different families was defined, two of which are retained in the macronucleus and two of which are completely eliminated. The inverted repeat family is retained with little rearrangement. Two of the families, defined by subregions that do not contain parts of the inverted repeat are totally eliminated during macronuclear development-and contain open reading frames. The significance of retained inverted repeats to the process of elimination is discussed
Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.
Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C
2018-01-10
Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing
Statistical properties of nucleotides in human chromosomes 21 and 22
International Nuclear Information System (INIS)
Zhang Linxi; Sun Tingting
2005-01-01
In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence
Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.
Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick
2017-08-01
A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.
Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon
2015-02-01
There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.
Zhou, Wei; Hu, Yiyi; Sui, Zhenghong; Fu, Feng; Wang, Jinguo; Chang, Lianpeng; Guo, Weihua; Li, Binbin
2013-01-01
Gracilariopsis lemaneiformis has a high economic value and is one of the most important aquaculture species in China. Despite it is economic importance, it has remained largely unstudied at the genomic level. In this study, we conducted a genome survey of Gp. lemaneiformis using next-generation sequencing (NGS) technologies. In total, 18.70 Gb of high-quality sequence data with an estimated genome size of 97 Mb were obtained by HiSeq 2000 sequencing for Gp. lemaneiformis. These reads were assembled into 160,390 contigs with a N50 length of 3.64 kb, which were further assembled into 125,685 scaffolds with a total length of 81.17 Mb. Genome analysis predicted 3490 genes and a GC% content of 48%. The identified genes have an average transcript length of 1,429 bp, an average coding sequence size of 1,369 bp, 1.36 exons per gene, exon length of 1,008 bp, and intron length of 191 bp. From the initial assembled scaffold, transposable elements constituted 54.64% (44.35 Mb) of the genome, and 7737 simple sequence repeats (SSRs) were identified. Among these SSRs, the trinucleotide repeat type was the most abundant (up to 73.20% of total SSRs), followed by the di- (17.41%), tetra- (5.49%), hexa- (2.90%), and penta- (1.00%) nucleotide repeat type. These characteristics suggest that Gp. lemaneiformis is a model organism for genetic study. This is the first report of genome-wide characterization within this taxon.
Sui, Zhenghong; Fu, Feng; Wang, Jinguo; Chang, Lianpeng; Guo, Weihua; Li, Binbin
2013-01-01
Gracilariopsis lemaneiformis has a high economic value and is one of the most important aquaculture species in China. Despite it is economic importance, it has remained largely unstudied at the genomic level. In this study, we conducted a genome survey of Gp. lemaneiformis using next-generation sequencing (NGS) technologies. In total, 18.70 Gb of high-quality sequence data with an estimated genome size of 97 Mb were obtained by HiSeq 2000 sequencing for Gp. lemaneiformis. These reads were assembled into 160,390 contigs with a N50 length of 3.64 kb, which were further assembled into 125,685 scaffolds with a total length of 81.17 Mb. Genome analysis predicted 3490 genes and a GC% content of 48%. The identified genes have an average transcript length of 1,429 bp, an average coding sequence size of 1,369 bp, 1.36 exons per gene, exon length of 1,008 bp, and intron length of 191 bp. From the initial assembled scaffold, transposable elements constituted 54.64% (44.35 Mb) of the genome, and 7737 simple sequence repeats (SSRs) were identified. Among these SSRs, the trinucleotide repeat type was the most abundant (up to 73.20% of total SSRs), followed by the di- (17.41%), tetra- (5.49%), hexa- (2.90%), and penta- (1.00%) nucleotide repeat type. These characteristics suggest that Gp. lemaneiformis is a model organism for genetic study. This is the first report of genome-wide characterization within this taxon. PMID:23875008
Directory of Open Access Journals (Sweden)
Erena A. Edae
2013-07-01
Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.
Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai
2013-08-01
To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.
RePS: a sequence assembler that masks exact repeats identified from the shotgun data
DEFF Research Database (Denmark)
Wang, Jun; Wong, Gane Ka-Shu; Ni, Peixiang
2002-01-01
We describe a sequence assembler, RePS (repeat-masked Phrap with scaffolding), that explicitly identifies exact 20mer repeats from the shotgun data and removes them prior to the assembly. The established software is used to compute meaningful error probabilities for each base. Clone......-end-pairing information is used to construct scaffolds that order and orient the contigs. We show with real data for human and rice that reasonable assemblies are possible even at coverages of only 4x to 6x, despite having up to 42.2% in exact repeats. Udgivelsesdato: 2002-May...
DEFF Research Database (Denmark)
Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.
2013-01-01
Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu...... 425 loci and 376 918 associated SNPs provides a valuable tool for future population genetics and genomics studies and allows for targeting specific genes and particularly interesting regions of the eel genome...
Tools for analyzing genetic variants from sequencing data Case study: short tandem repeats
Gymrek, Melissa
2016-01-01
This was presented as a BitesizeBio Webinar entitled "Tools for analyzing genetic variants from sequencing data Case study: short tandem repeats"Accompanying scripts can be accessed on github:https://github.com/mgymrek/mgymrek-bitesizebio-webinar
Adachi, A; Sakai, K; Kitamura, N; Nakanishi, S; Niwa, O; Matsuyama, M; Ishimoto, A
1984-01-01
The highly oncogenic erythroleukemia-inducing Friend mink cell focus-inducing (MCF) virus was molecularly cloned in phage lambda gtWES.lambda B, and the DNA sequences of the env gene and the long terminal repeat were determined. The nucleotide sequences of Friend MCF virus and Friend spleen focus-forming virus were quite homologous, supporting the hypothesis that Friend spleen focus-forming virus might be generated via Friend MCF virus from an ecotropic Friend virus mainly by some deletions. ...
Two new miniature inverted-repeat transposable elements in the genome of the clam Donax trunculus.
Šatović, Eva; Plohl, Miroslav
2017-10-01
Repetitive sequences are important components of eukaryotic genomes that drive their evolution. Among them are different types of mobile elements that share the ability to spread throughout the genome and form interspersed repeats. To broaden the generally scarce knowledge on bivalves at the genome level, in the clam Donax trunculus we described two new non-autonomous DNA transposons, miniature inverted-repeat transposable elements (MITEs), named DTC M1 and DTC M2. Like other MITEs, they are characterized by their small size, their A + T richness, and the presence of terminal inverted repeats (TIRs). DTC M1 and DTC M2 are 261 and 286 bp long, respectively, and in addition to TIRs, both of them contain a long imperfect palindrome sequence in their central parts. These elements are present in complete and truncated versions within the genome of the clam D. trunculus. The two new MITEs share only structural similarity, but lack any nucleotide sequence similarity to each other. In a search for related elements in databases, blast search revealed within the Crassostrea gigas genome a larger element sharing sequence similarity only to DTC M1 in its TIR sequences. The lack of sequence similarity with any previously published mobile elements indicates that DTC M1 and DTC M2 elements may be unique to D. trunculus.
In silico analysis of Simple Sequence Repeats from chloroplast genomes of Solanaceae species
Directory of Open Access Journals (Sweden)
Evandro Vagner Tambarussi
2009-01-01
Full Text Available The availability of chloroplast genome (cpDNA sequences of Atropa belladonna, Nicotiana sylvestris, N.tabacum, N. tomentosiformis, Solanum bulbocastanum, S. lycopersicum and S. tuberosum, which are Solanaceae species,allowed us to analyze the organization of cpSSRs in their genic and intergenic regions. In general, the number of cpSSRs incpDNA ranged from 161 in S. tuberosum to 226 in N. tabacum, and the number of intergenic cpSSRs was higher than geniccpSSRs. The mononucleotide repeats were the most frequent in studied species, but we also identified di-, tri-, tetra-, pentaandhexanucleotide repeats. Multiple alignments of all cpSSRs sequences from Solanaceae species made the identification ofnucleotide variability possible and the phylogeny was estimated by maximum parsimony. Our study showed that the plastomedatabase can be exploited for phylogenetic analysis and biotechnological approaches.
Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella
Li, Hongshan; Dai, Huaguo; Wei, Hui
2005-01-01
A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627
Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.
2013-01-01
Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619
Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei
2017-07-01
DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.
Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa
Directory of Open Access Journals (Sweden)
Shahin Arwa
2012-11-01
Full Text Available Abstract Background Bulbous flowers such as lily and tulip (Liliaceae family are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Results Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups and among the three monocot species: lily, tulip, and rice (6,900 groups were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Conclusions
Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa.
Shahin, Arwa; van Kaauwen, Martijn; Esselink, Danny; Bargsten, Joachim W; van Tuyl, Jaap M; Visser, Richard G F; Arens, Paul
2012-11-20
Bulbous flowers such as lily and tulip (Liliaceae family) are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags) for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats) showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions) compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP) markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side) were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups) and among the three monocot species: lily, tulip, and rice (6,900 groups) were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Two transcriptome sets were built that are valuable
International Nuclear Information System (INIS)
Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.
1998-01-01
To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)
Hwang, Dae-Sik; Ki, Jang-Seu; Jeong, Dong-Hyuk; Kim, Bo-Hyun; Lee, Bae-Keun; Han, Sang-Hoon; Lee, Jae-Seong
2008-08-01
In the present paper, we describe the mitochondrial genome sequence of the Asiatic black bear (Ursus thibetanus ussuricus) with particular emphasis on the control region (CR), and compared with mitochondrial genomes on molecular relationships among the bears. The mitochondrial genome sequence of U. thibetanus ussuricus was 16,700 bp in size with mostly conserved structures (e.g. 13 protein-coding, two rRNA genes, 22 tRNA genes). The CR consisted of several typical conserved domains such as F, E, D, and C boxes, and a conserved sequence block. Nucleotide sequences and the repeated motifs in the CR were different among the bear species, and their copy numbers were also variable according to populations, even within F1 generations of U. thibetanus ussuricus. Comparative analyses showed that the CR D1 region was highly informative for the discrimination of the bear family. These findings suggest that nucleotide sequences of both repeated motifs and CR D1 in the bear family are good markers for species discriminations.
Tasaki, E; Hirayama, J; Tazumi, A; Hayashi, K; Hara, Y; Ueno, H; Moore, J E; Millar, B C; Matsuda, M
2012-02-01
Novel clustered regularly-interspaced short palindromic repeats (CRISPRs) locus [7,500 base pairs (bp) in length] occurred in the urease-positive thermophilic Campylobacter (UPTC) Japanese isolate, CF89-12. The 7,500 bp gene loci consisted of the 5'-methylaminomethyl-2-thiouridylate methyltransferase gene, putative (P) CRISPR associated (p-Cas), putative open reading frames, Cas1 and Cas2, leader sequence region (146 bp), 12 CRISPRs consensus sequence repeats (each 36 bp) separated by a non-repetitive unique spacer region of similar length (26-31 bp) and the phosphatidyl glycerophosphatase A gene. When the CRISPRs loci in the UPTC CF89-12 and five C. jejuni isolates were compared with one another, these six isolates contained p-Cas, Cas1 and Cas2 within the loci. Four to 12 CRISPRs consensus sequence repeats separated by a non-repetitive unique spacer region occurred in six isolates and the nucleotide sequences of those repeats gave approximately 92-100% similarity with each other. However, no sequence similarity occurred in the unique spacer regions among these isolates. The putative σ(70) transcriptional promoter and the hypothetical ρ-independent terminator structures for the CRISPRs and Cas were detected. No in vivo transcription of p-Cas, Cas1 and Cas2 was confirmed in the UPTC cells.
Main: Nucleotide Analysis [KOME
Lifescience Database Archive (English)
Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...
Alvarez, Rene; Lwamba, Humphrey M.; Kapczynski, Darrell R.; Njenga, M. Kariuki; Seal, Bruce S.
2003-01-01
A serologically distinct avian metapneumovirus (aMPV) was isolated in the United States after an outbreak of turkey rhinotracheitis (TRT) in February 1997. The newly recognized U.S. virus was subsequently demonstrated to be genetically distinct from European subtypes and was designated aMPV serotype C (aMPV/C). We have determined the nucleotide sequence of the gene encoding the cell attachment glycoprotein (G) of aMPV/C (Colorado strain and three Minnesota isolates) and predicted amino acid sequence by sequencing cloned cDNAs synthesized from intracellular RNA of aMPV/C-infected cells. The nucleotide sequence comprised 1,321 nucleotides with only one predicted open reading frame encoding a protein of 435 amino acids, with a predicted Mr of 48,840. The structural characteristics of the predicted G protein of aMPV/C were similar to those of the human respiratory syncytial virus (hRSV) attachment G protein, including two mucin-like regions (heparin-binding domains) flanking both sides of a CX3C chemokine motif present in a conserved hydrophobic pocket. Comparison of the deduced G-protein amino acid sequence of aMPV/C with those of aMPV serotypes A, B, and D, as well as hRSV revealed overall predicted amino acid sequence identities ranging from 4 to 16.5%, suggesting a distant relationship. However, G-protein sequence identities ranged from 72 to 97% when aMPV/C was compared to other members within the aMPV/C subtype or 21% for the recently identified human MPV (hMPV) G protein. Ratios of nonsynonymous to synonymous nucleotide changes were greater than one in the G gene when comparing the more recent Minnesota isolates to the original Colorado isolate. Epidemiologically, this indicates positive selection among U.S. isolates since the first outbreak of TRT in the United States. PMID:12682171
Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang
2009-01-01
The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.
Characteristics of palindromic sequences in DNA of the sea urchin Stronglyocentrotus intermedius
International Nuclear Information System (INIS)
Brykov, V.A.; Kukhlevskii, A.D.
1986-01-01
The fraction of palindromic sequences in the nuclear DNA of the sea urchin S. intermedius was characterized. Using chromatography on hydroxyapatite and treatment with S1 nuclease, it was shown that the fraction of palindromic sequences more than doubles when the sodium concentration in solution is increased or the temperature of reassociation is lowered. The increase is due to the involvement of inverted repeats in reassociation, which are characterized by a substantial nonhomologous character and/or the presence of an extended intervening DNA sequence. It was found by the method of reassociation of a nicked palindrome fraction with an excess of total homologous DNA that most of the inverted repeats in the sea urchin genome are unique sequences. The complexity of the palindrome fraction was estimated at 8.2 x 10 7 nucleotide pairs, and the number of palindromes per haploid genome ∼ 500,000
Background: Due to a relatively high level of codominant inheritance and transferability within and among taxonomic groups, simple sequence repeat (SSR) markers are important elements in comparative mapping and delineation of genomic regions associated with traits of economic importance. Expressed S...
Directory of Open Access Journals (Sweden)
Stougaard Magnus
2007-11-01
Full Text Available Abstract Background In situ detection of short sequence elements in genomic DNA requires short probes with high molecular resolution and powerful specific signal amplification. Padlock probes can differentiate single base variations. Ligated padlock probes can be amplified in situ by rolling circle DNA synthesis and detected by fluorescence microscopy, thus enhancing PRINS type reactions, where localized DNA synthesis reports on the position of hybridization targets, to potentially reveal the binding of single oligonucleotide-size probe molecules. Such a system has been presented for the detection of mitochondrial DNA in fixed cells, whereas attempts to apply rolling circle detection to metaphase chromosomes have previously failed, according to the literature. Methods Synchronized cultured cells were fixed with methanol/acetic acid to prepare chromosome spreads in teflon-coated diagnostic well-slides. Apart from the slide format and the chromosome spreading everything was done essentially according to standard protocols. Hybridization targets were detected in situ with padlock probes, which were ligated and amplified using target primed rolling circle DNA synthesis, and detected by fluorescence labeling. Results An optimized protocol for the spreading of condensed metaphase chromosomes in teflon-coated diagnostic well-slides was developed. Applying this protocol we generated specimens for target primed rolling circle DNA synthesis of padlock probes recognizing a 40 nucleotide sequence in the male specific repetitive satellite I sequence (DYZ1 on the Y-chromosome and a 32 nucleotide sequence in the repetitive kringle IV domain in the apolipoprotein(a gene positioned on the long arm of chromosome 6. These targets were detected with good efficiency, but the efficiency on other target sites was unsatisfactory. Conclusion Our aim was to test the applicability of the method used on mitochondrial DNA to the analysis of nuclear genomes, in particular as
Robart, Aaron R; O'Connor, Catherine M; Collins, Kathleen
2010-03-01
Telomerase adds simple-sequence repeats to chromosome 3' ends to compensate for the loss of repeats with each round of genome replication. To accomplish this de novo DNA synthesis, telomerase uses a template within its integral RNA component. In addition to providing the template, the telomerase RNA subunit (TER) also harbors nontemplate motifs that contribute to the specialized telomerase catalytic cycle of reiterative repeat synthesis. Most nontemplate TER motifs function through linkage with the template, but in ciliate and vertebrate telomerases, a stem-loop motif binds telomerase reverse transcriptase (TERT) and reconstitutes full activity of the minimal recombinant TERT+TER RNP, even when physically separated from the template. Here, we resolve the functional requirements for this motif of ciliate TER in physiological RNP context using the Tetrahymena thermophila p65-TER-TERT core RNP reconstituted in vitro and the holoenzyme reconstituted in vivo. Contrary to expectation based on assays of the minimal recombinant RNP, we find that none of a panel of individual loop IV nucleotide substitutions impacts the profile of telomerase product synthesis when reconstituted as physiological core RNP or holoenzyme RNP. However, loop IV nucleotide substitutions do variably reduce assembly of TERT with the p65-TER complex in vitro and reduce the accumulation and stability of telomerase RNP in endogenous holoenzyme context. Our results point to a unifying model of a conformational activation role for this TER motif in the telomerase RNP enzyme.
The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition
Štambuk, Nikola
The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.
Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.
Wolf, P
1997-10-01
Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.
Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P
2010-09-01
The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Fukumori, F; Sashihara, N; Kudo, T; Horikoshi, K
1986-01-01
Two genes for cellulases of alkalophilic Bacillus sp. strain N-4 (ATCC 21833) have been sequenced. From the DNA sequences the cellulases encoded in the plasmids pNK1 and pNK2 consist of 488 and 409 amino acids, respectively. The DNA and protein sequences of the pNK1-encoded cellulase are related to those of the pNK2-encoded cellulase. The pNK2-encoded cellulase lacks the direct repeat sequence of a stretch of 60 amino acids near the C-terminal end of the pNK1-encoded cellulase. The duplicatio...
The sequence and de novo assembly of the giant panda genome
Li, Ruiqiang; Fan, Wei; Tian, Geng; Zhu, Hongmei; He, Lin; Cai, Jing; Huang, Quanfei; Cai, Qingle; Li, Bo; Bai, Yinqi; Zhang, Zhihe; Zhang, Yaping; Wang, Wen; Li, Jun; Wei, Fuwen; Li, Heng; Jian, Min; Li, Jianwen; Zhang, Zhaolei; Nielsen, Rasmus; Li, Dawei; Gu, Wanjun; Yang, Zhentao; Xuan, Zhaoling; Ryder, Oliver A.; Leung, Frederick Chi-Ching; Zhou, Yan; Cao, Jianjun; Sun, Xiao; Fu, Yonggui; Fang, Xiaodong; Guo, Xiaosen; Wang, Bo; Hou, Rong; Shen, Fujun; Mu, Bo; Ni, Peixiang; Lin, Runmao; Qian, Wubin; Wang, Guodong; Yu, Chang; Nie, Wenhui; Wang, Jinhuan; Wu, Zhigang; Liang, Huiqing; Min, Jiumeng; Wu, Qi; Cheng, Shifeng; Ruan, Jue; Wang, Mingwei; Shi, Zhongbin; Wen, Ming; Liu, Binghang; Ren, Xiaoli; Zheng, Huisong; Dong, Dong; Cook, Kathleen; Shan, Gao; Zhang, Hao; Kosiol, Carolin; Xie, Xueying; Lu, Zuhong; Zheng, Hancheng; Li, Yingrui; Steiner, Cynthia C.; Lam, Tommy Tsan-Yuk; Lin, Siyuan; Zhang, Qinghui; Li, Guoqing; Tian, Jing; Gong, Timing; Liu, Hongde; Zhang, Dejin; Fang, Lin; Ye, Chen; Zhang, Juanbin; Hu, Wenbo; Xu, Anlong; Ren, Yuanyuan; Zhang, Guojie; Bruford, Michael W.; Li, Qibin; Ma, Lijia; Guo, Yiran; An, Na; Hu, Yujie; Zheng, Yang; Shi, Yongyong; Li, Zhiqiang; Liu, Qing; Chen, Yanling; Zhao, Jing; Qu, Ning; Zhao, Shancen; Tian, Feng; Wang, Xiaoling; Wang, Haiyin; Xu, Lizhi; Liu, Xiao; Vinar, Tomas; Wang, Yajun; Lam, Tak-Wah; Yiu, Siu-Ming; Liu, Shiping; Zhang, Hemin; Li, Desheng; Huang, Yan; Wang, Xia; Yang, Guohua; Jiang, Zhi; Wang, Junyi; Qin, Nan; Li, Li; Li, Jingxiang; Bolund, Lars; Kristiansen, Karsten; Wong, Gane Ka-Shu; Olson, Maynard; Zhang, Xiuqing; Li, Songgang; Yang, Huanming; Wang, Jian; Wang, Jun
2013-01-01
Using next-generation sequencing technology alone, we have successfully generated and assembled a draft sequence of the giant panda genome. The assembled contigs (2.25 gigabases (Gb)) cover approximately 94% of the whole genome, and the remaining gaps (0.05 Gb) seem to contain carnivore-specific repeats and tandem repeats. Comparisons with the dog and human showed that the panda genome has a lower divergence rate. The assessment of panda genes potentially underlying some of its unique traits indicated that its bamboo diet might be more dependent on its gut microbiome than its own genetic composition. We also identified more than 2.7 million heterozygous single nucleotide polymorphisms in the diploid genome. Our data and analyses provide a foundation for promoting mammalian genetic research, and demonstrate the feasibility for using next-generation sequencing technologies for accurate, cost-effective and rapid de novo assembly of large eukaryotic genomes. PMID:20010809
I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)
1993-01-01
textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the
Nucleotide sequence of the 3' ends of the double-stranded RNAs of grapevine chrome mosaic nepovirus.
Le Gall, O; Candresse, T; Dunez, J
1988-02-01
Attempts were made to label the termini of dsRNAs corresponding to the two genomic RNAs of grapevine chrome mosaic nepovirus (GCMV). It was not possible to label the 5' ends of the dsRNAs with [gamma-32P]ATP, which suggests that a genome-linked protein blocks their 5' ends. Both dsRNA species were labelled at their 3' ends with pCp. The 3'-terminal sequences were determined by 'wandering spot' or by partial enzymic cleavage analysis. One strand (presumably positive) ended in a poly(A) 30 to 50 nucleotides long whereas the other (presumably negative) ended in 3'-ACCUUUUAAAAAG (RNA1) or 3'-ACCUUUUAAUAAAG (RNA2). The sequences resemble closely those complementary to the 5' ends of the RNAs of tomato black ring virus (strain S), which is distantly related to GCMV.
Directory of Open Access Journals (Sweden)
Jacqueline Morris
2017-12-01
Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation
Raynard, Steven J; Baker, Mark D
2004-01-01
In mammalian cells, little is known about the nature of recombination-prone regions of the genome. Previously, we reported that the immunoglobulin heavy chain (IgH) mu locus behaved as a hotspot for mitotic, intrachromosomal gene conversion (GC) between repeated mu constant (Cmu) regions in mouse hybridoma cells. To investigate whether elements within the mu gene regulatory region were required for hotspot activity, gene targeting was used to delete a 9.1 kb segment encompassing the mu gene promoter (Pmu), enhancer (Emu) and switch region (Smu) from the locus. In these cell lines, GC between the Cmu repeats was significantly reduced, indicating that this 'recombination-enhancing sequence' (RES) is necessary for GC hotspot activity at the IgH locus. Importantly, the RES fragment stimulated GC when appended to the same Cmu repeats integrated at ectopic genomic sites. We also show that deletion of Emu and flanking matrix attachment regions (MARs) from the RES abolishes GC hotspot activity at the IgH locus. However, no stimulation of ectopic GC was observed with the Emu/MARs fragment alone. Finally, we provide evidence that no correlation exists between the level of transcription and GC promoted by the RES. We suggest a model whereby Emu/MARS enhances mitotic GC at the endogenous IgH mu locus by effecting chromatin modifications in adjacent DNA.
C-terminal low-complexity sequence repeats of Mycobacterium smegmatis Ku modulate DNA binding.
Kushwaha, Ambuj K; Grove, Anne
2013-01-24
Ku protein is an integral component of the NHEJ (non-homologous end-joining) pathway of DSB (double-strand break) repair. Both eukaryotic and prokaryotic Ku homologues have been characterized and shown to bind DNA ends. A unique feature of Mycobacterium smegmatis Ku is its basic C-terminal tail that contains several lysine-rich low-complexity PAKKA repeats that are absent from homologues encoded by obligate parasitic mycobacteria. Such PAKKA repeats are also characteristic of mycobacterial Hlp (histone-like protein) for which they have been shown to confer the ability to appose DNA ends. Unexpectedly, removal of the lysine-rich extension enhances DNA-binding affinity, but an interaction between DNA and the PAKKA repeats is indicated by the observation that only full-length Ku forms multiple complexes with a short stem-loop-containing DNA previously designed to accommodate only one Ku dimer. The C-terminal extension promotes DNA end-joining by T4 DNA ligase, suggesting that the PAKKA repeats also contribute to efficient end-joining. We suggest that low-complexity lysine-rich sequences have evolved repeatedly to modulate the function of unrelated DNA-binding proteins.
Directory of Open Access Journals (Sweden)
Geovani T. Ragagnin
2016-03-01
Full Text Available Abstract Transposable elements (TEs are nucleotide sequences found in most studied genomes. These elements are highly diversified and have a large variation in nucleotide structure and mechanisms of transposition. hobo is a member of class II, belonging to hAT superfamily, described inDrosophila melanogaster, and it presents in its Open Reading Frame, a repetitive region encoding the amino acids threonine-proline-glutamic acid (TPE, which shows variability in the number of repeats in some regions of the world. Due to this variability some evolutionary scenarios of the hobo element are discussed, such as the scenario of the invasion of hobo element in populations ofD. melanogaster. In the present study, we investigated 22 DNA sequences of D. melanogaster and seven sequences ofD. simulans, both from South America, to check the number of repetitions of TPE, in order to clarify the evolutionary scenario of thehobo element in these populations. Our results showed a monomorphism in populations of both species in South America, with only three TPE repeats. Hence, we discuss and propose an evolutionary scenario of the invasion of the hobo element in populations of D. melanogaster and D. simulans.
Energy Technology Data Exchange (ETDEWEB)
Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))
1988-07-25
The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.
Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred
2014-09-01
Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.
Mixed Sequence Reader: A Program for Analyzing DNA Sequences with Heterozygous Base Calling
Chang, Chun-Tien; Tsai, Chi-Neu; Tang, Chuan Yi; Chen, Chun-Houh; Lian, Jang-Hau; Hu, Chi-Yu; Tsai, Chia-Lung; Chao, Angel; Lai, Chyong-Huey; Wang, Tzu-Hao; Lee, Yun-Shien
2012-01-01
The direct sequencing of PCR products generates heterozygous base-calling fluorescence chromatograms that are useful for identifying single-nucleotide polymorphisms (SNPs), insertion-deletions (indels), short tandem repeats (STRs), and paralogous genes. Indels and STRs can be easily detected using the currently available Indelligent or ShiftDetector programs, which do not search reference sequences. However, the detection of other genomic variants remains a challenge due to the lack of appropriate tools for heterozygous base-calling fluorescence chromatogram data analysis. In this study, we developed a free web-based program, Mixed Sequence Reader (MSR), which can directly analyze heterozygous base-calling fluorescence chromatogram data in .abi file format using comparisons with reference sequences. The heterozygous sequences are identified as two distinct sequences and aligned with reference sequences. Our results showed that MSR may be used to (i) physically locate indel and STR sequences and determine STR copy number by searching NCBI reference sequences; (ii) predict combinations of microsatellite patterns using the Federal Bureau of Investigation Combined DNA Index System (CODIS); (iii) determine human papilloma virus (HPV) genotypes by searching current viral databases in cases of double infections; (iv) estimate the copy number of paralogous genes, such as β-defensin 4 (DEFB4) and its paralog HSPDP3. PMID:22778697
de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E
2015-01-01
The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Noninvasive prenatal paternity testing (NIPAT) through maternal plasma DNA sequencing
DEFF Research Database (Denmark)
Jiang, Haojun; Xie, Yifan; Li, Xuchao
2016-01-01
developed a noninvasive prenatal paternity testing (NIPAT) based on SNP typing with maternal plasma DNA sequencing. We evaluated the influence factors (minor allele frequency (MAF), the number of total SNP, fetal fraction and effective sequencing depth) and designed three different selective SNP panels......Short tandem repeats (STRs) and single nucleotide polymorphisms (SNPs) have been already used to perform noninvasive prenatal paternity testing from maternal plasma DNA. The frequently used technologies were PCR followed by capillary electrophoresis and SNP typing array, respectively. Here, we...... paternity test using STR multiplex system. Our study here proved that the maternal plasma DNA sequencing-based technology is feasible and accurate in determining paternity, which may provide an alternative in forensic application in the future....
Fawzy, Ahmad; Zschöck, Michael; Ewers, Christa; Eisenberg, Tobias
2016-06-01
Variable number tandem repeat (VNTR) is a frequently employed typing method of Mycobacterium avium paratuberculosis (MAP) isolates. Based on whole genome sequencing in a previous study, allelic diversity at some VNTR loci seems to over- or under-estimate the actual phylogenetic variance among isolates. Interestingly, two closely related isolates on one farm showed polymorphism at the VNTR 7 locus, raising concerns about the misleading role that it might play in genotyping. We aimed to investigate the underlying basis of VNTR 7-polymorphism by analyzing sequence data for published genomes and field isolates of MAP and other M. avium complex (MAC) members. In contrast to MAP strains from cattle, strains from sheep displayed an "imperfect" repeat within VNTR 7, which was identical to respective allele types in other MAC genomes. Subspecies- and strain-specific single nucleotide polymorphisms (SNPs) and two novel (16 and 56 bp) repeats were detected. Given the combination of the three existing repeats, there are at least five different patterns for VNTR 7. The present findings highlight a higher polymorphism and probable instability of VNTR 7 locus that needs to be considered and challenged in future studies. Until then, sequencing of this locus in future studies is important to correctly assign the underlying allele types.(1). Copyright © 2016 Elsevier Ltd. All rights reserved.
Spielmann, A; Stutz, E
1983-10-25
The soybean chloroplast psb A gene (photosystem II thylakoid membrane protein of Mr 32 000, lysine-free) and the trn H gene (tRNAHisGUG), which both map in the large single copy region adjacent to one of the inverted repeat structures (IR1), have been sequenced including flanking regions. The psb A gene shows in its structural part 92% sequence homology with the corresponding genes of spinach and N. debneyi and contains also an open reading frame for 353 aminoacids. The aminoacid sequence of a potential primary translation product (calculated Mr, 38 904, no lysine) diverges from that of spinach and N. debneyi in only two positions in the C-terminal part. The trn H gene has the same polarity as the psb A gene and the coding region is located at the very end of the large single copy region. The deduced sequence of the soybean chloroplast tRNAHisGUG is identical with that of Zea mays chloroplasts. Both ends of the large single copy region were sequenced including a small segment of the adjacent IR1 and IR2.
Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui
2015-01-01
Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739
Chen, Honglin; Wang, Lixia; Wang, Suhua; Liu, Chunji; Blair, Matthew Wohlgemuth; Cheng, Xuzhen
2015-01-01
Mung bean (Vigna radiate (L.) Wilczek) is an important traditional food legume crop, with high economic and nutritional value. It is widely grown in China and other Asian countries. Despite its importance, genomic information is currently unavailable for this crop plant species or some of its close relatives in the Vigna genus. In this study, more than 103 million high quality cDNA sequence reads were obtained from mung bean using Illumina paired-end sequencing technology. The processed reads were assembled into 48,693 unigenes with an average length of 874 bp. Of these unigenes, 25,820 (53.0%) and 23,235 (47.7%) showed significant similarity to proteins in the NCBI non-redundant protein and nucleotide sequence databases, respectively. Furthermore, 19,242 (39.5%) could be classified into gene ontology categories, 18,316 (37.6%) into Swiss-Prot categories and 10,918 (22.4%) into KOG database categories (E-value SSR), and 2,303 sequences contained more than one SSR together in the same expressed sequence tag (EST). A total of 13,134 EST-SSRs were identified as potential molecular markers, with mono-nucleotide A/T repeats being the most abundant motif class and G/C repeats being rare. In this SSR analysis, we found five main repeat motifs: AG/CT (30.8%), GAA/TTC (12.6%), AAAT/ATTT (6.8%), AAAAT/ATTTT (6.2%) and AAAAAT/ATTTTT (1.9%). A total of 200 SSR loci were randomly selected for validation by PCR amplification as EST-SSR markers. Of these, 66 marker primer pairs produced reproducible amplicons that were polymorphic among 31 mung bean accessions selected from diverse geographical locations. The large number of SSR-containing sequences found in this study will be valuable for the construction of a high-resolution genetic linkage maps, association or comparative mapping and genetic analyses of various Vigna species.
Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M
2016-01-01
Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.
Functional Interaction of the Adenovirus IVa2 Protein with Adenovirus Type 5 Packaging Sequences
Ostapchuk, Philomena; Yang, Jihong; Auffarth, Ece; Hearing, Patrick
2005-01-01
Adenovirus type 5 (Ad5) DNA packaging is initiated in a polar fashion from the left end of the genome. The packaging process is dependent on the cis-acting packaging domain located between nucleotides 230 and 380. Seven AT-rich repeats that direct packaging have been identified within this domain. A1, A2, A5, and A6 are the most important repeats functionally and share a bipartite sequence motif. Several lines of evidence suggest that there is a limiting trans-acting factor(s) that plays a ro...
International Nuclear Information System (INIS)
Schott, G.
1989-01-01
It is well-known that collective form, stress intensity and loading sequence of individual stresses as well as size of repeated stress blocks can influence fatigue life, significantly. The basic variant of the consecutive Woehler curve concept will permit these effects to be involved into fatigue life computation. The paper presented will demonstrate that fatigue life computations using fatigue functions reflect the loading sequence effect with multilevel loading precisely and provide reliable fatigue life data. Effects of size of repeated stress block and loading sequence on fatigue life as observed with block program tests can be reproduced using the new computation method. (orig.) [de
Glynn, Neil C; Comstock, Jack C; Sood, Sushma G; Dang, Phat M; Chaparro, Jose X
2008-01-01
Resistance gene analogues (RGAs) have been isolated from many crops and offer potential in breeding for disease resistance through marker-assisted selection, either as closely linked or as perfect markers. Many R-gene sequences contain kinase domains, and indeed kinase genes have been reported as being proximal to R-genes, making kinase analogues an additionally promising target. The first step towards utilizing RGAs as markers for disease resistance is isolation and characterization of the sequences. Sugarcane clone US01-1158 was identified as resistant to yellow leaf caused by the sugarcane yellow leaf virus (SCYLV) and moderately resistant to rust caused by Puccinia melanocephala Sydow & Sydow. Degenerate primers that had previously proved useful for isolating RGAs and kinase analogues in wheat and soybean were used to amplify DNA from sugarcane (Saccharum spp.) clone US-01-1158. Sequences generated from 1512 positive clones were assembled into 134 contigs of between two and 105 sequences. Comparison of the contig consensuses with the NCBI sequence database using BLASTx showed that 20 had sequence homology to nuclear binding site and leucine rich repeat (NBS-LRR) RGAs, and eight to kinase genes. Alignment of the deduced amino acid sequences with similar sequences from the NCBI database allowed the identification of several conserved domains. The alignment and resulting phenetic tree showed that many of the sequences had greater similarity to sequences from other species than to one another. The use of degenerate primers is a useful method for isolating novel sugarcane RGA and kinase gene analogues. Further studies are needed to evaluate the role of these genes in disease resistance.
Identification of apple cultivars on the basis of simple sequence repeat markers.
Liu, G S; Zhang, Y G; Tao, R; Fang, J G; Dai, H Y
2014-09-12
DNA markers are useful tools that play an important role in plant cultivar identification. They are usually based on polymerase chain reaction (PCR) and include simple sequence repeats (SSRs), inter-simple sequence repeats, and random amplified polymorphic DNA. However, DNA markers were not used effectively in the complete identification of plant cultivars because of the lack of known DNA fingerprints. Recently, a novel approach called the cultivar identification diagram (CID) strategy was developed to facilitate the use of DNA markers for separate plant individuals. The CID was designed whereby a polymorphic maker was generated from each PCR that directly allowed for cultivar sample separation at each step. Therefore, it could be used to identify cultivars and varieties easily with fewer primers. In this study, 60 apple cultivars, including a few main cultivars in fields and varieties from descendants (Fuji x Telamon) were examined. Of the 20 pairs of SSR primers screened, 8 pairs gave reproducible, polymorphic DNA amplification patterns. The banding patterns obtained from these 8 primers were used to construct a CID map. Each cultivar or variety in this study was distinguished from the others completely, indicating that this method can be used for efficient cultivar identification. The result contributed to studies on germplasm resources and the seedling industry in fruit trees.
Directory of Open Access Journals (Sweden)
Xu Xiangming
2010-12-01
Full Text Available Abstract Background Determining the position and order of contigs and scaffolds from a genome assembly within an organism's genome remains a technical challenge in a majority of sequencing projects. In order to exploit contemporary technologies for DNA sequencing, we developed a strategy for whole genome single nucleotide polymorphism sequencing allowing the positioning of sequence contigs onto a linkage map using the bin mapping method. Results The strategy was tested on a draft genome of the fungal pathogen Venturia inaequalis, the causal agent of apple scab, and further validated using sequence contigs derived from the diploid plant genome Fragaria vesca. Using our novel method we were able to anchor 70% and 92% of sequences assemblies for V. inaequalis and F. vesca, respectively, to genetic linkage maps. Conclusions We demonstrated the utility of this approach by accurately determining the bin map positions of the majority of the large sequence contigs from each genome sequence and validated our method by mapping single sequence repeat markers derived from sequence contigs on a full mapping population.
Condensing the information in DNA with double-headed nucleotides
DEFF Research Database (Denmark)
Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte
2017-01-01
A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...
Yan, L.; Xu, Z.; Goldbach, R.W.; Chen, Y.K.; Prins, M.W.
2005-01-01
The complete nucleotide sequence of Peanut stunt virus strain Mi (PSV-Mi) from China was determined and compared to other viruses of the genus Cucumovirus. The tripartite genome of PSV-Mi encoded five open reading frames (ORFs) typical of cucumoviruses. Distance analyses of four ORFs indicated that
Kuno, Sotaro; Yoshida, Takashi; Kaneko, Takakazu; Sako, Yoshihiko
2012-08-01
Clustered regularly interspaced short palindromic repeats (CRISPR) confer sequence-dependent, adaptive resistance in prokaryotes against viruses and plasmids via incorporation of short sequences, called spacers, derived from foreign genetic elements. CRISPR loci are thus considered to provide records of past infections. To describe the host-parasite (i.e., cyanophages and plasmids) interactions involving the bloom-forming freshwater cyanobacterium Microcystis aeruginosa, we investigated CRISPR in four M. aeruginosa strains and in two previously sequenced genomes. The number of spacers in each locus was larger than the average among prokaryotes. All spacers were strain specific, except for a string of 11 spacers shared in two closely related strains, suggesting diversification of the loci. Using CRISPR repeat-based PCR, 24 CRISPR genotypes were identified in a natural cyanobacterial community. Among 995 unique spacers obtained, only 10 sequences showed similarity to M. aeruginosa phage Ma-LMM01. Of these, six spacers showed only silent or conservative nucleotide mutations compared to Ma-LMM01 sequences, suggesting a strategy by the cyanophage to avert CRISPR immunity dependent on nucleotide identity. These results imply that host-phage interactions can be divided into M. aeruginosa-cyanophage combinations rather than pandemics of population-wide infectious cyanophages. Spacer similarity also showed frequent exposure of M. aeruginosa to small cryptic plasmids that were observed only in a few strains. Thus, the diversification of CRISPR implies that M. aeruginosa has been challenged by diverse communities (almost entirely uncharacterized) of cyanophages and plasmids.
Directory of Open Access Journals (Sweden)
Sebastian Pita
Full Text Available The subfamily Triatominae, vectors of Chagas disease, comprises 140 species characterized by a highly homogeneous chromosome number. We analyzed the chromosomal distribution and evolution of repeated sequences in Triatominae genomes by Genomic in situ Hybridization using Triatoma delpontei and Triatoma infestans genomic DNAs as probes. Hybridizations were performed on their own chromosomes and on nine species included in six genera from the two main tribes: Triatomini and Rhodniini. Genomic probes clearly generate two different hybridization patterns, dispersed or accumulated in specific regions or chromosomes. The three used probes generate the same hybridization pattern in each species. However, these patterns are species-specific. In closely related species, the probes strongly hybridized in the autosomal heterochromatic regions, resembling C-banding and DAPI patterns. However, in more distant species these co-localizations are not observed. The heterochromatic Y chromosome is constituted by highly repeated sequences, which is conserved among 10 species of Triatomini tribe suggesting be an ancestral character for this group. However, the Y chromosome in Rhodniini tribe is markedly different, supporting the early evolutionary dichotomy between both tribes. In some species, sex chromosomes and autosomes shared repeated sequences, suggesting meiotic chromatin exchanges among these heterologous chromosomes. Our GISH analyses enabled us to acquire not only reliable information about autosomal repeated sequences distribution but also an insight into sex chromosome evolution in Triatominae. Furthermore, the differentiation obtained by GISH might be a valuable marker to establish phylogenetic relationships and to test the controversial origin of the Triatominae subfamily.
Short sequence motifs, overrepresented in mammalian conservednon-coding sequences
Energy Technology Data Exchange (ETDEWEB)
Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna
2007-02-21
Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by
Energy Technology Data Exchange (ETDEWEB)
Hatch, C L; Bonner, W M
1988-02-11
The nucleotide sequences of cDNAs for the evolutionarily diverged but highly conserved basal H2A isoprotein, H2A.Z, have been determined for the rat, cow, and human. As a basal histone, H2A.Z is synthesized throughout the cell cycle at a constant rate, unlinked to DNA replication, and at a much lower rate in quiescent cells. Each of the cDNA isolates encodes the entire H2A.Z polypeptide. The human isolate is about 1.0 kilobases long. It contains a coding region of 387 nucleotides flanked by 106 nucleotides of 5'UTR and 376 nucleotides of 3'UTR, which contains a polyadenylation signal followed by a poly A tail. The bovine and rat cDNAs have 97 and 94% nucleotide positional identity to the human cDNA in the coding region and 98% in the proximal 376 nucleotides of the 3'UTR which includes the polyadenylation signal. A potential stem-forming sequence imbedded in a direct repeat is found centered at 261 nucleotides into the 3'UTR. Each of the cDNA clones could be transcribed and translated in vitro to yield H2A.Z protein. The mammalian H2A.Z cDNA coding sequences are approximately 80% similar to those in chicken and 75% to those in sea urchin.
DEFF Research Database (Denmark)
Nordin, Angelica; Akimoto, Chizuru; Wuolikainen, Anna
2017-01-01
A large GGGGCC-repeat expansion mutation (HREM) in C9orf72 is the most common known cause of ALS and FTD in European populations. Sequence variations immediately downstream of the HREM region have previously been observed and have been suggested to be one reason for difficulties in interpreting R...
The arabidopsis cyclic nucleotide interactome
Donaldson, Lara Elizabeth
2016-05-11
Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.
DEFF Research Database (Denmark)
Defoor, Els Marie Celine; Martinussen, Jan
A new lactococcal plasmid, pDBORO, was isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410 responsible for the sensitivity of DB0410 towards the pyrimidine-analog 5´-fluoroorotate. The plasmid pDBORO amounts to 16404 bp and its complete nucleotide sequence has been...
JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.
Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun
2017-01-01
Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.
JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures
Dong, Min; Graham, Mitchell; Yadav, Nehul
2017-01-01
Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416
JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.
Directory of Open Access Journals (Sweden)
Jieming Shi
Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.
Length and repeat-sequence variation in 58 STRs and 94 SNPs in two Spanish populations.
Casals, Ferran; Anglada, Roger; Bonet, Núria; Rasal, Raquel; van der Gaag, Kristiaan J; Hoogenboom, Jerry; Solé-Morata, Neus; Comas, David; Calafell, Francesc
2017-09-01
We have genotyped the 58 STRs (27 autosomal, 24 Y-STRs and 7 X-STRs) and 94 autosomal SNPs in Illumina ForenSeq™ Primer Mix A in 88 Spanish Roma (Gypsy) samples and 143 Catalans. Since this platform is based in massive parallel sequencing, we have used simple R scripts to uncover the sequence variation in the repeat region. Thus, we have found, across 58 STRs, 541 length-based alleles, which, after considering repeat-sequence variation, became 804 different alleles. All loci in both populations were in Hardy-Weinberg equilibrium. F ST between both populations was 0.0178 for autosomal SNPs, 0.0146 for autosomal STRs, 0.0101 for X-STRs and 0.1866 for Y-STRs. Combined a priori statistics showed quite large; for instance, pooling all the autosomal loci, the a priori probabilities of discriminating a suspect become 1-(2.3×10 -70 ) and 1-(5.9×10 -73 ), for Roma and Catalans respectively, and the chances of excluding a false father in a trio are 1-(2.6×10 -20 ) and 1-(2.0×10 -21 ). Copyright © 2017 Elsevier B.V. All rights reserved.
Amirhaeri, S; Wohlrab, F; Wells, R D
1995-02-17
The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.
Sánchez-Navarro, J A; Pallás, V
1997-01-01
The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.
Bartels, Mette Damkjær; Petersen, Andreas; Worning, Peder; Nielsen, Jesper Boye; Larner-Svensson, Hanna; Johansen, Helle Krogh; Andersen, Leif Percival; Jarløv, Jens Otto; Boye, Kit; Larsen, Anders Rhod; Westh, Henrik
2014-12-01
spa typing of methicillin-resistant Staphylococcus aureus (MRSA) has traditionally been done by PCR amplification and Sanger sequencing of the spa repeat region. At Hvidovre Hospital, Denmark, whole-genome sequencing (WGS) of all MRSA isolates has been performed routinely since January 2013, and an in-house analysis pipeline determines the spa types. Due to national surveillance, all MRSA isolates are sent to Statens Serum Institut, where the spa type is determined by PCR and Sanger sequencing. The purpose of this study was to evaluate the reliability of the spa types obtained by 150-bp paired-end Illumina WGS. MRSA isolates from new MRSA patients in 2013 (n = 699) in the capital region of Denmark were included. We found a 97% agreement between spa types obtained by the two methods. All isolates achieved a spa type by both methods. Nineteen isolates differed in spa types by the two methods, in most cases due to the lack of 24-bp repeats in the whole-genome-sequenced isolates. These related but incorrect spa types should have no consequence in outbreak investigations, since all epidemiologically linked isolates, regardless of spa type, will be included in the single nucleotide polymorphism (SNP) analysis. This will reveal the close relatedness of the spa types. In conclusion, our data show that WGS is a reliable method to determine the spa type of MRSA. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...
African Journals Online (AJOL)
Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.
Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R
2012-10-01
To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.
Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou
2014-11-01
In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.
Quantum-Sequencing: Fast electronic single DNA molecule sequencing
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.
Burns, John A; Chowdhury, Moinuddin A; Cartularo, Laura; Berens, Christian; Scicchitano, David A
2018-01-01
Abstract Simple sequence repeats (SSRs) are found throughout the genome, and under some conditions can change in length over time. Germline and somatic expansions of trinucleotide repeats are associated with a series of severely disabling illnesses, including Huntington's disease. The underlying mechanisms that effect SSR expansions and contractions have been experimentally elusive, but models suggesting a role for DNA repair have been proposed, in particular the involvement of transcription-coupled nucleotide excision repair (TCNER) that removes transcription-blocking DNA damage from the transcribed strand of actively expressed genes. If the formation of secondary DNA structures that are associated with SSRs were to block RNA polymerase progression, TCNER could be activated, resulting in the removal of the aberrant structure and a concomitant change in the region's length. To test this, TCNER activity in primary human fibroblasts was assessed on defined DNA substrates containing extrahelical DNA loops that lack discernible internal base pairs or DNA stem–loops that contain base pairs within the stem. The results show that both structures impede transcription elongation, but there is no corresponding evidence that nucleotide excision repair (NER) or TCNER operates to remove them. PMID:29474673
Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia
2011-05-17
Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.
Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa
2013-06-01
Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and
International Nuclear Information System (INIS)
O'Hara, P.J.; Grant, F.J.; Haldeman, B.A.; Gray, C.L.; Insley, M.Y.; Hagen, F.S.; Murray, M.J.
1987-01-01
Activated factor VII (factor VIIa) is a vitamin K-dependent plasma serine protease that participates in a cascade of reactions leading to the coagulation of blood. Two overlapping genomic clones containing sequences encoding human factor VII were isolated and characterized. The complete sequence of the gene was determined and found to span about 12.8 kilobases. The mRNA for factor VII as demonstrated by cDNA cloning is polyadenylylated at multiple sites but contains only one AAUAAA poly(A) signal sequence. The mRNA can undergo alternative splicing, forming one transcript containing eight segments as exons and another with an additional exon that encodes a larger prepro leader sequence. The latter transcript has no known counterpart in the other vitamin K-dependent proteins. The positions of the introns with respect to the amino acid sequence encoded by the eight essential exons of factor VII are the same as those present in factor IX, factor X, protein C, and the first three exons of prothrombin. These exons code for domains generally conserved among members of this gene family. The comparable introns in these genes, however, are dissimilar with respect to size and sequence, with the exception of intron C in factor VII and protein C. The gene for factor VII also contains five regions made up of tandem repeats of oligonucleotide monomer elements. More than a quarter of the intron sequences and more than a third of the 3' untranslated portion of the mRNA transcript consist of these minisatellite tandem repeats
Mitochondrial DNA analysis reveals a low nucleotide diversity of ...
African Journals Online (AJOL)
STORAGESEVER
2009-06-17
Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.
Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki
2002-06-05
The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
Directory of Open Access Journals (Sweden)
Saroj K Young
2008-04-01
Full Text Available Inadequate understanding of the transmission of Mycobacterium leprae makes it difficult to predict the impact of leprosy control interventions. Genotypic tests that allow tracking of individual bacterial strains would strengthen epidemiological studies and contribute to our understanding of the disease.Genotyping assays based on variation in the copy number of short tandem repeat sequences were applied to biopsies collected in population-based epidemiological studies of leprosy in northern Malawi, and from members of multi-case households in Hyderabad, India. In the Malawi series, considerable genotypic variability was observed between patients, and also within patients, when isolates were collected at different times or from different tissues. Less within-patient variability was observed when isolates were collected from similar tissues at the same time. Less genotypic variability was noted amongst the closely related Indian patients than in the Malawi series.Lineages of M. leprae undergo changes in their pattern of short tandem repeat sequences over time. Genetic divergence is particularly likely between bacilli inhabiting different (e.g., skin and nerve tissues. Such variability makes short tandem repeat sequences unsuitable as a general tool for population-based strain typing of M. leprae, or for distinguishing relapse from reinfection. Careful use of these markers may provide insights into the development of disease within individuals and for tracking of short transmission chains.
Liu, Y T; Chen, R K; Lin, S J; Chen, Y C; Chin, S W; Chen, F C; Lee, C Y
2014-04-08
The Orchidaceae is one of the largest and most diverse families of flowering plants. The Dendrobium genus has high economic potential as ornamental plants and for medicinal purposes. In addition, the species of this genus are able to produce large crops. However, many Dendrobium varieties are very similar in outward appearance, making it difficult to distinguish one species from another. This study demonstrated that the 12 Dendrobium species used in this study may be divided into 2 groups by internal transcribed spacer (ITS) sequence analysis. Red and yellow flowers may also be used to separate these species into 2 main groups. In particular, the deciduous characteristic is associated with the ITS genetic diversity of the A group. Of 53 designed simple sequence repeat (SSR) primer pairs, 7 pairs were polymorphic for polymerase chain reaction products that were amplified from a specific band. The results of this study demonstrate that these 7 SSR primer pairs may potentially be used to identify Dendrobium species and their progeny in future studies.
Oggioni, M R; Claverys, J P
1999-10-01
A survey of all Streptococcus pneumoniae GenBank/EMBL DNA sequence entries and of the public domain sequence (representing more than 90% of the genome) of an S. pneumoniae type 4 strain allowed identification of 108 copies of a 107-bp-long highly repeated intergenic element called RUP (for repeat unit of pneumococcus). Several features of the element, revealed in this study, led to the proposal that RUP is an insertion sequence (IS)-derivative that could still be mobile. Among these features are: (1) a highly significant homology between the terminal inverted repeats (IRs) of RUPs and of IS630-Spn1, a new putative IS of S. pneumoniae; and (2) insertion at a TA dinucleotide, a characteristic target of several members of the IS630 family. Trans-mobilization of RUP is therefore proposed to be mediated by the transposase of IS630-Spn1. To account for the observation that RUPs are distributed among four subtypes which exhibit different degrees of sequence homogeneity, a scenario is invoked based on successive stages of RUP mobility and non-mobility, depending on whether an active transposase is present or absent. In the latter situation, an active transposase could be reintroduced into the species through natural transformation. Examination of sequences flanking RUP revealed a preferential association with ISs. It also provided evidence that RUPs promote sequence rearrangements, thereby contributing to genome flexibility. The possibility that RUP preferentially targets transforming DNA of foreign origin and subsequently favours disruption/rearrangement of exogenous sequences is discussed.
Single Nucleotide Polymorphism
DEFF Research Database (Denmark)
Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg
2014-01-01
Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....
Directory of Open Access Journals (Sweden)
Kwang-Soo Cho
Full Text Available We report the chloroplast (cp genome sequence of tartary buckwheat (Fagopyrum tataricum obtained by next-generation sequencing technology and compared this with the previously reported common buckwheat (F. esculentum ssp. ancestrale cp genome. The cp genome of F. tataricum has a total sequence length of 159,272 bp, which is 327 bp shorter than the common buckwheat cp genome. The cp gene content, order, and orientation are similar to those of common buckwheat, but with some structural variation at tandem and palindromic repeat frequencies and junction areas. A total of seven InDels (around 100 bp were found within the intergenic sequences and the ycf1 gene. Copy number variation of the 21-bp tandem repeat varied in F. tataricum (four repeats and F. esculentum (one repeat, and the InDel of the ycf1 gene was 63 bp long. Nucleotide and amino acid have highly conserved coding sequence with about 98% homology and four genes--rpoC2, ycf3, accD, and clpP--have high synonymous (Ks value. PCR based InDel markers were applied to diverse genetic resources of F. tataricum and F. esculentum, and the amplicon size was identical to that expected in silico. Therefore, these InDel markers are informative biomarkers to practically distinguish raw or processed buckwheat products derived from F. tataricum and F. esculentum.
Distribution and Evolution of Yersinia Leucine-Rich Repeat Proteins
Hu, Yueming; Huang, He; Hui, Xinjie; Cheng, Xi; White, Aaron P.
2016-01-01
Leucine-rich repeat (LRR) proteins are widely distributed in bacteria, playing important roles in various protein-protein interaction processes. In Yersinia, the well-characterized type III secreted effector YopM also belongs to the LRR protein family and is encoded by virulence plasmids. However, little has been known about other LRR members encoded by Yersinia genomes or their evolution. In this study, the Yersinia LRR proteins were comprehensively screened, categorized, and compared. The LRR proteins encoded by chromosomes (LRR1 proteins) appeared to be more similar to each other and different from those encoded by plasmids (LRR2 proteins) with regard to repeat-unit length, amino acid composition profile, and gene expression regulation circuits. LRR1 proteins were also different from LRR2 proteins in that the LRR1 proteins contained an E3 ligase domain (NEL domain) in the C-terminal region or an NEL domain-encoding nucleotide relic in flanking genomic sequences. The LRR1 protein-encoding genes (LRR1 genes) varied dramatically and were categorized into 4 subgroups (a to d), with the LRR1a to -c genes evolving from the same ancestor and LRR1d genes evolving from another ancestor. The consensus and ancestor repeat-unit sequences were inferred for different LRR1 protein subgroups by use of a maximum parsimony modeling strategy. Structural modeling disclosed very similar repeat-unit structures between LRR1 and LRR2 proteins despite the different unit lengths and amino acid compositions. Structural constraints may serve as the driving force to explain the observed mutations in the LRR regions. This study suggests that there may be functional variation and lays the foundation for future experiments investigating the functions of the chromosomally encoded LRR proteins of Yersinia. PMID:27217422
US Agency for International Development — Nucleotide sequences were generated from 37 cowpea (Vigna unguiculata L. Walp.) accessions relevant to Africa, China and the USA to discover at type of genetic...
International Nuclear Information System (INIS)
Dzhumagaliev, E.B.; Mazo, A.N.; Baev, A.A. Jr.; Gorelova, T.V.; Arkhipova, I.R.; Shuppe, N.G.; Il'in, Yu.V.
1986-01-01
The authors have determined the nucleotide sequences of long terminal repeats (LTRS) and adjacent regions in the transcribed and nontranscribed variants of the mobile dispersed gene mdg3. In its main characteristics the mdg3 is similar to other mdg. Its integration into chromosomal DNA brings about duplication of the 4 bp of the host DNA, no specificity of the mdg integration at the nucleotide level being detected. The mdg3 is flanked by a 5 bp inverted repeat. The variations in the length of the LTR in different mdg copies is mainly due to duplication of certain sequences in the U3 and R regions. mdg3 copies with a LTR length of 267 bp are the most abundant and are completely conservative in their primary structure. They are transcribed in the cells of the 67J25D culture, but not transcribed in the K/sub c/ line, where another mdg3 variant with a LTR length of 293 bp is transcriptionally active. The SI mapping of transcription initiation and termination sites has shown that in both mdg3 variants they are localized in the same LTR regions, and that the LTR itself has a characteristic U3-R-U5 structure-like retroviral LTRs. The possible factors involved in the regulation of mdg transcription are discussed
Arai, Y T; Takahashi, H; Kameoka, Y; Shiino, T; Wimalaratne, O; Lodmell, D L
2001-01-01
Thirty-four suspected rabid brain samples from 2 humans, 24 dogs, 4 cats, 2 mongooses, I jackal and I water buffalo were collected in 1995-1996 in Sri Lanka. Total RNA was extracted directly from brain suspensions and examined using a one-step reverse transcription-polymerase chain reaction (RT-PCR) for the rabies virus nucleoprotein (N) gene. Twenty-eight samples were found positive for the virus N gene by RT-PCR and also for the virus antigens by fluorescent antibody (FA) test. Rabies virus isolates obtained from different animal species in different regions of Sri Lanka were genetically homogenous. Sequences of 203 nucleotides (nt)-long RT-PCR products obtained from 16 of 27 samples were found identical. Sequences of 1350 nt of N genes of 14 RT-PCR products were determined. The Sri Lanka isolates under study formed a specific cluster that included also an earlier isolate from India but did not include the known isolates from China, Thailand, Malaysia, Israel, Iran, Oman, Saudi Arabia, Russia, Nepal, Philippines, Japan and from several other countries. These results suggest that one type of rabies virus is circulating among human, dog, cat, mongoose, jackal and water buffalo living near Colombo City and in other five remote regions in Sri Lanka.
Development of Genome-Wide SSR Markers from Angelica gigas Nakai Using Next Generation Sequencing.
Gil, Jinsu; Um, Yurry; Kim, Serim; Kim, Ok Tae; Koo, Sung Cheol; Reddy, Chinreddy Subramanyam; Kim, Seong-Cheol; Hong, Chang Pyo; Park, Sin-Gi; Kim, Ho Bang; Lee, Dong Hoon; Jeong, Byung-Hoon; Chung, Jong-Wook; Lee, Yi
2017-09-21
Angelica gigas Nakai is an important medicinal herb, widely utilized in Asian countries especially in Korea, Japan, and China. Although it is a vital medicinal herb, the lack of sequencing data and efficient molecular markers has limited the application of a genetic approach for horticultural improvements. Simple sequence repeats (SSRs) are universally accepted molecular markers for population structure study. In this study, we found over 130,000 SSRs, ranging from di- to deca-nucleotide motifs, using the genome sequence of Manchu variety (MV) of A. gigas, derived from next generation sequencing (NGS). From the putative SSR regions identified, a total of 16,496 primer sets were successfully designed. Among them, we selected 848 SSR markers that showed polymorphism from in silico analysis and contained tri- to hexa-nucleotide motifs. We tested 36 SSR primer sets for polymorphism in 16 A. gigas accessions. The average polymorphism information content (PIC) was 0.69; the average observed heterozygosity ( H O ) values, and the expected heterozygosity ( H E ) values were 0.53 and 0.73, respectively. These newly developed SSR markers would be useful tools for molecular genetics, genotype identification, genetic mapping, molecular breeding, and studying species relationships of the Angelica genus.
Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.
Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent
2016-03-22
Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.
Directory of Open Access Journals (Sweden)
Takeshi Kubota
Full Text Available BACKGROUND: Imaging the behavior of RNA in a living cell is a powerful means for understanding RNA functions and acquiring spatiotemporal information in a single cell. For more distinct RNA imaging in a living cell, a more effective chemical method to fluorescently label RNA is now required. In addition, development of the technology labeling with different colors for different RNA would make it easier to analyze plural RNA strands expressing in a cell. METHODOLOGY/PRINCIPAL FINDINGS: Tag technology for RNA imaging in a living cell has been developed based on the unique chemical functions of exciton-controlled hybridization-sensitive oligonucleotide (ECHO probes. Repetitions of selected 18-nucleotide RNA tags were incorporated into the mRNA 3'-UTR. Pairs with complementary ECHO probes exhibited hybridization-sensitive fluorescence emission for the mRNA expressed in a living cell. The mRNA in a nucleus was detected clearly as fluorescent puncta, and the images of the expression of two mRNAs were obtained independently and simultaneously with two orthogonal tag-probe pairs. CONCLUSIONS/SIGNIFICANCE: A compact and repeated label has been developed for RNA imaging in a living cell, based on the photochemistry of ECHO probes. The pairs of an 18-nt RNA tag and the complementary ECHO probes are highly thermostable, sequence-specifically emissive, and orthogonal to each other. The nucleotide length necessary for one tag sequence is much shorter compared with conventional tag technologies, resulting in easy preparation of the tag sequences with a larger number of repeats for more distinct RNA imaging.
M.N. lslam-Faridi; C.D. Nelson; S.P. DiFazio; L.E. Gunter; G.A. Tuskan
2009-01-01
The 185-285 rDNA and 55 rDNA loci in Populus trichocarpa were localized using fluorescent in situ hybridization (FISH). Two 185-285 rDNA sites and one 55 rDNA site were identified and located at the ends of 3 different chromosomes. FISH signals from the Arabidopsis-type telomere repeat sequence were observed at the distal ends of each chromosome. Six BAC clones...
Ayesh, Basim M
2017-01-01
Molecular markers are credible for the discrimination of genotypes and estimation of the extent of genetic diversity and relatedness in a set of genotypes. Inter-simple sequence repeat (ISSR) markers rapidly reveal high polymorphic fingerprints and have been used frequently to determine the genetic diversity among date palm cultivars. This chapter describes the application of ISSR markers for genotyping of date palm cultivars. The application involves extraction of genomic DNA from the target cultivars with reliable quality and quantity. Subsequently the extracted DNA serves as a template for amplification of genomic regions flanked by inverted simple sequence repeats using a single primer. The similarity of each pair of samples is measured by calculating the number of mono- and polymorphic bands revealed by gel electrophoresis. Matrices constructed for similarity and genetic distance are used to build a phylogenetic tree and cluster analysis, to determine the molecular relatedness of cultivars. The protocol describes 3 out of 9 tested primers consistently amplified 31 loci in 6 date palm cultivars, with 28 polymorphic loci.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions
Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.
Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
DEFF Research Database (Denmark)
Jutkina, Jekaterina; Hansen, Lars Hestbjerg; Li, Lili
2013-01-01
In the present study we report the complete nucleotide sequence of the toluene catabolic plasmid pD2RT of Pseudomonas migulae strain D2RT isolated from Baltic Sea water. The pD2RT is 129,894 base pairs in size with an average G+ C content of 53.75%. A total of 135 open reading frames (ORFs) were ...
Wanner, Roger M; Güthlein, Carolin; Springer, Burkhard; Böttger, Erik C; Ackermann, Martin
2008-01-01
Abstract Background The rate at which a stretch of DNA mutates is determined by the cellular systems for DNA replication and repair, and by the nucleotide sequence of the stretch itself. One sequence feature with a particularly strong influence on the mutation rate are nucleotide repeats. Some microbial pathogens use nucleotide repeats in their genome to stochastically vary phenotypic traits and thereby evade host defense. However, such unstable sequences also come at a cost, as mutations are...
Applications of High Throughput Nucleotide Sequencing
DEFF Research Database (Denmark)
Waage, Johannes Eichler
equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...
DEFF Research Database (Denmark)
Liu, Siyang; Huang, Shujia; Rao, Junhua
2015-01-01
present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome......) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We...... assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction...
Origin-Dependent Inverted-Repeat Amplification: Tests of a Model for Inverted DNA Amplification.
Directory of Open Access Journals (Sweden)
Bonita J Brewer
2015-12-01
Full Text Available DNA replication errors are a major driver of evolution--from single nucleotide polymorphisms to large-scale copy number variations (CNVs. Here we test a specific replication-based model to explain the generation of interstitial, inverted triplications. While no genetic information is lost, the novel inversion junctions and increased copy number of the included sequences create the potential for adaptive phenotypes. The model--Origin-Dependent Inverted-Repeat Amplification (ODIRA-proposes that a replication error at pre-existing short, interrupted, inverted repeats in genomic sequences generates an extrachromosomal, inverted dimeric, autonomously replicating intermediate; subsequent genomic integration of the dimer yields this class of CNV without loss of distal chromosomal sequences. We used a combination of in vitro and in vivo approaches to test the feasibility of the proposed replication error and its downstream consequences on chromosome structure in the yeast Saccharomyces cerevisiae. We show that the proposed replication error-the ligation of leading and lagging nascent strands to create "closed" forks-can occur in vitro at short, interrupted inverted repeats. The removal of molecules with two closed forks results in a hairpin-capped linear duplex that we show replicates in vivo to create an inverted, dimeric plasmid that subsequently integrates into the genome by homologous recombination, creating an inverted triplication. While other models have been proposed to explain inverted triplications and their derivatives, our model can also explain the generation of human, de novo, inverted amplicons that have a 2:1 mixture of sequences from both homologues of a single parent--a feature readily explained by a plasmid intermediate that arises from one homologue and integrates into the other homologue prior to meiosis. Our tests of key features of ODIRA lend support to this mechanism and suggest further avenues of enquiry to unravel the origins
Origin-Dependent Inverted-Repeat Amplification: Tests of a Model for Inverted DNA Amplification.
Brewer, Bonita J; Payen, Celia; Di Rienzi, Sara C; Higgins, Megan M; Ong, Giang; Dunham, Maitreya J; Raghuraman, M K
2015-12-01
DNA replication errors are a major driver of evolution--from single nucleotide polymorphisms to large-scale copy number variations (CNVs). Here we test a specific replication-based model to explain the generation of interstitial, inverted triplications. While no genetic information is lost, the novel inversion junctions and increased copy number of the included sequences create the potential for adaptive phenotypes. The model--Origin-Dependent Inverted-Repeat Amplification (ODIRA)-proposes that a replication error at pre-existing short, interrupted, inverted repeats in genomic sequences generates an extrachromosomal, inverted dimeric, autonomously replicating intermediate; subsequent genomic integration of the dimer yields this class of CNV without loss of distal chromosomal sequences. We used a combination of in vitro and in vivo approaches to test the feasibility of the proposed replication error and its downstream consequences on chromosome structure in the yeast Saccharomyces cerevisiae. We show that the proposed replication error-the ligation of leading and lagging nascent strands to create "closed" forks-can occur in vitro at short, interrupted inverted repeats. The removal of molecules with two closed forks results in a hairpin-capped linear duplex that we show replicates in vivo to create an inverted, dimeric plasmid that subsequently integrates into the genome by homologous recombination, creating an inverted triplication. While other models have been proposed to explain inverted triplications and their derivatives, our model can also explain the generation of human, de novo, inverted amplicons that have a 2:1 mixture of sequences from both homologues of a single parent--a feature readily explained by a plasmid intermediate that arises from one homologue and integrates into the other homologue prior to meiosis. Our tests of key features of ODIRA lend support to this mechanism and suggest further avenues of enquiry to unravel the origins of interstitial
FASH: A web application for nucleotides sequence search
Directory of Open Access Journals (Sweden)
Chew Paul
2008-05-01
Full Text Available Abstract FASH (Fourier Alignment Sequence Heuristics is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome, FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. Availability FASH can be accessed at https://fash.bgu.ac.il:8443/fash/default.jsp (secured website
The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.
Khoe, Clairine V; Chung, Long H; Murray, Vincent
2018-06-01
The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.
C9orf72 nucleotide repeat structures initiate molecular cascades of disease.
Haeusler, Aaron R; Donnelly, Christopher J; Periz, Goran; Simko, Eric A J; Shaw, Patrick G; Kim, Min-Sik; Maragakis, Nicholas J; Troncoso, Juan C; Pandey, Akhilesh; Sattler, Rita; Rothstein, Jeffrey D; Wang, Jiou
2014-03-13
A hexanucleotide repeat expansion (HRE), (GGGGCC)n, in C9orf72 is the most common genetic cause of the neurodegenerative diseases amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Here we identify a molecular mechanism by which structural polymorphism of the HRE leads to ALS/FTD pathology and defects. The HRE forms DNA and RNA G-quadruplexes with distinct structures and promotes RNA•DNA hybrids (R-loops). The structural polymorphism causes a repeat-length-dependent accumulation of transcripts aborted in the HRE region. These transcribed repeats bind to ribonucleoproteins in a conformation-dependent manner. Specifically, nucleolin, an essential nucleolar protein, preferentially binds the HRE G-quadruplex, and patient cells show evidence of nucleolar stress. Our results demonstrate that distinct C9orf72 HRE structural polymorphism at both DNA and RNA levels initiates molecular cascades leading to ALS/FTD pathologies, and provide the basis for a mechanistic model for repeat-associated neurodegenerative diseases.
Lin, Geng-Ming; Lai, Yu-Heng; Audira, Gilbert; Hsiao, Chung-Der
2017-11-06
Green algae, Chlorella ellipsoidea , Haematococcus pluvialis and Aegagropila linnaei (Phylum Chlorophyta) were simultaneously decoded by a genomic skimming approach within 18-5.8-28S rRNA region. Whole genomic DNAs were isolated from green algae and directly subjected to low coverage genome skimming sequencing. After de novo assembly and mapping, the size of complete 18-5.8-28S rRNA repeated units for three green algae were ranged from 5785 to 6028 bp, which showed high nucleotide diversity (π is around 0.5-0.6) within ITS1 and ITS2 (Internal Transcribed Spacer) regions. Previously, the evolutional diversity of algae has been difficult to decode due to the inability design universal primers that amplify specific marker genes across diverse algal species. In this study, our method provided a rapid and universal approach to decode the 18-5.8-28S rRNA repeat unit in three green algal species. In addition, the completely sequenced 18-5.8-28S rRNA repeated units provided a solid nuclear marker for phylogenetic and evolutionary analysis for green algae for the first time.
Inter-simple sequence repeat (ISSR) loci mapping in the genome of perennial ryegrass
DEFF Research Database (Denmark)
Pivorienė, O; Pašakinskienė, I; Brazauskas, G
2008-01-01
The aim of this study was to identify and characterize new ISSR markers and their loci in the genome of perennial ryegrass. A subsample of the VrnA F2 mapping family of perennial ryegrass comprising 92 individuals was used to develop a linkage map including inter-simple sequence repeat markers...... demonstrated a 70% similarity to the Hordeum vulgare germin gene GerA. Inter-SSR mapping will provide useful information for gene targeting, quantitative trait loci mapping and marker-assisted selection in perennial ryegrass....
Complete Nucleotide Sequence Analysis of the Norovirus GII.4 Sydney Variant in South Korea
Directory of Open Access Journals (Sweden)
Ji-Sun Park
2015-01-01
Full Text Available Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4 was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF composites throughout the whole genome: ORF1 (5,100 bp, ORF2 (1,623 bp, and ORF3 (807 bp. Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.
Campbell, Una C.; Winsauer, Peter J.; Stevenson, Michael W.; Moerschbaecher, Joseph M.
2004-01-01
The present study investigated the effects of positive and negative GABA[subscript A] modulators under three different baselines of repeated acquisition in squirrel monkeys in which the monkeys acquired a three-response sequence on three keys under a second-order fixed-ratio (FR) schedule of food reinforcement. In two of these baselines, the…
The Matrix Method of Representation, Analysis and Classification of Long Genetic Sequences
Directory of Open Access Journals (Sweden)
Ivan V. Stepanyan
2017-01-01
Full Text Available The article is devoted to a matrix method of comparative analysis of long nucleotide sequences by means of presenting each sequence in the form of three digital binary sequences. This method uses a set of symmetries of biochemical attributes of nucleotides. It also uses the possibility of presentation of every whole set of N-mers as one of the members of a Kronecker family of genetic matrices. With this method, a long nucleotide sequence can be visually represented as an individual fractal-like mosaic or another regular mosaic of binary type. In contrast to natural nucleotide sequences, artificial random sequences give non-regular patterns. Examples of binary mosaics of long nucleotide sequences are shown, including cases of human chromosomes and penicillins. The obtained results are then discussed.
The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine
International Nuclear Information System (INIS)
Nuc, K.; Nuc, P.; Pawelkiewicz, J.
1993-01-01
We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs
Classifying Coding DNA with Nucleotide Statistics
Directory of Open Access Journals (Sweden)
Nicolas Carels
2009-10-01
Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.
Directory of Open Access Journals (Sweden)
Varala Kranthi
2007-05-01
Full Text Available Abstract Background Extensive computational and database tools are available to mine genomic and genetic databases for model organisms, but little genomic data is available for many species of ecological or agricultural significance, especially those with large genomes. Genome surveys using conventional sequencing techniques are powerful, particularly for detecting sequences present in many copies per genome. However these methods are time-consuming and have potential drawbacks. High throughput 454 sequencing provides an alternative method by which much information can be gained quickly and cheaply from high-coverage surveys of genomic DNA. Results We sequenced 78 million base-pairs of randomly sheared soybean DNA which passed our quality criteria. Computational analysis of the survey sequences provided global information on the abundant repetitive sequences in soybean. The sequence was used to determine the copy number across regions of large genomic clones or contigs and discover higher-order structures within satellite repeats. We have created an annotated, online database of sequences present in multiple copies in the soybean genome. The low bias of pyrosequencing against repeat sequences is demonstrated by the overall composition of the survey data, which matches well with past estimates of repetitive DNA content obtained by DNA re-association kinetics (Cot analysis. Conclusion This approach provides a potential aid to conventional or shotgun genome assembly, by allowing rapid assessment of copy number in any clone or clone-end sequence. In addition, we show that partial sequencing can provide access to partial protein-coding sequences.
DEFF Research Database (Denmark)
Leonardsen, L; DeClue, J E; Lybaek, H
1996-01-01
The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....
Zhu, Huayu; Song, Pengyao; Koo, Dal-Hoe; Guo, Luqin; Li, Yanman; Sun, Shouru; Weng, Yiqun; Yang, Luming
2016-08-05
Microsatellite markers are one of the most informative and versatile DNA-based markers used in plant genetic research, but their development has traditionally been difficult and costly. The whole genome sequencing with next-generation sequencing (NGS) technologies provides large amounts of sequence data to develop numerous microsatellite markers at whole genome scale. SSR markers have great advantage in cross-species comparisons and allow investigation of karyotype and genome evolution through highly efficient computation approaches such as in silico PCR. Here we described genome wide development and characterization of SSR markers in the watermelon (Citrullus lanatus) genome, which were then use in comparative analysis with two other important crop species in the Cucurbitaceae family: cucumber (Cucumis sativus L.) and melon (Cucumis melo L.). We further applied these markers in evaluating the genetic diversity and population structure in watermelon germplasm collections. A total of 39,523 microsatellite loci were identified from the watermelon draft genome with an overall density of 111 SSRs/Mbp, and 32,869 SSR primers were designed with suitable flanking sequences. The dinucleotide SSRs were the most common type representing 34.09 % of the total SSR loci and the AT-rich motifs were the most abundant in all nucleotide repeat types. In silico PCR analysis identified 832 and 925 SSR markers with each having a single amplicon in the cucumber and melon draft genome, respectively. Comparative analysis with these cross-species SSR markers revealed complicated mosaic patterns of syntenic blocks among the genomes of three species. In addition, genetic diversity analysis of 134 watermelon accessions with 32 highly informative SSR loci placed these lines into two groups with all accessions of C.lanatus var. citorides and three accessions of C. colocynthis clustered in one group and all accessions of C. lanatus var. lanatus and the remaining accessions of C. colocynthis
Mallick, Pijush; Chattaraj, Shruti; Sikdar, Samir Ranjan
2017-10-01
The 12 pfls somatic hybrids and 2 parents of Pleurotus florida and Lentinus s quarrosulus were characterized by ISSR and sequencing of rRNA-ITS genes. Five ISSR primers were used and amplified a total of 54 reproducible fragments with 98.14% polymorphism among all the pfls hybrid populations and parental strains. UPGMA-based cluster exhibited a dendrogram with three major groups between the parents and pfls hybrids. Parent P . florida and L . squarrosulus showed different degrees of genetic distance with all the hybrid lines and they showed closeness to hybrid pfls 1m and pfls 1h , respectively. ITS1(F) and ITS4(R) amplified the rRNA-ITS gene with 611-867 bp sequence length. The nucleotide polymorphisms were found in the ITS1, ITS2 and 5.8S rRNA region with different number of bases. Based on rRNA-ITS sequence, UPGMA cluster exhibited three distinct groups between L. squarrosulus and pfls 1p , pfls 1m and pfls 1s , and pfls 1e and P. florida .
Baurens, Franc-Christophe; Bocs, Stéphanie; Rouard, Mathieu; Matsumoto, Takashi; Miller, Robert N G; Rodier-Goud, Marguerite; MBéguié-A-MBéguié, Didier; Yahiaoui, Nabila
2010-07-16
Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M. balbisiana haplotypes. A
The leucine-rich repeat structure.
Bella, J; Hindle, K L; McEwan, P A; Lovell, S C
2008-08-01
The leucine-rich repeat is a widespread structural motif of 20-30 amino acids with a characteristic repetitive sequence pattern rich in leucines. Leucine-rich repeat domains are built from tandems of two or more repeats and form curved solenoid structures that are particularly suitable for protein-protein interactions. Thousands of protein sequences containing leucine-rich repeats have been identified by automatic annotation methods. Three-dimensional structures of leucine-rich repeat domains determined to date reveal a degree of structural variability that translates into the considerable functional versatility of this protein superfamily. As the essential structural principles become well established, the leucine-rich repeat architecture is emerging as an attractive framework for structural prediction and protein engineering. This review presents an update of the current understanding of leucine-rich repeat structure at the primary, secondary, tertiary and quaternary levels and discusses specific examples from recently determined three-dimensional structures.
RANDNA: a random DNA sequence generator.
Piva, Francesco; Principato, Giovanni
2006-01-01
Monte Carlo simulations are useful to verify the significance of data. Genomic regularities, such as the nucleotide correlations or the not uniform distribution of the motifs throughout genomic or mature mRNA sequences, exist and their significance can be checked by means of the Monte Carlo test. The test needs good quality random sequences in order to work, moreover they should have the same nucleotide distribution as the sequences in which the regularities have been found. Random DNA sequences are also useful to estimate the background score of an alignment, that is a threshold below which the resulting score is merely due to chance. We have developed RANDNA, a free software which allows to produce random DNA or RNA sequences setting both their length and the percentage of nucleotide composition. Sequences having the same nucleotide distribution of exonic, intronic or intergenic sequences can be generated. Its graphic interface makes it possible to easily set the parameters that characterize the sequences being produced and saved in a text format file. The pseudo-random number generator function of Borland Delphi 6 is used, since it guarantees a good randomness, a long cycle length and a high speed. We have checked the quality of sequences generated by the software, by means of well-known tests, both by themselves and versus genuine random sequences. We show the good quality of the generated sequences. The software, complete with examples and documentation, is freely available to users from: http://www.introni.it/en/software.
Jaschob, Daniel; Davis, Trisha N; Riffle, Michael
2015-03-07
Sequence feature annotations (e.g., protein domain boundaries, binding sites, and secondary structure predictions) are an essential part of biological research. Annotations are widely used by scientists during research and experimental design, and are frequently the result of biological studies. A generalized and simple means of disseminating and visualizing these data via the web would be of value to the research community. Mason is a web site widget designed to visualize and compare annotated features of one or more nucleotide or protein sequence. Annotated features may be of virtually any type, ranging from annotating transcription binding sites or exons and introns in DNA to secondary structure or domain boundaries in proteins. Mason is simple to use and easy to integrate into web sites. Mason has a highly dynamic and configurable interface supporting multiple sets of annotations per sequence, overlapping regions, customization of interface and user-driven events (e.g., clicks and text to appear for tooltips). It is written purely in JavaScript and SVG, requiring no 3(rd) party plugins or browser customization. Mason is a solution for dissemination of sequence annotation data on the web. It is highly flexible, customizable, simple to use, and is designed to be easily integrated into web sites. Mason is open source and freely available at https://github.com/yeastrc/mason.
International Nuclear Information System (INIS)
Solov'yan, V.T.; Kunaleh, V.A.; Shumnyl, V.K.; Vershinin, A.V.
1986-01-01
This paper attempts to assess the quantity of repeated sequences and degree of homology of DNA in the intact plant and two lines of callus tissue of Rauwolfia serpentina Benth maintained for 20 years, which differ among themselves in the level of biosynthesis of the pharmacologically valuable alkaloid ajmaline. The tritium-labeled repeats of plants and calli were used in direct and reverse hybridization on nitrocellulose filters. Hybridization of H 3-labeled repeats with phage 17 DNA was used as control. The radioactivity of filters after washing was measured in a liquid scintillation counter
Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V
2018-04-01
Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
Directory of Open Access Journals (Sweden)
Li Xuehui
2012-10-01
Full Text Available Abstract Background Alfalfa, a perennial, outcrossing species, is a widely planted forage legume producing highly nutritious biomass. Currently, improvement of cultivated alfalfa mainly relies on recurrent phenotypic selection. Marker assisted breeding strategies can enhance alfalfa improvement efforts, particularly if many genome-wide markers are available. Transcriptome sequencing enables efficient high-throughput discovery of single nucleotide polymorphism (SNP markers for a complex polyploid species. Result The transcriptomes of 27 alfalfa genotypes, including elite breeding genotypes, parents of mapping populations, and unimproved wild genotypes, were sequenced using an Illumina Genome Analyzer IIx. De novo assembly of quality-filtered 72-bp reads generated 25,183 contigs with a total length of 26.8 Mbp and an average length of 1,065 bp, with an average read depth of 55.9-fold for each genotype. Overall, 21,954 (87.2% of the 25,183 contigs represented 14,878 unique protein accessions. Gene ontology (GO analysis suggested that a broad diversity of genes was represented in the resulting sequences. The realignment of individual reads to the contigs enabled the detection of 872,384 SNPs and 31,760 InDels. High resolution melting (HRM analysis was used to validate 91% of 192 putative SNPs identified by sequencing. Both allelic variants at about 95% of SNP sites identified among five wild, unimproved genotypes are still present in cultivated alfalfa, and all four US breeding programs also contain a high proportion of these SNPs. Thus, little evidence exists among this dataset for loss of significant DNA sequence diversity from either domestication or breeding of alfalfa. Structure analysis indicated that individuals from the subspecies falcata, the diploid subspecies caerulea, and the tetraploid subspecies sativa (cultivated tetraploid alfalfa were clearly separated. Conclusion We used transcriptome sequencing to discover large numbers of SNPs
Energy Technology Data Exchange (ETDEWEB)
Labbe, Jessy L [ORNL; Murat, Claude [INRA, Nancy, France; Morin, Emmanuelle [INRA, Nancy, France; Le Tacon, F [UMR, France; Martin, Francis [INRA, Nancy, France
2011-01-01
It is becoming clear that simple sequence repeats (SSRs) play a significant role in fungal genome organization, and they are a large source of genetic markers for population genetics and meiotic maps. We identified SSRs in the Laccaria bicolor genome by in silico survey and analyzed their distribution in the different genomic regions. We also compared the abundance and distribution of SSRs in L. bicolor with those of the following fungal genomes: Phanerochaete chrysosporium, Coprinopsis cinerea, Ustilago maydis, Cryptococcus neoformans, Aspergillus nidulans, Magnaporthe grisea, Neurospora crassa and Saccharomyces cerevisiae. Using the MISA computer program, we detected 277,062 SSRs in the L. bicolor genome representing 8% of the assembled genomic sequence. Among the analyzed basidiomycetes, L. bicolor exhibited the highest SSR density although no correlation between relative abundance and the genome sizes was observed. In most genomes the short motifs (mono- to trinucleotides) were more abundant than the longer repeated SSRs. Generally, in each organism, the occurrence, relative abundance, and relative density of SSRs decreased as the repeat unit increased. Furthermore, each organism had its own common and longest SSRs. In the L. bicolor genome, most of the SSRs were located in intergenic regions (73.3%) and the highest SSR density was observed in transposable elements (TEs; 6,706 SSRs/Mb). However, 81% of the protein-coding genes contained SSRs in their exons, suggesting that SSR polymorphism may alter gene phenotypes. Within a L. bicolor offspring, sequence polymorphism of 78 SSRs was mainly detected in non-TE intergenic regions. Unlike previously developed microsatellite markers, these new ones are spread throughout the genome; these markers could have immediate applications in population genetics.
Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro
2018-03-01
Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.
Complete genome sequence of Menghai rhabdovirus, a novel mosquito-borne rhabdovirus from China.
Sun, Qiang; Zhao, Qiumin; An, Xiaoping; Guo, Xiaofang; Zuo, Shuqing; Zhang, Xianglilan; Pei, Guangqian; Liu, Wenli; Cheng, Shi; Wang, Yunfei; Shu, Peng; Mi, Zhiqiang; Huang, Yong; Zhang, Zhiyi; Tong, Yigang; Zhou, Hongning; Zhang, Jiusong
2017-04-01
Menghai rhabdovirus (MRV) was isolated from Aedes albopictus in Menghai county of Yunnan Province, China, in August 2010. Whole-genome sequencing of MRV was performed using an Ion PGM™ Sequencer. We found that MRV is a single-stranded, negative-sense RNA virus. The complete genome of MRV has 10,744 nt, with short inverted repeat termini, encoding five typical rhabdovirus proteins (N, P, M, G, and L) and an additional small hypothetical protein. Nucleotide BLAST analysis using the BLASTn method showed that the genome sequence most similar to that of MRV is that of Arboretum virus (NC_025393.1), with a Max score of 322, query coverage of 14%, and 66% identity. Genomic and phylogenetic analyses both demonstrated that MRV should be considered a member of a novel species of the family Rhabdoviridae.
Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn
2016-01-01
Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.
Repeat-associated plasticity in the Helicobacter pylori RD gene family.
Shak, Joshua R; Dick, Jonathan J; Meinersmann, Richard J; Perez-Perez, Guillermo I; Blaser, Martin J
2009-11-01
The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3' region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5' region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host.
Directory of Open Access Journals (Sweden)
Gao Zhihong
2010-07-01
Full Text Available Abstract Background Expressed Sequence Tag (EST has been a cost-effective tool in molecular biology and represents an abundant valuable resource for genome annotation, gene expression, and comparative genomics in plants. Results In this study, we constructed a cDNA library of Prunus mume flower and fruit, sequenced 10,123 clones of the library, and obtained 8,656 expressed sequence tag (EST sequences with high quality. The ESTs were assembled into 4,473 unigenes composed of 1,492 contigs and 2,981 singletons and that have been deposited in NCBI (accession IDs: GW868575 - GW873047, among which 1,294 unique ESTs were with known or putative functions. Furthermore, we found 1,233 putative simple sequence repeats (SSRs in the P. mume unigene dataset. We randomly tested 42 pairs of PCR primers flanking potential SSRs, and 14 pairs were identified as true-to-type SSR loci and could amplify polymorphic bands from 20 individual plants of P. mume. We further used the 14 EST-SSR primer pairs to test the transferability on peach and plum. The result showed that nearly 89% of the primer pairs produced target PCR bands in the two species. A high level of marker polymorphism was observed in the plum species (65% and low in the peach (46%, and the clustering analysis of the three species indicated that these SSR markers were useful in the evaluation of genetic relationships and diversity between and within the Prunus species. Conclusions We have constructed the first cDNA library of P. mume flower and fruit, and our data provide sets of molecular biology resources for P. mume and other Prunus species. These resources will be useful for further study such as genome annotation, new gene discovery, gene functional analysis, molecular breeding, evolution and comparative genomics between Prunus species.
Zhang, Meiping; Rong, Ying; Lee, Mi-Kyung; Zhang, Yang; Stelly, David M; Zhang, Hong-Bin
2015-10-01
Cotton is the world's leading textile fiber crop and is also grown as a bioenergy and food crop. Knowledge of the phylogeny of closely related species and the genome origin and evolution of polyploid species is significant for advanced genomics research and breeding. We have reconstructed the phylogeny of the cotton genus, Gossypium L., and deciphered the genome origin and evolution of its five polyploid species by restriction fragment analysis of repeated sequences. Nuclear DNA of 84 accessions representing 35 species and all eight genomes of the genus were analyzed. The phylogenetic tree of the genus was reconstructed using the parsimony method on 1033 polymorphic repeated sequence restriction fragments. The genome origin of its polyploids was determined by calculating the diploid-polyploid restriction fragment correspondence (RFC). The tree is consistent with the morphological classification, genome designation and geographic distribution of the species at subgenus, section and subsection levels. Gossypium lobatum (D7) was unambiguously shown to have the highest RFC with the D-subgenomes of all five polyploids of the genus, while the common ancestor of Gossypium herbaceum (A1) and Gossypium arboreum (A2) likely contributed to the A-subgenomes of the polyploids. These results provide a comprehensive phylogenetic tree of the cotton genus and new insights into the genome origin and evolution of its polyploid species. The results also further demonstrate a simple, rapid and inexpensive method suitable for phylogenetic analysis of closely related species, especially congeneric species, and the inference of genome origin of polyploids that constitute over 70 % of flowering plants.
Directory of Open Access Journals (Sweden)
Arehart Eric
2009-03-01
Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in
Energy Technology Data Exchange (ETDEWEB)
Kyllo, J.H.; Collins, M.M.; Vetter, K.L. [Univ. of Iowa College of Medicine, Iowa City, IA (United States)] [and others
1996-03-29
Genetic screening techniques using simple sequence repeat polymorphisms were applied to investigate the molecular nature of congenital isolated adrenocorticotropic hormone (ACTH) deficiency. We hypothesize that this rare cause of hypocortisolism shared by a brother and sister with two unaffected sibs and unaffected parents is inherited as an autosomal recessive single gene mutation. Genes involved in the hypothalamic-pituitary axis controlling cortisol sufficiency were investigated for a causal role in this disorder. Southern blotting showed no detectable mutations of the gene encoding pro-opiomelanocortin (POMC), the ACTH precursor. Other candidate genes subsequently considered were those encoding neuroendocrine convertase-1, and neuroendocrine convertase-2 (NEC-1, NEC-2), and corticotropin releasing hormone (CRH). Tests for linkage were performed using polymorphic di- and tetranucleotide simple sequence repeat markers flanking the reported map locations for POMC, NEC-1, NEC-2, and CRH. The chromosomal haplotypes determined by the markers flanking the loci for POMC, NEC-1, and NEC-2 were not compatible with linkage. However, 22 individual markers defining the chromosomal haplotypes flanking CRH were compatible with linkage of the disorder to the immediate area of this gene of chromosome 8. Based on these data, we hypothesize that the ACTH deficiency in this family is due to an abnormality of CRH gene structure or expression. These results illustrate the useful application of high density genetic maps constructed with simple sequence repeat markers for inclusion/exclusion studies of candidate genes in even very small nuclear families segregating for unusual phenotypes. 25 refs., 5 figs., 2 tabs.
OrthoANI: An improved algorithm and software for calculating average nucleotide identity.
Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik
2016-02-01
Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.
Creation and structure determination of an artificial protein with three complete sequence repeats
Energy Technology Data Exchange (ETDEWEB)
Adachi, Motoyasu, E-mail: adachi.motoyasu@jaea.go.jp; Shimizu, Rumi; Kuroki, Ryota [Japan Atomic Energy Agency, Shirakatashirane 2-4, Nakagun Tokaimura, Ibaraki 319-1195 (Japan); Blaber, Michael [Japan Atomic Energy Agency, Shirakatashirane 2-4, Nakagun Tokaimura, Ibaraki 319-1195 (Japan); Florida State University, Tallahassee, FL 32306-4300 (United States)
2013-11-01
An artificial protein with three complete sequence repeats was created and the structure was determined by X-ray crystallography. The structure showed threefold symmetry even though there is an amino- and carboxy-terminal. The artificial protein with threefold symmetry may be useful as a scaffold to capture small materials with C3 symmetry. Symfoil-4P is a de novo protein exhibiting the threefold symmetrical β-trefoil fold designed based on the human acidic fibroblast growth factor. First three asparagine–glycine sequences of Symfoil-4P are replaced with glutamine–glycine (Symfoil-QG) or serine–glycine (Symfoil-SG) sequences protecting from deamidation, and His-Symfoil-II was prepared by introducing a protease digestion site into Symfoil-QG so that Symfoil-II has three complete repeats after removal of the N-terminal histidine tag. The Symfoil-QG and SG and His-Symfoil-II proteins were expressed in Eschericha coli as soluble protein, and purified by nickel affinity chromatography. Symfoil-II was further purified by anion-exchange chromatography after removing the HisTag by proteolysis. Both Symfoil-QG and Symfoil-II were crystallized in 0.1 M Tris-HCl buffer (pH 7.0) containing 1.8 M ammonium sulfate as precipitant at 293 K; several crystal forms were observed for Symfoil-QG and II. The maximum diffraction of Symfoil-QG and II crystals were 1.5 and 1.1 Å resolution, respectively. The Symfoil-II without histidine tag diffracted better than Symfoil-QG with N-terminal histidine tag. Although the crystal packing of Symfoil-II is slightly different from Symfoil-QG and other crystals of Symfoil derivatives having the N-terminal histidine tag, the refined crystal structure of Symfoil-II showed pseudo-threefold symmetry as expected from other Symfoils. Since the removal of the unstructured N-terminal histidine tag did not affect the threefold structure of Symfoil, the improvement of diffraction quality of Symfoil-II may be caused by molecular characteristics of
Pelsy, F.; Merdinoglu, D.
2002-09-01
A chromosome-walking strategy was used to sequence and characterize retrotransposons in the grapevine genome. The reconstitution of a family of retroelements, named Tvv1, was achieved by six successive steps. These elements share a single, highly conserved open reading frame 4,153 nucleotides-long, putatively encoding the gag, pro, int, rt and rh proteins. Comparison of the Tvv1 open reading frame coding potential with those of drosophila copia and tobacco Tnt1, revealed that Tvv1 is closely related to Ty 1 copia-like retrotransposons. A highly variable untranslated leader region, upstream of the open reading frame, allowed us to differentiate Tvv1 variants, which represent a family of at least 28 copies, in varying sizes. This internal region is flanked by two long terminal repeats in direct orientation, sized between 149 and 157 bp. Among elements theoretically sized from 4,970 to 5,550 bp, we describe the full-length sequence of a reference element Tvv1-1, 5,343 nucleotides-long. The full-length sequence of Tvv1-1 compared to pea PDR1 shows a 53.3% identity. In addition, both elements contain long terminal repeats of nearly the same size in which the U5 region could be entirely absent. Therefore, we assume that Tvv1 and PDR1 could constitute a particular class of short LTRs retroelements.
Sequencing and De Novo Transcriptome Assembly of Brachypodium sylvaticum (Poaceae
Directory of Open Access Journals (Sweden)
Samuel E. Fox
2013-03-01
Full Text Available Premise of the study: We report the de novo assembly and characterization of the transcriptomes of Brachypodium sylvaticum (slender false-brome accessions from native populations of Spain and Greece, and an invasive population west of Corvallis, Oregon, USA. Methods and Results: More than 350 million sequence reads from the mRNA libraries prepared from three B. sylvaticum genotypes were assembled into 120,091 (Corvallis, 104,950 (Spain, and 177,682 (Greece transcript contigs. In comparison with the B. distachyon Bd21 reference genome and GenBank protein sequences, we estimate >90% exome coverage for B. sylvaticum. The transcripts were assigned Gene Ontology and InterPro annotations. Brachypodium sylvaticum sequence reads aligned against the Bd21 genome revealed 394,654 single-nucleotide polymorphisms (SNPs and >20,000 simple sequence repeat (SSR DNA sites. Conclusions: To our knowledge, this is the first report of transcriptome sequencing of invasive plant species with a closely related sequenced reference genome. The sequences and identified SNP variant and SSR sites will provide tools for developing novel genetic markers for use in genotyping and characterization of invasive behavior of B. sylvaticum.
Alabi, Olufemi J; Villegas, Cecilia; Gregg, Lori; Murray, K Daniel
2016-06-01
Two isolates of a novel bipartite begomovirus, tentatively named malvastrum bright yellow mosaic virus (MaBYMV), were molecularly characterized from naturally infected plants of the genus Malvastrum showing bright yellow mosaic disease symptoms in South Texas. Six complete DNA-A and five DNA-B genome sequences of MaBYMV obtained from the isolates ranged in length from 2,608 to 2,609 nucleotides (nt) and 2,578 to 2,605 nt, respectively. Both genome segments shared a 178- to 180-nt common region. In pairwise comparisons, the complete DNA-A and DNA-B sequences of MaBYMV were most similar (87-88 % and 79-81 % identity, respectively) and phylogenetically related to the corresponding sequences of sida mosaic Sinaloa virus-[MX-Gua-06]. Further analysis revealed that MaBYMV is a putative recombinant virus, thus supporting the notion that malvaceous hosts may be influencing the evolution of several begomoviruses. The design of new diagnostic primers enabled the detection of MaBYMV in cohorts of Bemisia tabaci collected from symptomatic Malvastrum sp. plants, thus implicating whiteflies as potential vectors of the virus.
Hayashi, Kei; Mohanta, Uday K; Ohari, Yuma; Neeraja, Tambireddy; Singh, T Shantikumar; Sugiyama, Hiromu; Itagaki, Tadashi
2016-12-01
The aim of this study was to analyze the phylogenetic relationship between Explanatum explanatum populations in India and other countries of the Indian subcontinent. Seventy liver amphistomes collected from four localities in India were identified as E. explanatum based on the nucleotide sequences of ribosomal ITS2. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial gene nad1 in comparison with flukes from Bangladesh and Nepal. In the resulting phylogenetic tree, the nad1 haplotypes from India were divided into four clades, and the flukes showing the haplotypes of clades A and C were predominant in India. The haplotypes of the clades A and C have also been detected in Bangladesh and Nepal, and therefore, it seems they occur commonly throughout the Indian subcontinent. The results of AMOVA suggested that gene flow was likely to occur between E. explanatum populations in these countries. These countries are geographically close and have been historically and culturally connected to each other, and therefore, the movements of host ruminants among these countries might have been involved in the migration of the flukes and their gene flow.
Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi
2012-01-01
We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.
Reverchon, S; Huang, Y; Bourson, C; Robert-Baudouy, J
1989-12-21
The nucleotide sequences of the coding and regulatory regions of the genes encoding oligoglacturonate lyase (OGL) and pectate lyase e isoenzyme (PLe) from Erwinia chrysanthemi 3937 were determined. The ogl sequence contains an open reading frame (ORF) of 1164 bp coding for a 388-amino acid (aa) polypeptide with a predicted Mr of 44,124. A possible transcriptional start signal showing homology with the Escherichia coli promoter consensus sequence was detected. In addition, a sequence 3' to the coding region was found to be able to form a secondary structure which may function as an Rho-independent transcriptional termination signal. For the pelE sequence, a long ORF of 1212 bp coding for a 404-aa polypeptide was detected. PLe is secreted into the external medium by E. chrysanthemi, and a potential signal peptide sequence was identified in the pelE gene. In the 5' upstream pelE coding region, a putative promoter resembling E. coli promoter consensus sequences was detected. Furthermore, the region immediately 3' to the pelE translational stop codon may function as an Rho-independent translational termination signal. In strain 3937, the synthesis of OGL and PLe, as well as the other enzymes involved in the pectin-degradative pathway (particularly the kdgT product), are known to be regulated by the KdgR repressor, which mediates galacturonate and polygalacturonate induction. Synthesis of these enzymes is also regulated by the CRP-cAMP complex which mediates catabolite repression. Analysis of the regulatory regions of ogl and pelE allowed us to identify possible CRP-binding sites for these two genes.(ABSTRACT TRUNCATED AT 250 WORDS)
Supplementary Material for: The arabidopsis cyclic nucleotide interactome
Donaldson, Lara; Meier, Stuart; Gehring, Christoph A
2016-01-01
Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.
The Bryopsis hypnoides plastid genome: multimeric forms and complete nucleotide sequence.
Directory of Open Access Journals (Sweden)
Fang Lü
Full Text Available BACKGROUND: Bryopsis hypnoides Lamouroux is a siphonous green alga, and its extruded protoplasm can aggregate spontaneously in seawater and develop into mature individuals. The chloroplast of B. hypnoides is the biggest organelle in the cell and shows strong autonomy. To better understand this organelle, we sequenced and analyzed the chloroplast genome of this green alga. PRINCIPAL FINDINGS: A total of 111 functional genes, including 69 potential protein-coding genes, 5 ribosomal RNA genes, and 37 tRNA genes were identified. The genome size (153,429 bp, arrangement, and inverted-repeat (IR-lacking structure of the B. hypnoides chloroplast DNA (cpDNA closely resembles that of Chlorella vulgaris. Furthermore, our cytogenomic investigations using pulsed-field gel electrophoresis (PFGE and southern blotting methods showed that the B. hypnoides cpDNA had multimeric forms, including monomer, dimer, trimer, tetramer, and even higher multimers, which is similar to the higher order organization observed previously for higher plant cpDNA. The relative amounts of the four multimeric cpDNA forms were estimated to be about 1, 1/2, 1/4, and 1/8 based on molecular hybridization analysis. Phylogenetic analyses based on a concatenated alignment of chloroplast protein sequences suggested that B. hypnoides is sister to all Chlorophyceae and this placement received moderate support. CONCLUSION: All of the results suggest that the autonomy of the chloroplasts of B. hypnoides has little to do with the size and gene content of the cpDNA, and the IR-lacking structure of the chloroplasts indirectly demonstrated that the multimeric molecules might result from the random cleavage and fusion of replication intermediates instead of recombinational events.
Directory of Open Access Journals (Sweden)
Marcos César Lima de Mendonça
2011-06-01
Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.
Directory of Open Access Journals (Sweden)
Mandoli Dina F
2010-10-01
Full Text Available Abstract Background Despite considerable progress in our understanding of land plant phylogeny, several nodes in the green tree of life remain poorly resolved. Furthermore, the bulk of currently available data come from only a subset of major land plant clades. Here we examine early land plant evolution using complete plastome sequences including two previously unexamined and phylogenetically critical lineages. To better understand the evolution of land plants and their plastomes, we examined aligned nucleotide sequences, indels, gene and nucleotide composition, inversions, and gene order at the boundaries of the inverted repeats. Results We present the plastome sequences of Equisetum arvense, a horsetail, and of Isoetes flaccida, a heterosporous lycophyte. Phylogenetic analysis of aligned nucleotides from 49 plastome genes from 43 taxa supported monophyly for the following clades: embryophytes (land plants, lycophytes, monilophytes (leptosporangiate ferns + Angiopteris evecta + Psilotum nudum + Equisetum arvense, and seed plants. Resolution among the four monilophyte lineages remained moderate, although nucleotide analyses suggested that P. nudum and E. arvense form a clade sister to A. evecta + leptosporangiate ferns. Results from phylogenetic analyses of nucleotides were consistent with the distribution of plastome gene rearrangements and with analysis of sequence gaps resulting from insertions and deletions (indels. We found one new indel and an inversion of a block of genes that unites the monilophytes. Conclusions Monophyly of monilophytes has been disputed on the basis of morphological and fossil evidence. In the context of a broad sampling of land plant data we find several new pieces of evidence for monilophyte monophyly. Results from this study demonstrate resolution among the four monilophytes lineages, albeit with moderate support; we posit a clade consisting of Equisetaceae and Psilotaceae that is sister to the "true ferns
De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân
2016-07-27
The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
DEFF Research Database (Denmark)
Behn-Krappa, A; Mollenhauer, J; Doerfler, W
1993-01-01
The seemingly autonomous amplification of naturally occurring triplet repeat sequences in the human genome has been implicated in the causation of human genetic disease, such as the fragile X (Martin-Bell) syndrome, myotonic dystrophy (Curshmann-Steinert), spinal and bulbar muscular atrophy...
Directory of Open Access Journals (Sweden)
Alban eRamette
2014-11-01
Full Text Available Oligotyping is a novel, supervised computational method that classifies closely related sequences into oligotypes (OTs based on subtle nucleotide variations (Eren et al. 2013. Its application to microbial datasets has helped reveal ecological patterns which are often hidden by the way sequence data are currently clustered to define operational taxonomic units (OTUs. Here, we implemented the OT entropy decomposition procedure and its unsupervised version, Minimal Entropy Decomposition (MED; Eren et al. 2014, in the statistical programming language and environment, R. The aims are to facilitate the integration of computational routines, interactive statistical analyses, and visualization into a single framework. In addition, two complementary approaches are implemented: 1 An analytical method (the broken stick model is proposed to help identify oligotypes of low abundance that could be generated by chance alone and 2 a one-pass profiling (OP method, to efficiently identify those OTUs whose subsequent oligotyping would be most promising. These enhancements are especially useful for large datasets, where a manual screening of entropy analysis results and the creation of a full set of OTs may not be feasible. The package and procedures are illustrated by several tutorials and examples.
Energy Technology Data Exchange (ETDEWEB)
von Nickisch-Rosenegk, Markus; Brown, Wesley M.; Boore, Jeffrey L.
2001-01-01
Using ''long-PCR'' we have amplified in overlapping fragments the complete mitochondrial genome of the tapeworm Hymenolepis diminuta (Platyhelminthes: Cestoda) and determined its 13,900 nucleotide sequence. The gene content is the same as that typically found for animal mitochondrial DNA (mtDNA) except that atp8 appears to be lacking, a condition found previously for several other animals. Despite the small size of this mtDNA, there are two large non-coding regions, one of which contains 13 repeats of a 31 nucleotide sequence and a potential stem-loop structure of 25 base pairs with an 11-member loop. Large potential secondary structures are identified also for the non-coding regions of two other cestode mtDNAs. Comparison of the mitochondrial gene arrangement of H. diminuta with those previously published supports a phylogenetic position of flatworms as members of the Eutrochozoa, rather than being basal to either a clade of protostomes or a clade of coelomates.
Directory of Open Access Journals (Sweden)
Salem Mohamed
2009-11-01
Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In
Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E
2009-11-25
To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the
Vongerichten, K F; Klein, J R; Matern, H; Plapp, R
1994-10-01
Cell extracts of Lactobacillus delbrueckii subsp. lactis DSM 7290 were found to exhibit unique peptolytic ability against unusual beta-alanyl-dipeptides. In order to clone the gene encoding this activity, designated pepV, a gene library of strain DSM 7290 genomic DNA, prepared in the low-copy-number plasmid pLG339, was screened for heterologous expression in Escherichia coli. Recombinant clones harbouring pepV were identified by their ability to allow the utilization of carnosine (beta-alanyl-histidine) as a source of histidine by the E. coli mutant strain UK197 (pepD, hisG). Complementation was observed in a colony harbouring a recombinant plasmid (pKV101), carrying pepV. A 2.4 kb fragment containing pepV was subcloned and its nucleotide sequence revealed an open reading frame (ORF) of 1413 nucleotides, corresponding to a protein with predicted molecular mass of 51998 Da. A single transcription initiation site 71 bp upstream of the ATG translational start codon was identified by primer extension. No significant homology was detected between pepV or its deduced amino acid sequence with any entry in the databases. The only similarity was found in a region conserved in the ArgE/DapE/CPG2/YscS family of proteins. This observation, and protease inhibitor studies, indicated that pepV is of the metalloprotease type. A second ORF present in the sequenced fragment showed extensive homology to a variety of amino acid permeases from E. coli and Saccharomyces cerevisiae.
Repeat-Associated Plasticity in the Helicobacter pylori RD Gene Family▿ †
Shak, Joshua R.; Dick, Jonathan J.; Meinersmann, Richard J.; Perez-Perez, Guillermo I.; Blaser, Martin J.
2009-01-01
The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3′ region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5′ region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host. PMID:19749042
The Pentapeptide Repeat Proteins
Vetting, Matthew W.; Hegde, Subray S.; Fajardo, J. Eduardo; Fiser, Andras; Roderick, Steven L.; Takiff, Howard E.; Blanchard, John S.
2006-01-01
The Pentapeptide Repeat Protein (PRP) family has over 500 members in the prokaryotic and eukaryotic kingdoms. These proteins are composed of, or contain domains composed of, tandemly repeated amino acid sequences with a consensus sequence of [S,T,A,V][D,N][L,F]-[S,T,R][G]. The biochemical function of the vast majority of PRP family members is unknown. The three-dimensional structure of the first member of the PRP family was determined for the fluoroquinolone resistance protein (MfpA) from Myc...
Complete Genomic Sequence of Border Disease Virus, a Pestivirus from Sheep
Becher, Paul; Orlich, Michaela; Thiel, Heinz-Jürgen
1998-01-01
The genus Pestivirus of the family Flaviviridae comprises three established species, namely, bovine viral diarrhea virus (BVDV), classical swine fever virus (CSFV), and border disease virus from sheep (BDV). In this study, we report the first complete nucleotide sequence of BDV, that of strain X818. The genome is 12,333 nucleotides long and contains one long open reading frame encoding 3,895 amino acids. The 5′ noncoding region (NCR) of BDV X818 consists of 372 nucleotides and is thus similar in length to the 5′ NCR reported for other pestiviruses. The 3′ NCR of X818 is 273 nucleotides long and thereby at least 32 nucleotides longer than the 3′ NCR of pestiviruses analyzed thus far. Within the 3′ NCR of BDV X818, the sequence motif TATTTATTTA was identified at four locations. The same repeat was found at two or three locations within the 3′ NCR of different CSFV isolates but was absent in the 3′ NCR of BVDV. Analysis of five additional BDV strains showed that the 3′ NCR sequences are highly conserved within this species. Comparison of the deduced amino acid sequence of X818 with the ones of other pestiviruses allowed the prediction of polyprotein cleavage sites which were conserved with regard to the structural proteins. It has been reported for two BVDV strains that cleavage at the nonstructural (NS) protein sites 3/4A, 4A/4B, 4B/5A, and 5A/5B is mediated by the NS3 serine protease and for each site a conserved leucine was found at the P1 position followed by either serine or alanine at P1′ (N. Tautz, K. Elbers, D. Stoll, G. Meyers, and H.-J. Thiel, J. Virol. 71:5415–5422, 1997; J. Xu, E. Mendez, P. R. Caron, C. Lin, M. A. Murcko, M. S. Collett, and C. M. Rice, J. Virol. 71:5312–5322). Interestingly, P1′ of the predicted NS5A/5B cleavage site of BDV is represented by an asparagine residue. Transient expression studies demonstrated that this unusual NS5A/5B processing site is efficiently cleaved by the NS3 serine protease of BDV. PMID
Genome-Wide Analysis of Simple Sequence Repeats in Bitter Gourd (Momordica charantia
Directory of Open Access Journals (Sweden)
Junjie Cui
2017-06-01
Full Text Available Bitter gourd (Momordica charantia is widely cultivated as a vegetable and medicinal herb in many Asian and African countries. After the sequencing of the cucumber (Cucumis sativus, watermelon (Citrullus lanatus, and melon (Cucumis melo genomes, bitter gourd became the fourth cucurbit species whose whole genome was sequenced. However, a comprehensive analysis of simple sequence repeats (SSRs in bitter gourd, including a comparison with the three aforementioned cucurbit species has not yet been published. Here, we identified a total of 188,091 and 167,160 SSR motifs in the genomes of the bitter gourd lines ‘Dali-11’ and ‘OHB3-1,’ respectively. Subsequently, the SSR content, motif lengths, and classified motif types were characterized for the bitter gourd genomes and compared among all the cucurbit genomes. Lastly, a large set of 138,727 unique in silico SSR primer pairs were designed for bitter gourd. Among these, 71 primers were selected, all of which successfully amplified SSRs from the two bitter gourd lines ‘Dali-11’ and ‘K44’. To further examine the utilization of unique SSR primers, 21 SSR markers were used to genotype a collection of 211 bitter gourd lines from all over the world. A model-based clustering method and phylogenetic analysis indicated a clear separation among the geographic groups. The genomic SSR markers developed in this study have considerable potential value in advancing bitter gourd research.
Directory of Open Access Journals (Sweden)
Venanzetti Federica
2010-01-01
Full Text Available Abstract Background The great variety in sequence, length, complexity, and abundance of satellite DNA has made it difficult to ascribe any function to this genome component. Recent studies have shown that satellite DNA can be transcribed and be involved in regulation of chromatin structure and gene expression. Some satellite DNAs, such as the pDo500 sequence family in Dolichopoda cave crickets, have a catalytic hammerhead (HH ribozyme structure and activity embedded within each repeat. Results We assessed the phylogenetic footprints of the HH ribozyme within the pDo500 sequences from 38 different populations representing 12 species of Dolichopoda. The HH region was significantly more conserved than the non-hammerhead (NHH region of the pDo500 repeat. In addition, stems were more conserved than loops. In stems, several compensatory mutations were detected that maintain base pairing. The core region of the HH ribozyme was affected by very few nucleotide substitutions and the cleavage position was altered only once among 198 sequences. RNA folding of the HH sequences revealed that a potentially active HH ribozyme can be found in most of the Dolichopoda populations and species. Conclusions The phylogenetic footprints suggest that the HH region of the pDo500 sequence family is selected for function in Dolichopoda cave crickets. However, the functional role of HH ribozymes in eukaryotic organisms is unclear. The possible functions have been related to trans cleavage of an RNA target by a ribonucleoprotein and regulation of gene expression. Whether the HH ribozyme in Dolichopoda is involved in similar functions remains to be investigated. Future studies need to demonstrate how the observed nucleotide changes and evolutionary constraint have affected the catalytic efficiency of the hammerhead.
Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A
2009-01-01
The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.
PeakSeeker: a program for interpreting genotypes of mononucleotide repeats
Directory of Open Access Journals (Sweden)
Salipante Stephen J
2009-02-01
Full Text Available Abstract Background Mononucleotide repeat microsatellites are abundant, highly polymorphic DNA sequences, having the potential to serve as valuable genetic markers. Use of mononucleotide microsatellites has been limited by their tendency to produce "stutter", confounding signals from insertions and deletions within the mononucleotide tract that occur during PCR, which complicates interpretation of genotypes by masking the true position of alleles. Consequently, microsatellites with larger repeating subunits (dinucleotide and trinucleotide motifs are used, which produce less stutter but are less genetically heterogeneous and less informative. A method to interpret the genotypes of mononucleotide repeats would permit the widespread use of those highly informative microsatellites in genetic research. Findings We have developed an approach to interpret genotypes of mononucleotide repeats using a software program, named PeakSeeker. PeakSeeker interprets experimental electropherograms as the most likely product of signals from individual alleles. Because mononucleotide tracts demonstrate locus-specific patterns of stutter peaks, this approach requires that the genotype pattern from a single allele is defined for each marker, which can be approximated by genotyping single DNA molecules or homozygotes. We have evaluated the program's ability to discriminate various types of homozygous and heterozygous mononucleotide loci using simulated and experimental data. Conclusion Mononucleotide tracts offer significant advantages over di- and tri-nucleotide microsatellite markers traditionally employed in genetic research. The PeakSeeker algorithm provides a high-throughput means to type mononucleotide tracts using conventional and widely implemented fragment length polymorphism genotyping. Furthermore, the PeakSeeker algorithm could potentially be adapted to improve, and perhaps to standardize, the analysis of conventional microsatellite genotypes.
Yao, Xiaohong; Tang, Ping; Li, Zuozhou; Li, Dawei; Liu, Yifei; Huang, Hongwen
2015-01-01
Actinidia chinensis is an important economic plant belonging to the basal lineage of the asterids. Availability of a complete Actinidia chloroplast genome sequence is crucial to understanding phylogenetic relationships among major lineages of angiosperms and facilitates kiwifruit genetic improvement. We report here the complete nucleotide sequences of the chloroplast genomes for Actinidia chinensis and A. chinensis var deliciosa obtained through de novo assembly of Illumina paired-end reads produced by total DNA sequencing. The total genome size ranges from 155,446 to 157,557 bp, with an inverted repeat (IR) of 24,013 to 24,391 bp, a large single copy region (LSC) of 87,984 to 88,337 bp and a small single copy region (SSC) of 20,332 to 20,336 bp. The genome encodes 113 different genes, including 79 unique protein-coding genes, 30 tRNA genes and 4 ribosomal RNA genes, with 16 duplicated in the inverted repeats, and a tRNA gene (trnfM-CAU) duplicated once in the LSC region. Comparisons of IR boundaries among four asterid species showed that IR/LSC borders were extended into the 5' portion of the psbA gene and IR contraction occurred in Actinidia. The clap gene has been lost from the chloroplast genome in Actinidia, and may have been transferred to the nucleus during chloroplast evolution. Twenty-seven polymorphic simple sequence repeat (SSR) loci were identified in the Actinidia chloroplast genome. Maximum parsimony analyses of a 72-gene, 16 taxa angiosperm dataset strongly support the placement of Actinidiaceae in Ericales within the basal asterids.
Wanner, Roger M; Güthlein, Carolin; Springer, Burkhard; Böttger, Erik C; Ackermann, Martin
2008-05-28
The rate at which a stretch of DNA mutates is determined by the cellular systems for DNA replication and repair, and by the nucleotide sequence of the stretch itself. One sequence feature with a particularly strong influence on the mutation rate are nucleotide repeats. Some microbial pathogens use nucleotide repeats in their genome to stochastically vary phenotypic traits and thereby evade host defense. However, such unstable sequences also come at a cost, as mutations are often deleterious. Here, we analyzed how these opposing forces shaped genome stability in the human pathogen Mycobacterium tuberculosis. M. tuberculosis lacks a mismatch repair system, and this renders nucleotide repeats particularly unstable. We found that proteins of M. tuberculosis are encoded by using codons in a context-dependent manner that prevents the emergence of nucleotide repeats. This context-dependent codon choice leads to a strong decrease in the estimated frame-shift mutation rate and thus to an increase in genome stability. These results indicate that a context-specific codon choice can partially compensate for the lack of a mismatch repair system, and helps to maintain genome integrity in this pathogen.
Directory of Open Access Journals (Sweden)
Ackermann Martin
2008-05-01
Full Text Available Abstract Background The rate at which a stretch of DNA mutates is determined by the cellular systems for DNA replication and repair, and by the nucleotide sequence of the stretch itself. One sequence feature with a particularly strong influence on the mutation rate are nucleotide repeats. Some microbial pathogens use nucleotide repeats in their genome to stochastically vary phenotypic traits and thereby evade host defense. However, such unstable sequences also come at a cost, as mutations are often deleterious. Here, we analyzed how these opposing forces shaped genome stability in the human pathogen Mycobacterium tuberculosis. M. tuberculosis lacks a mismatch repair system, and this renders nucleotide repeats particularly unstable. Results We found that proteins of M. tuberculosis are encoded by using codons in a context-dependent manner that prevents the emergence of nucleotide repeats. This context-dependent codon choice leads to a strong decrease in the estimated frame-shift mutation rate and thus to an increase in genome stability. Conclusion These results indicate that a context-specific codon choice can partially compensate for the lack of a mismatch repair system, and helps to maintain genome integrity in this pathogen.
DEFF Research Database (Denmark)
Peng, Xu; Brügger, Kim; Shen, Biao
2003-01-01
terminally modified and corresponds to SSO454, an open reading frame of previously unassigned function. It binds specifically to DNA fragments carrying double and single repeat sequences, binding on one side of the repeat structure, and producing an opening of the opposite side of the DNA structure. It also...... recognizes both main families of repeat sequences in S. solfataricus. The recombinant protein, expressed in Escherichia coli, showed the same binding properties to the SRSR repeat as the native one. The SSO454 protein exhibits a tripartite internal repeat structure which yields a good sequence match...... with a helix-turn-helix DNA-binding motif. Although this putative motif is shared by other archaeal proteins, orthologs of SSO454 were only detected in species within the Sulfolobus genus and in the closely related Acidianus genus. We infer that the genus-specific protein induces an opening of the structure...
Joy, Nisha; Asha, Srinivasan; Mallika, Vijayan; Soniya, Eppurathu Vasudevan
2013-01-01
Next generation sequencing has an advantageon transformational development of species with limited available sequence data as it helps to decode the genome and transcriptome. We carried out the de novo sequencing using illuminaHiSeq™ 2000 to generate the first leaf transcriptome of black pepper (Piper nigrum L.), an important spice variety native to South India and also grown in other tropical regions. Despite the economic and biochemical importance of pepper, a scientifically rigorous study at the molecular level is far from complete due to lack of sufficient sequence information and cytological complexity of its genome. The 55 million raw reads obtained, when assembled using Trinity program generated 2,23,386 contigs and 1,28,157 unigenes. Reports suggest that the repeat-rich genomic regions give rise to small non-coding functional RNAs. MicroRNAs (miRNAs) are the most abundant type of non-coding regulatory RNAs. In spite of the widespread research on miRNAs, little is known about the hair-pin precursors of miRNAs bearing Simple Sequence Repeats (SSRs). We used the array of transcripts generated, for the in silico prediction and detection of ‘43 pre-miRNA candidates bearing different types of SSR motifs’. The analysis identified 3913 different types of SSR motifs with an average of one SSR per 3.04 MB of thetranscriptome. About 0.033% of the transcriptome constituted ‘pre-miRNA candidates bearing SSRs’. The abundance, type and distribution of SSR motifs studied across the hair-pin miRNA precursors, showed a significant bias in the position of SSRs towards the downstream of predicted ‘pre-miRNA candidates’. The catalogue of transcripts identified, together with the demonstration of reliable existence of SSRs in the miRNA precursors, permits future opportunities for understanding the genetic mechanism of black pepper and likely functions of ‘tandem repeats’ in miRNAs. PMID:23469176
Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.
Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro
2015-11-01
The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Assembly of Repeat Content Using Next Generation Sequencing Data
Energy Technology Data Exchange (ETDEWEB)
labutti, Kurt; Kuo, Alan; Grigoriev, Igor; Copeland, Alex
2014-03-17
Repetitive organisms pose a challenge for short read assembly, and typically only unique regions and repeat regions shorter than the read length, can be accurately assembled. Recently, we have been investigating the use of Pacific Biosciences reads for de novo fungal assembly. We will present an assessment of the quality and degree of repeat reconstruction possible in a fungal genome using long read technology. We will also compare differences in assembly of repeat content using short read and long read technology.
Directory of Open Access Journals (Sweden)
Budzanivska I. G.
2014-03-01
Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.
Directory of Open Access Journals (Sweden)
Odvody Gary N
2008-11-01
Full Text Available Abstract Background A recent outbreak of sorghum downy mildew in Texas has led to the discovery of both metalaxyl resistance and a new pathotype in the causal organism, Peronosclerospora sorghi. These observations and the difficulty in resolving among phylogenetically related downy mildew pathogens dramatically point out the need for simply scored markers in order to differentiate among isolates and species, and to study the population structure within these obligate oomycetes. Here we present the initial results from the use of a biotin capture method to discover, clone and develop PCR primers that permit the use of simple sequence repeats (microsatellites to detect differences at the DNA level. Results Among the 55 primers pairs designed from clones from pathotype 3 of P. sorghi, 36 flanked microsatellite loci containing simple repeats, including 28 (55% with dinucleotide repeats and 6 (11% with trinucleotide repeats. A total of 22 microsatellites with CA/AC or GT/TG repeats were the most abundant (40% and GA/AG or CT/TC types contribute 15% in our collection. When used to amplify DNA from 19 isolates from P. sorghi, as well as from 5 related species that cause downy mildew on other hosts, the number of different bands detected for each SSR primer pair using a LI-COR- DNA Analyzer ranged from two to eight. Successful cross-amplification for 12 primer pairs studied in detail using DNA from downy mildews that attack maize (P. maydis & P. philippinensis, sugar cane (P. sacchari, pearl millet (Sclerospora graminicola and rose (Peronospora sparsa indicate that the flanking regions are conserved in all these species. A total of 15 SSR amplicons unique to P. philippinensis (one of the potential threats to US maize production were detected, and these have potential for development of diagnostic tests. A total of 260 alleles were obtained using 54 microsatellites primer combinations, with an average of 4.8 polymorphic markers per SSR across 34
Perumal, Ramasamy; Nimmakayala, Padmavathi; Erattaimuthu, Saradha R; No, Eun-Gyu; Reddy, Umesh K; Prom, Louis K; Odvody, Gary N; Luster, Douglas G; Magill, Clint W
2008-11-29
A recent outbreak of sorghum downy mildew in Texas has led to the discovery of both metalaxyl resistance and a new pathotype in the causal organism, Peronosclerospora sorghi. These observations and the difficulty in resolving among phylogenetically related downy mildew pathogens dramatically point out the need for simply scored markers in order to differentiate among isolates and species, and to study the population structure within these obligate oomycetes. Here we present the initial results from the use of a biotin capture method to discover, clone and develop PCR primers that permit the use of simple sequence repeats (microsatellites) to detect differences at the DNA level. Among the 55 primers pairs designed from clones from pathotype 3 of P. sorghi, 36 flanked microsatellite loci containing simple repeats, including 28 (55%) with dinucleotide repeats and 6 (11%) with trinucleotide repeats. A total of 22 microsatellites with CA/AC or GT/TG repeats were the most abundant (40%) and GA/AG or CT/TC types contribute 15% in our collection. When used to amplify DNA from 19 isolates from P. sorghi, as well as from 5 related species that cause downy mildew on other hosts, the number of different bands detected for each SSR primer pair using a LI-COR- DNA Analyzer ranged from two to eight. Successful cross-amplification for 12 primer pairs studied in detail using DNA from downy mildews that attack maize (P. maydis & P. philippinensis), sugar cane (P. sacchari), pearl millet (Sclerospora graminicola) and rose (Peronospora sparsa) indicate that the flanking regions are conserved in all these species. A total of 15 SSR amplicons unique to P. philippinensis (one of the potential threats to US maize production) were detected, and these have potential for development of diagnostic tests. A total of 260 alleles were obtained using 54 microsatellites primer combinations, with an average of 4.8 polymorphic markers per SSR across 34 Peronosclerospora, Peronospora and Sclerospora
Franco, Bernardo; González-Cerón, Gabriela; Servín-González, Luis
2003-11-01
The functionality of direct and inverted repeat sequences inside the cis acting locus of transfer (clt) of the Streptomyces plasmid pJV1 was determined by testing the effect of different deletions on plasmid transfer. The results show that the single most important element for pJV1 clt function is a series of evenly spaced 9 bp long direct repeats which match the consensus CCGCACA(C/G)(C/G), since their deletion caused a dramatic reduction in plasmid transfer. The presence of these repeats in the absence of any other clt sequences allowed plasmid transfer to occur at a frequency that was at least two orders of magnitude higher than that obtained in the complete absence of clt. A database search revealed regions with a similar organization, and in the same position, in Streptomyces plasmids pSN22 and pSLS, which have transfer proteins homologous to those of pJV1.
International Nuclear Information System (INIS)
Azhar Mohamad; Muhammad Hanif Azhari N; Siti Norhayati Ismail
2014-01-01
Aquilaria sp. belongs to the Thymelaeaceae family and is well distributed in Asia region. The species has multipurpose use from root to shoot and is an economically important crop, which generates wide interest in understanding genetic diversity of the species. Knowledge on DNA-based markers has become a prerequisite for more effective application of molecular marker techniques in breeding and mapping programs. In this work, both targeted genes and tandem repeat sequences were used for DNA fingerprinting in Aquilaria sp. A total of 100 ISSR (inter simple sequence repeat) primers and 50 combination pairs of specific primers derived from conserved region of a specific protein known as system in were optimized. 38 ISSR primers were found affirmative for polymorphism evaluation study and were generated from both specific and degenerate ISSR primers. And one utmost combination of system in primers showed significant results in distinguishing the Aquilaria sp. In conclusion, polymorphism derived from ISSR profiling and targeted stress genes of protein system in proved as a powerful approach for identification and molecular classification of Aquilaria sp. which will be useful for diversification in identifying any mutant lines derived from nature. (author)
Li, Shufen; Zhang, Guojun; Li, Xu; Wang, Lianjun; Yuan, Jinhong; Deng, Chuanliang; Gao, Wujun
2016-06-01
Garden asparagus (Asparagus officinalis), an important vegetable cultivated worldwide, can also serve as a model dioecious plant species in the study of sex determination and sex chromosome evolution. However, limited DNA marker resources have been developed and used for this species. To expand these resources, we examined the DNA sequences for simple sequence repeats (SSRs) in 163,406 scaffolds representing approximately 400 Mbp of the A. officinalis genome. A total of 87,576 SSRs were identified in 59,565 scaffolds. The most abundant SSR repeats were trinucleotide and tetranucleotide, accounting for 29.2 and 29.1% of the total SSRs, respectively, followed by di-, penta-, hexa-, hepta-, and octanucleotides. The AG motif was most common among dinucleotides and was also the most frequent motif in the entire A. officinalis genome, representing 14.7% of all SSRs. A total of 41,917 SSR primers pairs were designed to amplify SSRs. Twenty-two genomic SSR markers were tested in 39 asparagus accessions belonging to ten cultivars and one accession of Asparagus setaceus for determination of genetic diversity. The intra-species polymorphism information content (PIC) values of the 22 genomic SSR markers were intermediate, with an average of 0.41. The genetic diversity between the ten A. officinalis cultivars was low, and the UPGMA dendrogram was largely unrelated to cultivars. It is here suggested that the sex of individuals is an important factor influencing the clustering results. The information reported here provides new information about the organization of the microsatellites in A. officinalis genome and lays a foundation for further genetic studies and breeding applications of A. officinalis and related species. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Broderick, T.P.; Schaff, D.A.; Bertino, A.M.; Dush, M.K.; Tischfield, J.A.; Stambrook, P.J.
1987-01-01
The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function
Mir, Mohammad A; Panganiban, Antonito T
2010-09-01
Hantavirus nucleocapsid protein (N) can replace the cellular cap-binding complex, eukaryotic initiation factor 4F (eIF4F), to mediate translation initiation. Although N can augment translation initiation of nonviral mRNA, initiation of viral mRNA by N is superior. All members of the Bunyaviridae family, including the species of the hantavirus genus, express either three or four primary mRNAs from their tripartite negative-sense genomes. The 5' ends of the mRNAs contain nonviral heterologous oligonucleotides that originate from endonucleolytic cleavage of cellular mRNA during the process of cap snatching. In the hantaviruses these caps terminate with a 3' G residue followed by nucleotides arising from the viral template. Further, the 5' untranslated region (UTR) of viral mRNA uniformly contains, near the 5' end, either two or three copies of the triplet repeat sequence, UAGUAG or UAGUAGUAG. Through analysis of a panel of mutants with mutations in the viral UTR, we found that the sequence GUAGUAG is sufficient for preferential N-mediated translation initiation and for high-affinity binding of N to the UTR. This heptanucleotide sequence is present in viral mRNA containing either two or three copies of the triplet repeat.
Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping
2010-12-01
Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.
Naveilhan, P; Baudet, C; Jabbour, W; Wion, D
1994-09-01
A model that may explain the limited division potential of certain cells such as human fibroblasts in culture is presented. The central postulate of this theory is that there exists, prior to certain key exons that code for materials needed for cell division, a unique sequence of specific repeating segments of DNA. One copy of such repeating segments is deleted during each cell cycle in cells that are not protected from such deletion through methylation of their cytosine residues. According to this theory, the means through which such repeated sequences are removed, one per cycle, is through the sequential action of enzymes that act much as bacterial restriction enzymes do--namely to produce scissions in both strands of DNA in areas that correspond to the DNA base sequence recognition specificities of such enzymes. After the first scission early in a replicative cycle, that enzyme becomes inhibited, but the cleavage of the first site exposes the closest site in the repetitive element to the action of a second restriction enzyme after which that enzyme also becomes inhibited. Then repair occurs, regenerating the original first site. Through this sequential activation and inhibition of two different restriction enzymes, only one copy of the repeating sequence is deleted during each cell cycle. In effect, the repeating sequence operates as a precise counter of the numbers of cell doubling that have occurred since the cells involved differentiated during development.
Directory of Open Access Journals (Sweden)
Juana M. Córdoba
2010-11-01
Full Text Available Microsatellite markers or simple sequence repeat (SSR loci are useful for diversity characterization and genetic–physical mapping. Different in silico microsatellite search methods have been developed for mining bacterial artificial chromosome (BAC end sequences for SSRs. The overall goal of this study was genome characterization based on SSRs in 89,017 BAC end sequences (BESs from the G19833 common bean ( L. library. Another objective was to identify new SSR taking into account three tandem motif identification programs (Automated Microsatellite Marker Development [AMMD], Tandem Repeats Finder [TRF], and SSRLocator [SSRL]. Among the microsatellite search engines, SSRL identified the highest number of SSRs; however, when primer design was attempted, the number dropped due to poor primer design regions. Automated Microsatellite Marker Development software identified many SSRs with valuable AT/TA or AG/TC motifs, while TRF found fewer SSRs and produced no primers. A subgroup of 323 AT-rich, di-, and trinucleotide SSRs were selected from the AMMD results and used in a parental survey with DOR364 and G19833, of which 75 could be mapped in the corresponding population; these represented 4052 BAC clones. Together with 92 previously mapped BES- and 114 non-BES-derived markers, a total of 280 SSRs were included in the polymerase chain reaction (PCR-based map, integrating a total of 8232 BAC clones in 162 contigs from the physical map.
Lack of variation of ATTCT pentanucleotide repeats at ATXN10 gene ...
Indian Academy of Sciences (India)
ized incoordination of gait, speech and limb movements. (Tang et ... ataxia (SCA); ATXN10 gene; nucleotide repeat; mutation detection; capillary electrophoresis; human genetics. ... Southern blot analysis using EcoRI was performed to distin-.
Development of a single nucleotide polymorphism (SNP) marker for ...
African Journals Online (AJOL)
The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...
Jiang, Qun; Li, Qi; Yu, Hong; Kong, Lingfeng
2011-06-01
The sea cucumber Apostichopus japonicus is a commercially and ecologically important species in China. A total of 3056 potential unigenes were generated after assembling 7597 A. japonicus expressed sequence tags (ESTs) downloaded from Gen-Bank. Two hundred and fifty microsatellite-containing ESTs (8.18%) and 299 simple sequence repeats (SSRs) were detected. The average density of SSRs was 1 per 7.403 kb of EST after redundancy elimination. Di-nucleotide repeat motifs appeared to be the most abundant type with a percentage of 69.90%. Of the 126 primer pairs designed, 90 amplified the expected products and 43 showed polymorphism in 30 individuals tested. The number of alleles per locus ranged from 2 to 26 with an average of 7.0 alleles, and the observed and expected heterozygosities varied from 0.067 to 1.000 and from 0.066 to 0.959, respectively. These new EST-derived microsatellite markers would provide sufficient polymorphism for population genetic studies and genome mapping of this sea cucumber species.
Marzo, Mar; Bello, Xabier; Puig, Marta; Maside, Xulio; Ruiz, Alfredo
2013-02-04
Galileo is a transposable element responsible for the generation of three chromosomal inversions in natural populations of Drosophila buzzatii. Although the most characteristic feature of Galileo is the long internally-repetitive terminal inverted repeats (TIRs), which resemble the Drosophila Foldback element, its transposase-coding sequence has led to its classification as a member of the P-element superfamily (Class II, subclass 1, TIR order). Furthermore, Galileo has a wide distribution in the genus Drosophila, since it has been found in 6 of the 12 Drosophila sequenced genomes. Among these species, D. mojavensis, the one closest to D. buzzatii, presented the highest diversity in sequence and structure of Galileo elements. In the present work, we carried out a thorough search and annotation of all the Galileo copies present in the D. mojavensis sequenced genome. In our set of 170 Galileo copies we have detected 5 Galileo subfamilies (C, D, E, F, and X) with different structures ranging from nearly complete, to only 2 TIR or solo TIR copies. Finally, we have explored the structural and length variation of the Galileo copies that point out the relatively frequent rearrangements within and between Galileo elements. Different mechanisms responsible for these rearrangements are discussed. Although Galileo is a transposable element with an ancient history in the D. mojavensis genome, our data indicate a recent transpositional activity. Furthermore, the dynamism in sequence and structure, mainly affecting the TIRs, suggests an active exchange of sequences among the copies. This exchange could lead to new subfamilies of the transposon, which could be crucial for the long-term survival of the element in the genome.
Bellerophon: a program to detect chimeric sequences in multiple sequence alignments.
Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip
2004-09-22
Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments. Bellerophon is available as an interactive web server at http://foo.maths.uq.edu.au/~huber/bellerophon.pl
One-Step PCR Sequencing. Final Technical Progress Report for February 15, 1997 - November 30, 2001
Energy Technology Data Exchange (ETDEWEB)
Shaw, B. R.
2004-04-16
We investigated new chemistries and alternate approaches for direct gene sequencing and detection based on the properties of boron-substituted nucleotides as chain delimiters in lieu of conventional chain terminators. Chain terminators, such as the widely used Sanger dideoxynucleotide truncators, stop DNA synthesis during replication and hence are incompatible with further PCR amplification. Chain delimiters, on the other hand, are chemically-modified, ''stealth'' nucleotides that act like normal nucleotides in DNA synthesis and PCR amplification, but can be unmasked following chain extension and exponential amplification. Specifically, chain delimiters give rise to an alternative sequencing strategy based on selective degradation of DNA chains generated by PCR amplification with modified nucleotides. The method as originally devised employed template-directed enzymatic, random incorporation of small amounts of boron-modified nucleotides (e.g., 2'-deoxynucleoside 5'-alpha-[P-borano]- triphosphates) during PCR amplification. Rather than incorporation of dideoxy chain terminators, which are less efficiently incorporated in PCR-based amplification than natural deoxynucleotides, our method is based on selective incorporation and exonuclease degradation of DNA chains generated by efficient PCR amplification of chemically-modified ''stealth'' nucleotides. The stealth nucleotides have a boranophosphate group instead of a normal phosphate, yet behave like normal nucleotides during PCR-amplification. The unique feature of our method is that the position of the stealth nucleotide, and hence DNA sequencing fragments, are revealed at the desired, appropriate moment following PCR amplification. During the current grant period, a variety of new boron-modified nucleotides were synthesized, and new chemistries and enzymatic methods and combinations thereof were explored to improve the method and study the effects of borane modified
International Nuclear Information System (INIS)
Deen, K.C.; Sweet, R.W.
1986-01-01
Sequences in the human genome with homology to the murine mammary tumor virus (MMTV) pol gene were isolated from a human phage library. Ten clones with extensive pol homology were shown to define five separate loci. These loci share common sequences immediately adjacent to the pol-like segments and, in addition, contain a related repeat element which bounds this region. This organization is suggestive of a proviral structure. The authors estimate that the human genome contains 30 to 40 copies of these pol-related sequences. The pol region of one of the cloned segments (HM16) and the complete MMTV pol gene were sequenced and compared. The nucleotide homology between these pol sequences is 52% and is concentrated in the terminal regions. The MMTV pol gene contains a single long open reading frame encoding 899 amino acids and is demarcated from the partially overlapping putative gag gene by termination codons and a shift in translational reading frame. The pol sequence of HM16 is multiply terminated but does contain open reading frames which encode 370, 105, and 112 amino acids residues in separate reading frames. The authors deduced a composite pol protein sequence for HM16 by aligning it to the MMTV pol gene and then compared these sequences with other retroviral pol protein sequences. Conserved sequences occur in both the amino and carboxyl regions which lie within the polymerase and endonuclease domains of pol, respectively
C9orf72 hexanucleotide repeat expansions in Chinese sporadic amyotrophic lateral sclerosis.
He, Ji; Tang, Lu; Benyamin, Beben; Shah, Sonia; Hemani, Gib; Liu, Rong; Ye, Shan; Liu, Xiaolu; Ma, Yan; Zhang, Huagang; Cremin, Katie; Leo, Paul; Wray, Naomi R; Visscher, Peter M; Xu, Huji; Brown, Matthew A; Bartlett, Perry F; Mangelsdorf, Marie; Fan, Dongsheng
2015-09-01
A hexanucleotide repeat expansion (HRE) in the C9orf72 gene has been identified as the most common mutation in amyotrophic lateral sclerosis (ALS) among Caucasian populations. We sought to comprehensively evaluate genetic and epigenetic variants of C9orf72 and the contribution of the HRE in Chinese ALS cases. We performed fragment-length and repeat-primed polymerase chain reaction to determine GGGGCC copy number and expansion within the C9orf72 gene in 1092 sporadic ALS (sALS) and 1062 controls from China. We performed haplotype analysis of 23 single-nucleotide polymorphisms within and surrounding C9orf72. The C9orf72 HRE was found in 3 sALS patients (0.3%) but not in control subjects (p = 0.25). For 2 of the cases with the HRE, genotypes of 8 single-nucleotide polymorphisms flanking the HRE were inconsistent with the haplotype reported to be strongly associated with ALS in Caucasian populations. For these 2 individuals, we found hypermethylation of the CpG island upstream of the repeat, an observation not detected in other sALS patients (p HRE were highly associated with repeat lengths >8 repeats implying that both haplotypes may confer instability of repeat length. Copyright © 2015 Elsevier Inc. All rights reserved.
Gritsun, T S; Venugopal, K; Zanotto, P M; Mikhailov, M V; Sall, A A; Holmes, E C; Polkinghorne, I; Frolova, T V; Pogodina, V V; Lashkevich, V A; Gould, E A
1997-05-01
The complete nucleotide sequence of two tick-transmitted flaviviruses, Vasilchenko (Vs) from Siberia and louping ill (LI) from the UK, have been determined. The genomes were respectively, 10928 and 10871 nucleotides (nt) in length. The coding strategy and functional protein sequence motifs of tick-borne flaviviruses are presented in both Vs and LI viruses. The phylogenies based on maximum likelihood, maximum parsimony and distance analysis of the polyproteins, identified Vs virus as a member of the tick-borne encephalitis virus subgroup within the tick-borne serocomplex, genus Flavivirus, family Flaviviridae. Comparative alignment of the 3'-untranslated regions revealed deletions of different lengths essentially at the same position downstream of the stop codon for all tick-borne viruses. Two direct 27 nucleotide repeats at the 3'-end were found only for Vs and LI virus. Immediately following the deletions a region of 332-334 nt with relatively conserved primary structure (67-94% identity) was observed at the 3'-non-coding end of the virus genome. Pairwise comparisons of the nucleotide sequence data revealed similar levels of variation between the coding region, and the 5' and 3'-termini of the genome, implying an equivalent strong selective control for translated and untranslated regions. Indeed the predicted folding of the 5' and 3'-untranslated regions revealed patterns of stem and loop structures conserved for all tick-borne flaviviruses suggesting a purifying selection for preservation of essential RNA secondary structures which could be involved in translational control and replication. The possible implications of these findings are discussed.
Expressed sequence tags (ESTs) and single nucleotide ...
African Journals Online (AJOL)
SERVER
2008-02-19
Feb 19, 2008 ... the discovery of the DNA, a new area of modern plant biotechnology begun. In plant ... Marker Assisted Breeding and Sequence Tagged Sites. (STS) are all in use in modern ...... and behaviour in the honey bee. Genome Res.
Retrieval and Representation of Nucleotide Sequence of ...
African Journals Online (AJOL)
Nigerian Journal of Basic and Applied Science (March, 2013), 21(1): 27-32 ... Full Length R esearch A rticle ... The present study highlights data retrieval and representation. .... the end of information and the start of the sequence on the next ...
Le Gall, O L; Lanneau, M; Candresse, T; Dunez, J
1995-05-01
The RNA-2 of a carrot isolate from the English serotype of tomato black ring nepovirus (TBRV-ED) has been sequenced. It is 4618 nucleotides long and contains one open reading frame encoding a polypeptide of 1344 amino acids. The 5' non-coding region contains three repetitions of a stem-loop structure also conserved in TBRV-Scottish and grapevine chrome mosaic nepovirus (GCMV). The coat protein domain was mapped to the carboxy-terminal one-third of the polyprotein. Sequence comparisons indicate that TBRV-ED RNA-2 probably arose by an RNA recombination event that resulted in the exchange of the putative movement protein gene between TBRV and GCMV.
t2prhd: a tool to study the patterns of repeat evolution
Directory of Open Access Journals (Sweden)
Pénzes Zsolt
2008-01-01
Full Text Available Abstract Background The models developed to characterize the evolution of multigene families (such as the birth-and-death and the concerted models have also been applied on the level of sequence repeats inside a gene/protein. Phylogenetic reconstruction is the method of choice to study the evolution of gene families and also sequence repeats in the light of these models. The characterization of the gene family evolution in view of the evolutionary models is done by the evaluation of the clustering of the sequences with the originating loci in mind. As the locus represents positional information, it is straightforward that in the case of the repeats the exact position in the sequence should be used, as the simple numbering according to repeat order can be misleading. Results We have developed a novel rapid visual approach to study repeat evolution, that takes into account the exact repeat position in a sequence. The "pairwise repeat homology diagram" visualizes sequence repeats detected by a profile HMM in a pair of sequences and highlights their homology relations inferred by a phylogenetic tree. The method is implemented in a Perl script (t2prhd available for downloading at http://t2prhd.sourceforge.net and is also accessible as an online tool at http://t2prhd.brc.hu. The power of the method is demonstrated on the EGF-like and fibronectin-III-like (Fn-III domain repeats of three selected mammalian Tenascin sequences. Conclusion Although pairwise repeat homology diagrams do not carry all the information provided by the phylogenetic tree, they allow a rapid and intuitive assessment of repeat evolution. We believe, that t2prhd is a helpful tool with which to study the pattern of repeat evolution. This method can be particularly useful in cases of large datasets (such as large gene families, as the command line interface makes it possible to automate the generation of pairwise repeat homology diagrams with the aid of scripts.
Directory of Open Access Journals (Sweden)
Steven Y C Tong
Full Text Available We have developed a single nucleotide polymorphism (SNP nucleated high-resolution melting (HRM technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE and an allele specific real-time PCR (AS kinetic PCR SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs and provides a Simpson's Index of Diversity (D of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.
Li, Guang-Qing; Liu, Zi; Shen, Hong-Bin; Yu, Dong-Jun
2016-10-01
As one of the most ubiquitous post-transcriptional modifications of RNA, N 6 -methyladenosine ( [Formula: see text]) plays an essential role in many vital biological processes. The identification of [Formula: see text] sites in RNAs is significantly important for both basic biomedical research and practical drug development. In this study, we designed a computational-based method, called TargetM6A, to rapidly and accurately target [Formula: see text] sites solely from the primary RNA sequences. Two new features, i.e., position-specific nucleotide/dinucleotide propensities (PSNP/PSDP), are introduced and combined with the traditional nucleotide composition (NC) feature to formulate RNA sequences. The extracted features are further optimized to obtain a much more compact and discriminative feature subset by applying an incremental feature selection (IFS) procedure. Based on the optimized feature subset, we trained TargetM6A on the training dataset with a support vector machine (SVM) as the prediction engine. We compared the proposed TargetM6A method with existing methods for predicting [Formula: see text] sites by performing stringent jackknife tests and independent validation tests on benchmark datasets. The experimental results show that the proposed TargetM6A method outperformed the existing methods for predicting [Formula: see text] sites and remarkably improved the prediction performances, with MCC = 0.526 and AUC = 0.818. We also provided a user-friendly web server for TargetM6A, which is publicly accessible for academic use at http://csbio.njust.edu.cn/bioinf/TargetM6A.
Energy Technology Data Exchange (ETDEWEB)
Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W.; Disney, Matthew D. (Scripps)
2012-03-27
RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[{und UU}GGGC(C{und U}G){sub 3}GUCC]{sub 2}, refined to 2.20 and 1.52 {angstrom} resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 x 1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 {angstrom} structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 x 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 x 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 {angstrom} structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 x 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 x 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.
International Nuclear Information System (INIS)
Hurley, L.H.; Needham-VanDevanter, D.R.
1986-01-01
DNA ligands which bind within the minor groove of DNA exhibit varying degrees of sequence selectivity. Factors which contribute to nucleotide sequence recognition by minor groove ligands have been extensively investigated. Electrostatic interactions, ligand and DNA dehydration energies, hydrophobic interactions and steric factors all play significant roles in sequence selectivity in the minor groove. Interestingly, ligand recognition of nucleotide sequence in the minor groove does not involve significant hydrogen bonding. This is in sharp contrast to cellular enzyme and protein recognition of nucleotide sequence, which is achieved in the major groove via specific hydrogen bond formation between individual bases and the ligand. The ability to read nucleotide sequence via hydrogen bonding allows precise binding of proteins to specific DNA sequences. Minor groove ligands examined to date exhibit a much lower sequence specificity, generally binding to a subset of possible sequences, rather than a single sequence. 19 refs., 7 figs
Applications of High-Throughput Nucleotide Sequencing (PhD)
DEFF Research Database (Denmark)
Waage, Johannes
equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...
Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J
2015-01-01
Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required
Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...
Mercati, Francesco; Riccardi, Paolo; Leebens-Mack, Jim; Abenavoli, Maria Rosa; Falavigna, Agostino; Sunseri, Francesco
2013-04-01
Single nucleotide polymorphisms (SNPs) and simple sequence repeats (SSR) are abundant and evenly distributed co-dominant molecular markers in plant genomes. SSRs are valuable for marker assisted breeding and positional cloning of genes associated traits of interest. Although several high throughput platforms have been developed to identify SNP and SSR markers for analysis of segregant plant populations, breeding in garden asparagus (Asparagus officinalis L.) has been limited by a low content of such markers. In this study massively parallel GS-FLX pyro-sequencing technology (454 Life Sciences) has been used to sequence and compare transcriptome from two genotypes: a rust tolerant male (1770) and a susceptible female (G190). A total of 122,963 and 99,368 sequence reads, with an average length of 245.7bp, have been recovered from accessions 1770 and 190 respectively. A computational pipeline has been used to predict and visually inspect putative SNPs and SSR sequences. Analysis of Gene Ontology (GO) slim annotation assignments for all assembled uniscripts indicated that the 24,403 assemblies represent genes from a broad array of functions. Further, over 1800 putative SNPs and 1000 SSRs were detected. One hundred forty-four SNPs together with 60 selected SSRs were validated and used to develop a preliminary genetic map by using a large BC(1) population, derived from 1770 and G190. The abundance of SNPs and SSRs provides a foundation for the development of saturated genetic maps and their utilization in assisted asparagus breeding programs. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Hongliang Liu
Full Text Available Liaoning cashmere goat is a famous goat breed for cashmere wool. In order to increase the transcriptome data and accelerate genetic improvement for this breed, we performed de novo transcriptome sequencing to generate the first expressed sequence tag dataset for the Liaoning cashmere goat, using next-generation sequencing technology.Transcriptome sequencing of Liaoning cashmere goat on a Roche 454 platform yielded 804,601 high-quality reads. Clustering and assembly of these reads produced a non-redundant set of 117,854 unigenes, comprising 13,194 isotigs and 104,660 singletons. Based on similarity searches with known proteins, 17,356 unigenes were assigned to 6,700 GO categories, and the terms were summarized into three main GO categories and 59 sub-categories. 3,548 and 46,778 unigenes had significant similarity to existing sequences in the KEGG and COG databases, respectively. Comparative analysis revealed that 42,254 unigenes were aligned to 17,532 different sequences in NCBI non-redundant nucleotide databases. 97,236 (82.51% unigenes were mapped to the 30 goat chromosomes. 35,551 (30.17% unigenes were matched to 11,438 reported goat protein-coding genes. The remaining non-matched unigenes were further compared with cattle and human reference genes, 67 putative new goat genes were discovered. Additionally, 2,781 potential simple sequence repeats were initially identified from all unigenes.The transcriptome of Liaoning cashmere goat was deep sequenced, de novo assembled, and annotated, providing abundant data to better understand the Liaoning cashmere goat transcriptome. The potential simple sequence repeats provide a material basis for future genetic linkage and quantitative trait loci analyses.
Lin, Heng-Sheng; Chiang, Chih-Yun; Chang, Song-Bin; Kuoh, Chang-Sheng
2011-01-01
Foxtail millet is one of the world's oldest cultivated crops. It has been adopted as a model organism for providing a deeper understanding of plant biology. In this study, 45 simple sequence repeats (SSR) markers of Setaria italica were developed. These markers showing polymorphism were screened in 223 samples from 12 foxtail millet populations around Taiwan. The most common dinucleotide and trinucleotide repeat motifs are AC/TG (84.21%) and CAT (46.15%). The average number of alleles (N(a)), the average heterozygosities observed (H(o)) and expected (H(e)) are 3.73, 0.714, 0.587, respectively. In addition, 24 SSR markers had shown transferability to six related Poaceae species. These new markers provide tools for examining genetic relatedness among foxtail millet populations and other related species. It is suitable for germplasm management and protection in Poaceae.
Directory of Open Access Journals (Sweden)
Moore JE
2006-01-01
Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.
Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC
2006-01-01
Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935
Detection, characterization and evolution of internal repeats in Chitinases of known 3-D structure.
Directory of Open Access Journals (Sweden)
Manigandan Sivaji
Full Text Available Chitinase proteins have evolved and diversified almost in all organisms ranging from prokaryotes to eukaryotes. During evolution, internal repeats may appear in amino acid sequences of proteins which alter the structural and functional features. Here we deciphered the internal repeats from Chitinase and characterized the structural similarities between them. Out of 24 diverse Chitinase sequences selected, six sequences (2CJL, 2DSK, 2XVP, 2Z37, 3EBV and 3HBE did not contain any internal repeats of amino acid sequences. Ten sequences contained repeats of length <50, and the remaining 8 sequences contained repeat length between 50 and 100 residues. Two Chitinase sequences, 1ITX and 3SIM, were found to be structurally similar when analyzed using secondary structure of Chitinase from secondary and 3-Dimensional structure database of Protein Data Bank. Internal repeats of 3N17 and 1O6I were also involved in the ligand-binding site of those Chitinase proteins, respectively. Our analyses enhance our understanding towards the identification of structural characteristics of internal repeats in Chitinase proteins.
Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)
Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.
We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database
Energy Technology Data Exchange (ETDEWEB)
Goldfarb, L.G.; Brown, P.; McCombie, W.R.; Gibbs, C.J. Jr.; Gajdusek, D.C. (National Inst. of Health, Bethesda, MD (United States)); Goldgaber, D. (State Univ. of New York, Stony Brook (United States)); Swergold, G.D. (National Inst. of Health, Bethesda, MD (United States)); Wills, P.R. (Univ. of Auckland (New Zealand)); Cervenakova, L. (Inst. of Preventive and Clinical Medicine, Bratislava (Czechoslovakia)); Baron, H. (Searle Pharmaceuticals, Paris (France))
1991-12-01
The PRNP gene, encoding the amyloid precursor protein that is centrally involved in Creutzfeldt-Jakob disease (CJD), has an unstable region of five variant tandem octapeptide coding repeats between codons 51 and 91. The authors screened a total of 535 individuals for the presence of extra repeats in this region, including patients with sporadic and familial forms of spongiform encephalopathy, members of their families, other neurological and non-neurological patients, and normal controls. They identified three CJD families (in each of which the proband's disease was neuropathologically confirmed and experimentally transmitted to primates) that were heterozygous for alleles with 10, 12, or 13 repeats, some of which had wobble nucleotide substitutions. They also found one individual with 9 repeats and no nucleotide substitutions who had no evidence of neurological disease. These observations, together with data on published British patients with 11 and 14 repeats, strongly suggest that the occurrence of 10 or more octapeptide repeats in the encoded amyloid precursor protein predisposes to CJD.
Nature and distribution of feline sarcoma virus nucleotide sequences.
Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A
1979-01-01
The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544
Prioritizing single-nucleotide polymorphisms and variants associated with clinical mastitis
Directory of Open Access Journals (Sweden)
Suravajhala P
2017-06-01
Full Text Available Prashanth Suravajhala,1 Alfredo Benso2 1Department of Molecular Biology and Genetics, Center for Quantitative Genetics and Genomics, Aarhus University, Aarhus, Denmark; 2Department of Control and Computer Engineering, Politecnico di Torino, Torino, Italy Abstract: Next-generation sequencing technology has provided resources to easily explore and identify candidate single-nucleotide polymorphisms (SNPs and variants. However, there remains a challenge in identifying and inferring the causal SNPs from sequence data. A problem with different methods that predict the effect of mutations is that they produce false positives. In this hypothesis, we provide an overview of methods known for identifying causal variants and discuss the challenges, fallacies, and prospects in discerning candidate SNPs. We then propose a three-point classification strategy, which could be an additional annotation method in identifying causalities. Keywords: clinical mastitis, single-nucleotide polymorphisms, variants, associations, diseases, linkage disequilibrium, GWAS
: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...
Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.
Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook
2014-11-01
As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of
Directed PCR-free engineering of highly repetitive DNA sequences
Directory of Open Access Journals (Sweden)
Preissler Steffen
2011-09-01
Full Text Available Abstract Background Highly repetitive nucleotide sequences are commonly found in nature e.g. in telomeres, microsatellite DNA, polyadenine (poly(A tails of eukaryotic messenger RNA as well as in several inherited human disorders linked to trinucleotide repeat expansions in the genome. Therefore, studying repetitive sequences is of biological, biotechnological and medical relevance. However, cloning of such repetitive DNA sequences is challenging because specific PCR-based amplification is hampered by the lack of unique primer binding sites resulting in unspecific products. Results For the PCR-free generation of repetitive DNA sequences we used antiparallel oligonucleotides flanked by restriction sites of Type IIS endonucleases. The arrangement of recognition sites allowed for stepwise and seamless elongation of repetitive sequences. This facilitated the assembly of repetitive DNA segments and open reading frames encoding polypeptides with periodic amino acid sequences of any desired length. By this strategy we cloned a series of polyglutamine encoding sequences as well as highly repetitive polyadenine tracts. Such repetitive sequences can be used for diverse biotechnological applications. As an example, the polyglutamine sequences were expressed as His6-SUMO fusion proteins in Escherichia coli cells to study their aggregation behavior in vitro. The His6-SUMO moiety enabled affinity purification of the polyglutamine proteins, increased their solubility, and allowed controlled induction of the aggregation process. We successfully purified the fusions proteins and provide an example for their applicability in filter retardation assays. Conclusion Our seamless cloning strategy is PCR-free and allows the directed and efficient generation of highly repetitive DNA sequences of defined lengths by simple standard cloning procedures.
Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J
2011-12-01
Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.
Directory of Open Access Journals (Sweden)
Hye Suck An
2012-08-01
Full Text Available Mytilus coruscus (family Mytilidae is one of the most important marine shellfish species in Korea. During the past few decades, this species has become endangered due to the loss of habitats and overfishing. Despite this species’ importance, information on its genetic background is scarce. In this study, we developed microsatellite markers for M. coruscus using next-generation sequencing. A total of 263,900 raw reads were obtained from a quarter-plate run on the 454 GS-FLX titanium platform, and 176,327 unique sequences were generated with an average length of 381 bp; 2569 (1.45% sequences contained a minimum of five di- to tetra-nucleotide repeat motifs. Of the 51 loci screened, 46 were amplified successfully, and 22 were polymorphic among 30 individuals, with seven of trinucleotide repeats and three of tetranucleotide repeats. All loci exhibited high genetic variability, with an average of 17.32 alleles per locus, and the mean observed and expected heterozygosities were 0.67 and 0.90, respectively. In addition, cross-amplification was tested for all 22 loci in another congener species, M. galloprovincialis. None of the primer pairs resulted in effective amplification, which might be due to their high mutation rates. Our work demonstrated the utility of next-generation 454 sequencing as a method for the rapid and cost-effective identification of microsatellites. The high degree of polymorphism exhibited by the 22 newly developed microsatellites will be useful in future conservation genetic studies of this species.
Directory of Open Access Journals (Sweden)
Bingjun eDang
2016-02-01
Full Text Available Plasmid pGA45 was isolated from the sediment of Haihe River using E. coli CV601 (gfp-tagged as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G+C content of 52.03%. Sequence analysis shows that pGA45 belongs to incFIIY group and harbors a backbone region shares high homology and gene synteny to several other incF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1 and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one blaIMI-3-containing region and one type VI secretion system region. The blaIMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the blaIMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of blaIMI carbapenemase genes.
Nostoc PCC7524, a cyanobacterium which contains five sequence-specific deoxyribonucleases
Reaston, J.; Duybesteyn, M.G.C.; Waard, Adrian de
1982-01-01
Five nucleotide sequence-specific deoxyribonucleases present in cell-free extracts of the filamentous cyanobacterium Nostoc PCC7524 have been purified and characterized. One of these enzymes, designated Nsp(7524)I cleaves at a new kind of nucleotide sequence i.e. 5'-PuCATG λ Py-3'. The other four
Recurrence plot analysis of DNA sequences
Energy Technology Data Exchange (ETDEWEB)
Wu Zuobing [State Key Laboratory of Nonlinear Mechanics, Institute of Mechanics, Chinese Academy of Sciences, Beijing 100080 (China)]. E-mail: wuzb@lnm.imech.ac.cn
2004-11-15
Recurrence plot technique of DNA sequences is established on metric representation and employed to analyze correlation structure of nucleotide strings. It is found that, in the transference of nucleotide strings, a human DNA fragment has a major correlation distance, but a yeast chromosome's correlation distance has a constant increasing.
Cheng, Jiaowen; Zhao, Zicheng; Li, Bo; Qin, Cheng; Wu, Zhiming; Trejo-Saavedra, Diana L; Luo, Xirong; Cui, Junjie; Rivera-Bustamante, Rafael F; Li, Shuaicheng; Hu, Kailin
2016-01-07
The sequences of the full set of pepper genomes including nuclear, mitochondrial and chloroplast are now available for use. However, the overall of simple sequence repeats (SSR) distribution in these genomes and their practical implications for molecular marker development in Capsicum have not yet been described. Here, an average of 868,047.50, 45.50 and 30.00 SSR loci were identified in the nuclear, mitochondrial and chloroplast genomes of pepper, respectively. Subsequently, systematic comparisons of various species, genome types, motif lengths, repeat numbers and classified types were executed and discussed. In addition, a local database composed of 113,500 in silico unique SSR primer pairs was built using a homemade bioinformatics workflow. As a pilot study, 65 polymorphic markers were validated among a wide collection of 21 Capsicum genotypes with allele number and polymorphic information content value per marker raging from 2 to 6 and 0.05 to 0.64, respectively. Finally, a comparison of the clustering results with those of a previous study indicated the usability of the newly developed SSR markers. In summary, this first report on the comprehensive characterization of SSR motifs in pepper genomes and the very large set of SSR primer pairs will benefit various genetic studies in Capsicum.
Guo, D; Maiss, E; Adam, G; Casper, R
1995-05-01
The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.
Analysis of simple sequence repeats in rice bean (Vigna umbellata using an SSR-enriched library
Directory of Open Access Journals (Sweden)
Lixia Wang
2016-02-01
Full Text Available Rice bean (Vigna umbellata Thunb., a warm-season annual legume, is grown in Asia mainly for dried grain or fodder and plays an important role in human and animal nutrition because the grains are rich in protein and some essential fatty acids and minerals. With the aim of expediting the genetic improvement of rice bean, we initiated a project to develop genomic resources and tools for molecular breeding in this little-known but important crop. Here we report the construction of an SSR-enriched genomic library from DNA extracted from pooled young leaf tissues of 22 rice bean genotypes and developing SSR markers. In 433,562 reads generated by a Roche 454 GS-FLX sequencer, we identified 261,458 SSRs, of which 48.8% were of compound form. Dinucleotide repeats were predominant with an absolute proportion of 81.6%, followed by trinucleotides (17.8%. Other types together accounted for 0.6%. The motif AC/GT accounted for 77.7% of the total, followed by AAG/CTT (14.3%, and all others accounted for 12.0%. Among the flanking sequences, 2928 matched putative genes or gene models in the protein database of Arabidopsis thaliana, corresponding with 608 non-redundant Gene Ontology terms. Of these sequences, 11.2% were involved in cellular components, 24.2% were involved molecular functions, and 64.6% were associated with biological processes. Based on homolog analysis, 1595 flanking sequences were similar to mung bean and 500 to common bean genomic sequences. Comparative mapping was conducted using 350 sequences homologous to both mung bean and common bean sequences. Finally, a set of primer pairs were designed, and a validation test showed that 58 of 220 new primers can be used in rice bean and 53 can be transferred to mung bean. However, only 11 were polymorphic when tested on 32 rice bean varieties. We propose that this study lays the groundwork for developing novel SSR markers and will enhance the mapping of qualitative and quantitative traits and marker
Directory of Open Access Journals (Sweden)
Solenne Ithurbide
2015-10-01
Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.
Directory of Open Access Journals (Sweden)
Ching-Ping Lin
Full Text Available We performed deep sequencing of the nuclear and organellar genomes of three mungbean genotypes: Vigna radiata ssp. sublobata TC1966, V. radiata var. radiata NM92 and the recombinant inbred line RIL59 derived from a cross between TC1966 and NM92. Moreover, we performed deep sequencing of the RIL59 transcriptome to investigate transcript variability. The mungbean chloroplast genome has a quadripartite structure including a pair of inverted repeats separated by two single copy regions. A total of 213 simple sequence repeats were identified in the chloroplast genomes of NM92 and RIL59; 78 single nucleotide variants and nine indels were discovered in comparing the chloroplast genomes of TC1966 and NM92. Analysis of the mungbean chloroplast transcriptome revealed mRNAs that were affected by transcriptional slippage and RNA editing. Transcriptional slippage frequency was positively correlated with the length of simple sequence repeats of the mungbean chloroplast genome (R2=0.9911. In total, 41 C-to-U editing sites were found in 23 chloroplast genes and in one intergenic spacer. No editing site that swapped U to C was found. A combination of bioinformatics and experimental methods revealed that the plastid-encoded RNA polymerase-transcribed genes psbF and ndhA are affected by transcriptional slippage in mungbean and in main lineages of land plants, including three dicots (Glycine max, Brassica rapa, and Nicotiana tabacum, two monocots (Oryza sativa and Zea mays, two gymnosperms (Pinus taeda and Ginkgo biloba and one moss (Physcomitrella patens. Transcript analysis of the rps2 gene showed that transcriptional slippage could affect transcripts at single sequence repeat regions with poly-A runs. It showed that transcriptional slippage together with incomplete RNA editing may cause sequence diversity of transcripts in chloroplasts of land plants.
Four new single nucleotide polymorphisms (SNPs) of toll-like ...
African Journals Online (AJOL)
In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...
Directory of Open Access Journals (Sweden)
Abraham Kuot
Full Text Available Fuchs' endothelial corneal dystrophy (FECD is a progressive, vision impairing disease. Common single nucleotide polymorphisms (SNPs and a trinucleotide repeat polymorphism, thymine-guanine-cytosine (TGC, in the TCF4 gene have been associated with the risk of FECD in some populations. We previously reported association of SNPs in TCF4 with FECD risk in the Australian population. The aim of this study was to determine whether TGC repeat polymorphism in TCF4 is associated with FECD in the Australian population. In 189 unrelated Australian cases with advanced late-onset FECD and 183 matched controls, the TGC repeat polymorphism located in intron 3 of TCF4 was genotyped using a short tandem repeat (STR assay. The repeat length was verified by direct sequencing in selected homozygous carriers. We found significant association between the expanded TGC repeat (≥ 40 repeats in TCF4 and advanced FECD (P = 2.58 × 10-22; OR = 15.66 (95% CI: 7.79-31.49. Genotypic analysis showed that 51% of cases (97 compared to 5% of controls (9 were heterozygous or homozygous for the expanded repeat allele. Furthermore, the repeat expansion showed stronger association than the most significantly associated SNP, rs613872, in TCF4, with the disease in the Australian cohort. This and haplotype analysis of both the polymorphisms suggest that considering both the polymorphisms together rather than either of the two alone would better predict susceptibility to FECD in the Australian population. This is the first study to report association of the TGC trinucleotide repeat expansion in TCF4 with advanced FECD in the Australian population.
DEFF Research Database (Denmark)
Larsen, Lars Erik; Uttenthal, Åse; Arctander, P.
1998-01-01
on the nucleotide sequence of the G protein. These findings indicated that the previously established variabilities of the G protein of RS virus isolates were not attributable to mutations induced during the propagation of the virus. The reactivity of the Danish isolates with G protein-specific MAbs were similar......Danish isolates of bovine respiratory syncytial virus (BRSV) were characterised by nucleotide sequencing of the G glycoprotein and by their reactivity with a panel of monoclonal antibodies (MAbs). Among the six Danish isolates, the overall sequence divergence ranged between 0 and 3...... part of the G gene of additional 11 field BRSV viruses, processed directly from lung samples without prior adaption to cell culture growth. revealed sequence variabilities in the range obtained with the propagated virus. In addition, several passages in cell culture and in calves had no major impact...
Analysis of genetic diversity in pigeon pea germplasm using ...
Indian Academy of Sciences (India)
MANEESHA
2017-08-16
Aug 16, 2017 ... fied polymorphic DNA (RAPD), simple sequence repeats. (SSR), amplified fragment length polymorphism (AFLP), single-nucleotide polymorphisms (SNPs), diversity array technology (DArT), genic-simple sequence repeats (genic-. SSR) etc. (see review by Varshney et al. 2013). Since retrotransposons are ...
Directory of Open Access Journals (Sweden)
Qun Wang
2012-12-01
Full Text Available Microsatellites are simple sequence repeats with a high degree of polymorphism in the genome; they are used as DNA markers in many molecular genetic studies. Using traditional methods such as the magnetic beads enrichment method, only a few microsatellite markers have been isolated from the Chinese mitten crab Eriocheir sinensis, as the crab genome sequence information is unavailable. Here, we have identified a large number of microsatellites from the Chinese mitten crab by taking advantage of Solexa genomic surveying. A total of 141,737 SSR (simple sequence repeats motifs were identified via analysis of 883 Mb of the crab genomic DNA information, including mono-, di-, tri-, tetra-, penta- and hexa-nucleotide repeat motifs. The number of di-nucleotide repeat motifs was 82,979, making this the most abundant type of repeat motif (58.54%; the second most abundant were the tri-nucleotide repeats (42,657, 30.11%. Among di-nucleotide repeats, the most frequent repeats were AC motifs, accounting for 67.55% of the total number. AGG motifs were the most frequent (59.32% of the tri-nucleotide motifs. A total of 15,125 microsatellite loci had a flanking sequence suitable for setting the primer of a polymerase chain reaction (PCR. To verify the identified SSRs, a subset of 100 primer pairs was randomly selected for PCR. Eighty two primer sets (82% produced strong PCR products matching expected sizes, and 78% were polymorphic. In an analysis of 30 wild individuals from the Yangtze River with 20 primer sets, the number of alleles per locus ranged from 2–14 and the mean allelic richness was 7.4. No linkage disequilibrium was found between any pair of loci, indicating that the markers were independent. The Hardy-Weinberg equilibrium test showed significant deviation in four of the 20 microsatellite loci after sequential Bonferroni corrections. This method is cost- and time-effective in comparison to traditional approaches for the isolation of microsatellites.
Detection of a divergent variant of grapevine virus F by next-generation sequencing.
Molenaar, Nicholas; Burger, Johan T; Maree, Hans J
2015-08-01
The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).
Properties and distribution of pure GA-sequences of mammalian genomes.
Directory of Open Access Journals (Sweden)
Guenter Albrecht-Buehler
Full Text Available The article describes DNA sequences of mammalian genomes that are longer than 50 bases, but consist exclusively of G's and A's ('pure GA-sequences'. Although their frequency of incidence should be 10(-16 or smaller, the chromosomes of human, chimpanzee, dog, cat, rat, and mouse contained many tens of thousands of them ubiquitously located along the chromosomes with a species-dependent density, reaching sizes of up to 1300 [b]. With the exception of a small number of poly-A-, poly-G-, poly-GA-, and poly-GAAA-sequences (combined <0.5%, all pure GA-sequences of the mammals tested were unique individuals, contained several repeated short GA-containing motifs, and shared a common hexa-nucleotide spectrum. At most 2% of the human GA-sequences were transcribed into mRNAs; all others were not coding for proteins. Although this could have made them less subject to natural selection, they contained many [corrected] times fewer point mutations than one should expect from the genome at large. As to the presence of other sequences with similarly restricted base contents, there were approximately as many pure TC-sequences as pure GA-sequences, but many fewer pure AC-, TA, and TG-sequences. There were practically no pure GC-sequences. The functions of pure GA-sequences are not known. Supported by a number of observations related to heat shock phenomena, the article speculates that they serve as genomic sign posts which may help guide polymerases and transcription factors to their proper targets, and/or as spatial linkers that help generate the 3-dimensional organization of chromatin.
DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure
International Nuclear Information System (INIS)
Revaud, D.
2009-06-01
Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)
Predicting protein-binding RNA nucleotides with consideration of binding partners.
Tuvshinjargal, Narankhuu; Lee, Wook; Park, Byungkyu; Han, Kyungsook
2015-06-01
In recent years several computational methods have been developed to predict RNA-binding sites in protein. Most of these methods do not consider interacting partners of a protein, so they predict the same RNA-binding sites for a given protein sequence even if the protein binds to different RNAs. Unlike the problem of predicting RNA-binding sites in protein, the problem of predicting protein-binding sites in RNA has received little attention mainly because it is much more difficult and shows a lower accuracy on average. In our previous study, we developed a method that predicts protein-binding nucleotides from an RNA sequence. In an effort to improve the prediction accuracy and usefulness of the previous method, we developed a new method that uses both RNA and protein sequence data. In this study, we identified effective features of RNA and protein molecules and developed a new support vector machine (SVM) model to predict protein-binding nucleotides from RNA and protein sequence data. The new model that used both protein and RNA sequence data achieved a sensitivity of 86.5%, a specificity of 86.2%, a positive predictive value (PPV) of 72.6%, a negative predictive value (NPV) of 93.8% and Matthews correlation coefficient (MCC) of 0.69 in a 10-fold cross validation; it achieved a sensitivity of 58.8%, a specificity of 87.4%, a PPV of 65.1%, a NPV of 84.2% and MCC of 0.48 in independent testing. For comparative purpose, we built another prediction model that used RNA sequence data alone and ran it on the same dataset. In a 10 fold-cross validation it achieved a sensitivity of 85.7%, a specificity of 80.5%, a PPV of 67.7%, a NPV of 92.2% and MCC of 0.63; in independent testing it achieved a sensitivity of 67.7%, a specificity of 78.8%, a PPV of 57.6%, a NPV of 85.2% and MCC of 0.45. In both cross-validations and independent testing, the new model that used both RNA and protein sequences showed a better performance than the model that used RNA sequence data alone in
The first complete chloroplast genome sequence of a lycophyte,Huperzia lucidula (Lycopodiaceae)
Energy Technology Data Exchange (ETDEWEB)
Wolf, Paul G.; Karol, Kenneth G.; Mandoli, Dina F.; Kuehl,Jennifer V.; Arumuganathan, K.; Ellis, Mark W.; Mishler, Brent D.; Kelch,Dean G.; Olmstead, Richard G.; Boore, Jeffrey L.
2005-02-01
We used a unique combination of techniques to sequence the first complete chloroplast genome of a lycophyte, Huperzia lucidula. This plant belongs to a significant clade hypothesized to represent the sister group to all other vascular plants. We used fluorescence-activated cell sorting (FACS) to isolate the organelles, rolling circle amplification (RCA) to amplify the genome, and shotgun sequencing to 8x depth coverage to obtain the complete chloroplast genome sequence. The genome is 154,373bp, containing inverted repeats of 15,314 bp each, a large single-copy region of 104,088 bp, and a small single-copy region of 19,671 bp. Gene order is more similar to those of mosses, liverworts, and hornworts than to gene order for other vascular plants. For example, the Huperziachloroplast genome possesses the bryophyte gene order for a previously characterized 30 kb inversion, thus supporting the hypothesis that lycophytes are sister to all other extant vascular plants. The lycophytechloroplast genome data also enable a better reconstruction of the basaltracheophyte genome, which is useful for inferring relationships among bryophyte lineages. Several unique characters are observed in Huperzia, such as movement of the gene ndhF from the small single copy region into the inverted repeat. We present several analyses of evolutionary relationships among land plants by using nucleotide data, amino acid sequences, and by comparing gene arrangements from chloroplast genomes. The results, while still tentative pending the large number of chloroplast genomes from other key lineages that are soon to be sequenced, are intriguing in themselves, and contribute to a growing comparative database of genomic and morphological data across the green plants.
FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation.
Bolleman, Jerven T; Mungall, Christopher J; Strozzi, Francesco; Baran, Joachim; Dumontier, Michel; Bonnal, Raoul J P; Buels, Robert; Hoehndorf, Robert; Fujisawa, Takatomo; Katayama, Toshiaki; Cock, Peter J A
2016-06-13
Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. We have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned "omics" areas. Using the same data format to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe - and potentially merge - sequence annotations from multiple sources. Data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.
Automated genotyping of dinucleotide repeat markers
Energy Technology Data Exchange (ETDEWEB)
Perlin, M.W.; Hoffman, E.P. [Carnegie Mellon Univ., Pittsburgh, PA (United States)]|[Univ. of Pittsburgh, PA (United States)
1994-09-01
The dinucleotide repeats (i.e., microsatellites) such as CA-repeats are a highly polymorphic, highly abundant class of PCR-amplifiable markers that have greatly streamlined genetic mapping experimentation. It is expected that over 30,000 such markers (including tri- and tetranucleotide repeats) will be characterized for routine use in the next few years. Since only size determination, and not sequencing, is required to determine alleles, in principle, dinucleotide repeat genotyping is easily performed on electrophoretic gels, and can be automated using DNA sequencers. Unfortunately, PCR stuttering with these markers generates not one band for each allele, but a pattern of bands. Since closely spaced alleles must be disambiguated by human scoring, this poses a key obstacle to full automation. We have developed methods that overcome this obstacle. Our model is that the observed data is generated by arithmetic superposition (i.e., convolution) of multiple allele patterns. By quantitatively measuring the size of each component band, and exploiting the unique stutter pattern associated with each marker, closely spaced alleles can be deconvolved; this unambiguously reconstructs the {open_quotes}true{close_quotes} allele bands, with stutter artifact removed. We used this approach in a system for automated diagnosis of (X-linked) Duchenne muscular dystrophy; four multiplexed CA-repeats within the dystrophin gene were assayed on a DNA sequencer. Our method accurately detected small variations in gel migration that shifted the allele size estimate. In 167 nonmutated alleles, 89% (149/167) showed no size variation, 9% (15/167) showed 1 bp variation, and 2% (3/167) showed 2 bp variation. We are currently developing a library of dinucleotide repeat patterns; together with our deconvolution methods, this library will enable fully automated genotyping of dinucleotide repeats from sizing data.
Directory of Open Access Journals (Sweden)
Simon Reed
2012-09-01
Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.
Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R
2005-09-01
We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.
Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth
2011-01-01
We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP
Complete sequencing of five araliaceae chloroplast genomes and the phylogenetic implications.
Directory of Open Access Journals (Sweden)
Rong Li
Full Text Available BACKGROUND: The ginseng family (Araliaceae includes a number of economically important plant species. Previously phylogenetic studies circumscribed three major clades within the core ginseng plant family, yet the internal relationships of each major group have been poorly resolved perhaps due to rapid radiation of these lineages. Recent studies have shown that phyogenomics based on chloroplast genomes provides a viable way to resolve complex relationships. METHODOLOGY/PRINCIPAL FINDINGS: We report the complete nucleotide sequences of five Araliaceae chloroplast genomes using next-generation sequencing technology. The five chloroplast genomes are 156,333-156,459 bp in length including a pair of inverted repeats (25,551-26,108 bp separated by the large single-copy (86,028-86,566 bp and small single-copy (18,021-19,117 bp regions. Each chloroplast genome contains the same 114 unique genes consisting of 30 transfer RNA genes, four ribosomal RNA genes, and 80 protein coding genes. Gene size, content, and order, AT content, and IR/SC boundary structure are similar among all Araliaceae chloroplast genomes. A total of 140 repeats were identified in the five chloroplast genomes with palindromic repeat as the most common type. Phylogenomic analyses using parsimony, likelihood, and Bayesian inference based on the complete chloroplast genomes strongly supported the monophyly of the Asian Palmate group and the Aralia-Panax group. Furthermore, the relationships among the sampled taxa within the Asian Palmate group were well resolved. Twenty-six DNA markers with the percentage of variable sites higher than 5% were identified, which may be useful for phylogenetic studies of Araliaceae. CONCLUSION: The chloroplast genomes of Araliaceae are highly conserved in all aspects of genome features. The large-scale phylogenomic data based on the complete chloroplast DNA sequences is shown to be effective for the phylogenetic reconstruction of Araliaceae.
International Nuclear Information System (INIS)
Siebert, P.D.; Fukuda, M.
1986-01-01
In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B
Yuan, Can; Peng, Fang; Yang, Ze-Mao; Zhong, Wen-Juan; Mou, Fang-Sheng; Gong, Yi-Yun; Ji, Pei-Cheng; Pu, De-Qiang; Huang, Hai-Yan; Yang, Xiao; Zhang, Chao
2017-09-01
Ligusticum chuanxiong is a well-known traditional Chinese medicine plant. The study on its molecular markers development and germplasm resources is very important. In this study, we obtained 24 422 unigenes by assembling transcriptome sequencing reads of L. chuanxiong root. EST-SSR was detected and 4 073 SSR loci were identified. EST-SSR distribution and characteristic analysis results showed that the mono-nucleotide repeats were the main repeat types, accounting for 41.0%. In addition, the sequences containing SSR were functionally annotated in Gene Ontology (GO) and KEGG pathway and were assigned to 49 GO categories, 242 KEGG pathways, among them 2 201 sequences were annotated against Nr database. By validating 235 EST-SSRs,74 primer pairs were ultimately proved to have high quality amplification. Subsequently, genetic diversity analysis, UPGMA cluster analysis, PCoA analysis and population structure analysis of 34 L. chuanxiong germplasm resources were carried out with 74 primer pairs. In both UPGMA tree and PCoA results, L. chuanxiong resources were clustered into two groups, which are believed to be partial related to their geographical distribution. In this study, EST-SSRs in L. chuanxiong was firstly identified, and newly developed molecular markers would contribute significantly to further genetic diversity study, the purity detection, gene mapping, and molecular breeding. Copyright© by the Chinese Pharmaceutical Association.
Directory of Open Access Journals (Sweden)
Chih-Yun Chiang
2011-11-01
Full Text Available Foxtail millet is one of the world’s oldest cultivated crops. It has been adopted as a model organism for providing a deeper understanding of plant biology. In this study, 45 simple sequence repeats (SSR markers of Setaria italica were developed. These markers showing polymorphism were screened in 223 samples from 12 foxtail millet populations around Taiwan. The most common dinucleotide and trinucleotide repeat motifs are AC/TG (84.21% and CAT (46.15%. The average number of alleles (Na, the average heterozygosities observed (Ho and expected (He are 3.73, 0.714, 0.587, respectively. In addition, 24 SSR markers had shown transferability to six related Poaceae species. These new markers provide tools for examining genetic relatedness among foxtail millet populations and other related species. It is suitable for germplasm management and protection in Poaceae.
Genome Wide Analysis of Nucleotide-Binding Site Disease Resistance Genes in Brachypodium distachyon
Directory of Open Access Journals (Sweden)
Shenglong Tan
2012-01-01
Full Text Available Nucleotide-binding site (NBS disease resistance genes play an important role in defending plants from a variety of pathogens and insect pests. Many R-genes have been identified in various plant species. However, little is known about the NBS-encoding genes in Brachypodium distachyon. In this study, using computational analysis of the B. distachyon genome, we identified 126 regular NBS-encoding genes and characterized them on the bases of structural diversity, conserved protein motifs, chromosomal locations, gene duplications, promoter region, and phylogenetic relationships. EST hits and full-length cDNA sequences (from Brachypodium database of 126 R-like candidates supported their existence. Based on the occurrence of conserved protein motifs such as coiled-coil (CC, NBS, leucine-rich repeat (LRR, these regular NBS-LRR genes were classified into four subgroups: CC-NBS-LRR, NBS-LRR, CC-NBS, and X-NBS. Further expression analysis of the regular NBS-encoding genes in Brachypodium database revealed that these genes are expressed in a wide range of libraries, including those constructed from various developmental stages, tissue types, and drought challenged or nonchallenged tissue.
Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays
DEFF Research Database (Denmark)
Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie
2014-01-01
The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sec...
Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology
DEFF Research Database (Denmark)
Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr
2017-01-01
Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Bell, G.I.
1991-12-31
The DNA of higher eukaryotes contains many repetitive sequences. The study of repetitive sequences is important, not only because many have important biological function, but also because they provide information on genome organization, evolution and dynamics. In this paper, I will first discuss some generic effects that repetitive sequences will have upon genome dynamics and evolution. In particular, it will be shown that repetitive sequences foster recombination among, and turnover of, the elements of a genome. I will then consider some examples of repetitive sequences, notably minisatellite sequences and telomere sequences as examples of tandem repeats, without and with respectively known function, and Alu sequences as an example of interspersed repeats. Some other examples will also be considered in less detail.
NUCLEOTIDE COMPARISON OF GDF9 GENE IN INDIAN YAK AND GADDI GOAT: HIGH ALTITUDE LIVESTOCK ANIMALS
Directory of Open Access Journals (Sweden)
Lakshya Veer Singh
2013-06-01
Full Text Available The present study was undertaken to characterize exon 1 and exon 2 sequence of one of fecundity genes: GDF9 (Growth differentiation factor 9, in high altitude livestock animal (Yak and Gaddi goat. Six nucleotide differences were identified between sheep (AF078545 and goats (EF446168 in exon 1 and exon 2. Sequencing revealed nine novel single nucleotide mutations in exon 1 and exon 2 of Indian yak that compared with Bos taurus (GQ922451. These results preliminarily showed that the GDF9 gene might be a major gene that influences prolificacy of Gaddi goats and Indian yak.
Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna
Directory of Open Access Journals (Sweden)
Souche Erika L
2011-06-01
Full Text Available Abstract Background Daphnia (Crustacea: Cladocera plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP marker development. Results We developed three expressed sequence tag (EST libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47% of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna.
Ha, Wai Y; Reid, David G; Kam, Wan L; Lau, Yuk Y; Sham, Wing C; Tam, Silvia Y K; Sin, Della W M; Mok, Chuen S
2011-05-25
Abalones ( Haliotis species) are a popular delicacy and commonly preserved in dried form either whole or in slices or small pieces for consumption in Asian countries. Driven by the huge profit from trading abalones, dishonest traders may substitute other molluscan species for processed abalone, of which the morphological characteristics are frequently lost in the processed form. For protection of consumer rights and law enforcement against fraud, there is a need for an effective methodology to differentiate between fake and genuine abalone. This paper describes a method (validated according to the international forensic guidelines provided by SWGDAM) for the identification of fake abalone species using forensically informative nucleotide sequence (FINS) analysis. A study of the local market revealed that many claimed "abalone slice" samples on sale are not genuine. The fake abalone samples were found to be either volutids of the genus Cymbium (93%) or the muricid Concholepas concholepas (7%). This is the first report of Cymbium species being used for the preparation and sale as "abalone" in dried sliced form in Hong Kong.
Sirena, Dominique; Ruzsics, Zsolt; Schaffner, Walter; Greber, Urs F; Hemmi, Silvio
2005-12-20
Human adenovirus (Ad) serotype 3 causes respiratory infections. It is considered highly virulent, accounting for about 13% of all Ad isolates. We report here the complete Ad3 DNA sequence of 35,343 base pairs (GenBank accession DQ086466). Ad3 shares 96.43% nucleotide identity with Ad7, another virulent subspecies B1 serotype, and 82.56 and 62.75% identity with the less virulent species B2 Ad11 and species C Ad5, respectively. The genomic organization of Ad3 is similar to the other human Ads comprising five early transcription units, E1A, E1B, E2, E3, and E4, two delayed early units IX and IVa2, and the major late unit, in total 39 putative and 7 hypothetical open reading frames. A recombinant E1-deleted Ad3 was generated on a bacterial artificial chromosome. This prototypic virus efficiently transduced CD46-positive rodent and human cells. Our results will help in clarifying the biology and pathology of adenoviruses and enhance therapeutic applications of viral vectors in clinical settings.
Nonlinear analysis of sequence repeats of multi-domain proteins
Energy Technology Data Exchange (ETDEWEB)
Huang Yanzhao [Biomolecular Physics and Modeling Group, Department of Physics, Huazhong University of Science and Technology, Wuhan 430074, Hubei (China); Li Mingfeng [Biomolecular Physics and Modeling Group, Department of Physics, Huazhong University of Science and Technology, Wuhan 430074, Hubei (China); Xiao Yi [Biomolecular Physics and Modeling Group, Department of Physics, Huazhong University of Science and Technology, Wuhan 430074, Hubei (China)]. E-mail: lmf_bill@sina.com
2007-11-15
Many multi-domain proteins have repetitive three-dimensional structures but nearly-random amino acid sequences. In the present paper, by using a modified recurrence plot proposed by us previously, we show that these amino acid sequences have hidden repetitions in fact. These results indicate that the repetitive domain structures are encoded by the repetitive sequences. This also gives a method to detect the repetitive domain structures directly from amino acid sequences.
Nucleotide sequence of a human tRNA gene heterocluster
International Nuclear Information System (INIS)
Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.
1986-01-01
Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues
DEFF Research Database (Denmark)
Meldgaard, Michael; Morling, N
1997-01-01
Detection on automated DNA sequencers of polymerase chain reaction (PCR) products of tetra- and penta-nucleotide short tandem repeat (STR) loci frequently reveals one or more extra peaks along with the true, major allele peak. The most frequent extra peak pattern is a single smaller peak which...... is one repeat unit shorter than the true allele peak. The existence of such artificial peaks is of special importance when the methods are used for forensic investigations because the artificial extra peaks may simulate true alleles when samples containing mixtures of DNA from different individuals...... are analyzed. We have investigated the relative levels of formation of extra peaks in 14 STR marker systems. We found that not only the parameters of the PCR but also factors determining the stringency during the post-PCR and pre-electrophoresis handling of samples were of importance for the formation of extra...
Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.
Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng
2017-07-01
The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.
Sakai, Kazuko; Takeda, Masayuki; Okamoto, Isamu; Nakagawa, Kazuhiko; Nishio, Kazuto
2015-01-01
Hepatocyte growth factor (HGF) expression is a poor prognostic factor in various types of cancer. Expression levels of HGF have been reported to be regulated by shorter poly(dA) sequences in the promoter region. In the present study, the poly(dA) mononucleotide tract in various types of human cancer cell lines was examined and compared with the HGF expression levels in those cells. Short deoxyadenosine repeat sequences were detected in five of the 55 cell lines used in the present study. The H69, IM95, CCK-81, Sui73 and H28 cells exhibited a truncated poly(dA) sequence in which the number of poly(dA) repeats was reduced by ≥5 bp. Two of the cell lines exhibited high HGF expression, determined by reverse transcription quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. The CCK-81, Sui73 and H28 cells with shorter poly(dA) sequences exhibited low HGF expression. The cause of the suppression of HGF expression in the CCK-81, Sui73 and H28 cells was clarified by two approaches, suppression by methylation and single nucleotide polymorphisms in the HGF gene. Exposure to 5-Aza-dC, an inhibitor of DNA methyltransferase 1, induced an increased expression of HGF in the CCK-81 cells, but not in the other cells. Single-nucleotide polymorphism (SNP) rs72525097 in intron 1 was detected in the Sui73 and H28 cells. Taken together, it was found that the defect of poly(dA) in the HGF promoter was present in various types of cancer, including lung, stomach, colorectal, pancreas and mesothelioma. The present study proposes the negative regulation mechanisms by methylation and SNP in intron 1 of HGF for HGF expression in cancer cells with short poly(dA).
Gritsun, T S; Frolova, T V; Pogodina, V V; Lashkevich, V A; Venugopal, K; Gould, E A
1993-02-01
A strain of tick-borne encephalitis virus known as Vasilchenko (Vs) exhibits relatively low virulence characteristics in monkeys, Syrian hamsters and humans. The gene encoding the envelope glycoprotein of this virus was cloned and sequenced. Alignment of the sequence with those of other known tick-borne flaviviruses and identification of the recognised amino acid genetic marker EHLPTA confirmed its identity as a member of the TBE complex. However, Vs virus was distinguishable from eastern and western tick-borne serotypes by the presence of the sequence AQQ at amino acid positions 232-234 and also by the presence of other specific amino acid substitutions which may be genetic markers for these viruses and could determine their pathogenetic characteristics. When compared with other tick-borne flaviviruses, Vs virus had 12 unique amino acid substitutions including an additional potential glycosylation site at position (315-317). The Vs virus strain shared closest nucleotide and amino acid homology (84.5% and 95.5% respectively) with western and far eastern strains of tick-borne encephalitis virus. Comparison with the far eastern serotype of tick-borne encephalitis virus, by cross-immunoelectrophoresis of Vs virions and PAGE analysis of the extracted virion proteins, revealed differences in surface charge and virus stability that may account for the different virulence characteristics of Vs virus. These results support and enlarge upon previous data obtained from molecular and serological analysis.
Directory of Open Access Journals (Sweden)
Jonas Binladen
2007-02-01
Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial
BlockLogo: Visualization of peptide and sequence motif conservation
DEFF Research Database (Denmark)
Olsen, Lars Rønn; Kudahl, Ulrich Johan; Simon, Christian
2013-01-01
BlockLogo is a web-server application for the visualization of protein and nucleotide fragments, continuous protein sequence motifs, and discontinuous sequence motifs using calculation of block entropy from multiple sequence alignments. The user input consists of a multiple sequence alignment, se...
Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet
2014-01-01
Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...
International Nuclear Information System (INIS)
Xiong Gang; Wang, X.R.
2005-01-01
The zero-temperature transmission rate spectrum of a double-chain tight-binding model for real DNA is calculated. It is shown that a band of extended-like states exists only for finite chain length with strong inter-chain coupling. While the whole spectrum tends to zero in thermodynamic limit, regardless of the strength of inter-chain coupling. It is also shown that a more faithful model for real DNA with periodic sugar-phosphate chains in backbone structures can be mapped into the above simple double-chain tight-binding model. Combined with above results, the transmission rate of real DNA with long random sequence of nucleotides is expected to be poor
Directory of Open Access Journals (Sweden)
Berendonk Thomas U
2011-05-01
Full Text Available Abstract Background Despite the fact that the organization of the ciliate mitochondrial genome is exceptional, only few ciliate mitochondrial genomes have been sequenced until today. All ciliate mitochondrial genomes are linear. They are 40 kb to 47 kb long and contain some 50 tightly packed genes without introns. Earlier studies documented that the mitochondrial guanine + cytosine contents are very different between Paramecium tetraurelia and all studied Tetrahymena species. This raises the question of whether the high mitochondrial G+C content observed in P. tetraurelia is a characteristic property of Paramecium mtDNA, or whether it is an exception of the ciliate mitochondrial genomes known so far. To test this question, we determined the mitochondrial genome sequence of Paramecium caudatum and compared the gene content and sequence properties to the closely related P. tetraurelia. Results The guanine + cytosine content of the P. caudatum mitochondrial genome was significantly lower than that of P. tetraurelia (22.4% vs. 41.2%. This difference in the mitochondrial nucleotide composition was accompanied by significantly different codon usage patterns in both species, i.e. within P. caudatum clearly A/T ending codons dominated, whereas for P. tetraurelia the synonymous codons were more balanced with a higher number of G/C ending codons. Further analyses indicated that the nucleotide composition of most members of the genus Paramecium resembles that of P. caudatum and that the shift observed in P. tetraurelia is restricted to the P. aurelia species complex. Conclusions Surprisingly, the codon usage bias in the P. caudatum mitochondrial genome, exemplified by the effective number of codons, is more similar to the distantly related T. pyriformis and other single-celled eukaryotes such as Chlamydomonas, than to the closely related P. tetraurelia. These differences in base composition and codon usage bias were, however, not reflected in the amino
Local repeat sequence organization of an intergenic spacer
Indian Academy of Sciences (India)
The amplification yielded the same uniquely ``sequence-scrambled” product, whether the template used for PCR was total cellular DNA, chloroplast DNA or a plasmid clone DNA corresponding to that region. The PCR product, a ``unique” new sequence, had lost the repetitive organization of the template genome where it ...
Fingerprinting for discriminating tea germplasm using inter-simple sequence repeat (ISSR) markers
International Nuclear Information System (INIS)
Liu, B.Y.; Li, Y.Y.; Wang, P.S.; Wang, L.Y.; Wang, P.S.
2012-01-01
For the discrimination of tea germplasm at the inter-specific level, 134 tea varieties preserved in the China National Germplasm Tea Repositories (CNGTR) were analyzed using inter simple sequence repeat (ISSR) markers. Eighteen primers were chosen from 60 screened for ISSR amplification, generating 99.4% polymorphic bands. The mean Nei's gene diversity (H) and the overall mean Shannon's Information index (I) were 0.396 and 0.578, respectively, indicating a wide gene pool. Using the presence, sometimes absence of unique ISSR markers, it was possible to discriminate 32 of the genotypes tested. No single primer could discriminate all the 134 genotypes. However, UBC811 provided rich band patterns and it can discriminate 35 genotypes. The combination of two and three primers could discriminate 99 and 121 genotypes, respectively. Furthermore, the combination of band patterns or the DNA fingerprinting based on specific ISSR markers generated by UBC811, UBC835, ISSR2 and ISSR3 could discriminate all 134 genotypes tested. ISSR markers also provide a powerful tool to discriminate tea germplasm at the inter-specific level. (author)
Shien, J-H; Wang, Y-S; Chen, C-H; Shieh, H K; Hu, C-C; Chang, P-C
2008-10-01
Live attenuated vaccines have been used for control of the disease caused by goose parvovirus (GPV), but the mechanism involved in attenuation of GPV remains elusive. This report presents the complete nucleotide sequences of two live attenuated strains of GPV (82-0321V and VG32/1) that were independently developed in Taiwan and Europe, together with the parental strain of 82-0321V and a field strain isolated in Taiwan in 2006. Sequence comparisons showed that 82-0321V and VG32/1 had multiple deletions and substitutions in the inverted terminal repeats region when compared with their parental strain or the field virus, but these changes did not affect the formation of the hairpin structure essential for viral replication. Moreover, 82-0321V and VG32/1 had five amino acid changes in the non-structural protein, but these changes were located at positions distant from known functional motifs in the non-structural protein. In contrast, 82-0321V had nine changes and VG32/1 had 11 changes in their capsid proteins (VP1), and the majority of these changes occurred at positions close to the putative receptor binding sites of VP1, as predicted using the structure of adeno-associated virus 2 as the model system. Taken together, the results suggest that changes in sequence near the receptor binding sites of VP1 might be responsible for attenuation of GPV. This is the first report of complete nucleotide sequences of GPV other than the virulent B strain, and suggests a possible mechanism for attenuation of GPV.
Wang, Jianye; Huang, Yu; Zhou, Mingxu; Hardwidge, Philip R; Zhu, Guoqiang
2016-06-21
Muscovy duck parvovirus (MDPV) is the etiological agent of Muscovy duckling parvoviral disease, which is characterized by diarrhea, locomotive dysfunction, stunting, and death in young ducklings, and causes substantial economic losses in the Muscovy duck industry worldwide. FZ91-30 is an attenuated vaccine strain that is safe and immunogenic to ducklings, but the genomic information and molecular mechanism underlining the attenuation are not understood. The FZ91-30 strain was propagated in 11-day-old embryonated goose eggs, and viral particles were purified from the pooled allantoic fluid by differential centrifugation and ultracentrifugation. Single-stranded genomic DNA was extracted and annealed to form double-stranded DNA. The dsDNA digested with NcoI resulted two sub-genomic fragments, which were then cloned into the modified plasmid pBluescript II SK, respectively, generating plasmid pBSKNL and pBSKNR. The sub-genomic plasmid clones were sequenced and further combined to construct the plasmid pFZ that contained the entire genome of strain FZ91-30. The complete genome sequences of strain FM and YY and partial genome sequences of other strains were retrieved from GenBank for sequence comparison. The plasmid pFZ containing the entire genome of FZ91-30 was transfected in 11-day-old embryonated goose eggs via the chorioallantoic membranes route to rescue infectious virus. A genetic marker was introduced into the rescued virus to discriminate from its parental virus. The genome of FZ91-30 consists of 5,131 nucleotides and has 98.9 % similarity to the FM strain. The inverted terminal repeats (ITR) are 456 nucleotides in length, 14 nucleotides longer than that of Goose parvovirus (GPV). The exterior 415 nucleotides of the ITR form a hairpin structure, and the interior 41 nucleotides constitute the D sequence, a reverse complement of the D' sequence at the 3' ITR. Amino acid sequence alignment of the VP1 proteins between FZ91-30 and five pathogenic MDPV strains
Inokuchi, Shota; Yamashita, Yasuhiro; Nishimura, Kazuma; Nakanishi, Hiroaki; Saito, Kazuyuki
2017-11-01
Phenomena known as null alleles and peak imbalance can occur because of mutations in the primer binding sites used for DNA typing. In these cases, an accurate statistical evaluation of DNA typing is difficult. The estimated likelihood ratio is incorrectly calculated because of the null allele and allele dropout caused by mutation-induced peak imbalance. Although a number of studies have attempted to uncover examples of these phenomena, few reports are available on the human identification kit manufactured by Qiagen. In this study, 196 Japanese individuals who were heterozygous at D2S1360 were genotyped using an Investigator HDplex Kit with optimal amounts of DNA. A peak imbalance was frequently observed at the D2S1360 locus. We performed a sequencing analysis of the area surrounding the D2S1360 repeat motif to identify the cause for peak imbalance. A point mutation (G>A transition) 136 nucleotides upstream from the D2S1360 repeat motif was discovered in a number of samples. The allele frequency of the mutation was 0.0566 in the Japanese population. Therefore, human identification or kinship testing using the Investigator HDplex Kit requires caution because of the higher frequency of single nucleotide polymorphisms at the primer binding site of D2S1360 locus in the Japanese population.
EuMicroSatdb: A database for microsatellites in the sequenced genomes of eukaryotes
Directory of Open Access Journals (Sweden)
Grover Atul
2007-07-01
Full Text Available Abstract Background Microsatellites have immense utility as molecular markers in different fields like genome characterization and mapping, phylogeny and evolutionary biology. Existing microsatellite databases are of limited utility for experimental and computational biologists with regard to their content and information output. EuMicroSatdb (Eukaryotic MicroSatellite database http://ipu.ac.in/usbt/EuMicroSatdb.htm is a web based relational database for easy and efficient positional mining of microsatellites from sequenced eukaryotic genomes. Description A user friendly web interface has been developed for microsatellite data retrieval using Active Server Pages (ASP. The backend database codes for data extraction and assembly have been written using Perl based scripts and C++. Precise need based microsatellites data retrieval is possible using different input parameters like microsatellite type (simple perfect or compound perfect, repeat unit length (mono- to hexa-nucleotide, repeat number, microsatellite length and chromosomal location in the genome. Furthermore, information about clustering of different microsatellites in the genome can also be retrieved. Finally, to facilitate primer designing for PCR amplification of any desired microsatellite locus, 200 bp upstream and downstream sequences are provided. Conclusion The database allows easy systematic retrieval of comprehensive information about simple and compound microsatellites, microsatellite clusters and their locus coordinates in 31 sequenced eukaryotic genomes. The information content of the database is useful in different areas of research like gene tagging, genome mapping, population genetics, germplasm characterization and in understanding microsatellite dynamics in eukaryotic genomes.
Directory of Open Access Journals (Sweden)
L.G. Mamonova
2007-01-01
Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.
Combined evidence annotation of transposable elements in genome sequences.
Directory of Open Access Journals (Sweden)
Hadi Quesneville
2005-07-01
Full Text Available Transposable elements (TEs are mobile, repetitive sequences that make up significant fractions of metazoan genomes. Despite their near ubiquity and importance in genome and chromosome biology, most efforts to annotate TEs in genome sequences rely on the results of a single computational program, RepeatMasker. In contrast, recent advances in gene annotation indicate that high-quality gene models can be produced from combining multiple independent sources of computational evidence. To elevate the quality of TE annotations to a level comparable to that of gene models, we have developed a combined evidence-model TE annotation pipeline, analogous to systems used for gene annotation, by integrating results from multiple homology-based and de novo TE identification methods. As proof of principle, we have annotated "TE models" in Drosophila melanogaster Release 4 genomic sequences using the combined computational evidence derived from RepeatMasker, BLASTER, TBLASTX, all-by-all BLASTN, RECON, TE-HMM and the previous Release 3.1 annotation. Our system is designed for use with the Apollo genome annotation tool, allowing automatic results to be curated manually to produce reliable annotations. The euchromatic TE fraction of D. melanogaster is now estimated at 5.3% (cf. 3.86% in Release 3.1, and we found a substantially higher number of TEs (n = 6,013 than previously identified (n = 1,572. Most of the new TEs derive from small fragments of a few hundred nucleotides long and highly abundant families not previously annotated (e.g., INE-1. We also estimated that 518 TE copies (8.6% are inserted into at least one other TE, forming a nest of elements. The pipeline allows rapid and thorough annotation of even the most complex TE models, including highly deleted and/or nested elements such as those often found in heterochromatic sequences. Our pipeline can be easily adapted to other genome sequences, such as those of the D. melanogaster heterochromatin or other
Araya, Susan; Martins, Alexandre M; Junqueira, Nilton T V; Costa, Ana Maria; Faleiro, Fábio G; Ferreira, Márcio E
2017-07-21
The Passiflora genus comprises hundreds of wild and cultivated species of passion fruit used for food, industrial, ornamental and medicinal purposes. Efforts to develop genomic tools for genetic analysis of P. edulis, the most important commercial Passiflora species, are still incipient. In spite of many recognized applications of microsatellite markers in genetics and breeding, their availability for passion fruit research remains restricted. Microsatellite markers in P. edulis are usually limited in number, show reduced polymorphism, and are mostly based on compound or imperfect repeats. Furthermore, they are confined to only a few Passiflora species. We describe the use of NGS technology to partially assemble the P. edulis genome in order to develop hundreds of new microsatellite markers. A total of 14.11 Gbp of Illumina paired-end sequence reads were analyzed to detect simple sequence repeat sites in the sour passion fruit genome. A sample of 1300 contigs containing perfect repeat microsatellite sequences was selected for PCR primer development. Panels of di- and tri-nucleotide repeat markers were then tested in P. edulis germplasm accessions for validation. DNA polymorphism was detected in 74% of the markers (PIC = 0.16 to 0.77; number of alleles/locus = 2 to 7). A core panel of highly polymorphic markers (PIC = 0.46 to 0.77) was used to cross-amplify PCR products in 79 species of Passiflora (including P. edulis), belonging to four subgenera (Astrophea, Decaloba, Distephana and Passiflora). Approximately 71% of the marker/species combinations resulted in positive amplicons in all species tested. DNA polymorphism was detected in germplasm accessions of six closely related Passiflora species (P. edulis, P. alata, P. maliformis, P. nitida, P. quadrangularis and P. setacea) and the data used for accession discrimination and species assignment. A database of P. edulis DNA sequences obtained by NGS technology was examined to identify microsatellite repeats in
Genetic diversity studies in pea (Pisum sativum L.) using simple sequence repeat markers.
Kumari, P; Basal, N; Singh, A K; Rai, V P; Srivastava, C P; Singh, P K
2013-03-13
The genetic diversity among 28 pea (Pisum sativum L.) genotypes was analyzed using 32 simple sequence repeat markers. A total of 44 polymorphic bands, with an average of 2.1 bands per primer, were obtained. The polymorphism information content ranged from 0.657 to 0.309 with an average of 0.493. The variation in genetic diversity among these cultivars ranged from 0.11 to 0.73. Cluster analysis based on Jaccard's similarity coefficient using the unweighted pair-group method with arithmetic mean (UPGMA) revealed 2 distinct clusters, I and II, comprising 6 and 22 genotypes, respectively. Cluster II was further differentiated into 2 subclusters, IIA and IIB, with 12 and 10 genotypes, respectively. Principal component (PC) analysis revealed results similar to those of UPGMA. The first, second, and third PCs contributed 21.6, 16.1, and 14.0% of the variation, respectively; cumulative variation of the first 3 PCs was 51.7%.
Briner, Alexandra E; Barrangou, Rodolphe
2014-02-01
Clustered regularly interspaced short palindromic repeats (CRISPR) in combination with associated sequences (cas) constitute the CRISPR-Cas immune system, which uptakes DNA from invasive genetic elements as novel "spacers" that provide a genetic record of immunization events. We investigated the potential of CRISPR-based genotyping of Lactobacillus buchneri, a species relevant for commercial silage, bioethanol, and vegetable fermentations. Upon investigating the occurrence and diversity of CRISPR-Cas systems in Lactobacillus buchneri genomes, we observed a ubiquitous occurrence of CRISPR arrays containing a 36-nucleotide (nt) type II-A CRISPR locus adjacent to four cas genes, including the universal cas1 and cas2 genes and the type II signature gene cas9. Comparative analysis of CRISPR spacer content in 26 L. buchneri pickle fermentation isolates associated with spoilage revealed 10 unique locus genotypes that contained between 9 and 29 variable spacers. We observed a set of conserved spacers at the ancestral end, reflecting a common origin, as well as leader-end polymorphisms, reflecting recent divergence. Some of these spacers showed perfect identity with phage sequences, and many spacers showed homology to Lactobacillus plasmid sequences. Following a comparative analysis of sequences immediately flanking protospacers that matched CRISPR spacers, we identified a novel putative protospacer-adjacent motif (PAM), 5'-AAAA-3'. Overall, these findings suggest that type II-A CRISPR-Cas systems are valuable for genotyping of L. buchneri.
Sequence-specific bias correction for RNA-seq data using recurrent neural networks.
Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru
2017-01-25
The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.
International Nuclear Information System (INIS)
Hui Lihong; Zhang Xiaodong; He Chao; Xie Sheng; Xiao Jiangxi; Zhang jue; Wang Xiaoying; Jiang Xuexiang
2010-01-01
Objective: To evaluate the stability and repeatability of gradient-echo sampling of spin- echo (GESSE) sequence in measuring the R 2 ' value in volunteers, by comparison with traditional GRE sequence (T 2 * ]nap and T 2 map). Methods: Eight normal healthy volunteers were enrolled in this study and written informed consents were obtained from all subjects. MR scanning including sequences of GESSE, T 2 map and T 2 * map were performed in these subjects at resting status. The same protocol was repeated one day later. Raw data from GESSE sequence were transferred to PC to conduct postprocessing with the software built in house. R 2 ' map and OEF map were got consequently. To obtain quantitative R 2 ' and OEF values in the brain parenchyma, six ROIs were equally placed in the anterior, middle and posterior part of bilateral hemispheres. Both mean and standard deviation of R 2 ' and OEF were recorded. All images from T 2 * map and T 2 map were transferred to the Workstation for postprocessing. The ROIs were put at the same areas as those for GESSE sequence. R 2 ' is defined as R 2 ' = R 2 * - R 2 , R 2 * = 1/T 2 * . The R 2 ' value of GESSE sequence were compared with that of GRE sequence. Results: The mean R 2 ' values of GESSE at the first and second scan and those of the GRE were (4.21±0.92), (4.45±0.94) Hz and (7.37±1.47), (6.42±2.33) Hz respectively. The mean OEF values of GESSE at the first and second scan is 0.327±0.036 and 0.336± 0.035 respectively. The R 2 ' value and OEF value obtained from GESSE were not significantly different between the first and second scan (t=-0.83, -1.48, P>0.05). The R 2 ' value of first GRE imaging had significantly statistical difference from that of second GRE imaging (t=1.80, P 2 ' value of GESSE sequence was less than that of GRE sequence, and there was significantly statistical difference between them (t=1.71, P<0.05). Conclusion: The GESSE sequence has good stability and repeatability with promising clinical practicability
Cech, Jennifer N; Peichel, Catherine L
2015-12-01
Centromere sequences exist as gaps in many genome assemblies due to their repetitive nature. Here we take an unbiased approach utilizing centromere protein A (CENP-A) chomatin immunoprecipitation followed by high-throughput sequencing to identify the centromeric repeat sequence in the threespine stickleback fish (Gasterosteus aculeatus). A 186-bp, AT-rich repeat was validated as centromeric using both fluorescence in situ hybridization (FISH) and immunofluorescence combined with FISH (IF-FISH) on interphase nuclei and metaphase spreads. This repeat hybridizes strongly to the centromere on all chromosomes, with the exception of weak hybridization to the Y chromosome. Together, our work provides the first validated sequence information for the threespine stickleback centromere.
DEFF Research Database (Denmark)
Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens
2011-01-01
Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...
Brütting, Christine; Emmer, Alexander; Kornhuber, Malte; Staege, Martin S
2016-08-01
Although multiple sclerosis (MS) is one of the most common central nervous system diseases in young adults, little is known about its etiology. Several human endogenous retroviruses (ERVs) are considered to play a role in MS. We are interested in which ERVs can be identified in the vicinity of MS associated genetic marker to find potential initiators of MS. We analysed the chromosomal regions surrounding 58 single nucleotide polymorphisms (SNPs) that are associated with MS identified in one of the last major genome wide association studies. We scanned these regions for putative endogenous retrovirus sequences with large open reading frames (ORFs). We observed that more retrovirus-related putative ORFs exist in the relatively close vicinity of SNP marker indices in multiple sclerosis compared to control SNPs. We found very high homologies to HERV-K, HCML-ARV, XMRV, Galidia ERV, HERV-H/env62 and XMRV-like mouse endogenous retrovirus mERV-XL. The associated genes (CYP27B1, CD6, CD58, MPV17L2, IL12RB1, CXCR5, PTGER4, TAGAP, TYK2, ICAM3, CD86, GALC, GPR65 as well as the HLA DRB1*1501) are mainly involved in the immune system, but also in vitamin D regulation. The most frequently detected ERV sequences are related to the multiple sclerosis-associated retrovirus, the human immunodeficiency virus 1, HERV-K, and the Simian foamy virus. Our data shows that there is a relation between MS associated SNPs and the number of retroviral elements compared to control. Our data identifies new ERV sequences that have not been associated with MS, so far.
Ruhlman, Tracey; Lee, Seung-Bum; Jansen, Robert K; Hostetler, Jessica B; Tallon, Luke J; Town, Christopher D; Daniell, Henry
2006-08-31
Carrot (Daucus carota) is a major food crop in the US and worldwide. Its capacity for storage and its lifecycle as a biennial make it an attractive species for the introduction of foreign genes, especially for oral delivery of vaccines and other therapeutic proteins. Until recently efforts to express recombinant proteins in carrot have had limited success in terms of protein accumulation in the edible tap roots. Plastid genetic engineering offers the potential to overcome this limitation, as demonstrated by the accumulation of BADH in chromoplasts of carrot taproots to confer exceedingly high levels of salt resistance. The complete plastid genome of carrot provides essential information required for genetic engineering. Additionally, the sequence data add to the rapidly growing database of plastid genomes for assessing phylogenetic relationships among angiosperms. The complete carrot plastid genome is 155,911 bp in length, with 115 unique genes and 21 duplicated genes within the IR. There are four ribosomal RNAs, 30 distinct tRNA genes and 18 intron-containing genes. Repeat analysis reveals 12 direct and 2 inverted repeats > or = 30 bp with a sequence identity > or = 90%. Phylogenetic analysis of nucleotide sequences for 61 protein-coding genes using both maximum parsimony (MP) and maximum likelihood (ML) were performed for 29 angiosperms. Phylogenies from both methods provide strong support for the monophyly of several major angiosperm clades, including monocots, eudicots, rosids, asterids, eurosids II, euasterids I, and euasterids II. The carrot plastid genome contains a number of dispersed direct and inverted repeats scattered throughout coding and non-coding regions. This is the first sequenced plastid genome of the family Apiaceae and only the second published genome sequence of the species-rich euasterid II clade. Both MP and ML trees provide very strong support (100% bootstrap) for the sister relationship of Daucus with Panax in the euasterid II clade. These
Directory of Open Access Journals (Sweden)
Ruhlman Tracey
2006-08-01
Full Text Available Abstract Background Carrot (Daucus carota is a major food crop in the US and worldwide. Its capacity for storage and its lifecycle as a biennial make it an attractive species for the introduction of foreign genes, especially for oral delivery of vaccines and other therapeutic proteins. Until recently efforts to express recombinant proteins in carrot have had limited success in terms of protein accumulation in the edible tap roots. Plastid genetic engineering offers the potential to overcome this limitation, as demonstrated by the accumulation of BADH in chromoplasts of carrot taproots to confer exceedingly high levels of salt resistance. The complete plastid genome of carrot provides essential information required for genetic engineering. Additionally, the sequence data add to the rapidly growing database of plastid genomes for assessing phylogenetic relationships among angiosperms. Results The complete carrot plastid genome is 155,911 bp in length, with 115 unique genes and 21 duplicated genes within the IR. There are four ribosomal RNAs, 30 distinct tRNA genes and 18 intron-containing genes. Repeat analysis reveals 12 direct and 2 inverted repeats ≥ 30 bp with a sequence identity ≥ 90%. Phylogenetic analysis of nucleotide sequences for 61 protein-coding genes using both maximum parsimony (MP and maximum likelihood (ML were performed for 29 angiosperms. Phylogenies from both methods provide strong support for the monophyly of several major angiosperm clades, including monocots, eudicots, rosids, asterids, eurosids II, euasterids I, and euasterids II. Conclusion The carrot plastid genome contains a number of dispersed direct and inverted repeats scattered throughout coding and non-coding regions. This is the first sequenced plastid genome of the family Apiaceae and only the second published genome sequence of the species-rich euasterid II clade. Both MP and ML trees provide very strong support (100% bootstrap for the sister relationship of
International Nuclear Information System (INIS)
Bjoerheim, Jens; Abrahamsen, Torveig Weum; Kristensen, Annette Torgunrud; Gaudernack, Gustav; Ekstroem, Per O.
2003-01-01
Melting gel techniques have proven to be amenable and powerful tools in point mutation and single nucleotide polymorphism (SNP) analysis. With the introduction of commercially available capillary electrophoresis instruments, a partly automated platform for denaturant capillary electrophoresis with potential for routine screening of selected target sequences has been established. The aim of this article is to demonstrate the use of automated constant denaturant capillary electrophoresis (ACDCE) in single nucleotide polymorphism analysis of various target sequences. Optimal analysis conditions for different single nucleotide polymorphisms on ACDCE are evaluated with the Poland algorithm. Laboratory procedures include only PCR and electrophoresis. For direct genotyping of individual SNPs, the samples are analyzed with an internal standard and the alleles are identified by co-migration of sample and standard peaks. In conclusion, SNPs suitable for melting gel analysis based on theoretical thermodynamics were separated by ACDCE under appropriate conditions. With this instrumentation (ABI 310 Genetic Analyzer), 48 samples could be analyzed without any intervention. Several institutions have capillary instrumentation in-house, thus making this SNP analysis method accessible to large groups of researchers without any need for instrument modification
Directory of Open Access Journals (Sweden)
Nedenia Bonvino Stafuzza
Full Text Available Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose, Gyr, Girolando and Holstein (dairy production. A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs and 3,828,041 insertions/deletions (InDels were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.
Wang, Pengfei; Wang, Yingfang; Duan, Guangcai; Xue, Zerun; Wang, Linlin; Guo, Xiangjiao; Yang, Haiyan; Xi, Yuanlin
2015-04-01
This study was aimed to explore the features of clustered regularly interspaced short palindromic repeats (CRISPR) structures in Shigella by using bioinformatics. We used bioinformatics methods, including BLAST, alignment and RNA structure prediction, to analyze the CRISPR structures of Shigella genomes. The results showed that the CRISPRs existed in the four groups of Shigella, and the flanking sequences of upstream CRISPRs could be classified into the same group with those of the downstream. We also found some relatively conserved palindromic motifs in the leader sequences. Repeat sequences had the same group with corresponding flanking sequences, and could be classified into two different types by their RNA secondary structures, which contain "stem" and "ring". Some spacers were found to homologize with part sequences of plasmids or phages. The study indicated that there were correlations between repeat sequences and flanking sequences, and the repeats might act as a kind of recognition mechanism to mediate the interaction between foreign genetic elements and Cas proteins.
Directory of Open Access Journals (Sweden)
Lefranc Marie-Paule
2008-10-01
Full Text Available Abstract Background Nucleotides are trimmed from the ends of variable (V, diversity (D and joining (J genes during immunoglobulin (IG and T cell receptor (TR rearrangements in B cells and T cells of the immune system. This trimming is followed by addition of nucleotides at random, forming the N regions (N for nucleotides of the V-J and V-D-J junctions. These processes are crucial for creating diversity in the immune response since the number of trimmed nucleotides and the number of added nucleotides vary in each B or T cell. IMGT® sequence analysis tools, IMGT/V-QUEST and IMGT/JunctionAnalysis, are able to provide detailed and accurate analysis of the final observed junction nucleotide sequences (tool "output". However, as trimmed nucleotides can potentially be replaced by identical N region nucleotides during the process, the observed "output" represents a biased estimate of the "true trimming process." Results A probabilistic approach based on an analysis of the standardized tool "output" is proposed to infer the probability distribution of the "true trimmming process" and to provide plausible biological hypotheses explaining this process. We collated a benchmark dataset of TR alpha (TRA and TR gamma (TRG V-J rearranged sequences and junctions analysed with IMGT/V-QUEST and IMGT/JunctionAnalysis, the nucleotide sequence analysis tools from IMGT®, the international ImMunoGeneTics information system®, http://imgt.cines.fr. The standardized description of the tool output is based on the IMGT-ONTOLOGY axioms and concepts. We propose a simple first-order model that attempts to transform the observed "output" probability distribution into an estimate closer to the "true trimming process" probability distribution. We use this estimate to test the hypothesis that Poisson processes are involved in trimming. This hypothesis was not rejected at standard confidence levels for three of the four trimming processes: TRAV, TRAJ and TRGV. Conclusion By
Bleakley, Kevin; Lefranc, Marie-Paule; Biau, Gérard
2008-10-02
Nucleotides are trimmed from the ends of variable (V), diversity (D) and joining (J) genes during immunoglobulin (IG) and T cell receptor (TR) rearrangements in B cells and T cells of the immune system. This trimming is followed by addition of nucleotides at random, forming the N regions (N for nucleotides) of the V-J and V-D-J junctions. These processes are crucial for creating diversity in the immune response since the number of trimmed nucleotides and the number of added nucleotides vary in each B or T cell. IMGT sequence analysis tools, IMGT/V-QUEST and IMGT/JunctionAnalysis, are able to provide detailed and accurate analysis of the final observed junction nucleotide sequences (tool "output"). However, as trimmed nucleotides can potentially be replaced by identical N region nucleotides during the process, the observed "output" represents a biased estimate of the "true trimming process." A probabilistic approach based on an analysis of the standardized tool "output" is proposed to infer the probability distribution of the "true trimmming process" and to provide plausible biological hypotheses explaining this process. We collated a benchmark dataset of TR alpha (TRA) and TR gamma (TRG) V-J rearranged sequences and junctions analysed with IMGT/V-QUEST and IMGT/JunctionAnalysis, the nucleotide sequence analysis tools from IMGT, the international ImMunoGeneTics information system, http://imgt.cines.fr. The standardized description of the tool output is based on the IMGT-ONTOLOGY axioms and concepts. We propose a simple first-order model that attempts to transform the observed "output" probability distribution into an estimate closer to the "true trimming process" probability distribution. We use this estimate to test the hypothesis that Poisson processes are involved in trimming. This hypothesis was not rejected at standard confidence levels for three of the four trimming processes: TRAV, TRAJ and TRGV. By using trimming of rearranged TR genes as a benchmark, we
Population genomics of parallel adaptation in threespine stickleback using sequenced RAD tags.
Directory of Open Access Journals (Sweden)
Paul A Hohenlohe
2010-02-01
Full Text Available Next-generation sequencing technology provides novel opportunities for gathering genome-scale sequence data in natural populations, laying the empirical foundation for the evolving field of population genomics. Here we conducted a genome scan of nucleotide diversity and differentiation in natural populations of threespine stickleback (Gasterosteus aculeatus. We used Illumina-sequenced RAD tags to identify and type over 45,000 single nucleotide polymorphisms (SNPs in each of 100 individuals from two oceanic and three freshwater populations. Overall estimates of genetic diversity and differentiation among populations confirm the biogeographic hypothesis that large panmictic oceanic populations have repeatedly given rise to phenotypically divergent freshwater populations. Genomic regions exhibiting signatures of both balancing and divergent selection were remarkably consistent across multiple, independently derived populations, indicating that replicate parallel phenotypic evolution in stickleback may be occurring through extensive, parallel genetic evolution at a genome-wide scale. Some of these genomic regions co-localize with previously identified QTL for stickleback phenotypic variation identified using laboratory mapping crosses. In addition, we have identified several novel regions showing parallel differentiation across independent populations. Annotation of these regions revealed numerous genes that are candidates for stickleback phenotypic evolution and will form the basis of future genetic analyses in this and other organisms. This study represents the first high-density SNP-based genome scan of genetic diversity and differentiation for populations of threespine stickleback in the wild. These data illustrate the complementary nature of laboratory crosses and population genomic scans by confirming the adaptive significance of previously identified genomic regions, elucidating the particular evolutionary and demographic history of such
Sequence variation and phylogenetic analysis of envelope glycoprotein of hepatitis G virus.
Lim, M Y; Fry, K; Yun, A; Chong, S; Linnen, J; Fung, K; Kim, J P
1997-11-01
A transfusion-transmissible agent provisionally designated hepatitis G virus (HGV) was recently identified. In this study, we examined the variability of the HGV genome by analysing sequences in the putative envelope region from 72 isolates obtained from diverse geographical sources. The 1561 nucleotide sequence of the E1/E2/NS2a region of HGV was determined from 12 isolates, and compared with three published sequences. The most variability was observed in 400 nucleotides at the N terminus of E2. We next analysed this 400 nucleotide envelope variable region (EV) from an additional 60 HGV isolates. This sequence varied considerably among the 75 isolates, with overall identity ranging from 79.3% to 99.5% at the nucleotide level, and from 83.5% to 100% at the amino acid level. However, hypervariable regions were not identified. Phylogenetic analyses indicated that the 75 HGV isolates belong to a single genotype. A single-tier distribution of evolutionary distances was observed among the 15 E1/E2/NS2a sequences and the 75 EV sequences. In contrast, 11 isolates of HCV were analysed and showed a three-tiered distribution, representing genotypes, subtypes, and isolates. The 75 isolates of HGV fell into four clusters on the phylogenetic tree. Tight geographical clustering was observed among the HGV isolates from Japan and Korea.
Environmental stress induces trinucleotide repeat mutagenesis in human cells.
Chatterjee, Nimrat; Lin, Yunfu; Santillan, Beatriz A; Yotnda, Patricia; Wilson, John H
2015-03-24
The dynamic mutability of microsatellite repeats is implicated in the modification of gene function and disease phenotype. Studies of the enhanced instability of long trinucleotide repeats (TNRs)-the cause of multiple human diseases-have revealed a remarkable complexity of mutagenic mechanisms. Here, we show that cold, heat, hypoxic, and oxidative stresses induce mutagenesis of a long CAG repeat tract in human cells. We show that stress-response factors mediate the stress-induced mutagenesis (SIM) of CAG repeats. We show further that SIM of CAG repeats does not involve mismatch repair, nucleotide excision repair, or transcription, processes that are known to promote TNR mutagenesis in other pathways of instability. Instead, we find that these stresses stimulate DNA rereplication, increasing the proportion of cells with >4 C-value (C) DNA content. Knockdown of the replication origin-licensing factor CDT1 eliminates both stress-induced rereplication and CAG repeat mutagenesis. In addition, direct induction of rereplication in the absence of stress also increases the proportion of cells with >4C DNA content and promotes repeat mutagenesis. Thus, environmental stress triggers a unique pathway for TNR mutagenesis that likely is mediated by DNA rereplication. This pathway may impact normal cells as they encounter stresses in their environment or during development or abnormal cells as they evolve metastatic potential.
Energy Technology Data Exchange (ETDEWEB)
Revaud, D.
2009-06-15
Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)
Uozumi, N; Sakurai, K; Sasaki, T; Takekawa, S; Yamagata, H; Tsukagoshi, N; Udaka, S
1989-01-01
The Bacillus polymyxa amylase gene comprises 3,588 nucleotides. The mature amylase comprises 1,161 amino acids with a molecular weight of 127,314. The gene appeared to be divided into two portions by the direct-repeat sequence located at almost the middle of the gene. The 5' region upstream of the direct-repeat sequence was shown to be responsible for the synthesis of beta-amylase. The 3' region downstream of the direct-repeat sequence contained four sequences homologous with those in other a...
Comparative and functional characterization of intragenic tandem repeats in 10 Aspergillus genomes.
Gibbons, John G; Rokas, Antonis
2009-03-01
Intragenic tandem repeats (ITRs) are consecutive repeats of three or more nucleotides found in coding regions. ITRs are the underlying cause of several human genetic diseases and have been associated with phenotypic variation, including pathogenesis, in several clades of the tree of life. We have examined the evolution and functional role of ITRs in 10 genomes spanning the fungal genus Aspergillus, a clade of relevance to medicine, agriculture, and industry. We identified several hundred ITRs in each of the species examined. ITR content varied extensively between species, with an average 79% of ITRs unique to a given species. For the fraction of conserved ITR regions, sequence comparisons within species and between close relatives revealed that they were highly variable. ITR-containing proteins were evolutionarily less conserved, compositionally distinct, and overrepresented for domains associated with cell-surface localization and function relative to the rest of the proteome. Furthermore, ITRs were preferentially found in proteins involved in transcription, cellular communication, and cell-type differentiation but were underrepresented in proteins involved in metabolism and energy. Importantly, although ITRs were evolutionarily labile, their functional associations appeared. To be remarkably conserved across eukaryotes. Fungal ITRs likely participate in a variety of developmental processes and cell-surface-associated functions, suggesting that their contribution to fungal lifestyle and evolution may be more general than previously assumed.
Directory of Open Access Journals (Sweden)
Frédérique Pasquali
2018-03-01
Full Text Available Listeria monocytogenes is a foodborne pathogen adapted to survive and persist in multiple environments. Following two previous studies on prevalence and virulence of L. monocytogenes ST121 and ST14 repeatedly collected in a the same rabbit-meat processing plant, the research questions of the present study were to: (1 assess persistence of L. monocytogenes isolates from the rabbit-plant; (2 select genes associated to physiological adaptation to the food-processing environment; (3 compare presence/absence/truncation of these genes in newly sequenced and publicly available ST121 and ST14 genomes. A total of 273 draft genomes including ST121 and ST14 newly sequenced and publicly available draft genomes were analyzed. Whole-genome Single Nucleotide Polymorfism (wgSNP analysis was performed separately on the assemblies of ST121 and ST14 draft genomes. SNPs alignments were used to infer phylogeny. A dataset of L. monocytogenes ecophysiology genes was built based on a comprehensive literature review. The 94 selected genes were screened on the assemblies of all ST121 and ST14 draft genomes. Significant gene enrichments were evaluated by statistical analyses. A persistent ST14 clone, including 23 out of 27 newly sequenced genomes, was circulating in the rabbit-meat plant along with two not persistent clones. A significant enrichment was observed in ST121 genomes concerning stress survival islet 2 (SSI-2 (alkaline and oxidative stress, qacH gene (resistance to benzalkonium chloride, cadA1C gene cassette (resistance to 70 mg/l of cadmium chloride and a truncated version of actA gene (biofilm formation. Conversely, ST14 draft genomes were enriched with a full-length version of actA gene along with the Listeria Genomic Island 2 (LGI 2 including the ars operon (arsenic resistance and the cadA4C gene cassette (resistance to 35 mg/l of cadmium chloride. Phenotypic tests confirmed ST121 as a weak biofilm producer in comparison to ST14. In conclusion, ST121
Pasquali, Frédérique; Palma, Federica; Guillier, Laurent; Lucchi, Alex; De Cesare, Alessandra; Manfreda, Gerardo
2018-01-01
Listeria monocytogenes is a foodborne pathogen adapted to survive and persist in multiple environments. Following two previous studies on prevalence and virulence of L. monocytogenes ST121 and ST14 repeatedly collected in a the same rabbit-meat processing plant, the research questions of the present study were to: (1) assess persistence of L. monocytogenes isolates from the rabbit-plant; (2) select genes associated to physiological adaptation to the food-processing environment; (3) compare presence/absence/truncation of these genes in newly sequenced and publicly available ST121 and ST14 genomes. A total of 273 draft genomes including ST121 and ST14 newly sequenced and publicly available draft genomes were analyzed. Whole-genome Single Nucleotide Polymorfism (wgSNP) analysis was performed separately on the assemblies of ST121 and ST14 draft genomes. SNPs alignments were used to infer phylogeny. A dataset of L. monocytogenes ecophysiology genes was built based on a comprehensive literature review. The 94 selected genes were screened on the assemblies of all ST121 and ST14 draft genomes. Significant gene enrichments were evaluated by statistical analyses. A persistent ST14 clone, including 23 out of 27 newly sequenced genomes, was circulating in the rabbit-meat plant along with two not persistent clones. A significant enrichment was observed in ST121 genomes concerning stress survival islet 2 (SSI-2) (alkaline and oxidative stress), qacH gene (resistance to benzalkonium chloride), cadA1C gene cassette (resistance to 70 mg/l of cadmium chloride) and a truncated version of actA gene (biofilm formation). Conversely, ST14 draft genomes were enriched with a full-length version of actA gene along with the Listeria Genomic Island 2 (LGI 2) including the ars operon (arsenic resistance) and the cadA4C gene cassette (resistance to 35 mg/l of cadmium chloride). Phenotypic tests confirmed ST121 as a weak biofilm producer in comparison to ST14. In conclusion, ST121 carried the
Park, Mi-Ri; Kwon, Sun-Jung; Choi, Hong-Soo; Hemenway, Cynthia L; Kim, Kook-Hyung
2008-08-15
The repeated ACCA or AC-rich sequence and structural (SL1) elements in the 5' non-translated region (NTR) of the Potato virus X (PVX) RNA play vital roles in the PVX life cycle by controlling translation, RNA replication, movement, and assembly. It has already been shown that the repeated ACCA or AC-rich sequence affect both gRNA and sgRNA accumulation, while not affecting minus-strand RNA accumulation, and are also required for host protein binding. The functional significance of the repeated ACCA sequence elements in the 5' NTR region was investigated by analyzing the effects of deletion and site-directed mutations on PVX replication in Nicotiana benthamiana plants and NT1 protoplasts. Substitution (ACCA into AAAA or UUUU) mutations introduced in the first (nt 10-13) element in the 5' NTR of the PVX RNA significantly affected viral replication, while mutations introduced in the second (nt 17-20) and third (nt 20-23) elements did not. The fourth (nt 29-32) ACCA element weakly affected virus replication, whereas mutations in the fifth (nt 38-41) significantly reduced virus replication due to the structure disruption of SL1 by AAAA and/or UUUU substitutions. Further characterization of the first ACCA element indicated that duplication of ACCA at nt 10-13 (nt 10-17, ACCAACCA) caused severe symptom development as compared to that of wild type, while deletion of the single element (nt 10-13), DeltaACCA) or tripling of this element caused reduced symptom development. Single- and double-nucleotide substitutions introduced into the first ACCA element revealed the importance of CC located at nt positions 11 and 12. Altogether, these results indicate that the first ACCA element is important for PVX replication.
Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.
2009-08-01
The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.
Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo
2017-09-01
There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.
An extended sequence specificity for UV-induced DNA damage.
Chung, Long H; Murray, Vincent
2018-01-01
The sequence specificity of UV-induced DNA damage was determined with a higher precision and accuracy than previously reported. UV light induces two major damage adducts: cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). Employing capillary electrophoresis with laser-induced fluorescence and taking advantages of the distinct properties of the CPDs and 6-4PPs, we studied the sequence specificity of UV-induced DNA damage in a purified DNA sequence using two approaches: end-labelling and a polymerase stop/linear amplification assay. A mitochondrial DNA sequence that contained a random nucleotide composition was employed as the target DNA sequence. With previous methodology, the UV sequence specificity was determined at a dinucleotide or trinucleotide level; however, in this paper, we have extended the UV sequence specificity to a hexanucleotide level. With the end-labelling technique (for 6-4PPs), the consensus sequence was found to be 5'-GCTC*AC (where C* is the breakage site); while with the linear amplification procedure, it was 5'-TCTT*AC. With end-labelling, the dinucleotide frequency of occurrence was highest for 5'-TC*, 5'-TT* and 5'-CC*; whereas it was 5'-TT* for linear amplification. The influence of neighbouring nucleotides on the degree of UV-induced DNA damage was also examined. The core sequences consisted of pyrimidine nucleotides 5'-CTC* and 5'-CTT* while an A at position "1" and C at position "2" enhanced UV-induced DNA damage. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.
A TALE-inspired computational screen for proteins that contain approximate tandem repeats.
Perycz, Malgorzata; Krwawicz, Joanna; Bochtler, Matthias
2017-01-01
TAL (transcription activator-like) effectors (TALEs) are bacterial proteins that are secreted from bacteria to plant cells to act as transcriptional activators. TALEs and related proteins (RipTALs, BurrH, MOrTL1 and MOrTL2) contain approximate tandem repeats that differ in conserved positions that define specificity. Using PERL, we screened ~47 million protein sequences for TALE-like architecture characterized by approximate tandem repeats (between 30 and 43 amino acids in length) and sequence variability in conserved positions, without requiring sequence similarity to TALEs. Candidate proteins were scored according to their propensity for nuclear localization, secondary structure, repeat sequence complexity, as well as covariation and predicted structural proximity of variable residues. Biological context was tentatively inferred from co-occurrence of other domains and interactome predictions. Approximate repeats with TALE-like features that merit experimental characterization were found in a protein of chestnut blight fungus, a eukaryotic plant pathogen.
International Nuclear Information System (INIS)
Kruminya, A.R.; Kroshkina, V.G.; Yurov, Yu.B.; Aleksandrov, I.A.; Mitkevich, S.P.; Gindilis, V.M.
1988-01-01
The chromosomal distribution of the cloned PHS05 fragment of human alphoid DNA was studied by in situ hybridization in 38 individuals. It was shown that this DNA fraction is primarily localized in the pericentric regions of practically all chromosomes of the set. Significant interchromosomal differences and a weakly expressed interindividual polymorphism were discovered in the copying ability of this class of repeating DNA sequences; associations were not found between the results of hybridization and the pattern of Q-polymorphism
Barreales, Eva G; Vicente, Cláudia M; de Pedro, Antonio; Santos-Aberturas, Javier; Aparicio, Jesús F
2018-05-15
The biosynthesis of small-size polyene macrolides is ultimately controlled by a couple of transcriptional regulators that act in a hierarchical way. A Streptomyces antibiotic regulatory protein-large ATP-binding regulator of the LuxR family (SARP-LAL) regulator binds the promoter of a PAS-LuxR regulator-encoding gene and activates its transcription, and in turn, the gene product of the latter activates transcription from various promoters of the polyene gene cluster directly. The primary operator of PimR, the archetype of SARP-LAL regulators, contains three heptameric direct repeats separated by four-nucleotide spacers, but the regulator can also bind a secondary operator with only two direct repeats separated by a 3-nucleotide spacer, both located in the promoter region of its unique target gene, pimM A similar arrangement of operators has been identified for PimR counterparts encoded by gene clusters for different antifungal secondary metabolites, including not only polyene macrolides but peptidyl nucleosides, phoslactomycins, or cycloheximide. Here, we used promoter engineering and quantitative transcriptional analyses to determine the contributions of the different heptameric repeats to transcriptional activation and final polyene production. Optimized promoters have thus been developed. Deletion studies and electrophoretic mobility assays were used for the definition of DNA-binding boxes formed by 22-nucleotide sequences comprising two conserved heptameric direct repeats separated by four-nucleotide less conserved spacers. The cooperative binding of PimR SARP appears to be the mechanism involved in the binding of regulator monomers to operators, and at least two protein monomers are required for efficient binding. IMPORTANCE Here, we have shown that a modulation of the production of the antifungal pimaricin in Streptomyces natalensis can be accomplished via promoter engineering of the PAS-LuxR transcriptional activator pimM The expression of this gene is
Sequencing and De Novo Assembly of the Toxicodendron radicans (Poison Ivy) Transcriptome.
Weisberg, Alexandra J; Kim, Gunjune; Westwood, James H; Jelesko, John G
2017-11-10
Contact with poison ivy plants is widely dreaded because they produce a natural product called urushiol that is responsible for allergenic contact delayed-dermatitis symptoms lasting for weeks. For this reason, the catchphrase most associated with poison ivy is "leaves of three, let it be", which serves the purpose of both identification and an appeal for avoidance. Ironically, despite this notoriety, there is a dearth of specific knowledge about nearly all other aspects of poison ivy physiology and ecology. As a means of gaining a more molecular-oriented understanding of poison ivy physiology and ecology, Next Generation DNA sequencing technology was used to develop poison ivy root and leaf RNA-seq transcriptome resources. De novo assembled transcriptomes were analyzed to generate a core set of high quality expressed transcripts present in poison ivy tissue. The predicted protein sequences were evaluated for similarity to SwissProt homologs and InterProScan domains, as well as assigned both GO terms and KEGG annotations. Over 23,000 simple sequence repeats were identified in the transcriptome, and corresponding oligo nucleotide primer pairs were designed. A pan-transcriptome analysis of existing Anacardiaceae transcriptomes revealed conserved and unique transcripts among these species.
In situ detection of tandem DNA repeat length
Energy Technology Data Exchange (ETDEWEB)
Yaar, R.; Szafranski, P.; Cantor, C.R.; Smith, C.L. [Boston Univ., MA (United States)
1996-11-01
A simple method for scoring short tandem DNA repeats is presented. An oligonucleotide target, containing tandem repeats embedded in a unique sequence, was hybridized to a set of complementary probes, containing tandem repeats of known lengths. Single-stranded loop structures formed on duplexes containing a mismatched (different) number of tandem repeats. No loop structure formed on duplexes containing a matched (identical) number of tandem repeats. The matched and mismatched loop structures were enzymatically distinguished and differentially labeled by treatment with S1 nuclease and the Klenow fragment of DNA polymerase. 7 refs., 4 figs.
Olsen, Ingrid; Balasingham, Seetha V; Davidsen, Tonje; Debebe, Ephrem; Rødland, Einar A; van Soolingen, Dick; Kremer, Kristin; Alseth, Ingrun; Tønjum, Tone
2009-07-01
The ability to repair DNA damage is likely to play an important role in the survival of facultative intracellular parasites because they are exposed to high levels of reactive oxygen species and nitrogen intermediates inside phagocytes. Correcting oxidative damage in purines and pyrimidines is the primary function of the enzymes formamidopyrimidine (faPy)-DNA glycosylase (Fpg) and endonuclease VIII (Nei) of the base excision repair pathway, respectively. Four gene homologs, belonging to the fpg/nei family, have been identified in Mycobacterium tuberculosis H37Rv. The recombinant protein encoded by M. tuberculosis Rv2924c, termed Mtb-Fpg1, was overexpressed, purified and biochemically characterized. The enzyme removed faPy and 5-hydroxycytosine lesions, as well as 8-oxo-7,8-dihydroguanine (8oxoG) opposite to C, T and G. Mtb-Fpg1 thus exhibited substrate specificities typical for Fpg enzymes. Although Mtb-fpg1 showed nearly complete nucleotide sequence conservation in 32 M. tuberculosis isolates, the region upstream of Mtb-fpg1 in these strains contained tandem repeat motifs of variable length. A relationship between repeat length and Mtb-fpg1 expression level was demonstrated in M. tuberculosis strains, indicating that an increased length of the tandem repeats positively influenced the expression levels of Mtb-fpg1. This is the first example of such a tandem repeat region of variable length being linked to the expression level of a bacterial gene.
Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R
2016-06-01
As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.
Wang, Defu; Wang, Xiaobing; Mei, Yu; Dong, Hansong
2016-03-01
Powdery mildew, one of the most destructive wheat diseases worldwide, is caused by Blumeria graminis f. sp. tritici (Bgt), a fungal species with a consistently high mutation rate that makes individual resistance (R) genes ineffective. Therefore, effective resistance-related gene cloning is vital for breeding and studying the resistance mechanisms of the disease. In this study, a putative nucleotide-binding site-leucine-rich repeat (NBS-LRR) R gene (TaRGA) was cloned using a homology-based cloning strategy and analyzed for its effect on powdery mildew disease and wheat defense responses. Real-time reverse transcription-PCR (RT-PCR) analyses revealed that a Bgt isolate 15 and salicylic acid stimulation significantly induced TaRGA in the resistant variety. Furthermore, the silencing of TaRGA in powdery mildew-resistant plants increased susceptibility to Bgt15 and prompted conidia propagation at the infection site. However, the expression of TaRGA in leaf segments after single-cell transient expression assay highly increased the defense responses to Bgt15 by enhancing callose deposition and phenolic autofluorogen accumulation at the pathogen invading sites. Meanwhile, the expression of pathogenesis-related genes decreased in the TaRGA-silenced plants and increased in the TaRGA-transient-overexpressing leaf segments. These results implied that the TaRGA gene positively regulates the defense response to powdery mildew disease in wheat.
Directory of Open Access Journals (Sweden)
Hane James K
2010-11-01
Full Text Available Abstract Background Repeat-induced point mutation (RIP is a fungal genome defence mechanism guarding against transposon invasion. RIP mutates the sequence of repeated DNA and over time renders the affected regions unrecognisable by similarity search tools such as BLAST. Results DeRIP is a new software tool developed to predict the original sequence of a RIP-mutated region prior to the occurrence of RIP. In this study, we apply deRIP to the genome of the wheat pathogen Stagonospora nodorum SN15 and predict the origin of several previously uncharacterised classes of repetitive DNA. Conclusions Five new classes of transposon repeats and four classes of endogenous gene repeats were identified after deRIP. The deRIP process is a new tool for fungal genomics that facilitates the identification and understanding of the role and origin of fungal repetitive DNA. DeRIP is open-source and is available as part of the RIPCAL suite at http://www.sourceforge.net/projects/ripcal.
Preparation of protected nucleotides usable in oligonucleotide synthesis
International Nuclear Information System (INIS)
Debiard, Jean-Pascal
1983-01-01
After having presented the components of DNA, the author of this research thesis outlines that, when dealing the chemical synthesis, the respect of the sequence of these components is the main problem as each nucleotide possesses several functions which may react with each other. In order to solve this problem, functional protection is used to protect functions which may react in an undesirable way and to let free those which participate to the desired reaction. But a selective protector group must be used and this group must remain stable during the operations it is not involved in. Therefore, its elimination will be easy and without any risk of deterioration of the synthesised molecule. This research thesis first addresses the various available techniques to perform these steps, and then reports the study of possible applications of synthetic nucleotides in the field of genetic engineering [fr
We are attempting to identify specific root fragments from soil cores with individual trees. We successfully used Inter Simple Sequence Repeats (ISSR) to distinguish neighboring old-growth Douglas-fir trees from one another, while maintaining identity among each tree's parts. W...
Nucleotide polymorphisms and haplotype diversity of RTCS gene in China elite maize inbred lines.
Directory of Open Access Journals (Sweden)
Enying Zhang
Full Text Available The maize RTCS gene, encoding a LOB domain transcription factor, plays important roles in the initiation of embryonic seminal and postembryonic shoot-borne root. In this study, the genomic sequences of this gene in 73 China elite inbred lines, including 63 lines from 5 temperate heteroric groups and 10 tropic germplasms, were obtained, and the nucleotide polymorphisms and haplotype diversity were detected. A total of 63 sequence variants, including 44 SNPs and 19 indels, were identified at this locus, and most of them were found to be located in the regions of UTR and intron. The coding region of this gene in all tested inbred lines carried 14 haplotypes, which encoding 7 deferring RTCS proteins. Analysis of the polymorphism sites revealed that at least 6 recombination events have occurred. Among all 6 groups tested, only the P heterotic group had a much lower nucleotide diversity than the whole set, and selection analysis also revealed that only this group was under strong negative selection. However, the set of Huangzaosi and its derived lines possessed a higher nucleotide diversity than the whole set, and no selection signal were identified.
LNA-enhanced detection of single nucleotide polymorphisms in the apolipoprotein E
DEFF Research Database (Denmark)
Jacobsen, Nana; Bentzen, Joan; Meldgaard, Michael
2002-01-01
Genotyping of single nucleotide polymorphisms (SNPs) in large populations presents a great challenge, especially if the SNPs are embedded in GC-rich regions, such as the codon 112 SNP in the human apolipoprotein E (apoE). In the present study, we have used immobilized locked nucleic acid (LNA...... was applied to a panel of patient samples with simultaneous genotyping of the patients by DNA sequencing. The apoE genotyping assays for the codons 112 and 158 SNPs resulted in unambiguous results for all patient samples, concurring with those obtained by DNA sequencing....
Directory of Open Access Journals (Sweden)
Mingjun Sun
2017-12-01
Full Text Available Brucellosis is a worldwide zoonotic disease caused by Brucella spp. In China, brucellosis is recognized as a reemerging disease mainly caused by Brucella melitensis specie. To better understand the currently endemic B. melitensis strains in China, three Brucella genotyping methods were applied to 110 B. melitensis strains obtained in past several years. By MLVA genotyping, five MLVA-8 genotypes were identified, among which genotypes 42 (1-5-3-13-2-2-3-2 was recognized as the predominant genotype, while genotype 63 (1-5-3-13-2-3-3-2 and a novel genotype of 1-5-3-13-2-4-3-2 were second frequently observed. MLVA-16 discerned a total of 57 MLVA-16 genotypes among these Brucella strains, with 41 genotypes being firstly detected and the other 16 genotypes being previously reported. By BruMLSA21 typing, six sequence types (STs were identified, among them ST8 is the most frequently seen in China while the other five STs were firstly detected and designated as ST137, ST138, ST139, ST140, and ST141 by international multilocus sequence typing database. Whole-genome sequence (WGS-single-nucleotide polymorphism (SNP-based typing and phylogenetic analysis resolved Chinese B. melitensis strains into five clusters, reflecting the existence of multiple lineages among these Chinese B. melitensis strains. In phylogeny, Chinese lineages are more closely related to strains collected from East Mediterranean and Middle East countries, such as Turkey, Kuwait, and Iraq. In the next few years, MLVA typing will certainly remain an important epidemiological tool for Brucella infection analysis, as it displays a high discriminatory ability and achieves result largely in agreement with WGS-SNP-based typing. However, WGS-SNP-based typing is found to be the most powerful and reliable method in discerning Brucella strains and will be popular used in the future.
Anderson, James; Wright, Drew; Meksem, Khalid
2013-01-01
In the modern age of genetic research there is a constant search for ways to improve the efficiency of plant selection. The most recent technology that can result in a highly efficient means of selection and still be done at a low cost is through plant selection directed by simple sequence repeats (SSRs or microsatellites). The molecular markers are used to select for certain desirable plant traits without relying on ambiguous phenotypic data. The best way to detect these is the use of gel electrophoresis. Gel electrophoresis is a common technique in laboratory settings which is used to separate deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) by size. Loading DNA and RNA onto gels allows for visualization of the size of fragments through the separation of DNA and RNA fragments. This is achieved through the use of the charge in the particles. As the fragments separate, they form into distinct bands at set sizes. We describe the ability to visualize SSRs on slab gels of agarose and polyacrylamide gel electrophoresis.
Cytosolic 5'-nucleotidase II interacts with the leucin rich repeat of NLR family member Ipaf.
Directory of Open Access Journals (Sweden)
Federico Cividini
Full Text Available IMP/GMP preferring cytosolic 5'-nucleotidase II (cN-II is a bifunctional enzyme whose activities and expression play crucial roles in nucleotide pool maintenance, nucleotide-dependent pathways and programmed cell death. Alignment of primary amino acid sequences of cN-II from human and other organisms show a strong conservation throughout the entire vertebrata taxon suggesting a fundamental role in eukaryotic cells. With the aim to investigate the potential role of this homology in protein-protein interactions, a two hybrid system screening of cN-II interactors was performed in S. cerevisiae. Among the X positive hits, the Leucin Rich Repeat (LRR domain of Ipaf was found to interact with cN-II. Recombinant Ipaf isoform B (lacking the Nucleotide Binding Domain was used in an in vitro affinity chromatography assay confirming the interaction obtained in the screening. Moreover, co-immunoprecipitation with proteins from wild type Human Embryonic Kidney 293 T cells demonstrated that endogenous cN-II co-immunoprecipitated both with wild type Ipaf and its LRR domain after transfection with corresponding expression vectors, but not with Ipaf lacking the LRR domain. These results suggest that the interaction takes place through the LRR domain of Ipaf. In addition, a proximity ligation assay was performed in A549 lung carcinoma cells and in MDA-MB-231 breast cancer cells and showed a positive cytosolic signal, confirming that this interaction occurs in human cells. This is the first report of a protein-protein interaction involving cN-II, suggesting either novel functions or an additional level of regulation of this complex enzyme.
Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.
2014-01-01
Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795
Directory of Open Access Journals (Sweden)
Xiaolin Ji
Full Text Available Subgroup J avian leukosis virus (ALV-J was first isolated from meat-type chickens that had developed myeloid leukosis and since 2008, ALV-J infections in chickens have become widespread in China. A comparison of the sequence of ALV-J epidemic isolates with HPRS-103, the ALV-J prototype virus, revealed several distinct features, one of which is a 19-nucleotide (nt insertion in the leader sequence. To determine the role of the 19-nt insertion in ALV-J pathogenicity, a pair of viruses were constructed and rescued. The first virus was an ALV-J Chinese isolate (designated rSD1009 containing the 19-nt insertion in its leader sequence. The second virus was a clone, in which the leader sequence had a deleted 19-nt sequence (designated rSD1009△19. Compared with rSD1009△19, rSD1009 displayed a moderate growth advantage in vitro. However, no differences were demonstrated in either viral replication or oncogenicity between the two rescued viruses in chickens. These results indicated that the 19-nt insertion contributed to ALV-J replication in vitro but was not related to its pathogenicity in vivo.
Gui, Xiao-Ling; Chang, Xiao-Bei; Gong, Zhen-Hui
2013-01-01
Mature pepper (Capsicum sp.) fruits come in a variety of colors, including red, orange, yellow, brown, and white. To better understand the genetic and regulatory relationships between the yellow fruit phenotype and the capsanthin-capsorubin synthase gene (Ccs), we examined 156 Capsicum varieties, most of which were collected from Northwest Chinese landraces. A new ccs variant was identified in the yellow fruit cultivar CK7. Cluster analysis revealed that CK7, which belongs to the C. annuum species, has low genetic similarity to other yellow C. annuum varieties. In the coding sequence of this ccs allele, we detected a premature stop codon derived from a C to G change, as well as a downstream frame-shift caused by a 1-bp nucleotide deletion. In addition, the expression of the gene was detected in mature CK7 fruit. Furthermore, the promoter sequences of Ccs from some pepper varieties were examined, and we detected a 176-bp tandem repeat sequence in the promoter region. In all C. annuum varieties examined in this study, the repeat number was three, compared with four in two C. chinense accessions. The sequence similarity ranged from 84.8% to 97.7% among the four types of repeats, and some putative cis-elements were also found in every repeat. This suggests that the transcriptional regulation of Ccs expression is complex. Based on the analysis of the novel C. annuum mutation reported here, along with the studies of three mutation types in yellow C. annuum and C. chinense accessions, we suggest that the mechanism leading to the production of yellow color fruit may be not as complex as that leading to orange fruit production. PMID:23637942
Pelham, Christopher; Jimenez, Tamara; Rodova, Marianna; Rudolph, Angela; Chipps, Elizabeth; Islam, M Rafiq
2013-12-01
Hereditary hemochromatosis (HH) is a common autosomal recessive disorder of iron overload among Caucasians of northern European descent. Over 85% of all cases with HH are due to mutations in the hemochromatosis protein (HFE) involved in iron metabolism. Although the importance in iron homeostasis is well recognized, the mechanism of sensing and regulating iron absorption by HFE, especially in the absence of iron response element in its gene, is not fully understood. In this report, we have identified an inverted repeat sequence (ATGGTcttACCTA) within 1700bp (-1675/+35) of the HFE promoter capable to form cruciform structure that binds PARP1 and strongly represses HFE promoter. Knockdown of PARP1 increases HFE mRNA and protein. Similarly, hemin or FeCl3 treatments resulted in increase in HFE expression by reducing nuclear PARP1 pool via its apoptosis induced cleavage, leading to upregulation of the iron regulatory hormone hepcidin mRNA. Thus, PARP1 binding to the inverted repeat sequence on the HFE promoter may serve as a novel iron sensing mechanism as increased iron level can trigger PARP1 cleavage and relief of HFE transcriptional repression. © 2013.