WorldWideScience

Sample records for repeated nucleotide sequence

  1. The proviral genome of radiation leukemia virus: Molecular cloning, nucleotide sequence of its long terminal repeat and integration in lymphoma cell DNA

    International Nuclear Information System (INIS)

    Janowski, M.; Merregaert, J.; Boniver, J.; Maisin, J.R.

    1985-01-01

    The proviral genome of a thymotropic and leukemogenic C57BL/Ka mouse retrovirus, RadLV/VL/sub 3/(T+L+), was cloned as a biologically active PstI insert in the bacterial plasmid pBR322. Its restriction map was compared to those, already known, of two nonthymotropic and nonleukemogenic viruses of the same mouse strain, the ecotropic BL/Ka(B) and the xenotropic constituent of the radiation leukemia virus complex (RadLV). Differences were observed in the pol gene and in the env gene. Moreover, the nucleotide sequence of the RadLV/VL/sub 3/(T+L+) long terminal repeat revealed the existence of two copies of a 42 bp long sequence, separated by 11 nucleotides and of which BL/Ka(B) possesses only one copy

  2. Analysis of the genome sequence of the pathogenic Muscovy duck parvovirus strain YY reveals a 14-nucleotide-pair deletion in the inverted terminal repeats.

    Science.gov (United States)

    Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang

    2016-09-01

    Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.

  3. simple sequence repeat (SSR)

    African Journals Online (AJOL)

    In the present study, 78 mapped simple sequence repeat (SSR) markers representing 11 linkage groups of adzuki bean were evaluated for transferability to mungbean and related Vigna spp. 41 markers amplified characteristic bands in at least one Vigna species. The transferability percentage across the genotypes ranged ...

  4. The Role of the Y-Chromosome in the Establishment of Murine Hybrid Dysgenesis and in the Analysis of the Nucleotide Sequence Organization, Genetic Transmission and Evolution of Repeated Sequences.

    Science.gov (United States)

    Nallaseth, Ferez Soli

    The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1

  5. Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

    Science.gov (United States)

    Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

    2012-01-01

    Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604

  6. The soybean-Phytophthora resistance locus Rps1-k encompasses coiled coil-nucleotide binding-leucine rich repeat-like genes and repetitive sequences

    Directory of Open Access Journals (Sweden)

    Bhattacharyya Madan K

    2008-03-01

    Full Text Available Abstract Background A series of Rps (resistance to Pytophthora sojae genes have been protecting soybean from the root and stem rot disease caused by the Oomycete pathogen, Phytophthora sojae. Five Rps genes were mapped to the Rps1 locus located near the 28 cM map position on molecular linkage group N of the composite genetic soybean map. Among these five genes, Rps1-k was introgressed from the cultivar, Kingwa. Rps1-k has been providing stable and broad-spectrum Phytophthora resistance in the major soybean-producing regions of the United States. Rps1-k has been mapped and isolated. More than one functional Rps1-k gene was identified from the Rps1-k locus. The clustering feature at the Rps1-k locus might have facilitated the expansion of Rps1-k gene numbers and the generation of new recognition specificities. The Rps1-k region was sequenced to understand the possible evolutionary steps that shaped the generation of Phytophthora resistance genes in soybean. Results Here the analyses of sequences of three overlapping BAC clones containing the 184,111 bp Rps1-k region are reported. A shotgun sequencing strategy was applied in sequencing the BAC contig. Sequence analysis predicted a few full-length genes including two Rps1-k genes, Rps1-k-1 and Rps1-k-2. Previously reported Rps1-k-3 from this genomic region 1 was evolved through intramolecular recombination between Rps1-k-1 and Rps1-k-2 in Escherichia coli. The majority of the predicted genes are truncated and therefore most likely they are nonfunctional. A member of a highly abundant retroelement, SIRE1, was identified from the Rps1-k region. The Rps1-k region is primarily composed of repetitive sequences. Sixteen simple repeat and 63 tandem repeat sequences were identified from the locus. Conclusion These data indicate that the Rps1 locus is located in a gene-poor region. The abundance of repetitive sequences in the Rps1-k region suggested that the location of this locus is in or near a

  7. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  8. Repeated DNA sequences in fungi

    Energy Technology Data Exchange (ETDEWEB)

    Dutta, S K

    1974-11-01

    Several fungal species, representatives of all broad groups like basidiomycetes, ascomycetes and phycomycetes, were examined for the nature of repeated DNA sequences by DNA:DNA reassociation studies using hydroxyapatite chromatography. All of the fungal species tested contained 10 to 20 percent repeated DNA sequences. There are approximately 100 to 110 copies of repeated DNA sequences of approximately 4 x 10/sup 7/ daltons piece size of each. Repeated DNA sequence homoduplexes showed on average 5/sup 0/C difference of T/sub e/50 (temperature at which 50 percent duplexes dissociate) values from the corresponding homoduplexes of unfractionated whole DNA. It is suggested that a part of repetitive sequences in fungi constitutes mitochondrial DNA and a part of it constitutes nuclear DNA. (auth)

  9. Optimization of sequence alignment for simple sequence repeat regions

    Directory of Open Access Journals (Sweden)

    Ogbonnaya Francis C

    2011-07-01

    Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs. SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. Findings To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type. When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. Conclusions The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic

  10. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  11. CHARACTERIZATION AND NUCLEOTIDE SEQUENCE DETERMINATION OF A REPEAT ELEMENT ISOLATED FROM A 2,4,5,-T DEGRADING STRAIN OF PSEUDOMONAS CEPACIA

    Science.gov (United States)

    Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...

  12. Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

    Directory of Open Access Journals (Sweden)

    Desirée Villahermosa

    2017-05-01

    Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.

  13. simple sequence repeats (EST-SSR)

    African Journals Online (AJOL)

    Yomi

    2012-01-19

    Jan 19, 2012 ... 212 primer pairs selected, based on repeat patterns of n≥8 for di-, tri-, tetra- and penta-nucleotide repeat ... Cluster analysis revealed a high genetic similarity among the sugarcane (Saccharum spp.) breeding lines which could reduce the genetic gain in ..... The multiple allele characteristic of SSR com-.

  14. Novel expressed sequence tag- simple sequence repeats (EST ...

    African Journals Online (AJOL)

    Using different bioinformatic criteria, the SUCEST database was used to mine for simple sequence repeat (SSR) markers. Among 42,189 clusters, 1,425 expressed sequence tag- simple sequence repeats (EST-SSRs) were identified in silico. Trinucleotide repeats were the most abundant SSRs detected. Of 212 primer pairs ...

  15. Two tandemly repeated telomere-associated sequences in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Chen, C M; Wang, C T; Wang, C J; Ho, C H; Kao, Y Y; Chen, C C

    1997-12-01

    Two tandemly repeated telomere-associated sequences, NP3R and NP4R, have been isolated from Nicotiana plumbaginifolia. The length of a repeating unit for NP3R and NP4R is 165 and 180 nucleotides respectively. The abundance of NP3R, NP4R and telomeric repeats is, respectively, 8.4 x 10(4), 6 x 10(3) and 1.5 x 10(6) copies per haploid genome of N. plumbaginifolia. Fluorescence in situ hybridization revealed that NP3R is located at the ends and/or in interstitial regions of all 10 chromosomes and NP4R on the terminal regions of three chromosomes in the haploid genome of N. plumbaginifolia. Sequence homology search revealed that not only are NP3R and NP4R homologous to HRS60 and GRS, respectively, two tandem repeats isolated from N. tabacum, but that NP3R and NP4R are also related to each other, suggesting that they originated from a common ancestral sequence. The role of these repeated sequences in chromosome healing is discussed based on the observation that two to three copies of a telomere-similar sequence were present in each repeating unit of NP3R and NP4R.

  16. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  17. Nucleotide sequence of soybean chloroplast DNA regions which contain the psb A and trn H genes and cover the ends of the large single copy region and one end of the inverted repeats.

    Science.gov (United States)

    Spielmann, A; Stutz, E

    1983-10-25

    The soybean chloroplast psb A gene (photosystem II thylakoid membrane protein of Mr 32 000, lysine-free) and the trn H gene (tRNAHisGUG), which both map in the large single copy region adjacent to one of the inverted repeat structures (IR1), have been sequenced including flanking regions. The psb A gene shows in its structural part 92% sequence homology with the corresponding genes of spinach and N. debneyi and contains also an open reading frame for 353 aminoacids. The aminoacid sequence of a potential primary translation product (calculated Mr, 38 904, no lysine) diverges from that of spinach and N. debneyi in only two positions in the C-terminal part. The trn H gene has the same polarity as the psb A gene and the coding region is located at the very end of the large single copy region. The deduced sequence of the soybean chloroplast tRNAHisGUG is identical with that of Zea mays chloroplasts. Both ends of the large single copy region were sequenced including a small segment of the adjacent IR1 and IR2.

  18. Statistical properties and fractals of nucleotide clusters in DNA sequences

    International Nuclear Information System (INIS)

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

    2004-01-01

    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  19. Multineuronal Spike Sequences Repeat with Millisecond Precision

    Directory of Open Access Journals (Sweden)

    Koki eMatsumoto

    2013-06-01

    Full Text Available Cortical microcircuits are nonrandomly wired by neurons. As a natural consequence, spikes emitted by microcircuits are also nonrandomly patterned in time and space. One of the prominent spike organizations is a repetition of fixed patterns of spike series across multiple neurons. However, several questions remain unsolved, including how precisely spike sequences repeat, how the sequences are spatially organized, how many neurons participate in sequences, and how different sequences are functionally linked. To address these questions, we monitored spontaneous spikes of hippocampal CA3 neurons ex vivo using a high-speed functional multineuron calcium imaging technique that allowed us to monitor spikes with millisecond resolution and to record the location of spiking and nonspiking neurons. Multineuronal spike sequences were overrepresented in spontaneous activity compared to the statistical chance level. Approximately 75% of neurons participated in at least one sequence during our observation period. The participants were sparsely dispersed and did not show specific spatial organization. The number of sequences relative to the chance level decreased when larger time frames were used to detect sequences. Thus, sequences were precise at the millisecond level. Sequences often shared common spikes with other sequences; parts of sequences were subsequently relayed by following sequences, generating complex chains of multiple sequences.

  20. Expressed sequence tags (ESTs) and single nucleotide ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... the discovery of the DNA, a new area of modern plant biotechnology begun. In plant ... Marker Assisted Breeding and Sequence Tagged Sites. (STS) are all in use in modern ...... and behaviour in the honey bee. Genome Res.

  1. DNA Nucleotide Sequence Restricted by the RI Endonuclease

    Science.gov (United States)

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

    1972-01-01

    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  2. Applications of High Throughput Nucleotide Sequencing

    DEFF Research Database (Denmark)

    Waage, Johannes Eichler

    equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...

  3. Retrieval and Representation of Nucleotide Sequence of ...

    African Journals Online (AJOL)

    Nigerian Journal of Basic and Applied Science (March, 2013), 21(1): 27-32 ... Full Length R esearch A rticle ... The present study highlights data retrieval and representation. .... the end of information and the start of the sequence on the next ...

  4. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  5. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Lo, A.; Yang, H.L.

    1990-01-01

    This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

  6. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  7. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    Science.gov (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  8. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  9. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  10. Recombination-dependent replication and gene conversion homogenize repeat sequences and diversify plastid genome structure.

    Science.gov (United States)

    Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K

    2017-04-01

    There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.

  11. Repeat Sequence Proteins as Matrices for Nanocomposites

    Energy Technology Data Exchange (ETDEWEB)

    Drummy, L.; Koerner, H; Phillips, D; McAuliffe, J; Kumar, M; Farmer, B; Vaia, R; Naik, R

    2009-01-01

    Recombinant protein-inorganic nanocomposites comprised of exfoliated Na+ montmorillonite (MMT) in a recombinant protein matrix based on silk-like and elastin-like amino acid motifs (silk elastin-like protein (SELP)) were formed via a solution blending process. Charged residues along the protein backbone are shown to dominate long-range interactions, whereas the SELP repeat sequence leads to local protein/MMT compatibility. Up to a 50% increase in room temperature modulus and a comparable decrease in high temperature coefficient of thermal expansion occur for cast films containing 2-10 wt.% MMT.

  12. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  13. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  14. Complete nucleotide sequences of avian metapneumovirus subtype B genome.

    Science.gov (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

    2010-12-01

    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  15. Always look on both sides: phylogenetic information conveyed by simple sequence repeat allele sequences.

    Directory of Open Access Journals (Sweden)

    Stéphanie Barthe

    Full Text Available Simple sequence repeat (SSR markers are widely used tools for inferences about genetic diversity, phylogeography and spatial genetic structure. Their applications assume that variation among alleles is essentially caused by an expansion or contraction of the number of repeats and that, accessorily, mutations in the target sequences follow the stepwise mutation model (SMM. Generally speaking, PCR amplicon sizes are used as direct indicators of the number of SSR repeats composing an allele with the data analysis either ignoring the extent of allele size differences or assuming that there is a direct correlation between differences in amplicon size and evolutionary distance. However, without precisely knowing the kind and distribution of polymorphism within an allele (SSR and the associated flanking region (FR sequences, it is hard to say what kind of evolutionary message is conveyed by such a synthetic descriptor of polymorphism as DNA amplicon size. In this study, we sequenced several SSR alleles in multiple populations of three divergent tree genera and disentangled the types of polymorphisms contained in each portion of the DNA amplicon containing an SSR. The patterns of diversity provided by amplicon size variation, SSR variation itself, insertions/deletions (indels, and single nucleotide polymorphisms (SNPs observed in the FRs were compared. Amplicon size variation largely reflected SSR repeat number. The amount of variation was as large in FRs as in the SSR itself. The former contributed significantly to the phylogenetic information and sometimes was the main source of differentiation among individuals and populations contained by FR and SSR regions of SSR markers. The presence of mutations occurring at different rates within a marker's sequence offers the opportunity to analyse evolutionary events occurring on various timescales, but at the same time calls for caution in the interpretation of SSR marker data when the distribution of within

  16. Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Madura, K.; Prakash, S.

    1986-01-01

    The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes

  17. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    Science.gov (United States)

    Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S

    2015-01-01

    In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

  18. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  19. Cytogenetic Diversity of Simple Sequences Repeats in Morphotypes of Brassica rapa ssp. chinensis.

    Science.gov (United States)

    Zheng, Jin-Shuang; Sun, Cheng-Zhen; Zhang, Shu-Ning; Hou, Xi-Lin; Bonnema, Guusje

    2016-01-01

    A significant fraction of the nuclear DNA of all eukaryotes is comprised of simple sequence repeats (SSRs). Although these sequences are widely used for studying genetic variation, linkage mapping and evolution, little attention had been paid to the chromosomal distribution and cytogenetic diversity of these sequences. In this paper, we report the distribution characterization of mono-, di-, and tri-nucleotide SSRs in Brassica rapa ssp. chinensis. Fluorescence in situ hybridization was used to characterize the cytogenetic diversity of SSRs among morphotypes of B. rapa ssp. chinensis. The proportion of different SSR motifs varied among morphotypes of B. rapa ssp. chinensis, with tri-nucleotide SSRs being more prevalent in the genome of B. rapa ssp. chinensis. We determined the chromosomal locations of mono-, di-, and tri-nucleotide repeat loci. The results showed that the chromosomal distribution of SSRs in the different morphotypes is non-random and motif-dependent, and allowed us to characterize the relative variability in terms of SSR numbers and similar chromosomal distributions in centromeric/peri-centromeric heterochromatin. The differences between SSR repeats with respect to abundance and distribution indicate that SSRs are a driving force in the genomic evolution of B. rapa species. Our results provide a comprehensive view of the SSR sequence distribution and evolution for comparison among morphotypes B. rapa ssp. chinensis.

  20. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  1. A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

    NARCIS (Netherlands)

    Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

    1996-01-01

    A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

  2. Tidying up international nucleotide sequence databases: ecological, geographical and sequence quality annotation of its sequences of mycorrhizal fungi.

    Science.gov (United States)

    Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

    2011-01-01

    Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.

  3. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange*

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

    2016-01-01

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

  4. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange.

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

    2016-01-15

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. simple sequence repeat (SSR) markers in genetic analysis of

    African Journals Online (AJOL)

    Yomi

    2012-08-28

    1998). Cross- species amplification of soybean (Glycine max) simple sequence repeats (SSRs) within the genus and other legume genera: implications for the transferability of SSRs in plants. Mol. Biol. Evol. 15:1275-1287.

  6. Simple sequence repeat marker development and genetic mapping ...

    Indian Academy of Sciences (India)

    polymorphic SSR (simple sequence repeats) markers from libraries enriched for GA, CAA and AAT repeats, as well as 6 ... ers for quinoa was the development of a genetic linkage map ...... Weber J. L. 1990 Informativeness of human (dC-dA)n.

  7. Development of simple sequence repeat (SSR) markers that are ...

    African Journals Online (AJOL)

    Simple sequence repeats (SSRs) markers were developed through data mining of 3,803 expressed sequence tags (ESTs) previously published. A total of 144 di- to penta-type SSRs were identified and they were screened for polymorphism between two turnip cultivars, 'Tsuda' and 'Yurugi Akamaru'. Out of 90 EST-SSRs for ...

  8. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    Directory of Open Access Journals (Sweden)

    Charlotte Rehm

    Full Text Available In prokaryotes simple sequence repeats (SSRs with unit sizes of 1-5 nucleotides (nt are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4 structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc, Xanthomonas axonopodis pv. citri str. 306 (Xac, and Nostoc sp. strain PCC7120 (Ana. In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

  9. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H

    1996-01-01

    The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

  10. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  11. PSSRdb: a relational database of polymorphic simple sequence repeats extracted from prokaryotic genomes.

    Science.gov (United States)

    Kumar, Pankaj; Chaitanya, Pasumarthy S; Nagarajaram, Hampapathalu A

    2011-01-01

    PSSRdb (Polymorphic Simple Sequence Repeats database) (http://www.cdfd.org.in/PSSRdb/) is a relational database of polymorphic simple sequence repeats (PSSRs) extracted from 85 different species of prokaryotes. Simple sequence repeats (SSRs) are the tandem repeats of nucleotide motifs of the sizes 1-6 bp and are highly polymorphic. SSR mutations in and around coding regions affect transcription and translation of genes. Such changes underpin phase variations and antigenic variations seen in some bacteria. Although SSR-mediated phase variation and antigenic variations have been well-studied in some bacteria there seems a lot of other species of prokaryotes yet to be investigated for SSR mediated adaptive and other evolutionary advantages. As a part of our on-going studies on SSR polymorphism in prokaryotes we compared the genome sequences of various strains and isolates available for 85 different species of prokaryotes and extracted a number of SSRs showing length variations and created a relational database called PSSRdb. This database gives useful information such as location of PSSRs in genomes, length variation across genomes, the regions harboring PSSRs, etc. The information provided in this database is very useful for further research and analysis of SSRs in prokaryotes.

  12. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    Science.gov (United States)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  13. Identification, variation and transcription of pneumococcal repeat sequences

    Science.gov (United States)

    2011-01-01

    Background Small interspersed repeats are commonly found in many bacterial chromosomes. Two families of repeats (BOX and RUP) have previously been identified in the genome of Streptococcus pneumoniae, a nasopharyngeal commensal and respiratory pathogen of humans. However, little is known about the role they play in pneumococcal genetics. Results Analysis of the genome of S. pneumoniae ATCC 700669 revealed the presence of a third repeat family, which we have named SPRITE. All three repeats are present at a reduced density in the genome of the closely related species S. mitis. However, they are almost entirely absent from all other streptococci, although a set of elements related to the pneumococcal BOX repeat was identified in the zoonotic pathogen S. suis. In conjunction with information regarding their distribution within the pneumococcal chromosome, this suggests that it is unlikely that these repeats are specialised sequences performing a particular role for the host, but rather that they constitute parasitic elements. However, comparing insertion sites between pneumococcal sequences indicates that they appear to transpose at a much lower rate than IS elements. Some large BOX elements in S. pneumoniae were found to encode open reading frames on both strands of the genome, whilst another was found to form a composite RNA structure with two T box riboswitches. In multiple cases, such BOX elements were demonstrated as being expressed using directional RNA-seq and RT-PCR. Conclusions BOX, RUP and SPRITE repeats appear to have proliferated extensively throughout the pneumococcal chromosome during the species' past, but novel insertions are currently occurring at a relatively slow rate. Through their extensive secondary structures, they seem likely to affect the expression of genes with which they are co-transcribed. Software for annotation of these repeats is freely available from ftp://ftp.sanger.ac.uk/pub/pathogens/strep_repeats/. PMID:21333003

  14. Simple sequence repeat marker development from bacterial artificial chromosome end sequences and expressed sequence tags of flax (Linum usitatissimum L.).

    Science.gov (United States)

    Cloutier, Sylvie; Miranda, Evelyn; Ward, Kerry; Radovanovic, Natasa; Reimer, Elsa; Walichnowski, Andrzej; Datla, Raju; Rowland, Gordon; Duguid, Scott; Ragupathy, Raja

    2012-08-01

    Flax is an important oilseed crop in North America and is mostly grown as a fibre crop in Europe. As a self-pollinated diploid with a small estimated genome size of ~370 Mb, flax is well suited for fast progress in genomics. In the last few years, important genetic resources have been developed for this crop. Here, we describe the assessment and comparative analyses of 1,506 putative simple sequence repeats (SSRs) of which, 1,164 were derived from BAC-end sequences (BESs) and 342 from expressed sequence tags (ESTs). The SSRs were assessed on a panel of 16 flax accessions with 673 (58 %) and 145 (42 %) primer pairs being polymorphic in the BESs and ESTs, respectively. With 818 novel polymorphic SSR primer pairs reported in this study, the repertoire of available SSRs in flax has more than doubled from the combined total of 508 of all previous reports. Among nucleotide motifs, trinucleotides were the most abundant irrespective of the class, but dinucleotides were the most polymorphic. SSR length was also positively correlated with polymorphism. Two dinucleotide (AT/TA and AG/GA) and two trinucleotide (AAT/ATA/TAA and GAA/AGA/AAG) motifs and their iterations, different from those reported in many other crops, accounted for more than half of all the SSRs and were also more polymorphic (63.4 %) than the rest of the markers (42.7 %). This improved resource promises to be useful in genetic, quantitative trait loci (QTL) and association mapping as well as for anchoring the physical/genetic map with the whole genome shotgun reference sequence of flax.

  15. Comparative effectiveness of inter-simple sequence repeat and ...

    African Journals Online (AJOL)

    A study to compare the effectiveness of inter-simple sequence repeats (ISSR) and randomly amplified polymorphic DNA (RAPD) profiling was carried out with a total of 65 DNA samples using 12 species of Indian Garcinia. ISSR and RAPD profiling were performed with 19 and 12 primers, respectively. ISSR markers ...

  16. Simple sequence repeat (SSR)-based genetic variability among ...

    African Journals Online (AJOL)

    The objective of this study was to compare if simple sequence repeat (SSR) markers could correctly identify peanut genotypes with difference in specific leaf weight (SLW) and relative water content (RWC). Four peanut genotypes and two water regimes (FC and 1/3 available water; 1/3 AW) were arranged in factorial ...

  17. FASH: A web application for nucleotides sequence search

    Directory of Open Access Journals (Sweden)

    Chew Paul

    2008-05-01

    Full Text Available Abstract FASH (Fourier Alignment Sequence Heuristics is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome, FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. Availability FASH can be accessed at https://fash.bgu.ac.il:8443/fash/default.jsp (secured website

  18. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  19. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Science.gov (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  20. Nature and distribution of feline sarcoma virus nucleotide sequences.

    Science.gov (United States)

    Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A

    1979-01-01

    The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544

  1. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  2. Applications of High-Throughput Nucleotide Sequencing (PhD)

    DEFF Research Database (Denmark)

    Waage, Johannes

    equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...

  3. Nucleotide sequence of a human tRNA gene heterocluster

    International Nuclear Information System (INIS)

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-01-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

  4. Simple sequence repeat (SSR) markers are effective for identifying ...

    African Journals Online (AJOL)

    DNA was extracted from newly formed leaves and amplified using 21 simple sequence repeat (SSR) markers (NH001c, NH002b, NH005b, NH007b, NH008b, NH009b, NH011b, NH013b, NH012a, NH014a, NH015a, NH017a, KA4b, KA5, KA14, KA16, KB16, KU10, BGA35, BGT23b and HGA8b). The data was analyzed by ...

  5. Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

    Directory of Open Access Journals (Sweden)

    Kouki Yonezawa

    Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

  6. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    Science.gov (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

    International Nuclear Information System (INIS)

    Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

    1994-01-01

    The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

  8. Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

    Science.gov (United States)

    Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

    2014-06-01

    The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

  9. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  10. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

    Directory of Open Access Journals (Sweden)

    Shui-Lian He

    Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  11. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

    Science.gov (United States)

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

    2015-01-01

    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  12. Expressed Sequence Tag-Simple Sequence Repeat (EST-SSR Marker Resources for Diversity Analysis of Mango (Mangifera indica L.

    Directory of Open Access Journals (Sweden)

    Natalie L. Dillon

    2014-01-01

    Full Text Available In this study, a collection of 24,840 expressed sequence tags (ESTs generated from five mango (Mangifera indica L. cDNA libraries was mined for EST-based simple sequence repeat (SSR markers. Over 1,000 ESTs with SSR motifs were detected from more than 24,000 EST sequences with di- and tri-nucleotide repeat motifs the most abundant. Of these, 25 EST-SSRs in genes involved in plant development, stress response, and fruit color and flavor development pathways were selected, developed into PCR markers and characterized in a population of 32 mango selections including M. indica varieties, and related Mangifera species. Twenty-four of the 25 EST-SSR markers exhibited polymorphisms, identifying a total of 86 alleles with an average of 5.38 alleles per locus, and distinguished between all Mangifera selections. Private alleles were identified for Mangifera species. These newly developed EST-SSR markers enhance the current 11 SSR mango genetic identity panel utilized by the Australian Mango Breeding Program. The current panel has been used to identify progeny and parents for selection and the application of this extended panel will further improve and help to design mango hybridization strategies for increased breeding efficiency.

  13. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Science.gov (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

    1985-11-01

    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  14. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  15. Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

    NARCIS (Netherlands)

    Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

    The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

  16. Exploiting BAC-end sequences for the mining, characterization and utility of new short sequences repeat (SSR) markers in Citrus.

    Science.gov (United States)

    Biswas, Manosh Kumar; Chai, Lijun; Mayer, Christoph; Xu, Qiang; Guo, Wenwu; Deng, Xiuxin

    2012-05-01

    The aim of this study was to develop a large set of microsatellite markers based on publicly available BAC-end sequences (BESs), and to evaluate their transferability, discriminating capacity of genotypes and mapping ability in Citrus. A set of 1,281 simple sequence repeat (SSR) markers were developed from the 46,339 Citrus clementina BAC-end sequences (BES), of them 20.67% contained SSR longer than 20 bp, corresponding to roughly one perfect SSR per 2.04 kb. The most abundant motifs were di-nucleotide (16.82%) repeats. Among all repeat motifs (TA/AT)n is the most abundant (8.38%), followed by (AG/CT)n (4.51%). Most of the BES-SSR are located in the non-coding region, but 1.3% of BES-SSRs were found to be associated with transposable element (TE). A total of 400 novel SSR primer pairs were synthesized and their transferability and polymorphism tested on a set of 16 Citrus and Citrus relative's species. Among these 333 (83.25%) were successfully amplified and 260 (65.00%) showed cross-species transferability with Poncirus trifoliata and Fortunella sp. These cross-species transferable markers could be useful for cultivar identification, for genomic study of Citrus, Poncirus and Fortunella sp. Utility of the developed SSR marker was demonstrated by identifying a set of 118 markers each for construction of linkage map of Citrus reticulata and Poncirus trifoliata. Genetic diversity and phylogenetic relationship among 40 Citrus and its related species were conducted with the aid of 25 randomly selected SSR primer pairs and results revealed that citrus genomic SSRs are superior to genic SSR for genetic diversity and germplasm characterization of Citrus spp.

  17. Development of simple sequence repeat markers and diversity analysis in alfalfa (Medicago sativa L.).

    Science.gov (United States)

    Wang, Zan; Yan, Hongwei; Fu, Xinnian; Li, Xuehui; Gao, Hongwen

    2013-04-01

    Efficient and robust molecular markers are essential for molecular breeding in plant. Compared to dominant and bi-allelic markers, multiple alleles of simple sequence repeat (SSR) markers are particularly informative and superior in genetic linkage map and QTL mapping in autotetraploid species like alfalfa. The objective of this study was to enrich SSR markers directly from alfalfa expressed sequence tags (ESTs). A total of 12,371 alfalfa ESTs were retrieved from the National Center for Biotechnology Information. Total 774 SSR-containing ESTs were identified from 716 ESTs. On average, one SSR was found per 7.7 kb of EST sequences. Tri-nucleotide repeats (48.8 %) was the most abundant motif type, followed by di-(26.1 %), tetra-(11.5 %), penta-(9.7 %), and hexanucleotide (3.9 %). One hundred EST-SSR primer pairs were successfully designed and 29 exhibited polymorphism among 28 alfalfa accessions. The allele number per marker ranged from two to 21 with an average of 6.8. The PIC values ranged from 0.195 to 0.896 with an average of 0.608, indicating a high level of polymorphism of the EST-SSR markers. Based on the 29 EST-SSR markers, assessment of genetic diversity was conducted and found that Medicago sativa ssp. sativa was clearly different from the other subspecies. The high transferability of those EST-SSR markers was also found for relative species.

  18. MSDB: A Comprehensive Database of Simple Sequence Repeats.

    Science.gov (United States)

    Avvaru, Akshay Kumar; Saxena, Saketh; Sowpati, Divya Tej; Mishra, Rakesh Kumar

    2017-06-01

    Microsatellites, also known as Simple Sequence Repeats (SSRs), are short tandem repeats of 1-6 nt motifs present in all genomes, particularly eukaryotes. Besides their usefulness as genome markers, SSRs have been shown to perform important regulatory functions, and variations in their length at coding regions are linked to several disorders in humans. Microsatellites show a taxon-specific enrichment in eukaryotic genomes, and some may be functional. MSDB (Microsatellite Database) is a collection of >650 million SSRs from 6,893 species including Bacteria, Archaea, Fungi, Plants, and Animals. This database is by far the most exhaustive resource to access and analyze SSR data of multiple species. In addition to exploring data in a customizable tabular format, users can view and compare the data of multiple species simultaneously using our interactive plotting system. MSDB is developed using the Django framework and MySQL. It is freely available at http://tdb.ccmb.res.in/msdb. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. Simple sequence repeats in Neurospora crassa: distribution, polymorphism and evolutionary inference

    Directory of Open Access Journals (Sweden)

    Park Jongsun

    2008-01-01

    Full Text Available Abstract Background Simple sequence repeats (SSRs have been successfully used for various genetic and evolutionary studies in eukaryotic systems. The eukaryotic model organism Neurospora crassa is an excellent system to study evolution and biological function of SSRs. Results We identified and characterized 2749 SSRs of 963 SSR types in the genome of N. crassa. The distribution of tri-nucleotide (nt SSRs, the most common SSRs in N. crassa, was significantly biased in exons. We further characterized the distribution of 19 abundant SSR types (AST, which account for 71% of total SSRs in the N. crassa genome, using a Poisson log-linear model. We also characterized the size variation of SSRs among natural accessions using Polymorphic Index Content (PIC and ANOVA analyses and found that there are genome-wide, chromosome-dependent and local-specific variations. Using polymorphic SSRs, we have built linkage maps from three line-cross populations. Conclusion Taking our computational, statistical and experimental data together, we conclude that 1 the distributions of the SSRs in the sequenced N. crassa genome differ systematically between chromosomes as well as between SSR types, 2 the size variation of tri-nt SSRs in exons might be an important mechanism in generating functional variation of proteins in N. crassa, 3 there are different levels of evolutionary forces in variation of amino acid repeats, and 4 SSRs are stable molecular markers for genetic studies in N. crassa.

  20. Structural organization of glycophorin A and B genes: Glycophorin B gene evolved by homologous recombination at Alu repeat sequences

    International Nuclear Information System (INIS)

    Kudo, Shinichi; Fukuda, Minoru

    1989-01-01

    Glycophorins A (GPA) and B (GPB) are two major sialoglycoproteins of the human erythrocyte membrane. Here the authors present a comparison of the genomic structures of GPA and GPB developed by analyzing DNA clones isolated from a K562 genomic library. Nucleotide sequences of exon-intron junctions and 5' and 3' flanking sequences revealed that the GPA and GPB genes consist of 7 and 5 exons, respectively, and both genes have >95% identical sequence from the 5' flanking region to the region ∼ 1 kilobase downstream from the exon encoding the transmembrane regions. In this homologous part of the genes, GPB lacks one exon due to a point mutation at the 5' splicing site of the third intron, which inactivates the 5' cleavage event of splicing and leads to ligation of the second to the fourth exon. Following these very homologous sequences, the genomic sequences for GPA and GPB diverge significantly and no homology can be detected in their 3' end sequences. The analysis of the Alu sequences and their flanking direct repeat sequences suggest that an ancestral genomic structure has been maintained in the GPA gene, whereas the GPB gene has arisen from the acquisition of 3' sequences different from those of the GPA gene by homologous recombination at the Alu repeats during or after gene duplication

  1. Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G

    1988-03-25

    Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.

  2. An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

    Directory of Open Access Journals (Sweden)

    Tautz Diethard

    2002-03-01

    Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

  3. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.

    1979-01-01

    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  4. Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

    Science.gov (United States)

    Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

    2017-12-01

    The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  5. cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

    Energy Technology Data Exchange (ETDEWEB)

    Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K

    1983-01-01

    Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

  6. Nucleotide sequence of a cDNA for branched chain acyltransferase with analysis of the deduced protein structure

    International Nuclear Information System (INIS)

    Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.

    1988-01-01

    Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases

  7. The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

    Science.gov (United States)

    Hammond, R W; Crosslin, J M

    1995-04-01

    The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

  8. Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

    Science.gov (United States)

    The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

  9. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    Science.gov (United States)

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

  10. The nucleotide sequence of human transition protein 1 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

  11. Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

    Energy Technology Data Exchange (ETDEWEB)

    Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

    1987-02-01

    To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

  12. C9orf72 nucleotide repeat structures initiate molecular cascades of disease.

    Science.gov (United States)

    Haeusler, Aaron R; Donnelly, Christopher J; Periz, Goran; Simko, Eric A J; Shaw, Patrick G; Kim, Min-Sik; Maragakis, Nicholas J; Troncoso, Juan C; Pandey, Akhilesh; Sattler, Rita; Rothstein, Jeffrey D; Wang, Jiou

    2014-03-13

    A hexanucleotide repeat expansion (HRE), (GGGGCC)n, in C9orf72 is the most common genetic cause of the neurodegenerative diseases amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Here we identify a molecular mechanism by which structural polymorphism of the HRE leads to ALS/FTD pathology and defects. The HRE forms DNA and RNA G-quadruplexes with distinct structures and promotes RNA•DNA hybrids (R-loops). The structural polymorphism causes a repeat-length-dependent accumulation of transcripts aborted in the HRE region. These transcribed repeats bind to ribonucleoproteins in a conformation-dependent manner. Specifically, nucleolin, an essential nucleolar protein, preferentially binds the HRE G-quadruplex, and patient cells show evidence of nucleolar stress. Our results demonstrate that distinct C9orf72 HRE structural polymorphism at both DNA and RNA levels initiates molecular cascades leading to ALS/FTD pathologies, and provide the basis for a mechanistic model for repeat-associated neurodegenerative diseases.

  13. Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation

    International Nuclear Information System (INIS)

    Maat, J.

    1978-01-01

    A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)

  14. A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Boulund Fredrik

    2012-12-01

    Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

  15. Conservation of nucleotide sequences for molecular diagnosis of Middle East respiratory syndrome coronavirus, 2015

    Directory of Open Access Journals (Sweden)

    Yuki Furuse

    2015-11-01

    Full Text Available Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.

  16. Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India

    Directory of Open Access Journals (Sweden)

    Sukdeb Nandi

    2010-03-01

    Full Text Available Canine parvovirus 2 (CPV‑2 is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV‑2a, CPV‑2b and CPV‑2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV‑2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India

  17. Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India.

    Science.gov (United States)

    Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj

    2010-01-01

    Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.

  18. Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.

    Science.gov (United States)

    Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y

    1998-07-01

    An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.

  19. 37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

    Science.gov (United States)

    2010-07-01

    ... may not include material other than part of the sequence listing. A fixed-width font should be used... integer expressing the number of bases or amino acid residues M. Type Whether presented sequence molecule is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type...

  20. Assembly of Repeat Content Using Next Generation Sequencing Data

    Energy Technology Data Exchange (ETDEWEB)

    labutti, Kurt; Kuo, Alan; Grigoriev, Igor; Copeland, Alex

    2014-03-17

    Repetitive organisms pose a challenge for short read assembly, and typically only unique regions and repeat regions shorter than the read length, can be accurately assembled. Recently, we have been investigating the use of Pacific Biosciences reads for de novo fungal assembly. We will present an assessment of the quality and degree of repeat reconstruction possible in a fungal genome using long read technology. We will also compare differences in assembly of repeat content using short read and long read technology.

  1. Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L

    Science.gov (United States)

    Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.

    2013-01-01

    Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

  2. Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

    Science.gov (United States)

    Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

    2018-01-10

    Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

  3. Extensive structural variations between mitochondrial genomes of CMS and normal peppers (Capsicum annuum L.) revealed by complete nucleotide sequencing.

    Science.gov (United States)

    Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl

    2014-07-04

    Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was

  4. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-04-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.

  5. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    OpenAIRE

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...

  6. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578

  7. Association Mapping and Nucleotide Sequence Variation in Five Drought Tolerance Candidate Genes in Spring Wheat

    Directory of Open Access Journals (Sweden)

    Erena A. Edae

    2013-07-01

    Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.

  8. ARHGEF7 (Beta-PIX acts as guanine nucleotide exchange factor for leucine-rich repeat kinase 2.

    Directory of Open Access Journals (Sweden)

    Karina Haebig

    Full Text Available BACKGROUND: Mutations within the leucine-rich repeat kinase 2 (LRRK2 gene are a common cause of familial and sporadic Parkinson's disease. The multidomain protein LRRK2 exhibits overall low GTPase and kinase activity in vitro. METHODOLOGY/PRINCIPAL FINDINGS: Here, we show that the rho guanine nucleotide exchange factor ARHGEF7 and the small GTPase CDC42 are interacting with LRRK2 in vitro and in vivo. GTPase activity of full-length LRRK2 increases in the presence of recombinant ARHGEF7. Interestingly, LRRK2 phosphorylates ARHGEF7 in vitro at previously unknown phosphorylation sites. We provide evidence that ARHGEF7 might act as a guanine nucleotide exchange factor for LRRK2 and that R1441C mutant LRRK2 with reduced GTP hydrolysis activity also shows reduced binding to ARHGEF7. CONCLUSIONS/SIGNIFICANCE: Downstream effects of phosphorylation of ARHGEF7 through LRRK2 could be (i a feedback control mechanism for LRRK2 activity as well as (ii an impact of LRRK2 on actin cytoskeleton regulation. A newly identified familial mutation N1437S, localized within the GTPase domain of LRRK2, further underlines the importance of the GTPase domain of LRRK2 in Parkinson's disease pathogenesis.

  9. DNA dynamics is likely to be a factor in the genomic nucleotide repeats expansions related to diseases.

    Directory of Open Access Journals (Sweden)

    Boian S Alexandrov

    Full Text Available Trinucleotide repeats sequences (TRS represent a common type of genomic DNA motif whose expansion is associated with a large number of human diseases. The driving molecular mechanisms of the TRS ongoing dynamic expansion across generations and within tissues and its influence on genomic DNA functions are not well understood. Here we report results for a novel and notable collective breathing behavior of genomic DNA of tandem TRS, leading to propensity for large local DNA transient openings at physiological temperature. Our Langevin molecular dynamics (LMD and Markov Chain Monte Carlo (MCMC simulations demonstrate that the patterns of openings of various TRSs depend specifically on their length. The collective propensity for DNA strand separation of repeated sequences serves as a precursor for outsized intermediate bubble states independently of the G/C-content. We report that repeats have the potential to interfere with the binding of transcription factors to their consensus sequence by altered DNA breathing dynamics in proximity of the binding sites. These observations might influence ongoing attempts to use LMD and MCMC simulations for TRS-related modeling of genomic DNA functionality in elucidating the common denominators of the dynamic TRS expansion mutation with potential therapeutic applications.

  10. Nonlinear analysis of sequence repeats of multi-domain proteins

    Energy Technology Data Exchange (ETDEWEB)

    Huang Yanzhao [Biomolecular Physics and Modeling Group, Department of Physics, Huazhong University of Science and Technology, Wuhan 430074, Hubei (China); Li Mingfeng [Biomolecular Physics and Modeling Group, Department of Physics, Huazhong University of Science and Technology, Wuhan 430074, Hubei (China); Xiao Yi [Biomolecular Physics and Modeling Group, Department of Physics, Huazhong University of Science and Technology, Wuhan 430074, Hubei (China)]. E-mail: lmf_bill@sina.com

    2007-11-15

    Many multi-domain proteins have repetitive three-dimensional structures but nearly-random amino acid sequences. In the present paper, by using a modified recurrence plot proposed by us previously, we show that these amino acid sequences have hidden repetitions in fact. These results indicate that the repetitive domain structures are encoded by the repetitive sequences. This also gives a method to detect the repetitive domain structures directly from amino acid sequences.

  11. Nucleotide sequence alignment of hdcA from Gram-positive bacteria.

    Science.gov (United States)

    Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A

    2016-03-01

    The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].

  12. Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella

    Science.gov (United States)

    Li, Hongshan; Dai, Huaguo; Wei, Hui

    2005-01-01

    A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627

  13. Isolation of nucleotide binding site-leucine rich repeat and kinase resistance gene analogues from sugarcane (Saccharum spp.).

    Science.gov (United States)

    Glynn, Neil C; Comstock, Jack C; Sood, Sushma G; Dang, Phat M; Chaparro, Jose X

    2008-01-01

    Resistance gene analogues (RGAs) have been isolated from many crops and offer potential in breeding for disease resistance through marker-assisted selection, either as closely linked or as perfect markers. Many R-gene sequences contain kinase domains, and indeed kinase genes have been reported as being proximal to R-genes, making kinase analogues an additionally promising target. The first step towards utilizing RGAs as markers for disease resistance is isolation and characterization of the sequences. Sugarcane clone US01-1158 was identified as resistant to yellow leaf caused by the sugarcane yellow leaf virus (SCYLV) and moderately resistant to rust caused by Puccinia melanocephala Sydow & Sydow. Degenerate primers that had previously proved useful for isolating RGAs and kinase analogues in wheat and soybean were used to amplify DNA from sugarcane (Saccharum spp.) clone US-01-1158. Sequences generated from 1512 positive clones were assembled into 134 contigs of between two and 105 sequences. Comparison of the contig consensuses with the NCBI sequence database using BLASTx showed that 20 had sequence homology to nuclear binding site and leucine rich repeat (NBS-LRR) RGAs, and eight to kinase genes. Alignment of the deduced amino acid sequences with similar sequences from the NCBI database allowed the identification of several conserved domains. The alignment and resulting phenetic tree showed that many of the sequences had greater similarity to sequences from other species than to one another. The use of degenerate primers is a useful method for isolating novel sugarcane RGA and kinase gene analogues. Further studies are needed to evaluate the role of these genes in disease resistance.

  14. Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

    2006-01-01

    Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

  15. Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

    Science.gov (United States)

    Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

    2005-05-01

    The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

  16. Mapping DNA methylation by transverse current sequencing: Reduction of noise from neighboring nucleotides

    Science.gov (United States)

    Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian

    Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.

  17. Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

    International Nuclear Information System (INIS)

    Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

    1987-01-01

    Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

  18. ChloroSSRdb: a repository of perfect and imperfect chloroplastic simple sequence repeats (cpSSRs) of green plants.

    Science.gov (United States)

    Kapil, Aditi; Rai, Piyush Kant; Shanker, Asheesh

    2014-01-01

    Simple sequence repeats (SSRs) are regions in DNA sequence that contain repeating motifs of length 1-6 nucleotides. These repeats are ubiquitously present and are found in both coding and non-coding regions of genome. A total of 534 complete chloroplast genome sequences (as on 18 September 2014) of Viridiplantae are available at NCBI organelle genome resource. It provides opportunity to mine these genomes for the detection of SSRs and store them in the form of a database. In an attempt to properly manage and retrieve chloroplastic SSRs, we designed ChloroSSRdb which is a relational database developed using SQL server 2008 and accessed through ASP.NET. It provides information of all the three types (perfect, imperfect and compound) of SSRs. At present, ChloroSSRdb contains 124 430 mined SSRs, with majority lying in non-coding region. Out of these, PCR primers were designed for 118 249 SSRs. Tetranucleotide repeats (47 079) were found to be the most frequent repeat type, whereas hexanucleotide repeats (6414) being the least abundant. Additionally, in each species statistical analyses were performed to calculate relative frequency, correlation coefficient and chi-square statistics of perfect and imperfect SSRs. In accordance with the growing interest in SSR studies, ChloroSSRdb will prove to be a useful resource in developing genetic markers, phylogenetic analysis, genetic mapping, etc. Moreover, it will serve as a ready reference for mined SSRs in available chloroplast genomes of green plants. Database URL: www.compubio.in/chlorossrdb/ © The Author(s) 2014. Published by Oxford University Press.

  19. Development and Characterization of Simple Sequence Repeat (SSR) Markers Based on RNA-Sequencing of Medicago sativa and In silico Mapping onto the M. truncatula Genome

    Science.gov (United States)

    Wang, Zan; Yu, Guohui; Shi, Binbin; Wang, Xuemin; Qiang, Haiping; Gao, Hongwen

    2014-01-01

    Sufficient codominant genetic markers are needed for various genetic investigations in alfalfa since the species is an outcrossing autotetraploid. With the newly developed next generation sequencing technology, a large amount of transcribed sequences of alfalfa have been generated and are available for identifying SSR markers by data mining. A total of 54,278 alfalfa non-redundant unigenes were assembled through the Illumina HiSeqTM 2000 sequencing technology. Based on 3,903 unigene sequences, 4,493 SSRs were identified. Tri-nucleotide repeats (56.71%) were the most abundant motif class while AG/CT (21.7%), AGG/CCT (19.8%), AAC/GTT (10.3%), ATC/ATG (8.8%), and ACC/GGT (6.3%) were the subsequent top five nucleotide repeat motifs. Eight hundred and thirty- seven EST-SSR primer pairs were successfully designed. Of these, 527 (63%) primer pairs yielded clear and scored PCR products and 372 (70.6%) exhibited polymorphisms. High transferability was observed for ssp falcata at 99.2% (523) and 71.7% (378) in M. truncatula. In addition, 313 of 527 SSR marker sequences were in silico mapped onto the eight M. truncatula chromosomes. Thirty-six polymorphic SSR primer pairs were used in the genetic relatedness analysis of 30 Chinese alfalfa cultivated accessions generating a total of 199 scored alleles. The mean observed heterozygosity and polymorphic information content were 0.767 and 0.635, respectively. The codominant markers not only enriched the current resources of molecular markers in alfalfa, but also would facilitate targeted investigations in marker-trait association, QTL mapping, and genetic diversity analysis in alfalfa. PMID:24642969

  20. Genome-wide identification and tissue-specific expression analysis of nucleotide binding site-leucine rich repeat gene family in Cicer arietinum (kabuli chickpea).

    Science.gov (United States)

    Sharma, Ranu; Rawat, Vimal; Suresh, C G

    2017-12-01

    The nucleotide binding site-leucine rich repeat (NBS-LRR) proteins play an important role in the defense mechanisms against pathogens. Using bioinformatics approach, we identified and annotated 104 NBS-LRR genes in chickpea. Phylogenetic analysis points to their diversification into two families namely TIR-NBS-LRR and non-TIR-NBS-LRR. Gene architecture revealed intron gain/loss events in this resistance gene family during their independent evolution into two families. Comparative genomics analysis elucidated its evolutionary relationship with other fabaceae species. Around 50% NBS-LRRs reside in macro-syntenic blocks underlining positional conservation along with sequence conservation of NBS-LRR genes in chickpea. Transcriptome sequencing data provided evidence for their transcription and tissue-specific expression. Four cis -regulatory elements namely WBOX, DRE, CBF, and GCC boxes, that commonly occur in resistance genes, were present in the promoter regions of these genes. Further, the findings will provide a strong background to use candidate disease resistance NBS-encoding genes and identify their specific roles in chickpea.

  1. Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum

    Directory of Open Access Journals (Sweden)

    White Frank F

    2011-07-01

    Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.

  2. The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.

    Science.gov (United States)

    Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F

    1992-12-01

    The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.

  3. The nucleotide sequence of a Polish isolate of Tomato torrado virus.

    Science.gov (United States)

    Budziszewska, Marta; Obrepalska-Steplowska, Aleksandra; Wieczorek, Przemysław; Pospieszny, Henryk

    2008-12-01

    A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.

  4. Local repeat sequence organization of an intergenic spacer

    Indian Academy of Sciences (India)

    The amplification yielded the same uniquely ``sequence-scrambled” product, whether the template used for PCR was total cellular DNA, chloroplast DNA or a plasmid clone DNA corresponding to that region. The PCR product, a ``unique” new sequence, had lost the repetitive organization of the template genome where it ...

  5. 37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

    Science.gov (United States)

    2010-07-01

    ... mature protein, with the number 1. When presented, the amino acids preceding the mature protein, e.g... acids. (1) The amino acids in a protein or peptide sequence shall be listed using the three-letter... data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

  6. Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

    Science.gov (United States)

    Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

    2015-02-01

    There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

  7. Study of simple sequence repeat (SSR) polymorphism for biotic ...

    African Journals Online (AJOL)

    home

    2013-10-02

    Oct 2, 2013 ... G. Siva Kumar1, K. Aruna Kumari1*, Ch. V. Durga Rani1, R. M. Sundaram2, S. Vanisree3, Md. ..... review by Jena and Mackill (2008) provided the list of .... repeat protein and is a member of a resistance gene cluster on rice.

  8. Using inter simple sequence repeat (ISSR) markers to study genetic ...

    African Journals Online (AJOL)

    enoh

    2012-04-10

    Apr 10, 2012 ... Genetic relationships among the cultivars was assessed by using six inter simple sequence ... polymorphism breeders of this species in order to find the ..... well as the high level of heterozygosity due to the cross- pollinating ...

  9. Pervasive within-Mitochondrion Single-Nucleotide Variant Heteroplasmy as Revealed by Single-Mitochondrion Sequencing

    Directory of Open Access Journals (Sweden)

    Jacqueline Morris

    2017-12-01

    Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation

  10. Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.

    Science.gov (United States)

    Wolf, P

    1997-10-01

    Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.

  11. Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

    Science.gov (United States)

    Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

    1991-02-15

    The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

  12. A statistical model for investigating binding probabilities of DNA nucleotide sequences using microarrays.

    Science.gov (United States)

    Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M

    2002-12-01

    There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.

  13. Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.

    Science.gov (United States)

    Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid

    2012-07-01

    Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

  14. Analysis of sequence diversity through internal transcribed spacers and simple sequence repeats to identify Dendrobium species.

    Science.gov (United States)

    Liu, Y T; Chen, R K; Lin, S J; Chen, Y C; Chin, S W; Chen, F C; Lee, C Y

    2014-04-08

    The Orchidaceae is one of the largest and most diverse families of flowering plants. The Dendrobium genus has high economic potential as ornamental plants and for medicinal purposes. In addition, the species of this genus are able to produce large crops. However, many Dendrobium varieties are very similar in outward appearance, making it difficult to distinguish one species from another. This study demonstrated that the 12 Dendrobium species used in this study may be divided into 2 groups by internal transcribed spacer (ITS) sequence analysis. Red and yellow flowers may also be used to separate these species into 2 main groups. In particular, the deciduous characteristic is associated with the ITS genetic diversity of the A group. Of 53 designed simple sequence repeat (SSR) primer pairs, 7 pairs were polymorphic for polymerase chain reaction products that were amplified from a specific band. The results of this study demonstrate that these 7 SSR primer pairs may potentially be used to identify Dendrobium species and their progeny in future studies.

  15. Evolutionary relationships in the ilarviruses: nucleotide sequence of prunus necrotic ringspot virus RNA 3.

    Science.gov (United States)

    Sánchez-Navarro, J A; Pallás, V

    1997-01-01

    The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.

  16. Interference by clustered regularly interspaced short palindromic repeat (CRISPR) RNA is governed by a seed sequence

    NARCIS (Netherlands)

    Semenova, E.V.; Jore, M.M.; Westra, E.R.; Oost, van der J.; Brouns, S.J.J.

    2011-01-01

    Prokaryotic clustered regularly interspaced short palindromic repeat (CRISPR)/Cas (CRISPR-associated sequences) systems provide adaptive immunity against viruses when a spacer sequence of small CRISPR RNA (crRNA) matches a protospacer sequence in the viral genome. Viruses that escape CRISPR/Cas

  17. Local repeat sequence organization of an intergenic spacer in the ...

    Indian Academy of Sciences (India)

    Unknown

    chloroplast genome of Chlamydomonas reinhardtii leads to DNA expansion and sequence ... The discovery of uniparentally inherited streptomycin resistant mutants ... resembles yeast, mitochondrial and phage recombination in that it is typically ...... Sager R and Lane D 1972 Molecular basis of maternal inheritance; Proc.

  18. Plasmid P1 replication: negative control by repeated DNA sequences.

    OpenAIRE

    Chattoraj, D; Cordes, K; Abeles, A

    1984-01-01

    The incompatibility locus, incA, of the unit-copy plasmid P1 is contained within a fragment that is essentially a set of nine 19-base-pair repeats. One or more copies of the fragment destabilizes the plasmid when present in trans. Here we show that extra copies of incA interfere with plasmid DNA replication and that a deletion of most of incA increases plasmid copy number. Thus, incA is not essential for replication but is required for its control. When cloned in a high-copy-number vector, pi...

  19. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  20. Comparison of Nucleotide Sequence of P2C Region in Diabetogenic and Non-Diabetogenic Coxsackie Virus B5 Isolates

    Directory of Open Access Journals (Sweden)

    Cheng-Chong Chou

    2004-11-01

    Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.

  1. Complete nucleotide sequence and analysis of two conjugative broad host range plasmids from a marine microbial biofilm.

    Directory of Open Access Journals (Sweden)

    Peter Norberg

    Full Text Available The complete nucleotide sequence of plasmids pMCBF1 and pMCBF6 was determined and analyzed. pMCBF1 and pMCBF6 form a novel clade within the IncP-1 plasmid family designated IncP-1 ς. The plasmids were exogenously isolated earlier from a marine biofilm. pMCBF1 (62 689 base pairs; bp and pMCBF6 (66 729 bp have identical backbones, but differ in their mercury resistance transposons. pMCBF1 carries Tn5053 and pMCBF6 carries Tn5058. Both are flanked by 5 bp direct repeats, typical of replicative transposition. Both insertions are in the vicinity of a resolvase gene in the backbone, supporting the idea that both transposons are "res-site hunters" that preferably insert close to and use external resolvase functions. The similarity of the backbones indicates recent insertion of the two transposons and the ongoing dynamics of plasmid evolution in marine biofilms. Both plasmids also carry the insertion sequence ISPst1, albeit without flanking repeats. ISPs1is located in an unusual site within the control region of the plasmid. In contrast to most known IncP-1 plasmids the pMCBF1/pMCBF6 backbone has no insert between the replication initiation gene (trfA and the vegetative replication origin (oriV. One pMCBF1/pMCBF6 block of about 2.5 kilo bases (kb has no similarity with known sequences in the databases. Furthermore, insertion of three genes with similarity to the multidrug efflux pump operon mexEF and a gene from the NodT family of the tripartite multi-drug resistance-nodulation-division (RND system in Pseudomonas aeruginosa was found. They do not seem to confer antibiotic resistance to the hosts of pMCBF1/pMCBF6, but the presence of RND on promiscuous plasmids may have serious implications for the spread of antibiotic multi-resistance.

  2. The complete nucleotide sequence of Alternanthera mosaic virus infecting Portulaca grandiflora represents a new strain distinct from phlox isolates.

    Science.gov (United States)

    Ivanov, Peter A; Mukhamedzhanova, Anna A; Smirnov, Alexander A; Rodionova, Nina P; Karpova, Olga V; Atabekov, Joseph G

    2011-04-01

    A southeastern European isolate of Alternanthera mosaic virus (AltMV-MU) of the genus Potexvirus (family Flexiviridae) was purified from the ornamental plant Portulaca grandiflora. The complete nucleotide sequence (6606 nucleotides) of AltMV-MU genomic RNA was defined. The AltMV-MU genome is different from those of all isolates described earlier and is most closely related to genomes of partly sequenced portulaca isolates AltMV-Po (America) and AltMV-It (Italy). Phylogenetic analysis supports the view that AltMV-MU belongs to a new "portulaca" genotype distinguishable from the "phlox" genotype.

  3. Genome-wide Comparative Analyses Reveal the Dynamic Evolution of Nucleotide-Binding Leucine-Rich Repeat Gene Family among Solanaceae Plants

    Directory of Open Access Journals (Sweden)

    Eunyoung Seo

    2016-08-01

    Full Text Available Plants have evolved an elaborate innate immune system against invading pathogens. Within this system, intracellular nucleotide-binding leucine-rich repeat (NLR immune receptors are known play critical roles in effector-triggered immunity (ETI plant defense. We performed genome-wide identification and classification of NLR-coding sequences from the genomes of pepper, tomato, and potato using fixed criteria. We then compared genomic duplication and evolution features. We identified intact 267, 443, and 755 NLR-encoding genes in tomato, potato, and pepper genomes, respectively. Phylogenetic analyses and classification of Solanaceae NLRs revealed that the majority of NLR super family members fell into 14 subgroups, including a TIR-NLR (TNL subgroup and 13 non-TNL subgroups. Specific subgroups have expanded in each genome, with the expansion in pepper showing subgroup-specific physical clusters. Comparative analysis of duplications showed distinct duplication patterns within pepper and among Solanaceae plants suggesting subgroup- or species-specific gene duplication events after speciation, resulting in divergent evolution. Taken together, genome-wide analyses of NLR family members provide insights into their evolutionary history in Solanaceae. These findings also provide important foundational knowledge for understanding NLR evolution and will empower broader characterization of disease resistance genes to be used for crop breeding.

  4. Identification, characterization, and utilization of genome-wide simple sequence repeats to identify a QTL for acidity in apple

    Science.gov (United States)

    2012-01-01

    Background Apple is an economically important fruit crop worldwide. Developing a genetic linkage map is a critical step towards mapping and cloning of genes responsible for important horticultural traits in apple. To facilitate linkage map construction, we surveyed and characterized the distribution and frequency of perfect microsatellites in assembled contig sequences of the apple genome. Results A total of 28,538 SSRs have been identified in the apple genome, with an overall density of 40.8 SSRs per Mb. Di-nucleotide repeats are the most frequent microsatellites in the apple genome, accounting for 71.9% of all microsatellites. AT/TA repeats are the most frequent in genomic regions, accounting for 38.3% of all the G-SSRs, while AG/GA dimers prevail in transcribed sequences, and account for 59.4% of all EST-SSRs. A total set of 310 SSRs is selected to amplify eight apple genotypes. Of these, 245 (79.0%) are found to be polymorphic among cultivars and wild species tested. AG/GA motifs in genomic regions have detected more alleles and higher PIC values than AT/TA or AC/CA motifs. Moreover, AG/GA repeats are more variable than any other dimers in apple, and should be preferentially selected for studies, such as genetic diversity and linkage map construction. A total of 54 newly developed apple SSRs have been genetically mapped. Interestingly, clustering of markers with distorted segregation is observed on linkage groups 1, 2, 10, 15, and 16. A QTL responsible for malic acid content of apple fruits is detected on linkage group 8, and accounts for ~13.5% of the observed phenotypic variation. Conclusions This study demonstrates that di-nucleotide repeats are prevalent in the apple genome and that AT/TA and AG/GA repeats are the most frequent in genomic and transcribed sequences of apple, respectively. All SSR motifs identified in this study as well as those newly mapped SSRs will serve as valuable resources for pursuing apple genetic studies, aiding the apple breeding

  5. Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.

    Science.gov (United States)

    Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick

    2017-08-01

    A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.

  6. Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags.

    Science.gov (United States)

    Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi

    2012-01-01

    We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

  7. Characterization of Sri Lanka rabies virus isolates using nucleotide sequence analysis of nucleoprotein gene.

    Science.gov (United States)

    Arai, Y T; Takahashi, H; Kameoka, Y; Shiino, T; Wimalaratne, O; Lodmell, D L

    2001-01-01

    Thirty-four suspected rabid brain samples from 2 humans, 24 dogs, 4 cats, 2 mongooses, I jackal and I water buffalo were collected in 1995-1996 in Sri Lanka. Total RNA was extracted directly from brain suspensions and examined using a one-step reverse transcription-polymerase chain reaction (RT-PCR) for the rabies virus nucleoprotein (N) gene. Twenty-eight samples were found positive for the virus N gene by RT-PCR and also for the virus antigens by fluorescent antibody (FA) test. Rabies virus isolates obtained from different animal species in different regions of Sri Lanka were genetically homogenous. Sequences of 203 nucleotides (nt)-long RT-PCR products obtained from 16 of 27 samples were found identical. Sequences of 1350 nt of N genes of 14 RT-PCR products were determined. The Sri Lanka isolates under study formed a specific cluster that included also an earlier isolate from India but did not include the known isolates from China, Thailand, Malaysia, Israel, Iran, Oman, Saudi Arabia, Russia, Nepal, Philippines, Japan and from several other countries. These results suggest that one type of rabies virus is circulating among human, dog, cat, mongoose, jackal and water buffalo living near Colombo City and in other five remote regions in Sri Lanka.

  8. Complete Nucleotide Sequence Analysis of the Norovirus GII.4 Sydney Variant in South Korea

    Directory of Open Access Journals (Sweden)

    Ji-Sun Park

    2015-01-01

    Full Text Available Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4 was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF composites throughout the whole genome: ORF1 (5,100 bp, ORF2 (1,623 bp, and ORF3 (807 bp. Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.

  9. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Science.gov (United States)

    Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  10. JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures

    Science.gov (United States)

    Dong, Min; Graham, Mitchell; Yadav, Nehul

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416

  11. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Directory of Open Access Journals (Sweden)

    Jieming Shi

    Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  12. Tandemly repeated sequence in 5'end of mtDNA control region of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-12-17

    Dec 17, 2008 ... chain reaction (PCR). Japanese Spanish ... mainly covered general ecology and fishery biology. No study concerning the ... Conserved sequence blocks and the repeat units are indicated by boxes. performed using the exact ...

  13. Tools for analyzing genetic variants from sequencing data Case study: short tandem repeats

    OpenAIRE

    Gymrek, Melissa

    2016-01-01

    This was presented as a BitesizeBio Webinar entitled "Tools for analyzing genetic variants from sequencing data Case study: short tandem repeats"Accompanying scripts can be accessed on github:https://github.com/mgymrek/mgymrek-bitesizebio-webinar 

  14. Prevalence of single nucleotide polymorphism among 27 diverse alfalfa genotypes as assessed by transcriptome sequencing

    Directory of Open Access Journals (Sweden)

    Li Xuehui

    2012-10-01

    Full Text Available Abstract Background Alfalfa, a perennial, outcrossing species, is a widely planted forage legume producing highly nutritious biomass. Currently, improvement of cultivated alfalfa mainly relies on recurrent phenotypic selection. Marker assisted breeding strategies can enhance alfalfa improvement efforts, particularly if many genome-wide markers are available. Transcriptome sequencing enables efficient high-throughput discovery of single nucleotide polymorphism (SNP markers for a complex polyploid species. Result The transcriptomes of 27 alfalfa genotypes, including elite breeding genotypes, parents of mapping populations, and unimproved wild genotypes, were sequenced using an Illumina Genome Analyzer IIx. De novo assembly of quality-filtered 72-bp reads generated 25,183 contigs with a total length of 26.8 Mbp and an average length of 1,065 bp, with an average read depth of 55.9-fold for each genotype. Overall, 21,954 (87.2% of the 25,183 contigs represented 14,878 unique protein accessions. Gene ontology (GO analysis suggested that a broad diversity of genes was represented in the resulting sequences. The realignment of individual reads to the contigs enabled the detection of 872,384 SNPs and 31,760 InDels. High resolution melting (HRM analysis was used to validate 91% of 192 putative SNPs identified by sequencing. Both allelic variants at about 95% of SNP sites identified among five wild, unimproved genotypes are still present in cultivated alfalfa, and all four US breeding programs also contain a high proportion of these SNPs. Thus, little evidence exists among this dataset for loss of significant DNA sequence diversity from either domestication or breeding of alfalfa. Structure analysis indicated that individuals from the subspecies falcata, the diploid subspecies caerulea, and the tetraploid subspecies sativa (cultivated tetraploid alfalfa were clearly separated. Conclusion We used transcriptome sequencing to discover large numbers of SNPs

  15. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library

    Directory of Open Access Journals (Sweden)

    Salem Mohamed

    2009-11-01

    Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In

  16. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

    Science.gov (United States)

    Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

    2009-11-25

    To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the

  17. Finding the right coverage : The impact of coverage and sequence quality on single nucleotide polymorphism genotyping error rates

    NARCIS (Netherlands)

    Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah

    Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.

  18. ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

    Science.gov (United States)

    Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

    2012-09-08

    The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  19. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Directory of Open Access Journals (Sweden)

    Meiler Arno

    2012-09-01

    Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  20. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Science.gov (United States)

    2012-01-01

    Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

  1. Tandemly repeated sequence in 5'end of mtDNA control region of ...

    African Journals Online (AJOL)

    Extensive length variability was observed in 5' end sequence of the mitochondrial DNA control region of the Japanese Spanish mackerel (Scomberomorus niphonius). This length variability was due to the presence of varying numbers of a 56-bp tandemly repeated sequence and a 46-bp insertion/deletion (indel).

  2. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  3. Whole-genome sequencing identifies genomic heterogeneity at a nucleotide and chromosomal level in bladder cancer

    Science.gov (United States)

    Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.

    2014-01-01

    Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795

  4. Complete nucleotide sequence and genome organization of a Chinese isolate of Tobacco vein distorting virus.

    Science.gov (United States)

    Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping

    2010-12-01

    Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.

  5. Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.

    Science.gov (United States)

    Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent

    2016-03-22

    Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.

  6. The complete chloroplast genome sequence of Taxus chinensis var. mairei (Taxaceae): loss of an inverted repeat region and comparative analysis with related species.

    Science.gov (United States)

    Zhang, Yanzhen; Ma, Ji; Yang, Bingxian; Li, Ruyi; Zhu, Wei; Sun, Lianli; Tian, Jingkui; Zhang, Lin

    2014-05-01

    Taxus chinensis var. mairei (Taxaceae) is a domestic variety of yew species in local China. This plant is one of the sources for paclitaxel, which is a promising antineoplastic chemotherapy drugs during the last decade. We have sequenced the complete nucleotide sequence of the chloroplast (cp) genome of T. chinensis var. mairei. The T. chinensis var. mairei cp genome is 129,513 bp in length, with 113 single copy genes and two duplicated genes (trnI-CAU, trnQ-UUG). Among the 113 single copy genes, 9 are intron-containing. Compared to other land plant cp genomes, the T. chinensis var. mairei cp genome has lost one of the large inverted repeats (IRs) found in angiosperms, fern, liverwort, and gymnosperm such as Cycas revoluta and Ginkgo biloba L. Compared to related species, the gene order of T. chinensis var. mairei has a large inversion of ~110kb including 91 genes (from rps18 to accD) with gene contents unarranged. Repeat analysis identified 48 direct and 2 inverted repeats 30 bp long or longer with a sequence identity greater than 90%. Repeated short segments were found in genes rps18, rps19 and clpP. Analysis also revealed 22 simple sequence repeat (SSR) loci and almost all are composed of A or T. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Nucleotide sequence of the melA gene, coding for alpha-galactosidase in Escherichia coli K-12.

    OpenAIRE

    Liljeström, P L; Liljeström, P

    1987-01-01

    Melibiose uptake and hydrolysis in E.coli is performed by the MelB and MelA proteins, respectively. We report the cloning and sequencing of the melA gene. The nucleotide sequence data showed that melA codes for a 450 amino acid long protein with a molecular weight of 50.6 kd. The sequence data also supported the assumption that the mel locus forms an operon with melA in proximal position. A comparison of MelA with alpha-galactosidase proteins from yeast and human origin showed that these prot...

  8. Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

    Science.gov (United States)

    Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

    2012-07-01

    We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.

  9. Developing expressed sequence tag libraries and the discovery of simple sequence repeat markers for two species of raspberry (Rubus L.)

    Science.gov (United States)

    Background: Due to a relatively high level of codominant inheritance and transferability within and among taxonomic groups, simple sequence repeat (SSR) markers are important elements in comparative mapping and delineation of genomic regions associated with traits of economic importance. Expressed S...

  10. Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna

    Directory of Open Access Journals (Sweden)

    Souche Erika L

    2011-06-01

    Full Text Available Abstract Background Daphnia (Crustacea: Cladocera plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP marker development. Results We developed three expressed sequence tag (EST libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47% of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna.

  11. Potentials and limitations of histone repeat sequences for phylogenetic reconstruction of Sophophora.

    Science.gov (United States)

    Baldo, A M; Les, D H; Strausbaugh, L D

    1999-11-01

    Simplified DNA sequence acquisition has provided many new data sets that are useful for phylogenetic reconstruction, including single- and multiple-copy nuclear and organellar genes. Although transcribed regions receive much attention, nontranscribed regions have recently been added to the repertoire of sequences suitable for phylogenetic studies, especially for closely related taxa. We evaluated the efficacy of a small portion of the histone repeat for phylogenetic reconstruction among Drosophila species. Histone repeats in invertebrates offer distinct advantages similar to those of widely used ribosomal repeats. First, the units are tandemly repeated and undergo concerted evolution. Second, histone repeats include both highly conserved coding and variable intergenic regions. This composition facilitates application of "universal" primers spanning potentially informative sites. We examined a small region of the histone repeat, including the intergenic spacer segments of coding regions from the divergently transcribed H2A and H2B histone genes. The spacer (about 230 bp) exists as a mosaic with highly conserved functional motifs interspersed with rapidly diverging regions; the former aid in alignment of the spacer. There are no ambiguities in alignment of coding regions. Coding and noncoding regions were analyzed together and separately for phylogenetic information. Parsimony, distance, and maximum-likelihood methods successfully retrieve the corroborated phylogeny for the taxa examined. This study demonstrates the resolving power of a small histone region which may now be added to the growing collection of phylogenetically useful DNA sequences.

  12. RePS: a sequence assembler that masks exact repeats identified from the shotgun data

    DEFF Research Database (Denmark)

    Wang, Jun; Wong, Gane Ka-Shu; Ni, Peixiang

    2002-01-01

    We describe a sequence assembler, RePS (repeat-masked Phrap with scaffolding), that explicitly identifies exact 20mer repeats from the shotgun data and removes them prior to the assembly. The established software is used to compute meaningful error probabilities for each base. Clone......-end-pairing information is used to construct scaffolds that order and orient the contigs. We show with real data for human and rice that reasonable assemblies are possible even at coverages of only 4x to 6x, despite having up to 42.2% in exact repeats. Udgivelsesdato: 2002-May...

  13. Accurate typing of short tandem repeats from genome-wide sequencing data and its applications.

    Science.gov (United States)

    Fungtammasan, Arkarachai; Ananda, Guruprasad; Hile, Suzanne E; Su, Marcia Shu-Wei; Sun, Chen; Harris, Robert; Medvedev, Paul; Eckert, Kristin; Makova, Kateryna D

    2015-05-01

    Short tandem repeats (STRs) are implicated in dozens of human genetic diseases and contribute significantly to genome variation and instability. Yet profiling STRs from short-read sequencing data is challenging because of their high sequencing error rates. Here, we developed STR-FM, short tandem repeat profiling using flank-based mapping, a computational pipeline that can detect the full spectrum of STR alleles from short-read data, can adapt to emerging read-mapping algorithms, and can be applied to heterogeneous genetic samples (e.g., tumors, viruses, and genomes of organelles). We used STR-FM to study STR error rates and patterns in publicly available human and in-house generated ultradeep plasmid sequencing data sets. We discovered that STRs sequenced with a PCR-free protocol have up to ninefold fewer errors than those sequenced with a PCR-containing protocol. We constructed an error correction model for genotyping STRs that can distinguish heterozygous alleles containing STRs with consecutive repeat numbers. Applying our model and pipeline to Illumina sequencing data with 100-bp reads, we could confidently genotype several disease-related long trinucleotide STRs. Utilizing this pipeline, for the first time we determined the genome-wide STR germline mutation rate from a deeply sequenced human pedigree. Additionally, we built a tool that recommends minimal sequencing depth for accurate STR genotyping, depending on repeat length and sequencing read length. The required read depth increases with STR length and is lower for a PCR-free protocol. This suite of tools addresses the pressing challenges surrounding STR genotyping, and thus is of wide interest to researchers investigating disease-related STRs and STR evolution. © 2015 Fungtammasan et al.; Published by Cold Spring Harbor Laboratory Press.

  14. The Bryopsis hypnoides plastid genome: multimeric forms and complete nucleotide sequence.

    Directory of Open Access Journals (Sweden)

    Fang Lü

    Full Text Available BACKGROUND: Bryopsis hypnoides Lamouroux is a siphonous green alga, and its extruded protoplasm can aggregate spontaneously in seawater and develop into mature individuals. The chloroplast of B. hypnoides is the biggest organelle in the cell and shows strong autonomy. To better understand this organelle, we sequenced and analyzed the chloroplast genome of this green alga. PRINCIPAL FINDINGS: A total of 111 functional genes, including 69 potential protein-coding genes, 5 ribosomal RNA genes, and 37 tRNA genes were identified. The genome size (153,429 bp, arrangement, and inverted-repeat (IR-lacking structure of the B. hypnoides chloroplast DNA (cpDNA closely resembles that of Chlorella vulgaris. Furthermore, our cytogenomic investigations using pulsed-field gel electrophoresis (PFGE and southern blotting methods showed that the B. hypnoides cpDNA had multimeric forms, including monomer, dimer, trimer, tetramer, and even higher multimers, which is similar to the higher order organization observed previously for higher plant cpDNA. The relative amounts of the four multimeric cpDNA forms were estimated to be about 1, 1/2, 1/4, and 1/8 based on molecular hybridization analysis. Phylogenetic analyses based on a concatenated alignment of chloroplast protein sequences suggested that B. hypnoides is sister to all Chlorophyceae and this placement received moderate support. CONCLUSION: All of the results suggest that the autonomy of the chloroplasts of B. hypnoides has little to do with the size and gene content of the cpDNA, and the IR-lacking structure of the chloroplasts indirectly demonstrated that the multimeric molecules might result from the random cleavage and fusion of replication intermediates instead of recombinational events.

  15. Comparison of the nucleotide sequence of wild-type hepatitis - A virus and its attenuated candidate vaccine derivative

    International Nuclear Information System (INIS)

    Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.

    1987-01-01

    Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative

  16. A weighted sampling algorithm for the design of RNA sequences with targeted secondary structure and nucleotide distribution.

    Science.gov (United States)

    Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme

    2013-07-01

    The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.

  17. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

    Science.gov (United States)

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

  18. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    Directory of Open Access Journals (Sweden)

    Francesca Bertolini

    Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  19. Nucleotide sequence analysis of HTLV-I isolated from cerebrospinal fluid of a patient with TSP/HAM: comparison to other HTLV-I isolates.

    Science.gov (United States)

    Mukhopadhyaya, R; Sadaie, M R

    1993-02-01

    Human T-cell leukemia virus type I (HTLV-I) has been associated with adult T-cell leukemia/lymphoma and the chronic neurologic disorder tropical spastic paraparesis/HTLV-I-associated myelopathy (TSP/HAM). To study the genetic structure of the virus associated with TSP/HAM, we have obtained and sequenced a partial genomic clone from an HTLV-I-positive cell line established from cerebrospinal fluid (CSF) of a Jamaican patient with TSP/HAM. This clone consisted of a 4.3-kb viral sequence containing the 5' long terminal repeat (LTR), gag, and N-terminal portion of the pol gene, with an overall 1.3% sequence variation resulting from mostly nucleotide substitutions, as compared to the prototype HTLV-I ATK-1. The gag and pol regions showed only 1.4% and 1.2% nucleotide variations, respectively. However, the U3 region of the LTR showed the highest sequence variation (3.6%), where several changes appear to be common among certain TSP/HAM isolates. Several of these changes reside within the 21-bp boundaries and the Tax-responsive element. It would be important to determine if the observed changes are sufficient to cause neurologic disorders similar to the murine leukemia virus system or simply reflect the divergent pool of HTLV-I from different geographic locations. At this time, we cannot rule out the possibility that the observed changes have either direct or indirect significance for the HTLV-I pathogenesis in TSP/HAM.

  20. Molecular Identification of Necrophagous Muscidae and Sarcophagidae Fly Species Collected in Korea by Mitochondrial Cytochrome c Oxidase Subunit I Nucleotide Sequences

    Directory of Open Access Journals (Sweden)

    Yu-Hoon Kim

    2014-01-01

    Full Text Available Identification of insect species is an important task in forensic entomology. For more convenient species identification, the nucleotide sequences of cytochrome c oxidase subunit I (COI gene have been widely utilized. We analyzed full-length COI nucleotide sequences of 10 Muscidae and 6 Sarcophagidae fly species collected in Korea. After DNA extraction from collected flies, PCR amplification and automatic sequencing of the whole COI sequence were performed. Obtained sequences were analyzed for a phylogenetic tree and a distance matrix. Our data showed very low intraspecific sequence distances and species-level monophylies. However, sequence comparison with previously reported sequences revealed a few inconsistencies or paraphylies requiring further investigation. To the best of our knowledge, this study is the first report of COI nucleotide sequences from Hydrotaea occulta, Muscina angustifrons, Muscina pascuorum, Ophyra leucostoma, Sarcophaga haemorrhoidalis, Sarcophaga harpax, and Phaonia aureola.

  1. A versatile palindromic amphipathic repeat coding sequence horizontally distributed among diverse bacterial and eucaryotic microbes

    Directory of Open Access Journals (Sweden)

    Glass John I

    2010-07-01

    Full Text Available Abstract Background Intragenic tandem repeats occur throughout all domains of life and impart functional and structural variability to diverse translation products. Repeat proteins confer distinctive surface phenotypes to many unicellular organisms, including those with minimal genomes such as the wall-less bacterial monoderms, Mollicutes. One such repeat pattern in this clade is distributed in a manner suggesting its exchange by horizontal gene transfer (HGT. Expanding genome sequence databases reveal the pattern in a widening range of bacteria, and recently among eucaryotic microbes. We examined the genomic flux and consequences of the motif by determining its distribution, predicted structural features and association with membrane-targeted proteins. Results Using a refined hidden Markov model, we document a 25-residue protein sequence motif tandemly arrayed in variable-number repeats in ORFs lacking assigned functions. It appears sporadically in unicellular microbes from disparate bacterial and eucaryotic clades, representing diverse lifestyles and ecological niches that include host parasitic, marine and extreme environments. Tracts of the repeats predict a malleable configuration of recurring domains, with conserved hydrophobic residues forming an amphipathic secondary structure in which hydrophilic residues endow extensive sequence variation. Many ORFs with these domains also have membrane-targeting sequences that predict assorted topologies; others may comprise reservoirs of sequence variants. We demonstrate expressed variants among surface lipoproteins that distinguish closely related animal pathogens belonging to a subgroup of the Mollicutes. DNA sequences encoding the tandem domains display dyad symmetry. Moreover, in some taxa the domains occur in ORFs selectively associated with mobile elements. These features, a punctate phylogenetic distribution, and different patterns of dispersal in genomes of related taxa, suggest that the

  2. Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1987-01-01

    The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

  3. Random mutagenesis of the nucleotide-binding domain of NRC1 (NB-LRR Required for Hypersensitive Response-Associated Cell Death-1), a downstream signalling nucleotide-binding, leucine-rich repeat (NB-LRR) protein, identifies gain-of-function mutations in the nucleotide-binding pocket

    NARCIS (Netherlands)

    Sueldo, D.J.; Shimels, M.Z.; Spiridon, L.N.; Caldararu, O.; Petrescu, A.J.; Joosten, M.H.A.J.; Tameling, W.I.L.

    2015-01-01

    •Plant nucleotide-binding, leucine-rich repeat (NB-LRR) proteins confer immunity to pathogens possessing the corresponding avirulence proteins. Activation of NB-LRR proteins is often associated with induction of the hypersensitive response (HR), a form of programmed cell death. •NRC1 (NB-LRR

  4. SSRscanner: a program for reporting distribution and exact location of simple sequence repeats.

    Science.gov (United States)

    Anwar, Tamanna; Khan, Asad U

    2006-02-20

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. These repeated DNA sequences are found in both prokaryotes and eukaryotes. They are distributed almost at random throughout the genome, ranging from mononucleotide to trinucleotide repeats. They are also found at longer lengths (> 6 repeating units) of tracts. Most of the computer programs that find SSRs do not report its exact position. A computer program SSRscanner was written to find out distribution, frequency and exact location of each SSR in the genome. SSRscanner is user friendly. It can search repeats of any length and produce outputs with their exact position on chromosome and their frequency of occurrence in the sequence. This program has been written in PERL and is freely available for non-commercial users by request from the authors. Please contact the authors by E-mail: huzzi99@hotmail.com.

  5. Nucleotide sequences of two cellulase genes from alkalophilic Bacillus sp. strain N-4 and their strong homology.

    OpenAIRE

    Fukumori, F; Sashihara, N; Kudo, T; Horikoshi, K

    1986-01-01

    Two genes for cellulases of alkalophilic Bacillus sp. strain N-4 (ATCC 21833) have been sequenced. From the DNA sequences the cellulases encoded in the plasmids pNK1 and pNK2 consist of 488 and 409 amino acids, respectively. The DNA and protein sequences of the pNK1-encoded cellulase are related to those of the pNK2-encoded cellulase. The pNK2-encoded cellulase lacks the direct repeat sequence of a stretch of 60 amino acids near the C-terminal end of the pNK1-encoded cellulase. The duplicatio...

  6. Read length and repeat resolution: exploring prokaryote genomes using next-generation sequencing technologies.

    Directory of Open Access Journals (Sweden)

    Matt J Cahill

    Full Text Available BACKGROUND: There are a growing number of next-generation sequencing technologies. At present, the most cost-effective options also produce the shortest reads. However, even for prokaryotes, there is uncertainty concerning the utility of these technologies for the de novo assembly of complete genomes. This reflects an expectation that short reads will be unable to resolve small, but presumably abundant, repeats. METHODOLOGY/PRINCIPAL FINDINGS: Using a simple model of repeat assembly, we develop and test a technique that, for any read length, can estimate the occurrence of unresolvable repeats in a genome, and thus predict the number of gaps that would need to be closed to produce a complete sequence. We apply this technique to 818 prokaryote genome sequences. This provides a quantitative assessment of the relative performance of various lengths. Notably, unpaired reads of only 150nt can reconstruct approximately 50% of the analysed genomes with fewer than 96 repeat-induced gaps. Nonetheless, there is considerable variation amongst prokaryotes. Some genomes can be assembled to near contiguity using very short reads while others require much longer reads. CONCLUSIONS: Given the diversity of prokaryote genomes, a sequencing strategy should be tailored to the organism under study. Our results will provide researchers with a practical resource to guide the selection of the appropriate read length.

  7. Read length and repeat resolution: Exploring prokaryote genomes using next-generation sequencing technologies

    KAUST Repository

    Cahill, Matt J.

    2010-07-12

    Background: There are a growing number of next-generation sequencing technologies. At present, the most cost-effective options also produce the shortest reads. However, even for prokaryotes, there is uncertainty concerning the utility of these technologies for the de novo assembly of complete genomes. This reflects an expectation that short reads will be unable to resolve small, but presumably abundant, repeats. Methodology/Principal Findings: Using a simple model of repeat assembly, we develop and test a technique that, for any read length, can estimate the occurrence of unresolvable repeats in a genome, and thus predict the number of gaps that would need to be closed to produce a complete sequence. We apply this technique to 818 prokaryote genome sequences. This provides a quantitative assessment of the relative performance of various lengths. Notably, unpaired reads of only 150nt can reconstruct approximately 50% of the analysed genomes with fewer than 96 repeat-induced gaps. Nonetheless, there is considerable variation amongst prokaryotes. Some genomes can be assembled to near contiguity using very short reads while others require much longer reads. Conclusions: Given the diversity of prokaryote genomes, a sequencing strategy should be tailored to the organism under study. Our results will provide researchers with a practical resource to guide the selection of the appropriate read length. 2010 Cahill et al.

  8. Inverted repeats in the promoter as an autoregulatory sequence for TcrX in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Bhattacharya, Monolekha; Das, Amit Kumar

    2011-01-01

    Highlights: ► The regulatory sequences recognized by TcrX have been identified. ► The regulatory region comprises of inverted repeats segregated by 30 bp region. ► The mode of binding of TcrX with regulatory sequence is unique. ► In silico TcrX–DNA docked model binds one of the inverted repeats. ► Both phosphorylated and unphosphorylated TcrX binds regulatory sequence in vitro. -- Abstract: TcrY, a histidine kinase, and TcrX, a response regulator, constitute a two-component system in Mycobacterium tuberculosis. tcrX, which is expressed during iron scarcity, is instrumental in the survival of iron-dependent M. tuberculosis. However, the regulator of tcrX/Y has not been fully characterized. Crosslinking studies of TcrX reveal that it can form oligomers in vitro. Electrophoretic mobility shift assays (EMSAs) show that TcrX recognizes two regions in the promoter that are comprised of inverted repeats separated by ∼30 bp. The dimeric in silico model of TcrX predicts binding to one of these inverted repeat regions. Site-directed mutagenesis and radioactive phosphorylation indicate that D54 of TcrX is phosphorylated by H256 of TcrY. However, phosphorylated and unphosphorylated TcrX bind the regulatory sequence with equal efficiency, which was shown with an EMSA using the D54A TcrX mutant.

  9. Read length and repeat resolution: Exploring prokaryote genomes using next-generation sequencing technologies

    KAUST Repository

    Cahill, Matt J.; Kö ser, Claudio U.; Ross, Nicholas E.; Archer, John A.C.

    2010-01-01

    Background: There are a growing number of next-generation sequencing technologies. At present, the most cost-effective options also produce the shortest reads. However, even for prokaryotes, there is uncertainty concerning the utility of these technologies for the de novo assembly of complete genomes. This reflects an expectation that short reads will be unable to resolve small, but presumably abundant, repeats. Methodology/Principal Findings: Using a simple model of repeat assembly, we develop and test a technique that, for any read length, can estimate the occurrence of unresolvable repeats in a genome, and thus predict the number of gaps that would need to be closed to produce a complete sequence. We apply this technique to 818 prokaryote genome sequences. This provides a quantitative assessment of the relative performance of various lengths. Notably, unpaired reads of only 150nt can reconstruct approximately 50% of the analysed genomes with fewer than 96 repeat-induced gaps. Nonetheless, there is considerable variation amongst prokaryotes. Some genomes can be assembled to near contiguity using very short reads while others require much longer reads. Conclusions: Given the diversity of prokaryote genomes, a sequencing strategy should be tailored to the organism under study. Our results will provide researchers with a practical resource to guide the selection of the appropriate read length. 2010 Cahill et al.

  10. Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions.

    Science.gov (United States)

    Nishizawa, M; Nishizawa, K

    2000-10-01

    The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

  11. Single nucleotide polymorphism barcoding of cytochrome c oxidase I sequences for discriminating 17 species of Columbidae by decision tree algorithm.

    Science.gov (United States)

    Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2017-07-01

    DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.

  12. Roles of genes and Alu repeats in nonlinear correlations of HUMHBB DNA sequence

    International Nuclear Information System (INIS)

    Xiao Yi; Huang Yanzhao

    2004-01-01

    DNA sequences of different species and different portion of the DNA of the same species may have completely different correlation properties, but the origin of these correlations is still not very clear and is currently being investigated, especially in different particular cases. We report here a study of the DNA sequence of human beta globin region (HUMHBB) which has strong linear and nonlinear correlations. We studied the roles of two of the typical elements of DNA sequence, genes and Alu repeats, in the nonlinear correlations of HUMHBB. We find that there exist strong nonlinear correlations between the exons or introns in different genes and between the Alu repeats. They may be one of the major sources of the nonlinear correlations in HUMBHB

  13. Characterization of expressed sequence tag-derived simple sequence repeat markers for Aspergillus flavus: emphasis on variability of isolates from the southern United States.

    Science.gov (United States)

    Wang, Xinwang; Wadl, Phillip A; Wood-Jones, Alicia; Windham, Gary; Trigiano, Robert N; Scruggs, Mary; Pilgrim, Candace; Baird, Richard

    2012-12-01

    Simple sequence repeat (SSR) markers were developed from Aspergillus flavus expressed sequence tag (EST) database to conduct an analysis of genetic relationships of Aspergillus isolates from numerous host species and geographical regions, but primarily from the United States. Twenty-nine primers were designed from 362 tri-nucleotide EST-SSR sequences. Eighteen polymorphic loci were used to genotype 96 Aspergillus species isolates. The number of alleles detected per locus ranged from 2 to 24 with a mean of 8.2 alleles. Haploid diversity ranged from 0.28 to 0.91. Genetic distance matrix was used to perform principal coordinates analysis (PCA) and to generate dendrograms using unweighted pair group method with arithmetic mean (UPGMA). Two principal coordinates explained more than 75 % of the total variation among the isolates. One clade was identified for A. flavus isolates (n = 87) with the other Aspergillus species (n = 7) using PCA, but five distinct clusters were present when the others taxa were excluded from the analysis. Six groups were noted when the EST-SSR data were compared using UPGMA. However, the latter PCA or UPGMA comparison resulted in no direct associations with host species, geographical region or aflatoxin production. Furthermore, there was no direct correlation to visible morphological features such as sclerotial types. The isolates from Mississippi Delta region, which contained the largest percentage of isolates, did not show any unusual clustering except for isolates K32, K55, and 199. Further studies of these three isolates are warranted to evaluate their pathogenicity, aflatoxin production potential, additional gene sequences (e.g., RPB2), and morphological comparisons.

  14. Rate-determining Step of Flap Endonuclease 1 (FEN1) Reflects a Kinetic Bias against Long Flaps and Trinucleotide Repeat Sequences.

    Science.gov (United States)

    Tarantino, Mary E; Bilotti, Katharina; Huang, Ji; Delaney, Sarah

    2015-08-21

    Flap endonuclease 1 (FEN1) is a structure-specific nuclease responsible for removing 5'-flaps formed during Okazaki fragment maturation and long patch base excision repair. In this work, we use rapid quench flow techniques to examine the rates of 5'-flap removal on DNA substrates of varying length and sequence. Of particular interest are flaps containing trinucleotide repeats (TNR), which have been proposed to affect FEN1 activity and cause genetic instability. We report that FEN1 processes substrates containing flaps of 30 nucleotides or fewer at comparable single-turnover rates. However, for flaps longer than 30 nucleotides, FEN1 kinetically discriminates substrates based on flap length and flap sequence. In particular, FEN1 removes flaps containing TNR sequences at a rate slower than mixed sequence flaps of the same length. Furthermore, multiple-turnover kinetic analysis reveals that the rate-determining step of FEN1 switches as a function of flap length from product release to chemistry (or a step prior to chemistry). These results provide a kinetic perspective on the role of FEN1 in DNA replication and repair and contribute to our understanding of FEN1 in mediating genetic instability of TNR sequences. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Fusion protein gene nucleotide sequence similarities, shared antigenic sites and phylogenetic analysis suggest that phocid distemper virus 2 and canine distemper virus belong to the same virus entity.

    NARCIS (Netherlands)

    I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)

    1993-01-01

    textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the

  16. The nucleotide sequence of the right-hand terminus of adenovirus type 5 DNA: Implications for the mechanism of DNA replication

    NARCIS (Netherlands)

    Steenbergh, P.H.; Sussenbach, J.S.

    The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the

  17. Analysis of nucleotide sequence variations in herpes simplex virus types 1 and 2, and varicella-zoster virus

    International Nuclear Information System (INIS)

    Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.

    1998-01-01

    To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)

  18. Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

    Science.gov (United States)

    Amirhaeri, S; Wohlrab, F; Wells, R D

    1995-02-17

    The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

  19. Structure, organization, and sequence of alpha satellite DNA from human chromosome 17: evidence for evolution by unequal crossing-over and an ancestral pentamer repeat shared with the human X chromosome.

    Science.gov (United States)

    Waye, J S; Willard, H F

    1986-09-01

    The centromeric regions of all human chromosomes are characterized by distinct subsets of a diverse tandemly repeated DNA family, alpha satellite. On human chromosome 17, the predominant form of alpha satellite is a 2.7-kilobase-pair higher-order repeat unit consisting of 16 alphoid monomers. We present the complete nucleotide sequence of the 16-monomer repeat, which is present in 500 to 1,000 copies per chromosome 17, as well as that of a less abundant 15-monomer repeat, also from chromosome 17. These repeat units were approximately 98% identical in sequence, differing by the exclusion of precisely 1 monomer from the 15-monomer repeat. Homologous unequal crossing-over is suggested as a probable mechanism by which the different repeat lengths on chromosome 17 were generated, and the putative site of such a recombination event is identified. The monomer organization of the chromosome 17 higher-order repeat unit is based, in part, on tandemly repeated pentamers. A similar pentameric suborganization has been previously demonstrated for alpha satellite of the human X chromosome. Despite the organizational similarities, substantial sequence divergence distinguishes these subsets. Hybridization experiments indicate that the chromosome 17 and X subsets are more similar to each other than to the subsets found on several other human chromosomes. We suggest that the chromosome 17 and X alpha satellite subsets may be related components of a larger alphoid subfamily which have evolved from a common ancestral repeat into the contemporary chromosome-specific subsets.

  20. APE1 incision activity at abasic sites in tandem repeat sequences.

    Science.gov (United States)

    Li, Mengxia; Völker, Jens; Breslauer, Kenneth J; Wilson, David M

    2014-05-29

    Repetitive DNA sequences, such as those present in microsatellites and minisatellites, telomeres, and trinucleotide repeats (linked to fragile X syndrome, Huntington disease, etc.), account for nearly 30% of the human genome. These domains exhibit enhanced susceptibility to oxidative attack to yield base modifications, strand breaks, and abasic sites; have a propensity to adopt non-canonical DNA forms modulated by the positions of the lesions; and, when not properly processed, can contribute to genome instability that underlies aging and disease development. Knowledge on the repair efficiencies of DNA damage within such repetitive sequences is therefore crucial for understanding the impact of such domains on genomic integrity. In the present study, using strategically designed oligonucleotide substrates, we determined the ability of human apurinic/apyrimidinic endonuclease 1 (APE1) to cleave at apurinic/apyrimidinic (AP) sites in a collection of tandem DNA repeat landscapes involving telomeric and CAG/CTG repeat sequences. Our studies reveal the differential influence of domain sequence, conformation, and AP site location/relative positioning on the efficiency of APE1 binding and strand incision. Intriguingly, our data demonstrate that APE1 endonuclease efficiency correlates with the thermodynamic stability of the DNA substrate. We discuss how these results have both predictive and mechanistic consequences for understanding the success and failure of repair protein activity associated with such oxidatively sensitive, conformationally plastic/dynamic repetitive DNA domains. Published by Elsevier Ltd.

  1. Nucleotide sequences from the genomes of diverse cowpea accessions for discovery of genetic variation as part of the Feed the Future Innovation Lab for Climate Resilient Cowpea

    Data.gov (United States)

    US Agency for International Development — Nucleotide sequences were generated from 37 cowpea (Vigna unguiculata L. Walp.) accessions relevant to Africa, China and the USA to discover at type of genetic...

  2. The Potato Nucleotide-binding Leucine-rich Repeat (NLR) Immune Receptor Rx1 Is a Pathogen-dependent DNA-deforming Protein.

    Science.gov (United States)

    Fenyk, Stepan; Townsend, Philip D; Dixon, Christopher H; Spies, Gerhard B; de San Eustaquio Campillo, Alba; Slootweg, Erik J; Westerhof, Lotte B; Gawehns, Fleur K K; Knight, Marc R; Sharples, Gary J; Goverse, Aska; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

    2015-10-09

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable cells to respond to pathogen attack. Several NLRs act in the nucleus; however, conserved nuclear targets that support their role in immunity are unknown. Previously, we noted a structural homology between the nucleotide-binding domain of NLRs and DNA replication origin-binding Cdc6/Orc1 proteins. Here we show that the NB-ARC (nucleotide-binding, Apaf-1, R-proteins, and CED-4) domain of the Rx1 NLR of potato binds nucleic acids. Rx1 induces ATP-dependent bending and melting of DNA in vitro, dependent upon a functional P-loop. In situ full-length Rx1 binds nuclear DNA following activation by its cognate pathogen-derived effector protein, the coat protein of potato virus X. In line with its obligatory nucleocytoplasmic distribution, DNA binding was only observed when Rx1 was allowed to freely translocate between both compartments and was activated in the cytoplasm. Immune activation induced by an unrelated NLR-effector pair did not trigger an Rx1-DNA interaction. DNA binding is therefore not merely a consequence of immune activation. These data establish a role for DNA distortion in Rx1 immune signaling and define DNA as a molecular target of an activated NLR. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. The Potato Nucleotide-binding Leucine-rich Repeat (NLR) Immune Receptor Rx1 Is a Pathogen-dependent DNA-deforming Protein*

    Science.gov (United States)

    Fenyk, Stepan; Townsend, Philip D.; Dixon, Christopher H.; Spies, Gerhard B.; de San Eustaquio Campillo, Alba; Slootweg, Erik J.; Westerhof, Lotte B.; Gawehns, Fleur K. K.; Knight, Marc R.; Sharples, Gary J.; Goverse, Aska; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

    2015-01-01

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable cells to respond to pathogen attack. Several NLRs act in the nucleus; however, conserved nuclear targets that support their role in immunity are unknown. Previously, we noted a structural homology between the nucleotide-binding domain of NLRs and DNA replication origin-binding Cdc6/Orc1 proteins. Here we show that the NB-ARC (nucleotide-binding, Apaf-1, R-proteins, and CED-4) domain of the Rx1 NLR of potato binds nucleic acids. Rx1 induces ATP-dependent bending and melting of DNA in vitro, dependent upon a functional P-loop. In situ full-length Rx1 binds nuclear DNA following activation by its cognate pathogen-derived effector protein, the coat protein of potato virus X. In line with its obligatory nucleocytoplasmic distribution, DNA binding was only observed when Rx1 was allowed to freely translocate between both compartments and was activated in the cytoplasm. Immune activation induced by an unrelated NLR-effector pair did not trigger an Rx1-DNA interaction. DNA binding is therefore not merely a consequence of immune activation. These data establish a role for DNA distortion in Rx1 immune signaling and define DNA as a molecular target of an activated NLR. PMID:26306038

  4. [Molecular phylogeny of Turbellaria, based on data from comparing the nucleotide sequences of 18S ribosomal RNA genes].

    Science.gov (United States)

    Kuznedelov, K D; Timoshkin, O A

    1995-01-01

    Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.

  5. TRDistiller: a rapid filter for enrichment of sequence datasets with proteins containing tandem repeats.

    Science.gov (United States)

    Richard, François D; Kajava, Andrey V

    2014-06-01

    The dramatic growth of sequencing data evokes an urgent need to improve bioinformatics tools for large-scale proteome analysis. Over the last two decades, the foremost efforts of computer scientists were devoted to proteins with aperiodic sequences having globular 3D structures. However, a large portion of proteins contain periodic sequences representing arrays of repeats that are directly adjacent to each other (so called tandem repeats or TRs). These proteins frequently fold into elongated fibrous structures carrying different fundamental functions. Algorithms specific to the analysis of these regions are urgently required since the conventional approaches developed for globular domains have had limited success when applied to the TR regions. The protein TRs are frequently not perfect, containing a number of mutations, and some of them cannot be easily identified. To detect such "hidden" repeats several algorithms have been developed. However, the most sensitive among them are time-consuming and, therefore, inappropriate for large scale proteome analysis. To speed up the TR detection we developed a rapid filter that is based on the comparison of composition and order of short strings in the adjacent sequence motifs. Tests show that our filter discards up to 22.5% of proteins which are known to be without TRs while keeping almost all (99.2%) TR-containing sequences. Thus, we are able to decrease the size of the initial sequence dataset enriching it with TR-containing proteins which allows a faster subsequent TR detection by other methods. The program is available upon request. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats.

    Science.gov (United States)

    de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas

    2015-11-16

    Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. In silico analysis of Simple Sequence Repeats from chloroplast genomes of Solanaceae species

    Directory of Open Access Journals (Sweden)

    Evandro Vagner Tambarussi

    2009-01-01

    Full Text Available The availability of chloroplast genome (cpDNA sequences of Atropa belladonna, Nicotiana sylvestris, N.tabacum, N. tomentosiformis, Solanum bulbocastanum, S. lycopersicum and S. tuberosum, which are Solanaceae species,allowed us to analyze the organization of cpSSRs in their genic and intergenic regions. In general, the number of cpSSRs incpDNA ranged from 161 in S. tuberosum to 226 in N. tabacum, and the number of intergenic cpSSRs was higher than geniccpSSRs. The mononucleotide repeats were the most frequent in studied species, but we also identified di-, tri-, tetra-, pentaandhexanucleotide repeats. Multiple alignments of all cpSSRs sequences from Solanaceae species made the identification ofnucleotide variability possible and the phylogeny was estimated by maximum parsimony. Our study showed that the plastomedatabase can be exploited for phylogenetic analysis and biotechnological approaches.

  8. SeqEntropy: genome-wide assessment of repeats for short read sequencing.

    Directory of Open Access Journals (Sweden)

    Hsueh-Ting Chu

    Full Text Available BACKGROUND: Recent studies on genome assembly from short-read sequencing data reported the limitation of this technology to reconstruct the entire genome even at very high depth coverage. We investigated the limitation from the perspective of information theory to evaluate the effect of repeats on short-read genome assembly using idealized (error-free reads at different lengths. METHODOLOGY/PRINCIPAL FINDINGS: We define a metric H(k to be the entropy of sequencing reads at a read length k and use the relative loss of entropy ΔH(k to measure the impact of repeats for the reconstruction of whole-genome from sequences of length k. In our experiments, we found that entropy loss correlates well with de-novo assembly coverage of a genome, and a score of ΔH(k>1% indicates a severe loss in genome reconstruction fidelity. The minimal read lengths to achieve ΔH(k<1% are different for various organisms and are independent of the genome size. For example, in order to meet the threshold of ΔH(k<1%, a read length of 60 bp is needed for the sequencing of human genome (3.2 10(9 bp and 320 bp for the sequencing of fruit fly (1.8×10(8 bp. We also calculated the ΔH(k scores for 2725 prokaryotic chromosomes and plasmids at several read lengths. Our results indicate that the levels of repeats in different genomes are diverse and the entropy of sequencing reads provides a measurement for the repeat structures. CONCLUSIONS/SIGNIFICANCE: The proposed entropy-based measurement, which can be calculated in seconds to minutes in most cases, provides a rapid quantitative evaluation on the limitation of idealized short-read genome sequencing. Moreover, the calculation can be parallelized to scale up to large euakryotic genomes. This approach may be useful to tune the sequencing parameters to achieve better genome assemblies when a closely related genome is already available.

  9. Cytogenetic Analysis of Populus trichocarpa - Ribosomal DNA, Telomere Repeat Sequence, and Marker-selected BACs

    Science.gov (United States)

    M.N. lslam-Faridi; C.D. Nelson; S.P. DiFazio; L.E. Gunter; G.A. Tuskan

    2009-01-01

    The 185-285 rDNA and 55 rDNA loci in Populus trichocarpa were localized using fluorescent in situ hybridization (FISH). Two 185-285 rDNA sites and one 55 rDNA site were identified and located at the ends of 3 different chromosomes. FISH signals from the Arabidopsis-type telomere repeat sequence were observed at the distal ends of each chromosome. Six BAC clones...

  10. Nucleotide Sequences and Comparison of Two Large Conjugative Plasmids from Different Campylobacter species

    National Research Council Canada - National Science Library

    Batchelor, Roger A; Pearson, Bruce M; Friis, Lorna M; Guerry, Patricia; Wells, Jerry M

    2004-01-01

    .... Both plasmids are mosaic in structure, having homologues of genes found in a variety of different commensal and pathogenic bacteria, but nevertheless, showed striking similarities in DNA sequence...

  11. C-terminal low-complexity sequence repeats of Mycobacterium smegmatis Ku modulate DNA binding.

    Science.gov (United States)

    Kushwaha, Ambuj K; Grove, Anne

    2013-01-24

    Ku protein is an integral component of the NHEJ (non-homologous end-joining) pathway of DSB (double-strand break) repair. Both eukaryotic and prokaryotic Ku homologues have been characterized and shown to bind DNA ends. A unique feature of Mycobacterium smegmatis Ku is its basic C-terminal tail that contains several lysine-rich low-complexity PAKKA repeats that are absent from homologues encoded by obligate parasitic mycobacteria. Such PAKKA repeats are also characteristic of mycobacterial Hlp (histone-like protein) for which they have been shown to confer the ability to appose DNA ends. Unexpectedly, removal of the lysine-rich extension enhances DNA-binding affinity, but an interaction between DNA and the PAKKA repeats is indicated by the observation that only full-length Ku forms multiple complexes with a short stem-loop-containing DNA previously designed to accommodate only one Ku dimer. The C-terminal extension promotes DNA end-joining by T4 DNA ligase, suggesting that the PAKKA repeats also contribute to efficient end-joining. We suggest that low-complexity lysine-rich sequences have evolved repeatedly to modulate the function of unrelated DNA-binding proteins.

  12. Repeated-Sprint Sequences During Female Soccer Matches Using Fixed and Individual Speed Thresholds.

    Science.gov (United States)

    Nakamura, Fábio Y; Pereira, Lucas A; Loturco, Irineu; Rosseti, Marcelo; Moura, Felipe A; Bradley, Paul S

    2017-07-01

    Nakamura, FY, Pereira, LA, Loturco, I, Rosseti, M, Moura, FA, and Bradley, PS. Repeated-sprint sequences during female soccer matches using fixed and individual speed thresholds. J Strength Cond Res 31(7): 1802-1810, 2017-The main objective of this study was to characterize the occurrence of single sprint and repeated-sprint sequences (RSS) during elite female soccer matches, using fixed (20 km·h) and individually based speed thresholds (>90% of the mean speed from a 20-m sprint test). Eleven elite female soccer players from the same team participated in the study. All players performed a 20-m linear sprint test, and were assessed in up to 10 official matches using Global Positioning System technology. Magnitude-based inferences were used to test for meaningful differences. Results revealed that irrespective of adopting fixed or individual speed thresholds, female players produced only a few RSS during matches (2.3 ± 2.4 sequences using the fixed threshold and 3.3 ± 3.0 sequences using the individually based threshold), with most sequences composing of just 2 sprints. Additionally, central defenders performed fewer sprints (10.2 ± 4.1) than other positions (fullbacks: 28.1 ± 5.5; midfielders: 21.9 ± 10.5; forwards: 31.9 ± 11.1; with the differences being likely to almost certainly associated with effect sizes ranging from 1.65 to 2.72), and sprinting ability declined in the second half. The data do not support the notion that RSS occurs frequently during soccer matches in female players, irrespective of using fixed or individual speed thresholds to define sprint occurrence. However, repeated-sprint ability development cannot be ruled out from soccer training programs because of its association with match-related performance.

  13. Nucleotide sequence of the 3' ends of the double-stranded RNAs of grapevine chrome mosaic nepovirus.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Dunez, J

    1988-02-01

    Attempts were made to label the termini of dsRNAs corresponding to the two genomic RNAs of grapevine chrome mosaic nepovirus (GCMV). It was not possible to label the 5' ends of the dsRNAs with [gamma-32P]ATP, which suggests that a genome-linked protein blocks their 5' ends. Both dsRNA species were labelled at their 3' ends with pCp. The 3'-terminal sequences were determined by 'wandering spot' or by partial enzymic cleavage analysis. One strand (presumably positive) ended in a poly(A) 30 to 50 nucleotides long whereas the other (presumably negative) ended in 3'-ACCUUUUAAAAAG (RNA1) or 3'-ACCUUUUAAUAAAG (RNA2). The sequences resemble closely those complementary to the 5' ends of the RNAs of tomato black ring virus (strain S), which is distantly related to GCMV.

  14. D20S16 is a complex interspersed repeated sequence: Genetic and physical analysis of the locus

    Energy Technology Data Exchange (ETDEWEB)

    Bowden, D.W.; Krawchuk, M.D.; Howard, T.D. [Wake Forest Univ., Winston-Salem, NC (United States)] [and others

    1995-01-20

    The genomic structure of the D20S16 locus has been evaluated using genetic and physical methods. D20S16, originally detected with the probe CRI-L1214, is a highly informative, complex restriction fragment length polymorphism consisting of two separate allelic systems. The allelic systems have the characteristics of conventional VNTR polymorphisms and are separated by recombination ({theta} = 0.02, Z{sub max} = 74.82), as demonstrated in family studies. Most of these recombination events are meiotic crossovers and are maternal in origin, but two, including deletion of the locus in a cell line from a CEPH family member, occur without evidence for exchange of flanking markers. DNA sequence analysis suggests that the basis of the polymorphism is variable numbers of a 98-bp sequence tandemly repeated with 87 to 90% sequence similarity between repeats. The 98-bp repeat is a dimer of 49 bp sequence with 45 to 98% identity between the elements. In addition, nonpolymorphic genomic sequences adjacent to the polymorphic 98-bp repeat tracts are also repeated but are not polymorphic, i.e., show no individual to individual variation. Restriction enzyme mapping of cosmids containing the CRI-L1214 sequence suggests that there are multiple interspersed repeats of the CRI-L1214 sequence on chromosome 20. The results of dual-color fluorescence in situ hybridization experiments with interphase nuclei are also consistent with multiple repeats of an interspersed sequence on chromosome 20. 23 refs., 6 figs.

  15. Complete nucleotide sequence and genome organization of Olive latent virus 3, a new putative member of the family Tymoviridae.

    Science.gov (United States)

    Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P

    2010-09-01

    The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  16. Cis-acting regulatory sequences promote high-frequency gene conversion between repeated sequences in mammalian cells.

    Science.gov (United States)

    Raynard, Steven J; Baker, Mark D

    2004-01-01

    In mammalian cells, little is known about the nature of recombination-prone regions of the genome. Previously, we reported that the immunoglobulin heavy chain (IgH) mu locus behaved as a hotspot for mitotic, intrachromosomal gene conversion (GC) between repeated mu constant (Cmu) regions in mouse hybridoma cells. To investigate whether elements within the mu gene regulatory region were required for hotspot activity, gene targeting was used to delete a 9.1 kb segment encompassing the mu gene promoter (Pmu), enhancer (Emu) and switch region (Smu) from the locus. In these cell lines, GC between the Cmu repeats was significantly reduced, indicating that this 'recombination-enhancing sequence' (RES) is necessary for GC hotspot activity at the IgH locus. Importantly, the RES fragment stimulated GC when appended to the same Cmu repeats integrated at ectopic genomic sites. We also show that deletion of Emu and flanking matrix attachment regions (MARs) from the RES abolishes GC hotspot activity at the IgH locus. However, no stimulation of ectopic GC was observed with the Emu/MARs fragment alone. Finally, we provide evidence that no correlation exists between the level of transcription and GC promoted by the RES. We suggest a model whereby Emu/MARS enhances mitotic GC at the endogenous IgH mu locus by effecting chromatin modifications in adjacent DNA.

  17. Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning

    KAUST Repository

    Teng, Haotian; Cao, Minh Duc; Hall, Michael B; Duarte, Tania; Wang, Sheng; Coin, Lachlan J M

    2018-01-01

    Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.

  18. Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning

    KAUST Repository

    Teng, Haotian

    2018-04-10

    Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.

  19. Assessment of Cultivar Distinctness in Alfalfa: A Comparison of Genotyping-by-Sequencing, Simple-Sequence Repeat Marker, and Morphophysiological Observations

    Directory of Open Access Journals (Sweden)

    Paolo Annicchiarico

    2016-07-01

    Full Text Available Cultivar registration agencies typically require morphophysiological trait-based distinctness of candidate cultivars. This requirement is difficult to achieve for cultivars of major perennial forages because of their genetic structure and ever-increasing number of registered material, leading to possible rejection of agronomically valuable cultivars. This study aimed to explore the value of molecular markers applied to replicated bulked plants (three bulks of 100 independent plants each per cultivar to assess alfalfa ( L. subsp. cultivar distinctness. We compared genotyping-by-sequencing information based on 2902 polymorphic single-nucleotide polymorphism (SNP markers (>30 reads per DNA sample with morphophysiological information based on 11 traits and with simple-sequence repeat (SSR marker information from 41 polymorphic markers for their ability to distinguish 11 alfalfa landraces representative of the germplasm from northern Italy. Three molecular criteria, one based on cultivar differences for individual SSR bands and two based on overall SNP marker variation assessed either by statistically significant cultivar differences on principal component axes or discriminant analysis, distinctly outperformed the morphophysiological criterion. Combining the morphophysiological criterion with either molecular marker method increased discrimination among cultivars, since morphophysiological diversity was unrelated to SSR marker-based diversity ( = 0.04 and poorly related to SNP marker-based diversity ( = 0.23, < 0.15. The criterion based on statistically significant SNP allele frequency differences was less discriminating than morphophysiological variation. Marker-based distinctness, which can be assessed at low cost and without interactions with testing conditions, could validly substitute for (or complement morphophysiological distinctness in alfalfa cultivar registration schemes. It also has interest in sui generis registration systems aimed at

  20. Genome wide characterization of simple sequence repeats in watermelon genome and their application in comparative mapping and genetic diversity analysis.

    Science.gov (United States)

    Zhu, Huayu; Song, Pengyao; Koo, Dal-Hoe; Guo, Luqin; Li, Yanman; Sun, Shouru; Weng, Yiqun; Yang, Luming

    2016-08-05

    Microsatellite markers are one of the most informative and versatile DNA-based markers used in plant genetic research, but their development has traditionally been difficult and costly. The whole genome sequencing with next-generation sequencing (NGS) technologies provides large amounts of sequence data to develop numerous microsatellite markers at whole genome scale. SSR markers have great advantage in cross-species comparisons and allow investigation of karyotype and genome evolution through highly efficient computation approaches such as in silico PCR. Here we described genome wide development and characterization of SSR markers in the watermelon (Citrullus lanatus) genome, which were then use in comparative analysis with two other important crop species in the Cucurbitaceae family: cucumber (Cucumis sativus L.) and melon (Cucumis melo L.). We further applied these markers in evaluating the genetic diversity and population structure in watermelon germplasm collections. A total of 39,523 microsatellite loci were identified from the watermelon draft genome with an overall density of 111 SSRs/Mbp, and 32,869 SSR primers were designed with suitable flanking sequences. The dinucleotide SSRs were the most common type representing 34.09 % of the total SSR loci and the AT-rich motifs were the most abundant in all nucleotide repeat types. In silico PCR analysis identified 832 and 925 SSR markers with each having a single amplicon in the cucumber and melon draft genome, respectively. Comparative analysis with these cross-species SSR markers revealed complicated mosaic patterns of syntenic blocks among the genomes of three species. In addition, genetic diversity analysis of 134 watermelon accessions with 32 highly informative SSR loci placed these lines into two groups with all accessions of C.lanatus var. citorides and three accessions of C. colocynthis clustered in one group and all accessions of C. lanatus var. lanatus and the remaining accessions of C. colocynthis

  1. Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

    Science.gov (United States)

    Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

    2013-06-01

    Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and

  2. Nucleotide sequence of the gene coding for human factor VII, a vitamin K-dependent protein participating in blood coagulation

    International Nuclear Information System (INIS)

    O'Hara, P.J.; Grant, F.J.; Haldeman, B.A.; Gray, C.L.; Insley, M.Y.; Hagen, F.S.; Murray, M.J.

    1987-01-01

    Activated factor VII (factor VIIa) is a vitamin K-dependent plasma serine protease that participates in a cascade of reactions leading to the coagulation of blood. Two overlapping genomic clones containing sequences encoding human factor VII were isolated and characterized. The complete sequence of the gene was determined and found to span about 12.8 kilobases. The mRNA for factor VII as demonstrated by cDNA cloning is polyadenylylated at multiple sites but contains only one AAUAAA poly(A) signal sequence. The mRNA can undergo alternative splicing, forming one transcript containing eight segments as exons and another with an additional exon that encodes a larger prepro leader sequence. The latter transcript has no known counterpart in the other vitamin K-dependent proteins. The positions of the introns with respect to the amino acid sequence encoded by the eight essential exons of factor VII are the same as those present in factor IX, factor X, protein C, and the first three exons of prothrombin. These exons code for domains generally conserved among members of this gene family. The comparable introns in these genes, however, are dissimilar with respect to size and sequence, with the exception of intron C in factor VII and protein C. The gene for factor VII also contains five regions made up of tandem repeats of oligonucleotide monomer elements. More than a quarter of the intron sequences and more than a third of the 3' untranslated portion of the mRNA transcript consist of these minisatellite tandem repeats

  3. Mason: a JavaScript web site widget for visualizing and comparing annotated features in nucleotide or protein sequences.

    Science.gov (United States)

    Jaschob, Daniel; Davis, Trisha N; Riffle, Michael

    2015-03-07

    Sequence feature annotations (e.g., protein domain boundaries, binding sites, and secondary structure predictions) are an essential part of biological research. Annotations are widely used by scientists during research and experimental design, and are frequently the result of biological studies. A generalized and simple means of disseminating and visualizing these data via the web would be of value to the research community. Mason is a web site widget designed to visualize and compare annotated features of one or more nucleotide or protein sequence. Annotated features may be of virtually any type, ranging from annotating transcription binding sites or exons and introns in DNA to secondary structure or domain boundaries in proteins. Mason is simple to use and easy to integrate into web sites. Mason has a highly dynamic and configurable interface supporting multiple sets of annotations per sequence, overlapping regions, customization of interface and user-driven events (e.g., clicks and text to appear for tooltips). It is written purely in JavaScript and SVG, requiring no 3(rd) party plugins or browser customization. Mason is a solution for dissemination of sequence annotation data on the web. It is highly flexible, customizable, simple to use, and is designed to be easily integrated into web sites. Mason is open source and freely available at https://github.com/yeastrc/mason.

  4. Biological characterization and complete nucleotide sequence of a Tunisian isolate of Moroccan watermelon mosaic virus.

    Science.gov (United States)

    Yakoubi, S; Desbiez, C; Fakhfakh, H; Wipf-Scheibel, C; Marrakchi, M; Lecoq, H

    2008-01-01

    During a survey conducted in October 2005, cucurbit leaf samples showing virus-like symptoms were collected from the major cucurbit-growing areas in Tunisia. DAS-ELISA showed the presence of Moroccan watermelon mosaic virus (MWMV, Potyvirus), detected for the first time in Tunisia, in samples from the region of Cap Bon (Northern Tunisia). MWMV isolate TN05-76 (MWMV-Tn) was characterized biologically and its full-length genome sequence was established. MWMV-Tn was found to have biological properties similar to those reported for the MWMV type strain from Morocco. Phylogenetic analysis including the comparison of complete amino-acid sequences of 42 potyviruses confirmed that MWMV-Tn is related (65% amino-acid sequence identity) to Papaya ringspot virus (PRSV) isolates but is a member of a distinct virus species. Sequence analysis on parts of the CP gene of MWMV isolates from different geographical origins revealed some geographic structure of MWMV variability, with three different clusters: one cluster including isolates from the Mediterranean region, a second including isolates from western and central Africa, and a third one including isolates from the southern part of Africa. A significant correlation was observed between geographic and genetic distances between isolates. Isolates from countries in the Mediterranean region where MWMV has recently emerged (France, Spain, Portugal) have highly conserved sequences, suggesting that they may have a common and recent origin. MWMV from Sudan, a highly divergent variant, may be considered an evolutionary intermediate between MWMV and PRSV.

  5. Length and repeat-sequence variation in 58 STRs and 94 SNPs in two Spanish populations.

    Science.gov (United States)

    Casals, Ferran; Anglada, Roger; Bonet, Núria; Rasal, Raquel; van der Gaag, Kristiaan J; Hoogenboom, Jerry; Solé-Morata, Neus; Comas, David; Calafell, Francesc

    2017-09-01

    We have genotyped the 58 STRs (27 autosomal, 24 Y-STRs and 7 X-STRs) and 94 autosomal SNPs in Illumina ForenSeq™ Primer Mix A in 88 Spanish Roma (Gypsy) samples and 143 Catalans. Since this platform is based in massive parallel sequencing, we have used simple R scripts to uncover the sequence variation in the repeat region. Thus, we have found, across 58 STRs, 541 length-based alleles, which, after considering repeat-sequence variation, became 804 different alleles. All loci in both populations were in Hardy-Weinberg equilibrium. F ST between both populations was 0.0178 for autosomal SNPs, 0.0146 for autosomal STRs, 0.0101 for X-STRs and 0.1866 for Y-STRs. Combined a priori statistics showed quite large; for instance, pooling all the autosomal loci, the a priori probabilities of discriminating a suspect become 1-(2.3×10 -70 ) and 1-(5.9×10 -73 ), for Roma and Catalans respectively, and the chances of excluding a false father in a trio are 1-(2.6×10 -20 ) and 1-(2.0×10 -21 ). Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Analysis of expressed sequence tags from Prunus mume flower and fruit and development of simple sequence repeat markers

    Directory of Open Access Journals (Sweden)

    Gao Zhihong

    2010-07-01

    Full Text Available Abstract Background Expressed Sequence Tag (EST has been a cost-effective tool in molecular biology and represents an abundant valuable resource for genome annotation, gene expression, and comparative genomics in plants. Results In this study, we constructed a cDNA library of Prunus mume flower and fruit, sequenced 10,123 clones of the library, and obtained 8,656 expressed sequence tag (EST sequences with high quality. The ESTs were assembled into 4,473 unigenes composed of 1,492 contigs and 2,981 singletons and that have been deposited in NCBI (accession IDs: GW868575 - GW873047, among which 1,294 unique ESTs were with known or putative functions. Furthermore, we found 1,233 putative simple sequence repeats (SSRs in the P. mume unigene dataset. We randomly tested 42 pairs of PCR primers flanking potential SSRs, and 14 pairs were identified as true-to-type SSR loci and could amplify polymorphic bands from 20 individual plants of P. mume. We further used the 14 EST-SSR primer pairs to test the transferability on peach and plum. The result showed that nearly 89% of the primer pairs produced target PCR bands in the two species. A high level of marker polymorphism was observed in the plum species (65% and low in the peach (46%, and the clustering analysis of the three species indicated that these SSR markers were useful in the evaluation of genetic relationships and diversity between and within the Prunus species. Conclusions We have constructed the first cDNA library of P. mume flower and fruit, and our data provide sets of molecular biology resources for P. mume and other Prunus species. These resources will be useful for further study such as genome annotation, new gene discovery, gene functional analysis, molecular breeding, evolution and comparative genomics between Prunus species.

  7. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. sequence evaluation and plastome evolution.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G

    2008-04-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.

  8. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution†

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.

    2008-01-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283

  9. Selection, Recombination and History in a Parasitic Flatworm (Echinococcus Inferred from Nucleotide Sequences

    Directory of Open Access Journals (Sweden)

    Haag KL

    1998-01-01

    Full Text Available Three species of flatworms from the genus Echinococcus (E. granulosus, E. multilocularis and E. vogeli and four strains of E. granulosus (cattle, horse, pig and sheep strains were analysed by the PCR-SSCP method followed by sequencing, using as targets two non-coding and two coding (one nuclear and one mitochondrial genomic regions. The sequencing data was used to evaluate hypothesis about the parasite breeding system and the causes of genetic diversification. The calculated recombination parameters suggested that cross-fertilisation was rare in the history of the group. However, the relative rates of substitution in the coding sequences showed that positive selection (instead of purifying selection drove the evolution of an elastase and neutrophil chemotaxis inhibitor gene (AgB/1. The phylogenetic analyses revealed several ambiguities, indicating that the taxonomic status of the E. granulosus horse strain should be revised

  10. Molecular cloning and nucleotide sequence of cDNA for human liver arginase

    International Nuclear Information System (INIS)

    Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.

    1987-01-01

    Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes

  11. Cloning, nucleotide sequence and transcriptional analysis of the uvrA gene from Neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Black, C.G.; Fyfe, J.A.M.; Davies, J.K.

    1997-01-01

    A recombinant plasmid capable of restoring UV resistance to an Escherichia coli uvrA mutant was isolated from a genomic library of Neisseria gonorrhoeae. Sequence analysis revealed an open reading frame whose deduced amino acid sequence displayed significant similarity to those of the UvrA proteins of other bacterial species. A second open reading frame (ORF259) was identified upstream from, and in the opposite orientation to the gonococcal uvrA gene. Transcriptional fusions between portions of the gonococcal uvrA upstream region and a reporter gene were used to localise promoter activity in both E. coli and N. gonorrhoeae. The transcriptional starting points of uvrA and ORF259 were mapped in E. coli by primer extension analysis, and corresponding σ 70 promoters were identified. The arrangement of the uvrA-ORF259 intergenic region is similar to that of the gonococcal recA-aroD intergenic region. Both contain inverted copies of the 10 bp neisserial DNA uptake sequence situated between divergently transcribed genes. However, there is no evidence that either the uptake sequence or the proximity of the promoters influences expression of these genes. (author)

  12. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  13. Symbolic complexity for nucleotide sequences: a sign of the genome structure

    International Nuclear Information System (INIS)

    Salgado-García, R; Ugalde, E

    2016-01-01

    We introduce a method for estimating the complexity function (which counts the number of observable words of a given length) of a finite symbolic sequence, which we use to estimate the complexity function of coding DNA sequences for several species of the Hominidae family. In all cases, the obtained symbolic complexities show the same characteristic behavior: exponential growth for small word lengths, followed by linear growth for larger word lengths. The symbolic complexities of the species we consider exhibit a systematic trend in correspondence with the phylogenetic tree. Using our method, we estimate the complexity function of sequences obtained by some known evolution models, and in some cases we observe the characteristic exponential-linear growth of the Hominidae coding DNA complexity. Analysis of the symbolic complexity of sequences obtained from a specific evolution model points to the following conclusion: linear growth arises from the random duplication of large segments during the evolution of the genome, while the decrease in the overall complexity from one species to another is due to a difference in the speed of accumulation of point mutations. (paper)

  14. Inter-simple sequence repeat (ISSR) loci mapping in the genome of perennial ryegrass

    DEFF Research Database (Denmark)

    Pivorienė, O; Pašakinskienė, I; Brazauskas, G

    2008-01-01

    The aim of this study was to identify and characterize new ISSR markers and their loci in the genome of perennial ryegrass. A subsample of the VrnA F2 mapping family of perennial ryegrass comprising 92 individuals was used to develop a linkage map including inter-simple sequence repeat markers...... demonstrated a 70% similarity to the Hordeum vulgare germin gene GerA. Inter-SSR mapping will provide useful information for gene targeting, quantitative trait loci mapping and marker-assisted selection in perennial ryegrass....

  15. Nucleotide sequence and taxonomy of Cycas necrotic stunt virus. Brief report.

    Science.gov (United States)

    Han, S S; Karasev, A V; Ieki, H; Iwanami, T

    2002-11-01

    Cycas necrotic stunt virus (CNSV) is the only well-characterized virus from gymnosperm. cDNA segments corresponding to the bipartite genome RNAs (RNA1, RNA2) were synthesized and sequenced. Each RNA encoded a single polyprotein, flanked by the 5' and 3' non-coding regions (NCR) and followed by a poly (A) tail. The putative polyproteins encoded by RNA1 and RNA2 had sets of motifs, which were characteristic of viruses in the genus Nepovirus. The polyproteins showed higher sequence identities to Artichoke Italian latent virus, Grapevine chrome mosaic virus and Tomato black ring virus, all of which belong to subgroup b of the genus Nepovirus, than to other nepoviruses. Phylogenetic analysis of RNA dependent RNA polymerase and coat protein also showed closer relationships with these viruses than other viruses. The data obtained supported the taxonomical status of CNSV as a definitive member of the genus Nepovirus, subgroup b.

  16. Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Budzanivska I. G.

    2014-03-01

    Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

  17. Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing.

    Science.gov (United States)

    Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard

    2015-09-01

    Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.

  18. Complete nucleotide sequences and virion particle association of two satellite RNAs of panicum mosaic virus.

    Science.gov (United States)

    Pyle, Jesse D; Monis, Judit; Scholthof, Karen-Beth

    2017-08-15

    Over six decades ago, panicum mosaic virus (PMV) was identified as the first viral pathogen of cultivated switchgrass (Panicum virgatum). Subsequently, PMV was demonstrated to support the replication of both a satellite RNA virus (SPMV) and satellite RNA (satRNA) agents during natural infections of host grasses. In this study, we report the isolation and full-length sequences of two PMV satRNAs identified in 1988 from St. Augustinegrass (Stenotaphrum secundatum) and centipedegrass (Eremochloa ophiuroides) hosts. Each of these satellites have sequence relatedness at their 5'- and 3'-ends. In addition, satC has a region of ∼100 nt complementary to the 3'-end of the PMV genome. These agents are associated with purified virions of SPMV infections. Additionally, satS and satC RNAs contain conserved in-frame open reading frames in the complementary-sense sequences that could potentially generate 6.6- and 7.9-kDa proteins, respectively. In protoplasts and plants satS is infectious, when co-inoculated with the PMV RNA alone or PMV+SPMV RNAs, and negatively affects their accumulation. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Molecular cloning, nucleotide sequence, and expression of the gene encoding human eosinophil differentiation factor (interleukin 5)

    International Nuclear Information System (INIS)

    Campbell, H.D.; Tucker, W.Q.J.; Hort, Y.; Martinson, M.E.; Mayo, G.; Clutterbuck, E.J.; Sanderson, C.J.; Young, I.G.

    1987-01-01

    The human eosinophil differentiation factor (EDF) gene was cloned from a genomic library in λ phage EMBL3A by using a murine EDF cDNA clone as a probe. The DNA sequence of a 3.2-kilobase BamHI fragment spanning the gene was determined. The gene contains three introns. The predicted amino acid sequence of 134 amino acids is identical with that recently reported for human interleukin 5 but shows no significant homology with other known hemopoietic growth regulators. The amino acid sequence shows strong homology (∼ 70% identity) with that of murine EDF. Recombinant human EDF, expressed from the human EDF gene after transfection into monkey COS cells, stimulated the production of eosinophils and eosinophil colonies from normal human bone marrow but had no effect on the production of neutrophils or mononuclear cells (monocytes and lymphoid cells). The apparent specificity of human EDF for the eosinophil lineage in myeloid hemopoiesis contrasts with the properties of human interleukin 3 and granulocyte/macrophage and granulocyte colony-stimulating factors but is directly analogous to the biological properties of murine EDF. Human EDF therefore represents a distinct hemopoietic growth factor that could play a central role in the regulation of eosinophilia

  20. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    Science.gov (United States)

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  1. Complete nucleotide sequences of a new bipartite begomovirus from Malvastrum sp. plants with bright yellow mosaic symptoms in South Texas.

    Science.gov (United States)

    Alabi, Olufemi J; Villegas, Cecilia; Gregg, Lori; Murray, K Daniel

    2016-06-01

    Two isolates of a novel bipartite begomovirus, tentatively named malvastrum bright yellow mosaic virus (MaBYMV), were molecularly characterized from naturally infected plants of the genus Malvastrum showing bright yellow mosaic disease symptoms in South Texas. Six complete DNA-A and five DNA-B genome sequences of MaBYMV obtained from the isolates ranged in length from 2,608 to 2,609 nucleotides (nt) and 2,578 to 2,605 nt, respectively. Both genome segments shared a 178- to 180-nt common region. In pairwise comparisons, the complete DNA-A and DNA-B sequences of MaBYMV were most similar (87-88 % and 79-81 % identity, respectively) and phylogenetically related to the corresponding sequences of sida mosaic Sinaloa virus-[MX-Gua-06]. Further analysis revealed that MaBYMV is a putative recombinant virus, thus supporting the notion that malvaceous hosts may be influencing the evolution of several begomoviruses. The design of new diagnostic primers enabled the detection of MaBYMV in cohorts of Bemisia tabaci collected from symptomatic Malvastrum sp. plants, thus implicating whiteflies as potential vectors of the virus.

  2. Sequence variations in C9orf72 downstream of the hexanucleotide repeat region and its effect on repeat-primed PCR interpretation

    DEFF Research Database (Denmark)

    Nordin, Angelica; Akimoto, Chizuru; Wuolikainen, Anna

    2017-01-01

    A large GGGGCC-repeat expansion mutation (HREM) in C9orf72 is the most common known cause of ALS and FTD in European populations. Sequence variations immediately downstream of the HREM region have previously been observed and have been suggested to be one reason for difficulties in interpreting R...

  3. Identification of apple cultivars on the basis of simple sequence repeat markers.

    Science.gov (United States)

    Liu, G S; Zhang, Y G; Tao, R; Fang, J G; Dai, H Y

    2014-09-12

    DNA markers are useful tools that play an important role in plant cultivar identification. They are usually based on polymerase chain reaction (PCR) and include simple sequence repeats (SSRs), inter-simple sequence repeats, and random amplified polymorphic DNA. However, DNA markers were not used effectively in the complete identification of plant cultivars because of the lack of known DNA fingerprints. Recently, a novel approach called the cultivar identification diagram (CID) strategy was developed to facilitate the use of DNA markers for separate plant individuals. The CID was designed whereby a polymorphic maker was generated from each PCR that directly allowed for cultivar sample separation at each step. Therefore, it could be used to identify cultivars and varieties easily with fewer primers. In this study, 60 apple cultivars, including a few main cultivars in fields and varieties from descendants (Fuji x Telamon) were examined. Of the 20 pairs of SSR primers screened, 8 pairs gave reproducible, polymorphic DNA amplification patterns. The banding patterns obtained from these 8 primers were used to construct a CID map. Each cultivar or variety in this study was distinguished from the others completely, indicating that this method can be used for efficient cultivar identification. The result contributed to studies on germplasm resources and the seedling industry in fruit trees.

  4. Genotyping and Molecular Identification of Date Palm Cultivars Using Inter-Simple Sequence Repeat (ISSR) Markers.

    Science.gov (United States)

    Ayesh, Basim M

    2017-01-01

    Molecular markers are credible for the discrimination of genotypes and estimation of the extent of genetic diversity and relatedness in a set of genotypes. Inter-simple sequence repeat (ISSR) markers rapidly reveal high polymorphic fingerprints and have been used frequently to determine the genetic diversity among date palm cultivars. This chapter describes the application of ISSR markers for genotyping of date palm cultivars. The application involves extraction of genomic DNA from the target cultivars with reliable quality and quantity. Subsequently the extracted DNA serves as a template for amplification of genomic regions flanked by inverted simple sequence repeats using a single primer. The similarity of each pair of samples is measured by calculating the number of mono- and polymorphic bands revealed by gel electrophoresis. Matrices constructed for similarity and genetic distance are used to build a phylogenetic tree and cluster analysis, to determine the molecular relatedness of cultivars. The protocol describes 3 out of 9 tested primers consistently amplified 31 loci in 6 date palm cultivars, with 28 polymorphic loci.

  5. The complete nucleotide sequence, genome organization, and origin of human adenovirus type 11

    International Nuclear Information System (INIS)

    Stone, Daniel; Furthmann, Anne; Sandig, Volker; Lieber, Andre

    2003-01-01

    The complete DNA sequence and transcription map of human adenovirus type 11 are reported here. This is the first published sequence for a subgenera B human adenovirus and demonstrates a genome organization highly similar to those of other human adenoviruses. All of the genes from the early, intermediate, and late regions are present in the expected locations of the genome for a human adenovirus. The genome size is 34,794 bp in length and has a GC content of 48.9%. Sequence alignment with genomes of groups A (Ad12), C (Ad5), D (Ad17), E (Simian adenovirus 25), and F (Ad40) revealed homologies of 64, 54, 68, 75, and 52%, respectively. Detailed genomic analysis demonstrated that Ads 11 and 35 are highly conserved in all areas except the hexon hypervariable regions and fiber. Similarly, comparison of Ad11 with subgroup E SAV25 revealed poor homology between fibers but high homology in proteins encoded by all other areas of the genome. We propose an evolutionary model in which functional viruses can be reconstituted following fiber substitution from one serotype to another. According to this model either the Ad11 genome is a derivative of Ad35, from which the fiber was substituted with Ad7, or the Ad35 genome is the product of a fiber substitution from Ad21 into the Ad11 genome. This model also provides a possible explanation for the origin of group E Ads, which are evolutionarily derived from a group C fiber substitution into a group B genome

  6. Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

    Science.gov (United States)

    Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

  7. The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

    Science.gov (United States)

    Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

    1982-11-11

    The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

  8. Appendix: a solution hybridization assay to detect radioactive globin messenger RNA nucleotide sequences

    Energy Technology Data Exchange (ETDEWEB)

    Ross, J

    1976-09-15

    In view of the sensitivity and specificity of the solution hybridization assay for unlabeled globin mRNA a similar technique has been devised to detect radioactive globin mRNA sequences with unlabeled globin cDNA. Several properties of the hybridization reaction are presented since RNA kinetic experiments reported recently depend on the validity of this assay. Data on hybridization analysis of (/sup 3/H)RNA from mouse fetal liver or erythroleukemia cell cytoplasm are presented. These data indicate that the excess cDNA solution assay for radioactive globin mRNA detection is specific for globin mRNA sequences. It can be performed rapidly and is highly reproducible from experiment. It is at least 500-fold less sensitive than the assay for unlabeled globin mRNA, due to the RNAase backgrounds of 0.05 to 0.15 %. However, this limitation has not affected kinetic experiments with non-dividing fetal liver erythroid cells, which synthesize relatively large quantities of globin mRNA.

  9. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S; Drusiani, E; Battini, R; Fregni, M

    1988-01-11

    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  10. Identification and nucleotide sequence of the thymidine kinase gene of Shope fibroma virus

    International Nuclear Information System (INIS)

    Upton, C.; McFadden, G.

    1986-01-01

    The thymidine kinase (TK) gene of Shope fibroma virus (SFV), a tumorigenic leporipoxvirus, was localized within the viral genome with degenerate oligonucleotide probes. These probes were constructed to two regions of high sequence conservation between the vaccinia virus TK gene and those of several known eucaryotic cellular TK genes, including human, mouse, hamster, and chicken TK genes. The oligonucleotide probes initially localized the SFV TK gene 50 kilobases (kb) from the right terminus of the 160-kb SFV genome within the 9.5-kb BamHI-HindIII fragment E. Fine-mapping analysis indicated that the TK Gene was within a 1.2-kb AvaI-HaeIII fragment, and DNA sequencing of this region revealed an open reading frame capable of encoding a polypeptide of 187 amino acids possessing considerable homology to the TK genes of the vaccinia, variola, and monkeypox orthopoxviruses and also to a variety of cellular TK genes. Homology matrix analysis and homology scores suggest that the SFV TK gene has diverged significantly from its counterpart members in the orthopoxvirus genus. Nevertheless, the presence of conserved upstream open reading frames on the 5' side of all of the poxvirus TK genes indicates a similarity of functional organization between the orthopoxviruses and leporipoxviruses. These data suggest a common ancestral origin for at least some of the unique internal regions of the leporipoxviruses and orthopoxviruses as exemplified by SFV and vaccinia virus, respectively

  11. Mechanisms of haplotype divergence at the RGA08 nucleotide-binding leucine-rich repeat gene locus in wild banana (Musa balbisiana).

    Science.gov (United States)

    Baurens, Franc-Christophe; Bocs, Stéphanie; Rouard, Mathieu; Matsumoto, Takashi; Miller, Robert N G; Rodier-Goud, Marguerite; MBéguié-A-MBéguié, Didier; Yahiaoui, Nabila

    2010-07-16

    Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M. balbisiana haplotypes. A

  12. Prunus necrotic ringspot ilarvirus: nucleotide sequence of RNA3 and the relationship to other ilarviruses based on coat protein comparison.

    Science.gov (United States)

    Guo, D; Maiss, E; Adam, G; Casper, R

    1995-05-01

    The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.

  13. The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

    Science.gov (United States)

    Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

    2009-01-01

    The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

  14. Molecular characterization of long direct repeat (LDR) sequences expressing a stable mRNA encoding for a 35-amino-acid cell-killing peptide and a cis-encoded small antisense RNA in Escherichia coli.

    Science.gov (United States)

    Kawano, Mitsuoki; Oshima, Taku; Kasai, Hiroaki; Mori, Hirotada

    2002-07-01

    Genome sequence analyses of Escherichia coli K-12 revealed four copies of long repetitive elements. These sequences are designated as long direct repeat (LDR) sequences. Three of the repeats (LDR-A, -B, -C), each approximately 500 bp in length, are located as tandem repeats at 27.4 min on the genetic map. Another copy (LDR-D), 450 bp in length and nearly identical to LDR-A, -B and -C, is located at 79.7 min, a position that is directly opposite the position of LDR-A, -B and -C. In this study, we demonstrate that LDR-D encodes a 35-amino-acid peptide, LdrD, the overexpression of which causes rapid cell killing and nucleoid condensation of the host cell. Northern blot and primer extension analysis showed constitutive transcription of a stable mRNA (approximately 370 nucleotides) encoding LdrD and an unstable cis-encoded antisense RNA (approximately 60 nucleotides), which functions as a trans-acting regulator of ldrD translation. We propose that LDR encodes a toxin-antitoxin module. LDR-homologous sequences are not pre-sent on any known plasmids but are conserved in Salmonella and other enterobacterial species.

  15. Genome-Wide Analysis of Simple Sequence Repeats in Bitter Gourd (Momordica charantia

    Directory of Open Access Journals (Sweden)

    Junjie Cui

    2017-06-01

    Full Text Available Bitter gourd (Momordica charantia is widely cultivated as a vegetable and medicinal herb in many Asian and African countries. After the sequencing of the cucumber (Cucumis sativus, watermelon (Citrullus lanatus, and melon (Cucumis melo genomes, bitter gourd became the fourth cucurbit species whose whole genome was sequenced. However, a comprehensive analysis of simple sequence repeats (SSRs in bitter gourd, including a comparison with the three aforementioned cucurbit species has not yet been published. Here, we identified a total of 188,091 and 167,160 SSR motifs in the genomes of the bitter gourd lines ‘Dali-11’ and ‘OHB3-1,’ respectively. Subsequently, the SSR content, motif lengths, and classified motif types were characterized for the bitter gourd genomes and compared among all the cucurbit genomes. Lastly, a large set of 138,727 unique in silico SSR primer pairs were designed for bitter gourd. Among these, 71 primers were selected, all of which successfully amplified SSRs from the two bitter gourd lines ‘Dali-11’ and ‘K44’. To further examine the utilization of unique SSR primers, 21 SSR markers were used to genotype a collection of 211 bitter gourd lines from all over the world. A model-based clustering method and phylogenetic analysis indicated a clear separation among the geographic groups. The genomic SSR markers developed in this study have considerable potential value in advancing bitter gourd research.

  16. The R package otu2ot for implementing the entropy decomposition of nucleotide variation in sequence data

    Directory of Open Access Journals (Sweden)

    Alban eRamette

    2014-11-01

    Full Text Available Oligotyping is a novel, supervised computational method that classifies closely related sequences into oligotypes (OTs based on subtle nucleotide variations (Eren et al. 2013. Its application to microbial datasets has helped reveal ecological patterns which are often hidden by the way sequence data are currently clustered to define operational taxonomic units (OTUs. Here, we implemented the OT entropy decomposition procedure and its unsupervised version, Minimal Entropy Decomposition (MED; Eren et al. 2014, in the statistical programming language and environment, R. The aims are to facilitate the integration of computational routines, interactive statistical analyses, and visualization into a single framework. In addition, two complementary approaches are implemented: 1 An analytical method (the broken stick model is proposed to help identify oligotypes of low abundance that could be generated by chance alone and 2 a one-pass profiling (OP method, to efficiently identify those OTUs whose subsequent oligotyping would be most promising. These enhancements are especially useful for large datasets, where a manual screening of entropy analysis results and the creation of a full set of OTs may not be feasible. The package and procedures are illustrated by several tutorials and examples.

  17. Nucleotide sequence of the coat protein gene of Lettuce big-vein virus.

    Science.gov (United States)

    Sasaya, T; Ishikawa, K; Koganezawa, H

    2001-06-01

    A sequence of 1425 nt was established that included the complete coat protein (CP) gene of Lettuce big-vein virus (LBVV). The LBVV CP gene encodes a 397 amino acid protein with a predicted M(r) of 44486. Antisera raised against synthetic peptides corresponding to N-terminal or C-terminal parts of the LBVV CP reacted in Western blot analysis with a protein with an M(r) of about 48000. RNA extracted from purified particles of LBVV by using proteinase K, SDS and phenol migrated in gels as two single-stranded RNA species of approximately 7.3 kb (ss-1) and 6.6 kb (ss-2). After denaturation by heat and annealing at room temperature, the RNA migrated as four species, ss-1, ss-2 and two additional double-stranded RNAs (ds-1 and ds-2). The Northern blot hybridization analysis using riboprobes from a full-length clone of the LBVV CP gene indicated that ss-2 has a negative-sense nature and contains the LBVV CP gene. Moreover, ds-2 is a double-stranded form of ss-2. Database searches showed that the LBVV CP most resembled the nucleocapsid proteins of rhabdoviruses. These results indicate that it would be appropriate to classify LBVV as a negative-sense single-stranded RNA virus rather than as a double-stranded RNA virus.

  18. Striking structural dynamism and nucleotide sequence variation of the transposon Galileo in the genome of Drosophila mojavensis.

    Science.gov (United States)

    Marzo, Mar; Bello, Xabier; Puig, Marta; Maside, Xulio; Ruiz, Alfredo

    2013-02-04

    Galileo is a transposable element responsible for the generation of three chromosomal inversions in natural populations of Drosophila buzzatii. Although the most characteristic feature of Galileo is the long internally-repetitive terminal inverted repeats (TIRs), which resemble the Drosophila Foldback element, its transposase-coding sequence has led to its classification as a member of the P-element superfamily (Class II, subclass 1, TIR order). Furthermore, Galileo has a wide distribution in the genus Drosophila, since it has been found in 6 of the 12 Drosophila sequenced genomes. Among these species, D. mojavensis, the one closest to D. buzzatii, presented the highest diversity in sequence and structure of Galileo elements. In the present work, we carried out a thorough search and annotation of all the Galileo copies present in the D. mojavensis sequenced genome. In our set of 170 Galileo copies we have detected 5 Galileo subfamilies (C, D, E, F, and X) with different structures ranging from nearly complete, to only 2 TIR or solo TIR copies. Finally, we have explored the structural and length variation of the Galileo copies that point out the relatively frequent rearrangements within and between Galileo elements. Different mechanisms responsible for these rearrangements are discussed. Although Galileo is a transposable element with an ancient history in the D. mojavensis genome, our data indicate a recent transpositional activity. Furthermore, the dynamism in sequence and structure, mainly affecting the TIRs, suggests an active exchange of sequences among the copies. This exchange could lead to new subfamilies of the transposon, which could be crucial for the long-term survival of the element in the genome.

  19. Analysis of simple sequence repeats in rice bean (Vigna umbellata using an SSR-enriched library

    Directory of Open Access Journals (Sweden)

    Lixia Wang

    2016-02-01

    Full Text Available Rice bean (Vigna umbellata Thunb., a warm-season annual legume, is grown in Asia mainly for dried grain or fodder and plays an important role in human and animal nutrition because the grains are rich in protein and some essential fatty acids and minerals. With the aim of expediting the genetic improvement of rice bean, we initiated a project to develop genomic resources and tools for molecular breeding in this little-known but important crop. Here we report the construction of an SSR-enriched genomic library from DNA extracted from pooled young leaf tissues of 22 rice bean genotypes and developing SSR markers. In 433,562 reads generated by a Roche 454 GS-FLX sequencer, we identified 261,458 SSRs, of which 48.8% were of compound form. Dinucleotide repeats were predominant with an absolute proportion of 81.6%, followed by trinucleotides (17.8%. Other types together accounted for 0.6%. The motif AC/GT accounted for 77.7% of the total, followed by AAG/CTT (14.3%, and all others accounted for 12.0%. Among the flanking sequences, 2928 matched putative genes or gene models in the protein database of Arabidopsis thaliana, corresponding with 608 non-redundant Gene Ontology terms. Of these sequences, 11.2% were involved in cellular components, 24.2% were involved molecular functions, and 64.6% were associated with biological processes. Based on homolog analysis, 1595 flanking sequences were similar to mung bean and 500 to common bean genomic sequences. Comparative mapping was conducted using 350 sequences homologous to both mung bean and common bean sequences. Finally, a set of primer pairs were designed, and a validation test showed that 58 of 220 new primers can be used in rice bean and 53 can be transferred to mung bean. However, only 11 were polymorphic when tested on 32 rice bean varieties. We propose that this study lays the groundwork for developing novel SSR markers and will enhance the mapping of qualitative and quantitative traits and marker

  20. Genome-Wide Analysis of Simple Sequence Repeats and Efficient Development of Polymorphic SSR Markers Based on Whole Genome Re-Sequencing of Multiple Isolates of the Wheat Stripe Rust Fungus.

    Directory of Open Access Journals (Sweden)

    Huaiyong Luo

    Full Text Available The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.

  1. Genome-Wide Analysis of Simple Sequence Repeats and Efficient Development of Polymorphic SSR Markers Based on Whole Genome Re-Sequencing of Multiple Isolates of the Wheat Stripe Rust Fungus.

    Science.gov (United States)

    Luo, Huaiyong; Wang, Xiaojie; Zhan, Gangming; Wei, Guorong; Zhou, Xinli; Zhao, Jing; Huang, Lili; Kang, Zhensheng

    2015-01-01

    The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst) causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs) are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.

  2. Polyadenylation of RNA transcribed from mammalian SINEs by RNA polymerase III: Complex requirements for nucleotide sequences.

    Science.gov (United States)

    Borodulina, Olga R; Golubchikova, Julia S; Ustyantsev, Ilia G; Kramerov, Dmitri A

    2016-02-01

    It is generally accepted that only transcripts synthesized by RNA polymerase II (e.g., mRNA) were subject to AAUAAA-dependent polyadenylation. However, we previously showed that RNA transcribed by RNA polymerase III (pol III) from mouse B2 SINE could be polyadenylated in an AAUAAA-dependent manner. Many species of mammalian SINEs end with the pol III transcriptional terminator (TTTTT) and contain hexamers AATAAA in their A-rich tail. Such SINEs were united into Class T(+), whereas SINEs lacking the terminator and AATAAA sequences were classified as T(-). Here we studied the structural features of SINE pol III transcripts that are necessary for their polyadenylation. Eight and six SINE families from classes T(+) and T(-), respectively, were analyzed. The replacement of AATAAA with AACAAA in T(+) SINEs abolished the RNA polyadenylation. Interestingly, insertion of the polyadenylation signal (AATAAA) and pol III transcription terminator in T(-) SINEs did not result in polyadenylation. The detailed analysis of three T(+) SINEs (B2, DIP, and VES) revealed areas important for the polyadenylation of their pol III transcripts: the polyadenylation signal and terminator in A-rich tail, β region positioned immediately downstream of the box B of pol III promoter, and τ region located upstream of the tail. In DIP and VES (but not in B2), the τ region is a polypyrimidine motif which is also characteristic of many other T(+) SINEs. Most likely, SINEs of different mammals acquired these structural features independently as a result of parallel evolution. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Effects of loading sequences and size of repeated stress block of loads on fatigue life calculated using fatigue functions

    International Nuclear Information System (INIS)

    Schott, G.

    1989-01-01

    It is well-known that collective form, stress intensity and loading sequence of individual stresses as well as size of repeated stress blocks can influence fatigue life, significantly. The basic variant of the consecutive Woehler curve concept will permit these effects to be involved into fatigue life computation. The paper presented will demonstrate that fatigue life computations using fatigue functions reflect the loading sequence effect with multilevel loading precisely and provide reliable fatigue life data. Effects of size of repeated stress block and loading sequence on fatigue life as observed with block program tests can be reproduced using the new computation method. (orig.) [de

  4. A survey of endogenous retrovirus (ERV) sequences in the vicinity of multiple sclerosis (MS)-associated single nucleotide polymorphisms (SNPs).

    Science.gov (United States)

    Brütting, Christine; Emmer, Alexander; Kornhuber, Malte; Staege, Martin S

    2016-08-01

    Although multiple sclerosis (MS) is one of the most common central nervous system diseases in young adults, little is known about its etiology. Several human endogenous retroviruses (ERVs) are considered to play a role in MS. We are interested in which ERVs can be identified in the vicinity of MS associated genetic marker to find potential initiators of MS. We analysed the chromosomal regions surrounding 58 single nucleotide polymorphisms (SNPs) that are associated with MS identified in one of the last major genome wide association studies. We scanned these regions for putative endogenous retrovirus sequences with large open reading frames (ORFs). We observed that more retrovirus-related putative ORFs exist in the relatively close vicinity of SNP marker indices in multiple sclerosis compared to control SNPs. We found very high homologies to HERV-K, HCML-ARV, XMRV, Galidia ERV, HERV-H/env62 and XMRV-like mouse endogenous retrovirus mERV-XL. The associated genes (CYP27B1, CD6, CD58, MPV17L2, IL12RB1, CXCR5, PTGER4, TAGAP, TYK2, ICAM3, CD86, GALC, GPR65 as well as the HLA DRB1*1501) are mainly involved in the immune system, but also in vitamin D regulation. The most frequently detected ERV sequences are related to the multiple sclerosis-associated retrovirus, the human immunodeficiency virus 1, HERV-K, and the Simian foamy virus. Our data shows that there is a relation between MS associated SNPs and the number of retroviral elements compared to control. Our data identifies new ERV sequences that have not been associated with MS, so far.

  5. The First Molecular Identification of an Olive Collection Applying Standard Simple Sequence Repeats and Novel Expressed Sequence Tag Markers.

    Science.gov (United States)

    Mousavi, Soraya; Mariotti, Roberto; Regni, Luca; Nasini, Luigi; Bufacchi, Marina; Pandolfi, Saverio; Baldoni, Luciana; Proietti, Primo

    2017-01-01

    Germplasm collections of tree crop species represent fundamental tools for conservation of diversity and key steps for its characterization and evaluation. For the olive tree, several collections were created all over the world, but only few of them have been fully characterized and molecularly identified. The olive collection of Perugia University (UNIPG), established in the years' 60, represents one of the first attempts to gather and safeguard olive diversity, keeping together cultivars from different countries. In the present study, a set of 370 olive trees previously uncharacterized was screened with 10 standard simple sequence repeats (SSRs) and nine new EST-SSR markers, to correctly and thoroughly identify all genotypes, verify their representativeness of the entire cultivated olive variation, and validate the effectiveness of new markers in comparison to standard genotyping tools. The SSR analysis revealed the presence of 59 genotypes, corresponding to 72 well known cultivars, 13 of them resulting exclusively present in this collection. The new EST-SSRs have shown values of diversity parameters quite similar to those of best standard SSRs. When compared to hundreds of Mediterranean cultivars, the UNIPG olive accessions were splitted into the three main populations (East, Center and West Mediterranean), confirming that the collection has a good representativeness of the entire olive variability. Furthermore, Bayesian analysis, performed on the 59 genotypes of the collection by the use of both sets of markers, have demonstrated their splitting into four clusters, with a well balanced membership obtained by EST respect to standard SSRs. The new OLEST ( Olea expressed sequence tags) SSR markers resulted as effective as the best standard markers. The information obtained from this study represents a high valuable tool for ex situ conservation and management of olive genetic resources, useful to build a common database from worldwide olive cultivar collections

  6. Phylogenetic analysis of Gossypium L. using restriction fragment length polymorphism of repeated sequences.

    Science.gov (United States)

    Zhang, Meiping; Rong, Ying; Lee, Mi-Kyung; Zhang, Yang; Stelly, David M; Zhang, Hong-Bin

    2015-10-01

    Cotton is the world's leading textile fiber crop and is also grown as a bioenergy and food crop. Knowledge of the phylogeny of closely related species and the genome origin and evolution of polyploid species is significant for advanced genomics research and breeding. We have reconstructed the phylogeny of the cotton genus, Gossypium L., and deciphered the genome origin and evolution of its five polyploid species by restriction fragment analysis of repeated sequences. Nuclear DNA of 84 accessions representing 35 species and all eight genomes of the genus were analyzed. The phylogenetic tree of the genus was reconstructed using the parsimony method on 1033 polymorphic repeated sequence restriction fragments. The genome origin of its polyploids was determined by calculating the diploid-polyploid restriction fragment correspondence (RFC). The tree is consistent with the morphological classification, genome designation and geographic distribution of the species at subgenus, section and subsection levels. Gossypium lobatum (D7) was unambiguously shown to have the highest RFC with the D-subgenomes of all five polyploids of the genus, while the common ancestor of Gossypium herbaceum (A1) and Gossypium arboreum (A2) likely contributed to the A-subgenomes of the polyploids. These results provide a comprehensive phylogenetic tree of the cotton genus and new insights into the genome origin and evolution of its polyploid species. The results also further demonstrate a simple, rapid and inexpensive method suitable for phylogenetic analysis of closely related species, especially congeneric species, and the inference of genome origin of polyploids that constitute over 70 % of flowering plants.

  7. Genome-wide identification and validation of simple sequence repeats (SSRs) from Asparagus officinalis.

    Science.gov (United States)

    Li, Shufen; Zhang, Guojun; Li, Xu; Wang, Lianjun; Yuan, Jinhong; Deng, Chuanliang; Gao, Wujun

    2016-06-01

    Garden asparagus (Asparagus officinalis), an important vegetable cultivated worldwide, can also serve as a model dioecious plant species in the study of sex determination and sex chromosome evolution. However, limited DNA marker resources have been developed and used for this species. To expand these resources, we examined the DNA sequences for simple sequence repeats (SSRs) in 163,406 scaffolds representing approximately 400 Mbp of the A. officinalis genome. A total of 87,576 SSRs were identified in 59,565 scaffolds. The most abundant SSR repeats were trinucleotide and tetranucleotide, accounting for 29.2 and 29.1% of the total SSRs, respectively, followed by di-, penta-, hexa-, hepta-, and octanucleotides. The AG motif was most common among dinucleotides and was also the most frequent motif in the entire A. officinalis genome, representing 14.7% of all SSRs. A total of 41,917 SSR primers pairs were designed to amplify SSRs. Twenty-two genomic SSR markers were tested in 39 asparagus accessions belonging to ten cultivars and one accession of Asparagus setaceus for determination of genetic diversity. The intra-species polymorphism information content (PIC) values of the 22 genomic SSR markers were intermediate, with an average of 0.41. The genetic diversity between the ten A. officinalis cultivars was low, and the UPGMA dendrogram was largely unrelated to cultivars. It is here suggested that the sex of individuals is an important factor influencing the clustering results. The information reported here provides new information about the organization of the microsatellites in A. officinalis genome and lays a foundation for further genetic studies and breeding applications of A. officinalis and related species. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Rhoptry-associated protein (rap-1) genes in the sheep pathogen Babesia sp. Xinjiang: Multiple transcribed copies differing by 3' end repeated sequences.

    Science.gov (United States)

    Niu, Qingli; Marchand, Jordan; Yang, Congshan; Bonsergent, Claire; Guan, Guiquan; Yin, Hong; Malandrin, Laurence

    2015-07-30

    Sheep babesiosis occurs mainly in tropical and subtropical areas. The sheep parasite Babesia sp. Xinjiang is widespread in China, and our goal is to characterize rap-1 (rhoptry-associated protein 1) gene diversity and expression as a first step of a long term goal aiming at developing a recombinant subunit vaccine. Seven different rap-1a genes were amplified in Babesia sp. Xinjiang, using degenerate primers designed from conserved motifs. Rap-1b and rap-1c gene types could not be identified. In all seven rap-1a genes, the 5' regions exhibited identical sequences over 936 nt, and the 3' regions differed at 28 positions over 147 nt, defining two types of genes designated α and β. The remaining 3' part varied from 72 to 360 nt in length, depending on the gene. This region consists of a succession of two to ten 36 nt repeats, which explains the size differences. Even if the nucleotide sequences varied, 6 repeats encoded the same stretch of amino acids. Transcription of at least four α and two β genes was demonstrated by standard RT-PCR. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. The Saccharomyces cerevisiae RAD18 gene encodes a protein that contains potential zinc finger domains for nucleic acid binding and a putative nucleotide binding sequence

    Energy Technology Data Exchange (ETDEWEB)

    Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))

    1988-07-25

    The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.

  10. Identities among actin-encoding cDNAs of the Nile tilapia (Oreochromis niloticus and other eukaryote species revealed by nucleotide and amino acid sequence analyses

    Directory of Open Access Journals (Sweden)

    Andréia B. Poletto

    2008-01-01

    Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.

  11. Low-pass shotgun sequencing of the barley genome facilitates rapid identification of genes, conserved non-coding sequences and novel repeats

    Directory of Open Access Journals (Sweden)

    Graner Andreas

    2008-10-01

    Full Text Available Abstract Background Barley has one of the largest and most complex genomes of all economically important food crops. The rise of new short read sequencing technologies such as Illumina/Solexa permits such large genomes to be effectively sampled at relatively low cost. Based on the corresponding sequence reads a Mathematically Defined Repeat (MDR index can be generated to map repetitive regions in genomic sequences. Results We have generated 574 Mbp of Illumina/Solexa sequences from barley total genomic DNA, representing about 10% of a genome equivalent. From these sequences we generated an MDR index which was then used to identify and mark repetitive regions in the barley genome. Comparison of the MDR plots with expert repeat annotation drawing on the information already available for known repetitive elements revealed a significant correspondence between the two methods. MDR-based annotation allowed for the identification of dozens of novel repeat sequences, though, which were not recognised by hand-annotation. The MDR data was also used to identify gene-containing regions by masking of repetitive sequences in eight de-novo sequenced bacterial artificial chromosome (BAC clones. For half of the identified candidate gene islands indeed gene sequences could be identified. MDR data were only of limited use, when mapped on genomic sequences from the closely related species Triticum monococcum as only a fraction of the repetitive sequences was recognised. Conclusion An MDR index for barley, which was obtained by whole-genome Illumina/Solexa sequencing, proved as efficient in repeat identification as manual expert annotation. Circumventing the labour-intensive step of producing a specific repeat library for expert annotation, an MDR index provides an elegant and efficient resource for the identification of repetitive and low-copy (i.e. potentially gene-containing sequences regions in uncharacterised genomic sequences. The restriction that a particular

  12. The wheat homolog of putative nucleotide-binding site-leucine-rich repeat resistance gene TaRGA contributes to resistance against powdery mildew.

    Science.gov (United States)

    Wang, Defu; Wang, Xiaobing; Mei, Yu; Dong, Hansong

    2016-03-01

    Powdery mildew, one of the most destructive wheat diseases worldwide, is caused by Blumeria graminis f. sp. tritici (Bgt), a fungal species with a consistently high mutation rate that makes individual resistance (R) genes ineffective. Therefore, effective resistance-related gene cloning is vital for breeding and studying the resistance mechanisms of the disease. In this study, a putative nucleotide-binding site-leucine-rich repeat (NBS-LRR) R gene (TaRGA) was cloned using a homology-based cloning strategy and analyzed for its effect on powdery mildew disease and wheat defense responses. Real-time reverse transcription-PCR (RT-PCR) analyses revealed that a Bgt isolate 15 and salicylic acid stimulation significantly induced TaRGA in the resistant variety. Furthermore, the silencing of TaRGA in powdery mildew-resistant plants increased susceptibility to Bgt15 and prompted conidia propagation at the infection site. However, the expression of TaRGA in leaf segments after single-cell transient expression assay highly increased the defense responses to Bgt15 by enhancing callose deposition and phenolic autofluorogen accumulation at the pathogen invading sites. Meanwhile, the expression of pathogenesis-related genes decreased in the TaRGA-silenced plants and increased in the TaRGA-transient-overexpressing leaf segments. These results implied that the TaRGA gene positively regulates the defense response to powdery mildew disease in wheat.

  13. Nucleotide sequence analyses of genomic RNAs of peanut stunt virus Mi, the type strain representative of a novel PSV subgroup from China

    NARCIS (Netherlands)

    Yan, L.; Xu, Z.; Goldbach, R.W.; Chen, Y.K.; Prins, M.W.

    2005-01-01

    The complete nucleotide sequence of Peanut stunt virus strain Mi (PSV-Mi) from China was determined and compared to other viruses of the genus Cucumovirus. The tripartite genome of PSV-Mi encoded five open reading frames (ORFs) typical of cucumoviruses. Distance analyses of four ORFs indicated that

  14. Nucleotide Sequence and Analysis of an orotate transporter-containing plasmid isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410

    DEFF Research Database (Denmark)

    Defoor, Els Marie Celine; Martinussen, Jan

    A new lactococcal plasmid, pDBORO, was isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410 responsible for the sensitivity of DB0410 towards the pyrimidine-analog 5´-fluoroorotate. The plasmid pDBORO amounts to 16404 bp and its complete nucleotide sequence has been...

  15. Simple sequence repeat markers useful for sorghum downy mildew (Peronosclerospora sorghi and related species

    Directory of Open Access Journals (Sweden)

    Odvody Gary N

    2008-11-01

    Full Text Available Abstract Background A recent outbreak of sorghum downy mildew in Texas has led to the discovery of both metalaxyl resistance and a new pathotype in the causal organism, Peronosclerospora sorghi. These observations and the difficulty in resolving among phylogenetically related downy mildew pathogens dramatically point out the need for simply scored markers in order to differentiate among isolates and species, and to study the population structure within these obligate oomycetes. Here we present the initial results from the use of a biotin capture method to discover, clone and develop PCR primers that permit the use of simple sequence repeats (microsatellites to detect differences at the DNA level. Results Among the 55 primers pairs designed from clones from pathotype 3 of P. sorghi, 36 flanked microsatellite loci containing simple repeats, including 28 (55% with dinucleotide repeats and 6 (11% with trinucleotide repeats. A total of 22 microsatellites with CA/AC or GT/TG repeats were the most abundant (40% and GA/AG or CT/TC types contribute 15% in our collection. When used to amplify DNA from 19 isolates from P. sorghi, as well as from 5 related species that cause downy mildew on other hosts, the number of different bands detected for each SSR primer pair using a LI-COR- DNA Analyzer ranged from two to eight. Successful cross-amplification for 12 primer pairs studied in detail using DNA from downy mildews that attack maize (P. maydis & P. philippinensis, sugar cane (P. sacchari, pearl millet (Sclerospora graminicola and rose (Peronospora sparsa indicate that the flanking regions are conserved in all these species. A total of 15 SSR amplicons unique to P. philippinensis (one of the potential threats to US maize production were detected, and these have potential for development of diagnostic tests. A total of 260 alleles were obtained using 54 microsatellites primer combinations, with an average of 4.8 polymorphic markers per SSR across 34

  16. Simple sequence repeat markers useful for sorghum downy mildew (Peronosclerospora sorghi) and related species.

    Science.gov (United States)

    Perumal, Ramasamy; Nimmakayala, Padmavathi; Erattaimuthu, Saradha R; No, Eun-Gyu; Reddy, Umesh K; Prom, Louis K; Odvody, Gary N; Luster, Douglas G; Magill, Clint W

    2008-11-29

    A recent outbreak of sorghum downy mildew in Texas has led to the discovery of both metalaxyl resistance and a new pathotype in the causal organism, Peronosclerospora sorghi. These observations and the difficulty in resolving among phylogenetically related downy mildew pathogens dramatically point out the need for simply scored markers in order to differentiate among isolates and species, and to study the population structure within these obligate oomycetes. Here we present the initial results from the use of a biotin capture method to discover, clone and develop PCR primers that permit the use of simple sequence repeats (microsatellites) to detect differences at the DNA level. Among the 55 primers pairs designed from clones from pathotype 3 of P. sorghi, 36 flanked microsatellite loci containing simple repeats, including 28 (55%) with dinucleotide repeats and 6 (11%) with trinucleotide repeats. A total of 22 microsatellites with CA/AC or GT/TG repeats were the most abundant (40%) and GA/AG or CT/TC types contribute 15% in our collection. When used to amplify DNA from 19 isolates from P. sorghi, as well as from 5 related species that cause downy mildew on other hosts, the number of different bands detected for each SSR primer pair using a LI-COR- DNA Analyzer ranged from two to eight. Successful cross-amplification for 12 primer pairs studied in detail using DNA from downy mildews that attack maize (P. maydis & P. philippinensis), sugar cane (P. sacchari), pearl millet (Sclerospora graminicola) and rose (Peronospora sparsa) indicate that the flanking regions are conserved in all these species. A total of 15 SSR amplicons unique to P. philippinensis (one of the potential threats to US maize production) were detected, and these have potential for development of diagnostic tests. A total of 260 alleles were obtained using 54 microsatellites primer combinations, with an average of 4.8 polymorphic markers per SSR across 34 Peronosclerospora, Peronospora and Sclerospora

  17. A resource of genome-wide single-nucleotide polymorphisms generated by RAD tag sequencing in the critically endangered European eel

    DEFF Research Database (Denmark)

    Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.

    2013-01-01

    Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu...... 425 loci and 376 918 associated SNPs provides a valuable tool for future population genetics and genomics studies and allows for targeting specific genes and particularly interesting regions of the eel genome...

  18. Multiple Locus Variable-Number Tandem-Repeat and Single-Nucleotide Polymorphism-Based Brucella Typing Reveals Multiple Lineages in Brucella melitensis Currently Endemic in China

    Directory of Open Access Journals (Sweden)

    Mingjun Sun

    2017-12-01

    Full Text Available Brucellosis is a worldwide zoonotic disease caused by Brucella spp. In China, brucellosis is recognized as a reemerging disease mainly caused by Brucella melitensis specie. To better understand the currently endemic B. melitensis strains in China, three Brucella genotyping methods were applied to 110 B. melitensis strains obtained in past several years. By MLVA genotyping, five MLVA-8 genotypes were identified, among which genotypes 42 (1-5-3-13-2-2-3-2 was recognized as the predominant genotype, while genotype 63 (1-5-3-13-2-3-3-2 and a novel genotype of 1-5-3-13-2-4-3-2 were second frequently observed. MLVA-16 discerned a total of 57 MLVA-16 genotypes among these Brucella strains, with 41 genotypes being firstly detected and the other 16 genotypes being previously reported. By BruMLSA21 typing, six sequence types (STs were identified, among them ST8 is the most frequently seen in China while the other five STs were firstly detected and designated as ST137, ST138, ST139, ST140, and ST141 by international multilocus sequence typing database. Whole-genome sequence (WGS-single-nucleotide polymorphism (SNP-based typing and phylogenetic analysis resolved Chinese B. melitensis strains into five clusters, reflecting the existence of multiple lineages among these Chinese B. melitensis strains. In phylogeny, Chinese lineages are more closely related to strains collected from East Mediterranean and Middle East countries, such as Turkey, Kuwait, and Iraq. In the next few years, MLVA typing will certainly remain an important epidemiological tool for Brucella infection analysis, as it displays a high discriminatory ability and achieves result largely in agreement with WGS-SNP-based typing. However, WGS-SNP-based typing is found to be the most powerful and reliable method in discerning Brucella strains and will be popular used in the future.

  19. Creation and structure determination of an artificial protein with three complete sequence repeats

    Energy Technology Data Exchange (ETDEWEB)

    Adachi, Motoyasu, E-mail: adachi.motoyasu@jaea.go.jp; Shimizu, Rumi; Kuroki, Ryota [Japan Atomic Energy Agency, Shirakatashirane 2-4, Nakagun Tokaimura, Ibaraki 319-1195 (Japan); Blaber, Michael [Japan Atomic Energy Agency, Shirakatashirane 2-4, Nakagun Tokaimura, Ibaraki 319-1195 (Japan); Florida State University, Tallahassee, FL 32306-4300 (United States)

    2013-11-01

    An artificial protein with three complete sequence repeats was created and the structure was determined by X-ray crystallography. The structure showed threefold symmetry even though there is an amino- and carboxy-terminal. The artificial protein with threefold symmetry may be useful as a scaffold to capture small materials with C3 symmetry. Symfoil-4P is a de novo protein exhibiting the threefold symmetrical β-trefoil fold designed based on the human acidic fibroblast growth factor. First three asparagine–glycine sequences of Symfoil-4P are replaced with glutamine–glycine (Symfoil-QG) or serine–glycine (Symfoil-SG) sequences protecting from deamidation, and His-Symfoil-II was prepared by introducing a protease digestion site into Symfoil-QG so that Symfoil-II has three complete repeats after removal of the N-terminal histidine tag. The Symfoil-QG and SG and His-Symfoil-II proteins were expressed in Eschericha coli as soluble protein, and purified by nickel affinity chromatography. Symfoil-II was further purified by anion-exchange chromatography after removing the HisTag by proteolysis. Both Symfoil-QG and Symfoil-II were crystallized in 0.1 M Tris-HCl buffer (pH 7.0) containing 1.8 M ammonium sulfate as precipitant at 293 K; several crystal forms were observed for Symfoil-QG and II. The maximum diffraction of Symfoil-QG and II crystals were 1.5 and 1.1 Å resolution, respectively. The Symfoil-II without histidine tag diffracted better than Symfoil-QG with N-terminal histidine tag. Although the crystal packing of Symfoil-II is slightly different from Symfoil-QG and other crystals of Symfoil derivatives having the N-terminal histidine tag, the refined crystal structure of Symfoil-II showed pseudo-threefold symmetry as expected from other Symfoils. Since the removal of the unstructured N-terminal histidine tag did not affect the threefold structure of Symfoil, the improvement of diffraction quality of Symfoil-II may be caused by molecular characteristics of

  20. The complete chloroplast genome sequence of Mahonia bealei (Berberidaceae) reveals a significant expansion of the inverted repeat and phylogenetic relationship with other angiosperms.

    Science.gov (United States)

    Ma, Ji; Yang, Bingxian; Zhu, Wei; Sun, Lianli; Tian, Jingkui; Wang, Xumin

    2013-10-10

    Mahonia bealei (Berberidaceae) is a frequently-used traditional Chinese medicinal plant with efficient anti-inflammatory ability. This plant is one of the sources of berberine, a new cholesterol-lowering drug with anti-diabetic activity. We have sequenced the complete nucleotide sequence of the chloroplast (cp) genome of M. bealei. The complete cp genome of M. bealei is 164,792 bp in length, and has a typical structure with large (LSC 73,052 bp) and small (SSC 18,591 bp) single-copy regions separated by a pair of inverted repeats (IRs 36,501 bp) of large size. The Mahonia cp genome contains 111 unique genes and 39 genes are duplicated in the IR regions. The gene order and content of M. bealei are almost unarranged which is consistent with the hypothesis that large IRs stabilize cp genome and reduce gene loss-and-gain probabilities during evolutionary process. A large IR expansion of over 12 kb has occurred in M. bealei, 15 genes (rps19, rpl22, rps3, rpl16, rpl14, rps8, infA, rpl36, rps11, petD, petB, psbH, psbN, psbT and psbB) have expanded to have an additional copy in the IRs. The IR expansion rearrangement occurred via a double-strand DNA break and subsequence repair, which is different from the ordinary gene conversion mechanism. Repeat analysis identified 39 direct/inverted repeats 30 bp or longer with a sequence identity ≥ 90%. Analysis also revealed 75 simple sequence repeat (SSR) loci and almost all are composed of A or T, contributing to a distinct bias in base composition. Comparison of protein-coding sequences with ESTs reveals 9 putative RNA edits and 5 of them resulted in non-synonymous modifications in rpoC1, rps2, rps19 and ycf1. Phylogenetic analysis using maximum parsimony (MP) and maximum likelihood (ML) was performed on a dataset composed of 65 protein-coding genes from 25 taxa, which yields an identical tree topology as previous plastid-based trees, and provides strong support for the sister relationship between Ranunculaceae and Berberidaceae

  1. Genetic differentiation between fake abalone and genuine Haliotis species using the forensically informative nucleotide sequencing (FINS) method.

    Science.gov (United States)

    Ha, Wai Y; Reid, David G; Kam, Wan L; Lau, Yuk Y; Sham, Wing C; Tam, Silvia Y K; Sin, Della W M; Mok, Chuen S

    2011-05-25

    Abalones ( Haliotis species) are a popular delicacy and commonly preserved in dried form either whole or in slices or small pieces for consumption in Asian countries. Driven by the huge profit from trading abalones, dishonest traders may substitute other molluscan species for processed abalone, of which the morphological characteristics are frequently lost in the processed form. For protection of consumer rights and law enforcement against fraud, there is a need for an effective methodology to differentiate between fake and genuine abalone. This paper describes a method (validated according to the international forensic guidelines provided by SWGDAM) for the identification of fake abalone species using forensically informative nucleotide sequence (FINS) analysis. A study of the local market revealed that many claimed "abalone slice" samples on sale are not genuine. The fake abalone samples were found to be either volutids of the genus Cymbium (93%) or the muricid Concholepas concholepas (7%). This is the first report of Cymbium species being used for the preparation and sale as "abalone" in dried sliced form in Hong Kong.

  2. Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome.

    Directory of Open Access Journals (Sweden)

    Kei-ichi Morita

    Full Text Available Gorlin syndrome (GS is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs. In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals, whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.

  3. Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome.

    Science.gov (United States)

    Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki

    2015-01-01

    Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.

  4. The nucleotide sequence and a first generation gene transfer vector of species B human adenovirus serotype 3.

    Science.gov (United States)

    Sirena, Dominique; Ruzsics, Zsolt; Schaffner, Walter; Greber, Urs F; Hemmi, Silvio

    2005-12-20

    Human adenovirus (Ad) serotype 3 causes respiratory infections. It is considered highly virulent, accounting for about 13% of all Ad isolates. We report here the complete Ad3 DNA sequence of 35,343 base pairs (GenBank accession DQ086466). Ad3 shares 96.43% nucleotide identity with Ad7, another virulent subspecies B1 serotype, and 82.56 and 62.75% identity with the less virulent species B2 Ad11 and species C Ad5, respectively. The genomic organization of Ad3 is similar to the other human Ads comprising five early transcription units, E1A, E1B, E2, E3, and E4, two delayed early units IX and IVa2, and the major late unit, in total 39 putative and 7 hypothetical open reading frames. A recombinant E1-deleted Ad3 was generated on a bacterial artificial chromosome. This prototypic virus efficiently transduced CD46-positive rodent and human cells. Our results will help in clarifying the biology and pathology of adenoviruses and enhance therapeutic applications of viral vectors in clinical settings.

  5. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    Science.gov (United States)

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  6. High-resolution melting genotyping of Enterococcus faecium based on multilocus sequence typing derived single nucleotide polymorphisms.

    Directory of Open Access Journals (Sweden)

    Steven Y C Tong

    Full Text Available We have developed a single nucleotide polymorphism (SNP nucleated high-resolution melting (HRM technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE and an allele specific real-time PCR (AS kinetic PCR SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs and provides a Simpson's Index of Diversity (D of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.

  7. Single nucleotide polymorphism discovery via genotyping by sequencing to assess population genetic structure and recurrent polyploidization in Andropogon gerardii.

    Science.gov (United States)

    McAllister, Christine A; Miller, Allison J

    2016-07-01

    Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.

  8. Palindrome analyser - A new web-based server for predicting and evaluating inverted repeats in nucleotide sequences

    Czech Academy of Sciences Publication Activity Database

    Brázda, Václav; Kolomaznik, J.; Lysek, J.; Haroniková, Lucia; Coufal, Jan; Št'astný, J.

    2016-01-01

    Roč. 478, č. 4 (2016), s. 1739-1745 ISSN 0006-291X R&D Projects: GA ČR GA15-21855S Institutional support: RVO:68081707 Keywords : DNA TOPOLOGY * HUMAN GENOME * CRUCIFORM STRUCTURES Subject RIV: BO - Biophysics Impact factor: 2.466, year: 2016

  9. Genomic organization and developmental fate of adjacent repeated sequences in a foldback DNA clone of Tetrahymena thermophila

    International Nuclear Information System (INIS)

    Tschunko, A.H.; Loechel, R.H.; McLaren, N.C.; Allen, S.L.

    1987-01-01

    DNA sequence elimination and rearrangement occurs during the development of somatic cell lineages of eukaryotes and was first discovered over a century ago. However, the significance and mechanism of chromatin elimination are not understood. DNA elimination also occurs during the development of the somatic macronucleus from the germinal micronucleus in unicellular ciliated protozoa such as Tetrahymena thermophila. In this study foldback DNA from the micronucleus was used as a probe to isolate ten clones. All of those tested (4/4) contained sequences that were repetitive in the micronucleus and rearranged in the macronucleus. Inverted repeated sequences were present in one clone. This clone, pTtFBl, was subjected to a detailed analysis of its developmental fate. Subregions were subcloned and used as probes against Southern blots of micronuclear and macronuclear DNA. DNA was labeled with [ 33 P]-labeled dATP. The authors found that all subregions defined repeated sequence families in the micronuclear genome. A minimum of four different families was defined, two of which are retained in the macronucleus and two of which are completely eliminated. The inverted repeat family is retained with little rearrangement. Two of the families, defined by subregions that do not contain parts of the inverted repeat are totally eliminated during macronuclear development-and contain open reading frames. The significance of retained inverted repeats to the process of elimination is discussed

  10. Comparison of the degree of homology of DNA and quantity of repeated sequences in an intact plant and cell structure

    International Nuclear Information System (INIS)

    Solov'yan, V.T.; Kunaleh, V.A.; Shumnyl, V.K.; Vershinin, A.V.

    1986-01-01

    This paper attempts to assess the quantity of repeated sequences and degree of homology of DNA in the intact plant and two lines of callus tissue of Rauwolfia serpentina Benth maintained for 20 years, which differ among themselves in the level of biosynthesis of the pharmacologically valuable alkaloid ajmaline. The tritium-labeled repeats of plants and calli were used in direct and reverse hybridization on nitrocellulose filters. Hybridization of H 3-labeled repeats with phage 17 DNA was used as control. The radioactivity of filters after washing was measured in a liquid scintillation counter

  11. Repeated extragenic sequences in prokaryotic genomes: a proposal for the origin and dynamics of the RUP element in Streptococcus pneumoniae.

    Science.gov (United States)

    Oggioni, M R; Claverys, J P

    1999-10-01

    A survey of all Streptococcus pneumoniae GenBank/EMBL DNA sequence entries and of the public domain sequence (representing more than 90% of the genome) of an S. pneumoniae type 4 strain allowed identification of 108 copies of a 107-bp-long highly repeated intergenic element called RUP (for repeat unit of pneumococcus). Several features of the element, revealed in this study, led to the proposal that RUP is an insertion sequence (IS)-derivative that could still be mobile. Among these features are: (1) a highly significant homology between the terminal inverted repeats (IRs) of RUPs and of IS630-Spn1, a new putative IS of S. pneumoniae; and (2) insertion at a TA dinucleotide, a characteristic target of several members of the IS630 family. Trans-mobilization of RUP is therefore proposed to be mediated by the transposase of IS630-Spn1. To account for the observation that RUPs are distributed among four subtypes which exhibit different degrees of sequence homogeneity, a scenario is invoked based on successive stages of RUP mobility and non-mobility, depending on whether an active transposase is present or absent. In the latter situation, an active transposase could be reintroduced into the species through natural transformation. Examination of sequences flanking RUP revealed a preferential association with ISs. It also provided evidence that RUPs promote sequence rearrangements, thereby contributing to genome flexibility. The possibility that RUP preferentially targets transforming DNA of foreign origin and subsequently favours disruption/rearrangement of exogenous sequences is discussed.

  12. Genetic variation and DNA fingerprinting of durian types in Malaysia using simple sequence repeat (SSR) markers.

    Science.gov (United States)

    Siew, Ging Yang; Ng, Wei Lun; Tan, Sheau Wei; Alitheen, Noorjahan Banu; Tan, Soon Guan; Yeap, Swee Keong

    2018-01-01

    Durian ( Durio zibethinus ) is one of the most popular tropical fruits in Asia. To date, 126 durian types have been registered with the Department of Agriculture in Malaysia based on phenotypic characteristics. Classification based on morphology is convenient, easy, and fast but it suffers from phenotypic plasticity as a direct result of environmental factors and age. To overcome the limitation of morphological classification, there is a need to carry out genetic characterization of the various durian types. Such data is important for the evaluation and management of durian genetic resources in producing countries. In this study, simple sequence repeat (SSR) markers were used to study the genetic variation in 27 durian types from the germplasm collection of Universiti Putra Malaysia. Based on DNA sequences deposited in Genbank, seven pairs of primers were successfully designed to amplify SSR regions in the durian DNA samples. High levels of variation among the 27 durian types were observed (expected heterozygosity, H E  = 0.35). The DNA fingerprinting power of SSR markers revealed by the combined probability of identity (PI) of all loci was 2.3×10 -3 . Unique DNA fingerprints were generated for 21 out of 27 durian types using five polymorphic SSR markers (the other two SSR markers were monomorphic). We further tested the utility of these markers by evaluating the clonal status of shared durian types from different germplasm collection sites, and found that some were not clones. The findings in this preliminary study not only shows the feasibility of using SSR markers for DNA fingerprinting of durian types, but also challenges the current classification of durian types, e.g., on whether the different types should be called "clones", "varieties", or "cultivars". Such matters have a direct impact on the regulation and management of durian genetic resources in the region.

  13. Palindromic nucleotide analysis in human T cell receptor rearrangements.

    Directory of Open Access Journals (Sweden)

    Santosh K Srivastava

    Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

  14. Detection of short repeated genomic sequences on metaphase chromosomes using padlock probes and target primed rolling circle DNA synthesis

    Directory of Open Access Journals (Sweden)

    Stougaard Magnus

    2007-11-01

    Full Text Available Abstract Background In situ detection of short sequence elements in genomic DNA requires short probes with high molecular resolution and powerful specific signal amplification. Padlock probes can differentiate single base variations. Ligated padlock probes can be amplified in situ by rolling circle DNA synthesis and detected by fluorescence microscopy, thus enhancing PRINS type reactions, where localized DNA synthesis reports on the position of hybridization targets, to potentially reveal the binding of single oligonucleotide-size probe molecules. Such a system has been presented for the detection of mitochondrial DNA in fixed cells, whereas attempts to apply rolling circle detection to metaphase chromosomes have previously failed, according to the literature. Methods Synchronized cultured cells were fixed with methanol/acetic acid to prepare chromosome spreads in teflon-coated diagnostic well-slides. Apart from the slide format and the chromosome spreading everything was done essentially according to standard protocols. Hybridization targets were detected in situ with padlock probes, which were ligated and amplified using target primed rolling circle DNA synthesis, and detected by fluorescence labeling. Results An optimized protocol for the spreading of condensed metaphase chromosomes in teflon-coated diagnostic well-slides was developed. Applying this protocol we generated specimens for target primed rolling circle DNA synthesis of padlock probes recognizing a 40 nucleotide sequence in the male specific repetitive satellite I sequence (DYZ1 on the Y-chromosome and a 32 nucleotide sequence in the repetitive kringle IV domain in the apolipoprotein(a gene positioned on the long arm of chromosome 6. These targets were detected with good efficiency, but the efficiency on other target sites was unsatisfactory. Conclusion Our aim was to test the applicability of the method used on mitochondrial DNA to the analysis of nuclear genomes, in particular as

  15. Genetic Diversity Assessment and Identification of New Sour Cherry Genotypes Using Intersimple Sequence Repeat Markers

    Directory of Open Access Journals (Sweden)

    Roghayeh Najafzadeh

    2014-01-01

    Full Text Available Iran is one of the chief origins of subgenus Cerasus germplasm. In this study, the genetic variation of new Iranian sour cherries (which had such superior growth characteristics and fruit quality as to be considered for the introduction of new cultivars was investigated and identified using 23 intersimple sequence repeat (ISSR markers. Results indicated a high level of polymorphism of the genotypes based on these markers. According to these results, primers tested in this study specially ISSR-4, ISSR-6, ISSR-13, ISSR-14, ISSR-16, and ISSR-19 produced good and various levels of amplifications which can be effectively used in genetic studies of the sour cherry. The genetic similarity among genotypes showed a high diversity among the genotypes. Cluster analysis separated improved cultivars from promising Iranian genotypes, and the PCoA supported the cluster analysis results. Since the Iranian genotypes were superior to the improved cultivars and were separated from them in most groups, these genotypes can be considered as distinct genotypes for further evaluations in the framework of breeding programs and new cultivar identification in cherries. Results also confirmed that ISSR is a reliable DNA marker that can be used for exact genetic studies and in sour cherry breeding programs.

  16. Molecular Characterization of Cultivated Bromeliad Accessions with Inter-Simple Sequence Repeat (ISSR Markers

    Directory of Open Access Journals (Sweden)

    Yongming Yu

    2012-05-01

    Full Text Available Bromeliads are of great economic importance in flower production; however little information is available with respect to genetic characterization of cultivated bromeliads thus far. In the present study, a selection of cultivated bromeliads was characterized via inter-simple sequence repeat (ISSR markers with an emphasis on genetic diversity and population structure. Twelve ISSR primers produced 342 bands, of which 287 (~84% were polymorphic, with polymorphic bands per primer ranging from 17 to 34. The Jaccard’s similarity ranged from 0.08 to 0.89 and averaged ~0.30 for the investigated bromeliads. The Bayesian-based approach, together with the un-weighted paired group method with arithmetic average (UPGMA-based clustering and the principal coordinate analysis (PCoA, distinctly grouped the bromeliads from Neoregelia, Guzmania, and Vriesea into three separately clusters, well corresponding with their botanical classifications; whereas the bromeliads of Aechmea other than the recently selected hybrids were not well assigned to a cluster. Additionally, ISSR marker was proven efficient for the identification of hybrids and bud sports of cultivated bromeliads. The findings achieved herein will further our knowledge about the genetic variability within cultivated bromeliads and therefore facilitate breeding for new varieties of cultivated bromeliads in future as well.

  17. Estimation of genetic structure of a Mycosphaerella musicola population using inter-simple sequence repeat markers.

    Science.gov (United States)

    Peixouto, Y S; Dórea Bragança, C A; Andrade, W B; Ferreira, C F; Haddad, F; Oliveira, S A S; Darosci Brito, F S; Miller, R N G; Amorim, E P

    2015-07-17

    Among the diseases affecting banana (Musa sp), yellow Sigatoka, caused by the fungal pathogen Mycosphaerella musicola Leach, is considered one of the most important in Brazil, causing losses throughout the year. Understanding the genetic structure of pathogen populations will provide insight into the life history of pathogens, including the evolutionary processes occurring in agrosystems. Tools for estimating the possible emergence of pathogen variants with altered pathogenicity, virulence, or aggressiveness, as well as resistance to systemic fungicides, can also be developed from such data. The objective of this study was to analyze the genetic diversity and population genetics of M. musicola in the main banana-producing regions in Brazil. A total of 83 isolates collected from different banana cultivars in the Brazilian states of Bahia, Rio Grande do Norte, and Minas Gerais were evaluated using inter-simple sequence repeat markers. High variability was detected between the isolates, and 85.5% of the haplotypes were singletons in the populations. The highest source of genetic diversity (97.22%) was attributed to variations within populations. Bayesian cluster analysis revealed the presence of 2 probable ancestral groups, however, showed no relationship to population structure in terms of collection site, state of origin, or cultivar. Similarly, we detected noevidence of genetic recombination between individuals within different states, indicating that asexual cycles play a major role in M. musicola reproduction and that long-distance dispersal of the pathogen is the main factor contributing to the lack of population structure in the fungus.

  18. Fingerprinting for discriminating tea germplasm using inter-simple sequence repeat (ISSR) markers

    International Nuclear Information System (INIS)

    Liu, B.Y.; Li, Y.Y.; Wang, P.S.; Wang, L.Y.; Wang, P.S.

    2012-01-01

    For the discrimination of tea germplasm at the inter-specific level, 134 tea varieties preserved in the China National Germplasm Tea Repositories (CNGTR) were analyzed using inter simple sequence repeat (ISSR) markers. Eighteen primers were chosen from 60 screened for ISSR amplification, generating 99.4% polymorphic bands. The mean Nei's gene diversity (H) and the overall mean Shannon's Information index (I) were 0.396 and 0.578, respectively, indicating a wide gene pool. Using the presence, sometimes absence of unique ISSR markers, it was possible to discriminate 32 of the genotypes tested. No single primer could discriminate all the 134 genotypes. However, UBC811 provided rich band patterns and it can discriminate 35 genotypes. The combination of two and three primers could discriminate 99 and 121 genotypes, respectively. Furthermore, the combination of band patterns or the DNA fingerprinting based on specific ISSR markers generated by UBC811, UBC835, ISSR2 and ISSR3 could discriminate all 134 genotypes tested. ISSR markers also provide a powerful tool to discriminate tea germplasm at the inter-specific level. (author)

  19. Genetic diversity studies in pea (Pisum sativum L.) using simple sequence repeat markers.

    Science.gov (United States)

    Kumari, P; Basal, N; Singh, A K; Rai, V P; Srivastava, C P; Singh, P K

    2013-03-13

    The genetic diversity among 28 pea (Pisum sativum L.) genotypes was analyzed using 32 simple sequence repeat markers. A total of 44 polymorphic bands, with an average of 2.1 bands per primer, were obtained. The polymorphism information content ranged from 0.657 to 0.309 with an average of 0.493. The variation in genetic diversity among these cultivars ranged from 0.11 to 0.73. Cluster analysis based on Jaccard's similarity coefficient using the unweighted pair-group method with arithmetic mean (UPGMA) revealed 2 distinct clusters, I and II, comprising 6 and 22 genotypes, respectively. Cluster II was further differentiated into 2 subclusters, IIA and IIB, with 12 and 10 genotypes, respectively. Principal component (PC) analysis revealed results similar to those of UPGMA. The first, second, and third PCs contributed 21.6, 16.1, and 14.0% of the variation, respectively; cumulative variation of the first 3 PCs was 51.7%.

  20. Simple sequence repeats and compositional bias in the bipartite Ralstonia solanacearum GMI1000 genome

    Directory of Open Access Journals (Sweden)

    Vandamme Peter

    2003-03-01

    Full Text Available Abstract Background Ralstonia solanacearum is an important plant pathogen. The genome of R. solananearum GMI1000 is organised into two replicons (a 3.7-Mb chromosome and a 2.1-Mb megaplasmid and this bipartite genome structure is characteristic for most R. solanacearum strains. To determine whether the megaplasmid was acquired via recent horizontal gene transfer or is part of an ancestral single chromosome, we compared the abundance, distribution and compositon of simple sequence repeats (SSRs between both replicons and also compared the respective compositional biases. Results Our data show that both replicons are very similar in respect to distribution and composition of SSRs and presence of compositional biases. Minor variations in SSR and compositional biases observed may be attributable to minor differences in gene expression and regulation of gene expression or can be attributed to the small sample numbers observed. Conclusions The observed similarities indicate that both replicons have shared a similar evolutionary history and thus suggest that the megaplasmid was not recently acquired from other organisms by lateral gene transfer but is a part of an ancestral R. solanacearum chromosome.

  1. Simple Sequence Repeat Analysis of Selected NSIC-registered Coffee Varieties in the Philippines

    Directory of Open Access Journals (Sweden)

    Daisy May C. Santos

    2016-06-01

    Full Text Available Coffee (Coffea sp. is an important commercial crop worldwide. Three species of coffee are used as beverage, namely Coffea arabica, C. canephora, and C. liberica. Coffea arabica L. is the most cultivated among the three coffee species due to its taste quality, rich aroma, and low caffeine content. Despite its inferior taste and aroma, C. canephora Pierre ex A. Froehner, which has the highest caffeine content, is the second most widely cultivated because of its resistance to coffee diseases. On the other hand, C. liberica W.Bull ex Hierncomes is characterized by its very strong taste and flavor. The Philippines used to be a leading exporter of coffee until coffee rust destroyed the farms in Batangas, home of the famous Kapeng Barako. The country has been attempting to revive the coffee industry by focusing on the production of specialty coffee with registered varieties on the National Seed Industry Council (NSIC. Correct identification and isolation of pure coffee beans are the main factors that determine coffee’s market value. Local farms usually misidentify and mix coffee beans of different varieties, leading to the depreciation of their value. This study used simple sequence repeat (SSR markers to evaluate and distinguish Philippine NSIC-registered coffee species and varieties. The neighbor-joining tree generated using PAUP showed high bootstrap support, separating C. arabica, C. canephora, and C. liberica from each other. Among the twenty primer pairs used, seven were able to distinguish C. arabica, nine for C. liberica, and one for C. canephora.

  2. Genetic diversity among Puccinia melanocephala isolates from Brazil assessed using simple sequence repeat markers.

    Science.gov (United States)

    Peixoto-Junior, R F; Creste, S; Landell, M G A; Nunes, D S; Sanguino, A; Campos, M F; Vencovsky, R; Tambarussi, E V; Figueira, A

    2014-09-26

    Brown rust (causal agent Puccinia melanocephala) is an important sugarcane disease that is responsible for large losses in yield worldwide. Despite its importance, little is known regarding the genetic diversity of this pathogen in the main Brazilian sugarcane cultivation areas. In this study, we characterized the genetic diversity of 34 P. melanocephala isolates from 4 Brazilian states using loci identified from an enriched simple sequence repeat (SSR) library. The aggressiveness of 3 isolates from major sugarcane cultivation areas was evaluated by inoculating an intermediately resistant and a susceptible cultivar. From the enriched library, 16 SSR-specific primers were developed, which produced scorable alleles. Of these, 4 loci were polymorphic and 12 were monomorphic for all isolates evaluated. The molecular characterization of the 34 isolates of P. melanocephala conducted using 16 SSR loci revealed the existence of low genetic variability among the isolates. The average estimated genetic distance was 0.12. Phenetic analysis based on Nei's genetic distance clustered the isolates into 2 major groups. Groups I and II included 18 and 14 isolates, respectively, and both groups contained isolates from all 4 geographic regions studied. Two isolates did not cluster with these groups. It was not possible to obtain clusters according to location or state of origin. Analysis of disease severity data revealed that the isolates did not show significant differences in aggressiveness between regions.

  3. Agarose gel electrophoresis and polyacrylamide gel electrophoresis for visualization of simple sequence repeats.

    Science.gov (United States)

    Anderson, James; Wright, Drew; Meksem, Khalid

    2013-01-01

    In the modern age of genetic research there is a constant search for ways to improve the efficiency of plant selection. The most recent technology that can result in a highly efficient means of selection and still be done at a low cost is through plant selection directed by simple sequence repeats (SSRs or microsatellites). The molecular markers are used to select for certain desirable plant traits without relying on ambiguous phenotypic data. The best way to detect these is the use of gel electrophoresis. Gel electrophoresis is a common technique in laboratory settings which is used to separate deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) by size. Loading DNA and RNA onto gels allows for visualization of the size of fragments through the separation of DNA and RNA fragments. This is achieved through the use of the charge in the particles. As the fragments separate, they form into distinct bands at set sizes. We describe the ability to visualize SSRs on slab gels of agarose and polyacrylamide gel electrophoresis.

  4. Genetic characterization of autochthonous grapevine cultivars from Eastern Turkey by simple sequence repeats (SSRs

    Directory of Open Access Journals (Sweden)

    Sadiye Peral Eyduran

    2016-01-01

    Full Text Available In this research, two well-recognized standard grape cultivars, Cabernet Sauvignon and Merlot, together with eight historical autochthonous grapevine cultivars from Eastern Anatolia in Turkey, were genetically characterized by using 12 pairs of simple sequence repeat (SSR primers in order to evaluate their genetic diversity and relatedness. All of the used SSR primers produced successful amplifications and revealed DNA polymorphisms, which were subsequently utilized to evaluate the genetic relatedness of the grapevine cultivars. Allele richness was implied by the identification of 69 alleles in 8 autochthonous cultivars with a mean value of 5.75 alleles per locus. The average expected heterozygosity and observed heterozygosity were found to be 0.749 and 0.739, respectively. Taking into account the generated alleles, the highest number was recorded in VVC2C3 and VVS2 loci (nine and eight alleles per locus, respectively, whereas the lowest number was recorded in VrZAG83 (three alleles per locus. Two main clusters were produced by using the unweighted pair-group method with arithmetic mean dendrogram constructed on the basis of the SSR data. Only Cabernet Sauvignon and Merlot cultivars were included in the first cluster. The second cluster involved the rest of the autochthonous cultivars. The results obtained during the study illustrated clearly that SSR markers have verified to be an effective tool for fingerprinting grapevine cultivars and carrying out grapevine biodiversity studies. The obtained data are also meaningful references for grapevine domestication.

  5. Complete nucleotide sequence of Bacillus subtilis (natto) bacteriophage PM1, a phage associated with disruption of food production.

    Science.gov (United States)

    Umene, Kenichi; Shiraishi, Atsushi

    2013-06-01

    "Natto", considered a traditional food, is made by fermenting boiled soybeans with Bacillus subtilis (natto), which is a natto-producing strain related to B. subtilis. The production of natto is disrupted by phage infections of B. subtilis (natto); hence, it is necessary to control phage infections. PM1, a phage of B. subtilis (natto), was isolated during interrupted natto production in a factory. In a previous study, PM1 was classified morphologically into the family Siphoviridae, and its genome, comprising approximately 50 kbp of linear double-stranded DNA, was assumed to be circularly permuted. In the present study, the complete nucleotide sequence of the PM1 genomic DNA of 50,861 bp (41.3 %G+C) was determined, and 86 open reading frames (ORFs) were deduced. Forty-one ORFs of PM1 shared similarities with proteins deduced from the genome of phages reported so far. Twenty-three ORFs of PM1 were associated with functions related to the phage multiplication process of gene control, DNA replication/modification, DNA packaging, morphogenesis, and cell lysis. Bacillus subtilis (natto) produces a capsular polypeptide of glutamate with a γ-linkage (called poly-γ-glutamate), which appears to serve as a physical barrier to phage adsorption. One ORF of PM1 had similarity with a poly-γ-glutamate hydrolase, which is assumed to degrade the capsular barrier to allow phage progenies to infect encapsulated host cells. The genome analysis of PM1 revealed the characteristics of the phage that are consistent as Bacillus subtilis (natto)-infecting phage.

  6. Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

    Science.gov (United States)

    de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

    2015-01-01

    The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  7. Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability

    Science.gov (United States)

    Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

    2015-01-01

    Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739

  8. Distribution and evolution of repeated sequences in genomes of Triatominae (Hemiptera-Reduviidae inferred from genomic in situ hybridization.

    Directory of Open Access Journals (Sweden)

    Sebastian Pita

    Full Text Available The subfamily Triatominae, vectors of Chagas disease, comprises 140 species characterized by a highly homogeneous chromosome number. We analyzed the chromosomal distribution and evolution of repeated sequences in Triatominae genomes by Genomic in situ Hybridization using Triatoma delpontei and Triatoma infestans genomic DNAs as probes. Hybridizations were performed on their own chromosomes and on nine species included in six genera from the two main tribes: Triatomini and Rhodniini. Genomic probes clearly generate two different hybridization patterns, dispersed or accumulated in specific regions or chromosomes. The three used probes generate the same hybridization pattern in each species. However, these patterns are species-specific. In closely related species, the probes strongly hybridized in the autosomal heterochromatic regions, resembling C-banding and DAPI patterns. However, in more distant species these co-localizations are not observed. The heterochromatic Y chromosome is constituted by highly repeated sequences, which is conserved among 10 species of Triatomini tribe suggesting be an ancestral character for this group. However, the Y chromosome in Rhodniini tribe is markedly different, supporting the early evolutionary dichotomy between both tribes. In some species, sex chromosomes and autosomes shared repeated sequences, suggesting meiotic chromatin exchanges among these heterologous chromosomes. Our GISH analyses enabled us to acquire not only reliable information about autosomal repeated sequences distribution but also an insight into sex chromosome evolution in Triatominae. Furthermore, the differentiation obtained by GISH might be a valuable marker to establish phylogenetic relationships and to test the controversial origin of the Triatominae subfamily.

  9. Effects of GABA[subscript A] Modulators on the Repeated Acquisition of Response Sequences in Squirrel Monkeys

    Science.gov (United States)

    Campbell, Una C.; Winsauer, Peter J.; Stevenson, Michael W.; Moerschbaecher, Joseph M.

    2004-01-01

    The present study investigated the effects of positive and negative GABA[subscript A] modulators under three different baselines of repeated acquisition in squirrel monkeys in which the monkeys acquired a three-response sequence on three keys under a second-order fixed-ratio (FR) schedule of food reinforcement. In two of these baselines, the…

  10. Triplet repeat sequences in human DNA can be detected by hybridization to a synthetic (5'-CGG-3')17 oligodeoxyribonucleotide

    DEFF Research Database (Denmark)

    Behn-Krappa, A; Mollenhauer, J; Doerfler, W

    1993-01-01

    The seemingly autonomous amplification of naturally occurring triplet repeat sequences in the human genome has been implicated in the causation of human genetic disease, such as the fragile X (Martin-Bell) syndrome, myotonic dystrophy (Curshmann-Steinert), spinal and bulbar muscular atrophy...

  11. Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

    Science.gov (United States)

    Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

    2014-09-01

    Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

  12. Outlier Loci and Selection Signatures of Simple Sequence Repeats (SSRs) in Flax (Linum usitatissimum L.).

    Science.gov (United States)

    Soto-Cerda, Braulio J; Cloutier, Sylvie

    2013-01-01

    Genomic microsatellites (gSSRs) and expressed sequence tag-derived SSRs (EST-SSRs) have gained wide application for elucidating genetic diversity and population structure in plants. Both marker systems are assumed to be selectively neutral when making demographic inferences, but this assumption is rarely tested. In this study, three neutrality tests were assessed for identifying outlier loci among 150 SSRs (85 gSSRs and 65 EST-SSRs) that likely influence estimates of population structure in three differentiated flax sub-populations ( F ST  = 0.19). Moreover, the utility of gSSRs, EST-SSRs, and the combined sets of SSRs was also evaluated in assessing genetic diversity and population structure in flax. Six outlier loci were identified by at least two neutrality tests showing footprints of balancing selection. After removing the outlier loci, the STRUCTURE analysis and the dendrogram topology of EST-SSRs improved. Conversely, gSSRs and combined SSRs results did not change significantly, possibly as a consequence of the higher number of neutral loci assessed. Taken together, the genetic structure analyses established the superiority of gSSRs to determine the genetic relationships among flax accessions, although the combined SSRs produced the best results. Genetic diversity parameters did not differ statistically ( P  > 0.05) between gSSRs and EST-SSRs, an observation partially explained by the similar number of repeat motifs. Our study provides new insights into the ability of gSSRs and EST-SSRs to measure genetic diversity and structure in flax and confirms the importance of testing for the occurrence of outlier loci to properly assess natural and breeding populations, particularly in studies considering only few loci.

  13. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  14. Complete nucleotide sequence of the self-transmissible TOL plasmid pD2RT provides new insight into arrangement of toluene catabolic plasmids

    DEFF Research Database (Denmark)

    Jutkina, Jekaterina; Hansen, Lars Hestbjerg; Li, Lili

    2013-01-01

    In the present study we report the complete nucleotide sequence of the toluene catabolic plasmid pD2RT of Pseudomonas migulae strain D2RT isolated from Baltic Sea water. The pD2RT is 129,894 base pairs in size with an average G+ C content of 53.75%. A total of 135 open reading frames (ORFs) were ...

  15. Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale

    DEFF Research Database (Denmark)

    Liu, Siyang; Huang, Shujia; Rao, Junhua

    2015-01-01

    present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome......) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We...... assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction...

  16. Diversity analysis in Cannabis sativa based on large-scale development of expressed sequence tag-derived simple sequence repeat markers.

    Science.gov (United States)

    Gao, Chunsheng; Xin, Pengfei; Cheng, Chaohua; Tang, Qing; Chen, Ping; Wang, Changbiao; Zang, Gonggu; Zhao, Lining

    2014-01-01

    Cannabis sativa L. is an important economic plant for the production of food, fiber, oils, and intoxicants. However, lack of sufficient simple sequence repeat (SSR) markers has limited the development of cannabis genetic research. Here, large-scale development of expressed sequence tag simple sequence repeat (EST-SSR) markers was performed to obtain more informative genetic markers, and to assess genetic diversity in cannabis (Cannabis sativa L.). Based on the cannabis transcriptome, 4,577 SSRs were identified from 3,624 ESTs. From there, a total of 3,442 complementary primer pairs were designed as SSR markers. Among these markers, trinucleotide repeat motifs (50.99%) were the most abundant, followed by hexanucleotide (25.13%), dinucleotide (16.34%), tetranucloetide (3.8%), and pentanucleotide (3.74%) repeat motifs, respectively. The AAG/CTT trinucleotide repeat (17.96%) was the most abundant motif detected in the SSRs. One hundred and seventeen EST-SSR markers were randomly selected to evaluate primer quality in 24 cannabis varieties. Among these 117 markers, 108 (92.31%) were successfully amplified and 87 (74.36%) were polymorphic. Forty-five polymorphic primer pairs were selected to evaluate genetic diversity and relatedness among the 115 cannabis genotypes. The results showed that 115 varieties could be divided into 4 groups primarily based on geography: Northern China, Europe, Central China, and Southern China. Moreover, the coefficient of similarity when comparing cannabis from Northern China with the European group cannabis was higher than that when comparing with cannabis from the other two groups, owing to a similar climate. This study outlines the first large-scale development of SSR markers for cannabis. These data may serve as a foundation for the development of genetic linkage, quantitative trait loci mapping, and marker-assisted breeding of cannabis.

  17. Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

    Science.gov (United States)

    Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

    2004-01-01

    Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

  18. Complete nucleotide sequence of CTX-M-15-plasmids from clinical Escherichia coli isolates: insertional events of transposons and insertion sequences.

    Directory of Open Access Journals (Sweden)

    Annemieke Smet

    Full Text Available BACKGROUND: CTX-M-producing Escherichia coli strains are regarded as major global pathogens. METHODOLOGY/PRINCIPAL FINDINGS: The nucleotide sequence of three plasmids (pEC_B24: 73801-bp; pEC_L8: 118525-bp and pEC_L46: 144871-bp from Escherichia coli isolates obtained from patients with urinary tract infections and one plasmid (pEC_Bactec: 92970-bp from an Escherichia coli strain isolated from the joint of a horse with arthritis were determined. Plasmid pEC_Bactec belongs to the IncI1 group and carries two resistance genes: bla(TEM-1 and bla(CTX-M-15. It shares more than 90% homology with a previously published bla(CTX-M-plasmid from E. coli of human origin. Plasmid pEC_B24 belongs to the IncFII group whereas plasmids pEC_L8 and pEC_L46 represent a fusion of two replicons of type FII and FIA. On the pEC_B24 backbone, two resistance genes, bla(TEM-1 and bla(CTX-M-15, were found. Six resistance genes, bla(TEM-1, bla(CTX-M-15, bla(OXA-1, aac6'-lb-cr, tetA and catB4, were detected on the pEC_L8 backbone. The same antimicrobial drug resistance genes, with the exception of tetA, were also identified on the pEC_L46 backbone. Genome analysis of all 4 plasmids studied provides evidence of a seemingly frequent transposition event of the bla(CTX-M-15-ISEcp1 element. This element seems to have a preferred insertion site at the tnpA gene of a bla(TEM-carrying Tn3-like transposon, the latter itself being inserted by a transposition event. The IS26-composite transposon, which contains the bla(OXA-1, aac6'-lb-cr and catB4 genes, was inserted into plasmids pEC_L8 and pEC_L46 by homologous recombination rather than a transposition event. Results obtained for pEC_L46 indicated that IS26 also plays an important role in structural rearrangements of the plasmid backbone and seems to facilitate the mobilisation of fragments from other plasmids. CONCLUSIONS: Collectively, these data suggests that IS26 together with ISEcp1 could play a critical role in the evolution of

  19. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  20. Development of expressed sequence tag-simple sequence repeat markers for genetic characterization and population structure analysis of Praxelis clematidea (Asteraceae).

    Science.gov (United States)

    Wang, Q Z; Huang, M; Downie, S R; Chen, Z X

    2016-05-23

    Invasive plants tend to spread aggressively in new habitats and an understanding of their genetic diversity and population structure is useful for their management. In this study, expressed sequence tag-simple sequence repeat (EST-SSR) markers were developed for the invasive plant species Praxelis clematidea (Asteraceae) from 5548 Stevia rebaudiana (Asteraceae) expressed sequence tags (ESTs). A total of 133 microsatellite-containing ESTs (2.4%) were identified, of which 56 (42.1%) were hexanucleotide repeat motifs and 50 (37.6%) were trinucleotide repeat motifs. Of the 24 primer pairs designed from these 133 ESTs, 7 (29.2%) resulted in significant polymorphisms. The number of alleles per locus ranged from 5 to 9. The relatively high genetic diversity (H = 0.2667, I = 0.4212, and P = 100%) of P. clematidea was related to high gene flow (Nm = 1.4996) among populations. The coefficient of population differentiation (GST = 0.2500) indicated that most genetic variation occurred within populations. A Mantel test suggested that there was significant correlation between genetic distance and geographical distribution (r = 0.3192, P = 0.012). These results further support the transferability of EST-SSR markers between closely related genera of the same family.

  1. Transcription arrest by a G quadruplex forming-trinucleotide repeat sequence from the human c-myb gene.

    Science.gov (United States)

    Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia

    2011-05-17

    Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.

  2. Utilization of a cloned alphoid repeating sequence of human DNA in the study of polymorphism of chromosomal heterochromatin regions

    International Nuclear Information System (INIS)

    Kruminya, A.R.; Kroshkina, V.G.; Yurov, Yu.B.; Aleksandrov, I.A.; Mitkevich, S.P.; Gindilis, V.M.

    1988-01-01

    The chromosomal distribution of the cloned PHS05 fragment of human alphoid DNA was studied by in situ hybridization in 38 individuals. It was shown that this DNA fraction is primarily localized in the pericentric regions of practically all chromosomes of the set. Significant interchromosomal differences and a weakly expressed interindividual polymorphism were discovered in the copying ability of this class of repeating DNA sequences; associations were not found between the results of hybridization and the pattern of Q-polymorphism

  3. Linkage of congenital isolated adrenocorticotropic hormone deficiency to the corticotropin releasing hormone locus using simple sequence repeat polymorphisms

    Energy Technology Data Exchange (ETDEWEB)

    Kyllo, J.H.; Collins, M.M.; Vetter, K.L. [Univ. of Iowa College of Medicine, Iowa City, IA (United States)] [and others

    1996-03-29

    Genetic screening techniques using simple sequence repeat polymorphisms were applied to investigate the molecular nature of congenital isolated adrenocorticotropic hormone (ACTH) deficiency. We hypothesize that this rare cause of hypocortisolism shared by a brother and sister with two unaffected sibs and unaffected parents is inherited as an autosomal recessive single gene mutation. Genes involved in the hypothalamic-pituitary axis controlling cortisol sufficiency were investigated for a causal role in this disorder. Southern blotting showed no detectable mutations of the gene encoding pro-opiomelanocortin (POMC), the ACTH precursor. Other candidate genes subsequently considered were those encoding neuroendocrine convertase-1, and neuroendocrine convertase-2 (NEC-1, NEC-2), and corticotropin releasing hormone (CRH). Tests for linkage were performed using polymorphic di- and tetranucleotide simple sequence repeat markers flanking the reported map locations for POMC, NEC-1, NEC-2, and CRH. The chromosomal haplotypes determined by the markers flanking the loci for POMC, NEC-1, and NEC-2 were not compatible with linkage. However, 22 individual markers defining the chromosomal haplotypes flanking CRH were compatible with linkage of the disorder to the immediate area of this gene of chromosome 8. Based on these data, we hypothesize that the ACTH deficiency in this family is due to an abnormality of CRH gene structure or expression. These results illustrate the useful application of high density genetic maps constructed with simple sequence repeat markers for inclusion/exclusion studies of candidate genes in even very small nuclear families segregating for unusual phenotypes. 25 refs., 5 figs., 2 tabs.

  4. Use of short tandem repeat sequences to study Mycobacterium leprae in leprosy patients in Malawi and India.

    Directory of Open Access Journals (Sweden)

    Saroj K Young

    2008-04-01

    Full Text Available Inadequate understanding of the transmission of Mycobacterium leprae makes it difficult to predict the impact of leprosy control interventions. Genotypic tests that allow tracking of individual bacterial strains would strengthen epidemiological studies and contribute to our understanding of the disease.Genotyping assays based on variation in the copy number of short tandem repeat sequences were applied to biopsies collected in population-based epidemiological studies of leprosy in northern Malawi, and from members of multi-case households in Hyderabad, India. In the Malawi series, considerable genotypic variability was observed between patients, and also within patients, when isolates were collected at different times or from different tissues. Less within-patient variability was observed when isolates were collected from similar tissues at the same time. Less genotypic variability was noted amongst the closely related Indian patients than in the Malawi series.Lineages of M. leprae undergo changes in their pattern of short tandem repeat sequences over time. Genetic divergence is particularly likely between bacilli inhabiting different (e.g., skin and nerve tissues. Such variability makes short tandem repeat sequences unsuitable as a general tool for population-based strain typing of M. leprae, or for distinguishing relapse from reinfection. Careful use of these markers may provide insights into the development of disease within individuals and for tracking of short transmission chains.

  5. AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

    Science.gov (United States)

    Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

    2009-01-01

    The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

  6. A 135-kilodalton surface antigen of Mycoplasma hominis PG21 contains multiple directly repeated sequences

    DEFF Research Database (Denmark)

    Ladefoged, Søren; Birkelund, Svend; Hauge, S

    1995-01-01

    gene was sequenced, and its gene product was characterized with the goal of elucidating the structure and function of Lmp1. A total of 7,196 bp in the lmp1 region was sequenced. An open reading frame of 4,032 bp, encoding a protein of 1,344 amino acids with a calculated molecular weight of 147...

  7. A Chromosome 7 Pericentric Inversion Defined at Single-Nucleotide Resolution Using Diagnostic Whole Genome Sequencing in a Patient with Hand-Foot-Genital Syndrome.

    Science.gov (United States)

    Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn

    2016-01-01

    Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.

  8. Complete nucleotide sequence of pGA45, a 140,698-bp incFIIY plasmid encoding blaIMI-3-mediated carbapenem resistance, from river sediment

    Directory of Open Access Journals (Sweden)

    Bingjun eDang

    2016-02-01

    Full Text Available Plasmid pGA45 was isolated from the sediment of Haihe River using E. coli CV601 (gfp-tagged as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G+C content of 52.03%. Sequence analysis shows that pGA45 belongs to incFIIY group and harbors a backbone region shares high homology and gene synteny to several other incF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1 and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one blaIMI-3-containing region and one type VI secretion system region. The blaIMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the blaIMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of blaIMI carbapenemase genes.

  9. Comparative anatomy of the human APRT gene and enzyme: nucleotide sequence divergence and conservation of a nonrandom CpG dinucleotide arrangement

    International Nuclear Information System (INIS)

    Broderick, T.P.; Schaff, D.A.; Bertino, A.M.; Dush, M.K.; Tischfield, J.A.; Stambrook, P.J.

    1987-01-01

    The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function

  10. Molecular characterizations of somatic hybrids developed between Pleurotus florida and Lentinus squarrosulus through inter-simple sequence repeat markers and sequencing of ribosomal RNA-ITS gene.

    Science.gov (United States)

    Mallick, Pijush; Chattaraj, Shruti; Sikdar, Samir Ranjan

    2017-10-01

    The 12 pfls somatic hybrids and 2 parents of Pleurotus florida and Lentinus s quarrosulus were characterized by ISSR and sequencing of rRNA-ITS genes. Five ISSR primers were used and amplified a total of 54 reproducible fragments with 98.14% polymorphism among all the pfls hybrid populations and parental strains. UPGMA-based cluster exhibited a dendrogram with three major groups between the parents and pfls hybrids. Parent P . florida and L . squarrosulus showed different degrees of genetic distance with all the hybrid lines and they showed closeness to hybrid pfls 1m and pfls 1h , respectively. ITS1(F) and ITS4(R) amplified the rRNA-ITS gene with 611-867 bp sequence length. The nucleotide polymorphisms were found in the ITS1, ITS2 and 5.8S rRNA region with different number of bases. Based on rRNA-ITS sequence, UPGMA cluster exhibited three distinct groups between L. squarrosulus and pfls 1p , pfls 1m and pfls 1s , and pfls 1e and P. florida .

  11. Identification and Mapping of Simple Sequence Repeat Markers from Common Bean (Phaseolus vulgaris L. Bacterial Artificial Chromosome End Sequences for Genome Characterization and Genetic–Physical Map Integration

    Directory of Open Access Journals (Sweden)

    Juana M. Córdoba

    2010-11-01

    Full Text Available Microsatellite markers or simple sequence repeat (SSR loci are useful for diversity characterization and genetic–physical mapping. Different in silico microsatellite search methods have been developed for mining bacterial artificial chromosome (BAC end sequences for SSRs. The overall goal of this study was genome characterization based on SSRs in 89,017 BAC end sequences (BESs from the G19833 common bean ( L. library. Another objective was to identify new SSR taking into account three tandem motif identification programs (Automated Microsatellite Marker Development [AMMD], Tandem Repeats Finder [TRF], and SSRLocator [SSRL]. Among the microsatellite search engines, SSRL identified the highest number of SSRs; however, when primer design was attempted, the number dropped due to poor primer design regions. Automated Microsatellite Marker Development software identified many SSRs with valuable AT/TA or AG/TC motifs, while TRF found fewer SSRs and produced no primers. A subgroup of 323 AT-rich, di-, and trinucleotide SSRs were selected from the AMMD results and used in a parental survey with DOR364 and G19833, of which 75 could be mapped in the corresponding population; these represented 4052 BAC clones. Together with 92 previously mapped BES- and 114 non-BES-derived markers, a total of 280 SSRs were included in the polymerase chain reaction (PCR-based map, integrating a total of 8232 BAC clones in 162 contigs from the physical map.

  12. De novo Transcriptome Sequencing Reveals a Considerable Bias in the Incidence of Simple Sequence Repeats towards the Downstream of ‘Pre-miRNAs’ of Black Pepper

    Science.gov (United States)

    Joy, Nisha; Asha, Srinivasan; Mallika, Vijayan; Soniya, Eppurathu Vasudevan

    2013-01-01

    Next generation sequencing has an advantageon transformational development of species with limited available sequence data as it helps to decode the genome and transcriptome. We carried out the de novo sequencing using illuminaHiSeq™ 2000 to generate the first leaf transcriptome of black pepper (Piper nigrum L.), an important spice variety native to South India and also grown in other tropical regions. Despite the economic and biochemical importance of pepper, a scientifically rigorous study at the molecular level is far from complete due to lack of sufficient sequence information and cytological complexity of its genome. The 55 million raw reads obtained, when assembled using Trinity program generated 2,23,386 contigs and 1,28,157 unigenes. Reports suggest that the repeat-rich genomic regions give rise to small non-coding functional RNAs. MicroRNAs (miRNAs) are the most abundant type of non-coding regulatory RNAs. In spite of the widespread research on miRNAs, little is known about the hair-pin precursors of miRNAs bearing Simple Sequence Repeats (SSRs). We used the array of transcripts generated, for the in silico prediction and detection of ‘43 pre-miRNA candidates bearing different types of SSR motifs’. The analysis identified 3913 different types of SSR motifs with an average of one SSR per 3.04 MB of thetranscriptome. About 0.033% of the transcriptome constituted ‘pre-miRNA candidates bearing SSRs’. The abundance, type and distribution of SSR motifs studied across the hair-pin miRNA precursors, showed a significant bias in the position of SSRs towards the downstream of predicted ‘pre-miRNA candidates’. The catalogue of transcripts identified, together with the demonstration of reliable existence of SSRs in the miRNA precursors, permits future opportunities for understanding the genetic mechanism of black pepper and likely functions of ‘tandem repeats’ in miRNAs. PMID:23469176

  13. Development of Simple Sequence Repeats (SSR) markers in Setaria italica (Poaceae) and cross-amplification in related species.

    Science.gov (United States)

    Lin, Heng-Sheng; Chiang, Chih-Yun; Chang, Song-Bin; Kuoh, Chang-Sheng

    2011-01-01

    Foxtail millet is one of the world's oldest cultivated crops. It has been adopted as a model organism for providing a deeper understanding of plant biology. In this study, 45 simple sequence repeats (SSR) markers of Setaria italica were developed. These markers showing polymorphism were screened in 223 samples from 12 foxtail millet populations around Taiwan. The most common dinucleotide and trinucleotide repeat motifs are AC/TG (84.21%) and CAT (46.15%). The average number of alleles (N(a)), the average heterozygosities observed (H(o)) and expected (H(e)) are 3.73, 0.714, 0.587, respectively. In addition, 24 SSR markers had shown transferability to six related Poaceae species. These new markers provide tools for examining genetic relatedness among foxtail millet populations and other related species. It is suitable for germplasm management and protection in Poaceae.

  14. Development of Simple Sequence Repeats (SSR Markers in Setaria italica (Poaceae and Cross-Amplification in Related Species

    Directory of Open Access Journals (Sweden)

    Chih-Yun Chiang

    2011-11-01

    Full Text Available Foxtail millet is one of the world’s oldest cultivated crops. It has been adopted as a model organism for providing a deeper understanding of plant biology. In this study, 45 simple sequence repeats (SSR markers of Setaria italica were developed. These markers showing polymorphism were screened in 223 samples from 12 foxtail millet populations around Taiwan. The most common dinucleotide and trinucleotide repeat motifs are AC/TG (84.21% and CAT (46.15%. The average number of alleles (Na, the average heterozygosities observed (Ho and expected (He are 3.73, 0.714, 0.587, respectively. In addition, 24 SSR markers had shown transferability to six related Poaceae species. These new markers provide tools for examining genetic relatedness among foxtail millet populations and other related species. It is suitable for germplasm management and protection in Poaceae.

  15. Evaluation of Mammalian Interspersed Repeats to investigate the goat genome

    Directory of Open Access Journals (Sweden)

    P. Mariani

    2010-01-01

    Full Text Available Among the repeated sequences present in most eukaryotic genomes, SINEs (Short Interspersed Nuclear Elements are widely used to investigate evolution in the mammalian order (Buchanan et al., 1999. One family of these repetitive sequences, the MIR (Mammalian Interspersed Repeats; Jurka et al., 1995, is ubiquitous in all mammals.MIR elements are tRNA-derived SINEs and are identifiable by a conserved core region of about 70 nucleotides.

  16. The nucleotide sequence of the RNA-2 of an isolate of the English serotype of tomato black ring virus: RNA recombination in the history of nepoviruses.

    Science.gov (United States)

    Le Gall, O L; Lanneau, M; Candresse, T; Dunez, J

    1995-05-01

    The RNA-2 of a carrot isolate from the English serotype of tomato black ring nepovirus (TBRV-ED) has been sequenced. It is 4618 nucleotides long and contains one open reading frame encoding a polypeptide of 1344 amino acids. The 5' non-coding region contains three repetitions of a stem-loop structure also conserved in TBRV-Scottish and grapevine chrome mosaic nepovirus (GCMV). The coat protein domain was mapped to the carboxy-terminal one-third of the polyprotein. Sequence comparisons indicate that TBRV-ED RNA-2 probably arose by an RNA recombination event that resulted in the exchange of the putative movement protein gene between TBRV and GCMV.

  17. Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

    Science.gov (United States)

    Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

    2018-04-01

    Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  18. Molecular characterization and phylogenetic analysis of Explanatum explanatum in India based on nucleotide sequences of ribosomal ITS2 and the mitochondrial gene nad1.

    Science.gov (United States)

    Hayashi, Kei; Mohanta, Uday K; Ohari, Yuma; Neeraja, Tambireddy; Singh, T Shantikumar; Sugiyama, Hiromu; Itagaki, Tadashi

    2016-12-01

    The aim of this study was to analyze the phylogenetic relationship between Explanatum explanatum populations in India and other countries of the Indian subcontinent. Seventy liver amphistomes collected from four localities in India were identified as E. explanatum based on the nucleotide sequences of ribosomal ITS2. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial gene nad1 in comparison with flukes from Bangladesh and Nepal. In the resulting phylogenetic tree, the nad1 haplotypes from India were divided into four clades, and the flukes showing the haplotypes of clades A and C were predominant in India. The haplotypes of the clades A and C have also been detected in Bangladesh and Nepal, and therefore, it seems they occur commonly throughout the Indian subcontinent. The results of AMOVA suggested that gene flow was likely to occur between E. explanatum populations in these countries. These countries are geographically close and have been historically and culturally connected to each other, and therefore, the movements of host ruminants among these countries might have been involved in the migration of the flukes and their gene flow.

  19. The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

    Science.gov (United States)

    Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

    2002-06-05

    The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

  20. Detection of de novo single nucleotide variants in offspring of atomic-bomb survivors close to the hypocenter by whole-genome sequencing.

    Science.gov (United States)

    Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro

    2018-03-01

    Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.

  1. Survey and analysis of simple sequence repeats in the Laccaria bicolor genome, with development of microsatellite markers

    Energy Technology Data Exchange (ETDEWEB)

    Labbe, Jessy L [ORNL; Murat, Claude [INRA, Nancy, France; Morin, Emmanuelle [INRA, Nancy, France; Le Tacon, F [UMR, France; Martin, Francis [INRA, Nancy, France

    2011-01-01

    It is becoming clear that simple sequence repeats (SSRs) play a significant role in fungal genome organization, and they are a large source of genetic markers for population genetics and meiotic maps. We identified SSRs in the Laccaria bicolor genome by in silico survey and analyzed their distribution in the different genomic regions. We also compared the abundance and distribution of SSRs in L. bicolor with those of the following fungal genomes: Phanerochaete chrysosporium, Coprinopsis cinerea, Ustilago maydis, Cryptococcus neoformans, Aspergillus nidulans, Magnaporthe grisea, Neurospora crassa and Saccharomyces cerevisiae. Using the MISA computer program, we detected 277,062 SSRs in the L. bicolor genome representing 8% of the assembled genomic sequence. Among the analyzed basidiomycetes, L. bicolor exhibited the highest SSR density although no correlation between relative abundance and the genome sizes was observed. In most genomes the short motifs (mono- to trinucleotides) were more abundant than the longer repeated SSRs. Generally, in each organism, the occurrence, relative abundance, and relative density of SSRs decreased as the repeat unit increased. Furthermore, each organism had its own common and longest SSRs. In the L. bicolor genome, most of the SSRs were located in intergenic regions (73.3%) and the highest SSR density was observed in transposable elements (TEs; 6,706 SSRs/Mb). However, 81% of the protein-coding genes contained SSRs in their exons, suggesting that SSR polymorphism may alter gene phenotypes. Within a L. bicolor offspring, sequence polymorphism of 78 SSRs was mainly detected in non-TE intergenic regions. Unlike previously developed microsatellite markers, these new ones are spread throughout the genome; these markers could have immediate applications in population genetics.

  2. Complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from Klebsiella pneumoniae isolated in 1969.

    Science.gov (United States)

    Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R

    2012-10-01

    To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.

  3. In Silico Genome Comparison and Distribution Analysis of Simple Sequences Repeats in Cassava

    Directory of Open Access Journals (Sweden)

    Andrea Vásquez

    2014-01-01

    Full Text Available We conducted a SSRs density analysis in different cassava genomic regions. The information obtained was useful to establish comparisons between cassava’s SSRs genomic distribution and those of poplar, flax, and Jatropha. In general, cassava has a low SSR density (~50 SSRs/Mbp and has a high proportion of pentanucleotides, (24,2 SSRs/Mbp. It was found that coding sequences have 15,5 SSRs/Mbp, introns have 82,3 SSRs/Mbp, 5′ UTRs have 196,1 SSRs/Mbp, and 3′ UTRs have 50,5 SSRs/Mbp. Through motif analysis of cassava’s genome SSRs, the most abundant motif was AT/AT while in intron sequences and UTRs regions it was AG/CT. In addition, in coding sequences the motif AAG/CTT was also found to occur most frequently; in fact, it is the third most used codon in cassava. Sequences containing SSRs were classified according to their functional annotation of Gene Ontology categories. The identified SSRs here may be a valuable addition for genetic mapping and future studies in phylogenetic analyses and genomic evolution.

  4. Inter-simple sequence repeat (ISSR) markers in the evaluation of ...

    African Journals Online (AJOL)

    shawkat

    2013-02-13

    Feb 13, 2013 ... 666 Afr. J. Biotechnol. Table 1. Number and types of the ISSR bands as well as the total polymorphism percentages generated in six Capsicum hybrids. Primer code. Sequence. Monomorphic band. Polymorphic band. Total band. Polymorphism. (%). Unique. Shared. HB 1. (CAA)5. 4. 0. 1. 5. 20. HB 2. (CAG) ...

  5. Race: A scalable and elastic parallel system for discovering repeats in very long sequences

    KAUST Repository

    Mansour, Essam

    2013-08-26

    A wide range of applications, including bioinformatics, time series, and log analysis, depend on the identification of repetitions in very long sequences. The problem of finding maximal pairs subsumes most important types of repetition-finding tasks. Existing solutions require both the input sequence and its index (typically an order of magnitude larger than the input) to fit in memory. Moreover, they are serial algorithms with long execution time. Therefore, they are limited to small datasets, despite the fact that modern applications demand orders of magnitude longer sequences. In this paper we present RACE, a parallel system for finding maximal pairs in very long sequences. RACE supports parallel execution on stand-alone multicore systems, in addition to scaling to thousands of nodes on clusters or supercomputers. RACE does not require the input or the index to fit in memory; therefore, it supports very long sequences with limited memory. Moreover, it uses a novel array representation that allows for cache-efficient implementation. RACE is particularly suitable for the cloud (e.g., Amazon EC2) because, based on availability, it can scale elastically to more or fewer machines during its execution. Since scaling out introduces overheads, mainly due to load imbalance, we propose a cost model to estimate the expected speedup, based on statistics gathered through sampling. The model allows the user to select the appropriate combination of cloud resources based on the provider\\'s prices and the required deadline. We conducted extensive experimental evaluation with large real datasets and large computing infrastructures. In contrast to existing methods, RACE can handle the entire human genome on a typical desktop computer with 16GB RAM. Moreover, for a problem that takes 10 hours of serial execution, RACE finishes in 28 seconds using 2,048 nodes on an IBM BlueGene/P supercomputer.

  6. Nucleotide sequences of cDNAs for human papillomavirus type 18 transcripts in HeLa cells

    International Nuclear Information System (INIS)

    Inagaki, Yutaka; Tsunokawa, Youko; Takebe, Naoko; Terada, Masaaki; Sugimura, Takashi; Nawa, Hiroyuki; Nakanishi, Shigetada

    1988-01-01

    HeLa cells expressed 3.4- and 1.6-kilobase (kb) transcripts of the integrated human papillomavirus (HPV) type 18 genome. Two types of cDNA clones representing each size of HPV type 18 transcript were isolated. Sequence analysis of these two types of cDNA clones revealed that the 3.4-kb transcript contained E6, E7, the 5' portion of E1, and human sequence and that the 1.6-kb transcript contained spliced and frameshifted E6 (E6 * ), E7, and human sequence. There was a common human sequence containing a poly(A) addition signal in the 3' end portions of both transcripts, indicating that they were transcribed from the HPV genome at the same integration site with different splicing. Furthermore, the 1.6-kb transcript contained both of the two viral TATA boxes upstream of E6, strongly indicating that a cellular promoter was used for its transcription

  7. Nucleotide sequence analysis of the Legionella micdadei mip gene, encoding a 30-kilodalton analog of the Legionella pneumophila Mip protein

    DEFF Research Database (Denmark)

    Bangsborg, Jette Marie; Cianciotto, N P; Hindersson, P

    1991-01-01

    After the demonstration of analogs of the Legionella pneumophila macrophage infectivity potentiator (Mip) protein in other Legionella species, the Legionella micdadei mip gene was cloned and expressed in Escherichia coli. DNA sequence analysis of the L. micdadei mip gene contained in the plasmid p...... homology with the mip-like genes of several Legionella species. Furthermore, amino acid sequence comparisons revealed significant homology to two eukaryotic proteins with isomerase activity (FK506-binding proteins)....

  8. Complete nucleotide sequence and genome analysis of bacteriophage BFK20 — A lytic phage of the industrial producer Brevibacterium flavum

    Czech Academy of Sciences Publication Activity Database

    Bukovska, G.; Klucar, L.; Vlček, Čestmír; Adamovic, J.; Turna, J.; Timko, J.

    2006-01-01

    Roč. 348, č. 1 (2006), s. 57-71 ISSN 0042-6822 Grant - others:Slovenská akademie věd(SK) VEGA2/5068/25; Science and Technology Assistance Agency(SK) APVT-51-025004 Institutional research plan: CEZ:AV0Z50520514 Keywords : Bacteriophage * Complete genome sequence * Sequence analysis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.525, year: 2006

  9. Extended region of nodulation genes in Rhizobium meliloti 1021. II. Nucleotide sequence, transcription start sites and protein products

    International Nuclear Information System (INIS)

    Fisher, R.F.; Swanson, J.A.; Mulligan, J.T.; Long, S.R.

    1987-01-01

    The authors have established the DNA sequence and analyzed the transcription and translation products of a series of putative nodulation (nod) genes in Rhizobium meliloti strain 1021. Four loci have been designated nodF, nodE, nodG and nodH. The correlation of transposon insertion positions with phenotypes and open reading frames was confirmed by sequencing the insertion junctions of the transposons. The protein products of these nod genes were visualized by in vitro expression of cloned DNA segments in a R. meliloti transcription-translation system. In addition, the sequence for nodG was substantiated by creating translational fusions in all three reading frames at several points in the sequence; the resulting fusions were expressed in vitro in both E. coli and R. meliloti transcription-translation systems. A DNA segment bearing several open reading frames downstream of nodG corresponds to the putative nod gene mutated in strain nod-216. The transcription start sites of nodF and nodH were mapped by primer extension of RNA from cells induced with the plant flavone, luteolin. Initiation of transcription occurs approximately 25 bp downstream from the conserved sequence designated the nod box, suggesting that this conserved sequence acts as an upstream regulator of inducible nod gene expression. Its distance from the transcription start site is more suggestive of an activator binding site rather than an RNA polymerase binding site

  10. Strand bias in complementary single-nucleotide polymorphisms of transcribed human sequences: evidence for functional effects of synonymous polymorphisms

    Directory of Open Access Journals (Sweden)

    Majewski Jacek

    2006-08-01

    Full Text Available Abstract Background Complementary single-nucleotide polymorphisms (SNPs may not be distributed equally between two DNA strands if the strands are functionally distinct, such as in transcribed genes. In introns, an excess of A↔G over the complementary C↔T substitutions had previously been found and attributed to transcription-coupled repair (TCR, demonstrating the valuable functional clues that can be obtained by studying such asymmetry. Here we studied asymmetry of human synonymous SNPs (sSNPs in the fourfold degenerate (FFD sites as compared to intronic SNPs (iSNPs. Results The identities of the ancestral bases and the direction of mutations were inferred from human-chimpanzee genomic alignment. After correction for background nucleotide composition, excess of A→G over the complementary T→C polymorphisms, which was observed previously and can be explained by TCR, was confirmed in FFD SNPs and iSNPs. However, when SNPs were separately examined according to whether they mapped to a CpG dinucleotide or not, an excess of C→T over G→A polymorphisms was found in non-CpG site FFD SNPs but was absent from iSNPs and CpG site FFD SNPs. Conclusion The genome-wide discrepancy of human FFD SNPs provides novel evidence for widespread selective pressure due to functional effects of sSNPs. The similar asymmetry pattern of FFD SNPs and iSNPs that map to a CpG can be explained by transcription-coupled mechanisms, including TCR and transcription-coupled mutation. Because of the hypermutability of CpG sites, more CpG site FFD SNPs are relatively younger and have confronted less selection effect than non-CpG FFD SNPs, which can explain the asymmetric discrepancy of CpG site FFD SNPs vs. non-CpG site FFD SNPs.

  11. Nucleotide sequences of the Erwinia chrysanthemi ogl and pelE genes negatively regulated by the kdgR gene product.

    Science.gov (United States)

    Reverchon, S; Huang, Y; Bourson, C; Robert-Baudouy, J

    1989-12-21

    The nucleotide sequences of the coding and regulatory regions of the genes encoding oligoglacturonate lyase (OGL) and pectate lyase e isoenzyme (PLe) from Erwinia chrysanthemi 3937 were determined. The ogl sequence contains an open reading frame (ORF) of 1164 bp coding for a 388-amino acid (aa) polypeptide with a predicted Mr of 44,124. A possible transcriptional start signal showing homology with the Escherichia coli promoter consensus sequence was detected. In addition, a sequence 3' to the coding region was found to be able to form a secondary structure which may function as an Rho-independent transcriptional termination signal. For the pelE sequence, a long ORF of 1212 bp coding for a 404-aa polypeptide was detected. PLe is secreted into the external medium by E. chrysanthemi, and a potential signal peptide sequence was identified in the pelE gene. In the 5' upstream pelE coding region, a putative promoter resembling E. coli promoter consensus sequences was detected. Furthermore, the region immediately 3' to the pelE translational stop codon may function as an Rho-independent translational termination signal. In strain 3937, the synthesis of OGL and PLe, as well as the other enzymes involved in the pectin-degradative pathway (particularly the kdgT product), are known to be regulated by the KdgR repressor, which mediates galacturonate and polygalacturonate induction. Synthesis of these enzymes is also regulated by the CRP-cAMP complex which mediates catabolite repression. Analysis of the regulatory regions of ogl and pelE allowed us to identify possible CRP-binding sites for these two genes.(ABSTRACT TRUNCATED AT 250 WORDS)

  12. Characterization and compilation of polymorphic simple sequence repeat (SSR markers of peanut from public database

    Directory of Open Access Journals (Sweden)

    Zhao Yongli

    2012-07-01

    Full Text Available Abstract Background There are several reports describing thousands of SSR markers in the peanut (Arachis hypogaea L. genome. There is a need to integrate various research reports of peanut DNA polymorphism into a single platform. Further, because of lack of uniformity in the labeling of these markers across the publications, there is some confusion on the identities of many markers. We describe below an effort to develop a central comprehensive database of polymorphic SSR markers in peanut. Findings We compiled 1,343 SSR markers as detecting polymorphism (14.5% within a total of 9,274 markers. Amongst all polymorphic SSRs examined, we found that AG motif (36.5% was the most abundant followed by AAG (12.1%, AAT (10.9%, and AT (10.3%.The mean length of SSR repeats in dinucleotide SSRs was significantly longer than that in trinucleotide SSRs. Dinucleotide SSRs showed higher polymorphism frequency for genomic SSRs when compared to trinucleotide SSRs, while for EST-SSRs, the frequency of polymorphic SSRs was higher in trinucleotide SSRs than in dinucleotide SSRs. The correlation of the length of SSR and the frequency of polymorphism revealed that the frequency of polymorphism was decreased as motif repeat number increased. Conclusions The assembled polymorphic SSRs would enhance the density of the existing genetic maps of peanut, which could also be a useful source of DNA markers suitable for high-throughput QTL mapping and marker-assisted selection in peanut improvement and thus would be of value to breeders.

  13. Molecular study and nucleotide sequencing of Chlamydia abortus isolated from aborted sheep fetuses ewes of Alborz province

    Directory of Open Access Journals (Sweden)

    amirreza ebadi

    2015-02-01

    Full Text Available Chlamydia is an obligate intracellular and gram negative coccobacilli and one of the most important causes of abortion in ruminants especially in ewes. This investigation was performed with the purpose of molecular study and sequencing of Chlamydia abortus isolated from aborted sheep fetuses of Alborz Province. In this study, DNA extraction was performed on 100 samples from aborted fetuses of 32 sheep flocks from different areas of Alborz province. Then using specific primers of gene IGS-Sr- RNA, polymerase chain reaction was conducted and 10 samples were selected randomly from the positive cases were sent to Macrogene company in Korea for sequencing. In this study, 37 samples from a total of 100 aborted fetuses were positive for Chlamydia abortus. After sequencing, more than 99 percent of the positive samples were similar with sequences in gene bank. The sequencing results indicated that the samples were very similar to isolates LN554882/1, AF051935/1 and CR848038/1 of the gene bank and were in the same cluster. Also, this investigation indicated that Chlamydia abortus is one of the main reasons of ewe abortion in Alborz province.

  14. Generating markers based on biotic stress of protein system in and tandem repeats sequence for Aquilaria sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Muhammad Hanif Azhari N; Siti Norhayati Ismail

    2014-01-01

    Aquilaria sp. belongs to the Thymelaeaceae family and is well distributed in Asia region. The species has multipurpose use from root to shoot and is an economically important crop, which generates wide interest in understanding genetic diversity of the species. Knowledge on DNA-based markers has become a prerequisite for more effective application of molecular marker techniques in breeding and mapping programs. In this work, both targeted genes and tandem repeat sequences were used for DNA fingerprinting in Aquilaria sp. A total of 100 ISSR (inter simple sequence repeat) primers and 50 combination pairs of specific primers derived from conserved region of a specific protein known as system in were optimized. 38 ISSR primers were found affirmative for polymorphism evaluation study and were generated from both specific and degenerate ISSR primers. And one utmost combination of system in primers showed significant results in distinguishing the Aquilaria sp. In conclusion, polymorphism derived from ISSR profiling and targeted stress genes of protein system in proved as a powerful approach for identification and molecular classification of Aquilaria sp. which will be useful for diversification in identifying any mutant lines derived from nature. (author)

  15. A comprehensive characterization of simple sequence repeats in pepper genomes provides valuable resources for marker development in Capsicum.

    Science.gov (United States)

    Cheng, Jiaowen; Zhao, Zicheng; Li, Bo; Qin, Cheng; Wu, Zhiming; Trejo-Saavedra, Diana L; Luo, Xirong; Cui, Junjie; Rivera-Bustamante, Rafael F; Li, Shuaicheng; Hu, Kailin

    2016-01-07

    The sequences of the full set of pepper genomes including nuclear, mitochondrial and chloroplast are now available for use. However, the overall of simple sequence repeats (SSR) distribution in these genomes and their practical implications for molecular marker development in Capsicum have not yet been described. Here, an average of 868,047.50, 45.50 and 30.00 SSR loci were identified in the nuclear, mitochondrial and chloroplast genomes of pepper, respectively. Subsequently, systematic comparisons of various species, genome types, motif lengths, repeat numbers and classified types were executed and discussed. In addition, a local database composed of 113,500 in silico unique SSR primer pairs was built using a homemade bioinformatics workflow. As a pilot study, 65 polymorphic markers were validated among a wide collection of 21 Capsicum genotypes with allele number and polymorphic information content value per marker raging from 2 to 6 and 0.05 to 0.64, respectively. Finally, a comparison of the clustering results with those of a previous study indicated the usability of the newly developed SSR markers. In summary, this first report on the comprehensive characterization of SSR motifs in pepper genomes and the very large set of SSR primer pairs will benefit various genetic studies in Capsicum.

  16. Cloning and nucleotide sequence analysis of pepV, a carnosinase gene from Lactobacillus delbrueckii subsp. lactis DSM 7290, and partial characterization of the enzyme.

    Science.gov (United States)

    Vongerichten, K F; Klein, J R; Matern, H; Plapp, R

    1994-10-01

    Cell extracts of Lactobacillus delbrueckii subsp. lactis DSM 7290 were found to exhibit unique peptolytic ability against unusual beta-alanyl-dipeptides. In order to clone the gene encoding this activity, designated pepV, a gene library of strain DSM 7290 genomic DNA, prepared in the low-copy-number plasmid pLG339, was screened for heterologous expression in Escherichia coli. Recombinant clones harbouring pepV were identified by their ability to allow the utilization of carnosine (beta-alanyl-histidine) as a source of histidine by the E. coli mutant strain UK197 (pepD, hisG). Complementation was observed in a colony harbouring a recombinant plasmid (pKV101), carrying pepV. A 2.4 kb fragment containing pepV was subcloned and its nucleotide sequence revealed an open reading frame (ORF) of 1413 nucleotides, corresponding to a protein with predicted molecular mass of 51998 Da. A single transcription initiation site 71 bp upstream of the ATG translational start codon was identified by primer extension. No significant homology was detected between pepV or its deduced amino acid sequence with any entry in the databases. The only similarity was found in a region conserved in the ArgE/DapE/CPG2/YscS family of proteins. This observation, and protease inhibitor studies, indicated that pepV is of the metalloprotease type. A second ORF present in the sequenced fragment showed extensive homology to a variety of amino acid permeases from E. coli and Saccharomyces cerevisiae.

  17. A Nonpolynomial Optimal Algorithm for Sequencing Inspectors in a Repeat Inspection System with Rework

    Directory of Open Access Journals (Sweden)

    Moon Hee Yang

    2015-01-01

    Full Text Available Assuming that two types of inspection errors are nonidentical and that only the items rejected by an inspector are reworked and sent to the next inspection cycle, we formulate a combinatorial optimization problem for simultaneously determining both the minimum frequency of inspection-rework cycles and the optimal sequence of inspectors selected from a set of available inspectors, in order to meet the constraints of the outgoing quality level. Based on the inherent properties from our mathematical model, we provide a nonpolynomial optimal algorithm with a time complexity of O(2m.

  18. Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.

    Science.gov (United States)

    Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi

    2015-01-01

    The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

  19. Combination of Single Nucleotide Polymorphism and Variable-Number Tandem Repeats for Genotyping a Homogenous Population of Mycobacterium tuberculosis Beijing Strains in China

    OpenAIRE

    Luo, Tao; Yang, Chongguang; Gagneux, Sebastien; Gicquel, Brigitte; Mei, Jian; Gao, Qian

    2012-01-01

    The standard 15- and 24-locus variable-number tandem repeat (VNTR) genotyping methods have demonstrated adequate discriminatory power and a small homoplasy effect for tracing tuberculosis (TB) transmission and predicting Mycobacterium tuberculosis lineages in European and North American countries. However, its validity for the definition of transmission in homogenous M. tuberculosis populations in settings with high TB burdens has been questioned. Here, we genotyped a population-based collect...

  20. A survey of single nucleotide polymorphisms identified from whole-genome sequencing and their functional effect in the porcine genome.

    Science.gov (United States)

    Keel, B N; Nonneman, D J; Rohrer, G A

    2017-08-01

    Genetic variants detected from sequence have been used to successfully identify causal variants and map complex traits in several organisms. High and moderate impact variants, those expected to alter or disrupt the protein coded by a gene and those that regulate protein production, likely have a more significant effect on phenotypic variation than do other types of genetic variants. Hence, a comprehensive list of these functional variants would be of considerable interest in swine genomic studies, particularly those targeting fertility and production traits. Whole-genome sequence was obtained from 72 of the founders of an intensely phenotyped experimental swine herd at the U.S. Meat Animal Research Center (USMARC). These animals included all 24 of the founding boars (12 Duroc and 12 Landrace) and 48 Yorkshire-Landrace composite sows. Sequence reads were mapped to the Sscrofa10.2 genome build, resulting in a mean of 6.1 fold (×) coverage per genome. A total of 22 342 915 high confidence SNPs were identified from the sequenced genomes. These included 21 million previously reported SNPs and 79% of the 62 163 SNPs on the PorcineSNP60 BeadChip assay. Variation was detected in the coding sequence or untranslated regions (UTRs) of 87.8% of the genes in the porcine genome: loss-of-function variants were predicted in 504 genes, 10 202 genes contained nonsynonymous variants, 10 773 had variation in UTRs and 13 010 genes contained synonymous variants. Approximately 139 000 SNPs were classified as loss-of-function, nonsynonymous or regulatory, which suggests that over 99% of the variation detected in our pigs could potentially be ignored, allowing us to focus on a much smaller number of functional SNPs during future analyses. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  1. Listeria monocytogenes Sequence Types 121 and 14 Repeatedly Isolated Within One Year of Sampling in a Rabbit Meat Processing Plant: Persistence and Ecophysiology

    Science.gov (United States)

    Pasquali, Frédérique; Palma, Federica; Guillier, Laurent; Lucchi, Alex; De Cesare, Alessandra; Manfreda, Gerardo

    2018-01-01

    Listeria monocytogenes is a foodborne pathogen adapted to survive and persist in multiple environments. Following two previous studies on prevalence and virulence of L. monocytogenes ST121 and ST14 repeatedly collected in a the same rabbit-meat processing plant, the research questions of the present study were to: (1) assess persistence of L. monocytogenes isolates from the rabbit-plant; (2) select genes associated to physiological adaptation to the food-processing environment; (3) compare presence/absence/truncation of these genes in newly sequenced and publicly available ST121 and ST14 genomes. A total of 273 draft genomes including ST121 and ST14 newly sequenced and publicly available draft genomes were analyzed. Whole-genome Single Nucleotide Polymorfism (wgSNP) analysis was performed separately on the assemblies of ST121 and ST14 draft genomes. SNPs alignments were used to infer phylogeny. A dataset of L. monocytogenes ecophysiology genes was built based on a comprehensive literature review. The 94 selected genes were screened on the assemblies of all ST121 and ST14 draft genomes. Significant gene enrichments were evaluated by statistical analyses. A persistent ST14 clone, including 23 out of 27 newly sequenced genomes, was circulating in the rabbit-meat plant along with two not persistent clones. A significant enrichment was observed in ST121 genomes concerning stress survival islet 2 (SSI-2) (alkaline and oxidative stress), qacH gene (resistance to benzalkonium chloride), cadA1C gene cassette (resistance to 70 mg/l of cadmium chloride) and a truncated version of actA gene (biofilm formation). Conversely, ST14 draft genomes were enriched with a full-length version of actA gene along with the Listeria Genomic Island 2 (LGI 2) including the ars operon (arsenic resistance) and the cadA4C gene cassette (resistance to 35 mg/l of cadmium chloride). Phenotypic tests confirmed ST121 as a weak biofilm producer in comparison to ST14. In conclusion, ST121 carried the

  2. Listeria monocytogenes Sequence Types 121 and 14 Repeatedly Isolated Within One Year of Sampling in a Rabbit Meat Processing Plant: Persistence and Ecophysiology

    Directory of Open Access Journals (Sweden)

    Frédérique Pasquali

    2018-03-01

    Full Text Available Listeria monocytogenes is a foodborne pathogen adapted to survive and persist in multiple environments. Following two previous studies on prevalence and virulence of L. monocytogenes ST121 and ST14 repeatedly collected in a the same rabbit-meat processing plant, the research questions of the present study were to: (1 assess persistence of L. monocytogenes isolates from the rabbit-plant; (2 select genes associated to physiological adaptation to the food-processing environment; (3 compare presence/absence/truncation of these genes in newly sequenced and publicly available ST121 and ST14 genomes. A total of 273 draft genomes including ST121 and ST14 newly sequenced and publicly available draft genomes were analyzed. Whole-genome Single Nucleotide Polymorfism (wgSNP analysis was performed separately on the assemblies of ST121 and ST14 draft genomes. SNPs alignments were used to infer phylogeny. A dataset of L. monocytogenes ecophysiology genes was built based on a comprehensive literature review. The 94 selected genes were screened on the assemblies of all ST121 and ST14 draft genomes. Significant gene enrichments were evaluated by statistical analyses. A persistent ST14 clone, including 23 out of 27 newly sequenced genomes, was circulating in the rabbit-meat plant along with two not persistent clones. A significant enrichment was observed in ST121 genomes concerning stress survival islet 2 (SSI-2 (alkaline and oxidative stress, qacH gene (resistance to benzalkonium chloride, cadA1C gene cassette (resistance to 70 mg/l of cadmium chloride and a truncated version of actA gene (biofilm formation. Conversely, ST14 draft genomes were enriched with a full-length version of actA gene along with the Listeria Genomic Island 2 (LGI 2 including the ars operon (arsenic resistance and the cadA4C gene cassette (resistance to 35 mg/l of cadmium chloride. Phenotypic tests confirmed ST121 as a weak biofilm producer in comparison to ST14. In conclusion, ST121

  3. C-terminal sequences of hsp70 and hsp90 as non-specific anchors for tetratricopeptide repeat (TPR) proteins.

    Science.gov (United States)

    Ramsey, Andrew J; Russell, Lance C; Chinkers, Michael

    2009-10-12

    Steroid-hormone-receptor maturation is a multi-step process that involves several TPR (tetratricopeptide repeat) proteins that bind to the maturation complex via the C-termini of hsp70 (heat-shock protein 70) and hsp90 (heat-shock protein 90). We produced a random T7 peptide library to investigate the roles played by the C-termini of the two heat-shock proteins in the TPR-hsp interactions. Surprisingly, phages with the MEEVD sequence, found at the C-terminus of hsp90, were not recovered from our biopanning experiments. However, two groups of phages were isolated that bound relatively tightly to HsPP5 (Homo sapiens protein phosphatase 5) TPR. Multiple copies of phages with a C-terminal sequence of LFG were isolated. These phages bound specifically to the TPR domain of HsPP5, although mutation studies produced no evidence that they bound to the domain's hsp90-binding groove. However, the most abundant family obtained in the initial screen had an aspartate residue at the C-terminus. Two members of this family with a C-terminal sequence of VD appeared to bind with approximately the same affinity as the hsp90 C-12 control. A second generation pseudo-random phage library produced a large number of phages with an LD C-terminus. These sequences acted as hsp70 analogues and had relatively low affinities for hsp90-specific TPR domains. Unfortunately, we failed to identify residues near hsp90's C-terminus that impart binding specificity to individual hsp90-TPR interactions. The results suggest that the C-terminal sequences of hsp70 and hsp90 act primarily as non-specific anchors for TPR proteins.

  4. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  6. Absence of zero-temperature transmission rate of a double-chain tight-binding model for DNA with random sequence of nucleotides in thermodynamic limit

    International Nuclear Information System (INIS)

    Xiong Gang; Wang, X.R.

    2005-01-01

    The zero-temperature transmission rate spectrum of a double-chain tight-binding model for real DNA is calculated. It is shown that a band of extended-like states exists only for finite chain length with strong inter-chain coupling. While the whole spectrum tends to zero in thermodynamic limit, regardless of the strength of inter-chain coupling. It is also shown that a more faithful model for real DNA with periodic sugar-phosphate chains in backbone structures can be mapped into the above simple double-chain tight-binding model. Combined with above results, the transmission rate of real DNA with long random sequence of nucleotides is expected to be poor

  7. The complete nucleotide sequences of the 5 genetically distinct plastid genomes of Oenothera, subsection Oenothera: II. A microevolutionary view using bioinformatics and formal genetic data.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Herrmann, Reinhold G; Rauwolf, Uwe; Mayer, Klaus; Haberer, Georg; Meurer, Jörg

    2008-09-01

    A unique combination of genetic features and a rich stock of information make the flowering plant genus Oenothera an appealing model to explore the molecular basis of speciation processes including nucleus-organelle coevolution. From representative species, we have recently reported complete nucleotide sequences of the 5 basic and genetically distinguishable plastid chromosomes of subsection Oenothera (I-V). In nature, Oenothera plastid genomes are associated with 6 distinct, either homozygous or heterozygous, diploid nuclear genotypes of the 3 basic genomes A, B, or C. Artificially produced plastome-genome combinations that do not occur naturally often display interspecific plastome-genome incompatibility (PGI). In this study, we compare formal genetic data available from all 30 plastome-genome combinations with sequence differences between the plastomes to uncover potential determinants for interspecific PGI. Consistent with an active role in speciation, a remarkable number of genes have high Ka/Ks ratios. Different from the Solanacean cybrid model Atropa/tobacco, RNA editing seems not to be relevant for PGIs in Oenothera. However, predominantly sequence polymorphisms in intergenic segments are proposed as possible sources for PGI. A single locus, the bidirectional promoter region between psbB and clpP, is suggested to contribute to compartmental PGI in the interspecific AB hybrid containing plastome I (AB-I), consistent with its perturbed photosystem II activity.

  8. Nucleotide and deduced amino acid sequence of the envelope gene of the Vasilchenko strain of TBE virus; comparison with other flaviviruses.

    Science.gov (United States)

    Gritsun, T S; Frolova, T V; Pogodina, V V; Lashkevich, V A; Venugopal, K; Gould, E A

    1993-02-01

    A strain of tick-borne encephalitis virus known as Vasilchenko (Vs) exhibits relatively low virulence characteristics in monkeys, Syrian hamsters and humans. The gene encoding the envelope glycoprotein of this virus was cloned and sequenced. Alignment of the sequence with those of other known tick-borne flaviviruses and identification of the recognised amino acid genetic marker EHLPTA confirmed its identity as a member of the TBE complex. However, Vs virus was distinguishable from eastern and western tick-borne serotypes by the presence of the sequence AQQ at amino acid positions 232-234 and also by the presence of other specific amino acid substitutions which may be genetic markers for these viruses and could determine their pathogenetic characteristics. When compared with other tick-borne flaviviruses, Vs virus had 12 unique amino acid substitutions including an additional potential glycosylation site at position (315-317). The Vs virus strain shared closest nucleotide and amino acid homology (84.5% and 95.5% respectively) with western and far eastern strains of tick-borne encephalitis virus. Comparison with the far eastern serotype of tick-borne encephalitis virus, by cross-immunoelectrophoresis of Vs virions and PAGE analysis of the extracted virion proteins, revealed differences in surface charge and virus stability that may account for the different virulence characteristics of Vs virus. These results support and enlarge upon previous data obtained from molecular and serological analysis.

  9. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses.

    Science.gov (United States)

    Krueger, Elizabeth N; Beckett, Randy J; Gray, Stewart M; Miller, W Allen

    2013-01-01

    The yellow dwarf viruses (YDVs) of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs) of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs) and Wheat yellow dwarf virus (WYDV) of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV) were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392). The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV) share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV).

  10. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses

    Directory of Open Access Journals (Sweden)

    Elizabeth N. Krueger

    2013-07-01

    Full Text Available The yellow dwarf viruses (YDVs of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs and Wheat yellow dwarf virus (WYDV of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392. The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV.

  11. The influence of selection on the evolutionary distance estimated from the base changes observed between homologous nucleotide sequences.

    Science.gov (United States)

    Otsuka, J; Kawai, Y; Sugaya, N

    2001-11-21

    In most studies of molecular evolution, the nucleotide base at a site is assumed to change with the apparent rate under functional constraint, and the comparison of base changes between homologous genes is thought to yield the evolutionary distance corresponding to the site-average change rate multiplied by the divergence time. However, this view is not sufficiently successful in estimating the divergence time of species, but mostly results in the construction of tree topology without a time-scale. In the present paper, this problem is investigated theoretically by considering that observed base changes are the results of comparing the survivals through selection of mutated bases. In the case of weak selection, the time course of base changes due to mutation and selection can be obtained analytically, leading to a theoretical equation showing how the selection has influence on the evolutionary distance estimated from the enumeration of base changes. This result provides a new method for estimating the divergence time more accurately from the observed base changes by evaluating both the strength of selection and the mutation rate. The validity of this method is verified by analysing the base changes observed at the third codon positions of amino acid residues with four-fold codon degeneracy in the protein genes of mammalian mitochondria; i.e. the ratios of estimated divergence times are fairly well consistent with a series of fossil records of mammals. Throughout this analysis, it is also suggested that the mutation rates in mitochondrial genomes are almost the same in different lineages of mammals and that the lineage-specific base-change rates indicated previously are due to the selection probably arising from the preference of transfer RNAs to codons.

  12. Isolation and characterization of human glycophorin A cDNA clones by a synthetic oligonucleotide approach: nucleotide sequence and mRNA structure

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1986-01-01

    In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B

  13. Complete nucleotide sequence of the Coturnix chinensis (blue-breasted quail) mitochondrial genome and a phylogenetic analysis with related species.

    Science.gov (United States)

    Nishibori, M; Tsudzuki, M; Hayashi, T; Yamamoto, Y; Yasue, H

    2002-01-01

    Coturnix chinensis (blue-breasted quail) has been classically grouped in Galliformes Phasianidae Coturnix, based on morphologic features and biochemical evidence. Since the blue-breasted quail has the smallest body size among the species of Galliformes, in addition to a short generation time and an excellent reproductive performance, it is a possible model fowl for breeding and physiological studies of the Coturnix japonica (Japanese quail) and Gallus gallus domesticus (chicken), which are classified in the same family as blue-breasted quail. However, since its phylogenetic position in the family Phasianidae has not been determined conclusively, the sequence of the entire blue-breasted quail mitochondria (mt) genome was obtained to provide genetic information for phylogenetic analysis in the present study. The blue-breasted quail mtDNA was found to be a circular DNA of 16,687 base pairs (bp) with the same genomic structure as the mtDNAs of Japanese quail and chicken, though it is smaller than Japanese quail and chicken mtDNAs by 10 bp and 88 bp, respectively. The sequence identity of all mitochondrial genes, including those for 12S and 16S ribosomal RNAs, between blue-breasted quail and Japanese quail ranged from 84.5% to 93.5%; between blue-breasted quail and chicken, sequence identity ranged from 78.0% to 89.6%. In order to obtain information on the phylogenetic position of blue-breasted quail in Galliformes Phasianidae, the 2,184 bp sequence comprising NADH dehydrogenase subunit 2 and cytochrome b genes available for eight species in Galliformes [Japanese quail, chicken, Gallus varius (green junglefowl), Bambusicola thoracica (Chinese bamboo partridge), Pavo cristatus (Indian peafowl), Perdix perdix (gray partridge), Phasianus colchicus (ring-neck pheasant), and Tympanchus phasianellus (sharp-tailed grouse)] together with that of Aythya americana (redhead) were examined using a maximum likelihood (ML) method. The ML analyses on the first/second codon positions

  14. TargetM6A: Identifying N6-Methyladenosine Sites From RNA Sequences via Position-Specific Nucleotide Propensities and a Support Vector Machine.

    Science.gov (United States)

    Li, Guang-Qing; Liu, Zi; Shen, Hong-Bin; Yu, Dong-Jun

    2016-10-01

    As one of the most ubiquitous post-transcriptional modifications of RNA, N 6 -methyladenosine ( [Formula: see text]) plays an essential role in many vital biological processes. The identification of [Formula: see text] sites in RNAs is significantly important for both basic biomedical research and practical drug development. In this study, we designed a computational-based method, called TargetM6A, to rapidly and accurately target [Formula: see text] sites solely from the primary RNA sequences. Two new features, i.e., position-specific nucleotide/dinucleotide propensities (PSNP/PSDP), are introduced and combined with the traditional nucleotide composition (NC) feature to formulate RNA sequences. The extracted features are further optimized to obtain a much more compact and discriminative feature subset by applying an incremental feature selection (IFS) procedure. Based on the optimized feature subset, we trained TargetM6A on the training dataset with a support vector machine (SVM) as the prediction engine. We compared the proposed TargetM6A method with existing methods for predicting [Formula: see text] sites by performing stringent jackknife tests and independent validation tests on benchmark datasets. The experimental results show that the proposed TargetM6A method outperformed the existing methods for predicting [Formula: see text] sites and remarkably improved the prediction performances, with MCC = 0.526 and AUC = 0.818. We also provided a user-friendly web server for TargetM6A, which is publicly accessible for academic use at http://csbio.njust.edu.cn/bioinf/TargetM6A.

  15. Meta-analysis of sequence-based association studies across three cattle breeds reveals 25 QTL for fat and protein percentages in milk at nucleotide resolution.

    Science.gov (United States)

    Pausch, Hubert; Emmerling, Reiner; Gredler-Grandl, Birgit; Fries, Ruedi; Daetwyler, Hans D; Goddard, Michael E

    2017-11-09

    Genotyping and whole-genome sequencing data have been generated for hundreds of thousands of cattle. International consortia used these data to compile imputation reference panels that facilitate the imputation of sequence variant genotypes for animals that have been genotyped using dense microarrays. Association studies with imputed sequence variant genotypes allow for the characterization of quantitative trait loci (QTL) at nucleotide resolution particularly when individuals from several breeds are included in the mapping populations. We imputed genotypes for 28 million sequence variants in 17,229 cattle of the Braunvieh, Fleckvieh and Holstein breeds in order to compile large mapping populations that provide high power to identify QTL for milk production traits. Association tests between imputed sequence variant genotypes and fat and protein percentages in milk uncovered between six and thirteen QTL (P < 1e-8) per breed. Eight of the detected QTL were significant in more than one breed. We combined the results across breeds using meta-analysis and identified a total of 25 QTL including six that were not significant in the within-breed association studies. Two missense mutations in the ABCG2 (p.Y581S, rs43702337, P = 4.3e-34) and GHR (p.F279Y, rs385640152, P = 1.6e-74) genes were the top variants at QTL on chromosomes 6 and 20. Another known causal missense mutation in the DGAT1 gene (p.A232K, rs109326954, P = 8.4e-1436) was the second top variant at a QTL on chromosome 14 but its allelic substitution effects were inconsistent across breeds. It turned out that the conflicting allelic substitution effects resulted from flaws in the imputed genotypes due to the use of a multi-breed reference population for genotype imputation. Many QTL for milk production traits segregate across breeds and across-breed meta-analysis has greater power to detect such QTL than within-breed association testing. Association testing between imputed sequence variant genotypes and

  16. Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

    Science.gov (United States)

    Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

    2015-01-01

    Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

  17. Single-nucleotide variant in multiple copies of a deleted in azoospermia (DAZ) sequence - a human Y chromosome quantitative polymorphism.

    Science.gov (United States)

    Szmulewicz, Martin N; Ruiz, Luis M; Reategui, Erika P; Hussini, Saeed; Herrera, Rene J

    2002-01-01

    The evolution of the deleted in azoospermia (DAZ) gene family supports prevalent theories on the origin and development of sex chromosomes and sexual dimorphism. The ancestral DAZL gene in human chromosome 3 is known to be involved in germline development of both males and females. The available phylogenetic data suggest that some time after the divergence of the New World and Old World monkey lineages, the DAZL gene, which is found in all mammals, was copied to the Y chromosome of an ancestor to the Old World monkeys, but not New World monkeys. In modern man, the Y-linked DAZ gene complex is located on the distal part of the q arm. It is thought that after being copied to the Y chromosome, and after the divergence of the human and great ape lineages, the DAZ gene in the former underwent internal rearrangements. This included tandem duplications as well as a T > C transition altering an MboI restriction enzyme site in a duplicated sequence. In this study, we report on the ratios of MboI-/MboI+ variant sequences in individuals from seven worldwide human populations (Basque, Benin, Egypt, Formosa, Kungurtug, Oman and Rwanda) in the DAZ complex. The ratio of PCR MboI- and MboI+ amplicons can be used to characterize individuals and populations. Our results show a nonrandom distribution of MboI-/MboI+ sequence ratios in all populations examined, as well as significant differences in ratios between populations when compared pairwise. The multiple ratios imply that there have been more than one recent reorganization events at this locus. Considering the dynamic nature of this locus and its involvement in male fertility, we investigated the extent and distribution of this polymorphism. Copyright 2002 S. Karger AG, Basel

  18. Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

    Energy Technology Data Exchange (ETDEWEB)

    Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

    1988-08-11

    The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

  19. Sequence diversities of serine-aspartate repeat genes among Staphylococcus aureus isolates from different hosts presumably by horizontal gene transfer.

    Directory of Open Access Journals (Sweden)

    Huping Xue

    Full Text Available BACKGROUND: Horizontal gene transfer (HGT is recognized as one of the major forces for bacterial genome evolution. Many clinically important bacteria may acquire virulence factors and antibiotic resistance through HGT. The comparative genomic analysis has become an important tool for identifying HGT in emerging pathogens. In this study, the Serine-Aspartate Repeat (Sdr family has been compared among different sources of Staphylococcus aureus (S. aureus to discover sequence diversities within their genomes. METHODOLOGY/PRINCIPAL FINDINGS: Four sdr genes were analyzed for 21 different S. aureus strains and 218 mastitis-associated S. aureus isolates from Canada. Comparative genomic analyses revealed that S. aureus strains from bovine mastitis (RF122 and mastitis isolates in this study, ovine mastitis (ED133, pig (ST398, chicken (ED98, and human methicillin-resistant S. aureus (MRSA (TCH130, MRSA252, Mu3, Mu50, N315, 04-02981, JH1 and JH9 were highly associated with one another, presumably due to HGT. In addition, several types of insertion and deletion were found in sdr genes of many isolates. A new insertion sequence was found in mastitis isolates, which was presumably responsible for the HGT of sdrC gene among different strains. Moreover, the sdr genes could be used to type S. aureus. Regional difference of sdr genes distribution was also indicated among the tested S. aureus isolates. Finally, certain associations were found between sdr genes and subclinical or clinical mastitis isolates. CONCLUSIONS: Certain sdr gene sequences were shared in S. aureus strains and isolates from different species presumably due to HGT. Our results also suggest that the distributional assay of virulence factors should detect the full sequences or full functional regions of these factors. The traditional assay using short conserved regions may not be accurate or credible. These findings have important implications with regard to animal husbandry practices that may

  20. Inter- and intra-strain variability of tandem repeats in Mycoplasma pneumoniae based on next-generation sequencing data.

    Science.gov (United States)

    Zhang, Jing; Song, Xiaohong; Ma, Marella J; Xiao, Li; Kenri, Tsuyoshi; Sun, Hongmei; Ptacek, Travis; Li, Shaoli; Waites, Ken B; Atkinson, T Prescott; Shibayama, Keigo; Dybvig, Kevin; Feng, Yanmei

    2017-02-01

    To characterize inter- and intra-strain variability of variable-number tandem repeats (VNTRs) in Mycoplasma pneumoniae to determine the optimal multilocus VNTR analysis scheme for improved strain typing. Whole genome assemblies and next-generation sequencing data from diverse M. pneumoniae isolates were used to characterize VNTRs and their variability, and to compare the strain discriminability of new VNTR and existing markers. We identified 13 VNTRs including five reported previously. These VNTRs displayed different levels of inter- and intra-strain copy number variations. All new markers showed similar or higher discriminability compared with existing VNTR markers and the P1 typing system. Our study provides novel insights into VNTR variations and potential new multilocus VNTR analysis schemes for improved genotyping of M. pneumoniae.

  1. PCR Assays for Identification of Coccidioides posadasii Based on the Nucleotide Sequence of the Antigen 2/Proline-Rich Antigen

    Science.gov (United States)

    Bialek, Ralf; Kern, Jan; Herrmann, Tanja; Tijerina, Rolando; Ceceñas, Luis; Reischl, Udo; González, Gloria M.

    2004-01-01

    A conventional nested PCR and a real-time LightCycler PCR assay for detection of Coccidioides posadasii DNA were designed and tested in 120 clinical strains. These had been isolated from 114 patients within 10 years in Monterrey, Nuevo Leon, Mexico, known to be endemic for coccidioidomycosis. The gene encoding the specific antigen 2/proline-rich antigen (Ag2/PRA) was used as a target. All strains were correctly identified, whereas DNA from related members of the family Onygenaceae remained negative. Melting curve analysis by LightCycler and sequencing of the 526-bp product of the first PCR demonstrated either 100% identity to the GenBank sequence of the Silveira strain, now known to be C. posadasii (accession number AF013256), or a single silent mutation at position 1228. Length determination of two microsatellite-containing loci (GAC and 621) identified all 120 isolates as C. posadasii. Specific DNA was amplified by conventional nested PCR from three microscopically spherule-positive paraffin-embedded tissue samples, whereas 20 human tissue samples positive for other dimorphic fungi remained negative. Additionally, the safety of each step of a modified commercially available DNA extraction procedure was evaluated by using 10 strains. At least three steps of the protocol were demonstrated to sufficiently kill arthroconidia. This safe procedure is applicable to cultures and to clinical specimens. PMID:14766853

  2. Characterisation of purified parvalbumin from five fish species and nucleotide sequencing of this major allergen from Pacific pilchard, Sardinops sagax.

    Science.gov (United States)

    Beale, Janine E; Jeebhay, Mohamed F; Lopata, Andreas L

    2009-09-01

    IgE-mediated allergic reaction to seafood is a common cause of food allergy including anaphylactic reactions. Parvalbumin, the major fish allergen, has been shown to display IgE cross-reactivity among fish species consumed predominantly in Europe and the Far East. However, cross-reactivity studies of parvalbumin from fish species widely consumed in the Southern hemisphere are limited as is data relating to immunological and molecular characterisation. In this study, antigenic cross-reactivity and the presence of oligomers and isomers of parvalbumin from five highly consumed fish species in Southern Africa were assessed by immunoblotting using purified parvalbumin and crude fish extracts. Pilchard (Sardinops sagax) parvalbumin was found to display the strongest IgE reactivity among 10 fish-allergic consumers. The cDNA sequence of the beta-form of pilchard parvalbumin was determined and designated Sar sa 1.0101 (accession number FM177701 EMBL/GenBank/DDBJ databases). Oligomeric forms of parvalbumin were observed in all fish species using a monoclonal anti-parvalbumin antibody and subject's sera. Isoforms varied between approximately 10-13 kDa. A highly cross-reactive allergenic isoform of parvalbumin was identified and sequenced, providing a successful primary step towards the generation of a recombinant form that could be used for diagnostic and potential therapeutic use in allergic individuals.

  3. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    International Nuclear Information System (INIS)

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

    1988-01-01

    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  4. Analysis of simple sequence repeats in the Gaeumannomyces graminis var. tritici genome and the development of microsatellite markers.

    Science.gov (United States)

    Li, Wei; Feng, Yanxia; Sun, Haiyan; Deng, Yuanyu; Yu, Hanshou; Chen, Huaigu

    2014-11-01

    Understanding the genetic structure of Gaeumannomyces graminis var. tritici is essential for the establishment of efficient disease control strategies. It is becoming clear that microsatellites, or simple sequence repeats (SSRs), play an important role in genome organization and phenotypic diversity, and are a large source of genetic markers for population genetics and meiotic maps. In this study, we examined the G. graminis var. tritici genome (1) to analyze its pattern of SSRs, (2) to compare it with other plant pathogenic filamentous fungi, such as Magnaporthe oryzae and M. poae, and (3) to identify new polymorphic SSR markers for genetic diversity. The G. graminis var. tritici genome was rich in SSRs; a total 13,650 SSRs have been identified with mononucleotides being the most common motifs. In coding regions, the densities of tri- and hexanucleotides were significantly higher than in noncoding regions. The di-, tri-, tetra, penta, and hexanucleotide repeats in the G. graminis var. tritici genome were more abundant than the same repeats in M. oryzae and M. poae. From 115 devised primers, 39 SSRs are polymorphic with G. graminis var. tritici isolates, and 8 primers were randomly selected to analyze 116 isolates from China. The number of alleles varied from 2 to 7 and the expected heterozygosity (He) from 0.499 to 0.837. In conclusion, SSRs developed in this study were highly polymorphic, and our analysis indicated that G. graminis var. tritici is a species with high genetic diversity. The results provide a pioneering report for several applications, such as the assessment of population structure and genetic diversity of G. graminis var. tritici.

  5. Global repeat discovery and estimation of genomic copy number in a large, complex genome using a high-throughput 454 sequence survey

    Directory of Open Access Journals (Sweden)

    Varala Kranthi

    2007-05-01

    Full Text Available Abstract Background Extensive computational and database tools are available to mine genomic and genetic databases for model organisms, but little genomic data is available for many species of ecological or agricultural significance, especially those with large genomes. Genome surveys using conventional sequencing techniques are powerful, particularly for detecting sequences present in many copies per genome. However these methods are time-consuming and have potential drawbacks. High throughput 454 sequencing provides an alternative method by which much information can be gained quickly and cheaply from high-coverage surveys of genomic DNA. Results We sequenced 78 million base-pairs of randomly sheared soybean DNA which passed our quality criteria. Computational analysis of the survey sequences provided global information on the abundant repetitive sequences in soybean. The sequence was used to determine the copy number across regions of large genomic clones or contigs and discover higher-order structures within satellite repeats. We have created an annotated, online database of sequences present in multiple copies in the soybean genome. The low bias of pyrosequencing against repeat sequences is demonstrated by the overall composition of the survey data, which matches well with past estimates of repetitive DNA content obtained by DNA re-association kinetics (Cot analysis. Conclusion This approach provides a potential aid to conventional or shotgun genome assembly, by allowing rapid assessment of copy number in any clone or clone-end sequence. In addition, we show that partial sequencing can provide access to partial protein-coding sequences.

  6. Purification, enzymatic characterization, and nucleotide sequence of a high-isoelectric-point alpha-glucosidase from barley malt

    DEFF Research Database (Denmark)

    Frandsen, T P; Lok, F; Mirgorodskaya, E

    2000-01-01

    in the transition state complex. Mass spectrometry of tryptic fragments assigned the 92-kD protein to a barley cDNA (GenBank accession no. U22450) that appears to encode an alpha-glucosidase. A corresponding sequence (HvAgl97; GenBank accession no. AF118226) was isolated from a genomic phage library using a c......High-isoelectric-point (pI) alpha-glucosidase was purified 7, 300-fold from an extract of barley (Hordeum vulgare) malt by ammonium sulfate fractionation, ion-exchange, and butyl-Sepharose chromatography. The enzyme had high activity toward maltose (k(cat) = 25 s(-1)), with an optimum at pH 4...

  7. Complete nucleotide sequence of the Oenothera elata plastid chromosome, representing plastome I of the five distinguishable euoenothera plastomes.

    Science.gov (United States)

    Hupfer, H; Swiatek, M; Hornung, S; Herrmann, R G; Maier, R M; Chiu, W L; Sears, B

    2000-05-01

    We describe the 159,443-bp [corrected] sequence of the plastid chromosome of Oenothera elata (evening primrose). The Oe. elata plastid chromosome represents type I of the five genetically distinguishable basic plastomes found in the subsection Euoenothera. The genus Oenothera provides an ideal system in which to address fundamental questions regarding the functional integration of the compartmentalised genetic system characteristic of the eukaryotic cell. Its highly developed taxonomy and genetics, together with a favourable combination of features in its genetic structure (interspecific fertility, stable heterozygous progeny, biparental transmission of organelles, and the phenomenon of complex heterozygosity), allow facile exchanges of nuclei, plastids and mitochondria, as well as individual chromosome pairs, between species. The resulting hybrids or cybrids are usually viable and fertile, but can display various forms of developmental disturbance.

  8. COMPLETE NUCLEOTIDE SEQUENCE OF SPHEROIDIN GENES OF CALLIPTAMUS ITALICUS ENTOMOPOXVIRUS(CIEPV) AND GOMPHOCERUS SIBIRICUS ENTOMOPOXVIRUS(GSEPV)

    Institute of Scientific and Technical Information of China (English)

    Yong-danLi; Li-yingWang; Xi-wuGao; Chao-yangZhao; Zhao-fengTian

    2004-01-01

    The spheroidin genes of Calliptamus italicus entomopoxvirus (CiEPV) and Gomphocerus sibiricus entomopoxvirus (GsEPV) were obtained by PCR,and the fragments were cloned, sequenced and analyzed. The CiEPV and GsEPV spheroidin genes respectively harbored ORFs of 2 922 bps and 2 967 bps that were capable of coding polypeptides of 109.2 and 111.1 kDa. Computer analysis indicated that CiEPV and GsEPV spheroidins shared less than 20% amino acid identities with lepidopteran AmEPV and coleopteran AcEPV spheroidins, but more than 80% amino acid identities with orthopteran OaEPV, MsEPV and AaEPV spheroidins. The CiEPV and GsEPV spheroidins respectively contained 19 and 21 cysteine residues that were particularly abundant at the C-termini, as is the case with those of the other orthopteran EPV spheroidins. The numbers and locations of the cysteine residues of the spheroidins were most similar to those of the spheroidins of EPVs that are virulent on the same insect orders. The promoter regions of the two spheroidin genes were highly conserved (99%) among the orthopteran EPVs and also contained the typical very A+T rich and TAAATG signal mediating transcription of poxvirus late genes. We also sequenced an incomplete ORF downstream of the pheroidin gene of CiEPV and GsEPV. The ORF was in the opposite direction to the spheroidin gene and was homologous to MSV072 putative protein of MsEPV.

  9. Species delimitation of common reef corals in the genus Pocillopora using nucleotide sequence phylogenies, population genetics and symbiosis ecology.

    Science.gov (United States)

    Pinzón, Jorge H; LaJeunesse, Todd C

    2011-01-01

    Stony corals in the genus Pocillopora are among the most common and widely distributed of Indo-Pacific corals and, as such, are often the subject of physiological and ecological research. In the far Tropical Eastern Pacific (TEP), they are major constituents of shallow coral communities, exhibiting considerable variability in colony shape and branch morphology and marked differences in response to thermal stress. Numerous intermediates occur between morphospecies that may relate to extensive hybridization. The diversity of the Pocillopora genus in the TEP was analysed genetically using nuclear ribosomal (ITS2) and mitochondrial (ORF) sequences, and population genetic markers (seven microsatellite loci). The resident dinoflagellate endosymbiont (Symbiodinium sp.) in each sample was also characterized using sequences of the internal transcribed spacer 2 (ITS2) rDNA and the noncoding region of the chloroplast psbA minicircle. From these analyses, three symbiotically distinct, reproductively isolated, nonhybridizing, evolutionarily divergent animal lineages were identified. Designated types 1, 2 and 3, these groupings were incongruent with traditional morphospecies classification. Type 1 was abundant and widespread throughout the TEP; type 2 was restricted to the Clipperton Atoll; and type 3 was found only in Panama and the Galapagos Islands. Each type harboured a different Symbiodinium'species lineage' in Clade C, and only type 1 associated with the 'stress-tolerant'Symbiodinium glynni (D1). The accurate delineation of species and implementation of a proper taxonomy may profoundly improve our assessment of Pocillopora's reproductive biology, biogeographic distributions, and resilience to climate warming, information that must be considered when planning for the conservation of reef corals. © 2010 Blackwell Publishing Ltd.

  10. Long Terminal Repeat Retrotransposon Content in Eight Diploid Sunflower Species Inferred from Next-Generation Sequence Data

    Science.gov (United States)

    Tetreault, Hannah M.; Ungerer, Mark C.

    2016-01-01

    The most abundant transposable elements (TEs) in plant genomes are Class I long terminal repeat (LTR) retrotransposons represented by superfamilies gypsy and copia. Amplification of these superfamilies directly impacts genome structure and contributes to differential patterns of genome size evolution among plant lineages. Utilizing short-read Illumina data and sequence information from a panel of Helianthus annuus (sunflower) full-length gypsy and copia elements, we explore the contribution of these sequences to genome size variation among eight diploid Helianthus species and an outgroup taxon, Phoebanthus tenuifolius. We also explore transcriptional dynamics of these elements in both leaf and bud tissue via RT-PCR. We demonstrate that most LTR retrotransposon sublineages (i.e., families) display patterns of similar genomic abundance across species. A small number of LTR retrotransposon sublineages exhibit lineage-specific amplification, particularly in the genomes of species with larger estimated nuclear DNA content. RT-PCR assays reveal that some LTR retrotransposon sublineages are transcriptionally active across all species and tissue types, whereas others display species-specific and tissue-specific expression. The species with the largest estimated genome size, H. agrestis, has experienced amplification of LTR retrotransposon sublineages, some of which have proliferated independently in other lineages in the Helianthus phylogeny. PMID:27233667

  11. The mitochondrial genome sequence of the ciliate Paramecium caudatum reveals a shift in nucleotide composition and codon usage within the genus Paramecium

    Directory of Open Access Journals (Sweden)

    Berendonk Thomas U

    2011-05-01

    Full Text Available Abstract Background Despite the fact that the organization of the ciliate mitochondrial genome is exceptional, only few ciliate mitochondrial genomes have been sequenced until today. All ciliate mitochondrial genomes are linear. They are 40 kb to 47 kb long and contain some 50 tightly packed genes without introns. Earlier studies documented that the mitochondrial guanine + cytosine contents are very different between Paramecium tetraurelia and all studied Tetrahymena species. This raises the question of whether the high mitochondrial G+C content observed in P. tetraurelia is a characteristic property of Paramecium mtDNA, or whether it is an exception of the ciliate mitochondrial genomes known so far. To test this question, we determined the mitochondrial genome sequence of Paramecium caudatum and compared the gene content and sequence properties to the closely related P. tetraurelia. Results The guanine + cytosine content of the P. caudatum mitochondrial genome was significantly lower than that of P. tetraurelia (22.4% vs. 41.2%. This difference in the mitochondrial nucleotide composition was accompanied by significantly different codon usage patterns in both species, i.e. within P. caudatum clearly A/T ending codons dominated, whereas for P. tetraurelia the synonymous codons were more balanced with a higher number of G/C ending codons. Further analyses indicated that the nucleotide composition of most members of the genus Paramecium resembles that of P. caudatum and that the shift observed in P. tetraurelia is restricted to the P. aurelia species complex. Conclusions Surprisingly, the codon usage bias in the P. caudatum mitochondrial genome, exemplified by the effective number of codons, is more similar to the distantly related T. pyriformis and other single-celled eukaryotes such as Chlamydomonas, than to the closely related P. tetraurelia. These differences in base composition and codon usage bias were, however, not reflected in the amino

  12. 16S-23S rDNA intergenic spacer region polymorphism of Lactococcus garvieae, Lactococcus raffinolactis and Lactococcus lactis as revealed by PCR and nucleotide sequence analysis.

    Science.gov (United States)

    Blaiotta, Giuseppe; Pepe, Olimpia; Mauriello, Gianluigi; Villani, Francesco; Andolfi, Rosamaria; Moschetti, Giancarlo

    2002-12-01

    The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of "Fior di Latte" cheese were analyzed. After 16S-23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S-23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S-23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates.

  13. Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

    Science.gov (United States)

    Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

    2016-01-01

    Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

  14. Genetic relatedness among indigenous rice varieties in the Eastern Himalayan region based on nucleotide sequences of the Waxy gene.

    Science.gov (United States)

    Choudhury, Baharul I; Khan, Mohammed L; Dayanandan, Selvadurai

    2014-12-29

    Indigenous rice varieties in the Eastern Himalayan region of Northeast India are traditionally classified into sali, boro and jum ecotypes based on geographical locality and the season of cultivation. In this study, we used DNA sequence data from the Waxy (Wx) gene to infer the genetic relatedness among indigenous rice varieties in Northeast India and to assess the genetic distinctiveness of ecotypes. The results of all three analyses (Bayesian, Maximum Parsimony and Neighbor Joining) were congruent and revealed two genetically distinct clusters of rice varieties in the region. The large group comprised several varieties of sali and boro ecotypes, and all agronomically improved varieties. The small group consisted of only traditionally cultivated indigenous rice varieties, which included one boro, few sali and all jum varieties. The fixation index analysis revealed a very low level of differentiation between sali and boro (F(ST) = 0.005), moderate differentiation between sali and jum (F(ST) = 0.108) and high differentiation between jum and boro (F(ST) = 0.230) ecotypes. The genetic relatedness analyses revealed that sali, boro and jum ecotypes are genetically heterogeneous, and the current classification based on cultivation type is not congruent with the genetic background of rice varieties. Indigenous rice varieties chosen from genetically distinct clusters could be used in breeding programs to improve genetic gain through heterosis, while maintaining high genetic diversity.

  15. Characterization of the transcriptome, nucleotide sequence polymorphism, and natural selection in the desert adapted mouse Peromyscus eremicus

    Directory of Open Access Journals (Sweden)

    Matthew D. MacManes

    2014-10-01

    Full Text Available As a direct result of intense heat and aridity, deserts are thought to be among the most harsh of environments, particularly for their mammalian inhabitants. Given that osmoregulation can be challenging for these animals, with failure resulting in death, strong selection should be observed on genes related to the maintenance of water and solute balance. One such animal, Peromyscus eremicus, is native to the desert regions of the southwest United States and may live its entire life without oral fluid intake. As a first step toward understanding the genetics that underlie this phenotype, we present a characterization of the P. eremicus transcriptome. We assay four tissues (kidney, liver, brain, testes from a single individual and supplement this with population level renal transcriptome sequencing from 15 additional animals. We identified a set of transcripts undergoing both purifying and balancing selection based on estimates of Tajima’s D. In addition, we used the branch-site test to identify a transcript—Slc2a9, likely related to desert osmoregulation—undergoing enhanced selection in P. eremicus relative to a set of related non-desert rodents.

  16. Detection and copy number estimation of the transgenic nucleotide sequences in an unknown GM event of Oryza sativa

    Directory of Open Access Journals (Sweden)

    Ali M. Sajjad

    2016-12-01

    Full Text Available The present study was designed to establish a qualitative detection method based on conventional and real time PCR assay to screen the commonly grown rice varieties for the presence of the cry1Ac gene. The detection of genetically modified rice in the screening process would necessitate accurate assay development and precise qualitative PCR tests complying with established procedures for the detection and characterization of transgenes in food grains. Such assay would not only enable the monitoring of transgene flow in local agricultural environment but also the characterization of different plant species produced with this transgene and its regulatory components. Thus, a reliable and quick screening assay was established for the qualitative detection of the transgene along with the promoter and selectable marker gene in genetically modified rice. By conventional PCR, a fragment of 215 bp was amplified with gene specific primers of cry1Ac. Primers for other transgenes such as gna and bar were also employed; however, no amplification was detected. The presence of the p35s, sps, and nptII genes was confirmed by qualitative real-time PCR. The specificity of the respective PCR products was checked through melt peak curve analysis. Sharp and precise melting temperatures indicated the presence of a single kind of PCR product in correspondence to each of the primers used. Moreover, the copy number of cry1Ac was estimated by ∆∆CT method. It is proposed that the primer sets and experimental conditions used in this study will be sufficient to meet the requirements for molecular detection and characterization of the cry1Ac transgene and affiliated sequences in sorting out conventional rice varieties from the ones which are genetically modified. It will also help to monitor the ecological flow of these transgenes and other biosafety factors.

  17. Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds.

    Directory of Open Access Journals (Sweden)

    Nedenia Bonvino Stafuzza

    Full Text Available Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose, Gyr, Girolando and Holstein (dairy production. A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs and 3,828,041 insertions/deletions (InDels were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.

  18. Genome-wide association study using high-density single nucleotide polymorphism arrays and whole-genome sequences for clinical mastitis traits in dairy cattle.

    Science.gov (United States)

    Sahana, G; Guldbrandtsen, B; Thomsen, B; Holm, L-E; Panitz, F; Brøndum, R F; Bendixen, C; Lund, M S

    2014-11-01

    Mastitis is a mammary disease that frequently affects dairy cattle. Despite considerable research on the development of effective prevention and treatment strategies, mastitis continues to be a significant issue in bovine veterinary medicine. To identify major genes that affect mastitis in dairy cattle, 6 chromosomal regions on Bos taurus autosome (BTA) 6, 13, 16, 19, and 20 were selected from a genome scan for 9 mastitis phenotypes using imputed high-density single nucleotide polymorphism arrays. Association analyses using sequence-level variants for the 6 targeted regions were carried out to map causal variants using whole-genome sequence data from 3 breeds. The quantitative trait loci (QTL) discovery population comprised 4,992 progeny-tested Holstein bulls, and QTL were confirmed in 4,442 Nordic Red and 1,126 Jersey cattle. The targeted regions were imputed to the sequence level. The highest association signal for clinical mastitis was observed on BTA 6 at 88.97 Mb in Holstein cattle and was confirmed in Nordic Red cattle. The peak association region on BTA 6 contained 2 genes: vitamin D-binding protein precursor (GC) and neuropeptide FF receptor 2 (NPFFR2), which, based on known biological functions, are good candidates for affecting mastitis. However, strong linkage disequilibrium in this region prevented conclusive determination of the causal gene. A different QTL on BTA 6 located at 88.32 Mb in Holstein cattle affected mastitis. In addition, QTL on BTA 13 and 19 were confirmed to segregate in Nordic Red cattle and QTL on BTA 16 and 20 were confirmed in Jersey cattle. Although several candidate genes were identified in these targeted regions, it was not possible to identify a gene or polymorphism as the causal factor for any of these regions. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  19. [Application of single nucleotide polymorphism-microarray and target gene sequencing in the study of genetic etiology of children with unexplained intellectual disability or developmental delay].

    Science.gov (United States)

    Gao, Z J; Jiang, Q; Cheng, D Z; Yan, X X; Chen, Q; Xu, K M

    2016-10-02

    Objective: To evaluate the application of single nucleotide polymorphism (SNP)-microarray and target gene sequencing technology in the clinical molecular genetic diagnosis of unexplained intellectual disability(ID) or developmental delay (DD). Method: Patients with ID or DD were recruited in the Department of Neurology, Affiliated Children's Hospital of Capital Institute of Pediatrics between September 2015 and February 2016. The intellectual assessment of the patients was performed using 0-6-year-old pediatric examination table of neuropsychological development or Wechsler intelligence scale (>6 years). Patients with a DQ less than 49 or IQ less than 51 were included in this study. The patients were scanned by SNP-array for detection of genomic copy number variations (CNV), and the revealed genomic imbalance was confirmed by quantitative real time-PCR. Candidate gene mutation screening was carried out by target gene sequencing technology.Causal mutations or likely pathogenic variants were verified by polymerase chain reaction and direct sequencing. Result: There were 15 children with ID or DD enrolled, 9 males and 6 females. The age of these patients was 7 months-16 years and 9 months. SNP-array revealed that two of the 15 patients had genomic CNV. Both CNV were de novo micro deletions, one involved 11q24.1q25 and the other micro deletion located on 21q22.2q22.3. Both micro deletions were proved to have a clinical significance due to their association with ID, brain DD, unusual faces etc. by querying Decipher database. Thirteen patients with negative findings in SNP-array were consequently examined with target gene sequencing technology, genotype-phenotype correlation analysis and genetic analysis. Five patients were diagnosed with monogenic disorder, two were diagnosed with suspected genetic disorder and six were still negative. Conclusion: Sequential use of SNP-array and target gene sequencing technology can significantly increase the molecular genetic etiologic

  20. Organelle Simple Sequence Repeat Markers Help to Distinguish Carpelloid Stamen and Normal Cytoplasmic Male Sterile Sources in Broccoli

    Science.gov (United States)

    Shu, Jinshuai; Liu, Yumei; Li, Zhansheng; Zhang, Lili; Fang, Zhiyuan; Yang, Limei; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao

    2015-01-01

    We previously discovered carpelloid stamens when breeding cytoplasmic male sterile lines in broccoli (Brassica oleracea var. italica). In this study, hybrids and multiple backcrosses were produced from different cytoplasmic male sterile carpelloid stamen sources and maintainer lines. Carpelloid stamens caused dysplasia of the flower structure and led to hooked or coiled siliques with poor seed setting, which were inherited in a maternal fashion. Using four distinct carpelloid stamens and twelve distinct normal stamens from cytoplasmic male sterile sources and one maintainer, we used 21 mitochondrial simple sequence repeat (mtSSR) primers and 32 chloroplast SSR primers to identify a mitochondrial marker, mtSSR2, that can differentiate between the cytoplasm of carpelloid and normal stamens. Thereafter, mtSSR2 was used to identify another 34 broccoli accessions, with an accuracy rate of 100%. Analysis of the polymorphic sequences revealed that the mtSSR2 open reading frame of carpelloid stamen sterile sources had a deletion of 51 bases (encoding 18 amino acids) compared with normal stamen materials. The open reading frame is located in the coding region of orf125 and orf108 of the mitochondrial genomes in Brassica crops and had the highest similarity with Raphanus sativus and Brassica carinata. The current study has not only identified a useful molecular marker to detect the cytoplasm of carpelloid stamens during broccoli breeding, but it also provides evidence that the mitochondrial genome is maternally inherited and provides a basis for studying the effect of the cytoplasm on flower organ development in plants. PMID:26407159

  1. A novel family of sequence-specific endoribonucleases associated with the clustered regularly interspaced short palindromic repeats.

    Science.gov (United States)

    Beloglazova, Natalia; Brown, Greg; Zimmerman, Matthew D; Proudfoot, Michael; Makarova, Kira S; Kudritska, Marina; Kochinyan, Samvel; Wang, Shuren; Chruszcz, Maksymilian; Minor, Wladek; Koonin, Eugene V; Edwards, Aled M; Savchenko, Alexei; Yakunin, Alexander F

    2008-07-18

    Clustered regularly interspaced short palindromic repeats (CRISPRs) together with the associated CAS proteins protect microbial cells from invasion by foreign genetic elements using presently unknown molecular mechanisms. All CRISPR systems contain proteins of the CAS2 family, suggesting that these uncharacterized proteins play a central role in this process. Here we show that the CAS2 proteins represent a novel family of endoribonucleases. Six purified CAS2 proteins from diverse organisms cleaved single-stranded RNAs preferentially within U-rich regions. A representative CAS2 enzyme, SSO1404 from Sulfolobus solfataricus, cleaved the phosphodiester linkage on the 3'-side and generated 5'-phosphate- and 3'-hydroxyl-terminated oligonucleotides. The crystal structure of SSO1404 was solved at 1.6A resolution revealing the first ribonuclease with a ferredoxin-like fold. Mutagenesis of SSO1404 identified six residues (Tyr-9, Asp-10, Arg-17, Arg-19, Arg-31, and Phe-37) that are important for enzymatic activity and suggested that Asp-10 might be the principal catalytic residue. Thus, CAS2 proteins are sequence-specific endoribonucleases, and we propose that their role in the CRISPR-mediated anti-phage defense might involve degradation of phage or cellular mRNAs.

  2. Genetic Diversity of Arabica Coffee (Coffea arabica L. in Nicaragua as Estimated by Simple Sequence Repeat Markers

    Directory of Open Access Journals (Sweden)

    Mulatu Geleta

    2012-01-01

    Full Text Available Coffea arabica L. (arabica coffee, the only tetraploid species in the genus Coffea, represents the majority of the world’s coffee production and has a significant contribution to Nicaragua’s economy. The present paper was conducted to determine the genetic diversity of arabica coffee in Nicaragua for its conservation and breeding values. Twenty-six populations that represent eight varieties in Nicaragua were investigated using simple sequence repeat (SSR markers. A total of 24 alleles were obtained from the 12 loci investigated across 260 individual plants. The total Nei’s gene diversity (HT and the within-population gene diversity (HS were 0.35 and 0.29, respectively, which is comparable with that previously reported from other countries and regions. Among the varieties, the highest diversity was recorded in the variety Catimor. Analysis of variance (AMOVA revealed that about 87% of the total genetic variation was found within populations and the remaining 13% differentiate the populations (FST=0.13; P<0.001. The variation among the varieties was also significant. The genetic variation in Nicaraguan coffee is significant enough to be used in the breeding programs, and most of this variation can be conserved through ex situ conservation of a low number of populations from each variety.

  3. Inter-Simple Sequence Repeat (ISSR Markers to Study Genetic Diversity Among Cotton Cultivars in Associated with Salt Tolerance

    Directory of Open Access Journals (Sweden)

    Ali Akbar ABDI

    2012-11-01

    Full Text Available Developing salt-tolerant crops is very important as a significant proportion of cultivated land is salt-affected. Screening and selection of salt tolerant genotypes of cotton using DNA molecular markers not only introduce tolerant cultivars useful for hybridization and breeding programs but also detect DNA regions involved in mechanism of salinity tolerance. To study this, 28 cotton cultivars, including 8 Iranian cotton varieties were grown in pots under greenhouse condition and three salt treatments were imposed with salt solutions (0, 70 and 140 mM NaCl. Eight agronomic traits including root length, root fresh weight, root dry weight, chlorophyll and fluorescence index, K+ and Na+ contents in shoot (above ground biomass, and K+/Na+ ratio were measured. Cluster analysis of cultivars based on measured agronomic traits, showed �Cindose� and �Ciacra� as the most tolerant cultivars, and �B-557� and �43347� as the most sensitive cultivars of salt damage. A total of 65 polymorphic DNA fragments were generated at 14 inter-simple sequence repeat (ISSR loci. Plants of 28 cultivars of cotton grouped into three clusters based on ISSR markers. Regression analysis of markers in relation with traits data showed that 23, 33 and 30 markers associated with the measured traits in three salt treatments respectively. These markers might help breeders in any marker assisted selection program in order to improving cotton cultivars against salt stress.

  4. Molecular characterization of three common olive (Olea europaea L.) cultivars in Palestine, using simple sequence repeat (SSR) markers.

    Science.gov (United States)

    Obaid, Ramiz; Abu-Qaoud, Hassan; Arafeh, Rami

    2014-09-03

    Eight accessions of olive trees from three common varieties in Palestine, Nabali Baladi, Nabali Mohassan and Surri, were genetically evaluated using five simple sequence repeat (SSR) markers. A total of 17 alleles from 5 loci were observed in which 15 (88.2%) were polymorphic and 2 (11.8%) were monomorphic. An average of 3.4 alleles per locus was found ranging from 2.0 alleles with the primers GAPU-103 and DCA-9 to 5.0 alleles with U9932 and DCA-16. The smallest amplicon size observed was 50 bp with the primer DCA-16, whereas the largest one (450 bp) with the primer U9932. Cluster analysis with the unweighted pair group method with arithmetic average (UPGMA) showed three clusters: a cluster with four accessions from the 'Nabali Baladi' cultivar, another cluster with three accessions that represents the 'Nabali Mohassen' cultivar and finally the 'Surri' cultivar. The similarity coefficient for the eight olive tree samples ranged from a maximum of 100% between two accessions from Nabali Baladi and also in two other samples from Nabali Mohassan, to a minimum similarity coefficient (0.315) between the Surri and two Nabali Baladi accessions. The results in this investigation clearly highlight the genetic dissimilarity between the three main olive cultivars that have been misidentified and mixed up in the past, based on conventional morphological characters.

  5. Transferability of simple sequence repeat (SSR) markers developed in guava (Psidium guajava L.) to four Myrtaceae species.

    Science.gov (United States)

    Rai, Manoj K; Phulwaria, Mahendra; Shekhawat, N S

    2013-08-01

    Present study demonstrated the cross-genera transferability of 23 simple sequence repeat (SSR) primer pairs developed for guava (Psidium guajava L.) to four new targets, two species of eucalypts (Eucalyptus citriodora, Eucalyptus camaldulensis), bottlebrush (Callistemon lanceolatus) and clove (Syzygium aromaticum), belonging to the family Myrtaceae and subfamily Myrtoideae. Off the 23 SSR loci assayed, 18 (78.2%) gave cross-amplification in E. citriodora, 14 (60.8%) in E. camaldulensis and 17-17 (73.9%) in C. lanceolatus and S. aromaticum. Eight primer pairs were found to be transferable to all four species. The number of alleles detected at each locus ranged from one to nine, with an average of 4.8, 2.6, 4.5 and 4.6 alleles in E. citriodora, E. camaldulensis, C. lanceolatus and S. aromaticum, respectively. The high levels of cross-genera transferability of guava SSRs may be applicable for the analysis of intra- and inter specific genetic diversity of target species, especially in E. citriodora, C. lanceolatus and S. aromaticum, for which till date no information about EST-derived as well as genomic SSR is available.

  6. Evaluation of genetic diversity amongst Descurainia sophia L. genotypes by inter-simple sequence repeat (ISSR) marker.

    Science.gov (United States)

    Saki, Sahar; Bagheri, Hedayat; Deljou, Ali; Zeinalabedini, Mehrshad

    2016-01-01

    Descurainia sophia is a valuable medicinal plant in family of Brassicaceae. To determine the range of diversity amongst D. sophia in Iran, 32 naturally distributed plants belonging to six natural populations of the Iranian plateau were investigated by inter-simple sequence repeat (ISSR) markers. The average percentage of polymorphism produced by 12 ISSR primers was 86 %. The PIC values for primers ranged from 0.22 to 0.40 and Rp values ranged between 6.5 and 19.9. The relative genetic diversity of the populations was not high (Gst =0.32). However, the value of gene flow revealed by the ISSR marker was high (Nm = 1.03). UPGMA clustering method based on Jaccard similarity coefficient grouped the genotypes into two major clusters. Graph results from Neighbor-Net Network generated after a 1000 bootstrap test using Jaccard coefficient, and STRUCTURE analysis confirmed the UPGMA clustering. The first three PCAs represented 57.31 % of the total variation. The high levels of genetic diversity were observed within populations, which is useful in breeding and conservation programs. ISSR is found to be an eligible marker to study genetic diversity of D. sophia.

  7. Diversity and genetic stability in banana genotypes in a breeding program using inter simple sequence repeats (ISSR) markers.

    Science.gov (United States)

    Silva, A V C; Nascimento, A L S; Vitória, M F; Rabbani, A R C; Soares, A N R; Lédo, A S

    2017-02-23

    Banana (Musa spp) is a fruit species frequently cultivated and consumed worldwide. Molecular markers are important for estimating genetic diversity in germplasm and between genotypes in breeding programs. The objective of this study was to analyze the genetic diversity of 21 banana genotypes (FHIA 23, PA42-44, Maçã, Pacovan Ken, Bucaneiro, YB42-47, Grand Naine, Tropical, FHIA 18, PA94-01, YB42-17, Enxerto, Japira, Pacovã, Prata-Anã, Maravilha, PV79-34, Caipira, Princesa, Garantida, and Thap Maeo), by using inter-simple sequence repeat (ISSR) markers. Material was generated from the banana breeding program of Embrapa Cassava & Fruits and evaluated at Embrapa Coastal Tablelands. The 12 primers used in this study generated 97.5% polymorphism. Four clusters were identified among the different genotypes studied, and the sum of the first two principal components was 48.91%. From the Unweighted Pair Group Method using Arithmetic averages (UPGMA) dendrogram, it was possible to identify two main clusters and subclusters. Two genotypes (Garantida and Thap Maeo) remained isolated from the others, both in the UPGMA clustering and in the principal cordinate analysis (PCoA). Using ISSR markers, we could analyze the genetic diversity of the studied material and state that these markers were efficient at detecting sufficient polymorphism to estimate the genetic variability in banana genotypes.

  8. Estimating Genetic Conformism of Korean Mulberry Cultivars Using Random Amplified Polymorphic DNA and Inter-Simple Sequence Repeat Profiling

    Directory of Open Access Journals (Sweden)

    Sunirmal Sheet

    2018-03-01

    Full Text Available Apart from being fed to silkworms in sericulture, the ecologically important Mulberry plant has been used for traditional medicine in Asian countries as well as in manufacturing wine, food, and beverages. Germplasm analysis among Mulberry cultivars originating from South Korea is crucial in the plant breeding program for cultivar development. Hence, the genetic deviations and relations among 8 Morus alba plants, and one Morus lhou plant, of different cultivars collected from South Korea were investigated using 10 random amplified polymorphic DNA (RAPD and 10 inter-simple sequence repeat (ISSR markers in the present study. The ISSR markers exhibited a higher polymorphism (63.42% among mulberry genotypes in comparison to RAPD markers. Furthermore, the similarity coefficient was estimated for both markers and found to be varying between 0.183 and 0.814 for combined pooled data of ISSR and RAPD. The phenogram drawn using the UPGMA cluster method based on combined pooled data of RAPD and ISSR markers divided the nine mulberry genotypes into two divergent major groups and the two individual independent accessions. The distant relationship between Dae-Saug (SM1 and SangchonJo Sang Saeng (SM5 offers a possibility of utilizing them in mulberry cultivar improvement of Morus species of South Korea.

  9. Analysis of genetic relationships and identification of lily cultivars based on inter-simple sequence repeat markers.

    Science.gov (United States)

    Cui, G F; Wu, L F; Wang, X N; Jia, W J; Duan, Q; Ma, L L; Jiang, Y L; Wang, J H

    2014-07-29

    Inter-simple sequence repeat (ISSR) markers were used to discriminate 62 lily cultivars of 5 hybrid series. Eight ISSR primers generated 104 bands in total, which all showed 100% polymorphism, and an average of 13 bands were amplified by each primer. Two software packages, POPGENE 1.32 and NTSYSpc 2.1, were used to analyze the data matrix. Our results showed that the observed number of alleles (NA), effective number of alleles (NE), Nei's genetic diversity (H), and Shannon's information index (I) were 1.9630, 1.4179, 0.2606, and 0.4080, respectively. The highest genetic similarity (0.9601) was observed between the Oriental x Trumpet and Oriental lilies, which indicated that the two hybrids had a close genetic relationship. An unweighted pair-group method with arithmetic means dendrogram showed that the 62 lily cultivars clustered into two discrete groups. The first group included the Oriental and OT cultivars, while the Asiatic, LA, and Longiflorum lilies were placed in the second cluster. The distribution of individuals in the principal component analysis was consistent with the clustering of the dendrogram. Fingerprints of all lily cultivars built from 8 primers could be separated completely. This study confirmed the effect and efficiency of ISSR identification in lily cultivars.

  10. Genetic variability in Brazilian populations of Biomphalaria straminea complex detected by simple sequence repeat anchored polymerase chain reaction amplification

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2001-01-01

    Full Text Available Biomphalaria glabrata, B. tenagophila and B. straminea are intermediate hosts of Schistosoma mansoni, in Brazil. The latter is of epidemiological importance in the northwest of Brazil and, due to morphological similarities, has been grouped with B. intermedia and B. kuhniana in a complex named B. straminea. In the current work, we have standardized the simple sequence repeat anchored polymerase chain reaction (SSR-PCR technique, using the primers (CA8RY and K7, to study the genetic variability of these species. The similarity level was calculated using the Dice coefficient and genetic distance using the Nei and Li coefficient. The trees were obtained by the UPGMA and neighbor-joining methods. We have observed that the most related individuals belong to the same species and locality and that individuals from different localities, but of the same species, present clear heterogeneity. The trees generated using both methods showed similar topologies. The SSR-PCR technique was shown to be very efficient in intrapopulational and intraspecific studies of the B. straminea complex snails.

  11. Isolation, sequencing and expression of RED, a novel human gene encoding an acidic-basic dipeptide repeat.

    Science.gov (United States)

    Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T

    1999-04-16

    A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.

  12. Genetic diversity of the Andean tuber-bearing species, oca (Oxalis tuberosa Mol.), investigated by inter-simple sequence repeats.

    Science.gov (United States)

    Pissard, A; Ghislain, M; Bertin, P

    2006-01-01

    The Andean tuber-bearing species, Oxalis tuberosa Mol., is a vegetatively propagated crop cultivated in the uplands of the Andes. Its genetic diversity was investigated in the present study using the inter-simple sequence repeat (ISSR) technique. Thirty-two accessions originating from South America (Argentina, Bolivia, Chile, and Peru) and maintained in vitro were chosen to represent the ecogeographic diversity of its cultivation area. Twenty-two primers were tested and 9 were selected according to fingerprinting quality and reproducibility. Genetic diversity analysis was performed with 90 markers. Jaccard's genetic distance between accessions ranged from 0 to 0.49 with an average of 0.28 +/- 0.08 (mean +/- SD). Dendrogram (UPGMA (unweighted pair-group method with arithmetic averaging)) and factorial correspondence analysis (FCA) showed that the genetic structure was influenced by the collection site. The two most distant clusters contained all of the Peruvian accessions, one from Bolivia, none from Argentina or Chile. Analysis by country revealed that Peru presented the greatest genetic distances from the other countries and possessed the highest intra-country genetic distance (0.30 +/- 0.08). This suggests that the Peruvian oca accessions form a distinct genetic group. The relatively low level of genetic diversity in the oca species may be related to its predominating reproduction strategy, i.e., vegetative propagation. The extent and structure of the genetic diversity of the species detailed here should help the establishment of conservation strategies.

  13. Genetic mapping of ascochyta blight resistance in chickpea (Cicer arietinum L.) using a simple sequence repeat linkage map.

    Science.gov (United States)

    Tar'an, B; Warkentin, T D; Tullu, A; Vandenberg, A

    2007-01-01

    Ascochyta blight, caused by the fungus Ascochyta rabiei (Pass.) Lab., is one of the most devastating diseases of chickpea (Cicer arietinum L.) worldwide. Research was conducted to map genetic factors for resistance to ascochyta blight using a linkage map constructed with 144 simple sequence repeat markers and 1 morphological marker (fc, flower colour). Stem cutting was used to vegetatively propagate 186 F2 plants derived from a cross between Cicer arietinum L. 'ICCV96029' and 'CDC Frontier'. A total of 556 cutting-derived plants were evaluated for their reaction to ascochyta blight under controlled conditions. Disease reaction of the F1 and F2 plants demonstrated that the resistance was dominantly inherited. A Fain's test based on the means and variances of the ascochyta blight reaction of the F3 families showed that a few genes were segregating in the population. Composite interval mapping identified 3 genomic regions that were associated with the reaction to ascochyta blight. One quantitative trait locus (QTL) on each of LG3, LG4, and LG6 accounted for 13%, 29%, and 12%, respectively, of the total estimated phenotypic variation for the reaction to ascochyta blight. Together, these loci controlled 56% of the total estimated phenotypic variation. The QTL on LG4 and LG6 were in common with the previously reported QTL for ascochyta blight resistance, whereas the QTL on LG3 was unique to the current population.

  14. Molecular Comparison and Evolutionary Analyses of VP1 Nucleotide Sequences of New African Human Enterovirus 71 Isolates Reveal a Wide Genetic Diversity

    Science.gov (United States)

    Nougairède, Antoine; Joffret, Marie-Line; Deshpande, Jagadish M.; Dubot-Pérès, Audrey; Héraud, Jean-Michel

    2014-01-01

    Most circulating strains of Human enterovirus 71 (EV-A71) have been classified primarily into three genogroups (A to C) on the basis of genetic divergence between the 1D gene, which encodes the VP1 capsid protein. The aim of the present study was to provide further insights into the diversity of the EV-A71 genogroups following the recent description of highly divergent isolates, in particular those from African countries, including Madagascar. We classified recent EV-A71 isolates by a large comparison of 3,346 VP1 nucleotidic sequences collected from GenBank. Analysis of genetic distances and phylogenetic investigations indicated that some recently-reported isolates did not fall into the genogroups A-C and clustered into three additional genogroups, including one Indian genogroup (genogroup D) and 2 African ones (E and F). Our Bayesian phylogenetic analysis provided consistent data showing that the genogroup D isolates share a recent common ancestor with the members of genogroup E, while the isolates of genogroup F evolved from a recent common ancestor shared with the members of the genogroup B. Our results reveal the wide diversity that exists among EV-A71 isolates and suggest that the number of circulating genogroups is probably underestimated, particularly in developing countries where EV-A71 epidemiology has been poorly studied. PMID:24598878

  15. Next-Generation Sequencing Approaches in Genome-Wide Discovery of Single Nucleotide Polymorphism Markers Associated with Pungency and Disease Resistance in Pepper.

    Science.gov (United States)

    Manivannan, Abinaya; Kim, Jin-Hee; Yang, Eun-Young; Ahn, Yul-Kyun; Lee, Eun-Su; Choi, Sena; Kim, Do-Sun

    2018-01-01

    Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS) approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP) indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.

  16. Next-Generation Sequencing Approaches in Genome-Wide Discovery of Single Nucleotide Polymorphism Markers Associated with Pungency and Disease Resistance in Pepper

    Directory of Open Access Journals (Sweden)

    Abinaya Manivannan

    2018-01-01

    Full Text Available Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.

  17. Nucleotide and Predicted Amino Acid Sequence-Based Analysis of the Avian Metapneumovirus Type C Cell Attachment Glycoprotein Gene: Phylogenetic Analysis and Molecular Epidemiology of U.S. Pneumoviruses

    Science.gov (United States)

    Alvarez, Rene; Lwamba, Humphrey M.; Kapczynski, Darrell R.; Njenga, M. Kariuki; Seal, Bruce S.

    2003-01-01

    A serologically distinct avian metapneumovirus (aMPV) was isolated in the United States after an outbreak of turkey rhinotracheitis (TRT) in February 1997. The newly recognized U.S. virus was subsequently demonstrated to be genetically distinct from European subtypes and was designated aMPV serotype C (aMPV/C). We have determined the nucleotide sequence of the gene encoding the cell attachment glycoprotein (G) of aMPV/C (Colorado strain and three Minnesota isolates) and predicted amino acid sequence by sequencing cloned cDNAs synthesized from intracellular RNA of aMPV/C-infected cells. The nucleotide sequence comprised 1,321 nucleotides with only one predicted open reading frame encoding a protein of 435 amino acids, with a predicted Mr of 48,840. The structural characteristics of the predicted G protein of aMPV/C were similar to those of the human respiratory syncytial virus (hRSV) attachment G protein, including two mucin-like regions (heparin-binding domains) flanking both sides of a CX3C chemokine motif present in a conserved hydrophobic pocket. Comparison of the deduced G-protein amino acid sequence of aMPV/C with those of aMPV serotypes A, B, and D, as well as hRSV revealed overall predicted amino acid sequence identities ranging from 4 to 16.5%, suggesting a distant relationship. However, G-protein sequence identities ranged from 72 to 97% when aMPV/C was compared to other members within the aMPV/C subtype or 21% for the recently identified human MPV (hMPV) G protein. Ratios of nonsynonymous to synonymous nucleotide changes were greater than one in the G gene when comparing the more recent Minnesota isolates to the original Colorado isolate. Epidemiologically, this indicates positive selection among U.S. isolates since the first outbreak of TRT in the United States. PMID:12682171

  18. THE USE OF INTER SIMPLE SEQUENCE REPEATS (ISSR) IN DISTINGUISHING NEIGHBORING DOUGLAS-FIR TREES AS A MEANS TO IDENTIFYING TREE ROOTS WITH ABOVE-GROUND BIOMASS

    Science.gov (United States)

    We are attempting to identify specific root fragments from soil cores with individual trees. We successfully used Inter Simple Sequence Repeats (ISSR) to distinguish neighboring old-growth Douglas-fir trees from one another, while maintaining identity among each tree's parts. W...

  19. Direct repeat sequences are essential for function of the cis-acting locus of transfer (clt) of Streptomyces phaeochromogenes plasmid pJV1.

    Science.gov (United States)

    Franco, Bernardo; González-Cerón, Gabriela; Servín-González, Luis

    2003-11-01

    The functionality of direct and inverted repeat sequences inside the cis acting locus of transfer (clt) of the Streptomyces plasmid pJV1 was determined by testing the effect of different deletions on plasmid transfer. The results show that the single most important element for pJV1 clt function is a series of evenly spaced 9 bp long direct repeats which match the consensus CCGCACA(C/G)(C/G), since their deletion caused a dramatic reduction in plasmid transfer. The presence of these repeats in the absence of any other clt sequences allowed plasmid transfer to occur at a frequency that was at least two orders of magnitude higher than that obtained in the complete absence of clt. A database search revealed regions with a similar organization, and in the same position, in Streptomyces plasmids pSN22 and pSLS, which have transfer proteins homologous to those of pJV1.

  20. Clinical and molecular characterization of a cohort of patients with novel nucleotide alterations of the Dystrophin gene detected by direct sequencing

    Directory of Open Access Journals (Sweden)

    Corti Stefania

    2011-03-01

    Full Text Available Abstract Background Duchenne and Becker Muscular dystrophies (DMD/BMD are allelic disorders caused by mutations in the dystrophin gene, which encodes a sarcolemmal protein responsible for muscle integrity. Deletions and duplications account for approximately 75% of mutations in DMD and 85% in BMD. The implementation of techniques allowing complete gene sequencing has focused attention on small point mutations and other mechanisms underlying complex rearrangements. Methods We selected 47 patients (41 families; 35 DMD, 6 BMD without deletions and duplications in DMD gene (excluded by multiplex ligation-dependent probe amplification and multiplex polymerase chain reaction analysis. This cohort was investigated by systematic direct sequence analysis to study sequence variation. We focused our attention on rare mutational events which were further studied through transcript analysis. Results We identified 40 different nucleotide alterations in DMD gene and their clinical correlates; altogether, 16 mutations were novel. DMD probands carried 9 microinsertions/microdeletions, 19 nonsense mutations, and 7 splice-site mutations. BMD patients carried 2 nonsense mutations, 2 splice-site mutations, 1 missense substitution, and 1 single base insertion. The most frequent stop codon was TGA (n = 10 patients, followed by TAG (n = 7 and TAA (n = 4. We also analyzed the molecular mechanisms of five rare mutational events. They are two frame-shifting mutations in the DMD gene 3'end in BMD and three novel splicing defects: IVS42: c.6118-3C>A, which causes a leaky splice-site; c.9560A>G, which determines a cryptic splice-site activation and c.9564-426 T>G, which creates pseudoexon retention within IVS65. Conclusion The analysis of our patients' sample, carrying point mutations or complex rearrangements in DMD gene, contributes to the knowledge on phenotypic correlations in dystrophinopatic patients and can provide a better understanding of pre-mRNA maturation defects

  1. Comparing Enterovirus 71 with Coxsackievirus A16 by analyzing nucleotide sequences and antigenicity of recombinant proteins of VP1s and VP4s

    Directory of Open Access Journals (Sweden)

    Sun Yu

    2011-11-01

    Full Text Available Abstract Background Enterovirus 71 (EV71 and Coxsackievirus A16 (CA16 are two major etiological agents of Hand, Foot and Mouth Disease (HFMD. EV71 is associated with severe cases but not CA16. The mechanisms contributed to the different pathogenesis of these two viruses are unknown. VP1 and VP4 are two major structural proteins of these viruses, and should be paid close attention to. Results The sequences of vp1s from 14 EV71 and 14 CA16, and vp4s from 10 EV71 and 1 CA16 isolated in this study during 2007 to 2009 HFMD seasons were analyzed together with the corresponding sequences available in GenBank using DNAStar and MEGA 4.0. Phylogenetic analysis of complete vp1s or vp4s showed that EV71 isolated in Beijing belonged to C4 and CA16 belonged to lineage B2 (lineage C. VP1s and VP4s from 4 strains of viruses expressed in E. coli BL21 cells were used to detect IgM and IgG in human sera by Western Blot. The detection of IgM against VP1s of EV71 and CA16 showed consistent results with current infection, while none of the sera were positive against VP4s of EV71 and CA16. There was significant difference in the positive rates between EV71 VP1 and CA16 VP1 (χ2 = 5.02, P 2 = 15.30, P 2 = 26.47, P 2 = 16.78, P Conclusions EV71 and CA16 were highly diverse in the nucleotide sequences of vp1s and vp4s. The sera positive rates of VP1 and VP4 of EV71 were lower than those of CA16 respectively, which suggested a less exposure rate to EV71 than CA16 in Beijing population. Human serum antibodies detected by Western blot using VP1s and VP4s as antigen indicated that the immunological reaction to VP1 and VP4 of both EV71 and CA16 was different.

  2. Repeated fault rupture recorded by paleoenvironmental changes in a wetland sedimentary sequence ponded against the Alpine Fault, New Zealand

    Science.gov (United States)

    Clark, K.; Berryman, K. R.; Cochran, U. A.; Bartholomew, T.; Turner, G. M.

    2010-12-01

    At Hokuri Creek, in south Westland, New Zealand, an 18 m thickness of Holocene sediments has accumulated against the upthrown side of the Alpine Fault. Recent fluvial incision has created numerous exposures of this sedimentary sequence. At a decimetre to metre scale there are two dominant types of sedimentary units: clastic-dominated, grey silt packages, and organic-dominated, light brown peaty-silt units. These units represent repeated alternations of the paleoenvironment due to fault rupture over the past 7000 years. We have located the event horizons within the sedimentary sequence, and identified evidence to support earthquake-driven paleoenvironmental change (rather than climatic variability), and developed a model of paleoenvironmental changes over a typical seismic cycle. To quantitatively characterise the sediments we use high resolution photography, x-ray imaging, magnetic-susceptibility and total carbon analysis. To understand the depositional environment we used diatom and pollen studies. The organic-rich units have very low magnetic susceptibility and density values, with high greyscale and high total carbon values. Diatoms indicate these units represent stable wetland environments with standing water and predominantly in-situ organic material deposition. The clastic-rich units are characterised by higher magnetic susceptibility and density values, with low greyscale and total carbon. The clastic-rich units represent environments of flowing water and deep pond settings that received predominantly catchment-derived silt and sand. The event horizon is located at the upper contact of the organic-rich horizons. The event horizon contact marks a drastic change in hydrologic regime as fault rupture changed the stream base level and there was a synchronous influx of clastic sediment as the catchment responded to earthquake shaking. During the interseismic period the flowing-water environment gradually stabilised and returned to an organic-rich wetland. Such

  3. Genetic variation in Rhodomyrtus tomentosa (Kemunting) populations from Malaysia as revealed by inter-simple sequence repeat markers.

    Science.gov (United States)

    Hue, T S; Abdullah, T L; Abdullah, N A P; Sinniah, U R

    2015-12-14

    Kemunting (Rhodomyrtus tomentosa) from the Myrtaceae family, is native to Malaysia. It is widely used in traditional medicine to treat various illnesses and possesses significant antibacterial properties. In addition, it has great potential as ornamental in landscape design. Genetic variability studies are important for the rational management and conservation of genetic material. In the present study, inter-simple sequence repeat markers were used to assess the genetic diversity of 18 R. tomentosa populations collected from ten states of Peninsular Malaysia. The 11 primers selected generated 173 bands that ranged in size from 1.6 kb to 130 bp, which corresponded to an average of 15.73 bands per primer. Of these bands, 97.69% (169 in total) were polymorphic. High genetic diversity was documented at the species level (H(T) = 0.2705; I = 0.3973; PPB = 97.69%) but there was a low diversity at population level (H(S) = 0.0073; I = 0 .1085; PPB = 20.14%). The high level of genetic differentiation revealed by G(ST) (73%) and analysis of molecular variance (63%), together with the limited gene flow among population (N(m) = 0.1851), suggests that the populations examined are isolated. Results from an unweighted pair group method with arithmetic mean dendrogram and principal coordinate analysis clearly grouped the populations into two geographic groups. This clear grouping can also be demonstrated by the significant Mantel test (r = 0.581, P = 0.001). We recommend that all the R. tomentosa populations be preserved in conservation program.

  4. Genetic diversity and population structure analysis in Perilla frutescens from Northern areas of China based on simple sequence repeats.

    Science.gov (United States)

    Ma, S J; Sa, K J; Hong, T K; Lee, J K

    2017-09-21

    In this study, 21 simple sequence repeat (SSR) markers were used to evaluate the genetic diversity and population structure among 77 Perilla accessions from high-latitude and middle-latitude areas of China. Ninety-five alleles were identified with an average of 4.52 alleles per locus. The average polymorphic information content (PIC) and genetic diversity values were 0.346 and 0.372, respectively. The level of genetic diversity and PIC value for cultivated accessions of Perilla frutescens var. frutescens from middle-latitude areas were higher than accessions from high-latitude areas. Based on the dendrogram of unweighted pair group method with arithmetic mean (UPGMA), all accessions were classified into four major groups with a genetic similarity of 46%. All accessions of the cultivated var. frutescens were discriminated from the cultivated P. frutescens var. crispa. Furthermore, most accessions of the cultivated var. frutescens collected in high-latitude and middle-latitude areas were distinguished depending on their geographical location. However, the geographical locations of several accessions of the cultivated var. frutescens have no relation with their positions in the UPGMA dendrogram and population structure. This result implies that the diffusion of accessions of the cultivated Perilla crop in the northern areas of China might be through multiple routes. On the population structure analysis, 77 Perilla accessions were divided into Group I, Group II, and an admixed group based on a membership probability threshold of 0.8. Finally, the findings in this study can provide useful theoretical knowledge for further study on the population structure and genetic diversity of Perilla and benefit for Perilla crop breeding and germplasm conservation.

  5. Genetic diversity analysis of cyanogenic potential (CNp) of root among improved genotypes of cassava using simple sequence repeat markers.

    Science.gov (United States)

    Moyib, O K; Mkumbira, J; Odunola, O A; Dixon, A G

    2012-12-01

    Cyanogenic potential (CNp) of cassava constitutes a serious problem for over 500 million people who rely on the crop as their main source of calories. Genetic diversity is a key to successful crop improvement for breeding new improved variability for target traits. Forty-three improved genotypes of cassava developed by International Institute of Tropical Agriculture (ITA), Ibadan, were characterized for CNp trait using 35 Simple Sequence.Repeat (SSR) markers. Essential colorimetry picric test was used for evaluation of CNp on a color scale of 1 to 14. The CNp scores obtained ranged from 3 to 9, with a mean score of 5.48 (+/- 0.09) based on Statistical Analysis System (SAS) package. TMS M98/ 0068 (4.0 +/- 0.25) was identified as the best genotype with low CNp while TMS M98/0028 (7.75 +/- 0.25) was the worst. The 43 genotypes were assigned into 7 phenotypic groups based on rank-sum analysis in SAS. Dissimilarity analysis representatives for windows generated a phylogenetic tree with 5 clusters which represented hybridizing groups. Each of the clusters (except 4) contained low CNp genotypes that could be used for improving the high CNp genotypes in the same or near cluster. The scatter plot of the genotypes showed that there was little or no demarcation for phenotypic CNp groupings in the molecular groupings. The result of this study demonstrated that SSR markers are powerful tools for the assessment of genetic variability, and proper identification and selection of parents for genetic improvement of low CNp trait among the IITA cassava collection.

  6. Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

    Science.gov (United States)

    Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

    2014-11-01

    In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

  7. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

  8. DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα-encoding (GNAS genomic imprinting domain are associated with performance traits

    Directory of Open Access Journals (Sweden)

    Mullen Michael P

    2011-01-01

    Full Text Available Abstract Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486 were located upstream of the GNAS gene, while one SNP (rs41694646 was located in the second intron of the GNAS gene. The final SNP (rs41694656 was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646 is associated (P ≤ 0.05 with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf and gestation length. Association (P ≤ 0.01 with direct calving difficulty (i.e. due to calf size and maternal calving difficulty (i.e. due to the maternal pelvic width size was also observed at the rs

  9. Loss and recovery of Arabidopsis-type telomere repeat sequences 5'-(TTTAGGG)(n)-3' in the evolution of a major radiation of flowering plants.

    OpenAIRE

    Adams, S. P.; Hartman, T. P.; Lim, K. Y.; Chase, M. W.; Bennett, M. D.; Leitch, I. J.; Leitch, A. R.

    2001-01-01

    Fluorescent in situ hybridization and Southern blotting were used for showing the predominant absence of the Arabidopsis-type telomere repeat sequence (TRS) 5'-(TTTAGGG)(n)-3' (the 'typical' telomere) in a monocot clade which comprises up to 6300 species within Asparagales. Initially, two apparently disparate genera that lacked the typical telomere were identified. Here, we used the new angiosperm phylogenetic classification for predicting in which other related families such telomeres might ...

  10. Association Analysis of Simple Sequence Repeat (SSR Markers with Agronomic Traits in Tall Fescue (Festuca arundinacea Schreb..

    Directory of Open Access Journals (Sweden)

    Yanhong Lou

    Full Text Available Tall fescue is widely used in temperate regions throughout the world as a dominant forage grass as well as a turfgrass, in pastoral and turf industry. However, the utilization of tall fescue was limited because of its leaf roughness, poor regeneration ability and poor stress resistance. New cultivars were desirable in modern pastoral industries exceed the potential of existing cultivars. Therefore, well understanding the agronomic traits and describing germplasms would help to overcome these constraints, and morphological evaluation of tall fescue germplasm is the key component in selecting rational parents for hybridization breeding. However, describing the morphological traits of tall fescue germplasm is costly and time-consuming. Fortunately, biotechnology approaches can supplement conventional breeding efforts for tall fescue improvement. Association mapping, as a powerful approach to identify association between agronomic traits and molecular markers has been widely used for enhancing the utilization, conservation and management of the tall fescue germplasms. Therefore, in the present research, 115 tall fescue accessions from different origins (25 accessions are cultivars; 31 accessions from America; 32 accessions from European; 7 accessions from Africa; 20 accessions from Asia, were evaluated for agronomic traits and genetic diversity with 90 simple sequence repeat (SSR markers. The panel displayed significant variation in spike count per plant (SCP and spike weight (SW. However, BCS performed the lowest CV among all the observed agronomic traits. Three subpopulations were identified within the collections but no obvious relative kinship (K was found. The GLM model was used to describe the association between SSR and agronomic traits. Fifty-one SSR markers associated with agronomic traits were observed. Twelve single-associated markers were associated with PH; six single-associated markers were associated with BCS; eight single

  11. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  12. High-resolution comparative mapping among man, cattle and mouse suggests a role for repeat sequences in mammalian genome evolution

    Directory of Open Access Journals (Sweden)

    Rodolphe François

    2006-08-01

    Full Text Available Abstract Background Comparative mapping provides new insights into the evolutionary history of genomes. In particular, recent studies in mammals have suggested a role for segmental duplication in genome evolution. In some species such as Drosophila or maize, transposable elements (TEs have been shown to be involved in chromosomal rearrangements. In this work, we have explored the presence of interspersed repeats in regions of chromosomal rearrangements, using an updated high-resolution integrated comparative map among cattle, man and mouse. Results The bovine, human and mouse comparative autosomal map has been constructed using data from bovine genetic and physical maps and from FISH-mapping studies. We confirm most previous results but also reveal some discrepancies. A total of 211 conserved segments have been identified between cattle and man, of which 33 are new segments and 72 correspond to extended, previously known segments. The resulting map covers 91% and 90% of the human and bovine genomes, respectively. Analysis of breakpoint regions revealed a high density of species-specific interspersed repeats in the human and mouse genomes. Conclusion Analysis of the breakpoint regions has revealed specific repeat density patterns, suggesting that TEs may have played a significant role in chromosome evolution and genome plasticity. However, we cannot rule out that repeats and breakpoints accumulate independently in the few same regions where modifications are better tolerated. Likewise, we cannot ascertain whether increased TE density is the cause or the consequence of chromosome rearrangements. Nevertheless, the identification of high density repeat clusters combined with a well-documented repeat phylogeny should highlight probable breakpoints, and permit their precise dating. Combining new statistical models taking the present information into account should help reconstruct ancestral karyotypes.

  13. Characterization of the Complete Nucleotide Sequences of IncA/C2 Plasmids Carrying In809-Like Integrons from Enterobacteriaceae Isolates of Wildlife Origin.

    Science.gov (United States)

    Papagiannitsis, Costas C; Kutilova, Iva; Medvecky, Matej; Hrabak, Jaroslav; Dolejska, Monika

    2017-09-01

    A total of 18 Enterobacteriaceae (17 from gulls and 1 from a clinical sample) collected from Australia, carrying IncA/C plasmids with the IMP-encoding In809-like integrons, were studied. Seven plasmids, being representatives of different origins, plasmid sizes, replicon combinations, and resistance genes, were completely sequenced. Plasmid pEc158, identified in a clinical Escherichia coli ST752 isolate, showed extensive similarity to type 2 IncA/C 2 plasmids. pEc158 carried none of the bla CMY-2 -like region or ARI-B and ARI-A regions, while it contained a hybrid transposon structure. The six remaining plasmids, which were of wildlife origin, were highly similar to each other and probably were fusion derivatives of type 1 and type 2 A/C 2 plasmids. The latter plasmids contained an ARI-B region and hybrid transposon structures. In all plasmids, hybrid transposon structures containing In809-like integrons were inserted 3,434 bp downstream of the rhs2 start codon. In all cases, the one outermost 38-bp inverted repeat (IR) of the transposon was associated with the Tn 1696 tnp module, while the other outermost 38-bp IR of the transposon was associated with either a Tn 6317 -like module or a Tn 21 mer module. However, the internal structure of the transposon and the resistance genes were different in each plasmid. These findings indicated that, for the specific periods of time and settings, different IncA/C 2 plasmid types carrying In809-like elements circulated among isolates of wildlife and clinical origins. Additionally, they provided the basis for speculations regarding the reshuffling of IncA/C 2 plasmids with In809-like integrons and confirmed the rapid evolution of IncA/C 2 plasmid lineages. Copyright © 2017 American Society for Microbiology.

  14. Sequence determinants of human microsatellite variability

    Directory of Open Access Journals (Sweden)

    Jakobsson Mattias

    2009-12-01

    Full Text Available Abstract Background Microsatellite loci are frequently used in genomic studies of DNA sequence repeats and in population studies of genetic variability. To investigate the effect of sequence properties of microsatellites on their level of variability we have analyzed genotypes at 627 microsatellite loci in 1,048 worldwide individuals from the HGDP-CEPH cell line panel together with the DNA sequences of these microsatellites in the human RefSeq database. Results Calibrating PCR fragment lengths in individual genotypes by using the RefSeq sequence enabled us to infer repeat number in the HGDP-CEPH dataset and to calculate the mean number of repeats (as opposed to the mean PCR fragment length, under the assumption that differences in PCR fragment length reflect differences in the numbers of repeats in the embedded repeat sequences. We find the mean and maximum numbers of repeats across individuals to be positively correlated with heterozygosity. The size and composition of the repeat unit of a microsatellite are also important factors in predicting heterozygosity, with tetra-nucleotide repeat units high in G/C content leading to higher heterozygosity. Finally, we find that microsatellites containing more separate sets of repeated motifs generally have higher heterozygosity. Conclusions These results suggest that sequence properties of microsatellites have a significant impact in determining the features of human microsatellite variability.

  15. The DUB/USP17 deubiquitinating enzymes: A gene family within a tandemly repeated sequence, is also embedded within the copy number variable Beta-defensin cluster

    Directory of Open Access Journals (Sweden)

    Scott Christopher J

    2010-04-01

    Full Text Available Abstract Background The DUB/USP17 subfamily of deubiquitinating enzymes were originally identified as immediate early genes induced in response to cytokine stimulation in mice (DUB-1, DUB-1A, DUB-2, DUB-2A. Subsequently we have identified a number of human family members and shown that one of these (DUB-3 is also cytokine inducible. We originally showed that constitutive expression of DUB-3 can block cell proliferation and more recently we have demonstrated that this is due to its regulation of the ubiquitination and activity of the 'CAAX' box protease RCE1. Results Here we demonstrate that the human DUB/USP17 family members are found on both chromosome 4p16.1, within a block of tandem repeats, and on chromosome 8p23.1, embedded within the copy number variable beta-defensin cluster. In addition, we show that the multiple genes observed in humans and other distantly related mammals have arisen due to the independent expansion of an ancestral sequence within each species. However, it is also apparent when sequences from humans and the more closely related chimpanzee are compared, that duplication events have taken place prior to these species separating. Conclusions The observation that the DUB/USP17 genes, which can influence cell growth and survival, have evolved from an unstable ancestral sequence which has undergone multiple and varied duplications in the species examined marks this as a unique family. In addition, their presence within the beta-defensin repeat raises the question whether they may contribute to the influence of this repeat on immune related conditions.

  16. Simulating efficiently the evolution of DNA sequences.

    Science.gov (United States)

    Schöniger, M; von Haeseler, A

    1995-02-01

    Two menu-driven FORTRAN programs are described that simulate the evolution of DNA sequences in accordance with a user-specified model. This general stochastic model allows for an arbitrary stationary nucleotide composition and any transition-transversion bias during the process of base substitution. In addition, the user may define any hypothetical model tree according to which a family of sequences evolves. The programs suggest the computationally most inexpensive approach to generate nucleotide substitutions. Either reproducible or non-repeatable simulations, depending on the method of initializing the pseudo-random number generator, can be performed. The corresponding options are offered by the interface menu.

  17. Rapid functional and sequence differentiation of a tandemly repeated species-specific multigene family in Drosophila

    DEFF Research Database (Denmark)

    Clifton, Bryan D.; Sanz, Pablo Librado; Yeh, Shu-Dan

    2017-01-01

    Gene clusters of recently duplicated genes are hotbeds for evolutionary change. However, our understanding of how mutational mechanisms and evolutionary forces shape the structural and functional evolution of these clusters is hindered by the high sequence identity among the copies, which typical...

  18. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide

    2015-10-01

    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  19. Nucleotide sequences of the cDNAs encoding the V-regions of H- and L-chains of a human monoclonal antibody with broad reactivity to malignant tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Kishimoto, Toshimitsu; Okajima, Hideki; Okumoto, Takeki [Yoshitomi Pharmaceutical Industries, Ltd., Saitama (Japan); Taniguchi, Masaru [Chiba Univ. (Japan)

    1989-06-12

    The human monoclonal antibody secreted from 4G12 hybridoma cells has broad reactivity to malignant tumor cells, especially for lung squamous cell carcinomas, and recognizes a new tumor-associated and differentiation antigen. The antigen detected by 4G12 is a glycoprotein with MW 195,000 and MW 65,000 under nonreducing and reducing conditions, respectively. Screening of a 4G12 {lambda}gt10 cDNA library with constant region probes for human immunoglobulin yielded full length clones for H- and L-chains. Nucleotide sequences revealed that subtypes of the variable regions were V{sub HIII} and {lambda}{sub 1}, respectively.

  20. Survey of clustered regularly interspaced short palindromic repeats and their associated Cas proteins (CRISPR/Cas) systems in multiple sequenced strains of Klebsiella pneumoniae.

    Science.gov (United States)

    Ostria-Hernández, Martha Lorena; Sánchez-Vallejo, Carlos Javier; Ibarra, J Antonio; Castro-Escarpulli, Graciela

    2015-08-04

    In recent years the emergence of multidrug resistant Klebsiella pneumoniae strains has been an increasingly common event. This opportunistic species is one of the five main bacterial pathogens that cause hospital infections worldwide and multidrug resistance has been associated with the presence of high molecular weight plasmids. Plasmids are generally acquired through horizontal transfer and therefore is possible that systems that prevent the entry of foreign genetic material are inactive or absent. One of these systems is CRISPR/Cas. However, little is known regarding the clustered regularly interspaced short palindromic repeats and their associated Cas proteins (CRISPR/Cas) system in K. pneumoniae. The adaptive immune system CRISPR/Cas has been shown to limit the entry of foreign genetic elements into bacterial organisms and in some bacteria it has been shown to be involved in regulation of virulence genes. Thus in this work we used bioinformatics tools to determine the presence or absence of CRISPR/Cas systems in available K. pneumoniae genomes. The complete CRISPR/Cas system was identified in two out of the eight complete K. pneumoniae genomes sequences and in four out of the 44 available draft genomes sequences. The cas genes in these strains comprises eight cas genes similar to those found in Escherichia coli, suggesting they belong to the type I-E group, although their arrangement is slightly different. As for the CRISPR sequences, the average lengths of the direct repeats and spacers were 29 and 33 bp, respectively. BLAST searches demonstrated that 38 of the 116 spacer sequences (33%) are significantly similar to either plasmid, phage or genome sequences, while the remaining 78 sequences (67%) showed no significant similarity to other sequences. The region where the CRISPR/Cas systems were located is the same in all the Klebsiella genomes containing it, it has a syntenic architecture, and is located among genes encoding for proteins likely involved in

  1. Nucleotide sequence of a cDNA coding for the amino-terminal region of human prepro. alpha. 1(III) collagen

    Energy Technology Data Exchange (ETDEWEB)

    Toman, P D; Ricca, G A [Rorer Biotechnology, Inc., Springfield, VA (USA); de Crombrugghe, B [National Institutes of Health, Bethesda, MD (USA)

    1988-07-25

    Type III Collagen is synthesized in a variety of tissues as a precursor macromolecule containing a leader sequence, a N-propeptide, a N-telopeptide, the triple helical region, a C-telopeptide, and C-propeptide. To further characterize the human type III collagen precursor, a human placental cDNA library was constructed in gt11 using an oligonucleotide derived from a partial cDNA sequence corresponding to the carboxy-terminal part of the 1(III) collagen. A cDNA was identified which contains the leader sequence, the N-propeptide and N-telopeptide regions. The DNA sequence of these regions are presented here. The triple helical, C-telopeptide and C-propeptide amino acid sequence for human type III collagen has been determined previously. A comparison of the human amino acid sequence with mouse, chicken, and calf sequence shows 81%, 81%, and 92% similarity, respectively. At the DNA level, the sequence similarity between human and mouse or chicken type III collagen sequences in this area is 82% and 77%, respectively.

  2. Subtyping Salmonella enterica serovar enteritidis isolates from different sources by using sequence typing based on virulence genes and clustered regularly interspaced short palindromic repeats (CRISPRs).

    Science.gov (United States)

    Liu, Fenyun; Kariyawasam, Subhashinie; Jayarao, Bhushan M; Barrangou, Rodolphe; Gerner-Smidt, Peter; Ribot, Efrain M; Knabel, Stephen J; Dudley, Edward G

    2011-07-01

    Salmonella enterica subsp. enterica serovar Enteritidis is a major cause of food-borne salmonellosis in the United States. Two major food vehicles for S. Enteritidis are contaminated eggs and chicken meat. Improved subtyping methods are needed to accurately track specific strains of S. Enteritidis related to human salmonellosis throughout the chicken and egg food system. A sequence typing scheme based on virulence genes (fimH and sseL) and clustered regularly interspaced short palindromic repeats (CRISPRs)-CRISPR-including multi-virulence-locus sequence typing (designated CRISPR-MVLST)-was used to characterize 35 human clinical isolates, 46 chicken isolates, 24 egg isolates, and 63 hen house environment isolates of S. Enteritidis. A total of 27 sequence types (STs) were identified among the 167 isolates. CRISPR-MVLST identified three persistent and predominate STs circulating among U.S. human clinical isolates and chicken, egg, and hen house environmental isolates in Pennsylvania, and an ST that was found only in eggs and humans. It also identified a potential environment-specific sequence type. Moreover, cluster analysis based on fimH and sseL identified a number of clusters, of which several were found in more than one outbreak, as well as 11 singletons. Further research is needed to determine if CRISPR-MVLST might help identify the ecological origins of S. Enteritidis strains that contaminate chickens and eggs.

  3. Variable number of tandem repeat markers in the genome sequence of Mycosphaerella fijiensis, the causal agent of black leaf streak disease of banana (Musa spp).

    Science.gov (United States)

    Garcia, S A L; Van der Lee, T A J; Ferreira, C F; Te Lintel Hekkert, B; Zapater, M-F; Goodwin, S B; Guzmán, M; Kema, G H J; Souza, M T

    2010-11-09

    We searched the genome of Mycosphaerella fijiensis for molecular markers that would allow population genetics analysis of this plant pathogen. M. fijiensis, the causal agent of banana leaf streak disease, also known as black Sigatoka, is the most devastating pathogen attacking bananas (Musa spp). Recently, the entire genome sequence of M. fijiensis became available. We screened this database for VNTR markers. Forty-two primer pairs were selected for validation, based on repeat type and length and the number of repeat units. Five VNTR markers showing multiple alleles were validated with a reference set of isolates from different parts of the world and a population from a banana plantation in Costa Rica. Polymorphism information content values varied from 0.6414 to 0.7544 for the reference set and from 0.0400 and 0.7373 for the population set. Eighty percent of the polymorphism information content values were above 0.60, indicating that the markers are highly informative. These markers allowed robust scoring of agarose gels and proved to be useful for variability and population genetics studies. In conclusion, the strategy we developed to identify and validate VNTR markers is an efficient means to incorporate markers that can be used for fungicide resistance management and to develop breeding strategies to control banana black leaf streak disease. This is the first report of VNTR-minisatellites from the M. fijiensis genome sequence.

  4. Regulation of HFE expression by poly(ADP-ribose) polymerase-1 (PARP1) through an inverted repeat DNA sequence in the distal promoter.

    Science.gov (United States)

    Pelham, Christopher; Jimenez, Tamara; Rodova, Marianna; Rudolph, Angela; Chipps, Elizabeth; Islam, M Rafiq

    2013-12-01

    Hereditary hemochromatosis (HH) is a common autosomal recessive disorder of iron overload among Caucasians of northern European descent. Over 85% of all cases with HH are due to mutations in the hemochromatosis protein (HFE) involved in iron metabolism. Although the importance in iron homeostasis is well recognized, the mechanism of sensing and regulating iron absorption by HFE, especially in the absence of iron response element in its gene, is not fully understood. In this report, we have identified an inverted repeat sequence (ATGGTcttACCTA) within 1700bp (-1675/+35) of the HFE promoter capable to form cruciform structure that binds PARP1 and strongly represses HFE promoter. Knockdown of PARP1 increases HFE mRNA and protein. Similarly, hemin or FeCl3 treatments resulted in increase in HFE expression by reducing nuclear PARP1 pool via its apoptosis induced cleavage, leading to upregulation of the iron regulatory hormone hepcidin mRNA. Thus, PARP1 binding to the inverted repeat sequence on the HFE promoter may serve as a novel iron sensing mechanism as increased iron level can trigger PARP1 cleavage and relief of HFE transcriptional repression. © 2013.

  5. Identification of Variable-Number Tandem-Repeat (VNTR) Sequences in Acinetobacter baumannii and Interlaboratory Validation of an Optimized Multiple-Locus VNTR Analysis Typing Scheme▿†

    Science.gov (United States)

    Pourcel, Christine; Minandri, Fabrizia; Hauck, Yolande; D'Arezzo, Silvia; Imperi, Francesco; Vergnaud, Gilles; Visca, Paolo

    2011-01-01

    Acinetobacter baumannii is an important opportunistic pathogen responsible for nosocomial outbreaks, mostly occurring in intensive care units. Due to the multiplicity of infection sources, reliable molecular fingerprinting techniques are needed to establish epidemiological correlations among A. baumannii isolates. Multiple-locus variable-number tandem-repeat analysis (MLVA) has proven to be a fast, reliable, and cost-effective typing method for several bacterial species. In this study, an MLVA assay compatible with simple PCR- and agarose gel-based electrophoresis steps as well as with high-throughput automated methods was developed for A. baumannii typing. Preliminarily, 10 potential polymorphic variable-number tandem repeats (VNTRs) were identified upon bioinformatic screening of six annotated genome sequences of A. baumannii. A collection of 7 reference strains plus 18 well-characterized isolates, including unique types and representatives of the three international A. baumannii lineages, was then evaluated in a two-center study aimed at validating the MLVA assay and comparing it with other genotyping assays, namely, macrorestriction analysis with pulsed-field gel electrophoresis (PFGE) and PCR-based sequence group (SG) profiling. The results showed that MLVA can discriminate between isolates with identical PFGE types and SG profiles. A panel of eight VNTR markers was selected, all showing the ability to be amplified and good amounts of polymorphism in the majority of strains. Independently generated MLVA profiles, composed of an ordered string of allele numbers corresponding to the number of repeats at each VNTR locus, were concordant between centers. Typeability, reproducibility, stability, discriminatory power, and epidemiological concordance were excellent. A database containing information and MLVA profiles for several A. baumannii strains is available from http://mlva.u-psud.fr/. PMID:21147956

  6. Partial nucleotide sequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmo trutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles.

    Science.gov (United States)

    McMeel, O M; Hoey, E M; Ferguson, A

    2001-01-01

    The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.

  7. A 19-nucleotide insertion in the leader sequence of avian leukosis virus subgroup J contributes to its replication in vitro but is not related to its pathogenicity in vivo.

    Directory of Open Access Journals (Sweden)

    Xiaolin Ji

    Full Text Available Subgroup J avian leukosis virus (ALV-J was first isolated from meat-type chickens that had developed myeloid leukosis and since 2008, ALV-J infections in chickens have become widespread in China. A comparison of the sequence of ALV-J epidemic isolates with HPRS-103, the ALV-J prototype virus, revealed several distinct features, one of which is a 19-nucleotide (nt insertion in the leader sequence. To determine the role of the 19-nt insertion in ALV-J pathogenicity, a pair of viruses were constructed and rescued. The first virus was an ALV-J Chinese isolate (designated rSD1009 containing the 19-nt insertion in its leader sequence. The second virus was a clone, in which the leader sequence had a deleted 19-nt sequence (designated rSD1009△19. Compared with rSD1009△19, rSD1009 displayed a moderate growth advantage in vitro. However, no differences were demonstrated in either viral replication or oncogenicity between the two rescued viruses in chickens. These results indicated that the 19-nt insertion contributed to ALV-J replication in vitro but was not related to its pathogenicity in vivo.

  8. In situ optical sequencing and structure analysis of a trinucleotide repeat genome region by localization microscopy after specific COMBO-FISH nano-probing

    Science.gov (United States)

    Stuhlmüller, M.; Schwarz-Finsterle, J.; Fey, E.; Lux, J.; Bach, M.; Cremer, C.; Hinderhofer, K.; Hausmann, M.; Hildenbrand, G.

    2015-10-01

    Trinucleotide repeat expansions (like (CGG)n) of chromatin in the genome of cell nuclei can cause neurological disorders such as for example the Fragile-X syndrome. Until now the mechanisms are not clearly understood as to how these expansions develop during cell proliferation. Therefore in situ investigations of chromatin structures on the nanoscale are required to better understand supra-molecular mechanisms on the single cell level. By super-resolution localization microscopy (Spectral Position Determination Microscopy; SPDM) in combination with nano-probing using COMBO-FISH (COMBinatorial Oligonucleotide FISH), novel insights into the nano-architecture of the genome will become possible. The native spatial structure of trinucleotide repeat expansion genome regions was analysed and optical sequencing of repetitive units was performed within 3D-conserved nuclei using SPDM after COMBO-FISH. We analysed a (CGG)n-expansion region inside the 5' untranslated region of the FMR1 gene. The number of CGG repeats for a full mutation causing the Fragile-X syndrome was found and also verified by Southern blot. The FMR1 promotor region was similarly condensed like a centromeric region whereas the arrangement of the probes labelling the expansion region seemed to indicate a loop-like nano-structure. These results for the first time demonstrate that in situ chromatin structure measurements on the nanoscale are feasible. Due to further methodological progress it will become possible to estimate the state of trinucleotide repeat mutations in detail and to determine the associated chromatin strand structural changes on the single cell level. In general, the application of the described approach to any genome region will lead to new insights into genome nano-architecture and open new avenues for understanding mechanisms and their relevance in the development of heredity diseases.

  9. Evolutionary history of Phakopsora pachyrhizi (the Asian soybean rust in Brazil based on nucleotide sequences of the internal transcribed spacer region of the nuclear ribosomal DNA

    Directory of Open Access Journals (Sweden)

    Maíra C. M. Freire

    2008-01-01

    Full Text Available Phakopsora pachyrhizi has dispersed globally and brought severe economic losses to soybean growers. The fungus has been established in Brazil since 2002 and is found nationwide. To gather information on the temporal and spatial patterns of genetic variation in P. pachyrhizi , we sequenced the nuclear internal transcribed spacer regions (ITS1 and ITS2. Total genomic DNA was extracted using either lyophilized urediniospores or lesions removed from infected leaves sampled from 26 soybean fields in Brazil and one field in South Africa. Cloning prior to sequencing was necessary because direct sequencing of PCR amplicons gave partially unreadable electrophoretograms with peak displacements suggestive of multiple sequences with length polymorphism. Sequences were determined from four clones per field. ITS sequences from African or Asian isolates available from the GenBank were included in the analyses. Independent sequence alignments of the ITS1 and ITS2 datasets identified 27 and 19 ribotypes, respectively. Molecular phylogeographic analyses revealed that ribotypes of widespread distribution in Brazil displayed characteristics of ancestrality and were shared with Africa and Asia, while ribotypes of rare occurrence in Brazil were indigenous. The results suggest P. pachyrhizi found in Brazil as originating from multiple, independent long-distance dispersal events.

  10. Peptide and nucleotide sequences of rat CD4 (W3/25) antigen: evidence for derivation from a structure with four immunoglobulin-related domains

    International Nuclear Information System (INIS)

    Clark, S.J.; Jefferies, W.A.; Barclay, A.N.; Gagnon, J.; Williams, A.F.

    1987-01-01

    The rat W3/25 antigen was the first marker antigen of helper T lymphocytes to be identified. Subsequently, the human OKT4 antigen (now called CD4) was described, and cell distribution and functional data suggested that W3/25 and OKT4 antigens were homologous. This is now confirmed by the matching of peptide sequences from W3/25 antigen with sequence predicted from rat cDNA clones detected by cross-hybridization with a cDNA probe for human CD4. Analysis of the two sequences suggests an evolutionary origin from a structure with four immunoglobulin-related domains, although only domain 1 at the NH 2 terminus meets the standard criteria for an immunoglobulin-related sequence. CD4 domains 2 and 4 contain disulfide bonds but seem like truncated immunoglobulin domains, whereas domain 3 may have a pattern of β-strands like an immunoglobulin variable domain, but without the disulfide bond

  11. Genetic diversity of the captive Asian tapir population in Thailand, based on mitochondrial control region sequence data and the comparison of its nucleotide structure with Brazilian tapir.

    Science.gov (United States)

    Muangkram, Yuttamol; Amano, Akira; Wajjwalku, Worawidh; Pinyopummintr, Tanu; Thongtip, Nikorn; Kaolim, Nongnid; Sukmak, Manakorn; Kamolnorranath, Sumate; Siriaroonrat, Boripat; Tipkantha, Wanlaya; Maikaew, Umaporn; Thomas, Warisara; Polsrila, Kanda; Dongsaard, Kwanreaun; Sanannu, Saowaphang; Wattananorrasate, Anuwat

    2017-07-01

    The Asian tapir (Tapirus indicus) has been classified as Endangered on the IUCN Red List of Threatened Species (2008). Genetic diversity data provide important information for the management of captive breeding and conservation of this species. We analyzed mitochondrial control region (CR) sequences from 37 captive Asian tapirs in Thailand. Multiple alignments of the full-length CR sequences sized 1268 bp comprised three domains as described in other mammal species. Analysis of 16 parsimony-informative variable sites revealed 11 haplotypes. Furthermore, the phylogenetic analysis using median-joining network clearly showed three clades correlated with our earlier cytochrome b gene study in this endangered species. The repetitive motif is located between first and second conserved sequence blocks, similar to the Brazilian tapir. The highest polymorphic site was located in the extended termination associated sequences domain. The results could be applied for future genetic management based in captivity and wild that shows stable populations.

  12. Genome-wide cloning and sequence analysis of leucine-rich repeat receptor-like protein kinase genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Yuan Tong

    2010-01-01

    Full Text Available Abstract Background Transmembrane receptor kinases play critical roles in both animal and plant signaling pathways regulating growth, development, differentiation, cell death, and pathogenic defense responses. In Arabidopsis thaliana, there are at least 223 Leucine-rich repeat receptor-like kinases (LRR-RLKs, representing one of the largest protein families. Although functional roles for a handful of LRR-RLKs have been revealed, the functions of the majority of members in this protein family have not been elucidated. Results As a resource for the in-depth analysis of this important protein family, the complementary DNA sequences (cDNAs of 194 LRR-RLKs were cloned into the GatewayR donor vector pDONR/ZeoR and analyzed by DNA sequencing. Among them, 157 clones showed sequences identical to the predictions in the Arabidopsis sequence resource, TAIR8. The other 37 cDNAs showed gene structures distinct from the predictions of TAIR8, which was mainly caused by alternative splicing of pre-mRNA. Most of the genes have been further cloned into GatewayR destination vectors with GFP or FLAG epitope tags and have been transformed into Arabidopsis for in planta functional analysis. All clones from this study have been submitted to the Arabidopsis Biological Resource Center (ABRC at Ohio State University for full accessibility by the Arabidopsis research community. Conclusions Most of the Arabidopsis LRR-RLK genes have been isolated and the sequence analysis showed a number of alternatively spliced variants. The generated resources, including cDNA entry clones, expression constructs and transgenic plants, will facilitate further functional analysis of the members of this important gene family.

  13. The chloroplast genome sequence of the green alga Leptosira terrestris: multiple losses of the inverted repeat and extensive genome rearrangements within the Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Turmel Monique

    2007-07-01

    Full Text Available Abstract Background In the Chlorophyta – the green algal phylum comprising the classes Prasinophyceae, Ulvophyceae, Trebouxiophyceae and Chlorophyceae – the chloroplast genome displays a highly variable architecture. While chlorophycean chloroplast DNAs (cpDNAs deviate considerably from the ancestral pattern described for the prasinophyte Nephroselmis olivacea, the degree of remodelling sustained by the two ulvophyte cpDNAs completely sequenced to date is intermediate relative to those observed for chlorophycean and trebouxiophyte cpDNAs. Chlorella vulgaris (Chlorellales is currently the only photosynthetic trebouxiophyte whose complete cpDNA sequence has been reported. To gain insights into the evolutionary trends of the chloroplast genome in the Trebouxiophyceae, we sequenced cpDNA from the filamentous alga Leptosira terrestris (Ctenocladales. Results The 195,081-bp Leptosira chloroplast genome resembles the 150,613-bp Chlorella genome in lacking a large inverted repeat (IR but differs greatly in gene order. Six of the conserved genes present in Chlorella cpDNA are missing from the Leptosira gene repertoire. The 106 conserved genes, four introns and 11 free standing open reading frames (ORFs account for 48.3% of the genome sequence. This is the lowest gene density yet observed among chlorophyte cpDNAs. Contrary to the situation in Chlorella but similar to that in the chlorophycean Scenedesmus obliquus, the gene distribution is highly biased over the two DNA strands in Leptosira. Nine genes, compared to only three in Chlorella, have significantly expanded coding regions relative to their homologues in ancestral-type green algal cpDNAs. As observed in chlorophycean genomes, the rpoB gene is fragmented into two ORFs. Short repeats account for 5.1% of the Leptosira genome sequence and are present mainly in intergenic regions. Conclusion Our results highlight the great plasticity of the chloroplast genome in the Trebouxiophyceae and indicate

  14. Development of Highly Informative Genome-Wide Single Sequence Repeat Markers for Breeding Applications in Sesame and Construction of a Web Resource: SisatBase

    Directory of Open Access Journals (Sweden)

    Komivi Dossa

    2017-08-01

    Full Text Available The sequencing of the full nuclear genome of sesame (Sesamum indicum L. provides the platform for functional analyses of genome components and their application in breeding programs. Although the importance of microsatellites markers or simple sequence repeats (SSR in crop genotyping, genetics, and breeding applications is well established, only a little information exist concerning SSRs at the whole genome level in sesame. In addition, SSRs represent a suitable marker type for sesame molecular breeding in developing countries where it is mainly grown. In this study, we identified 138,194 genome-wide SSRs of which 76.5% were physically mapped onto the 13 pseudo-chromosomes. Among these SSRs, up to three primers pairs were supplied for 101,930 SSRs and used to in silico amplify the reference genome together with two newly sequenced sesame accessions. A total of 79,957 SSRs (78% were polymorphic between the three genomes thereby suggesting their promising use in different genomics-assisted breeding applications. From these polymorphic SSRs, 23 were selected and validated to have high polymorphic potential in 48 sesame accessions from different growing areas of Africa. Furthermore, we have developed an online user-friendly database, SisatBase (http://www.sesame-bioinfo.org/SisatBase/, which provides free access to SSRs data as well as an integrated platform for functional analyses. Altogether, the reference SSR and SisatBase would serve as useful resources for genetic assessment, genomic studies, and breeding advancement in sesame, especially in developing countries.

  15. NUCLEOTIDES IN INFANT FEEDING

    Directory of Open Access Journals (Sweden)

    L.G. Mamonova

    2007-01-01

    Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.

  16. Targeted genomic enrichment and sequencing of CyHV-3 from carp tissues confirms low nucleotide diversity and mixed genotype infections

    Directory of Open Access Journals (Sweden)

    Saliha Hammoumi

    2016-09-01

    Full Text Available Koi herpesvirus disease (KHVD is an emerging disease that causes mass mortality in koi and common carp, Cyprinus carpio L. Its causative agent is Cyprinid herpesvirus 3 (CyHV-3, also known as koi herpesvirus (KHV. Although data on the pathogenesis of this deadly virus is relatively abundant in the literature, still little is known about its genomic diversity and about the molecular mechanisms that lead to such a high virulence. In this context, we developed a new strategy for sequencing full-length CyHV-3 genomes directly from infected fish tissues. Total genomic DNA extracted from carp gill tissue was specifically enriched with CyHV-3 sequences through hybridization to a set of nearly 2 million overlapping probes designed to cover the entire genome length, using KHV-J sequence (GenBank accession number AP008984 as reference. Applied to 7 CyHV-3 specimens from Poland and Indonesia, this targeted genomic enrichment enabled recovery of the full genomes with >99.9% reference coverage. The enrichment rate was directly correlated to the estimated number of viral copies contained in the DNA extracts used for library preparation, which varied between ∼5000 and ∼2×107. The average sequencing depth was >200 for all samples, thus allowing the search for variants with high confidence. Sequence analyses highlighted a significant proportion of intra-specimen sequence heterogeneity, suggesting the presence of mixed infections in all investigated fish. They also showed that inter-specimen genetic diversity at the genome scale was very low (>99.95% of sequence identity. By enabling full genome comparisons directly from infected fish tissues, this new method will be valuable to trace outbreaks rapidly and at a reasonable cost, and in turn to understand the transmission routes of CyHV-3.

  17. Nucleotide sequence of the hexA gene for DNA mismatch repair in Streptococcus pneumoniae and homology of hexA to mutS of Escherichia coli and Salmonella typhimurium

    International Nuclear Information System (INIS)

    Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.

    1988-01-01

    The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems

  18. Complete nucleotide sequence and organization of the mitogenome of the silk moth Caligula boisduvalii (Lepidoptera: Saturniidae) and comparison with other lepidopteran insects.

    Science.gov (United States)

    Hong, Mee Yeon; Lee, Eun Mee; Jo, Yong Hun; Park, Hae Chul; Kim, Seong Ryul; Hwang, Jae Sam; Jin, Byung Rae; Kang, Pil Don; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

    2008-04-30

    The 15,360-bp long complete mitogenome of Caligula boisduvalii possesses a gene arrangement and content identical to other completely sequenced lepidopteran mitogenomes, but different from the common arrangement found in most insect order, as the result of the movement of tRNA(Met) to a position 5'-upstream of tRNA Ile. The 330-bp A+T-rich region is apparently capable of forming a stem-and-loop structure, which harbors the conserved flanking sequences at both ends. Dissimilar to what has been seen in other sequenced lepidopteran insects, the initiation codon for C. boisduvalii COI appears to be TTG, which is a rare, but apparently possible initiation codon. The ATP8, ATP6, ND4L, and ND6 genes, which neighbor another PCG at their 3' end, all harbored potential sequences for the formation of a hairpin structure. This is suggestive of the importance of such structures for the precise cleavage of the mRNA of mature PCGs. Phylogenetic analyses of available sequenced species of Bombycoidea, Pyraloidea, and Tortricidea supported the morphology-based current hypothesis that Bombycoidea and Pyraloidea are monophyletic (Obtectomera). As previously suggested, Bombycidae (Bombyx mori and B. mandarina) and Saturniidae (Antheraea pernyi and C. boisduvalii) formed a reciprocal monophyletic group.

  19. The sequence of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus genome

    NARCIS (Netherlands)

    Chen, X.; IJkel, W.F.J.; Tarchini, R.; Sun, X.; Sandbrink, H.; Wang, H.; Peters, S.; Zuidema, D.; Klein Lankhorst, R.; Vlak, J.M.; Hu, Z.

    2001-01-01

    The nucleotide sequence of the Helicoverpa armigera single-nucleocapsid nucleopolyhedrovirus (HaSNPV) DNA genome was determined and analysed. The circular genome encompasses 131 403 bp, has a G C content of 39.1 molnd contains five homologous regions with a unique pattern of repeats.

  20. Using Markov chains of nucleotide sequences as a possible precursor to predict functional roles of human genome: a case study on inactive chromatin regions.

    Science.gov (United States)

    Lee, K-E; Lee, E-J; Park, H-S

    2016-08-30

    Recent advances in computational epigenetics have provided new opportunities to evaluate n-gram probabilistic language models. In this paper, we describe a systematic genome-wide approach for predicting functional roles in inactive chromatin regions by using a sequence-based Markovian chromatin map of the human genome. We demonstrate that Markov chains of sequences can be used as a precursor to predict functional roles in heterochromatin regions and provide an example comparing two publicly available chromatin annotations of large-scale epigenomics projects: ENCODE project consortium and Roadmap Epigenomics consortium.

  1. Inter Simple Sequence Repeat DNA (ISSR) Polymorphism Utility in Haploid Nicotiana Alata Irradiated Plants for Finding Markers Associated with Gamma Irradiation and Salinity

    International Nuclear Information System (INIS)

    El-Fiki, A.; Adly, M.; El-Metabteb, G.

    2017-01-01

    Nicotiana alata is an ornamental plant. It is a member of family Solanasea. Tobacco (Nicotiana spp.) is one of the most important commercial crops in the world. Wild Nicotiana species, as a store house of genes for several diseases and pests, in addition to genes for several important phytochemicals and quality traits which are not present in cultivated varieties. Inter simple sequence repeat DNA (ISSR) analysis was used to determine the degree of genetic variation in treated haploid Nicotiana alata plants. Total genomic DNAs from different treated haploid plant lets were amplified using five specific primers. All primers were polymorphic. A total of 209 bands were amplified of which 135 (59.47%) polymorphic across the radiation treatments. Whilst, the level of polymorphism among the salinity treatments were 181 (85.6 %). Whereas, the polymorphism among the combined effects between gamma radiation doses and salinity concentrations were 283 ( 73.95% ). Treatments relationships were estimated through cluster analysis (UPGMA) based on ISSR data

  2. Isolation and Optimization of Inter-Simple Sequence Repeat (ISSR) Technique For Pleurotus Sajor Caju Towards Environmental Study in Support of the Country's Nuclear Power Programme

    International Nuclear Information System (INIS)

    Rosnani Abdul Rashid; Azhar Mohamad; Mat Rasol Awang; Hassan Hamdani Mutaat; Shaiful Azuar Mohamad; Affrida Abu Hasan; Mohd Meswan Maskom; Siti Khadijah Mohd Nahar

    2013-01-01

    Mushroom can be used as a biological indicator in assessing radiological impact on the environment. Radiological effect would be reflected through morphological changes as well as those changes at molecular level. For this purpose, a preliminary work was conducted, which included DNA isolation, optimization of PCR parameters for Inter-Simple Sequence Repeat (ISSR) and primers screening on Pleurotus sajor caju mushroom strains from Nuclear Malaysia's Sterifeed Mushrooms Collection Centre. In this work, DNA isolation technique from cap and stalk of fruit body were optimized and quantified. It was found that stalk produced highest amount of genomic DNA at 304.01 ng/ μl and cap at 149.00 ng/ μl. A total of 100 ISSR primers were tested and 51 primers were successfully amplified. These primers will be used further for dose response evaluation and molecular profiling in mushroom species. (author)

  3. Analysis of genetic diversity of Sclerotinia sclerotiorum from eggplant by mycelial compatibility, random amplification of polymorphic DNA (RAPD and simple sequence repeat (SSR analyses

    Directory of Open Access Journals (Sweden)

    Fatih Mehmet Tok

    2016-09-01

    Full Text Available The genetic diversity and pathogenicity/virulence among 60 eggplant Sclerotinia sclerotiorum isolates collected from six different geographic regions of Turkey were analysed using mycelial compatibility groupings (MCGs, random amplified polymorphic DNA (RAPD and simple sequence repeat (SSR polymorphism. By MCG tests, the isolates were classified into 22 groups. Out of 22 MCGs, 36% were represented each by a single isolate. The isolates showed great variability for virulence regardless of MCG and geographic origin. Based on the results of RAPD and SSR analyses, 60 S. sclerotiorum isolates representing 22 MCGs were grouped in 2 and 3 distinct clusters, respectively. Analyses using RAPD and SSR markers illustrated that cluster groupings or genetic distance of S. sclerotiorum populations from eggplant were not distinctly relative to the MCG, geographical origin and virulence diversity. The patterns obtained revealed a high heterogeneity of genetic composition and suggested the occurrence of clonal and sexual reproduction of S. sclerotiorum on eggplant in the areas surveyed.

  4. A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

    Science.gov (United States)

    Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

    2014-01-01

    The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

  5. Complete plastid genome sequencing of Trochodendraceae reveals a significant expansion of the inverted repeat and suggests a Paleogene divergence between the two extant species.

    Directory of Open Access Journals (Sweden)

    Yan-xia Sun

    Full Text Available The early-diverging eudicot order Trochodendrales contains only two monospecific genera, Tetracentron and Trochodendron. Although an extensive fossil record indicates that the clade is perhaps 100 million years old and was widespread throughout the Northern Hemisphere during the Paleogene and Neogene, the two extant genera are both narrowly distributed in eastern Asia. Recent phylogenetic analyses strongly support a clade of Trochodendrales, Buxales, and Gunneridae (core eudicots, but complete plastome analyses do not resolve the relationships among these groups with strong support. However, plastid phylogenomic analyses have not included data for Tetracentron. To better resolve basal eudicot relationships and to clarify when the two extant genera of Trochodendrales diverged, we sequenced the complete plastid genome of Tetracentron sinense using Illumina technology. The Tetracentron and Trochodendron plastomes possess the typical gene content and arrangement that characterize most angiosperm plastid genomes, but both genomes have the same unusual ∼4 kb expansion of the inverted repeat region to include five genes (rpl22, rps3, rpl16, rpl14, and rps8 that are normally found in the large single-copy region. Maximum likelihood analyses of an 83-gene, 88 taxon angiosperm data set yield an identical tree topology as previous plastid-based trees, and moderately support the sister relationship between Buxaceae and Gunneridae. Molecular dating analyses suggest that Tetracentron and Trochodendron diverged between 44-30 million years ago, which is congruent with the fossil record of Trochodendrales and with previous estimates of the divergence time of these two taxa. We also characterize 154 simple sequence repeat loci from the Tetracentron sinense and Trochodendron aralioides plastomes that will be useful in future studies of population genetic structure for these relict species, both of which are of conservation concern.

  6. Genetic Diversity of Pinus nigra Arn. Populations in Southern Spain and Northern Morocco Revealed By Inter-Simple Sequence Repeat Profiles

    Directory of Open Access Journals (Sweden)

    Oussama Ahrazem

    2012-05-01

    Full Text Available Eight Pinus nigra Arn. populations from Southern Spain and Northern Morocco were examined using inter-simple sequence repeat markers to characterize the genetic variability amongst populations. Pair-wise population genetic distance ranged from 0.031 to 0.283, with a mean of 0.150 between populations. The highest inter-population average distance was between PaCU from Cuenca and YeCA from Cazorla, while the lowest distance was between TaMO from Morocco and MA Sierra Mágina populations. Analysis of molecular variance (AMOVA and Nei’s genetic diversity analyses revealed higher genetic variation within the same population than among different populations. Genetic differentiation (Gst was 0.233. Cuenca showed the highest Nei’s genetic diversity followed by the Moroccan region, Sierra Mágina, and Cazorla region. However, clustering of populations was not in accordance with their geographical locations. Principal component analysis showed the presence of two major groups—Group 1 contained all populations from Cuenca while Group 2 contained populations from Cazorla, Sierra Mágina and Morocco—while Bayesian analysis revealed the presence of three clusters. The low genetic diversity observed in PaCU and YeCA is probably a consequence of inappropriate management since no estimation of genetic variability was performed before the silvicultural treatments. Data indicates that the inter-simple sequence repeat (ISSR method is sufficiently informative and powerful to assess genetic variability among populations of P. nigra.

  7. The complete nucleotide sequence and environmental distribution of the cryptic, conjugative, broad-host-range plasmid pIPO2 islated from bacteria of the wheat rhizosphere

    NARCIS (Netherlands)

    Tauch, A.; Schneiker, S.; Selbitschka, W.; PÜhler, A.; Overbeek, van L.S.; Smalla, K.; Thomas, C.M.; Bailey, M.J.; Forney, L.J.; Weightman, A.; Ceglowski, P.; Pembroke, T.; Tietze, E.; Schröder, G.; Lanka, E.; Elsas, van J.D.

    2002-01-01

    The flood of sequence data resulting from the large number of current genome projects has increased the need for a flexible, open source genome annotation system, which so far has not existed. To account for the individual needs of different projects, such a system should be modular and easily

  8. Length and nucleotide sequence polymorphism at the trnL and trnF non-coding regions of chloroplast genomes among Saccharum and Erianthus species

    Science.gov (United States)

    The aneupolyploidy genome of sugarcane (Saccharum hybrids spp.) and lack of a classical genetic linkage map make genetics research most difficult for sugarcane. Whole genome sequencing and genetic characterization of sugarcane and related taxa are far behind other crops. In this study, universal PCR...

  9. NUCLEOTIDE SEQUENCING AND TRANSCRIPTIONAL MAPPING OF THE GENES ENCODING BIPHENYL DIOXYGENASE, A MULTICOM- PONENT POLYCHLORINATED-BIPHENYL-DEGRADING ENZYME IN PSEUDOMONAS STRAIN LB400

    Science.gov (United States)

    The DNA region encoding biphenyl dioxygenase, the first enzyme in the biphenyl-polychlorinated biphenyl degradation pathway of Pseudomonas species strain LB400, was sequenced. Six open reading frames were identified, four of which are homologous to the components of toluene dioxy...

  10. Population genetic structure in farm and feral American mink (Neovison vison) inferred from RAD sequencing-generated single nucleotide polymorphisms

    DEFF Research Database (Denmark)

    Thirstrup, Janne Pia; Ruiz-Gonzalez, Aritz; Pujolar, José Martin

    2015-01-01

    Feral American mink populations (Neovison vison), derived from mink farms, are widespread in Europe. In this study we investigated genetic diversity and genetic differentiation between feral and farm mink using a panel of genetic markers (194 SNP) generated from RAD sequencing data. Sampling incl...

  11. Nucleotide sequence and phylogeny of the tet (L) tetracycline resistance determinant encoded by the plasmid pSTE1 from Staphylococcus hyicus

    DEFF Research Database (Denmark)

    Schwarz, S.; Cardoso, M.; Wegener, Henrik Caspar

    1992-01-01

    O from Streptococcus mutans were performed. An alignment of Tet amino acid sequence revealed the presence of 30 conserved amino acids among these Tet variants. On the basis of the alignment, a phylogenetic tree was constructed. It demonstrated large evolutionary distances between the Tet M and Tet O...

  12. Exploring the correlation between the sequence composition of the nucleotide binding G5 loop of the FeoB GTPase domain (NFeoB) and intrinsic rate of GDP release.

    Science.gov (United States)

    Guilfoyle, Amy P; Deshpande, Chandrika N; Schenk, Gerhard; Maher, Megan J; Jormakka, Mika

    2014-12-12

    GDP release from GTPases is usually extremely slow and is in general assisted by external factors, such as association with guanine exchange factors or membrane-embedded GPCRs (G protein-coupled receptors), which accelerate the release of GDP by several orders of magnitude. Intrinsic factors can also play a significant role; a single amino acid substitution in one of the guanine nucleotide recognition motifs, G5, results in a drastically altered GDP release rate, indicating that the sequence composition of this motif plays an important role in spontaneous GDP release. In the present study, we used the GTPase domain from EcNFeoB (Escherichia coli FeoB) as a model and applied biochemical and structural approaches to evaluate the role of all the individual residues in the G5 loop. Our study confirms that several of the residues in the G5 motif have an important role in the intrinsic affinity and release of GDP. In particular, a T151A mutant (third residue of the G5 loop) leads to a reduced nucleotide affinity and provokes a drastically accelerated dissociation of GDP.

  13. The complete nucleotide sequence and environmental distribution of the cryptic, conjugative, broad-host-range plasmid pIPO2 islated from bacteria of the wheat rhizosphere

    OpenAIRE

    Tauch, A.; Schneiker, S.; Selbitschka, W.; PÜhler, A.; Overbeek, van, L.S.; Smalla, K.; Thomas, C.M.; Bailey, M.J.; Forney, L.J.; Weightman, A.; Ceglowski, P.; Pembroke, T.; Tietze, E.; Schröder, G.; Lanka, E.

    2002-01-01

    The flood of sequence data resulting from the large number of current genome projects has increased the need for a flexible, open source genome annotation system, which so far has not existed. To account for the individual needs of different projects, such a system should be modular and easily extensible. We present a genome annotation system for prokaryote genomes, which is well tested and readily adaptable to different tasks. The modular system was developed using an object-oriented approac...

  14. Complete nucleotide sequence of Sida golden mosaic Florida virus and phylogenetic relationships with other begomoviruses infecting malvaceous weeds in the Caribbean.

    Science.gov (United States)

    Fiallo-Olivé, Elvira; Martínez-Zubiaur, Yamila; Moriones, Enrique; Navas-Castillo, Jesús

    2010-09-01

    The complete genome sequence of two isolates of the bipartite begomovirus (genus Begomovirus, family Geminiviridae) Sida golden mosaic Florida virus (SiGMFV) is presented. We propose that both isolates, found infecting Malvastrum coromandelianum (family Malvaceae) in Cuba, belong to a new strain of SiGMFV. Phylogenetic analysis showed that SiGMFV DNA-A is located in a monophyletic cluster that includes begomoviruses infecting malvaceous weeds from the Caribbean.

  15. Analysis of complete nucleotide sequences of Angolan hepatitis B virus isolates reveals the existence of a separate lineage within genotype E.

    Directory of Open Access Journals (Sweden)

    Barbara V Lago

    Full Text Available Hepatitis B virus genotype E (HBV/E is highly prevalent in Western Africa. In this work, 30 HBV/E isolates from HBsAg positive Angolans (staff and visitors of a private hospital in Luanda were genetically characterized: 16 of them were completely sequenced and the pre-S/S sequences of the remaining 14 were determined. A high proportion (12/30, 40% of subjects tested positive for both HBsAg and anti-HBs markers. Deduced amino acid sequences revealed the existence of specific substitutions and deletions in the B- and T-cell epitopes of the surface antigen (pre-S1- and pre-S2 regions of the virus isolates derived from 8/12 individuals with concurrent HBsAg/anti-HBs. Phylogenetic analysis performed with 231 HBV/E full-length sequences, including 16 from this study, showed that all isolates from Angola, Namibia and the Democratic Republic of Congo (n = 28 clustered in a separate lineage, divergent from the HBV/E isolates from nine other African countries, namely Cameroon, Central African Republic, Côte d'Ivoire, Ghana, Guinea, Madagascar, Niger, Nigeria and Sudan, with a Bayesian posterior probability of 1. Five specific mutations, namely small S protein T57I, polymerase Q177H, G245W and M612L, and X protein V30L, were observed in 79-96% of the isolates of the separate lineage, compared to a frequency of 0-12% among the other HBV/E African isolates.

  16. Analysis of genetic diversity and population structure of oil palm (Elaeis guineensis) from China and Malaysia based on species-specific simple sequence repeat markers.

    Science.gov (United States)

    Zhou, L X; Xiao, Y; Xia, W; Yang, Y D

    2015-12-08

    Genetic diversity and patterns of population structure of the 94 oil palm lines were investigated using species-specific simple sequence repeat (SSR) markers. We designed primers for 63 SSR loci based on their flanking sequences and conducted amplification in 94 oil palm DNA samples. The amplification result showed that a relatively high level of genetic diversity was observed between oil palm individuals according a set of 21 polymorphic microsatellite loci. The observed heterozygosity (Ho) was 0.3683 and 0.4035, with an average of 0.3859. The Ho value was a reliable determinant of the discriminatory power of the SSR primer combinations. The principal component analysis and unweighted pair-group method with arithmetic averaging cluster analysis showed the 94 oil palm lines were grouped into one cluster. These results demonstrated that the oil palm in Hainan Province of China and the germplasm introduced from Malaysia may be from the same source. The SSR protocol was effective and reliable for assessing the genetic diversity of oil palm. Knowledge of the genetic diversity and population structure will be crucial for establishing appropriate management stocks for this species.

  17. A theory that may explain the Hayflick limit--a means to delete one copy of a repeating sequence during each cell cycle in certain human cells such as fibroblasts.

    Science.gov (United States)

    Naveilhan, P; Baudet, C; Jabbour, W; Wion, D

    1994-09-01

    A model that may explain the limited division potential of certain cells such as human fibroblasts in culture is presented. The central postulate of this theory is that there exists, prior to certain key exons that code for materials needed for cell division, a unique sequence of specific repeating segments of DNA. One copy of such repeating segments is deleted during each cell cycle in cells that are not protected from such deletion through methylation of their cytosine residues. According to this theory, the means through which such repeated sequences are removed, one per cycle, is through the sequential action of enzymes that act much as bacterial restriction enzymes do--namely to produce scissions in both strands of DNA in areas that correspond to the DNA base sequence recognition specificities of such enzymes. After the first scission early in a replicative cycle, that enzyme becomes inhibited, but the cleavage of the first site exposes the closest site in the repetitive element to the action of a second restriction enzyme after which that enzyme also becomes inhibited. Then repair occurs, regenerating the original first site. Through this sequential activation and inhibition of two different restriction enzymes, only one copy of the repeating sequence is deleted during each cell cycle. In effect, the repeating sequence operates as a precise counter of the numbers of cell doubling that have occurred since the cells involved differentiated during development.

  18. Statistical properties of nucleotides in human chromosomes 21 and 22

    International Nuclear Information System (INIS)

    Zhang Linxi; Sun Tingting

    2005-01-01

    In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence

  19. Maximum likelihood and Bayesian analyses of a combined nucleotide sequence dataset for genetic characterization of a novel pestivirus, SVA/cont-08.

    Science.gov (United States)

    Liu, Lihong; Xia, Hongyan; Baule, Claudia; Belák, Sándor

    2009-01-01

    Bovine viral diarrhoea virus 1 (BVDV-1) and Bovine viral diarrhoea virus 2 (BVDV-2) are two recognised bovine pestivirus species of the genus Pestivirus. Recently, a pestivirus, termed SVA/cont-08, was detected in a batch of contaminated foetal calf serum originating from South America. Comparative sequence analysis showed that the SVA/cont-08 virus shares 15-28% higher sequence identity to pestivirus D32/00_'HoBi' than to members of BVDV-1 and BVDV-2. In order to reveal the phylogenetic relationship of SVA/cont-08 with other pestiviruses, a molecular dataset of 30 pestiviruses and 1,896 characters, comprising the 5'UTR, N(pro) and E2 gene regions, was analysed by two methods: maximum likelihood and Bayesian approach. An identical, well-supported tree topology was observed, where four pestiviruses (SVA/cont-08, D32/00_'HoBi', CH-KaHo/cont, and Th/04_KhonKaen) formed a monophyletic clade that is closely related to the BVDV-1 and BVDV-2 clades. The strategy applied in this study is useful for classifying novel pestiviruses in the future.

  20. A set of tetra-nucleotide core motif SSR markers for efficient identification of potato (Solanum tuberosum) cultivars.

    Science.gov (United States)

    Kishine, Masahiro; Tsutsumi, Katsuji; Kitta, Kazumi

    2017-12-01

    Simple sequence repeat (SSR) is a popular tool for individual fingerprinting. The long-core motif (e.g. tetra-, penta-, and hexa-nucleotide) simple sequence repeats (SSRs) are preferred because they make it easier to separate and distinguish neighbor alleles. In the present study, a new set of 8 tetra-nucleotide SSRs in potato ( Solanum tuberosum ) is reported. By using these 8 markers, 72 out of 76 cultivars obtained from Japan and the United States were clearly discriminated, while two pairs, both of which arose from natural variation, showed identical profiles. The combined probability of identity between two random cultivars for the set of 8 SSR markers was estimated to be 1.10 × 10 -8 , confirming the usefulness of the proposed SSR markers for fingerprinting analyses of potato.

  1. Nucleotide sequence of a cDNA coding for the barley seed protein CMa: an inhibitor of insect α-amylase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Johansson, A.

    1992-01-01

    The primary structure of the insect alpha-amylase inhibitor CMa of barley seeds was deduced from a full-length cDNA clone pc43F6. Analysis of RNA from barley endosperm shows high levels 15 and 20 days after flowering. The cDNA predicts an amino acid sequence of 119 residues preceded by a signal...... peptide of 25 amino acids. Ala and Leu account for 55% of the signal peptide. CMa is 60-85% identical with alpha-amylase inhibitors of wheat, but shows less than 50% identity to trypsin inhibitors of barley and wheat. The 10 Cys residues