WorldWideScience

Sample records for repeated initial studies

  1. Repeat Colonoscopy within 6 Months after Initial Outpatient Colonoscopy in Ontario: A Population-Based Cross-Sectional Study

    Directory of Open Access Journals (Sweden)

    Lawrence Paszat

    2017-01-01

    Full Text Available Background. The goal of this study is to examine utilization of early repeat colonoscopy ≤ 6 months after an index procedure. Methods. We identified persons having repeat colonoscopy ≤ 6 months following outpatient colonoscopy without prior colonoscopy ≤ 5 years or prior diagnosis of colorectal cancer (CRC. We modeled repeat colonoscopy using a generalized estimating equation with an exchangeable correlation structure to account for clustering of patients by endoscopist. Results. The population included 334,663 persons, 7,892 (2.36% of whom had an early repeat colonoscopy within 6 months. Overall, endoscopist prior year colonoscopy volume was inversely related to repeat ≤ 6 months. Repeat colonoscopy ≤ 6 months varied by the clinical setting of the index colonoscopy (adjusted OR = 1.41 (95% CI 1.29–1.55 at nonhospital facilities compared to teaching or community hospitals. Among those who had polypectomy or biopsy, the adjusted OR for early repeat ≤ 6 months was elevated among those whose index colonoscopy was at a nonhospital facility (OR 1.44, 95% CI 1.30–1.60, compared to those at a teaching hospital or community hospital. Conclusions. Repeat colonoscopy ≤ 6 months after an index procedure is associated with the clinical setting of the index colonoscopy.

  2. Initiating Repair and Beyond: The Use of Two Repeat-Formatted Repair Initiations in Mandarin Conversation

    Science.gov (United States)

    Wu, Ruey-Jiuan Regina

    2006-01-01

    As part of a growing effort to understand the organization of repair across languages, this study examines 2 repeat-formatted other-initiated repair practices in Mandarin conversation. Using the methodology of conversation analysis as a central framework, this study shows that the 2 Mandarin repair initiations under examination, like…

  3. Initial Study

    DEFF Research Database (Denmark)

    Torp, Kristian

    2009-01-01

    Congestion is a major problem in most cities and the problem is growing (Quiroga, 2000) (Faghri & Hamad, 2002). When the congestion level is increased the drivers notice this as delays in the traffic (Taylor, Woolley, & Zito, 2000), i.e., the travel time for the individual driver is simply...... increased. In the initial study presented here, the time it takes to pass an intersection is studied in details. Two major signal-controlled four-way intersections in the center of the city Aalborg are studied in details to estimate the congestion levels in these intersections, based on the time it takes...

  4. Who Repeats Algebra, and How Does Initial Performance Relate to Improvement When the Course Is Repeated?

    Science.gov (United States)

    Fong, Anthony; Jaquet, Karina; Finkelstein, Neal

    2016-01-01

    The information provided in this report shows how students perform when they repeat algebra I and how the level of improvement varies depending on initial course performance and the academic measure (course grades or CST scores). This information can help inform decisions and policies regarding whether and under what circumstances students should…

  5. Value of repeat brain MRI in children with focal epilepsy and negative findings on initial MRI

    Energy Technology Data Exchange (ETDEWEB)

    Jeon, Tae Yeon; Kim, Ji Hye; Lee, Jee Hun; Yoo, So Young; Hwang, Sook Min; Lee, Mun Hyang [Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul (Korea, Republic of)

    2017-08-01

    To evaluate the value of repeat brain magnetic resonance imaging (MRI) in identifying potential epileptogenic lesions in children with initial MRI-negative focal epilepsy. Our Institutional Review Board approved this retrospective study and waived the requirement for informed consent. During a 15-year period, 257 children (148 boys and 109 girls) with initial MRI-negative focal epilepsy were included. After re-evaluating both initial and repeat MRIs, positive results at repeat MRI were classified into potential epileptogenic lesions (malformation of cortical development and hippocampal sclerosis) and other abnormalities. Contributing factors for improved lesion conspicuity of the initially overlooked potential epileptogenic lesions were analyzed and classified into lesion factors and imaging factors. Repeat MRI was positive in 21% (55/257) and negative in 79% cases (202/257). Of the positive results, potential epileptogenic lesions comprised 49% (27/55) and other abnormalities comprised 11% of the cases (28/257). Potential epileptogenic lesions included focal cortical dysplasia (n = 11), hippocampal sclerosis (n = 10), polymicrogyria (n = 2), heterotopic gray matter (n = 2), microlissencephaly (n = 1), and cortical tumor (n = 1). Of these, seven patients underwent surgical resection. Contributing factors for new diagnoses were classified as imaging factors alone (n = 6), lesion factors alone (n = 2), both (n = 18), and neither (n = 1). Repeat MRI revealed positive results in 21% of the children with initial MRI-negative focal epilepsy, with 50% of the positive results considered as potential epileptogenic lesions. Enhanced MRI techniques or considering the chronological changes of lesions on MRI may improve the diagnostic yield for identification of potential epileptogenic lesions on repeat MRI.

  6. Anterior prostate biopsy at initial and repeat evaluation: is it useful to detect significant prostate cancer?

    Directory of Open Access Journals (Sweden)

    Pietro Pepe

    2015-10-01

    Full Text Available ABSTRACT Purpose: Detection rate for anterior prostate cancer (PCa in men who underwent initial and repeat biopsy has been prospectively evaluated. Materials and Methods: From January 2013 to March 2014, 400 patients all of Caucasian origin (median age 63.5 years underwent initial (285 cases and repeat (115 cases prostate biopsy; all the men had negative digital rectal examination and the indications to biopsy were: PSA values > 10 ng/mL, PSA between 4.1-10 or 2.6-4 ng/mL with free/total PSA≤25% and ≤20%, respectively. A median of 22 (initial biopsy and 31 cores (repeat biopsy were transperineally performed including 4 cores of the anterior zone (AZ and 4 cores of the AZ plus 2 cores of the transition zone (TZ, respectively. Results: Median PSA was 7.9 ng/mL; overall, a PCa was found in 180 (45% patients: in 135 (47.4% and 45 (36% of the men who underwent initial and repeat biopsy, respectively. An exclusive PCa of the anterior zone was found in the 8.9 (initial biopsy vs 13.3% (repeat biopsy of the men: a single microfocus of cancer was found in the 61.2% of the cases; moreover, in 7 out 18 AZ PCa the biopsy histology was predictive of significant cancer in 2 (28.5% and 5 (71.5% men who underwent initial and repeat biopsy, respectively. Conclusions: However AZ biopsies increased detection rate for PCa (10% of the cases, the majority of AZ PCa with histological findings predictive of clinically significant cancer were found at repeat biopsy (about 70% of the cases.

  7. Who Repeats Algebra I, and How Does Initial Performance Relate to Improvement When the Course Is Repeated? REL 2015-059

    Science.gov (United States)

    Fong, Anthony B.; Jaquet, Karina; Finkelstein, Neal

    2014-01-01

    This REL West study explores the prevalence of students repeating Algebra I, who is most likely to repeat the course, and the level of improvement for students who repeat. Using six years of data from a cohort of 3,400 first-time seventh grade students in a California school district, authors found that 44 percent of students repeated algebra I.…

  8. PET functional volume delineation: a robustness and repeatability study

    Energy Technology Data Exchange (ETDEWEB)

    Hatt, Mathieu [CHU Morvan, INSERM, U650, LaTIM, Brest (France); CHU MORVAN, LaTIM, INSERM U650, Brest (France); Cheze-le Rest, Catherine [CHU Morvan, INSERM, U650, LaTIM, Brest (France); CHU, Academic Department of Nuclear Medicine, Brest (France); Albarghach, Nidal; Pradier, Olivier [CHU Morvan, INSERM, U650, LaTIM, Brest (France); CHU, Institute of Oncology, Brest (France); Visvikis, Dimitris [CHU Morvan, INSERM, U650, LaTIM, Brest (France)

    2011-04-15

    Current state-of-the-art algorithms for functional uptake volume segmentation in PET imaging consist of threshold-based approaches, whose parameters often require specific optimization for a given scanner and associated reconstruction algorithms. Different advanced image segmentation approaches previously proposed and extensively validated, such as among others fuzzy C-means (FCM) clustering, or fuzzy locally adaptive bayesian (FLAB) algorithm have the potential to improve the robustness of functional uptake volume measurements. The objective of this study was to investigate robustness and repeatability with respect to various scanner models, reconstruction algorithms and acquisition conditions. Robustness was evaluated using a series of IEC phantom acquisitions carried out on different PET/CT scanners (Philips Gemini and Gemini Time-of-Flight, Siemens Biograph and GE Discovery LS) with their associated reconstruction algorithms (RAMLA, TF MLEM, OSEM). A range of acquisition parameters (contrast, duration) and reconstruction parameters (voxel size) were considered for each scanner model, and the repeatability of each method was evaluated on simulated and clinical tumours and compared to manual delineation. For all the scanner models, acquisition parameters and reconstruction algorithms considered, the FLAB algorithm demonstrated higher robustness in delineation of the spheres with low mean errors (10%) and variability (5%), with respect to threshold-based methodologies and FCM. The repeatability provided by all segmentation algorithms considered was very high with a negligible variability of <5% in comparison to that associated with manual delineation (5-35%). The use of advanced image segmentation algorithms may not only allow high accuracy as previously demonstrated, but also provide a robust and repeatable tool to aid physicians as an initial guess in determining functional volumes in PET. (orig.)

  9. 网络零售中的新客户与老客户购买行为差异基于淘宝网的实证对比研究%The Initial Buyers and Repeat Buyers in Online Retailing: an Empirical Study based on TaoBao. com

    Institute of Scientific and Technical Information of China (English)

    秦二娃; 卢向华

    2012-01-01

    traditional markets in terms of shopping environment, transaction process, consumer decision making process et al. It is rea sonable to doubt if we can simply copy the method of traditional market to manage the initial buyers and repeat buy ers to online. As the best of our knowledge, there is very few research differentiates the initial buyer and repeat buyers in the online retailing customer relationship management. With the rapid development and maturing of the online retailing market in China, it is necessary to study the differenceservice requirements between initial buyers and repeat buyers in the online retailing context. In the prior researches, many researchers studied online service quality focused on the perceptions of all cus tomers. Furthermore, some researchers focused on the different needs of the online retailers' service quality between the loyal customers and information searchers from Internet users' perceptions. Unfortunately, the role of customers experience is always not been taken seriously in online retailing. In this paper, we focus on the perspective of on line retailers to investigate the influence of customers' direct experience in online purchase intention, which is help ful for online retailers to promote differently when they try to retain repeat customers or attract initial customers. Based on the theoretical framework of "anchoring and adjustment", this paper analyzes the different services re quirements between initial buyers and repeat buyer by combining the characteristics of online shopping. The serv ices we examined in this paper include information retrieval services, product comparison services, reputation sys tems services and postpurchase services obtained according to buyers' purchase process. Four pairs of hypothesis are put forward based on the theoretical analysis and comprehensive literature review. Our empirical test is followed with the data from Taobao. com. We collect 2384 online retailers' information from Nov

  10. Analysis of repeated outcome measures from longitudinal studies

    Institute of Scientific and Technical Information of China (English)

    Yuanjia WANG; Naihua DUAN

    2011-01-01

    @@ In many clinical studies repeated measurements of an outcome are collected over time.For example,in an 8-week study of treatment for obsessive compulsive disorder,the severity of the disorder may be measured weekly using the Yale-Brown-Obsessive-Compulsive-Disorder-Scale (YBOCS).For each study participant who completes the study,there will be nine repeated measures of YBOCS (a baseline assessment plus eight assessments during the course of treatment).Such a study in which participants are followed and measured repeatedly over time is called a longitudinal study and the resulting data are called longitudinal data.

  11. Optimal timing for a repeat fine-needle aspiration biopsy of thyroid nodule following an initial nondiagnostic fine-needle aspiration.

    Science.gov (United States)

    Deniwar, Ahmed; Hammad, AbdulRahman Y; Ali, Daniah Bu; Alsaleh, Nuha; Lahlouh, Maha; Sholl, Andrew B; Moroz, Krzysztof; Aslam, Rizwan; Thethi, Tina; Kandil, Emad

    2017-02-01

    In the case of a nondiagnostic thyroid fine-needle aspiration (FNA) biopsy result, recent guidelines from the Bethesda system recommend repeat thyroid FNA after 3 months to prevent false-positive results. We aimed to examine our institutional data to determine whether the 3-month period affects the diagnostic yield of repeat biopsies. A retrospective review of patient records over a 5-year period at our institution was performed. Patients who required repeat FNA due to nondiagnostic results were included. The time between the FNA biopsies, adequacy of the FNA specimens, as well as the surgical pathology diagnosis were analyzed. We identified 317 patients who required a repeat FNA. Of these, 96 (30.3%) patients had repeat FNAs less than 3 months after initial biopsy, while 221 (69.7%) patients had repeat FNAs in greater than 3 months. One hundred five patients were referred to our clinic with an initial nondiagnostic biopsy from an outside institution. Repeat FNA was nondiagnostic in 35 patients (11.04%) in the total study population. There was no difference in satisfactory diagnostic yield between repeat FNAs performed greater than 3 months (201 patients, 90.95%) or less than 3 months (81 patients, 84.38%) after the initial biopsy (P = .117). Of the 35 patients with repeat nondiagnostic biopsy, 17 patients underwent diagnostic lobectomy and 3 (17.6%) patients were found to have malignant disease. Early (biopsy interval would alleviate stress on patients with benign nodules and expedite surgical intervention in patients with malignancy. Published by Elsevier Inc.

  12. Core-needle biopsy versus repeat fine-needle aspiration for thyroid nodules initially read as atypia/follicular lesion of undetermined significance.

    Science.gov (United States)

    Choi, Young Jun; Baek, Jung Hwan; Suh, Chong Hyun; Shim, Woo Hyun; Jeong, Boseul; Kim, Jae Kyun; Song, Dong Eun; Kim, Tae Yong; Chung, Ki-Wook; Lee, Jeong Hyun

    2017-02-01

    The purpose of this study was to evaluate the role of core-needle biopsy (CNB) by comparing the results of CNB and repeat fine-needle aspiration (FNA) for thyroid nodules that are initially read as atypia/follicular lesion of undetermined significance (AUS/FLUS) on FNA. Among 2631 initial AUS/FLUS FNA results, 505 consecutive nodules (295 repeat FNAs and 210 CNBs) were retrospectively analyzed. The primary outcome was inconclusive (ie, nondiagnostic or AUS/FLUS). The secondary outcomes included inconclusive results of the subcategory, risk factors for inconclusive results, and diagnostic performance. CNB demonstrated significantly fewer inconclusive results than repeat FNA for the overall nodules (40.9% vs 63%; p < .001). Repeat FNA and group FLUS were significant risk factors for inconclusive results (odds ratio = 1.92; p =.001 and odds ratio = 2.08; p <.001, respectively). All diagnostic performances using CNB were higher than repeat FNAs. CNB is more useful than repeat FNAs for reducing inconclusive results and improving the diagnostic performance of thyroid nodules with initial AUS/FLUS FNA results. © 2016 Wiley Periodicals, Inc. Head Neck 39: 361-369, 2017. © 2016 Wiley Periodicals, Inc.

  13. Repeat procedure using radiofrequency energy for recurrence of atrial fibrillation after initial cryoballoon ablation: a 2-year follow-up

    NARCIS (Netherlands)

    Conte, G.; Chierchia, G.B.; Sieira, J.; Levinstein, M.; Casado-Arroyo, R.; Asmundis, C. de; Sarkozy, A.; Rodriguez-Manero, M.; Giovanni, G.; Baltogiannis, G.; Wauters, K.; Brugada, P.

    2013-01-01

    AIMS: The ideal energy source needed to perform 're-isolation' of the pulmonary veins (PVs) during a repeat procedure for recurrence of paroxysmal atrial fibrillation (AF) has not been established yet. In this study we analysed the outcome of repeat procedure using radiofrequency (RF) energy after i

  14. Utility of repeat cytological assessment of thyroid nodules initially classified as benign: clinical insights from multidisciplinary care in an Irish tertiary referral centre.

    Science.gov (United States)

    Glynn, Nigel; Hannon, Mark J; Lewis, Sarah; Hillery, Patrick; Al-Mousa, Mohammed; Hill, Arnold D K; Keeling, Frank; Morrin, Martina; Thompson, Christopher J; Smith, Diarmuid; Royston, Derval; Leader, Mary; Agha, Amar

    2016-08-02

    Fine needle aspiration biopsy (FNAB) is the tool of choice for evaluating thyroid nodules with the majority classified as benign following initial assessment. However, concern remains about false negative results and some guidelines have recommended routine repeat aspirates. We aimed to assess the utility of routine repeat FNAB for nodules classified as benign on initial biopsy and to examine the impact of establishing a multidisciplinary team for the care of these patients. We performed a retrospective review of 400 consecutive patients (413 nodules) who underwent FNAB of a thyroid nodule at our hospital between July 2008 and July 2011. Data recorded included demographic, clinical, histological and radiological variables. Three hundred and fifty seven patients (89 %) were female. Median follow-up was 5.5 years. Two hundred and fifty eight (63 %) nodules were diagnosed as benign. The rate of routine repeat biopsy increased significantly over the time course of the study (p for trend = 0.012). Nine Thy 2 nodules were classified differently on the basis of routine repeat biopsy; one patient was classified as malignant on repeat biopsy and was diagnosed with papillary thyroid carcinoma. Eight were classified as a follicular lesions on repeat biopsy-six diagnosed as benign following lobectomy; two declined lobectomy and were followed radiologically with no nodule size increase. The false negative rate of an initial benign cytology result, from a thyroid nodule aspirate, is low. In the setting of an experienced multidisciplinary thyroid team, routine repeat aspiration is not justified.

  15. Decreased infiltration of macrophage scavenger receptor-positive cells in initial negative biopsy specimens is correlated with positive repeat biopsies of the prostate.

    Science.gov (United States)

    Nonomura, Norio; Takayama, Hitoshi; Kawashima, Atsunari; Mukai, Masatoshi; Nagahara, Akira; Nakai, Yasutomo; Nakayama, Masashi; Tsujimura, Akira; Nishimura, Kazuo; Aozasa, Katsuyuki; Okuyama, Akihiko

    2010-06-01

    Macrophage scavenger receptor (MSR)-positive inflammatory cells and tumor-associated macrophages (TAMs) have been reported to regulate the growth of various cancers. In this study, the infiltration of MSR-positive cells and TAMs was analyzed to predict the outcome of repeat biopsy in men diagnosed as having no malignancy at the first prostate biopsy. Repeat biopsy of the prostate was carried out in 92 patients who were diagnosed as having no malignancy at the first biopsy. Of these, 30 patients (32.6%) were positive for prostate cancer at the repeat biopsy. Tumor-associated macrophages and MSR-positive cells were immunohistochemically stained with mAbs CD68 and CD204, respectively. Six ocular measuring fields were chosen randomly under a microscope at x400 power in the initial negative biopsy specimens, and the mean TAM and MSR counts for each case were determined. No difference in TAM count was found between the cases with or without prostate cancer. By contrast, the MSR count in patients with cancer was significantly lower than that in patients without cancer at the repeat biopsy (P biopsies, or TAM count. Decreased infiltration of MSR-positive cells in negative first biopsy specimens was correlated with positive findings in the repeat biopsy. The MSR count might be a good indicator for avoiding unnecessary repeat biopsies.

  16. Repeat associated non-ATG translation initiation: one DNA, two transcripts, seven reading frames, potentially nine toxic entities!

    Directory of Open Access Journals (Sweden)

    Christopher E Pearson

    2011-03-01

    Full Text Available Diseases associated with unstable repetitive elements in the DNA, RNA, and amino acids have consistently revealed scientific surprises. Most diseases are caused by expansions of trinucleotide repeats, which ultimately lead to diseases like Huntington's disease, myotonic dystrophy, fragile X syndrome, and a series of spinocerebellar ataxias. These repeat mutations are dynamic, changing through generations and within an individual, and the repeats can be bi-directionally transcribed. Unsuspected modes of pathogenesis involve aberrant loss of protein expression; aberrant over-expression of non-mutant proteins; toxic-gain-of-protein function through expanded polyglutamine tracts that are encoded by expanded CAG tracts; and RNA-toxic-gain-of-function caused by transcripts harboring expanded CUG, CAG, or CGG tracts. A recent advance reveals that RNA transcripts with expanded CAG repeats can be translated in the complete absence of a starting ATG, and this Repeat Associated Non-ATG translation (RAN-translation occurs across expanded CAG repeats in all reading frames (CAG, AGC, and GCA to produce homopolymeric proteins of long polyglutamine, polyserine, and polyalanine tracts. Expanded CTG tracts expressing CUG transcripts also show RAN-translation occurring in all three frames (CUG, UGC, and GCU, to produce polyleucine, polycysteine, and polyalanine. These RAN-translation products can be toxic. Thus, one unstable (CAG•(CTG DNA can produce two expanded repeat transcripts and homopolymeric proteins with reading frames (the AUG-directed polyGln and six RAN-translation proteins, yielding a total of potentially nine toxic entities. The occurrence of RAN-translation in patient tissues expands our horizons of modes of disease pathogenesis. Moreover, since RAN-translation counters the canonical requirements of translation initiation, many new questions are now posed that must be addressed. This review covers RAN-translation and some of the pertinent

  17. Successive failure, repeat entrepreneurship and no learning: A case study

    Directory of Open Access Journals (Sweden)

    Marius Pretorius

    2011-02-01

    Full Text Available Orientation: Current theories of repeat entrepreneurship provide little explanation for the effect of failure as a ‘trigger’ for creating successive ventures or learning from repeated failures. Research purpose: This study attempts to establish the role of previous failures on the ventures that follow them and to determine the process of learning from successive failures.Motivation for the study: Successive failures offer potentially valuable insights into the relationship between failures on the ventures that follow and the process of learning from failure.Research design, approach and method: The researchers investigated a single case study of one entrepreneur’s successive failures over 20 years.Main findings: Although the causes varied, all the failures had fundamental similarities. This suggested that the entrepreneur had not learnt from them. The previous failures did not trigger the subsequent ventures. Instead, they played a role in causing the failures. Learning from failure does not happen immediately but requires deliberate reflection. Deliberate reflection is a prerequisite for learning from failure as the entrepreneur repeated similar mistakes time after time until he reflected on each failure.Practical/managerial implications: It confirms that failure is a part of entrepreneurial endeavours. However, learning from it requires deliberate reflection. Failure does not ‘trigger’ the next venture and educators should note this.Contribution/value-add: Knowing the effect of failure on consecutive ventures may help us to understand the development of prototypes (mental frameworks and expand the theory about entrepreneurial prototype categories.

  18. Forecasting Repeat Child Abuse from Initial Social Worker Reports: A Metropolitan and Non-metropolitan Comparison.

    Science.gov (United States)

    Padgitt, Steven; Gibbs, Leonard

    Since the phenomenon of reabuse is postulated as being more probable after initial child abuse than is the probability of an initial abuse and since only modest inquiry has been directed at this phenomenon, research was conducted to answer two questions: Is there patterning to reabuse? And if so, is this different in metro and nonmetro…

  19. Repeat endocarditis: analysis of risk factors based on the International Collaboration on Endocarditis - Prospective Cohort Study.

    Science.gov (United States)

    Alagna, L; Park, L P; Nicholson, B P; Keiger, A J; Strahilevitz, J; Morris, A; Wray, D; Gordon, D; Delahaye, F; Edathodu, J; Miró, J M; Fernández-Hidalgo, N; Nacinovich, F M; Shahid, R; Woods, C W; Joyce, M J; Sexton, D J; Chu, V H

    2014-06-01

    Repeat episodes of infective endocarditis (IE) can occur in patients who survive an initial episode. We analysed risk factors and 1-year mortality of patients with repeat IE. We considered 1874 patients enrolled in the International Collaboration on Endocarditis - Prospective Cohort Study between January 2000 and December 2006 (ICE-PCS) who had definite native or prosthetic valve IE and 1-year follow-up. Multivariable analysis was used to determine risk factors for repeat IE and 1-year mortality. Of 1874 patients, 1783 (95.2%) had single-episode IE and 91 (4.8%) had repeat IE: 74/91 (81%) with new infection and 17/91 (19%) with presumed relapse. On bivariate analysis, repeat IE was associated with haemodialysis (p 0.002), HIV (p 0.009), injection drug use (IDU) (p < 0.001), Staphylococcus aureus IE (p 0.003), healthcare acquisition (p 0.006) and previous IE before ICE enrolment (p 0.001). On adjusted analysis, independent risk factors were haemodialysis (OR, 2.5; 95% CI, 1.2-5.3), IDU (OR, 2.9; 95% CI, 1.6-5.4), previous IE (OR, 2.8; 95% CI, 1.5-5.1) and living in the North American region (OR, 1.9; 95% CI, 1.1-3.4). Patients with repeat IE had higher 1-year mortality than those with single-episode IE (p 0.003). Repeat IE is associated with IDU, previous IE and haemodialysis. Clinicians should be aware of these risk factors in order to recognize patients who are at risk of repeat IE.

  20. Repeating tests: different roles in research studies and clinical medicine.

    Science.gov (United States)

    Monach, Paul A

    2012-10-01

    Researchers often decide whether to average multiple results in order to produce more precise data, and clinicians often decide whether to repeat a laboratory test in order to confirm its validity or to follow a trend. Some of the major sources of variation in laboratory tests (analytical imprecision, within-subject biological variation and between-subject variation) and the effects of averaging multiple results from the same sample or from the same person over time are discussed quantitatively in this article. This analysis leads to the surprising conclusion that the strategy of averaging multiple results is only necessary and effective in a limited range of research studies. In clinical practice, it may be important to repeat a test in order to eliminate the possibility of a rare type of error that has nothing to do analytical imprecision or within-subject variation, and for this reason, paradoxically, it may be most important to repeat tests with the highest sensitivity and/or specificity (i.e., ones that are critical for clinical decision-making).

  1. Studies of an expanded trinucleotide repeat in transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Bingham, P.; Wang, S.; Merry, D. [Univ. of Pennsylvania, Philadelphia, PA (United States)

    1994-09-01

    Spinal and bulbar muscular atrophy (SBMA) is a progressive motor neuron disease caused by expansion of a trinucleotide repeat in the androgen receptor gene (AR{sup exp}). AR{sup exp} repeats expand further or contract in approximately 25% of transmissions. Analogous {open_quotes}dynamic mutations{close_quotes} have been reported in other expanded trinucleotide repeat disorders. We have been developing a mouse model of this disease using a transgenic approach. Expression of the SBMA AR was documented in transgenic mice with an inducible promoter. No phenotypic effects of transgene expression were observed. We have extended our previous results on stability of the expanded trinucleotide repeat in transgenic mice in two lines carrying AR{sup exp}. Tail DNA was amplified by PCR using primers spanning the repeat on 60 AR{sup exp} transgenic mice from four different transgenic lines. Migration of the PCR product through an acrylamide gel showed no change of the 45 CAG repeat length in any progeny. Similarly, PCR products from 23 normal repeat transgenics showed no change from the repeat length of the original construct. Unlike the disease allele in humans, the expanded repeat AR cDNA in transgenic mice showed no change in repeat length with transmission. The relative stability of CAG repeats seen in the transgenic mice may indicate either differences in the fidelity of replicative enzymes, or differences in error identification and repair between mice and humans. Integration site or structural properties of the transgene itself might also play a role.

  2. Cytogenetic studies in couples experiencing repeated pregnancy losses.

    Science.gov (United States)

    De Braekeleer, M; Dao, T N

    1990-07-01

    A computerized database generated from the literature on cytogenetic studies in couples experiencing repeated pregnancy losses has been set up at the University of Quebec at Chicoutimi. At the present time, it contains data on 22,199 couples (44,398 individuals). The statistical analyses showed a relationship between the distribution of the chromosome abnormalities and the number of abortions. An uneven distribution of the chromosomal structural rearrangements according to the sex of the carrier was found (P less than 0.05). Overall, 4.7% of the couples ascertained for two or more spontaneous abortions included one carrier. It also appeared that only translocations (both reciprocal and Robertsonian) and inversions were associated with a higher risk of pregnancy wastage. Therefore, genetic counselling should be offered to these couples and investigations performed on their extended families.

  3. [Developing a study: initial strategy].

    Science.gov (United States)

    Nahas, Fabio Xerfan; Hochman, Bernardo; Ferreira, Lydia Masako

    2005-01-01

    In this article the preparation of a scientific paper and its project are described. The possible reasons that lead to rejection of an article such as the proper focus of the chosen journal, its writing and mistakes in the grammar are considered. The initial steps of a scientific paper such as the choice of an idea, literature search, and the selection of related articles are described. After a group discussion about the purpose of the paper and its methods (brainstorm), the project is described and its items (Introduction, Objective, Methods, Protocol, References and Chronogram) are analyzed.

  4. Effects of repeated walking in a perturbing environment: a 4-day locomotor learning study.

    Science.gov (United States)

    Blanchette, Andreanne; Moffet, Helene; Roy, Jean-Sébastien; Bouyer, Laurent J

    2012-07-01

    Previous studies have shown that when subjects repeatedly walk in a perturbing environment, initial movement error becomes smaller, suggesting that retention of the adapted locomotor program occurred (learning). It has been proposed that the newly learned locomotor program may be stored separately from the baseline program. However, how locomotor performance evolves with repeated sessions of walking with the perturbation is not yet known. To address this question, 10 healthy subjects walked on a treadmill on 4 consecutive days. Each day, locomotor performance was measured using kinematics and surface electromyography (EMGs), before, during, and after exposure to a perturbation, produced by an elastic tubing that pulled the foot forward and up during swing, inducing a foot velocity error in the first strides. Initial movement error decreased significantly between days 1 and 2 and then remained stable. Associated changes in medial hamstring EMG activity stabilized only on day 3, however. Aftereffects were present after perturbation removal, suggesting that daily adaptation involved central command recalibration of the baseline program. Aftereffects gradually decreased across days but were still visible on day 4. Separation between the newly learned and baseline programs may take longer than suggested by the daily improvement in initial performance in the perturbing environment or may never be complete. These results therefore suggest that reaching optimal performance in a perturbing environment should not be used as the main indicator of a completed learning process, as central reorganization of the motor commands continues days after initial performance has stabilized.

  5. Study of simple sequence repeat (SSR) polymorphism for biotic ...

    African Journals Online (AJOL)

    home

    2013-10-02

    Oct 2, 2013 ... back cross breeding; SSRs, simple sequence repeats; PIC, polymorphism ..... PIC values were reported in barley wheat and rice (Gu et ... doubled-haploid rice population. Theor. ... Grover A, Aishwarya V, Sharma PC (2007).

  6. Determinants of percutaneous coronary intervention success in repeat chronic total occlusion procedures following an initial failed attempt

    Science.gov (United States)

    Cuevas, Cecilia; Ryan, Nicola; Quirós, Alicia; Del Angel, Juan Gustavo; Gonzalo, Nieves; Salinas, Pablo; Jiménez-Quevedo, Pilar; Nombela-Franco, Luis; Nuñez-Gil, Ivan; Fernandez-Ortiz, Antonio; Macaya, Carlos; Escaned, Javier

    2017-01-01

    AIM To investigate the rates and determinants of success of repeat percutaneous coronary intervention (PCI) following an initial failed attempt at recanalising the chronic total occlusions (CTO) percutaneously. METHODS In 445 consecutive first attempt CTO-PCI procedures in our institution, procedural failure occurred in 149 (33.5%). Sixty-four re-PCI procedures were performed in 58 patients (39%) all had a single CTO. Procedural and outcome data in the re-PCI population was entered into the institutional database. A retrospective analysis of clinical, angiographic and procedural data was performed. RESULTS Procedural success was achieved in 41 (64%) procedures. Univariate analysis of clinical and angiographic characteristics showed that re-PCI success was associated with intravascular ultrasound (IVUS) guidance (19.5% vs 0%, P = 0.042), while failure was associated with severe calcification (30.4% vs 9.7%, P = 0.047) and a JCTO score > 3 (56.5% vs 17.1% P = 0.003). Following multiple regression analysis the degree of lesion complexity (J-CTO score > 3), IVUS use, involvement of an experienced CTO operator and LAD CTO location were significant predictors of successful re-PCI. Overall the complication rate was low, with the only MACCE two periprocedural MI’s neither of which required intervention. CONCLUSION Re-PCI substantially increases the overall success rate of CTO revascularization. Predictors of re-PCI success included the use of IVUS, the involvement of an experienced CTO operator in the repeat attempt and the location of the CTO. PMID:28515854

  7. Exposing Students to Repeat Photography: Increasing Cultural Understanding on a Short-Term Study Abroad

    Science.gov (United States)

    Lemmons, Kelly K.; Brannstrom, Christian; Hurd, Danielle

    2014-01-01

    Traditionally, repeat photography has been used to analyze land cover change. This paper describes how repeat photography may be used as a tool to enhance the short-term study abroad experience by facilitating cultural interaction and understanding. We present evidence from two cases and suggest a five-step repeat photography method for educators…

  8. Exposing Students to Repeat Photography: Increasing Cultural Understanding on a Short-Term Study Abroad

    Science.gov (United States)

    Lemmons, Kelly K.; Brannstrom, Christian; Hurd, Danielle

    2014-01-01

    Traditionally, repeat photography has been used to analyze land cover change. This paper describes how repeat photography may be used as a tool to enhance the short-term study abroad experience by facilitating cultural interaction and understanding. We present evidence from two cases and suggest a five-step repeat photography method for educators…

  9. Prolonged repeated acupuncture stimulation induces habituation effects in pain-related brain areas: an FMRI study.

    Science.gov (United States)

    Li, Chuanfu; Yang, Jun; Park, Kyungmo; Wu, Hongli; Hu, Sheng; Zhang, Wei; Bu, Junjie; Xu, Chunsheng; Qiu, Bensheng; Zhang, Xiaochu

    2014-01-01

    Most previous studies of brain responses to acupuncture were designed to investigate the acupuncture instant effect while the cumulative effect that should be more important in clinical practice has seldom been discussed. In this study, the neural basis of the acupuncture cumulative effect was analyzed. For this experiment, forty healthy volunteers were recruited, in which more than 40 minutes of repeated acupuncture stimulation was implemented at acupoint Zhusanli (ST36). Three runs of acupuncture fMRI datasets were acquired, with each run consisting of two blocks of acupuncture stimulation. Besides general linear model (GLM) analysis, the cumulative effects of acupuncture were analyzed with analysis of covariance (ANCOVA) to find the association between the brain response and the cumulative duration of acupuncture stimulation in each stimulation block. The experimental results showed that the brain response in the initial stage was the strongest although the brain response to acupuncture was time-variant. In particular, the brain areas that were activated in the first block and the brain areas that demonstrated cumulative effects in the course of repeated acupuncture stimulation overlapped in the pain-related areas, including the bilateral middle cingulate cortex, the bilateral paracentral lobule, the SII, and the right thalamus. Furthermore, the cumulative effects demonstrated bimodal characteristics, i.e. the brain response was positive at the beginning, and became negative at the end. It was suggested that the cumulative effect of repeated acupuncture stimulation was consistent with the characteristic of habituation effects. This finding may explain the neurophysiologic mechanism underlying acupuncture analgesia.

  10. Single and repeated elective abortions in Japan: a psychosocial study.

    Science.gov (United States)

    Kitamura, T; Toda, M A; Shima, S; Sugawara, M

    1998-09-01

    Despite its social, legal and medical importance, termination of pregnancy (TOP) (induced abortion) has rarely been the focus of psychosocial research. Of a total of 1329 women who consecutively attended the antenatal clinic of a general hospital in Japan, 635 were expecting their first baby. Of these 635 women, 103 (16.2%) had experienced TOP once previously (first aborters), while 47 (7.4%) had experienced TOP two or more times (repeated aborters). Discriminant function analysis was performed using psychosocial variables found to be significantly associated with either first abortion or repeated abortion in bivariate analyses. This revealed that both first and repeated aborters could be predicted by smoking habits and an unwanted current pregnancy while the repeated aborters appear to differ from first aborters in having a longer pre-marital dating period, non-arranged marriages, smoking habits, early maternal loss experience or a low level of maternal care during childhood. These findings suggest that both the frequency of abortion and its repetition have psychosocial origins.

  11. Repeat biopsy in patients with initial diagnosis of PIN; La biopsia ripetuta nei pazienti con diagnosi iniziale di PIN

    Energy Technology Data Exchange (ETDEWEB)

    De Matteis, Massimo [Azienda Ospedaliera Policlinico S. Orsola-Malpighi, Bologna (Italy). UO Radiologia Albertoni; Poggi, Cristina; De Martino, Antonietta; Pavlica, Pietro [Azienda Ospedaliera Policlinico S. Orsola-Malpighi, Bologna (Italy). UO Radiologia Palagi, Dipartimento area radiologica; Corti, Barbara [Azienda Ospedaliera Policlinico S. Orsola-Malpighi, Bologna (Italy). UO Anatomia ed istologia patologica, Dipartimento oncologico ed ematologico; Barozzi, Libero [Azienda Ospedaliera Policlinico S. Orsola-Malpighi, Bologna (Italy). UO Radiologia d' urgenza, Dipartimento emergenze ed accettazione

    2005-09-15

    Purpose. Prostatic intra-epithelial neoplasia (PIN) is considered a pre-malignant lesion and the main precursor of invasive prostatic adenocarcinoma. A PIN diagnosis established by prostate needle biopsy poses a difficult clinical management. problem. We retrospectively reviewed our three-year experience in order to identify criteria for referring patients to repeat biopsy. Materials and methods. We reviewed the repeat biopsy records of 72 patients in whom PIN had been detected on initial US-guided needle biopsy of the prostate. All the patients had a minimum of 6 biopsy cores taken, and they all had PSA > 4 ng/ml. Results. Adenocarcinoma was detected in 15 patients out of 50 (30%) with an initial diagnosis of low-grade PIN and in 10 patients out of 22 (45.4%) with high grade PIN, in 7 out of 18 (39%) in whom PSA levels had decreased during the observation interval, in 16 patients out of 46 (35%) in whom the PSA had increased and in 2 patients out of 8 (25%) with stable PSA. Conclusions. Our results seem to confirm that PIN can be considered a precursor of prostatic adenocarcinoma or a histological alteration often associated with it. Patients with low-grade PIN and particularly those with high-grade PIN should be regularly subjected to repeat biopsy at short intervals due to the high frequency of the final diagnosis of carcinoma. No agreement has been reached on the time interval between the first and the second biopsy. The PSA changes during the observation period are not a statistically significant parameter to suggest the repetition of prostatic biopsy. [Italian] Scopo. La neoplasia prostatica intraepiteliale (PIN) e considerata una lesione premaligna ed il precursore principale dell'adenocarcinoma prostatico infiltrante. La diagnosi di PIN ottenuta con l'agobiopsia della prostata rappresenta un difficile problema gestionale clinico. In una valutazione retrospettiva della nostra esperienza di 3 anni si e cercato di individuare i criteri che possano

  12. Using Bayesian analysis in repeated preclinical in vivo studies for a more effective use of animals.

    Science.gov (United States)

    Walley, Rosalind; Sherington, John; Rastrick, Joe; Detrait, Eric; Hanon, Etienne; Watt, Gillian

    2016-05-01

    Whilst innovative Bayesian approaches are increasingly used in clinical studies, in the preclinical area Bayesian methods appear to be rarely used in the reporting of pharmacology data. This is particularly surprising in the context of regularly repeated in vivo studies where there is a considerable amount of data from historical control groups, which has potential value. This paper describes our experience with introducing Bayesian analysis for such studies using a Bayesian meta-analytic predictive approach. This leads naturally either to an informative prior for a control group as part of a full Bayesian analysis of the next study or using a predictive distribution to replace a control group entirely. We use quality control charts to illustrate study-to-study variation to the scientists and describe informative priors in terms of their approximate effective numbers of animals. We describe two case studies of animal models: the lipopolysaccharide-induced cytokine release model used in inflammation and the novel object recognition model used to screen cognitive enhancers, both of which show the advantage of a Bayesian approach over the standard frequentist analysis. We conclude that using Bayesian methods in stable repeated in vivo studies can result in a more effective use of animals, either by reducing the total number of animals used or by increasing the precision of key treatment differences. This will lead to clearer results and supports the "3Rs initiative" to Refine, Reduce and Replace animals in research. Copyright © 2016 John Wiley & Sons, Ltd.

  13. Acute effects of two different initial heart rates on testing the Repeated Sprint Ability in young soccer players.

    Science.gov (United States)

    Ruscello, B; Briotti, G; Tozzo, N; Partipilo, F; Taraborelli, M; Zeppetella, A; Padulo, J; D'Ottavio, S

    2015-10-01

    The aim of this paper was to investigate the acute effects of two different initial heart rates intensities when testing the repeated sprint ability (RSA) performances in young soccer players. Since there are many kinds of pre-match warm-ups, we chose to take as an absolute indicator of internal load the heart rate reached at the end of two different warm-up protocols (60 vs. 90% HRmax) and to compare the respective RSA performances. The RSA tests were performed on fifteen male soccer players (age: 17.9±1.5 years) with two sets of ten shuttle-sprints (15+15 m) with a 1:3 exercise to rest ratio, in different days (randomized order) with different HR% (60 & 90% HRmax). In order to compare the different sprint performances a Fatigue Index (FI%) was computed, while the blood lactate concentrations (BLa-) were measured before and after testing, to compare metabolic demand. Significant differences among trials within each sets (P4 mmol/L(-1)).

  14. Study of Optimal Perimetric Testing in Children (OPTIC: Feasibility, Reliability and Repeatability of Perimetry in Children.

    Directory of Open Access Journals (Sweden)

    Dipesh E Patel

    Full Text Available To investigate feasibility, reliability and repeatability of perimetry in children.A prospective, observational study recruiting 154 children aged 5-15 years, without an ophthalmic condition that affects the visual field (controls, identified consecutively between May 2012 and November 2013 from hospital eye clinics. Perimetry was undertaken in a single sitting, with standardised protocols, in a randomised order using the Humphrey static (SITA 24-2 FAST, Goldmann and Octopus kinetic perimeters. Data collected included test duration, subjective experience and test quality (incorporating examiner ratings on comprehension of instructions, fatigue, response to visual and auditory stimuli, concentration and co-operation to assess feasibility and reliability. Testing was repeated within 6 months to assess repeatability.Overall feasibility was very high (Goldmann=96.1%, Octopus=89% and Humphrey=100% completed the tests. Examiner rated reliability was 'good' in 125 (81.2% children for Goldmann, 100 (64.9% for Octopus and 98 (63.6% for Humphrey perimetry. Goldmann perimetry was the most reliable method in children under 9 years of age. Reliability improved with increasing age (multinomial logistic regression (Goldmann, Octopus and Humphrey, p<0.001. No significant differences were found for any of the three test strategies when examining initial and follow-up data outputs (Bland-Altman plots, n=43, suggesting good test repeatability, although the sample size may preclude detection of a small learning effect.Feasibility and reliability of formal perimetry in children improves with age. By the age of 9 years, all the strategies used here were highly feasible and reliable. Clinical assessment of the visual field is achievable in children as young as 5 years, and should be considered where visual field loss is suspected. Since Goldmann perimetry is the most effective strategy in children aged 5-8 years and this perimeter is no longer available, further

  15. Repeat Courses of Stereotactic Radiosurgery (SRS), Deferring Whole-Brain Irradiation, for New Brain Metastases After Initial SRS

    Energy Technology Data Exchange (ETDEWEB)

    Shultz, David B.; Modlin, Leslie A.; Jayachandran, Priya; Von Eyben, Rie; Gibbs, Iris C. [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California (United States); Choi, Clara Y.H. [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California (United States); Department of Radiation Oncology, Santa Clara Valley Medical Center, San Jose, California (United States); Chang, Steven D.; Harsh, Griffith R.; Li, Gordon; Adler, John R. [Department of Neurosurgery, Stanford University School of Medicine, Stanford, California (United States); Hancock, Steven L. [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California (United States); Soltys, Scott G., E-mail: sgsoltys@stanford.edu [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California (United States)

    2015-08-01

    Purpose: To report the outcomes of repeat stereotactic radiosurgery (SRS), deferring whole-brain radiation therapy (WBRT), for distant intracranial recurrences and identify factors associated with prolonged overall survival (OS). Patients and Methods: We retrospectively identified 652 metastases in 95 patients treated with 2 or more courses of SRS for brain metastases, deferring WBRT. Cox regression analyzed factors predictive for OS. Results: Patients had a median of 2 metastases (range, 1-14) treated per course, with a median of 2 courses (range, 2-14) of SRS per patient. With a median follow-up after first SRS of 15 months (range, 3-98 months), the median OS from the time of the first and second course of SRS was 18 (95% confidence interval [CI] 15-24) and 11 months (95% CI 6-17), respectively. On multivariate analysis, histology, graded prognostic assessment score, aggregate tumor volume (but not number of metastases), and performance status correlated with OS. The 1-year cumulative incidence, with death as a competing risk, of local failure was 5% (95% CI 4-8%). Eighteen (24%) of 75 deaths were from neurologic causes. Nineteen patients (20%) eventually received WBRT. Adverse radiation events developed in 2% of SRS sites. Conclusion: Multiple courses of SRS, deferring WBRT, for distant brain metastases after initial SRS, seem to be a safe and effective approach. The graded prognostic assessment score, updated at each course, and aggregate tumor volume may help select patients in whom the deferral of WBRT might be most beneficial.

  16. Reactor pulse repeatability studies at the annular core research reactor

    Energy Technology Data Exchange (ETDEWEB)

    DePriest, K.R. [Applied Nuclear Technologies, Sandia National Laboratories, Mail Stop 1146, Post Office Box 5800, Albuquerque, NM 87185-1146 (United States); Trinh, T.Q. [Nuclear Facility Operations, Sandia National Laboratories, Mail Stop 0614, Post Office Box 5800, Albuquerque, NM 87185-1146 (United States); Luker, S. M. [Applied Nuclear Technologies, Sandia National Laboratories, Mail Stop 1146, Post Office Box 5800, Albuquerque, NM 87185-1146 (United States)

    2011-07-01

    The Annular Core Research Reactor (ACRR) at Sandia National Laboratories is a water-moderated pool-type reactor designed for testing many types of objects in the pulse and steady-state mode of operations. Personnel at Sandia began working to improve the repeatability of pulse operations for experimenters in the facility. The ACRR has a unique UO{sub 2}-BeO fuel that makes the task of producing repeatable pulses difficult with the current operating procedure. The ACRR produces a significant quantity of photoneutrons through the {sup 9}Be({gamma}, n){sup 8}Be reaction in the fuel elements. The photoneutrons are the result of the gammas produced during fission and in fission product decay, so their production is very much dependent on the reactor power history and changes throughout the day/week of experiments in the facility. Because the photoneutrons interfere with the delayed-critical measurements required for accurate pulse reactivity prediction, a new operating procedure was created. The photoneutron effects at delayed critical are minimized when using the modified procedure. In addition, the pulse element removal time is standardized for all pulse operations with the modified procedure, and this produces less variation in reactivity removal times. (authors)

  17. A study on the trinucleotide repeat associated with Huntington`s disease in the Chinese

    Energy Technology Data Exchange (ETDEWEB)

    Bing-wen Soong; Jih-tsuu Wang [Neurological Institute, Taipei (Taiwan, Province of China)

    1994-09-01

    Analysis of the polymorphic (CAG)n repeat in the hungingtin gene in the chinese confirmed the presence of an expanded repeat on all Huntington`s disease chromosomes. Measurement of the specific CAG repeat sequence in 34 HD chromosomes from 15 unrelated families and 190 control chromosomes from the Chinese population showed a range from 9 to 29 repeats in normal subjects and 40 to 58 in affected subjects. The size distributions of normal and affected alleles did not overlap. A clear correlation bewteen early onset of symptoms and very high repeat number was seen, but the spread of the age-at-onset in the major repeat range producing characteristic HD it too wide to be of diagnostic value. There was also variability in the transmitted repeat size for both sexes in the HD size range. Maternal HD alleles showed a moderate instability with a preponderance of size decrease, while paternal HD alleles had a tendency to increase in repeat size on transmission, the degree of which appeared proportional to the initial size.

  18. Implementation of repeat HIV testing during pregnancy in Kenya: a qualitative study.

    Science.gov (United States)

    Rogers, Anna Joy; Weke, Elly; Kwena, Zachary; Bukusi, Elizabeth A; Oyaro, Patrick; Cohen, Craig R; Turan, Janet M

    2016-07-11

    Repeat HIV testing in late pregnancy has the potential to decrease rates of mother-to-child transmission of HIV by identifying mothers who seroconvert after having tested negative for HIV in early pregnancy. Despite being national policy in Kenya, the available data suggest that implementation rates are low. We conducted 20 in-depth semi-structured interviews with healthcare providers and managers to explore barriers and enablers to implementation of repeat HIV testing guidelines for pregnant women. Participants were from the Nyanza region of Kenya and were purposively selected to provide variation in socio-demographics and job characteristics. Interview transcripts were coded and analyzed in Dedoose software using a thematic analysis approach. Four themes were identified a priori using Ferlie and Shortell's Framework for Change and additional themes were allowed to emerge from the data. Participants identified barriers and enablers at the client, provider, facility, and health system levels. Key barriers at the client level from the perspective of providers included late initial presentation to antenatal care and low proportions of women completing the recommended four antenatal visits. Barriers to offering repeat HIV testing for providers included heavy workloads, time limitations, and failing to remember to check for retest eligibility. At the facility level, inconsistent volume of clients and lack of space required for confidential HIV retesting were cited as barriers. Finally, at the health system level, there were challenges relating to the HIV test kit supply chain and the design of nationally standardized antenatal patient registers. Enablers to improving the implementation of repeat HIV testing included client dissemination of the benefits of antenatal care through word-of-mouth, provider cooperation and task shifting, and it was suggested that use of an electronic health record system could provide automatic reminders for retest eligibility. This study

  19. Prolonged repeated acupuncture stimulation induces habituation effects in pain-related brain areas: an FMRI study.

    Directory of Open Access Journals (Sweden)

    Chuanfu Li

    Full Text Available Most previous studies of brain responses to acupuncture were designed to investigate the acupuncture instant effect while the cumulative effect that should be more important in clinical practice has seldom been discussed. In this study, the neural basis of the acupuncture cumulative effect was analyzed. For this experiment, forty healthy volunteers were recruited, in which more than 40 minutes of repeated acupuncture stimulation was implemented at acupoint Zhusanli (ST36. Three runs of acupuncture fMRI datasets were acquired, with each run consisting of two blocks of acupuncture stimulation. Besides general linear model (GLM analysis, the cumulative effects of acupuncture were analyzed with analysis of covariance (ANCOVA to find the association between the brain response and the cumulative duration of acupuncture stimulation in each stimulation block. The experimental results showed that the brain response in the initial stage was the strongest although the brain response to acupuncture was time-variant. In particular, the brain areas that were activated in the first block and the brain areas that demonstrated cumulative effects in the course of repeated acupuncture stimulation overlapped in the pain-related areas, including the bilateral middle cingulate cortex, the bilateral paracentral lobule, the SII, and the right thalamus. Furthermore, the cumulative effects demonstrated bimodal characteristics, i.e. the brain response was positive at the beginning, and became negative at the end. It was suggested that the cumulative effect of repeated acupuncture stimulation was consistent with the characteristic of habituation effects. This finding may explain the neurophysiologic mechanism underlying acupuncture analgesia.

  20. Association between CAG repeat polymorphisms and the risk of prostate cancer: a meta-analysis by race, study design and the number of (CAG)n repeat polymorphisms.

    Science.gov (United States)

    Sun, Jun-Hyun; Lee, Sang-Ah

    2013-11-01

    Although a number of studies have been conducted on the association between prostate cancer and CAG repeat polymorphisms of the androgen receptor gene, this association remains elusive and controversial. In this meta-analysis, we aimed to evaluate the effects of (CAG)n repeat genetic polymorphisms on the incidence of prostate cancer, particularly as regards race, study design and the number of (CAG)n repeats. To collect articles published on the association between CAG repeats and prostate cancer, publications were identified from the National Center for Biotechnology Information (NCBI) database of epidemiological studies published up to October 2011; our identification of publications was not limited by a language barrier. The following search keywords were used: prostate cancer risk, CAG repeat polymorphism, androgen receptor gene and human. Stata version 10 was used for the meta-analysis and the publication bias was measured through the Begg's test and Egger's test. This meta-analysis included 47 studies with 13,346 cases and 15,172 control or non-cases and consisted of 31 reports based on Caucasians, ten on Asians, one on Hispanics and four on combined ethnic groups. The carriers of a shorter CAG repeat sequence had an increased risk of prostate cancer (OR 1.21, 95% CI 1.10-1.34 for all subjects; OR 1.21, 95% CI 1.10-1.34 for prospective studies; OR 1.32, 95% CI 1.15-1.51 for retrospective studies) regardless of the exact length of the CAG repeat, compared with carriers of a longer repeat sequence. In terms of race, the risk of carrying a shorter CAG repeat sequence was 1.10- and 1.83-fold higher than that of a longer repeat sequence in Caucasians and Asians, respectively. For the specific number of CAG repeat polymorphisms, carriers of repeats were observed to have a higher risk of prostate cancer (OR 1.16, 95% CI 1.04-1.29) compared with carriers with ≥ 22 CAG repeat polymorphisms, particularly for Asians (OR 2.06, 95% CI 1.00-4.24). This meta

  1. Thyroid nodules with initially non-diagnostic, fine-needle aspiration results: comparison of core-needle biopsy and repeated fine-needle aspiration.

    Science.gov (United States)

    Choi, Sang Hyun; Baek, Jung Hwan; Lee, Jeong Hyun; Choi, Young Jun; Hong, Min Ji; Song, Dong Eun; Kim, Jae Kyun; Yoon, Jong Ho; Kim, Won Bae

    2014-11-01

    To evaluate the role of core-needle biopsy (CNB) by comparing the results of CNB and repeated fine-needle aspiration (FNA) for thyroid nodules with initially non-diagnostic FNA results. From October 2008 to December 2011, 360 nodules - 180 consecutive repeated FNAs and 180 consecutive CNBs -- from 360 patients (83 men, 277 women; mean age, 54.4 years) with initially non-diagnostic FNA results were analyzed retrospectively. The incidence of non-diagnostic results, inconclusive results, diagnostic surgery, and diagnostic performance of repeated FNA and CNB were assessed, and factors affecting second non-diagnostic results were evaluated. CNB achieved a significantly lower non-diagnostic and inconclusive rate than repeated FNA (1.1 % versus 40.0 %, P needle biopsy achieved a lower number of non-diagnostic and inconclusive results. • Core-needle biopsy achieved better diagnostic performance. • Use of core-needle biopsy could prevent unnecessary diagnostic surgery. • Repeated fine-needle aspiration was significantly associated with a second non-diagnosis.

  2. Ventilatory long-term facilitation is evident after initial and repeated exposure to intermittent hypoxia in mice genetically depleted of brain serotonin.

    Science.gov (United States)

    Hickner, Stephen; Hussain, Najaah; Angoa-Perez, Mariana; Francescutti, Dina M; Kuhn, Donald M; Mateika, Jason H

    2014-02-01

    Our study was designed to determine if central nervous system (CNS) serotonin is required for the induction of ventilatory long-term facilitation (LTF) in intact, spontaneously breathing mice. Nineteen tryptophan hydroxylase 2-deficient (Tph2(-/-)) mice, devoid of serotonin in the CNS, and their wild-type counterparts (Tph2(+/+)) were exposed to intermittent hypoxia each day for 10 consecutive days. The ventilatory response to intermittent hypoxia was greater in the Tph2(+/+) compared with the Tph2(-/-) mice (1.10 ± 0.10 vs. 0.77 ± 0.01 ml min(-1)·percent(-1) oxygen; P ≤ 0.04). Ventilatory LTF, caused by increases in breathing frequency, was evident in Tph2(+/+) and Tph2(-/-) mice following exposure to intermittent hypoxia each day; however, the magnitude of the response was greater in the Tph2(+/+) compared with the Tph2(-/-) mice (1.11 ± 0.02 vs. 1.05 ± 0.01 normalized to baseline on each day; P ≤ 0.01). The magnitude of ventilatory LTF increased significantly from the initial to the finals days of the protocol in the Tph2(-/-) (1.06 ± 0.02 vs. 1.11 ± 0.03 normalized to baseline on the initial days; P ≤ 0.004) but not in the Tph2(+/+) mice. This enhanced response was mediated by increases in tidal volume. Body temperature and metabolic rate did not account for differences in the magnitude of ventilatory LTF observed between groups after acute and repeated daily exposure to intermittent hypoxia. We conclude that ventilatory LTF, after acute exposure to intermittent hypoxia, is mediated by increases in breathing frequency and occurs in the absence of serotonin, although the magnitude of the response is diminished. This weakened response is enhanced following repeated daily exposure to intermittent hypoxia, via increases in tidal volume, to a similar magnitude evident in Tph2(+/+) mice. Thus the magnitude of ventilatory LTF following repeated daily exposure to intermittent hypoxia is not dependent on the presence of CNS serotonin.

  3. Analysing Repeat Visitation on Country Level with Passive Mobile Positioning Method: an Estonian Case Study

    Directory of Open Access Journals (Sweden)

    Andres Kuusik

    2013-01-01

    Full Text Available The purpose of this paper is to investigate the capabilities and limits of the passive mobile positioning (PMP method in studying loyalty of tourists on the macro level. The repeat visitors were identified using database of call activities of roaming phones in Estonia since 25.04.2005 till 31.01.2009. For this purpose was developed model which selected repeat visits on the basis of time interval. The findings of the study revealed that it is possible to observe the duration, density, seasonality and dynamics of repeat visitations. In addition the local destinations and events most loved by repeat visitors and the trajectory they are using could be also identified. Another important finding revealed that repeat visitors stay longer in destination than first time visitors. The results presented in this paper could be used by Estonian Ministry of Economic Affairs and Communications and by Enterprise Estonia developing the Estonian tourism policy

  4. Space Biology Initiative. Trade Studies, volume 2

    Science.gov (United States)

    1989-01-01

    The six studies which are the subjects of this report are entitled: Design Modularity and Commonality; Modification of Existing Hardware (COTS) vs. New Hardware Build Cost Analysis; Automation Cost vs. Crew Utilization; Hardware Miniaturization versus Cost; Space Station Freedom/Spacelab Modules Compatibility vs. Cost; and Prototype Utilization in the Development of Space Hardware. The product of these six studies was intended to provide a knowledge base and methodology that enables equipment produced for the Space Biology Initiative program to meet specific design and functional requirements in the most efficient and cost effective form consistent with overall mission integration parameters. Each study promulgates rules of thumb, formulas, and matrices that serves as a handbook for the use and guidance of designers and engineers in design, development, and procurement of Space Biology Initiative (SBI) hardware and software.

  5. Space Biology Initiative. Trade Studies, volume 1

    Science.gov (United States)

    1989-01-01

    The six studies which are addressed are entitled: Design Modularity and Commonality; Modification of Existing Hardware (COTS) vs. New Hardware Build Cost Analysis; Automation Cost vs. Crew Utilization; Hardware Miniaturization versus Cost; Space Station Freedom/Spacelab Modules Compatibility vs. Cost; and Prototype Utilization in the Development of Space Hardware. The product of these six studies was intended to provide a knowledge base and methodology that enables equipment produced for the Space Biology Initiative program to meet specific design and functional requirements in the most efficient and cost effective form consistent with overall mission integration parameters. Each study promulgates rules of thumb, formulas, and matrices that serves has a handbook for the use and guidance of designers and engineers in design, development, and procurement of Space Biology Initiative (SBI) hardware and software.

  6. [A case-control study of factors associated with repeat teen pregnancy based on a sample from a university maternity hospital].

    Science.gov (United States)

    Silva, Andréa de Albuquerque Arruda; Coutinho, Isabela C; Katz, Leila; Souza, Alex Sandro Rolland

    2013-03-01

    Repeat teen pregnancy is a frequent issue and is considered an aggravating factor for increased maternal and fetal morbidity and social problems. The aim of the study was to identify factors associated with repeat teen pregnancy. A case-control study was conducted in 90 postpartum adolescents with more than one pregnancy (cases) and 90 adult women with a history of only one pregnancy during adolescence (controls). Statistical analysis used hierarchical logistic regression with 5% significance. Early sexual initiation (< 15 years), early age at first pregnancy (< 16 years), not raising the children themselves, and low family income (< one minimum wage) were associated with repeat teenage pregnancy, while partner change was inversely associated. Repeat teen pregnancy was mainly associated with reproductive and socioeconomic factors. Partner change appeared as a protective factor. Measures should be adopted during the postpartum period of teenage mothers in order to avoid repeat pregnancy.

  7. The Effect of Age and Initial Central Retinal Thickness on Earlier Need of Repeat Ozurdex Treatment for Macular Edema Due to Retinal Vein Occlusion: A Retrospective Case Series.

    Science.gov (United States)

    Lin, Chun-Ju; Chen, Huan-Sheng; Su, Cheng-Wen; Tien, Peng-Tai; Lin, Jane-Ming; Chen, Wen-Lu; Kuo, Chung-Yuan; Lai, Chun-Ting; Tsai, Yi-Yu

    2017-09-26

    To evaluate the effects of dexamethasone intravitreal implant (Ozurdex) and identify risk factors for repeated treatment in patients with macula edema due to branch retinal vein occlusion (BRVO) or central retinal vein occlusion (CRVO). Patients followed up for at least 6 months were enrolled from 2013 to 2016. Dexamethasone intravitreal implant was given as the baseline treatment. For evaluation of dexamethasone intravitreal implant effects and complications, the demographics, medical history, best-corrected visual acuity (BCVA), intraocular pressure, and central retinal thickness (CRT) were recorded. Multivariate Cox proportional hazard model and logistic regression were used to identify factors for repeated treatment. Twenty-three BRVO and 11 CRVO patients were enrolled. There were 15 males and 19 females. Fifteen (44.12%) patients needed only one dexamethasone intravitreal implant. The peak CRT and BCVA significantly improved. Comparing single-injection with multiple-injection group, age and initial CRT more than 400 μm were significantly higher in the multiple-injection group. From multivariate logistic regression and Cox proportional hazards analysis, patients with age older than 55 years and initial CRT more than 400 μm had higher risk for multiple injections. Patients receiving as-needed schedule of dexamethasone intravitreal implant had significant peak CRT and BCVA improvement. Age older than 55 years and initial CRT more than 400 μm were significant risk factors associated with repeated dexamethasone intravitreal implant treatment.

  8. The PICTURE study: diagnostic accuracy of multiparametric MRI in men requiring a repeat prostate biopsy.

    Science.gov (United States)

    Simmons, Lucy A M; Kanthabalan, Abi; Arya, Manit; Briggs, Tim; Barratt, Dean; Charman, Susan C; Freeman, Alex; Gelister, James; Hawkes, David; Hu, Yipeng; Jameson, Charles; McCartan, Neil; Moore, Caroline M; Punwani, Shonit; Ramachandran, Navin; van der Meulen, Jan; Emberton, Mark; Ahmed, Hashim U

    2017-04-25

    Transrectal prostate biopsy has limited diagnostic accuracy. Prostate Imaging Compared to Transperineal Ultrasound-guided biopsy for significant prostate cancer Risk Evaluation (PICTURE) was a paired-cohort confirmatory study designed to assess diagnostic accuracy of multiparametric magnetic resonance imaging (mpMRI) in men requiring a repeat biopsy. All underwent 3 T mpMRI and transperineal template prostate mapping biopsies (TTPM biopsies). Multiparametric MRI was reported using Likert scores and radiologists were blinded to initial biopsies. Men were blinded to mpMRI results. Clinically significant prostate cancer was defined as Gleason ⩾4+3 and/or cancer core length ⩾6 mm. Two hundred and forty-nine had both tests with mean (s.d.) age was 62 (7) years, median (IQR) PSA 6.8 ng ml (4.98-9.50), median (IQR) number of previous biopsies 1 (1-2) and mean (s.d.) gland size 37 ml (15.5). On TTPM biopsies, 103 (41%) had clinically significant prostate cancer. Two hundred and fourteen (86%) had a positive prostate mpMRI using Likert score ⩾3; sensitivity was 97.1% (95% confidence interval (CI): 92-99), specificity 21.9% (15.5-29.5), negative predictive value (NPV) 91.4% (76.9-98.1) and positive predictive value (PPV) 46.7% (35.2-47.8). One hundred and twenty-nine (51.8%) had a positive mpMRI using Likert score ⩾4; sensitivity was 80.6% (71.6-87.7), specificity 68.5% (60.3-75.9), NPV 83.3% (75.4-89.5) and PPV 64.3% (55.4-72.6). In men advised to have a repeat prostate biopsy, prostate mpMRI could be used to safely avoid a repeat biopsy with high sensitivity for clinically significant cancers. However, such a strategy can miss some significant cancers and overdiagnose insignificant cancers depending on the mpMRI score threshold used to define which men should be biopsied.

  9. Repeated open application test with methyldibromo glutaronitrile, a multicentre study within the EECDRG.

    Science.gov (United States)

    Gruvberger, B; Andersen, K E; Brandão, F M; Bruynzeel, D P; Bruze, M; Frosch, P J; Goossens, A; Lahti, A; Maibach, H I; Menné, T; Orton, D; Seidenari, S

    2005-01-01

    Contact allergy to and allergic contact dermatitis from methyldibromo glutaronitrile (MDBGN) have frequently been reported. This study was initiated to help determine the optimal patch test preparation for MDBGN. In 51 patients with a doubtful or a positive patch test reaction to at least 1 of 4 test preparations with MDBGN in petrolatum at 1.0% w/w, 0.5%, 0.3% and 0.1%, a repeated open application test (ROAT) with moisturizers with and without MDBGN at 0.03% w/w was performed on the upper arms for 2 weeks. 18 of the 51 (35.3%) patients developed a positive ROAT. In all patients, there was a positive ROAT only to the moisturizer with MDBGN (P < 0.001). A statistically significant association was also found between the patch test reactivity (PTRL) and the outcome of the ROAT (P < 0.001). If only considering those with a PTRL above 0.3%, thus with negative or doubtful test reactions to 0.1% and 0.3%, there were still statistically significantly more patients with a positive ROAT to the moisturizer with MDBGN than to the moisturizer without MDBGN. The study demonstrates that patch testing with MDBGN at 0.3% and 0.1% will miss clinically relevant patch test reactions to MDBGN.

  10. Repeated exposure of acidic beverages on esthetic restorative materials: An in-vitro surface microhardness study.

    Science.gov (United States)

    Xavier, Arun M; Sunny, Steffy M; Rai, Kavita; Hegde, Amitha M

    2016-07-01

    A manifold increase in the consumption of aerated beverages has witnessed a twin increase in tooth wear and raised demand for esthetic restorative materials. This study aimed to evaluate the surface microhardness changes of esthetic restorative materials following treatment with aerated beverages in an in-vitro situation. The initial surface microhardness of the restorative materials GC Fuji II LC, GC Fuji IX, Nano Glass ionomer, Resin and Nano composite was recorded. These materials were studied under 3 groups that included those exposed to the acidic beverages daily, weekly once in a month and those that had no exposures at all. The final surface microhardness of the materials was recorded following experimentation and was subjected to statistical comparisons. The restorative materials were compared for their surface microhardness changes following respective treatments using the T-test and One-way ANOVA analysis. Inter-comparisons between the groups showed statistical significance (pmaterials revealed surface microhardness loss; the maximum reduction noticed with the Nano glass ionomer cement tested (pmaterials markedly reduced upon repeated exposures with acidic beverages; the product with phosphoric acid producing the maximum surface microhardness loss. Restorative materials, acidic beverages, surface microhardness, resin composites, glass ionomers.

  11. Application of transrectal ultrasound-guided repeat needle biopsy in the diagnosis of prostate cancer in Chinese population: A retrospective study

    Directory of Open Access Journals (Sweden)

    Yi Wang

    2016-01-01

    Full Text Available Background: Transrectal ultrasound-guided repeat needle biopsy (TUGRNB is widely used for diagnosis of prostate cancer (PCa. However, significance of TUGRNB in Chinese population was rarely reported. A retrospective study was conducted to evaluate the significance of TUGRNB applied in prediction of PCa in Chinese population. Materials and Methods: A total of 960 from January 2009 to December 2012 were included. Repeat needle biopsy rate and PCa positive detection rate were evaluated. Relationship between prostate specific antigen (PSA levels and PCa positive rates was analyzed. Results: PCa positive detection rate after initial needle biopsy was 28.4%, which was lower than the rate of repeat needle biopsy (40%. The rate for immediate transurethral resection (TUR, surgery after initial needle biopsy, was 27.1%, however with a low PCa positive detection rate (0.66%. The repeat needle biopsy rate was lower compared with the initial biopsy rate (P 20 ng/ml, PCa positive rate was significantly higher than those with PSA < 20 ng/ml (P < 0.05. Conclusion: PCa positive detection rate following repeat needle biopsy in Chinese population was higher, although the repeated needle biopsy rate was still in a low level. TUGRNB should attract more attention in the diagnosis of PCa.

  12. Computational study of the human dystrophin repeats: interaction properties and molecular dynamics.

    Science.gov (United States)

    Legrand, Baptiste; Giudice, Emmanuel; Nicolas, Aurélie; Delalande, Olivier; Le Rumeur, Elisabeth

    2011-01-01

    Dystrophin is a large protein involved in the rare genetic disease Duchenne muscular dystrophy (DMD). It functions as a mechanical linker between the cytoskeleton and the sarcolemma, and is able to resist shear stresses during muscle activity. In all, 75% of the dystrophin molecule consists of a large central rod domain made up of 24 repeat units that share high structural homology with spectrin-like repeats. However, in the absence of any high-resolution structure of these repeats, the molecular basis of dystrophin central domain's functions has not yet been deciphered. In this context, we have performed a computational study of the whole dystrophin central rod domain based on the rational homology modeling of successive and overlapping tandem repeats and the analysis of their surface properties. Each tandem repeat has very specific surface properties that make it unique. However, the repeats share enough electrostatic-surface similarities to be grouped into four separate clusters. Molecular dynamics simulations of four representative tandem repeats reveal specific flexibility or bending properties depending on the repeat sequence. We thus suggest that the dystrophin central rod domain is constituted of seven biologically relevant sub-domains. Our results provide evidence for the role of the dystrophin central rod domain as a scaffold platform with a wide range of surface features and biophysical properties allowing it to interact with its various known partners such as proteins and membrane lipids. This new integrative view is strongly supported by the previous experimental works that investigated the isolated domains and the observed heterogeneity of the severity of dystrophin related pathologies, especially Becker muscular dystrophy.

  13. Computational study of the human dystrophin repeats: interaction properties and molecular dynamics.

    Directory of Open Access Journals (Sweden)

    Baptiste Legrand

    Full Text Available Dystrophin is a large protein involved in the rare genetic disease Duchenne muscular dystrophy (DMD. It functions as a mechanical linker between the cytoskeleton and the sarcolemma, and is able to resist shear stresses during muscle activity. In all, 75% of the dystrophin molecule consists of a large central rod domain made up of 24 repeat units that share high structural homology with spectrin-like repeats. However, in the absence of any high-resolution structure of these repeats, the molecular basis of dystrophin central domain's functions has not yet been deciphered. In this context, we have performed a computational study of the whole dystrophin central rod domain based on the rational homology modeling of successive and overlapping tandem repeats and the analysis of their surface properties. Each tandem repeat has very specific surface properties that make it unique. However, the repeats share enough electrostatic-surface similarities to be grouped into four separate clusters. Molecular dynamics simulations of four representative tandem repeats reveal specific flexibility or bending properties depending on the repeat sequence. We thus suggest that the dystrophin central rod domain is constituted of seven biologically relevant sub-domains. Our results provide evidence for the role of the dystrophin central rod domain as a scaffold platform with a wide range of surface features and biophysical properties allowing it to interact with its various known partners such as proteins and membrane lipids. This new integrative view is strongly supported by the previous experimental works that investigated the isolated domains and the observed heterogeneity of the severity of dystrophin related pathologies, especially Becker muscular dystrophy.

  14. Repeat film analysis and its implications for quality assurance in dental radiology: An institutional case study

    Directory of Open Access Journals (Sweden)

    Shruthi Acharya

    2015-01-01

    Full Text Available Context: The goal of any radiologist is to produce the highest quality diagnostic radiographs, while keeping patient exposure as low as reasonably achievable (ALARA. Aims: The aim of this study was to describe the reasons for radiograph rejections through a repeat film analysis in an Indian dental school. Settings and Design: An observational study conducted in the Department of Oral Medicine and Radiology, Manipal College of Dental Sciences, Manipal. Materials and Methods: During a 6-month study period, a total of 9,495 intra-oral radiographs and 2339 extraoral radiographs taken in the Radiology Department were subjected to repeat film analysis. Statistical Analysis Used: SPSS Version 16. Descriptive analysis used. Results: The results showed that the repeat rates were 7.1% and 5.86% for intraoral and extraoral radiographs, respectively. Among the causes for errors reported, positioning error (38.7% was the most common, followed by improper angulations (26.1%, and improper film placement (11.2% for intra-oral radiographs. The study found that the maximum frequency of repeats among extraoral radiographs was for panoramic radiographs (49% followed by lateral cephalogram (33%, and paranasal sinus view (14%. It was also observed that repeat rate of intraoral radiographs was highest for internees (44.7%, and undergraduate students (28.2%. Conclusions: The study pointed to a need for more targeted interventions to achieve the goal of keeping patient exposure ALARA in a dental school setting.

  15. A study of allelic polymorphism of four short tandem repeats in the population of northwestern Russia

    Energy Technology Data Exchange (ETDEWEB)

    Aseev, M.V.; Skakun, V.N.; Baranov, V.S. [Ott Institute of Obstetrics and Gynecology, St. Petersburg (Russian Federation)

    1995-06-01

    Characteristics of the allelic polymorphisms of the trimeric AGC repeat of the androgen receptor gene (Xq11-12), exon 1 (AR); the tetrameric ATCT repeat of the von Willebrand factor gene (12p12), intron 40 (vWF); the AGAT repeat of the hypoxanthine phosphoribosyltransferase gene (Xq26) (HPRT); and the AGAT repeat of anonymous DNA sequences of the short arm of chromosome X (STRX1) were studied in 160 DNA samples from unrelated inhabitants of northwestern Russia using the method of polymerase chain reaction. Seventeen, ten, eight, and nine alleles were revealed electrophoretically for short tandem repeats of AR, vWF, HPRT, and STRX1, respectively. The heterozygosity indices for these repeats were 0.80, 0.70, 0.54, and 0.58, respectively. The values for AR and vWF correlated with those expected according to the Hardy-Weinberg equilibrium, whereas the values for HPRT and STRX1 differed significantly from those theoretically expected. The individualization potentials were 0.045, 0.135, 0.095, and 0.061 for the short tandem repeats of AR, vWF, HPRT, and STRX1, respectively. The distribution of genotypes for the set of these four loci in the population studied was determined. The possibilities of using the studied polymorphic marker systems in molecular diagnosis of the corresponding monogenic diseases - spinal and bulbar muscle atrophy (AR), Lesch-Nyhan disease (HPRT), and von Willebrand disease (vWF) - as well as in population human genetics, testing of personal identity, and molecular approaches to the estimation of mutagenic activity are discussed. 17 refs., 2 figs., 6 tabs.

  16. An interdisciplinary study in initial teacher training

    Directory of Open Access Journals (Sweden)

    Virginia Larraz Rada

    2014-07-01

    Full Text Available This experiment of innovative university education shows the interdisciplinary work carried out in the studies of the Bachelor of Science in Education at the University of Andorra. The study was developed within two subjects: Communication Technology (TAC and Cultural Heritage Education in Andorra. The main objective of this experiment is to foster the use of technological resources and digital materials, with the aim of drawing cultural heritage closer to the classroom. Based on a previous study of documentation and an analysis of online educational materials, the students have to design an e-book, which is understood to be digital material in the curricular field of cultural heritage. This digital material is a didactic proposal that focuses on the construction of knowledge by primary school students. During the elaboration of the materials the instructors introduce follow-up activities. The results of the experiment show that, from an interdisciplinary approach, and a problem-solving, learning-centered methodology, specific and transferable abilities in initial teacher training can be studied and evaluated.

  17. Anterior segment biometry: a study and review of resolution and repeatability data.

    Science.gov (United States)

    Reinstein, Dan Z; Gobbe, Marine; Archer, Timothy J

    2012-07-01

    To obtain comparable resolution and repeatability data for a selection of anterior segment imaging devices. A standard letter of request was sent in May 2008 to each device manufacturer requesting resolution and repeatability data for its device to be provided according to specific definitions and protocol; if this was not already published in the peer-reviewed domain, compliant raw data were required. Where applicable, repeatability data were reported for corneal vertex corneal thickness; epithelial and flap thickness; minimum corneal thickness; corneal, epithelial and flap thickness mapping for the central 6-mm diameter; minimum residual stromal thickness; angle-to-angle diameter; sulcus-to-sulcus diameter; and anterior chamber depth. To summarize published repeatability data, a complete review of the peer-reviewed literature waas performed. Nine of the 13 manufacturers contacted agreed to take part and provided the data requested: Pentacam HD (Oculus Optikgeräte GmbH), Galilei (Ziemer), Visante OCT (Carl Zeiss Meditec), SL-OCT (Haag-Streit), RTVue (Optovue), Artemis (ArcScan), Vumax (Sonomed), HiScan (Opticon), and Eye Cubed (Ellex/Innovative). Only one (Carl Zeiss Meditec) of 9 manufacturers was able to provide the data directly upon request, without performing a prospective study. Five of the 9 manufacturers were able to provide a complete set of repeatability data for all parameters measurable with their device; the remaining 4 manufacturers admitted that repeatability of some parameters was unknown. Both literature and manufacturers' data on file were lacking and required the study to be performed. This report provides an imperfect, but most comprehensive to date, resolution and repeatability data review of biometric devices intended for surgical planning. Copyright 2012, SLACK Incorporated.

  18. Effects of repeated injection of kisspeptin-10 on the initiation of egg-laying in juvenile quail.

    Science.gov (United States)

    Ni, Yingdong; Huang, Yanbing; Xiao, Yunqi; Wu, Jing; Qian, Fuyu; Grossmann, Roland; Zhao, Ruqian

    2012-10-01

    The kisspeptin (Kp) signaling pathway plays an essential role in the onset of reproduction in mammals. To investigate the effects of Kp on the initiation of egg laying in birds, juvenile female quail were given daily intraperitoneal injections of 300μl saline (control, Con), or 10nmol (low dosage, L) or 100nmol (high dosage, H) kisspeptin-10 (Kp-10) dissolved in 300μl saline for 3 weeks. The ratio of egg laying of quail in the L and H groups was notably increased compared to that of the Con group (Pquail by regulating the activities of the hypothalamus-pituitary-gonadal axis.

  19. Receptionist input to quality and safety in repeat prescribing in UK general practice: ethnographic case study.

    Science.gov (United States)

    Swinglehurst, Deborah; Greenhalgh, Trisha; Russell, Jill; Myall, Michelle

    2011-11-03

    To describe, explore, and compare organisational routines for repeat prescribing in general practice to identify contributors and barriers to safety and quality. Ethnographic case study. Four urban UK general practices with diverse organisational characteristics using electronic patient records that supported semi-automation of repeat prescribing. 395 hours of ethnographic observation of staff (25 doctors, 16 nurses, 4 healthcare assistants, 6 managers, and 56 reception or administrative staff), and 28 documents and other artefacts relating to repeat prescribing locally and nationally. Potential threats to patient safety and characteristics of good practice. Observation of how doctors, receptionists, and other administrative staff contributed to, and collaborated on, the repeat prescribing routine. Analysis included mapping prescribing routines, building a rich description of organisational practices, and drawing these together through narrative synthesis. This was informed by a sociological model of how organisational routines shape and are shaped by information and communications technologies. Results Repeat prescribing was a complex, technology-supported social practice requiring collaboration between clinical and administrative staff, with important implications for patient safety. More than half of requests for repeat prescriptions were classed as "exceptions" by receptionists (most commonly because the drug, dose, or timing differed from what was on the electronic repeat list). They managed these exceptions by making situated judgments that enabled them (sometimes but not always) to bridge the gap between the idealised assumptions about tasks, roles, and interactions that were built into the electronic patient record and formal protocols, and the actual repeat prescribing routine as it played out in practice. This work was creative and demanded both explicit and tacit knowledge. Clinicians were often unaware of this input and it did not feature in policy

  20. Planned Repeat Cesarean Section at Term and Adverse Childhood Health Outcomes: A Record-Linkage Study.

    Directory of Open Access Journals (Sweden)

    Mairead Black

    2016-03-01

    Full Text Available Global cesarean section (CS rates range from 1% to 52%, with a previous CS being the commonest indication. Labour following a previous CS carries risk of scar rupture, with potential for offspring hypoxic brain injury, leading to high rates of repeat elective CS. However, the effect of delivery by CS on long-term outcomes in children is unclear. Increasing evidence suggests that in avoiding exposure to maternal bowel flora during labour or vaginal birth, offspring delivered by CS may be adversely affected in terms of energy uptake from the gut and immune development, increasing obesity and asthma risks, respectively. This study aimed to address the evidence gap on long-term childhood outcomes following repeat CS by comparing adverse childhood health outcomes after (1 planned repeat CS and (2 unscheduled repeat CS with those that follow vaginal birth after CS (VBAC.A data-linkage cohort study was performed. All second-born, term, singleton offspring delivered between 1 January 1993 and 31 December 2007 in Scotland, UK, to women with a history of CS (n = 40,145 were followed up until 31 January 2015. Outcomes assessed included obesity at age 5 y, hospitalisation with asthma, learning disability, cerebral palsy, and death. Cox regression and binary logistic regression were used as appropriate to compare outcomes following planned repeat CS (n = 17,919 and unscheduled repeat CS (n = 8,847 with those following VBAC (n = 13,379. Risk of hospitalisation with asthma was greater following both unscheduled repeat CS (3.7% versus 3.3%, adjusted hazard ratio [HR] 1.18, 95% CI 1.05-1.33 and planned repeat CS (3.6% versus 3.3%, adjusted HR 1.24, 95% CI 1.09-1.42 compared with VBAC. Learning disability and death were more common following unscheduled repeat CS compared with VBAC (3.7% versus 2.3%, adjusted odds ratio 1.64, 95% CI 1.17-2.29, and 0.5% versus 0.4%, adjusted HR 1.50, 95% CI 1.00-2.25, respectively. Risk of obesity at age 5 y and risk of cerebral

  1. Identification and characterization of simple sequence repeats (SSRs) for population studies of Puccinia novopanici.

    Science.gov (United States)

    Orquera-Tornakian, Gabriela K; Garrido, Patricia; Kronmiller, Brent; Hunger, Robert; Tyler, Brett M; Garzon, Carla D; Marek, Stephen M

    2017-08-01

    Switchgrass (Panicum virgatum L.) can be severely affected by rust disease. Recently switchgrass rust caused by P. emaculata (now confirmed to be Puccinia novopanici) has received most of the attention by the research community because this pathogen is responsible for reducing the biomass production and biofuel feedstock quality of switchgrass. Microsatellite markers found in the literature were either not informative (no allele frequency) or showed few polymorphisms in the target populations, therefore additional markers are needed for future studies of the genetic variation and population structure of P. novopanici. This study reports the development and characterization of novel simple sequence repeat (SSR) markers from a Puccinia emaculata s.l. microsatellite-enriched library and expressed sequence tags (ESTs). Microsatellites were evaluated for polymorphisms on P. emaculata s.l. urediniospores collected in Iowa (IA), Mississippi (MS), Oklahoma (OK), South Dakota (SD) and Virginia (VA). Puccinia novopanici single spore whole genome amplifications were used as templates to validate the SSR reactions protocol and to assess a preliminary population genetics statistics of the pathogen. Eighteen microsatellite markers were polymorphic (average PIC=0.72) on individual urediniospores, with an average of 8.3 alleles per locus (range 3 to 17). Of the 49 SSRs loci initially identified in P. emaculata s.l., 18 were transferable to P. striiformis f. sp. tritici, 23 to P. triticina, 20 to P. sorghi and 31 to P. andropogonis. Thus, these markers could be useful for DNA fingerprinting and population structure analysis for population genetics, epidemiology and ecological studies of P. novopanici and potentially other related Puccinia species. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Longitudinal study of repeated sprint performance in youth soccer players of contrasting skeletal maturity status

    NARCIS (Netherlands)

    Valente-dos-Santos, Joao; Coelho-e-Silva, Manuel J.; Severino, Vitor; Duarte, Joao; Martins, Raul S.; Figueiredo, Antonio J.; Seabra, Andre T.; Philippaerts, Renaat M.; Cumming, Sean P.; Elferink-Gemser, Marije; Malina, Robert M.

    The purpose of the study was to evaluate the developmental changes in performance in a repeated-sprint ability (RSA) test in young soccer players of contrasting maturity status. A total of 83 regional level Portuguese youth soccer players, aged 11-13 years at baseline was assessed annually. Stature,

  3. Longitudinal study of repeated sprint performance in youth soccer players of contrasting maturity status

    NARCIS (Netherlands)

    V. Duarte; A. Seabra; A. Figueiredo; S. Cumming; R. Martins; R. Philippaerts; M. Coelho e Silva; J. Valente dos Santos; V. Severino; Marije Elferink-Gemser

    2012-01-01

    The purpose of the study was to evaluate the developmental changes in performance in a repeated-sprint ability (RSA) test in young soccer players of contrasting maturity status. A total of 83 regional level Portuguese youth soccer players, aged 11- 13 years at baseline was assessed annually.

  4. 40 CFR 799.9305 - TSCA Repeated dose 28-day oral toxicity study in rodents.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 31 2010-07-01 2010-07-01 true TSCA Repeated dose 28-day oral toxicity study in rodents. 799.9305 Section 799.9305 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... strains of young healthy adult animals should be employed. The females should be nulliparous and...

  5. Optimal selection of individuals for repeated covariate measurements in follow-up studies.

    Science.gov (United States)

    Reinikainen, Jaakko; Karvanen, Juha; Tolonen, Hanna

    2016-12-01

    Repeated covariate measurements bring important information on the time-varying risk factors in long epidemiological follow-up studies. However, due to budget limitations, it may be possible to carry out the repeated measurements only for a subset of the cohort. We study cost-efficient alternatives for the simple random sampling in the selection of the individuals to be remeasured. The proposed selection criteria are based on forms of the D-optimality. The selection methods are compared with the simulation studies and illustrated with the data from the East-West study carried out in Finland from 1959 to 1999. The results indicate that cost savings can be achieved if the selection is focused on the individuals with high expected risk of the event and, on the other hand, on those with extreme covariate values in the previous measurements. © The Author(s) 2014.

  6. Initial Aging Studies of Unfilled VCE

    Energy Technology Data Exchange (ETDEWEB)

    Letant, S E; Herberg, J L; Wilson, T S; Alviso, C T; Chinn, S C; Maxwell, R S

    2008-10-09

    This report presents initial data on the effects of temperature, oxygen, and radiation on the chemical and structural properties of newly formulated, unfilled VCE. This initial effort focused on a pristine sample, and a replicate sample irradiated in air at a dose of 25MR. Thermal degradation was investigated by performing Thermogravimetric Analysis (TGA), and radiation-induced degradation was investigated using Differential Scanning Calorimetry (DSC), X-ray Diffraction (XRD), Solid Phase MicroExtraction--Gas Chromatography/Mass Spectrometry (SPME-GC/MS), as well as various Nuclear Magnetic Resonance (NMR) techniques including: {sup 13}C, {sup 13}C {sup 1}H cross polarization (CP), and {sup 1}H magic angle spinning (MAS) NMR.

  7. Brexpiprazole Alters Monoaminergic Systems following Repeated Administration: an in Vivo Electrophysiological Study

    OpenAIRE

    Oosterhof, Chris A.; Mansari, Mostafa El; Bundgaard, Christoffer; Blier, Pierre

    2015-01-01

    Background: Brexpiprazole was recently approved as adjunctive therapy for depression and treatment of schizophrenia in adults. To complement results from a previous study in which its acute effects were characterized, the present study assessed the effect of repeated brexpiprazole administration on monoaminergic systems. Methods: Brexpiprazole (1mg/kg, subcutaneous) or vehicle was administered once daily for 2 and 14 days. Single-unit electrophysiological recordings from noradrenaline neurons...

  8. Evaluation of statistical tools used in short-term repeated dose administration toxicity studies with rodents.

    Science.gov (United States)

    Kobayashi, Katsumi; Pillai, K Sadasivan; Sakuratani, Yuki; Abe, Takemaru; Kamata, Eiichi; Hayashi, Makoto

    2008-02-01

    In order to know the different statistical tools used to analyze the data obtained from twenty-eight-day repeated dose oral toxicity studies with rodents and the impact of these statistical tools on interpretation of data obtained from the studies, study reports of 122 numbers of twenty-eight-day repeated dose oral toxicity studies conducted in rats were examined. It was found that both complex and easy routes of decision trees were followed for the analysis of the quantitative data. These tools include Scheffe's test, non-parametric type Dunnett's and Scheffe's tests with very low power. Few studies used the non-parametric Dunnett type test and Mann-Whitney's U test. Though Chi-square and Fisher's tests are widely used for analysis of qualitative data, their sensitivity to detect a treatment-related effect is questionable. Mann-Whitney's U test has better sensitivity to analyze qualitative data than the chi-square and Fisher's tests. We propose Dunnett's test for analysis of quantitative data obtained from twenty-eight-day repeated dose oral toxicity tests and for qualitative data, Mann-Whitney's U test. For both tests, one-sided test with p=0.05 may be applied.

  9. Acute and repeated dose toxicity studies of different β-cyclodextrin-based nanosponge formulations.

    Science.gov (United States)

    Shende, Pravin; Kulkarni, Yogesh A; Gaud, R S; Deshmukh, Kiran; Cavalli, Roberta; Trotta, Francesco; Caldera, Fabrizio

    2015-05-01

    Nanosponges (NS) show promising results in different fields such as medicine, agriculture, water purification, fire engineering and so on. The present study was designed to evaluate toxicity of different NS formulations (namely, S1-S6) synthesized with different cross-linking agents such as carbonyl diimidazole, pyromellitic dianhydride and hexamethylene diisocynate; and preparation methods in experimental animals. Acute and repeated dose toxicity studies of formulations were carried out as per OECD guidelines 423 and 407, respectively. For acute toxicity study, formulations were administered to female rats at doses of 300 and 2000 mg/kg orally. The general behaviour of the rats was continuously monitored for 1 h after dosing, periodically during the first 24 h and daily thereafter for a total of 14 days. On day 14, animals were fasted overnight, weighed, and sacrificed. After sacrification, animals were subjected to necropsy. For repeated dose toxicity study, rats of either sex were orally administered with formulations at the dose of 300 mg/kg per day for a period of 28 days. The maximally tolerated dose of all formulations was found to be 2000 mg/kg. Repeated administration of formulations for 28 days did not show any significant changes in haematological and biochemical parameters in experimental animals. These results indicate that the formulations are safe, when tested in experimental animals.

  10. Repeated vertebral augmentation for new vertebral compression fractures of postvertebral augmentation patients: a nationwide cohort study

    Directory of Open Access Journals (Sweden)

    Liang CL

    2015-03-01

    Full Text Available Cheng-Loong Liang,1 Hao-Kwan Wang,1 Fei-Kai Syu,2 Kuo-Wei Wang,1 Kang Lu,1 Po-Chou Liliang1 1Department of Neurosurgery, E-Da Hospital, I-Shou University, Kaohsiung City, Taiwan; 2Department of Pharmacy, China Medical University Hospital, Taichung City, Taiwan Purpose: Postvertebral augmentation vertebral compression fractures are common; repeated vertebral augmentation is usually performed for prompt pain relief. This study aimed to evaluate the incidence and risk factors of repeat vertebral augmentation.Methods: We performed a retrospective, nationwide, population-based longitudinal observation study, using the National Health Insurance Research Database (NHIRD of Taiwan. All patients who received vertebral augmentation for vertebral compression fractures were evaluated. The collected data included patient characteristics (demographics, comorbidities, and medication exposure and repeat vertebral augmentation. Kaplan–Meier and stratified Cox proportional hazard regressions were performed for analyses.Results: The overall incidence of repeat vertebral augmentation was 11.3% during the follow-up until 2010. Patients with the following characteristics were at greater risk for repeat vertebral augmentation: female sex (AOR=1.24; 95% confidence interval [CI]: 1.10–2.36, advanced age (AOR=1.60; 95% CI: 1.32–2.08, diabetes mellitus (AOR=4.31; 95% CI: 4.05–5.88, cerebrovascular disease (AOR=4.09; 95% CI: 3.44–5.76, dementia (AOR=1.97; 95% CI: 1.69–2.33, blindness or low vision (AOR=3.72; 95% CI: 2.32–3.95, hypertension (AOR=2.58; 95% CI: 2.35–3.47, and hyperlipidemia (AOR=2.09; 95% CI: 1.67–2.22. Patients taking calcium/ vitamin D (AOR=2.98; 95% CI: 1.83–3.93, bisphosphonates (AOR=2.11; 95% CI: 1.26–2.61, or calcitonin (AOR=4.59; 95% CI: 3.40–5.77 were less likely to undergo repeat vertebral augmentation; however, those taking steroids (AOR=7.28; 95% CI: 6.32–8.08, acetaminophen (AOR=3.54; 95% CI: 2.75–4.83, or nonsteroidal

  11. Chromosomal abnormalities in couples with repeated fetal loss: An Indian retrospective study

    Directory of Open Access Journals (Sweden)

    Frenny J Sheth

    2013-01-01

    Full Text Available Background: Recurrent pregnancy loss is a common occurrence and a matter of concern for couples planning the pregnancy. Chromosomal abnormalities, mainly balanced rearrangements, are common in couples with repeated miscarriages. Purpose: The purpose of this study is to evaluate the contribution of chromosomal anomalies causing repeated spontaneous miscarriages and provide detailed characterization of a few structurally altered chromosomes. Materials and Methods: A retrospective cytogenetic study was carried out on 4859 individuals having a history of recurrent miscarriages. The cases were analyzed using G-banding and fluorescence in situ hybridization wherever necessary. Results: Chromosomal rearrangements were found in 170 individuals (3.5%. Translocations were seen in 72 (42.35% cases. Of these, reciprocal translocations constituted 42 (24.70% cases while Robertsonian translocations were detected in 30 (17.64% cases. 7 (4.11% cases were mosaic, 8 (4.70% had small supernumerary marker chromosomes and 1 (0.6% had an interstitial microdeletion. Nearly, 78 (1.61% cases with heteromorphic variants were seen of which inversion of Y chromosome (57.70% and chromosome 9 pericentromeric variants (32.05% were predominantly involved. Conclusions: Chromosomal analysis is an important etiological investigation in couples with repeated miscarriages. Characterization of variants/marker chromosome enable calculation of a more precise recurrent risk in a subsequent pregnancy thereby facilitating genetic counseling and deciding further reproductive options.

  12. Prolonged Repeated Acupuncture Stimulation Induces Habituation Effects in Pain-Related Brain Areas: An fMRI Study

    Science.gov (United States)

    Li, Chuanfu; Yang, Jun; Park, Kyungmo; Wu, Hongli; Hu, Sheng; Zhang, Wei; Bu, Junjie; Xu, Chunsheng; Qiu, Bensheng; Zhang, Xiaochu

    2014-01-01

    Most previous studies of brain responses to acupuncture were designed to investigate the acupuncture instant effect while the cumulative effect that should be more important in clinical practice has seldom been discussed. In this study, the neural basis of the acupuncture cumulative effect was analyzed. For this experiment, forty healthy volunteers were recruited, in which more than 40 minutes of repeated acupuncture stimulation was implemented at acupoint Zhusanli (ST36). Three runs of acupuncture fMRI datasets were acquired, with each run consisting of two blocks of acupuncture stimulation. Besides general linear model (GLM) analysis, the cumulative effects of acupuncture were analyzed with analysis of covariance (ANCOVA) to find the association between the brain response and the cumulative duration of acupuncture stimulation in each stimulation block. The experimental results showed that the brain response in the initial stage was the strongest although the brain response to acupuncture was time-variant. In particular, the brain areas that were activated in the first block and the brain areas that demonstrated cumulative effects in the course of repeated acupuncture stimulation overlapped in the pain-related areas, including the bilateral middle cingulate cortex, the bilateral paracentral lobule, the SII, and the right thalamus. Furthermore, the cumulative effects demonstrated bimodal characteristics, i.e. the brain response was positive at the beginning, and became negative at the end. It was suggested that the cumulative effect of repeated acupuncture stimulation was consistent with the characteristic of habituation effects. This finding may explain the neurophysiologic mechanism underlying acupuncture analgesia. PMID:24821143

  13. On the Applicability of Elastic Network Models for the Study of RNA CUG Trinucleotide Repeat Overexpansion.

    Directory of Open Access Journals (Sweden)

    Àlex L González

    Full Text Available Non-coding RNAs play a pivotal role in a number of diseases promoting an aberrant sequestration of nuclear RNA-binding proteins. In the particular case of myotonic dystrophy type 1 (DM1, a multisystemic autosomal dominant disease, the formation of large non-coding CUG repeats set up long-tract hairpins able to bind muscleblind-like proteins (MBNL, which trigger the deregulation of several splicing events such as cardiac troponin T (cTNT and insulin receptor's, among others. Evidence suggests that conformational changes in RNA are determinant for the recognition and binding of splicing proteins, molecular modeling simulations can attempt to shed light on the structural diversity of CUG repeats and to understand their pathogenic mechanisms. Molecular dynamics (MD are widely used to obtain accurate results at atomistic level, despite being very time consuming, and they contrast with fast but simplified coarse-grained methods such as Elastic Network Model (ENM. In this paper, we assess the application of ENM (traditionally applied on proteins for studying the conformational space of CUG repeats and compare it to conventional and accelerated MD conformational sampling. Overall, the results provided here reveal that ANM can provide useful insights into dynamic rCUG structures at a global level, and that their dynamics depend on both backbone and nucleobase fluctuations. On the other hand, ANM fail to describe local U-U dynamics of the rCUG system, which require more computationally expensive methods such as MD. Given that several limitations are inherent to both methods, we discuss here the usefulness of the current theoretical approaches for studying highly dynamic RNA systems such as CUG trinucleotide repeat overexpansions.

  14. Initial DEMO tokamak design configuration studies

    Energy Technology Data Exchange (ETDEWEB)

    Bachmann, Christian, E-mail: christian.bachmann@efda.org [EFDA, Boltzmannstraße 2, 85748 Garching (Germany); Aiello, G. [CEA-Saclay, DEN, DM2S, SEMT, F-91191 Gif-Sur-Yvette (France); Albanese, R.; Ambrosino, R. [ENEA/CREATE, Universita di Napoli Federico II, Naples (Italy); Arbeiter, F. [Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany); Aubert, J. [CEA-Saclay, DEN, DM2S, SEMT, F-91191 Gif-Sur-Yvette (France); Boccaccini, L.; Carloni, D. [Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany); Federici, G. [EFDA, Boltzmannstraße 2, 85748 Garching (Germany); Fischer, U. [Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany); Kovari, M. [CCFE, Culham Science Centre, Abingdon, Oxon OX14 3DB (United Kingdom); Li Puma, A. [CEA-Saclay, DEN, DM2S, SEMT, F-91191 Gif-Sur-Yvette (France); Loving, A. [CCFE, Culham Science Centre, Abingdon, Oxon OX14 3DB (United Kingdom); Maione, I. [Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany); Mattei, M. [ENEA/CREATE, Universita di Napoli Federico II, Naples (Italy); Mazzone, G. [ENEA C.R. Frascati, via E. Fermi 45, 00044 Frascati, Roma (Italy); Meszaros, B. [EFDA, Boltzmannstraße 2, 85748 Garching (Germany); Palermo, I. [Centro de Investigaciones Energéticas, Medioambientales y Tecnológicas (CIEMAT), Madrid (Spain); Pereslavtsev, P. [Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany); Riccardo, V. [CCFE, Culham Science Centre, Abingdon, Oxon OX14 3DB (United Kingdom); and others

    2015-10-15

    Highlights: • A definition of main DEMO requirements. • A description of the DEMO tokamak design configuration. • A description of issues yet to be solved. - Abstract: To prepare the DEMO conceptual design phase a number of physics and engineering assessments were carried out in recent years in the frame of EFDA concluding in an initial design configuration of a DEMO tokamak. This paper gives an insight into the identified engineering requirements and constraints and describes their impact on the selection of the technologies and design principles of the main tokamak components. The EU DEMO program aims at making best use of the technologies developed for ITER (e.g., magnets, vessel, cryostat, and to some degree also the divertor). However, other systems in particular the breeding blanket require design solutions and advanced technologies that will only partially be tested in ITER. The main differences from ITER include the requirement to breed, to extract, to process and to recycle the tritium needed for plasma operation, the two orders of magnitude larger lifetime neutron fluence, the consequent radiation dose levels, which limit remote maintenance options, and the requirement to use low-activation steel for in-vessel components that also must operate at high temperature for efficient energy conversion.

  15. An Interdisciplinary Study in Initial Teacher Training

    Science.gov (United States)

    Larraz Rada, Virginia; Yáñez de Aldecoa, Cristina; Gisbert Cervera, Mercè; Espuny Vidal, Cinta

    2014-01-01

    This experiment of innovative university education shows the interdisciplinary work carried out in the studies of the Bachelor of Science in Education at the University of Andorra. The study was developed within two subjects: Communication Technology (TAC) and Cultural Heritage Education in Andorra. The main objective of this experiment is to…

  16. Effectiveness of repeated photodynamic therapy in the elimination of intracanal Enterococcus faecalis biofilm: an in vitro study.

    Science.gov (United States)

    Prażmo, Ewa Joanna; Godlewska, Renata Alicja; Mielczarek, Agnieszka Beata

    2017-04-01

    The study aimed to investigate the effectiveness of photodynamic therapy in the elimination of intracanal Enterococcus faecalis biofilm and to analyse how a repeated light irradiation, replenishment of oxygen and photosensitiser affect the results of the photodynamic disinfecting protocol. After chemomechanical preparation, 46 single-rooted human teeth were infected with a clinical strain of E. faecalis and incubated for a week in microaerobic conditions. The experimental procedures included groups of single application of photodynamic therapy, two cycles of PDT, irrigation with 5.25% NaOCl solution and negative and positive control. The number of residing bacterial colonies in the root canals was determined based on the CFU/ml method. In the group of preparations irrigated with NaOCl, bacterial colonies were not observed. A single PDT eliminated 45% of the initial CFU/ml. Repeated PDT eradicated 95% of the intracanal bacterial biofilm. Photodynamic therapy has a high potential for the elimination of E. faecalis biofilm. There is a safe therapeutic window where photoinduced disinfection can be used as an adjuvant to conventional endodontic treatment, which remains the most effective.

  17. The role of exposure history on HIV acquisition: insights from repeated low-dose challenge studies.

    Directory of Open Access Journals (Sweden)

    Roland R Regoes

    Full Text Available To assess the efficacy of HIV vaccine candidates or preventive treatment, many research groups have started to challenge monkeys repeatedly with low doses of the virus. Such challenge data provide a unique opportunity to assess the importance of exposure history for the acquisition of the infection. I developed stochastic models to analyze previously published challenge data. In the mathematical models, I allowed for variation of the animals' susceptibility to infection across challenge repeats, or across animals. In none of the studies I analyzed, I found evidence for an immunizing effect of non-infecting challenges, and in most studies, there is no evidence for variation in the susceptibilities to the challenges across animals. A notable exception was a challenge experiment by Letvin et al. Sci Translat Med (2011 conducted with the strain SIVsmE660. The challenge data of this experiment showed significant susceptibility variation from animal-to-animal, which is consistent with previously established genetic differences between the involved animals. For the studies which did not show significant immunizing effects and susceptibility differences, I conducted a power analysis and could thus exclude a very strong immunization effect for some of the studies. These findings validate the assumption that non-infecting challenges do not immunize an animal - an assumption that is central in the argument that repeated low-dose challenge experiments increase the statistical power of preclinical HIV vaccine trials. They are also relevant for our understanding of the role of exposure history for HIV acquisition and forecasting the epidemiological spread of HIV.

  18. An Initial Study on Video Game Localization

    Institute of Scientific and Technical Information of China (English)

    言明乐

    2009-01-01

    Rapid expanding of video games around the globe brings the prosperity of localization industry. As one of the largest markets, China has become a popular arena for foreign game publishers,that is why studies on video game trans-lation are urgent and important. Focusing on the translation activity in video game localization, this paper describes the process of translation and summarizes the contents need to be translated.

  19. Factors associated with repeated outbreak of anthrax in Bangladesh: qualitative and quantitative study

    Directory of Open Access Journals (Sweden)

    Jayedul Hassan

    2015-06-01

    Full Text Available Anthrax, caused by Bacillus anthracis is an acute, febrile disease of warm blooded animals including humans. Social norms and poverty in addition to climatic factors such as soil conditions, seasons of year, ambient temperature and rainfall influence the persistence of the B. anthracis and anthrax outbreaks. The present study was designed to reveal the factors influencing the repeated outbreak of anthrax in Bangladesh. Considering the previous outbreaks of anthrax, Sirajganj, Bogra, Kushtia, Tangail and Mymensingh districts of Bangladesh were selected for this study. To elucidate the factors, qualitative data relating to the animal management, knowledge and behavior of the people; and quantitative data relating to soil conditions, ambient temperature and rainfall were acquired, and analyzed critically. Based on the outbreak histories, a year was divided into two seasons, anthrax prone season (May-November and anthrax dry season (December-April. Anthrax spores could be isolated from 11.67% (n=14/120 of the soil samples collected from the study areas. The present study revealed that poor knowledge, lack of awareness, improper carcass disposal, inadequate vaccination, high Ca content and moisture in the soil along with high ambient temperature and rainfall during the anthrax prone season were the possible influencing factors of repeated outbreaks of anthrax in the study areas. Intensive propaganda to create public awareness of anthrax together with proper vaccination may reduce anthrax outbreaks in Bangladesh.

  20. Virtual interconnection platform initiative scoping study

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Yong [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Kou, Gefei [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Pan, Zuohong [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Liu, Yilu [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); King Jr., Thomas J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2016-01-01

    Due to security and liability concerns, the research community has limited access to realistic large-scale power grid models to test and validate new operation and control methodologies. It is also difficult for industry to evaluate the relative value of competing new tools without a common platform for comparison. This report proposes to develop a large-scale virtual power grid model that retains basic features and represents future trends of major U.S. electric interconnections. This model will include realistic power flow and dynamics information as well as a relevant geospatial distribution of assets. This model will be made widely available to the research community for various power system stability and control studies and can be used as a common platform for comparing the efficacies of various new technologies.

  1. Initial and noninitial name-letter preferences as obtained through repeated letter rating tasks continue to reflect (different aspects of) self-esteem.

    Science.gov (United States)

    Hoorens, Vera; Takano, Keisuke; Franck, Erik; Roberts, John E; Raes, Filip

    2015-09-01

    We tested the usefulness of name-letter preference scores as indirect indicators of self-esteem by exploring whether multiple unsupervised self-administrations of letter rating tasks within a short period of time yield useful data. We also examined whether preferences for initials and noninitial name-letters tap different aspects of self-esteem. Participants from a community sample (N = 164; 58 men and 106 women, 17-67 years, Mage = 34.57, SD = 13.28) completed daily letter rating tasks and state self-esteem questionnaires for 7 consecutive days. They also completed a trait self-esteem questionnaire on the first measurement day as well as 6 months later. Preference scores for first-name initials were stronger but more unstable than preference scores for other name-letters. Preferences for first-name initials were primarily associated with directly measured state self-esteem whereas preferences for noninitials were primarily associated with directly measured trait self-esteem even if the latter was measured 6 months later. Thus, we showed that preferences for initials and noninitials are not simply interchangeable. Previous letter rating studies, which almost exclusively used initial preferences, should be interpreted in terms of state rather than trait self-esteem. In future studies, researchers should focus on the name-letter preference that reflects the aspect of self-esteem they wish to address.

  2. Accuracy and repeatability of an inertial measurement unit system for field-based occupational studies.

    Science.gov (United States)

    Schall, Mark C; Fethke, Nathan B; Chen, Howard; Oyama, Sakiko; Douphrate, David I

    2016-04-01

    The accuracy and repeatability of an inertial measurement unit (IMU) system for directly measuring trunk angular displacement and upper arm elevation were evaluated over eight hours (i) in comparison to a gold standard, optical motion capture (OMC) system in a laboratory setting, and (ii) during a field-based assessment of dairy parlour work. Sample-to-sample root mean square differences between the IMU and OMC system ranged from 4.1° to 6.6° for the trunk and 7.2°-12.1° for the upper arm depending on the processing method. Estimates of mean angular displacement and angular displacement variation (difference between the 90th and 10th percentiles of angular displacement) were observed to change IMU system may serve as an acceptable instrument for directly measuring trunk and upper arm postures in field-based occupational exposure assessment studies with long sampling durations. Practitioner Summary: Few studies have evaluated inertial measurement unit (IMU) systems in the field or over long sampling durations. Results of this study indicate that the IMU system evaluated has reasonably good accuracy and repeatability for use in a field setting over a long sampling duration.

  3. Association study of the trinucleotide repeat polymorphism within SMARCA2 and schizophrenia

    Directory of Open Access Journals (Sweden)

    Danics Zoltan

    2006-06-01

    Full Text Available Abstract Background Brahma (BRM is a key component of the multisubunit SWI/SNF complex, a complex which uses the energy of ATP hydrolysis to remodel chromatin. BRM contains an N-terminal polyglutamine domain, encoded by a polymorphic trinucleotide (CAA/CAG repeat, the only known polymorphism in the coding region of the gene (SMARCA2. We have examined the association of this polymorphism with schizophrenia in a family-based and case/control study. SMARCA2 was chosen as a candidate gene because of its specific role in developmental pathways, its high expression level in the brain and some evidence of its association with schizophrenia spectrum disorder from genome-wide linkage analysis. Results Family-based analysis with 281 complete and incomplete triads showed that there is no significant preferential transmission of any of the alleles to the affected offspring. Also, in the case/control analysis, similar allele and genotype distributions were observed between affected cases (n = 289 and unaffected controls (n = 273 in each of three Caucasian populations studied: French Canadian, Tunisian and other Caucasians of European origin. Conclusion Results from our family-based and case-control association study suggest that there is no association between the trinucleotide repeat polymorphism within SMARCA2 and schizophrenia.

  4. Investigation of the toxicity of some organophosphorus pesticides in a repeated dose study in rats.

    Science.gov (United States)

    Baconi, Daniela Luiza; Bârcă, Maria; Manda, Gina; Ciobanu, Anne Marie; Bălălău, C

    2013-01-01

    The study aimed to the investigation of the toxicity of organophosphorus pesticides malathion (MLT) and diazinon (DZN) in Wistar rats in a repeated dose study for 35 days. MLT and DZN in corn oil vehicle were oral administered. Body and organs weights, plasma and brain cholinesterase activities, serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) activities, histopathological changes in liver and kidney, and some parameters of the immune function, such as leukocyte formula, spleen weight and cellularity, spleen lymphocytes proliferation in response to concanavalin A (Con A) were investigated; the potential oxidative stress (malondialdehyde in plasma and brain, and blood catalase activity) was also evaluated. No clinical toxicity signs attributed to pesticides were noted; no significant changes in the organ weights have been found. Body weight tends slightly to increase, predominantly in DZN treated rats. The results suggest that plasma cholinesterase is more susceptible than brain cholinesterase to the inhibitory effect of DZN and MLT. Other serum biochemical parameters showed no significant difference. DZN produced a marked increase of the number of spleen lymphocytes without a significant gain of the relative spleen weight. The both pesticides produced an increase of the number of mononuclear cells÷weight spleen. The splenic lymphocyte proliferation has not been influenced by MLT or DZN treatment. Histopathological observations identified some changes (vasodilatation, microvacuoles, and granular dystrophy) in the liver, with MLT, inducing macrovacuolar steatosis. The study indicates that repeated exposure, at subclinical doses, to organophosphorus MLT and DZN causes some biochemical, histopathological and immune alterations in rats.

  5. Potential Role of the Last Half Repeat in TAL Effectors Revealed by a Molecular Simulation Study

    Directory of Open Access Journals (Sweden)

    Hua Wan

    2016-01-01

    Full Text Available TAL effectors (TALEs contain a modular DNA-binding domain that is composed of tandem repeats. In all naturally occurring TALEs, the end of tandem repeats is invariantly a truncated half repeat. To investigate the potential role of the last half repeat in TALEs, we performed comparative molecular dynamics simulations for the crystal structure of DNA-bound TALE AvrBs3 lacking the last half repeat and its modeled structure having the last half repeat. The structural stability analysis indicates that the modeled system is more stable than the nonmodeled system. Based on the principle component analysis, it is found that the AvrBs3 increases its structural compactness in the presence of the last half repeat. The comparison of DNA groove parameters of the two systems implies that the last half repeat also causes the change of DNA major groove binding efficiency. The following calculation of hydrogen bond reveals that, by stabilizing the phosphate binding with DNA at the C-terminus, the last half repeat helps to adopt a compact conformation at the protein-DNA interface. It further mediates more contacts between TAL repeats and DNA nucleotide bases. Finally, we suggest that the last half repeat is required for the high-efficient recognition of DNA by TALE.

  6. Potential Role of the Last Half Repeat in TAL Effectors Revealed by a Molecular Simulation Study

    Science.gov (United States)

    Wan, Hua; Chang, Shan; Hu, Jian-ping; Tian, Xu-hong

    2016-01-01

    TAL effectors (TALEs) contain a modular DNA-binding domain that is composed of tandem repeats. In all naturally occurring TALEs, the end of tandem repeats is invariantly a truncated half repeat. To investigate the potential role of the last half repeat in TALEs, we performed comparative molecular dynamics simulations for the crystal structure of DNA-bound TALE AvrBs3 lacking the last half repeat and its modeled structure having the last half repeat. The structural stability analysis indicates that the modeled system is more stable than the nonmodeled system. Based on the principle component analysis, it is found that the AvrBs3 increases its structural compactness in the presence of the last half repeat. The comparison of DNA groove parameters of the two systems implies that the last half repeat also causes the change of DNA major groove binding efficiency. The following calculation of hydrogen bond reveals that, by stabilizing the phosphate binding with DNA at the C-terminus, the last half repeat helps to adopt a compact conformation at the protein-DNA interface. It further mediates more contacts between TAL repeats and DNA nucleotide bases. Finally, we suggest that the last half repeat is required for the high-efficient recognition of DNA by TALE. PMID:27803930

  7. Does repeated reading predict reading development over time? A study of children from Grade 3 to 4.

    Science.gov (United States)

    Gellert, Anna S

    2014-08-01

    The purpose of this study was to investigate whether immediate gains in reading fluency achieved during repeated reading of text can predict long-term reading development over and above traditional predictors of reading development. Eighty-one Grade 3 children read texts three times consecutively and were instructed either to read as quickly as possible (speed-focused repeated reading), or to retell the text afterwards (meaning-focused repeated reading). Measures of text reading fluency, sentence reading fluency, and text comprehension were administered to the children in Grades 3 and 4 to assess their reading development over time. The results indicate that children's immediate response to repeated reading can contribute to the prediction of their development of reading fluency over time. Even after controlling for individual differences in general cognitive ability, word reading fluency, rapid automatized naming, and vocabulary, the experimental measure with meaning-focused repeated reading remained a significant predictor.

  8. 5-Day repeated inhalation and 28-day post-exposure study of graphene.

    Science.gov (United States)

    Shin, Jae Hoon; Han, Sung Gu; Kim, Jin Kwon; Kim, Boo Wook; Hwang, Joo Hwan; Lee, Jong Seong; Lee, Ji Hyun; Baek, Jin Ee; Kim, Tae Gyu; Kim, Keun Soo; Lee, Heon Sang; Song, Nam Woong; Ahn, Kangho; Yu, Il Je

    2015-01-01

    Graphene has recently been attracting increasing attention due to its unique electronic and chemical properties and many potential applications in such fields as semiconductors, energy storage, flexible electronics, biosensors and medical imaging. However, the toxicity of graphene in the case of human exposure has not yet been clarified. Thus, a 5-day repeated inhalation toxicity study of graphene was conducted using a nose-only inhalation system for male Sprague-Dawley rats. A total of three groups (20 rats per group) were compared: (1) control (ambient air), (2) low concentration (0.68 ± 0.14 mg/m(3) graphene) and (3) high concentration (3.86 ± 0.94 mg/m(3) graphene). The rats were exposed to graphene for 6 h/day for 5 days, followed by recovery for 1, 3, 7 or 28 days. The bioaccumulation and macrophage ingestion of the graphene were evaluated in the rat lungs. The exposure to graphene did not change the body weights or organ weights of the rats after the 5-day exposure and during the recovery period. No statistically significant difference was observed in the levels of lactate dehydrogenase, protein and albumin between the exposed and control groups. However, graphene ingestion by alveolar macrophages was observed in the exposed groups. Therefore, these results suggest that the 5-day repeated exposure to graphene only had a minimal toxic effect at the concentrations and time points used in this study.

  9. Validation of a track repeating algorithm for intensity modulated proton therapy: clinical cases study

    Science.gov (United States)

    Yepes, Pablo P.; Eley, John G.; Liu, Amy; Mirkovic, Dragan; Randeniya, Sharmalee; Titt, Uwe; Mohan, Radhe

    2016-04-01

    Monte Carlo (MC) methods are acknowledged as the most accurate technique to calculate dose distributions. However, due its lengthy calculation times, they are difficult to utilize in the clinic or for large retrospective studies. Track-repeating algorithms, based on MC-generated particle track data in water, accelerate dose calculations substantially, while essentially preserving the accuracy of MC. In this study, we present the validation of an efficient dose calculation algorithm for intensity modulated proton therapy, the fast dose calculator (FDC), based on a track-repeating technique. We validated the FDC algorithm for 23 patients, which included 7 brain, 6 head-and-neck, 5 lung, 1 spine, 1 pelvis and 3 prostate cases. For validation, we compared FDC-generated dose distributions with those from a full-fledged Monte Carlo based on GEANT4 (G4). We compared dose-volume-histograms, 3D-gamma-indices and analyzed a series of dosimetric indices. More than 99% of the voxels in the voxelized phantoms describing the patients have a gamma-index smaller than unity for the 2%/2 mm criteria. In addition the difference relative to the prescribed dose between the dosimetric indices calculated with FDC and G4 is less than 1%. FDC reduces the calculation times from 5 ms per proton to around 5 μs.

  10. Seroepidemiological studies indicate frequent and repeated exposure to Campylobacter spp. during childhood.

    Science.gov (United States)

    Ang, C W; Teunis, P F M; Herbrink, P; Keijser, J; Van Duynhoven, Y H T P; Visser, C E; Van Pelt, W

    2011-09-01

    The annual number of episodes of clinical gastroenteritis caused by Campylobacter spp. in The Netherlands is estimated to be 75 000, i.e. once per 200 person life-years. This number is based on extrapolation of culture results from population-based studies. The number of culture-confirmed cases of Campylobacter infection peaks in the first 3 years of life and again between the ages of 20 and 25 years. The seroepidemiology of Campylobacter describes the relationship between age and exposure to Campylobacter and reflects both symptomatic and asymptomatic infections. Using a validated ELISA system, antibodies to Campylobacter were measured in an age-stratified sample (n=456) of the PIENTER serum collection of the Dutch general population. The seroprevalence of Campylobacter IgG antibodies increased with age, reaching almost 100% at age 20 years. Antibody levels steadily increased with age until young adulthood, suggesting repeated exposure to Campylobacter. In conclusion, seroepidemiological data demonstrated repeated exposures to Campylobacter throughout life, most of which do not lead to clinical symptoms. From young adulthood, >95% of the population in The Netherlands had serological evidence for exposure to Campylobacter.

  11. Study of four week repeated dose toxic test of Sweet Bee Venom in Beagle Dogs

    Directory of Open Access Journals (Sweden)

    Jae-Seuk Park

    2010-12-01

    Full Text Available Objectives: This study was performed to analyse four week repeated dose toxicity of Sweet Bee Venom(Sweet BV extracted from the bee venom in Beagle dogs. Methods: All experiments were conducted under the regulations of Good Laboratory Practice (GLP at Biotoxtech Company, a non-clinical study authorized institution. Male and female Beagle dogs of 5-6 months old were chosen for the pilot study of four week repeated dose toxicity of Sweet BV which was administered at the level of 0.56㎎/㎏ body weight which is eighty times higher than the clinical application dosage as the high dosage, followed by 0.28 and 0.14㎎/㎏ as midium and low dosage, respectively. Equal amount of excipient(normal saline to the Sweet BV experiment groups was administered as the control group every day for four weeks. Results: 1. No mortality was witnessed in all of the experiment groups. 2. All experiment groups were appealed pain sense in the treating time compared to the control group, and hyperemia and movement disorder were observed around the area of administration in all experiment groups, and higher occurrence in the higher dosage treatment. 3. For weight measurement, Neither male nor female groups showed significant changes. 4. In the urine analysis, CBC and biochemistry didn't show any significant changes in the experiment groups compared with control group. 5. For weight measurement of organs, experiment groups didn't show any significant changes compared with control group. 6. To verify abnormalities of organs and tissues, thigh muscle which treated with Sweet BV, cerebrum, liver, lung, kidney, and spinal cords were removed and conducted histologocal observation with H-E staining. In the histologocal observation of thigh muscle, cell infiltration, inflammatory, degeneration, necrosis of muscle fiber, and fibrosis were found in both thigh tissue. And the changes were depend on the dose of Sweet BV. But another organs were not detected in any abnormalities. 7

  12. Reducing impaired driving through the identification of Repeat Target Vehicles: A case study.

    Science.gov (United States)

    Stewart, James

    2012-02-01

    One of the most persistent groups of impaired drivers that are seemingly unaffected by social pressure, moral appeals, and the fear of arrest is that of the repeat impaired driver. This smaller group accounts for a disproportionate number of all impaired driving trips, often with high blood alcohol contents. New approaches are needed to identify and deal with the repeat impaired driver. We propose a method based on the discovery that almost 10% of all impaired driving calls for service involve repeat vehicles. Using the number of times a vehicle appears in our data, the average time to repeat, and the personality characteristics of the repeat impaired driver, we are able to create a comprehensive and predictive description of a Repeat Target Vehicle (RTV). Our method provides an opportunity to explore new and innovative crime reduction strategies that were never before possible. Copyright © 2011 Elsevier Ltd. All rights reserved.

  13. A study on ten short tandem repeat systems: African immigrant and Spanish population data.

    Science.gov (United States)

    Gamero, J J; Romero, J L; Gonzalez, J L; Arufe, M I; Cuesta, M I; Corte-Real, F; Carvalho, M; Anjos, M J; Vieira, D N; Vide, M C

    2000-06-05

    This work presents the results obtained from a genetic-population study for the D1S1656 system in the population of Southwest Spain (Huelva, Cádiz and Sevilla), Spaniards of Caucasian origin from North Africa (Ceuta), as well as in the black Central West African and Moroccan immigrant populations in Spain. The results of a study of the autochtonous population of the Canary Islands (n=138), and immigrant Central West African populations in Spain (n=132), obtained for nine short tandem repeat (STR) loci (D3S1358, VWA, FGA, D8S1179, D21S11, D18S51, D5S818, D13S317, D7S820), as well as the amelogenin locus, all contained in Profiler Plus (Perkin-Elmer) PCR amplification kits, are also presented. Except for the FGA and VWA data on immigrant Central West African populations in Spain, no deviations from the Hardy-Weinberg equilibrium were detected.

  14. A Prospective Study of Psychiatric Comorbidity and Recidivism Among Repeat DUI Offenders

    OpenAIRE

    Nelson, Sarah E.; Belkin, Katerina; LaPlante, Debi A.; Bosworth, Leslie; Shaffer, Howard J.

    2015-01-01

    Psychiatric comorbidity has emerged as a key element distinguishing DUI offenders from others, and, in some cases, distinguishing repeat offenders from first-time offenders. This paper utilizes a prospective design to determine whether the comorbid disorders identified among repeat DUI offenders can predict recidivism. Seven hundred forty-three repeat DUI offenders were recruited from a two-week inpatient treatment program at which they received a standardized mental health assessment and fol...

  15. Bayesian latent variable models for hierarchical clustered count outcomes with repeated measures in microbiome studies.

    Science.gov (United States)

    Xu, Lizhen; Paterson, Andrew D; Xu, Wei

    2017-04-01

    Motivated by the multivariate nature of microbiome data with hierarchical taxonomic clusters, counts that are often skewed and zero inflated, and repeated measures, we propose a Bayesian latent variable methodology to jointly model multiple operational taxonomic units within a single taxonomic cluster. This novel method can incorporate both negative binomial and zero-inflated negative binomial responses, and can account for serial and familial correlations. We develop a Markov chain Monte Carlo algorithm that is built on a data augmentation scheme using Pólya-Gamma random variables. Hierarchical centering and parameter expansion techniques are also used to improve the convergence of the Markov chain. We evaluate the performance of our proposed method through extensive simulations. We also apply our method to a human microbiome study.

  16. [Repeat induced abortion: A multicenter study on medical abortions in France in 2014].

    Science.gov (United States)

    Opatowski, M; Bardy, F; David, P; Dunbavand, A; Saurel-Cubizolles, M-J

    2017-01-01

    To describe the social characteristics of women seeking a medical abortion, and the conditions of that abortion, according to whether they had one or more previous induced abortions. An observational study was carried out in 11 French units in 2013-2014, among women 18 years or older. A self-administered questionnaire on the abortion context and social situation was given to them, as well as a diary to record the pain level for each of five days following the mifepristone intake. The sample included 453 women. Among the respondents, 22% had had one previous abortion and 8% had had two or more. Women having had a previous voluntary abortion were more often isolated and in a poorer social situation than women having their first abortion. Better support for contraception after abortion could reduce the number of repeated abortions. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  17. A Review on the Study of "Repeating Earthquakes" by Cross-correlation of Seismic Waveforms~%A Review on the Study of "Repeating Earthquakes" by Cross-correlation of Seismic Waveforms~

    Institute of Scientific and Technical Information of China (English)

    Li Yutong; Jiang Changsheng

    2012-01-01

    "Repeating earthquakes", identified by cross-correlation of seismic waveforms, are found to be much more abundant in the nature than conventionally expected. In recent years, with the development of digital seismic networks, waveform cross correlation and "repeating earthquakes" have caused much attention to the measuring the variation of crustal medium properties and estimation of location accuracy and fault slip rate at depth or earthquake recurrence intervals. Moreover, as a useful tool, the "repeating earthquake" approach has also been used in the assessment of the accuracy of seismic phase picking, hypocenter location, fault structure and physics of earthquake sources, as well as the study of earthquake prediction. In this paper, we summarized the latest research and applications of "repeating earthquakes".

  18. Repeated open application test with methyldibromo glutaronitrile, a multicentre study within the EECDRG

    DEFF Research Database (Denmark)

    Gruvberger, B; Andersen, Klaus Ejner; Brandão, F M

    2005-01-01

    Contact allergy to and allergic contact dermatitis from methyldibromo glutaronitrile (MDBGN) have frequently been reported. This study was initiated to help determine the optimal patch test preparation for MDBGN. In 51 patients with a doubtful or a positive patch test reaction to at least 1 of 4 ...

  19. Causal inference in longitudinal comparative effectiveness studies with repeated measures of a continuous intermediate variable.

    Science.gov (United States)

    Wang, Chen-Pin; Jo, Booil; Brown, C Hendricks

    2014-09-10

    We propose a principal stratification approach to assess causal effects in nonrandomized longitudinal comparative effectiveness studies with a binary endpoint outcome and repeated measures of a continuous intermediate variable. Our method is an extension of the principal stratification approach originally proposed for the longitudinal randomized study "Prevention of Suicide in Primary Care Elderly: Collaborative Trial" to assess the treatment effect on the continuous Hamilton depression score adjusting for the heterogeneity of repeatedly measured binary compliance status. Our motivation for this work comes from a comparison of the effect of two glucose-lowering medications on a clinical cohort of patients with type 2 diabetes. Here, we consider a causal inference problem assessing how well the two medications work relative to one another on two binary endpoint outcomes: cardiovascular disease-related hospitalization and all-cause mortality. Clinically, these glucose-lowering medications can have differential effects on the intermediate outcome, glucose level over time. Ultimately, we want to compare medication effects on the endpoint outcomes among individuals in the same glucose trajectory stratum while accounting for the heterogeneity in baseline covariates (i.e., to obtain 'principal effects' on the endpoint outcomes). The proposed method involves a three-step model estimation procedure. Step 1 identifies principal strata associated with the intermediate variable using hybrid growth mixture modeling analyses. Step 2 obtains the stratum membership using the pseudoclass technique and derives propensity scores for treatment assignment. Step 3 obtains the stratum-specific treatment effect on the endpoint outcome weighted by inverse propensity probabilities derived from Step 2.

  20. SU-E-J-263: Repeatability of SUV and Texture Parameters in Serial PET Studies

    Energy Technology Data Exchange (ETDEWEB)

    Schwartz, J; Humm, J; Nehmeh, S; Schoder, H [Memorial Sloan-Kettering Cancer Center, New York, NY (United States)

    2015-06-15

    Purpose: Standardized uptake values (SUV) are standard quantitative PET measures of FDG tumor uptake used,and are used as a tool to monitor response to therapy. Textural analysis is emerging as a new tool for assessing intratumoral heterogeneity which may allow better tissue characterization and improved prediction of response and survival rate.Understanding what variations may be expected in these parameters is key in order to make decisions based on how the change throughout the course of treatment. The aim of this study was to assess repeatability in SUV measures and texture parameters,and establish criteria that differentiate changes associated with treatment rather than statistical variability. Methods: Eighty patients,167 random lesions total,were scanned in a GE Discovery STE PET/CT Scanner. One field-of-view was chosen centered on the largest lesion observed in a clinical whole-body FDG PET.Immediately following,a gated 9 min scan was acquired in list mode,without changing the patient’s position between any scans. Data was replayed into 3 time bins,3 min each,in order to insure equivalent noise characteristics in each replicate.Data was reconstructed into 128×128×47 square matrices.One VOI was drawn over each lesion for each patient and used to segment all 3 replicates. The mean.max and peak SUV were calculated for each VOI and replicate. First-order textural features were also calculated (skewness and kurtosis). Repeatability was calculated as the average standard deviation over the mean for the 3 repeated measurements for each lesion. Results: The average percent error in the SUV max,peak and mean were 3.4%(0– 12.9%),1.9% (0–7.5%),2.8% (0–12.2%),respectively.For skewness and kurtosis they were 10.9% and 17.8%. Conclusion: We have shown that there is a large variation in %error in SUV measures across patients. SUVpeak is the least variable and kurtosis and skewness parameters are less reliable thatn SUVs.Higher order textures are be.

  1. Prognostic usefulness of repeated echocardiographic evaluation after acute myocardial infarction. TRACE Study Group. TRAndolapril Cardiac Evaluation

    DEFF Research Database (Denmark)

    Korup, E; Køber, L; Torp-Pedersen, C;

    1999-01-01

    The prognostic value of repeated echocardiographic measurement of left ventricular function after acute myocardial infarction was evaluated. We found that repeated measurements of wall motion index in survivors of acute myocardial infarction, with no reinfarction, provide important prognostic inf...... information about death and worsening of heart failure....

  2. Studies of the CAG repeat in the Machado-Joseph disease gene in Taiwan.

    Science.gov (United States)

    Hsieh, M; Tsai, H F; Lu, T M; Yang, C Y; Wu, H M; Li, S Y

    1997-08-01

    Machado-Joseph disease (MJD) is an autosomal dominant spinocerebellar degeneration characterized by cerebellar ataxia and pyramidal signs associated in varying degrees with a dystonic-rigid extrapyramidal syndrome or peripheral amyotrophy. Unstable CAG trinucleotide repeat expansion in the MJD gene on the long arm of chromosome 14 has been identified as the pathological mutation for MJD. While investigating the distribution of CAG repeat lengths of the MJD gene in Taiwan's population, we have identified 18 MJD-affected patients and 12 at-risk individuals in seven families. In addition, we have analyzed the range of CAG repeat lengths in 96 control individuals. The CAG repeat number ranged from 13 to 44 in the controls and 72-85 in the affected and at-risk individuals. Our results indicated that the CAG repeat number was inversely correlated with the age of onset. The differences in CAG repeat length between parent and child and between siblings are greater with paternal transmission than maternal transmission. Our data show a tendency towards the phenomenon of anticipation in the MJD families but do not support unidirectional expansion of CAG repeats during transmission. We also demonstrated that PCR amplification of the CAG repeats in the MJD gene from villous DNA was possible and might prove useful as a diagnostic tool for affected families in the future.

  3. Repeat colonoscopy after a colonoscopy with a negative result in Ontario: a population-based cohort study.

    Science.gov (United States)

    Hol, Lieke; Sutradhar, Rinku; Gu, Sumei; Baxter, Nancy N; Rabeneck, Linda; Tinmouth, Jill M; Paszat, Lawrence F

    2015-01-01

    Data suggest the overuse of repeat colonoscopies, especially in patients at low risk for colorectal cancer. Our objective was to evaluate the time to repeat colonoscopies in low-risk patients aged 50-79 years old and the associated patient- and endoscopist-related factors. All patients aged 50-79 years of age who underwent a complete outpatient colonoscopy with a negative result between 2000 and 2007 were identified from the Ontario Health Insurance Plan database. A colonoscopy performed within 5.5 years of follow-up after the index colonoscopy was considered an early repeat colonoscopy. Patient, endoscopist and endoscopy setting characteristics were recorded and their association with an early repeat colonoscopy was determined using an extended Cox proportional hazards regression model. The cohort consisted of 546 467 patients: 55.4% of the patients were female with a mean age of 61.1 years (95% confidence interval [CI] 61.1-61.2). The cumulative percentage of early repeat colonoscopy after 5.5 years was 33.7%. The rate decreased significantly between 2000 and 2007 (hazard ratio [HR] 0.35, 95% CI 0.34-0.36). General surgeons were associated with a higher risk of early repeat colonoscopy than gastroenterologists (HR 1.27, 95% CI 1.25-1.28). Endoscopists practising in a nonhospital setting were more likely to perform an early repeat colonoscopy (HR 1.26, 95% CI 1.22-1.30) than endoscopists at a hospital. This study showed that there was overuse of early repeat colonoscopy in more than 30% of patients who were at low risk for colorectal cancer. The risk decreased significantly between 2000 and 2007 but was still greater than 20% in 2007. Our findings can be used to develop targeted educational interventions among subgroups of endoscopists with a higher rate of early repeat colonoscopy.

  4. A Prospective Study of Psychiatric Comorbidity and Recidivism Among Repeat DUI Offenders.

    Science.gov (United States)

    Nelson, Sarah E; Belkin, Katerina; LaPlante, Debi A; Bosworth, Leslie; Shaffer, Howard J

    2015-04-13

    Psychiatric comorbidity has emerged as a key element distinguishing DUI offenders from others, and, in some cases, distinguishing repeat offenders from first-time offenders. This paper utilizes a prospective design to determine whether the comorbid disorders identified among repeat DUI offenders can predict recidivism. Seven hundred forty-three repeat DUI offenders were recruited from a two-week inpatient treatment program at which they received a standardized mental health assessment and followed across five years post-treatment to track DUI offense, motor vehicle-related offenses, and general criminal offenses. Psychiatric comorbidity, though it did not predict DUI recidivism specifically, predicted criminal re-offense more generally. In addition, there was a specific relationship between lifetime attention deficit disorder and repeated motor vehicle-related offenses. These findings suggest that for many repeat offenders, DUI is one outlet in a constellation of criminal behavior, and that psychiatric comorbidity increases vulnerability for criminal re-offense.

  5. Strengths and limitations of using repeat-dose toxicity studies to predict effects on fertility.

    Science.gov (United States)

    Dent, M P

    2007-08-01

    The upcoming European chemicals legislation REACH (Registration, Evaluation, and Authorisation of Chemicals) will require the risk assessment of many thousands of chemicals. It is therefore necessary to develop intelligent testing strategies to ensure that chemicals of concern are identified whilst minimising the testing of chemicals using animals. Xenobiotics may perturb the reproductive cycle, and for this reason several reproductive studies are recommended under REACH. One of the endpoints assessed in this battery of tests is mating performance and fertility. Animal tests that address this endpoint use a relatively large number of animals and are also costly in terms of resource, time, and money. If it can be shown that data from non-reproductive studies such as in-vitro or repeat-dose toxicity tests are capable of generating reliable alerts for effects on fertility then some animal testing may be avoided. Available rat sub-chronic and fertility data for 44 chemicals that have been classified by the European Union as toxic to fertility were therefore analysed for concordance of effects. Because it was considered appropriate to read across data for some chemicals these data sets were considered relevant for 73 of the 102 chemicals currently classified as toxic to reproduction (fertility) under this system. For all but 5 of these chemicals it was considered that a well-performed sub-chronic toxicity study would have detected pathology in the male, and in some cases, the female reproductive tract. Three showed evidence of direct interaction with oestrogen or androgen receptors (linuron, nonylphenol, and fenarimol). The remaining chemicals (quinomethionate and azafenidin) act by modes of action that do not require direct interaction with steroid receptors. However, both these materials caused in-utero deaths in pre-natal developmental toxicity studies, and the relatively low NOAELs and the nature of the hazard identified in the sub-chronic tests provides an alert

  6. Decision-to-Delivery Time Intervals in Emergency Caesarean Section Cases: Repeated cross-sectional study from Oman.

    Science.gov (United States)

    Tashfeen, Kaukab; Patel, Malini; Hamdi, Ilham M; Al-Busaidi, Ibrahim H A; Al-Yarubi, Mansour N

    2017-02-01

    In cases of fetal intolerance to labour, meeting the standard decision-to-delivery time interval (DDI) of ≤30 minutes is challenging. This study aimed to assess DDIs in emergency Caesarean section (CS) cases to identify factors causing DDI delays and the impact of a delayed DDI on perinatal outcomes. This repeated cross-sectional study included all emergency CS procedures performed due to acute fetal distress, antepartum haemorrhage or umbilical cord prolapse at the Nizwa Hospital, Nizwa, Oman. Three audit cycles of three months each were conducted between April 2011 and June 2013, including an initial retrospective cycle and two prospective cycles following the implementation of improvement strategies to address factors causing DDI delays. Poor perinatal outcomes were defined as Apgar scores of 60 minutes was significantly associated with poor neonatal outcomes in terms of increased SCBU admissions and low Apgar scores (P <0.001 each). Factors causing DDI delays included obtaining consent for the CS procedure, a lack of operating theatre availability and moving patients to the operating theatre. The identification of factors causing DDI delays may provide opportunities to improve perinatal outcomes.

  7. Decision-to-Delivery Time Intervals in Emergency Caesarean Section Cases; Repeated cross-sectional study from Oman

    Directory of Open Access Journals (Sweden)

    Kaukab Tashfeen

    2017-03-01

    Full Text Available Objectives: In cases of fetal intolerance to labour, meeting the standard decision-to-delivery time interval (DDI of ≤30 minutes is challenging. This study aimed to assess DDIs in emergency Caesarean section (CS cases to identify factors causing DDI delays and the impact of a delayed DDI on perinatal outcomes. Methods: This repeated cross-sectional study included all emergency CS procedures performed due to acute fetal distress, antepartum haemorrhage or umbilical cord prolapse at the Nizwa Hospital, Nizwa, Oman. Three audit cycles of three months each were conducted between April 2011 and June 2013, including an initial retrospective cycle and two prospective cycles following the implementation of improvement strategies to address factors causing DDI delays. Poor perinatal outcomes were defined as Apgar scores of 60 minutes was significantly associated with poor neonatal outcomes in terms of increased SCBU admissions and low Apgar scores (P <0.001 each. Factors causing DDI delays included obtaining consent for the CS procedure, a lack of operating theatre availability and moving patients to the operating theatre. Conclusion: The identification of factors causing DDI delays may provide opportunities to improve perinatal outcomes.

  8. Non-target effects of repeated chlorothalonil application on soil nitrogen cycling: The key functional gene study.

    Science.gov (United States)

    Zhang, Manyun; Xu, Zhihong; Teng, Ying; Christie, Peter; Wang, Jun; Ren, Wenjie; Luo, Yongming; Li, Zhengao

    2016-02-01

    The widespread and increasing application of chlorothalonil (CTN) raises concerns about its non-target impacts, but little information is available on the effect of CTN on the key functional genes related to soil nitrogen (N) cycling, especially in the case of repeated applications. In the present study, a microcosm incubation was conducted to determine CTN residues and the impacts on the abundances of key functional genes related to N cycling after repeated CTN applications. The results demonstrated that repeated CTN applications at the recommended application rate and five times the recommended rate led to the accumulation of CTN residue in soil at concentrations of 5.59 and 78.79 mg kg(-1), respectively, by the end of incubation. Real time PCR (RT-PCR) revealed that repeated CTN applications had negative effects on the chiA and aprA gene abundances. There were significantly negative correlations between CTN residues and abundances of AOA and AOB genes. In addition, the abundances of key functional genes involved in soil denitrification were declined by repeated CTN applications with the sole exception of the nosZ gene. This study suggests that repeated CTN applications could lead to the accumulation of CTN residue and generate somewhat inconsistent and erratic effects on the abundances of key functional genes related to soil N cycling.

  9. Impact of repeated measures and sample selection on genome-wide association studies of fasting glucose

    Science.gov (United States)

    Rasmussen-Torvik, Laura J.; Alonso, Alvaro; Li, Man; Kao, Wen; Köttgen, Anna; Yan, Yuer; Couper, David; Boerwinkle, Eric; Bielinski, Suzette J.; Pankow, James S.

    2010-01-01

    Although GWAS have been performed in longitudinal studies, most used only a single trait measure. GWAS of fasting glucose have generally included only normoglycemic individuals. We examined the impact of both repeated measures and sample selection on GWAS in ARIC, a study which obtained four longitudinal measures of fasting glucose and included both individuals with and without prevalent diabetes. The sample included Caucasians and the Affymetrix 6.0 chip was used for genotyping. Sample sizes for GWAS analyses ranged from 8372 (first study visit) to 5782 (average fasting glucose). Candidate SNP analyses with SNPs identified through fasting glucose or diabetes GWAS were conducted in 9133 individuals, including 761 with prevalent diabetes. For a constant sample size, smaller p-values were obtained for the average measure of fasting glucose compared to values at any single visit, and two additional significant GWAS signals were detected. For four candidate SNPs (rs780094, rs10830963, rs7903146, and rs4607517), the strength of association between genotype and glucose was significantly (p-interaction fasting glucose candidate SNPs (rs780094, rs10830963, rs560887, rs4607517, rs13266634) the association with measured fasting glucose was more significant in the smaller sample without prevalent diabetes than in the larger combined sample of those with and without diabetes. This analysis demonstrates the potential utility of averaging trait values in GWAS studies and explores the advantage of using only individuals without prevalent diabetes in GWAS of fasting glucose. PMID:20839289

  10. Repeated exposure of acidic beverages on esthetic restorative materials: an in-vitro surface microhardness study

    OpenAIRE

    Xavier, Arun M.; Sunny, Steffy M.; Rai, Kavita; Amitha M Hegde

    2016-01-01

    Background A manifold increase in the consumption of aerated beverages has witnessed a twin increase in tooth wear and raised demand for esthetic restorative materials. This study aimed to evaluate the surface microhardness changes of esthetic restorative materials following treatment with aerated beverages in an in-vitro situation. Material and Methods The initial surface microhardness of the restorative materials GC Fuji II LC, GC Fuji IX, Nano Glass ionomer, Resin and Nano composite was re...

  11. A nationwide, population-based, long-term follow-up study of repeated self-harm in Taiwan

    Directory of Open Access Journals (Sweden)

    Chung Chi-Hsiang

    2012-09-01

    Full Text Available Abstract Background Previous follow-up studies of repeated self-harm show that the cumulative risk of repeated self-harm within one year is 5.7%–15%, with females at greatest risk. However, relatively few studies have focused on the Far East. The objective of this study was to calculate the cumulative risk of repeated self-harm over different lengths of follow-up time (3 months, 6 months, and 1–8 years, to determine factors influencing repeated self-harm and to explore the interaction between gender and self-harm methods. Methods We used self-harm patient who hospitalized due to first-time self-harm between 2000 and 2007 from 1,230 hospitals in Taiwan. Hospitalization for repeated self-harm among members of this cohort was tracked after 3 months, 6 months, and 1–8 years. Tracking continued until December 31, 2008. We analyzed the cumulative risk and risk factors of repeated self-harm by using negative binomial regression. Results Of the 39,875 individual study samples, 3,388 individuals (8.50% were found to have repeatedly self-harmed. The cumulative risk of repeated self-harm within three months was 7.19% and within one year was 8%. Within 8 years, it was 8.70%. Females were more likely to repeatedly self-harm than males (RR = 1.21, 95% CI = 1.15–1.76. The main method of self-harm was solid or liquid substances (RR = 1.88, 95% CI = 1.23–2.04 or cutting or piercing (RR = 1.36, 95% CI = 1.02–1.82, and in patients with psychiatric disorders were more likely to self-harm (RR = 1.61, 95% CI = 1.48–1.75. Conclusions The key time for intervention for repeated self-harm is within three months. Appropriate prevention programs should be developed based on gender differences.

  12. Thermal stability of chicken brain {alpha}-spectrin repeat 17: a spectroscopic study

    Energy Technology Data Exchange (ETDEWEB)

    Brenner, Annette K. [University of Bergen, Department of Chemistry (Norway); Kieffer, Bruno [Ecole Superieure de Biotechnologie de Strasbourg, IGBMC Biomolecular NMR Group, CNRS UMR 7104 (France); Trave, Gilles [Ecole Superieure de Biotechnologie de Strasbourg, Equipe Oncoproteines, IREBS, UMR 7242 (France); Froystein, Nils Age [University of Bergen, Department of Chemistry (Norway); Raae, Arnt J., E-mail: arnt.raae@mbi.uib.no [University of Bergen, Department of Molecular Biology (Norway)

    2012-06-15

    Spectrin is a rod-like multi-modular protein that is mainly composed of triple-helical repeats. These repeats show very similar 3D-structures but variable conformational and thermodynamical stabilities, which may be of great importance for the flexibility and dynamic behaviour of spectrin in the cell. For instance, repeat 17 (R17) of the chicken brain spectrin {alpha}-chain is four times less stable than neighbouring repeat 16 (R16) in terms of Increment G. The structure of spectrin repeats has mainly been investigated by X-ray crystallography, but the structures of a few repeats, e.g. R16, have also been determined by NMR spectroscopy. Here, we undertook a detailed characterization of the neighbouring R17 by NMR spectroscopy. We assigned most backbone resonances and observed NOE restraints, relaxation values and coupling constants that all indicated that the fold of R17 is highly similar to that of R16, in agreement with previous X-ray analysis of a tandem repeat of the two domains. However, {sup 15}N heteronuclear NMR spectra measured at different temperatures revealed particular features of the R17 domain that might contribute to its lower stability. Conformational exchange appeared to alter the linker connecting R17 to R16 as well as the BC-loop in close proximity. In addition, heat-induced splitting was observed for backbone resonances of a few spatially related residues including V99 of helix C, which in R16 is replaced by the larger hydrophobic tryptophan residue that is relatively conserved among other spectrin repeats. These data support the view that the substitution of tryptophan by valine at this position may contribute to the lower stability of R17.

  13. Essays on diffusion and repeat sales of consumer durables : a study of the consumer electronics market

    OpenAIRE

    Kaya, Maria

    2008-01-01

    Although repeat purchases dominate overall sales of consumer durables, diffusion of innovations research has paid them far less attention than new product adoptions. A large survey of 8,077 households allowed a detailed investigation of the differences between households in terms of their repeat purchase behavior of durables. Asymmetric effects were investigated using competing hazard models and showed that consumer innovativeness has a strong impact on discretionary replacements. A modified ...

  14. Reconfigurable multiport EPON repeater

    Science.gov (United States)

    Oishi, Masayuki; Inohara, Ryo; Agata, Akira; Horiuchi, Yukio

    2009-11-01

    An extended reach EPON repeater is one of the solutions to effectively expand FTTH service areas. In this paper, we propose a reconfigurable multi-port EPON repeater for effective accommodation of multiple ODNs with a single OLT line card. The proposed repeater, which has multi-ports in both OLT and ODN sides, consists of TRs, BTRs with the CDR function and a reconfigurable electrical matrix switch, can accommodate multiple ODNs to a single OLT line card by controlling the connection of the matrix switch. Although conventional EPON repeaters require full OLT line cards to accommodate subscribers from the initial installation stage, the proposed repeater can dramatically reduce the number of required line cards especially when the number of subscribers is less than a half of the maximum registerable users per OLT. Numerical calculation results show that the extended reach EPON system with the proposed EPON repeater can save 17.5% of the initial installation cost compared with a conventional repeater, and can be less expensive than conventional systems up to the maximum subscribers especially when the percentage of ODNs in lightly-populated areas is higher.

  15. CAG repeat polymorphisms in the androgen receptor and breast cancer risk in women: a meta-analysis of 17 studies.

    Science.gov (United States)

    Mao, Qixing; Qiu, Mantang; Dong, Gaochao; Xia, Wenjie; Zhang, Shuai; Xu, Youtao; Wang, Jie; Rong, Yin; Xu, Lin; Jiang, Feng

    2015-01-01

    The association between polymorphic CAG repeats in the androgen receptor gene in women and breast cancer susceptibility has been studied extensively. However, the conclusions regarding this relationship remain conflicting. The purpose of this meta-analysis was to identify whether androgen receptor CAG repeat lengths were related to breast cancer susceptibility. The MEDLINE, PubMed, and EMBASE databases were searched through to December 2014 to identify eligible studies. Data and study quality were rigorously assessed by two investigators according to the Newcastle-Ottawa Quality Assessment Scale. The publication bias was assessed by the Begg's test. Seventeen eligible studies were included in this meta-analysis. The overall analysis suggested no association between CAG polymorphisms and breast cancer risk (odds ratio [OR] 1.031, 95% confidence interval [CI] 0.855-1.245). However, in the subgroup analysis, we observed that long CAG repeats significantly increased the risk of breast cancer in the Caucasian population (OR 1.447, 95% CI 1.089-1.992). Additionally, the risk was significantly increased in Caucasian women carrying two alleles with CAG repeats ≥22 units compared with those with two shorter alleles (OR 1.315, 95% CI 1.014-1.707). These findings suggest that long CAG repeats increase the risk of breast cancer in Caucasian women. However, larger scale case-control studies are needed to validate our results.

  16. Initial study of stability and repeatability of measuring R2 ' and oxygen extraction fraction values in the healthy brain with gradient-echo sampling of spin-echo sequence%梯度回波采样自旋回波序列测量脑R2'及氧摄取分数值稳定性及重复性的研究

    Institute of Scientific and Technical Information of China (English)

    惠丽红; 张晓东; 何超; 谢晟; 肖江喜; 张珏; 王霄英; 蒋学祥

    2010-01-01

    Eight normal healthy volunteers were enrolled in this study and written informed consents were obtained from all subjects. MR scanning including sequences of GESSE,T2 map and T2 * map were performed in these subjects at resting status. The same protocol was repeated one day later. Raw data from GESSE sequence were transferred to PC to conduct postprocessing with the software built in house. R2'map and OEF map were got consequently. To obtain quantitative R2'and OEF values in the brain parenchyma, six ROIs were equally placed in the anterior, middle and posterior part of bilateral hemispheres. Both mean and standard deviation of R2 'and OEF were recorded. All images from T2 * map and T2 map were transferred to the Workstation for postprocessing. The ROIs were put at the same areas as those for GESSE sequence. R2'is defined as R2' = R2 * -R2,R2* = 1/T2*. The R2'value of GESSE sequence were compared with that of GRE sequence. Results The mean R2 'values of GESSE at the first and second scan and those of the GRE were (4.21 ±0.92),(4.45 ±0. 94) Hz and (7.37 ±1.47), (6. 42 ±2. 33) Hz 0. 035 respectively. The R2'value and OEF value obtained from GESSE were not significantly different between the first and second scan ( t = - 0. 83, - 1.48, P > 0. 05 ). The R2' value of first GRE imaging had significantly statistical difference from that of second GRE inaging ( t = 1.80, P < 0. 05 ). The R2' value of GESSE sequence was less than that of GRE sequence, and there was significantly statistical difference between them(t = 1.71 ,P<0. 05). Conclusion The GESSE sequence has good stability and repeatability with promising clinical practicability.

  17. Intimate partner violence and repeat induced abortion in Italy: A cross sectional study.

    Science.gov (United States)

    Citernesi, Angela; Dubini, Valeria; Uglietti, Anna; Ricci, Elena; Cipriani, Sonia; Parazzini, Fabio

    2015-01-01

    To investigate the impact of intimate partner violence (IPV) on the risk of repeat induced abortion (RIA), we compared IPV history among women with and without previous induced abortion (IA). All consecutive women aged 18 years or more requiring IA in 12 Italian abortion clinics were eligible for inclusion in the study. They were asked to fill in an anonymous, self-developed questionnaire assessing sociodemographic data and their history of different types of violence and related risk factors. The analysis included 1030 women, 624 (60.6%) of whom reported a previous IA. Past or current IPV was reported by 19.3%: 7.0% reported sexual violence, 11.3% physical abuse and 12.1% psychological abuse. Past or current IPV was reported by 22.3% of women with RIA and 14.8% of those undergoing their first IA (adjusted odds ratio 1.57, 95% confidence interval 1.07-2.30; p = 0.02). When we considered sexual, psychological and physical abuse separately, we found that any kind of abuse was more frequent in women with RIA than in women with no previous IA. This study underlines the impact of IPV on the risk of RIA and suggests the need for screening for IPV among women requiring abortion, in order to identify women at risk of RIA and to improve their general and reproductive health.

  18. Effectiveness of Repeat Angiographic Assessment in Patients Designated for Radioembolization Using Yttrium-90 Microspheres With Initial Extrahepatic Accumulation of Technitium-99m Macroaggregated Albumin: A Single Center's Experience

    Energy Technology Data Exchange (ETDEWEB)

    Dudeck, Oliver, E-mail: oliver.dudeck@med.ovgu.de; Wilhelmsen, Skadi; Ulrich, Gerhard; Loewenthal, David; Pech, Maciej; Amthauer, Holger; Ricke, Jens [University of Magdeburg, Department of Radiology and Nuclear Medicine (Germany)

    2012-10-15

    Purpose: To evaluate the efficacy of a workflow consisting of repeat assessment in patients planned for yttrium-90 ({sup 90}Y) radioembolization in case of nontarget visceral technetium-99m ({sup 99m}Tc)-macroaggregated albumin (MAA) accumulation despite initial prophylactic coil embolization of nonhepatic arteries. Materials and Methods: In 341 patients with primary and secondary liver cancer, pretreatment hepatic angiograms, as well as single-photon emission computed tomography coregistered with magnetic resonance imaging scans, were obtained. Extrahepatic tracer deposition was identified in 33 patients (9.7%) necessitating repeat assessment. Images were reviewed to correlate the site of MAA accumulation with causative gastrointestinal vessels, and repeat angiograms served as reference standard. Results: At repeat angiography, the source of extrahepatic flow was identified and eliminated in 31 of 33 patients (93.9%). In 20 patients (60.6%), successful embolization of nontarget vessels was achieved, in 13 patients (39.4%), MAA was administered more distally. Afterward, extrahepatic MAA deposition was eliminated in 30 patients (90.9%). Conclusion: The algorithm of repeat assessment in case of extrahepatic MAA accumulation has proven highly effective to eliminate extrahepatic shunting, thus decreasing the risk of postradioembolization complications due to inadvertent visceral microsphere deposition.

  19. The Study on the Ferrokinetics and Acquired Immunity in Repeated Hookworm Infections

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Mun Ho; Lee, Pyl Ung [Seoul National University College of Medicine, Seoul (Korea, Republic of)

    1967-09-15

    In order to confirm whether acquired immunity or resistance can be developed by the repeated hookworm infections, the 150 mature actively moving filariform ancylostoma duodenale larvae obtained from the severe hookworm anemia patients were orally given to 8 healthy volunteers in three divided doses, 50 in each, at 5 day interval. Also the hematological changes as well as several ferrokinetics using {sup 59}Fe were done and were compared with 10 controls. The clinical symptoms and signs were checked every day for the first 3 weeks and then twice weekly until the end of the experiment. The appearance of the ova in the stool was examined by the formalin ether method and the ova was counted by the Stoll's method. The following laboratory tests were done:1) Red blood cell count, venous blood hematocrit (micromethod), hemoglobin count (cyanomethemoglobin method) were checked every 5 to 7 day interval. 2) Plasma iron concentration (Barkan's modified method) was determined every 2 to 3 week interval. 3) Radioisotope studies:a) Ferrokinetics: Huff et al and Bothwell's method were applied. Erythropoietic Index (% of normal)= ['Subject's turnover/100 ml whole bloodX100'] over ['Average normal turnover/100 ml whole blood'] b) Quantitative measurement of the gastrointestinal absorption of iron:Radioiron ({sup 59}Fe) balance method was applied. c) Determination of the plasma erythropoietin activity: Fried's method was applied. Following were the results: 1) The serum iron level was lower. The red cell volume was decreased, but with relative increase of plasma volume. 2) The plasma iron disappearance time was accelerated and the plasma iron turnover rate was decreased. The red cell iron turnover rate was markedly increased, while all of the red cell iron concentration, circulating red cell iron, plasma iron pool were decreased. The daily iron pool turnover and red cell renewal rate were increased. 3) The erythropoietic index

  20. Structural Studies of a Four-MBT Repeat Protein MBTD1

    Energy Technology Data Exchange (ETDEWEB)

    Eryilmaz, Jitka; Pan, Patricia; Amaya, Maria F.; Allali-Hassani, Abdellah; Dong, Aiping; Adams-Cioaba, Melanie A.; MacKenzie, Farrell; Vedadi, Masoud; Min, Jinrong; (Toronto); (Toronto)

    2010-08-17

    The Polycomb group (PcG) of proteins is a family of important developmental regulators. The respective members function as large protein complexes involved in establishment and maintenance of transcriptional repression of developmental control genes. MBTD1, Malignant Brain Tumor domain-containing protein 1, is one such PcG protein. MBTD1 contains four MBT repeats. We have determined the crystal structure of MBTD1 (residues 130-566aa covering the 4 MBT repeats) at 2.5 {angstrom} resolution by X-ray crystallography. The crystal structure of MBTD1 reveals its similarity to another four-MBT-repeat protein L3MBTL2, which binds lower methylated lysine histones. Fluorescence polarization experiments confirmed that MBTD1 preferentially binds mono- and di-methyllysine histone peptides, like L3MBTL1 and L3MBTL2. All known MBT-peptide complex structures characterized to date do not exhibit strong histone peptide sequence selectivity, and use a 'cavity insertion recognition mode' to recognize the methylated lysine with the deeply buried methyl-lysine forming extensive interactions with the protein while the peptide residues flanking methyl-lysine forming very few contacts. Nevertheless, our mutagenesis data based on L3MBTL1 suggested that the histone peptides could not bind to MBT repeats in any orientation. The four MBT repeats in MBTD1 exhibits an asymmetric rhomboid architecture. Like other MBT repeat proteins characterized so far, MBTD1 binds mono- or dimethylated lysine histones through one of its four MBT repeats utilizing a semi-aromatic cage.

  1. Resistance repeatability study of ion-beam deposited vanadium oxide thin films

    Science.gov (United States)

    Alvarez, P.; Pearson, D. I. C.; Pochon, S.; Thomas, O.; Cooke, M.; Gunn, R.

    2016-09-01

    Ion Beam Sputter Deposition (IBSD) is a versatile technique particularly suited to applications requiring high quality, high performance layer materials as it allows independent and accurate control of the process parameters. Vanadium oxides, used for example in the fabrication of microbolometers, optical switches or optical storage, exhibit interesting properties such as a high Temperature Coefficient of Resistance (TCR), relatively low 1/f noise and a semiconductormetal phase transition close to room temperature. However, it is very challenging to control the stoichiometry of the deposited film as there are at least 25 different oxidation states of vanadium, few of which display the required electrical characteristics. In the present study, vanadium oxide thin layers were deposited by IBSD using an Oxford Ionfab300+ and analyzed with regard to their electrical properties. The impact of the system parameters on the resistance repeatability, wafer-to-wafer and batch-to-batch, was thoroughly investigated to provide the end user with a clear understanding of the factors affecting film resistivity while ensuring at the same time a steep variation of resistance with temperature, as notably required for uncooled bolometers. These parameters were balanced to also achieve a good deposition rate, throughput and uniformity over large device areas, compatible with the requirements of industrial applications.

  2. Comparative Genomic Hybridization Selection of Blastocysts for Repeated Implantation Failure Treatment: A Pilot Study

    Science.gov (United States)

    Greco, Ermanno; Bono, Sara; Ruberti, Alessandra; Lobascio, Anna Maria; Greco, Pierfrancesco; Biricik, Anil; Spizzichino, Letizia; Greco, Alessia; Tesarik, Jan; Minasi, Maria Giulia; Fiorentino, Francesco

    2014-01-01

    The aim of this study is to determine if the use of preimplantation genetic screening (PGS) by array comparative genomic hybridization (array CGH) and transfer of a single euploid blastocyst in patients with repeated implantation failure (RIF) can improve clinical results. Three patient groups are compared: 43 couples with RIF for whom embryos were selected by array CGH (group RIF-PGS), 33 couples with the same history for whom array CGH was not performed (group RIF NO PGS), and 45 good prognosis infertile couples with array CGH selected embryos (group NO RIF PGS). A single euploid blastocyst was transferred in groups RIF-PGS and NO RIF PGS. Array CGH was not performed in group RIF NO PGS in which 1-2 blastocysts were transferred. One monoembryonic sac with heartbeat was found in 28 patients of group RIF PGS and 31 patients of group NO RIF PGS showing similar clinical pregnancy and implantation rates (68.3% and 70.5%, resp.). In contrast, an embryonic sac with heartbeat was only detected in 7 (21.2%) patients of group RIF NO PGS. In conclusion, PGS by array CGH with single euploid blastocyst transfer appears to be a successful strategy for patients with multiple failed IVF attempts. PMID:24779011

  3. Repeated dose (14 days) rat intramuscular toxicology study of Her1 vaccine.

    Science.gov (United States)

    Mancebo, A; Casacó, A; Sánchez, B; González, B; Gómez, D; León, A; Bada, A M; Arteaga, M E; González, Y; González, C; Pupo, M; Fuentes, Dasha

    2012-12-01

    Our goal was to assess the toxicity of two strengths (200 and 400 μg) of HER1 cancer vaccine (Center of Molecular Immunology, Cuba), presented in two different formulations, in Sprague Dawley rats after repeated intramuscular administration (14 days). Four groups (5 animals/sex) were established: Control, Placebo (adjuvant), and two Treated groups receiving a dose representing ten times of human total dose (10×), 28.6 and 57.1 μg/kg. Clinical observations, body weight and rectal temperature were measured during the study. Clinical pathology analysis was performed, besides gross necropsy and histological examination of tissues on animals at the end of the assay. The assay ended with a 100% survival. Injection site damage, with the presence of cysts and granulomas, was observed in adjuvant and vaccine treated groups, with most severe cases predominating at higher strength. Administration of Placebo and Her1 vaccine induced increase in polymorphonuclear cells, with relative lymphopenia conditioned by primary neutrophilia. In summary, results suggest that Her1 immunization was capable of inducing an inflammatory effect at the injection site, leading to systemic alterations, more significant at higher strength (400 μg, 57.1 μg/kg), probably affected by the immunizations' schedule used. The vaccine was shown to be well tolerated without any obvious signs of systemic toxicity, with findings largely attributable to the adjuvant used.

  4. Study on the homocysteine metabolism of patients with unexplained repeated spontaneous abortion

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Objective:To study the metabolism abnormality of homocysteine(Hcy) in unexplained repeated spontaneous abortion(URSA).Methods:The level of Hcy in sera was measured with hyperpressure liquid chromatography(HPLC);Folic acid and vitamin B12 were detected by radioimmune assay;anticardiolipin antibody (ACA) was detected by ELISA.Results:(1)The level of serum Hcy in URSA group was significantly higher than that in control group,showing a statistical significant difference(P<0.01).The level of Hcy was correlated with ages,but not correlated with areas,numbers of miscarriage,gestation age,primary or secondary abortions.(2)The levels of folic acid and vitamin B12 in URSA group were significantly lower than those in control group.The levels of serum folic acid and vitamin B12 were not correlated with age,area,numbers of miscarriage and abortion periods.(3)ACA positive rate in URSA was significantly higher than that in control group.The level of Hcy in ACA(+) group was significantly higher than that in ACA(-) group among URSA patients.Conclusions:Hyperhomocysteinemia,low folic acid state,and ACA were all the independent risk factors for URSA.Lacking of folic acid and vitamin B12 is one of the important causes of hyperhomocysteinemia.ACA and hyperhomocysteinemia may have synergistic action in the occurrence of URSA.

  5. Repeat sleeve gastrectomy compared with primary sleeve gastrectomy: a single-center, matched case study.

    Science.gov (United States)

    Rebibo, Lionel; Fuks, David; Verhaeghe, Pierre; Deguines, Jean-Baptiste; Dhahri, Abdennaceur; Regimbeau, Jean-Marc

    2012-12-01

    Longitudinal sleeve gastrectomy (LSG) has been validated for the treatment of morbid obesity. However, treatment failures can appear several months after SG. Additional malabsorptive surgery is generally recommended in such cases. The objective of the present study was to evaluate the outcomes of repeat SG (re-SG) relative to first-line SG. This was a retrospective study included 15 patients underwent re-SG after failure of first-line SG (i.e. University Hospital, France; Public Practice). These patients were matched (for age, gender, body mass index and comorbidities) 1:2 with 30 patients having undergone first-line SG. The efficacy criteria comprised intra-operative data and postoperative data. The overall study population comprised 45 patients. The re-SG and first-line SG groups did not differ significantly in terms of median age (p = NS). The median BMI was similar in the two groups (43 kg/m(2) vs. 42.3 kg/m(2), p = NS). The two groups were similar in terms of the prevalence of comorbidities. The mean operating time was longer in the re-SG group (116 vs. 86 min; p ≤ 0.01). The postoperative complication rate was twice as high in the re-SG group (p = 0.31). Two patients in the re-SG group developed a gastric fistula (p = 0.25) and one of the latter died. At 12 months, the Excess Weight Loss was 66% (re-SG group) and 77% (first-line SG group) (p = 0.05). Re-SG is feasible but appears to be associated with a greater risk of complications. Nevertheless, re-SG can produce results (in terms of weight loss), equivalent to those obtained after first-line SG.

  6. Quantum repeated games revisited

    CERN Document Server

    Frackiewicz, Piotr

    2011-01-01

    We present a scheme for playing quantum repeated 2x2 games based on the Marinatto and Weber's approach to quantum games. As a potential application, we study twice repeated Prisoner's Dilemma game. We show that results not available in classical game can be obtained when the game is played in the quantum way. Before we present our idea, we comment on the previous scheme of playing quantum repeated games.

  7. Responsiveness of 5-HT2C receptors in repeatedly diazepam-injected rats: a behavioral and neurochemical study.

    Science.gov (United States)

    Khan, Asma; Haleem, Darakhshan J

    2008-01-01

    The role of 5-hydroxytryptamine (serotonin; 5-HT)2C receptors in anxiety and the anxiolytic effects of drugs is well documented. In view of the withdrawal anxiety associated with repeated diazepam intake, the present study concerns the efficacy of 5-HT2C receptors in rats treated with diazepam. Results show that diazepam injections at a dose of 2 mg/kg daily for two weeks increased weekly food intake and growth rate. Anxiolytic effects of the drug monitored in a light/dark activity box were not significant after single administration. One week and two weeks of administration elicited anxiolytic effects, which were smaller after two weeks of administration as compared to one week, suggesting the development of tolerance to the anxiolytic profile of diazepam. Moreover, three days' withdrawal from repeated administration elicited anxiogenic behavior in the light/dark activity box. The behavioral and neurochemical effects of 1-(m-chlorophenyl)piperazine (m-CPP) (3 mg/kg), a 5-HT2C agonist, were monitored following withdrawal (three days) from two weeks of diazepam administration. Results showed that hypophagic as well as anxiogenic-like effects of m-CPP were not different from repeated saline or repeated diazepam-injected animals. Administration of m-CPP increased 5-HT metabolism in repeated saline as well as repeated diazepam-injected animals. However, m-CPP-induced increases in 5-HT metabolism were greater in repeated diazepam-injected animals. Results are discussed in the context of the role of 5-HT2C receptors in the precipitation of withdrawal anxiety.

  8. The Xin repeat-containing protein, mXinβ, initiates the maturation of the intercalated discs during postnatal heart development

    Science.gov (United States)

    Wang, Qinchuan; Lin, Jenny Li-Chun; Chan, Stephen Y.; Lin, Jim Jung-Ching

    2012-01-01

    The intercalated disc (ICD) is a unique structure to the heart and plays vital roles in communication and signaling among cardiomyocytes. ICDs are formed and matured during postnatal development through a profound redistribution of the intercellular junctions, as well as recruitment and assembly of more than 200 proteins at the termini of cardiomyocytes. The molecular mechanism underlying this process is not completely understood. The mouse orthologs (mXinα and mXinβ) of human cardiomyopathy-associated (CMYA)/Xin actin-binding repeat-containing protein (XIRP) genes (CMYA1/XIRP1 and CMYA3/XIRP2, respectively) encode proteins localized to ICDs. Ablation of mXinα results in adult late-onset cardiomyopathy with conduction defects and up-regulation of mXinβ. ICD structural defects are found in adult but not juvenile mXinα-null hearts. On the other hand, loss of mXinβ leads to ICD defects at postnatal day 16.5, a developmental stage when the heart is forming ICDs, suggesting mXinβ is required for ICD formation. Using quantitative Western blot, we showed in this study that mXinβ but not mXinα was uniquely up-regulated during the redistribution of intercellular junction from the lateral membrane of cardiomyocytes to their termini. In the absence of mXinβ, the intercellular junctions failed to be restricted to the termini of the cells, and the onset of such defect correlated with the peak expression of mXinβ. Immunofluorescence staining and subcellular fractionation showed that mXinβ preferentially associated with the forming ICDs, further suggesting that mXinβ functioned locally to promote ICD maturation. In contrast, the spatiotemporal expression profile of mXinα and the lack of more severe ICD defects in mXinα−/−;mXinβ−/− double knockout hearts than in mXinβ−/− hearts suggested that mXinα was not essential for the postnatal formation of ICDs. A two-step model for the development of ICD is proposed where mXinβ is essential for the

  9. Genetic structure of the Azores Islands: a study using 15 autosomal short tandem repeat loci.

    Science.gov (United States)

    Santos, Cristina; Alvarez, Luis; Aluja, Maria Pilar; Bruges-Armas, Jacome; Lima, Manuela

    2009-12-01

    The Azores archipelago (Portugal), located in the Atlantic Ocean, 1,500 km from the European mainland, is formed by nine islands of volcanic origin. The relative position of these islands allows the definition of three geographical groups: Eastern, Central and Western. Previous studies of the Azores using Short Tandem Repeats (STRs) have highlighted differences in the frequencies of several loci, when compared to Mainland Portugal or Madleira Island. Furthermore, linkage disequilibrium (LD), described for Azorean samples has been tentatively explained as reflecting the presence of genetic sub-structuring in the archipelago. To provide information concerning the genetic profile of the Azores Islands and to evaluate the presence of substructuring we have determined the allelic frequencies of 15 autosomal STR loci, using the AmpFlSTR Identifiler Kit, in representative samples from the Azorean Islands. Either considering the Azores as a whole, or analysing by island all the loci were in conformity with Hardy-Weinberg equilibrium. Average gene diversity ranged from 0.7669 in Corvo to 0.7972 in Terceira Island. Allelic independence between loci, tested for the global sample, detected significant LD (after correction for multiple tests) for pairs D21S11/D7S820 and D3S1358/D5S818. The exact test of population differentiation, combining the information of the 15 markers analysed, revealed significant differences between the three groups of islands, and between islands. Inter-island analysis reinforces the previous data that suggested the existence of sub-structuring in the Azores archipelago. Moreover, the data generated by this study can be used in a future forensic genetic database of the Azores after the appropriate enlacement of sample size by island, preventing, in that way, misinterpretations caused by population substructuring and small sample sizes.

  10. LONGITUDINAL STUDY OF REPEATED SPRINT PERFORMANCE IN YOUTH SOCCER PLAYERS OF CONTRASTING SKELETAL MATURITY STATUS

    Directory of Open Access Journals (Sweden)

    João Valente-dos-Santos

    2012-09-01

    Full Text Available The purpose of the study was to evaluate the developmental changes in performance in a repeated-sprint ability (RSA test in young soccer players of contrasting maturity status. A total of 83 regional level Portuguese youth soccer players, aged 11- 13 years at baseline was assessed annually. Stature, body mass, 7x34.2-m sprint protocol (25-s active recovery, 20-m multi-stage continuous shuttle endurance run and counter-movement jump (CMJ without the use of the arms were measured. Fat-free mass (FFM was determined by age and gender- specific formulas. Developmental changes in total sprint time across ages were predicted using multilevel modeling. Corresponding measurements were performed on an independent cross-sectional subsample of 52 youth soccer players 11-17 years to evaluate the predictive model. CA, CA2, maturational status (SA-CA, body size (mass and stature, FFM, aerobic endurance, lower limb explosive strength and annual volume training significantly improved the statistical fit of the RSA multilevel model. In 'late' maturing athletes, the best model for predicting change in RSA was expressed by the following equation: 86.54 - 2.87 x CA + 0.05 x CA2 - 0.25 x FFM + 0.15 x body mass + 0.05 x stature - 0.05 x aerobic endurance - 0.09 x lower limb explosive strength - 0.01 x annual volume training. The best fitting models for players who were 'on time' and 'early' maturing were identical to the best model for late maturing players, less 0.64 seconds and 1.74 seconds, respectively. Multilevel modeling provided performance curves that permitted the prediction of individual RSA performance across adolescent years in regional level soccer players

  11. A 13-week dermal repeat-dose neurotoxicity study of hydrodesulfurized kerosene in rats.

    Science.gov (United States)

    Breglia, Rudolph; Bui, Quang; Burnett, Donald; Koschier, Francis; Lapadula, Elizabeth; Podhasky, Paula; Schreiner, Ceinwen; White, Russell

    2014-01-01

    A 13-week dermal repeat-dose toxicity study was conducted with hydrodesulfurized (HDS) kerosene, a test material that also met the commercial specifications for aviation turbine fuel (jet A). The objectives were to assess the potential for target organ toxicity and neurotoxicity. The HDS kerosene was applied to the shaved backs of Sprague-Dawley CD rats, 12/sex/group, 6 h/d, 5 d/wk in doses of 0 (vehicle control), 165 mg/kg (20% HDS kerosene), 330 mg/kg (40% HDS kerosene), or 495 mg/kg (60% HDS kerosene). Additional rats (12/sex) from the control and the high-dose groups were held without treatment for 4 weeks to assess recovery. Standard parameters of toxicity were investigated during the in-life phase. At necropsy, organs were weighed and selected tissues were processed for microscopic evaluation. Neurobehavioral evaluations included tests of motor activity and functional observations that were conducted pretest, at intervals during the exposure period and after recovery. No test substance-related effects on mortality, clinical observations (except dermal irritation), body weight, or clinical chemistry values were observed. A dose-related increase in skin irritation, confirmed histologically as minimal, was evident at the dosing site. The only statistically significant change considered potentially treatment related was an increase in the neutrophil count in females at 13 weeks. No test article-related effects were observed in the neurobehavioral assessments or gross or microscopic findings in the peripheral or central nervous system tissues in any of the dose groups. Excluding skin irritation, the no observed adverse effect level value for all effects was considered 495 mg/kg/d.

  12. Population genetic study of 10 short tandem repeat loci from 600 domestic dogs in Korea

    Science.gov (United States)

    Moon, Seo Hyun; Jang, Yoon-Jeong

    2016-01-01

    Dogs have long shared close relationships with many humans. Due to the large number of dogs in human populations, they are often involved in crimes. Occasionally, canine biological evidence such as saliva, bloodstains and hairs can be found at crime scenes. Accordingly, canine DNA can be used as forensic evidence. The use of short tandem repeat (STR) loci from biological evidence is valuable for forensic investigations. In Korea, canine STR profiling-related crimes are being successfully analyzed, leading to diverse crimes such as animal cruelty, dog-attacks, murder, robbery, and missing and abandoned dogs being solved. However, the probability of random DNA profile matches cannot be analyzed because of a lack of canine STR data. Therefore, in this study, 10 STR loci were analyzed in 600 dogs in Korea (344 dogs belonging to 30 different purebreds and 256 crossbred dogs) to estimate canine forensic genetic parameters. Among purebred dogs, a separate statistical analysis was conducted for five major subgroups, 97 Maltese, 47 Poodles, 31 Shih Tzus, 32 Yorkshire Terriers, and 25 Pomeranians. Allele frequencies, expected (Hexp) and observed heterozygosity (Hobs), fixation index (F), probability of identity (P(ID)), probability of sibling identity (P(ID)sib) and probability of exclusion (PE) were then calculated. The Hexp values ranged from 0.901 (PEZ12) to 0.634 (FHC2079), while the P(ID)sib values were between 0.481 (FHC2079) and 0.304 (PEZ12) and the P(ID)sib was about 3.35 × 10−5 for the combination of all 10 loci. The results presented herein will strengthen the value of canine DNA to solving dog-related crimes. PMID:26645337

  13. Pilot study: Assessing repeatability of the EcoWalk platform resistive pressure sensors to measure plantar pressure during barefoot standing

    Science.gov (United States)

    Zequera, Martha; Perdomo, Oscar; Wilches, Carlos; Vizcaya, Pedro

    2013-06-01

    Plantar pressure provides useful information to assess the feet's condition. These systems have emerged as popular tools in clinical environment. These systems present errors and no compensation information is presented by the manufacturer, leading to uncertainty in the measurements. Ten healthy subjects, 5 females and 5 males, were recruited. Lateral load distribution, antero-posterior load distribution, average pressure, contact area, and force were recorded. The aims of this study were to assess repeatability of the EcoWalk system and identify the range of pressure values observed in the normal foot. The coefficient of repeatability was less than 4% for all parameters considered.

  14. Reduction and technical simplification of testing protocol for walking based on repeatability analyses: An Interreg IVa pilot study

    Directory of Open Access Journals (Sweden)

    Nejc Sarabon

    2010-12-01

    Full Text Available The aim of this study was to define the most appropriate gait measurement protocols to be used in our future studies in the Mobility in Ageing project. A group of young healthy volunteers took part in the study. Each subject carried out a 10-metre walking test at five different speeds (preferred, very slow, very fast, slow, and fast. Each walking speed was repeated three times, making a total of 15 trials which were carried out in a random order. Each trial was simultaneously analysed by three observers using three different technical approaches: a stop watch, photo cells and electronic kinematic dress. In analysing the repeatability of the trials, the results showed that of the five self-selected walking speeds, three of them (preferred, very fast, and very slow had a significantly higher repeatability of the average walking velocity, step length and cadence than the other two speeds. Additionally, the data showed that one of the three technical methods for gait assessment has better metric characteristics than the other two. In conclusion, based on repeatability, technical and organizational simplification, this study helped us to successfully define a simple and reliable walking test to be used in the main study of the project.

  15. Studies on the disbonding initiation of interfacial cracks.

    Energy Technology Data Exchange (ETDEWEB)

    McAdams, Brian J. (Lehigh University, Bethlehem, PA); Pearson, Raymond A. (Lehigh University, Bethlehem, PA)

    2005-08-01

    With the continuing trend of decreasing feature sizes in flip-chip assemblies, the reliability tolerance to interfacial flaws is also decreasing. Small-scale disbonds will become more of a concern, pointing to the need for a better understanding of the initiation stage of interfacial delamination. With most accepted adhesion metric methodologies tailored to predict failure under the prior existence of a disbond, the study of the initiation phenomenon is open to development and standardization of new testing procedures. Traditional fracture mechanics approaches are not suitable, as the mathematics assume failure to originate at a disbond or crack tip. Disbond initiation is believed to first occur at free edges and corners, which act as high stress concentration sites and exhibit singular stresses similar to a crack tip, though less severe in intensity. As such, a 'fracture mechanics-like' approach may be employed which defines a material parameter--a critical stress intensity factor (K{sub c})--that can be used to predict when initiation of a disbond at an interface will occur. The factors affecting the adhesion of underfill/polyimide interfaces relevant to flip-chip assemblies were investigated in this study. The study consisted of two distinct parts: a comparison of the initiation and propagation phenomena and a comparison of the relationship between sub-critical and critical initiation of interfacial failure. The initiation of underfill interfacial failure was studied by characterizing failure at a free-edge with a critical stress intensity factor. In comparison with the interfacial fracture toughness testing, it was shown that a good correlation exists between the initiation and propagation of interfacial failures. Such a correlation justifies the continuing use of fracture mechanics to predict the reliability of flip-chip packages. The second aspect of the research involved fatigue testing of tensile butt joint specimens to determine lifetimes at sub

  16. Repeat fine-needle aspiration can be performed at 6 months or more after initial atypia of undetermined significance or follicular lesion of undetermined significance results for thyroid nodules 10 mm or larger.

    Science.gov (United States)

    Koh, Jieun; Kim, Eun-Kyung; Kwak, Jin Young; Yoon, Jung Hyun; Moon, Hee Jung

    2016-12-01

    To investigate whether repeat ultrasound-guided fine-needle aspiration (US-FNA) in initial atypia of undetermined significance or follicular lesion of undetermined significance (AUS/FLUS) results could be performed 6 months after or more. A total of 221 AUS/FLUS ≥10 mm with any follow-up were grouped according to the first follow-up interval at less than 6 months (group 1, n = 87) and 6 months or more (group 2, n = 134). Clinical features, final assessment of ultrasound (US) or the Thyroid Imaging Reporting and Data System (TIRADS), tumour size, extrathyroidal extension and lymph node metastasis in malignancies were compared. Thirty-four (15.4 %) were malignant. Age, gender, size, final assessment, TIRADS and malignancy rate were not significantly different between the two groups (p = 0.660, 0.691, 0.502, 0.237, 0.819 and 0.420). Tumour size, extrathyroidal extension and lymph node metastasis were not significantly different between the two malignancy groups (p = 0.770, 0.611 and 0.068). Two of 10 nodules with increased size were malignancies found at 7.1 and 25.0 months. None of 33 nodules (14.9 %) with decreased size at a median 10 months were malignant. Repeat US-FNA performed on nodules ≥10 mm at 6 months or more after initial AUS/FLUS results can reduce unnecessary repeat US-FNAs without progression of malignancy. • Follow-up intervals of AUS/FLUS did not affect the malignancy rate • Tumour stage was not different according to the follow-up intervals • None of the nodules with decreased size were malignant • Repeat US-FNA can be performed at ≥6 months after initial AUS/FLUS.

  17. Prospective study on determinants of repeat attendance and attendance patterns in breast cancer screening using the Theory of Planned Behaviour.

    NARCIS (Netherlands)

    Drossaert, Constance H.C.; Boer, Hendrik; Seydel, E.R.

    2003-01-01

    This prospective study, using the Theory of Planned Behaviour (TPB) as a theoretical framework, was carried out to identify the determinants of repeat attendance and attendance patterns in organised breast screening. A group of 2657 women filled out a baseline questionnaire, approximately 8 weeks

  18. Initial Feasibility Study to Drill and Core the Ocean Mantle

    OpenAIRE

    2011-01-01

    An initial feasibility study (Pilisi and Whitney, 2011) of drilling through the Mohorovičić discontinuity (Moho) into the oceanic mantle specifically focused on future requirements for planning, drilling and coring a hole 500 m into the oceanic mantle from three candidate locations in the Pacific Ocean (Cocos Plate, Baja California, and offshore Hawaii). The study points out some of the critical issues that need to be resolved before embarking upon such a challengingproject. It was conducted ...

  19. Assessing the repeatability of terrestrial laser scanning for monitoring gully topography: A case study from Aratula, Queensland, Australia

    Science.gov (United States)

    Goodwin, Nicholas Robert; Armston, John; Stiller, Isaac; Muir, Jasmine

    2016-06-01

    Terrestrial laser scanning (TLS) technology is a powerful tool for quantifying gully morphology and monitoring change over time. This is due to the high sampling density, sub-centimetre positional accuracies (x, y, z), flexibility of survey configurations and ability to link multiple TLS scans together. However, to ensure correct interpretation of results, research is needed to test the repeatability of TLS derived products to quantify the accuracy and separate 'false' from 'true' geomorphic change. In this study, we use the RIEGL VZ400 scanner to test the repeatability of TLS datasets for mapping gully morphology. We then quantify change following a rainfall event of approximately 100 mm. Our study site, located in south-east Queensland, Australia was chosen to be challenging from a repeatability perspective with high topographic variability. The TLS data capture involved three sets of linked scans: one survey pre-rainfall, to be compared to two surveys post-rainfall acquired on consecutive days. Change is considered negligible in the two post-rainfall scans to test survey repeatability. To verify TLS accuracy, an independent dataset of gully extent and spot heights were acquired using traditional total station techniques. Results confirm that the TLS datasets can be registered multi-temporally at sub-centimetre levels of accuracy in three dimensions. Total station and TLS elevation samples showed strong agreement with a mean error and standard deviation (SD) of residuals equal to 0.052 and 0.047 m, respectively (n = 889). Significantly, our repeatability tests found that return type and pulse deviation influence the accuracy and repeatability of DEMs in gully environments. Analysis of consecutive day datasets showed that DEMs derived from first return data recorded 40% higher SD of residual error than DEMs using multiple return data. A significant empirical relationship between pulse deviation and the variance of residuals for repeat DEMs is also shown (r2 = 0

  20. Kingdom of Saudi Arabia Geospatial Information Infrastructure - AN Initial Study

    Science.gov (United States)

    Alsultan, S. H.; Rahman, A. A.

    2015-10-01

    This paper reviews the current Geographic Information System (Longley et al.) implementation and status in the Kingdom of Saudi Arabia (KSA). Based on the review, several problems were identified and discussed. The characteristic of these problems show that the country needs a national geospatial centre. As a new initiative for a national geospatial centre, a study is being conducted especially on best practice from other countries, availability of national committee for standards and policies on data sharing, and the best proposed organization structure inside the administration for the KSA. The study also covers the degree of readiness and awareness among the main GIS stakeholders within the country as well as private parties. At the end of this paper, strategic steps for the national geospatial management centre were proposed as the initial output of the study.

  1. Repeatability of Cryogenic Multilayer Insulation

    Science.gov (United States)

    Johnson, W. L.; Vanderlaan, M.; Wood, J. J.; Rhys, N. O.; Guo, W.; Van Sciver, S.; Chato, D. J.

    2017-01-01

    Due to the variety of requirements across aerospace platforms, and one off projects, the repeatability of cryogenic multilayer insulation has never been fully established. The objective of this test program is to provide a more basic understanding of the thermal performance repeatability of MLI systems that are applicable to large scale tanks. There are several different types of repeatability that can be accounted for: these include repeatability between multiple identical blankets, repeatability of installation of the same blanket, and repeatability of a test apparatus. The focus of the work in this report is on the first two types of repeatability. Statistically, repeatability can mean many different things. In simplest form, it refers to the range of performance that a population exhibits and the average of the population. However, as more and more identical components are made (i.e. the population of concern grows), the simple range morphs into a standard deviation from an average performance. Initial repeatability testing on MLI blankets has been completed at Florida State University. Repeatability of five GRC provided coupons with 25 layers was shown to be +/- 8.4 whereas repeatability of repeatedly installing a single coupon was shown to be +/- 8.0. A second group of 10 coupons have been fabricated by Yetispace and tested by Florida State University, through the first 4 tests, the repeatability has been shown to be +/- 16. Based on detailed statistical analysis, the data has been shown to be statistically significant.

  2. Progress study on the mechanism of CAG repeats dynamic mutation in polyQ disease

    Directory of Open Access Journals (Sweden)

    WANG Chun-rong

    2012-06-01

    Full Text Available Polyglutamine (polyQ disease is a group of neurodegenerative disorders caused by abnormal expansion of CAG repeats within coding regions of certain causative genes, which are translated into a series of abnormally expanded polyQ tracts causing cytotoxicity. So far, nine diseases caused by expanded polyQ tracts have been demonstrated including Huntington's disease (HD, spinobulbar muscular atrophy (SBMA, dentatorubral-pallidoluysian atrophy (DRPLA and several spinocerebellar ataxias subtypes (SCA. In human, long CAG repeats tend to expand during transmissions from parent to offspring, named as dynamic mutation, leading to an earlier age of disease onset and more severe symptoms in subsequent generations. The review presents some novel mechanisms based on dynamic mutation.

  3. PCR bias in amplification of androgen receptor alleles, a trinucleotide repeat marker used in clonality studies.

    OpenAIRE

    Mutter, G L; Boynton, K A

    1995-01-01

    Trinucleotide CAG repeats in the X-linked human androgen receptor gene (HUMARA) have proved a useful means of determining X chromosome haplotypes, and when combined with methylation analysis of nearby cytosine residues permits identification of non-random X inactivation in tumors of women. Co-amplification of two alleles in a heterozygote generates PCR products which differ in the number of CAG units, and thus their melting and secondary structure characteristics. We have shown that under opt...

  4. A genetic and structural study of genome rearrangements mediated by high copy repeat Ty1 elements.

    Directory of Open Access Journals (Sweden)

    Jason E Chan

    2011-05-01

    Full Text Available Ty elements are high copy number, dispersed repeated sequences in the Saccharomyces cerevisiae genome known to mediate gross chromosomal rearrangements (GCRs. Here we found that introduction of Ty912, a previously identified Ty1 element, onto the non-essential terminal region of the left arm of chromosome V led to a 380-fold increase in the rate of accumulating GCRs in a wild-type strain. A survey of 48 different mutations identified those that either increased or decreased the rate of Ty-mediated GCRs and demonstrated that suppression of Ty-mediated GCRs differs from that of both low copy repeat sequence- and single copy sequence-mediated GCRs. The majority of the Ty912-mediated GCRs observed were monocentric nonreciprocal translocations mediated by RAD52-dependent homologous recombination (HR between Ty912 and a Ty element on another chromosome arm. The remaining Ty912-mediated GCRs appeared to involve Ty912-mediated formation of unstable dicentric translocation chromosomes that were resolved by one or more Ty-mediated breakage-fusion-bridge cycles. Overall, the results demonstrate that the Ty912-mediated GCR assay is an excellent model for understanding mechanisms and pathways that suppress genome rearrangements mediated by high copy number repeat sequences, as well as the mechanisms by which such rearrangements occur.

  5. Study of the repeatability of histone genes in the ploidy series of wheat and Aegilops

    Energy Technology Data Exchange (ETDEWEB)

    Vakhitov, V.A.; Kulikov, A.M.

    1986-10-01

    The hDNA content and number of histone genes in the genomes of different wheat and Aegilops species have been determined by molecular hybridization of DNA with /sup 125/I-histone DNA of Drosophila (L-repeat) on nitrocellulose filters. It has been demonstrated that the proportion of hDNA in the total DNA of diploid and polyploid wheat species is (1.3-7.7) x 10/sup -3/% (57-850 genes), and in the ploidy series of Aegilops species (2.0-8.0) x 10/sup -3/% (89-780 genes). The repeatability of the histone genes generally increases at each ploidy level in the species with higher DNA content. At the same time, it has been demonstrated that the DNA content is not the only factor determining repeatability of the histone genes, as some diploid and allopolyploid species have similar number of these genes. It has been concluded that genetic mechanisms are involved in the regulation of the number of histone genes.

  6. Repeatability study of mechanomyography in submaximal isometric contractions using coefficient of variation and intraclass correlation coefficient.

    Science.gov (United States)

    Akataki, K; Mita, K; Itoh, Y

    1999-01-01

    The within-day and between-day repeatability of the mechanomyogram (MMG) was assessed using the coefficient of variation (CV) and the intraclass correlation coefficient (ICC) and was compared with that of the electromyogram (EMG). The MMG and EMG were recorded simultaneously during isometric elbow flexion trials at different submaximal levels of 10% to 90% MVC. The testing session consisting of 9 submaximal trials was repeated 8 times on the same day for estimation of the within-day variation. In order to examine the between-day variation, the same testing session was also performed 8 times over 3 weeks with a 2-day rest interval between each session. The CVs within-day and between-day in both the MMG and EMG did not demonstrate any significant differences relating to the magnitude of force exerted. The CVs combined over all the force levels were approximately 10% within the same day and 25% between days for both the MMG and EMG. These corresponded to the within-day ICC of approximately 0.95 and the between-day ICC of 0.80. The repeatability of the MMG during submaximal isometric contractions of biceps brachii muscles is considered to be similar to that of the more established EMG.

  7. Shock initiation studies on high concentration hydrogen peroxide

    Energy Technology Data Exchange (ETDEWEB)

    Sheffield, Stephen A [Los Alamos National Laboratory; Dattelbaum, Dana M [Los Alamos National Laboratory; Stahl, David B [Los Alamos National Laboratory; Gibson, L. Lee [Los Alamos National Laboratory; Bartram, Brian D. [Los Alamos National Laboratory

    2009-01-01

    Concentrated hydrogen peroxide (H{sub 2}O{sub 2}) has been known to detonate for many years. However, because of its reactivity and the difficulty in handling and confining it, along with the large critical diameter, few studies providing basic information about the initiation and detonation properties have been published. We are conducting a study to understand and quantify the initiation and detonation properties of highly concentrated H{sub 2}O{sub 2} using a gas-driven two-stage gun to produce well defined shock inputs. Multiple magnetic gauges are used to make in-situ measurements of the growth of reaction and subsequent detonation in the liquid. These experiments are designed to be one-dimensional to eliminate any difficulties that might be encountered with large critical diameters. Because of the concern of the reactivity of the H{sub 2}O{sub 2} with the confining materials, a remote loading system has been developed. The gun is pressurized, then the cell is filled and the experiment shot within less than three minutes. TV cameras are attached to the target so the cell filling can be monitored. Several experiments have been completed on {approx}98 wt % H{sub 2}O{sub 2}/H{sub 2}O mixtures; initiation has been observed in some experiments that shows homogeneous shock initiation behavior. The initial shock pressurizes and heats the mixture. After an induction time, a thermal explosion type reaction produces an evolving reactive wave that strengthens and eventually overdrives the first wave producing a detonation. From these measurements, we have determined unreacted Hugoniot information, times (distances) to detonation (Pop-plot points) that indicate low sensitivity, and detonation velocities of high concentration H{sub 2}O{sub 2}/H{sub 2}O solutions that agree with earlier estimates.

  8. Shock initiation studies on high concentration hydrogen peroxide

    Energy Technology Data Exchange (ETDEWEB)

    Sheffield, Stephen A [Los Alamos National Laboratory; Dattelbaum, Dana M [Los Alamos National Laboratory; Stahl, David B [Los Alamos National Laboratory; Gibson, L. Lee [Los Alamos National Laboratory; Bartram, Brian D. [Los Alamos National Laboratory

    2009-01-01

    Concentrated hydrogen peroxide (H{sub 2}O{sub 2}) has been known to detonate for many years. However, because of its reactivity and the difficulty in handling and confining it, along with the large critical diameter, few studies providing basic information about the initiation and detonation properties have been published. We are conducting a study to understand and quantify the initiation and detonation properties of highly concentrated H{sub 2}O{sub 2} using a gas-driven two-stage gun to produce well defined shock inputs. Multiple magnetic gauges are used to make in-situ measurements of the growth of reaction and subsequent detonation in the liquid. These experiments are designed to be one-dimensional to eliminate any difficulties that might be encountered with large critical diameters. Because of the concern of the reactivity of the H{sub 2}O{sub 2} with the confining materials, a remote loading system has been developed. The gun is pressurized, then the cell is filled and the experiment shot within less than three minutes. TV cameras are attached to the target so the cell filling can be monitored. Several experiments have been completed on {approx}98 wt % H{sub 2}O{sub 2}/H{sub 2}O mixtures; initiation has been observed in some experiments that shows homogeneous shock initiation behavior. The initial shock pressurizes and heats the mixture. After an induction time, a thermal explosion type reaction produces an evolving reactive wave that strengthens and eventually overdrives the first wave producing a detonation. From these measurements, we have determined unreacted Hugoniot information, times (distances) to detonation (Pop-plot points) that indicate low sensitivity, and detonation velocities of high concentration H{sub 2}O{sub 2}/H{sub 2}O solutions that agree with earlier estimates.

  9. STUDIES ON VINYL POLYMERIZATION WITH INITIATION SYSTEM CONTAINING AMINE DERIVATIVES

    Institute of Scientific and Technical Information of China (English)

    QIU Kunyuan; ZHANG Jingyi; FENG Xinde(S. T. Voong)

    1983-01-01

    Two main types of amine-containing initiation systems were studied in this work. In the case of MMA polymerization initiated by BPO-amine (DMT, DHET, DMA) redox systems, it was found that the polymerization rate and colour stability of the polymer for different amine systems were in the following order: DMT≈DHET>DMA. Accordingly, BPO-DMT and BPO-DHET are effective initiators. In the case of MEMA polymerization by amine (DMT, DHET, DMA) alone, it was found that the polymerization rate and the percentage of conversion for these different amine systems were in the following order: DMT≥DHET>DMA. The polymerization rate and the percentage of conversion also increased with the increase of DMT concentration. From the kinetic investigation the rate equation of Rp=K [DMT]1/2 [MEMA]3/2 was obtained, and the overall activation energy of polymerization was calculated to be 34.3 KJ/mol (8.2 Kcal/mol). Moreover, the polymerization of MEMA in the presence of DMT was strongly inhibited by hydroquinone, indicating the polymerization being free radical in nature. From these results, the mechanism of MEMA polymerization initiated by amine was proposed.

  10. INITIATION OF SHELL MOTION ON SAND BEDS: AN EXPERIMENTAL STUDY

    Institute of Scientific and Technical Information of China (English)

    Subhasish DEY; Alok KUMAR

    2002-01-01

    Experimental study on initiation of bivalve shell motion on a horizontal sand bed, under a unidirectional flow of water, is presented. Experiments were carried out in a flume with three types of bivalve shells,namely Coquina Clam, Cross-barred Chione and Ponderous Ark, to test the condition for initiation of motion. The shape parameters of bivalve shells are defined appropriately. Experiments were conducted in a flume with a horizontal bed, and the critical shear stresses were estimated using Vanoni's side-wall correction. The characteristic parameters affecting the initiation of shell motion on a horizontal bed in rough-turbulent regime identified based on the physical reasoning and dimensional analysis are the Shields parameter (nondimensional critical shear stress), nondimensional competent mean velocity,nondimensional sand roughness, nondimensional flow depth and shape parameter. Equations of Shields parameter and nondimensional competent mean velocity for the initial movement of shells on a horizontal sand bed with convex upward and downward conditions are obtained using experimental data.

  11. Initial trade and design studies for the fusion engineering device

    Energy Technology Data Exchange (ETDEWEB)

    Flanagan, C.A.; Steiner, D.; Smith, G.E.

    1981-06-01

    The Magnetic Fusion Energy Engineering Act of 1980 calls for the operation of a Fusion Engineering Device (FED) by 1990. It is the intent of the Act that the FED, in combination with other testing facilities, will establish the engineering feasibility of magnetic fusion energy. The Fusion Engineering Design Center (FEDC), under the guidance of a Technical Management Board (TMB), initiated a program of trade and design studies in October 1980 to support the selection of the FED concept. This document presents the results of these initial trade and design studies. Based on these results, a baseline configuration has been identified and the Design Center effort for the remainder of the fiscal year will be devoted to the development of a self-consistent FED design description.

  12. Deployment Repeatability

    Science.gov (United States)

    2016-04-01

    controlled to great precision, but in a Cubesat , there may be no attitude determination at all. Such a Cubesat might treat sun angle and tumbling rates as...could be sensitive to small differences in motor controller timing. In these cases, the analyst might choose to model the entire deployment path, with...knowledge of the material damage model or motor controller timing precision. On the other hand, if many repeated and environmentally representative

  13. Variability in prefrontal hemodynamic response during exposure to repeated self-selected music excerpts, a near-infrared spectroscopy study.

    Science.gov (United States)

    Moghimi, Saba; Schudlo, Larissa; Chau, Tom; Guerguerian, Anne-Marie

    2015-01-01

    Music-induced brain activity modulations in areas involved in emotion regulation may be useful in achieving therapeutic outcomes. Clinical applications of music may involve prolonged or repeated exposures to music. However, the variability of the observed brain activity patterns in repeated exposures to music is not well understood. We hypothesized that multiple exposures to the same music would elicit more consistent activity patterns than exposure to different music. In this study, the temporal and spatial variability of cerebral prefrontal hemodynamic response was investigated across multiple exposures to self-selected musical excerpts in 10 healthy adults. The hemodynamic changes were measured using prefrontal cortex near infrared spectroscopy and represented by instantaneous phase values. Based on spatial and temporal characteristics of these observed hemodynamic changes, we defined a consistency index to represent variability across these domains. The consistency index across repeated exposures to the same piece of music was compared to the consistency index corresponding to prefrontal activity from randomly matched non-identical musical excerpts. Consistency indexes were significantly different for identical versus non-identical musical excerpts when comparing a subset of repetitions. When all four exposures were compared, no significant difference was observed between the consistency indexes of randomly matched non-identical musical excerpts and the consistency index corresponding to repetitions of the same musical excerpts. This observation suggests the existence of only partial consistency between repeated exposures to the same musical excerpt, which may stem from the role of the prefrontal cortex in regulating other cognitive and emotional processes.

  14. Social Cognition Psychometric Evaluation: Results of the Initial Psychometric Study.

    Science.gov (United States)

    Pinkham, Amy E; Penn, David L; Green, Michael F; Harvey, Philip D

    2016-03-01

    Measurement of social cognition in treatment trials remains problematic due to poor and limited psychometric data for many tasks. As part of the Social Cognition Psychometric Evaluation (SCOPE) study, the psychometric properties of 8 tasks were assessed. One hundred and seventy-nine stable outpatients with schizophrenia and 104 healthy controls completed the battery at baseline and a 2-4-week retest period at 2 sites. Tasks included the Ambiguous Intentions Hostility Questionnaire (AIHQ), Bell Lysaker Emotion Recognition Task (BLERT), Penn Emotion Recognition Task (ER-40), Relationships Across Domains (RAD), Reading the Mind in the Eyes Task (Eyes), The Awareness of Social Inferences Test (TASIT), Hinting Task, and Trustworthiness Task. Tasks were evaluated on: (i) test-retest reliability, (ii) utility as a repeated measure, (iii) relationship to functional outcome, (iv) practicality and tolerability, (v) sensitivity to group differences, and (vi) internal consistency. The BLERT and Hinting task showed the strongest psychometric properties across all evaluation criteria and are recommended for use in clinical trials. The ER-40, Eyes Task, and TASIT showed somewhat weaker psychometric properties and require further study. The AIHQ, RAD, and Trustworthiness Task showed poorer psychometric properties that suggest caution for their use in clinical trials. © The Author 2015. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  15. Repeated hands-and-knees positioning during labour: a randomized pilot study.

    Science.gov (United States)

    Hodnett, Ellen D; Stremler, Robyn; Halpern, Stephen H; Weston, Julie; Windrim, Rory

    2013-01-01

    Background. Caesarean birth rates in North America continue to rise, in the absence of benefit for mothers and babies. One reason may be that hospitalized labouring women spend most of their labours in recumbent or semi-recumbent positions. Although hands-and-knees position has theoretical advantages, efforts to encourage its adoption in practice are severely hampered by the lack of compelling evidence that it is beneficial. Before a definitive, large scale trial, with spontaneous vaginal birth as the primary outcome, could be justified in terms of time, effort, and expense, several feasibility and acceptability questions had to be addressed. We aimed to enrol 60 women in a pilot study to assess feasibility and acceptability of the trial protocol, and to obtain estimates of treatment effects on method of birth and persistent back pain. Methods. We conducted a pilot study at two North American hospitals. In ten months of recruitment, 30 nulliparous women in labour at term were randomly allocated to either usual care (use of any position during labour except hands-and-knees) or to try hands-and-knees for 15 min every hour during labour. Data were collected about compliance, acceptability, persistent back pain, intrapartum interventions, and women's views of their experiences. Results. Although mean length of time from randomization to delivery was over 12 hours, only 9 of the 16 women allocated to repeated hands-and-knees used it more than twice. Two of the 14 in the usual care group used hands-and-knees once. Twenty-seven women had regional analgesia (15 in the hands-and-knees group and 12 in the usual care group). Eleven in the hands-and-knees group and 14 in the usual care group had spontaneous vaginal births. One woman (in the hands-and-knees group) had a vacuum extraction. Four women in the hands-and-knees group and none in the usual care group gave birth by caesarean section. Hourly back pain ratings were highly variable in both groups, covering the full range

  16. Repeated hands-and-knees positioning during labour: a randomized pilot study

    Directory of Open Access Journals (Sweden)

    Ellen D. Hodnett

    2013-02-01

    Full Text Available Background. Caesarean birth rates in North America continue to rise, in the absence of benefit for mothers and babies. One reason may be that hospitalized labouring women spend most of their labours in recumbent or semi-recumbent positions. Although hands-and-knees position has theoretical advantages, efforts to encourage its adoption in practice are severely hampered by the lack of compelling evidence that it is beneficial. Before a definitive, large scale trial, with spontaneous vaginal birth as the primary outcome, could be justified in terms of time, effort, and expense, several feasibility and acceptability questions had to be addressed. We aimed to enrol 60 women in a pilot study to assess feasibility and acceptability of the trial protocol, and to obtain estimates of treatment effects on method of birth and persistent back pain.Methods. We conducted a pilot study at two North American hospitals. In ten months of recruitment, 30 nulliparous women in labour at term were randomly allocated to either usual care (use of any position during labour except hands-and-knees or to try hands-and-knees for 15 min every hour during labour. Data were collected about compliance, acceptability, persistent back pain, intrapartum interventions, and women’s views of their experiences.Results. Although mean length of time from randomization to delivery was over 12 hours, only 9 of the 16 women allocated to repeated hands-and-knees used it more than twice. Two of the 14 in the usual care group used hands-and-knees once. Twenty-seven women had regional analgesia (15 in the hands-and-knees group and 12 in the usual care group. Eleven in the hands-and-knees group and 14 in the usual care group had spontaneous vaginal births. One woman (in the hands-and-knees group had a vacuum extraction. Four women in the hands-and-knees group and none in the usual care group gave birth by caesarean section. Hourly back pain ratings were highly variable in both groups

  17. Corneal epithelial toxicity of antiglaucoma formulations: in vitro study of repeated applications

    Directory of Open Access Journals (Sweden)

    Meloni M

    2012-09-01

    Full Text Available Marisa Meloni,1 Giampiero Cattaneo,2 Barbara De Servi11VitroScreen In Vitro Research Laboratories, 2Thea Farma, Milan, ItalyBackground: By using a biologically relevant and sensitive three-dimensional model of human corneal epithelium and multiple endpoint analysis, assessment of the potential for eye irritation and long-term compatibility of four registered ophthalmological preparations, ie, Timolabak®, Timoptol®, Nyogel®, and Timogel®, was performed. This approach enables classification of the potential for irritation, discriminating between mildly irritant and non-irritant ocular substances.Methods: The exposure protocol included two time periods, ie, 24 hours (acute application and 72 hours (repeated applications twice daily. This approach allows assessment of not only the acute reaction but also possible recovery, as well as mimicking the potential cumulative effects associated with long-term application. Using benzalkonium chloride (BAK 0.01% as a positive control, the following parameters were quantified: cellular viability by MTT test, histological analysis by hematoxylin and eosin staining, passive release of interleukin-1a by enzyme-linked immunosorbent assay, and OCLN gene expression by quantitative real-time polymerase chain reaction.Results: Cell viability was reduced to under the 50% cutoff value after acute exposure (24 hours to BAK 0.01%, and after repeated application (72 hours of Timoptol and Nyogel. Histological analysis after acute exposure showed signs of superficial damage with all formulations, and severe changes after repeated applications of Timoptol, BAK 0.01%, and Nyogel. Timolabak and Timogel did not significantly alter the morphology of the human corneal epithelial cells after the different exposure times. Interleukin-1α release was greater than that for the negative control (>20 pg/mL and the positive control (BAK 0.01%, Nyogel, and Timoptol treatments and not different after treatment with Timolabak and

  18. CAG repeat polymorphisms in the androgen receptor and breast cancer risk in women: a meta-analysis of 17 studies

    Directory of Open Access Journals (Sweden)

    Mao Q

    2015-08-01

    Full Text Available Qixing Mao,1–3,* Mantang Qiu,1–3,* Gaochao Dong,3 Wenjie Xia,1–3 Shuai Zhang,1,3 Youtao Xu,1,3 Jie Wang,3 Yin Rong,1,3 Lin Xu,1,3 Feng Jiang1,3 1Department of Thoracic Surgery, Nanjing Medical University Affiliated Cancer Institute of Jiangsu Province, 2Fourth Clinical College of Nanjing Medical University, 3Jiangsu Key Laboratory of Molecular and Translational Cancer Research, Nanjing, People’s Republic of China *These authors contributed equally to this work Abstract: The association between polymorphic CAG repeats in the androgen receptor gene in women and breast cancer susceptibility has been studied extensively. However, the conclusions regarding this relationship remain conflicting. The purpose of this meta-analysis was to identify whether androgen receptor CAG repeat lengths were related to breast cancer susceptibility. The MEDLINE, PubMed, and EMBASE databases were searched through to December 2014 to identify eligible studies. Data and study quality were rigorously assessed by two investigators according to the Newcastle-Ottawa Quality Assessment Scale. The publication bias was assessed by the Begg’s test. Seventeen eligible studies were included in this meta-analysis. The overall analysis suggested no association between CAG polymorphisms and breast cancer risk (odds ratio [OR] 1.031, 95% confidence interval [CI] 0.855–1.245. However, in the subgroup analysis, we observed that long CAG repeats significantly increased the risk of breast cancer in the Caucasian population (OR 1.447, 95% CI 1.089–1.992. Additionally, the risk was significantly increased in Caucasian women carrying two alleles with CAG repeats ≥22 units compared with those with two shorter alleles (OR 1.315, 95% CI 1.014–1.707. These findings suggest that long CAG repeats increase the risk of breast cancer in Caucasian women. However, larger scale case-control studies are needed to validate our results. Keywords: androgen, CAG repeat polymorphism, women

  19. Comparison of initial and tertiary centre second opinion reads of multiparametric magnetic resonance imaging of the prostate prior to repeat biopsy

    Energy Technology Data Exchange (ETDEWEB)

    Hansen, Nienke L. [University Hospital RWTH Aachen, Department of Diagnostic and Interventional Radiology, Aachen (Germany); Addenbrooke' s Hospital and University of Cambridge, CamPARI Clinic, Cambridge (United Kingdom); Koo, Brendan C.; Gallagher, Ferdia A. [Addenbrooke' s Hospital and University of Cambridge, CamPARI Clinic, Cambridge (United Kingdom); Addenbrooke' s Hospital and University of Cambridge, Department of Radiology, Cambridge (United Kingdom); Warren, Anne Y. [Addenbrooke' s Hospital and University of Cambridge, CamPARI Clinic, Cambridge (United Kingdom); Addenbrooke' s Hospital, Department of Pathology, Cambridge (United Kingdom); Doble, Andrew; Gnanapragasam, Vincent; Bratt, Ola; Kastner, Christof [Addenbrooke' s Hospital and University of Cambridge, CamPARI Clinic, Cambridge (United Kingdom); Addenbrooke' s Hospital, Department of Urology, Cambridge (United Kingdom); Barrett, Tristan [Addenbrooke' s Hospital and University of Cambridge, CamPARI Clinic, Cambridge (United Kingdom); Addenbrooke' s Hospital and University of Cambridge, Department of Radiology, Cambridge (United Kingdom); University of Cambridge School of Clinical Medicine, Department of Radiology, Box 218, Cambridge (United Kingdom)

    2017-06-15

    To investigate the value of second-opinion evaluation of multiparametric prostate magnetic resonance imaging (MRI) by subspecialised uroradiologists at a tertiary centre for the detection of significant cancer in transperineal fusion prostate biopsy. Evaluation of prospectively acquired initial and second-opinion radiology reports of 158 patients who underwent MRI at regional hospitals prior to transperineal MR/untrasound fusion biopsy at a tertiary referral centre over a 3-year period. Gleason score (GS) 7-10 cancer, positive predictive value (PPV) and negative (NPV) predictive value (±95 % confidence intervals) were calculated and compared by Fisher's exact test. Disagreement between initial and tertiary centre second-opinion reports was observed in 54 % of cases (86/158). MRIs had a higher NPV for GS 7-10 in tertiary centre reads compared to initial reports (0.89 ± 0.08 vs 0.72 ± 0.16; p = 0.04), and a higher PPV in the target area for all cancer (0.61 ± 0.12 vs 0.28 ± 0.10; p = 0.01) and GS 7-10 cancer (0.43 ± 0.12 vs 0.2 3 ± 0.09; p = 0.02). For equivocal suspicion, the PPV for GS 7-10 was 0.12 ± 0.11 for tertiary centre and 0.11 ± 0.09 for initial reads; p = 1.00. Second readings of prostate MRI by subspecialised uroradiologists at a tertiary centre significantly improved both NPV and PPV. Reporter experience may help to reduce overcalling and avoid overtargeting of lesions. (orig.)

  20. Repeat prenatal corticosteroid prior to preterm birth: a systematic review and individual participant data meta-analysis for the PRECISE study group (prenatal repeat corticosteroid international IPD study group: assessing the effects using the best level of evidence - study protocol

    Directory of Open Access Journals (Sweden)

    Crowther Caroline A

    2012-02-01

    Full Text Available Abstract Background The aim of this individual participant data (IPD meta-analysis is to assess whether the effects of repeat prenatal corticosteroid treatment given to women at risk of preterm birth to benefit their babies are modified in a clinically meaningful way by factors related to the women or the trial protocol. Methods/Design The Prenatal Repeat Corticosteroid International IPD Study Group: assessing the effects using the best level of Evidence (PRECISE Group will conduct an IPD meta-analysis. The PRECISE International Collaborative Group was formed in 2010 and data collection commenced in 2011. Eleven trials with up to 5,000 women and 6,000 infants are eligible for the PRECISE IPD meta-analysis. The primary study outcomes for the infants will be serious neonatal outcome (defined by the PRECISE International IPD Study Group as one of death (foetal, neonatal or infant; severe respiratory disease; severe intraventricular haemorrhage (grade 3 and 4; chronic lung disease; necrotising enterocolitis; serious retinopathy of prematurity; and cystic periventricular leukomalacia; use of respiratory support (defined as mechanical ventilation or continuous positive airways pressure or other respiratory support; and birth weight (Z-scores. For the children, the primary study outcomes will be death or any neurological disability (however defined by trialists at childhood follow up and may include developmental delay or intellectual impairment (developmental quotient or intelligence quotient more than one standard deviation below the mean, cerebral palsy (abnormality of tone with motor dysfunction, blindness (for example, corrected visual acuity worse than 6/60 in the better eye or deafness (for example, hearing loss requiring amplification or worse. For the women, the primary outcome will be maternal sepsis (defined as chorioamnionitis; pyrexia after trial entry requiring the use of antibiotics; puerperal sepsis; intrapartum fever requiring the use

  1. Evaluation of a repeated dose liver micronucleus assay in rats treated with two genotoxic hepatocarcinogens, dimethylnitrosamine and 2-acetylaminofluorene: the possibility of integrating micronucleus tests with multiple tissues into a repeated dose general toxicity study.

    Science.gov (United States)

    Takashima, Rie; Takasawa, Hironao; Kawasako, Kazufumi; Ohyama, Wakako; Okada, Emiko; Narumi, Kazunori; Fujiishi, Yohei; Wako, Yumi; Yasunaga, Katsuaki; Hattori, Akiko; Kawabata, Masayoshi; Nakadate, Kiyoko; Nakagawa, Munehiro; Hamada, Shuichi

    2015-03-01

    As part of a collaborative study by the Collaborative Study Group for Micronucleus Test (CSGMT) of the Mammalian Mutagenicity Study Group (MMS) in the Japanese Environmental Mutagen Society (JEMS), the present study evaluated the effectiveness of the repeated dose liver micronucleus (RDLMN) assay. Two genotoxic hepatocarcinogens, dimethylnitrosamine (DMN) and 2-acetylaminofluorene (2-AAF), were administered orally to male rats (6 weeks old at the initial dosing) once daily for 14 and 28 days to evaluate the micronucleus (MN) inducibility in the liver. In addition, these chemicals were evaluated for MN inducibility in the bone marrow (BM) and gastrointestinal (GI) tract, i.e. glandular stomach and colon of the same animals used in the RDLMN assay. As a result, both chemicals produced positive results in the liver, although a weak positive response was given by 2-AAF. DMN gave negative results in the tissues other than the liver. 2-AAF produced positive responses in the BM and glandular stomach, and a prominent response was particularly observed in the glandular stomach, which is directly exposed to the test chemicals by gavage. The present results suggest that the RDLMN assay is a useful method for detecting genotoxic hepatocarcinogens, and that it is especially effective for evaluating test chemicals, such as DMN, undetectable by the BM and GI tract MN assay. Moreover, the results in this investigation indicate that the use of multiple tissues in the study integrating the MN tests is more effective than using a single tissue, for detection of the MN induction produced by chemical exposure to rats, and helps to determine the characteristics of the test chemicals.

  2. Global teaching and training initiatives for emerging cohort studies.

    Science.gov (United States)

    Paulus, Jessica K; Santoyo-Vistrain, Rocío; Havelick, David; Cohen, Amy; Kalyesubula, Robert; Ajayi, Ikeoluwapo O; Mattsson, Jens G; Adami, Hans-Olov; Dalal, Shona

    2012-09-01

    A striking disparity exists across the globe, with essentially no large-scale longitudinal studies ongoing in regions that will be significantly affected by the oncoming non-communicable disease epidemic. The successful implementation of cohort studies in most low-resource research environments presents unique challenges that may be aided by coordinated training programs. Leaders of emerging cohort studies attending the First World Cohort Integration Workshop were surveyed about training priorities, unmet needs and potential cross-cohort solutions to these barriers through an electronic pre-workshop questionnaire and focus groups. Cohort studies representing India, Mexico, Nigeria, South Africa, Sweden, Tanzania and Uganda described similar training needs, including on-the-job training, data analysis software instruction, and database and bio-bank management. A lack of funding and protected time for training activities were commonly identified constraints. Proposed solutions include a collaborative cross-cohort teaching platform with web-based content and interactive teaching methods for a range of research personnel. An international network for research mentorship and idea exchange, and modifying the graduate thesis structure were also identified as key initiatives. Cross-cohort integrated educational initiatives will efficiently meet shared needs, catalyze the development of emerging cohorts, speed closure of the global disparity in cohort research, and may fortify scientific capacity development in low-resource settings.

  3. Beacon Communities’ Public Health Initiatives: A Case Study Analysis

    Science.gov (United States)

    Massoudi, Barbara L.; Marcial, Laura H.; Haque, Saira; Bailey, Robert; Chester, Kelley; Cunningham, Shellery; Riley, Amanda; Soper, Paula

    2014-01-01

    Introduction: The Beacon Communities for Public Health (BCPH) project was launched in 2011 to gain a better understanding of the range of activities currently being conducted in population- and public health by the Beacon Communities. The project highlighted the successes and challenges of these efforts with the aim of sharing this information broadly among the public health community. Background: The Beacon Community Program, designed to showcase technology-enabled, community-based initiatives to improve outcomes, focused on: building and strengthening health information technology (IT) infrastructure and exchange capabilities; translating investments in health IT to measureable improvements in cost, quality, and population health; and, developing innovative approaches to performance measurement, technology, and care delivery. Methods: Four multimethod case studies were conducted based on a modified sociotechnical framework to learn more about public health initiative implementation and use in the Beacon Communities. Our methodological approach included using document review and semistructured key informant interviews. NACCHO Model Practice Program criteria were used to select the public health initiatives included in the case studies. Findings: Despite differences among the case studies, common barriers and facilitators were found to be present in all areas of the sociotechnical framework application including structure, people, technology, tasks, overarching considerations, and sustainability. Overall, there were many more facilitators (range = 7–14) present for each Beacon compared to barriers (range = 4–6). Discussion: Four influential promising practices were identified through the work: forging strong and sustainable partnerships; ensuring a good task-technology fit and a flexible and iterative design; fostering technology acceptance; and, providing education and demonstrating value. Conclusions: A common weakness was the lack of a framework or model for

  4. Beacon communities' public health initiatives: a case study analysis.

    Science.gov (United States)

    Massoudi, Barbara L; Marcial, Laura H; Haque, Saira; Bailey, Robert; Chester, Kelley; Cunningham, Shellery; Riley, Amanda; Soper, Paula

    2014-01-01

    The Beacon Communities for Public Health (BCPH) project was launched in 2011 to gain a better understanding of the range of activities currently being conducted in population- and public health by the Beacon Communities. The project highlighted the successes and challenges of these efforts with the aim of sharing this information broadly among the public health community. The Beacon Community Program, designed to showcase technology-enabled, community-based initiatives to improve outcomes, focused on: building and strengthening health information technology (IT) infrastructure and exchange capabilities; translating investments in health IT to measureable improvements in cost, quality, and population health; and, developing innovative approaches to performance measurement, technology, and care delivery. Four multimethod case studies were conducted based on a modified sociotechnical framework to learn more about public health initiative implementation and use in the Beacon Communities. Our methodological approach included using document review and semistructured key informant interviews. NACCHO Model Practice Program criteria were used to select the public health initiatives included in the case studies. Despite differences among the case studies, common barriers and facilitators were found to be present in all areas of the sociotechnical framework application including structure, people, technology, tasks, overarching considerations, and sustainability. Overall, there were many more facilitators (range = 7-14) present for each Beacon compared to barriers (range = 4-6). Four influential promising practices were identified through the work: forging strong and sustainable partnerships; ensuring a good task-technology fit and a flexible and iterative design; fostering technology acceptance; and, providing education and demonstrating value. A common weakness was the lack of a framework or model for the Beacon Communities evaluation work. Sharing a framework or approach

  5. Study of initial stage of mechanochemical transformation in pyrite

    Directory of Open Access Journals (Sweden)

    Paneva D.

    2007-01-01

    Full Text Available The initial stage of transformation of pyrite to Fe(II-sulfate as a result of mechanical milling is studied by X-ray powder diffraction (XRD, Moessbauer spectroscopy (MS, Infrared (IR and X-ray photoelectron spectroscopy (XPS techniques. A degree of conversion of 0.071 is achieved in the time interval of 0 36 min. The kinetic data satisfy the equation of a shrinking core reaction 1-(1-α1/3=kt. The reaction is of the first order. The calculated rate constant is k=6.434.10-4 min-1. .

  6. Uncontrolled variables in frying studies: differences in repeatability between thermoxidation and frying experiments

    Directory of Open Access Journals (Sweden)

    Dobarganes, Carmen

    2007-09-01

    Full Text Available Palm oil, soybean oil and partially hydrogenated soybean oil were used to define the repeatability of oil degradation under thermoxidation in the absence of food and during the frying of potatoes. Total polar compounds and their constituent polymeric triglycerides, oxidized monomeric triglycerides and diglycerides were analyzed. The oils were thermoxidized under standard conditions in a Rancimat apparatus at 180 °C for 25 hours. Discontinuous frying experiments were carried out in triplicate in three apparently identical domestic fryers. Five batches of potatoes were fried per day in each fryer. Oils were heated at 180 °C in periods of 5 h per day during 5 consecutive days so that the total heating period was 25 h. Repeatability was high in the thermoxidation assays and rather low in the frying experiments. Significant differences between the oils were found in the thermoxidation experiments, while no significant differences were found in the frying assays due to large standard deviations. The participation of variables related to the fryer performance which are difficult to control, was deduced. Among them, differences in the heating/cooling cycles at high temperature might be important. The contribution of fryer performance to the decreased repeatability was confirmed in further frying experiments with palm oil. Results showed that repeatability for the same fryer was higher than that obtained when different fryers were considered.Se estudia la repetibilidad de los resultados obtenidos en el calentamiento de los aceites y grasas a temperatura elevada utilizando aceite de palma, aceite de soja y aceite de soja parcialmente hidrogenado. Partiendo de la repetibilidad de las determinaciones analíticas utilizadas para la evaluación de la degradación de los aceites y grasas a elevada temperatura, el análisis de compuestos polares y de su distribución en polímeros de triglicéridos, triglicéridos monómeros oxidados y diglicéridos, se

  7. The Pittsburgh Girls Studies: Overview and Initial Findings

    Science.gov (United States)

    Keenan, Kate; Hipwell, Alison; Chung, Tammy; Stepp, Stephanie; Stouthamer-Loeber, Magda; Loeber, Rolf; McTigue, Kathleen

    2010-01-01

    The Pittsburgh Girls Study is a longitudinal, community–based study of 2,451 girls who were initially recruited when they were between the ages of 5 and 8 years. The primary aim of the study was testing developmental models of conduct disorder (CD), major depressive disorder (MDD), and their co-occurrence in girls. In the current paper, we summarize the published findings from the past 5 years of the PGS and place those results in the context of what it known to date about developmental psychopathology in girls. Key results suggest that DSM-IV mental disorders tend to have an insidious onset often beginning with sub-syndromal symptom manifestation and that there appear to be shared and unique developmental precursors to disorder in subgroups of girls based on race and poverty. PMID:20589562

  8. Use of short tandem repeat sequences to study Mycobacterium leprae in leprosy patients in Malawi and India.

    Directory of Open Access Journals (Sweden)

    Saroj K Young

    2008-04-01

    Full Text Available Inadequate understanding of the transmission of Mycobacterium leprae makes it difficult to predict the impact of leprosy control interventions. Genotypic tests that allow tracking of individual bacterial strains would strengthen epidemiological studies and contribute to our understanding of the disease.Genotyping assays based on variation in the copy number of short tandem repeat sequences were applied to biopsies collected in population-based epidemiological studies of leprosy in northern Malawi, and from members of multi-case households in Hyderabad, India. In the Malawi series, considerable genotypic variability was observed between patients, and also within patients, when isolates were collected at different times or from different tissues. Less within-patient variability was observed when isolates were collected from similar tissues at the same time. Less genotypic variability was noted amongst the closely related Indian patients than in the Malawi series.Lineages of M. leprae undergo changes in their pattern of short tandem repeat sequences over time. Genetic divergence is particularly likely between bacilli inhabiting different (e.g., skin and nerve tissues. Such variability makes short tandem repeat sequences unsuitable as a general tool for population-based strain typing of M. leprae, or for distinguishing relapse from reinfection. Careful use of these markers may provide insights into the development of disease within individuals and for tracking of short transmission chains.

  9. Revisiting the TALE repeat.

    Science.gov (United States)

    Deng, Dong; Yan, Chuangye; Wu, Jianping; Pan, Xiaojing; Yan, Nieng

    2014-04-01

    Transcription activator-like (TAL) effectors specifically bind to double stranded (ds) DNA through a central domain of tandem repeats. Each TAL effector (TALE) repeat comprises 33-35 amino acids and recognizes one specific DNA base through a highly variable residue at a fixed position in the repeat. Structural studies have revealed the molecular basis of DNA recognition by TALE repeats. Examination of the overall structure reveals that the basic building block of TALE protein, namely a helical hairpin, is one-helix shifted from the previously defined TALE motif. Here we wish to suggest a structure-based re-demarcation of the TALE repeat which starts with the residues that bind to the DNA backbone phosphate and concludes with the base-recognition hyper-variable residue. This new numbering system is consistent with the α-solenoid superfamily to which TALE belongs, and reflects the structural integrity of TAL effectors. In addition, it confers integral number of TALE repeats that matches the number of bound DNA bases. We then present fifteen crystal structures of engineered dHax3 variants in complex with target DNA molecules, which elucidate the structural basis for the recognition of bases adenine (A) and guanine (G) by reported or uncharacterized TALE codes. Finally, we analyzed the sequence-structure correlation of the amino acid residues within a TALE repeat. The structural analyses reported here may advance the mechanistic understanding of TALE proteins and facilitate the design of TALEN with improved affinity and specificity.

  10. Initial Feasibility Study to Drill and Core the Ocean Mantle

    Directory of Open Access Journals (Sweden)

    Nicolas Pilisi

    2011-09-01

    Full Text Available An initial feasibility study (Pilisi and Whitney, 2011 of drilling through the Mohorovičić discontinuity (Moho into the oceanic mantle specifically focused on future requirements for planning, drilling and coring a hole 500 m into the oceanic mantle from three candidate locations in the Pacific Ocean (Cocos Plate, Baja California, and offshore Hawaii. The study points out some of the critical issues that need to be resolved before embarking upon such a challengingproject. It was conducted on the basis of data provided by the Integrated Ocean Drilling Program–Management International (IODP-MI, the Center for Deep Earth Exploration (CDEX operating the drilling vessel Chikyu within IODP, public domain information, and past experience that Blade Energy Partners (hereafter mentioned as “Blade”; http://www.blade-energy.com/ has had with frontier projects in the offshore deepwater oil and gas and geothermal industries.

  11. Initial Development and Pilot Study Design of Interactive Lecture Demonstrations for ASTRO 101

    Science.gov (United States)

    Schwortz, Andria C.; French, D. A; Gutierrez, Joseph V; Sanchez, Richard L; Slater, Timothy F.; Tatge, Coty

    2014-06-01

    Interactive lecture demonstrations (ILDs) have repeatedly shown to be effective tools for improving student achievement in the context of learning physics. As a first step toward systematic development of interactive lecture demonstrations in ASTRO 101, the introductory astronomy survey course, a systematic review of education research, describing educational computer simulations (ECSs) reveals that initial development requires a targeted study of how ASTRO 101 students respond to ECSs in the non-science majoring undergraduate lecture setting. In this project we have adopted the process by which ILDs were designed, pilot-tested, and successfully implemented in the context of physics teaching (Sokoloff & Thornton, 1997; Sokoloff & Thornton, 2004). We have designed the initial pilot-test set of ASTRO 101 ILD instructional materials relying heavily on ECSs. Both an instructor’s manual and a preliminary classroom-ready student workbook have been developed, and we are implementing a pilot study to explore their effectiveness in communicating scientific content, and the extent to which they might enhance students’ knowledge of and perception about astronomy and science in general. The study design uses a pre-/post-test quasi-experimental study design measuring students’ normalized gain scores, calculated as per Hake (1998) and Prather (2009), using a slightly modified version of S. Slater’s (2011) Test Of Astronomy STandards TOAST combined with other instruments. The results of this initial study will guide the iterative development of ASTRO 101 ILDs that are intended to both be effective at enhancing student achievement and easy for instructors to successfully implement.

  12. Spa Goers' Repeated Visits for Health and Wellness and the Influential Factors: An Exploratory Study of the UK Spa Goers.

    Science.gov (United States)

    Choi, Myungsuk; Poade, Donna; Sohn, Minsung; Choi, Mankyu

    2016-01-01

    Dissemination of spa services across the globe and its market saturation drive demand for differentiated communication methods. This study aims to explore the influential factors on spa goers' repeated visits and their practical applications in the health and wellness spa industry. The identified factors were used as the measurement variables to examine the relation with spa goers' repeated visits. The proposed concept was tested by a mixed method combining a self-administered questionnaire and semistructured interview with 54 survey participants and 6 interviewees. It was meaningful to use a sample of the UK spa goers from the southwest region since global spa trends stem from the EU spas, and the United Kingdom is one of the market leaders. The data were analyzed using frequency, percentage, multiple logistic regression analysis, and coding process. The survey findings demonstrated that the most significant influential factor on the repeated spa visits is a memorable experience of which showed 13.7 times higher probability than the reference up-to-date facility. The details of memorable experiences were discovered throughout the interviews that include the rediscovery of self, feeling of connectedness, recharge for positive emotions, self-reward through escapism, and experience of noncommercialized local products and attractions. Therefore, using experiential marketing methods can be effective spa service marketing.

  13. The prodromal phase of leucine-rich repeat kinase 2-associated Parkinson disease: Clinical and imaging Studies.

    Science.gov (United States)

    Pont-Sunyer, Claustre; Tolosa, Eduardo; Caspell-Garcia, Chelsea; Coffey, Christopher; Alcalay, Roy N; Chan, Piu; Duda, John E; Facheris, Maurizio; Fernández-Santiago, Rubén; Marek, Kenneth; Lomeña, Francisco; Marras, Connie; Mondragon, Elisabet; Saunders-Pullman, Rachel; Waro, Bjorg

    2017-05-01

    Asymptomatic, nonmanifesting carriers of leucine-rich repeat kinase 2 mutations are at increased risk of developing PD. Clinical and neuroimaging features may be associated with gene carriage and/or may demarcate individuals at greater risk for phenoconversion to PD. To investigate clinical and dopamine transporter single-photon emission computed tomography imaging characteristics of leucine-rich repeat kinase 2 asymptomatic carriers. A total of 342 carriers' and 259 noncarriers' relatives of G2019S leucine-rich repeat kinase 2/PD patients and 39 carriers' and 31 noncarriers' relatives of R1441G leucine-rich repeat kinase 2/PD patients were evaluated. Motor and nonmotor symptoms were assessed using specific scales and questionnaires. Neuroimaging quantitative data were obtained in 81 carriers and compared with 41 noncarriers. G2019S carriers scored higher in motor scores and had lower radioligand uptake compared to noncarriers, but no differences in nonmotor symptoms scores were observed. R1441G carriers scored higher in motor scores, had lower radioligand uptake, and had higher scores in depression, dysautonomia, and Rapid Eye Movements Sleep Behavior Disorder Screening Questionnaire scores, but had better cognition scores than noncarriers. Among G2019S carriers, a group with "mild motor signs" was identified, and was significantly older, with worse olfaction and lower radioligand uptake. G2019S and R1441G carriers differ from their noncarriers' relatives in higher motor scores and slightly lower radioligand uptake. Nonmotor symptoms were mild, and different nonmotor profiles were observed in G2019S carriers compared to R1441G carriers. A group of G2019S carriers with known prodromal features was identified. Longitudinal studies are required to determine whether such individuals are at short-term risk of developing overt parkinsonism. © 2017 International Parkinson and Movement Disorder Society. © 2017 International Parkinson and Movement Disorder Society.

  14. Variability in prefrontal hemodynamic response during exposure to repeated self-selected music excerpts, a near-infrared spectroscopy study.

    Directory of Open Access Journals (Sweden)

    Saba Moghimi

    Full Text Available Music-induced brain activity modulations in areas involved in emotion regulation may be useful in achieving therapeutic outcomes. Clinical applications of music may involve prolonged or repeated exposures to music. However, the variability of the observed brain activity patterns in repeated exposures to music is not well understood. We hypothesized that multiple exposures to the same music would elicit more consistent activity patterns than exposure to different music. In this study, the temporal and spatial variability of cerebral prefrontal hemodynamic response was investigated across multiple exposures to self-selected musical excerpts in 10 healthy adults. The hemodynamic changes were measured using prefrontal cortex near infrared spectroscopy and represented by instantaneous phase values. Based on spatial and temporal characteristics of these observed hemodynamic changes, we defined a consistency index to represent variability across these domains. The consistency index across repeated exposures to the same piece of music was compared to the consistency index corresponding to prefrontal activity from randomly matched non-identical musical excerpts. Consistency indexes were significantly different for identical versus non-identical musical excerpts when comparing a subset of repetitions. When all four exposures were compared, no significant difference was observed between the consistency indexes of randomly matched non-identical musical excerpts and the consistency index corresponding to repetitions of the same musical excerpts. This observation suggests the existence of only partial consistency between repeated exposures to the same musical excerpt, which may stem from the role of the prefrontal cortex in regulating other cognitive and emotional processes.

  15. PCR bias in amplification of androgen receptor alleles, a trinucleotide repeat marker used in clonality studies.

    Science.gov (United States)

    Mutter, G L; Boynton, K A

    1995-04-25

    Trinucleotide CAG repeats in the X-linked human androgen receptor gene (HUMARA) have proved a useful means of determining X chromosome haplotypes, and when combined with methylation analysis of nearby cytosine residues permits identification of non-random X inactivation in tumors of women. Co-amplification of two alleles in a heterozygote generates PCR products which differ in the number of CAG units, and thus their melting and secondary structure characteristics. We have shown that under optimal conditions amplification efficiency of two HUMARA alleles is near-equivalent, generating PCR products in a ratio proportional to that of the genomic template. In contrast, reduction of template quantity, damage of template by ultraviolet irradiation or addition of monovalent salts (sodium chloride, sodium acetate or ammonium acetate) produces highly variable imbalances of allelic PCR products, with a strong tendency to preferentially amplify lower molecular weight alleles. Variability and biasing was diminished by substitution of 7-deaza-2'-dGTP for dGTP during amplification, an intervention which reduces stability of intramolecular and intermolecular GC base pairing. We conclude that DNA which is scanty, damaged or salt contaminated may display amplification bias of GC-rich PCR targets, potentially confounding accurate interpretation or reproducibility of assays which require co-amplification of alleles.

  16. Analyzing repeated measures semi-continuous data, with application to an alcohol dependence study.

    Science.gov (United States)

    Liu, Lei; Strawderman, Robert L; Johnson, Bankole A; O'Quigley, John M

    2016-02-01

    Two-part random effects models (Olsen and Schafer,(1) Tooze et al.(2)) have been applied to repeated measures of semi-continuous data, characterized by a mixture of a substantial proportion of zero values and a skewed distribution of positive values. In the original formulation of this model, the natural logarithm of the positive values is assumed to follow a normal distribution with a constant variance parameter. In this article, we review and consider three extensions of this model, allowing the positive values to follow (a) a generalized gamma distribution, (b) a log-skew-normal distribution, and (c) a normal distribution after the Box-Cox transformation. We allow for the possibility of heteroscedasticity. Maximum likelihood estimation is shown to be conveniently implemented in SAS Proc NLMIXED. The performance of the methods is compared through applications to daily drinking records in a secondary data analysis from a randomized controlled trial of topiramate for alcohol dependence treatment. We find that all three models provide a significantly better fit than the log-normal model, and there exists strong evidence for heteroscedasticity. We also compare the three models by the likelihood ratio tests for non-nested hypotheses (Vuong(3)). The results suggest that the generalized gamma distribution provides the best fit, though no statistically significant differences are found in pairwise model comparisons.

  17. NMR studies on domain diffusion and alignment in modular GB1 repeats.

    Science.gov (United States)

    Walsh, Joseph D; Meier, Katlyn; Ishima, Rieko; Gronenborn, Angela M

    2010-10-20

    Modular proteins contain individual domains that are often connected by flexible, unstructured linkers. Using a model system based on the GB1 domain, we constructed tandem repeat proteins and investigated the rotational diffusion and long-range angular ordering behavior of individual domains by measuring NMR relaxation parameters and residual dipolar couplings. Although they display almost identical protein-solvent interfaces, each domain exhibits distinct rotational diffusion and alignment properties. The diffusion tensor anisotropy of the N-terminal domain (NTD) is D(‖)/D(⊥) = 1.5-1.6, similar to that of single-GB1 domains (D(‖)/D(⊥) = 1.6-1.7), whereas the value for the C-terminal domain (CTD) is D(‖)/D(⊥) = 2.0-2.2. In addition, the two domains have different rotational correlation times. These effects are observed for linkers of three to 24 residues, irrespective of linker length. The NTD and CTD also differ in their degree of magnetic alignment, even with a flexible linker of 18 residues, exhibiting D(a) values of 7.7 Hz and 9.7 Hz, respectively. Our results suggest that diffusion differences and long-range influences may persist in modular protein systems, even for systems that have highly flexible linkers and exhibit no domain-domain or domain-linker interactions.

  18. Does sequential embryo transfer improve pregnancy rate in patients with repeated implantation failure? A randomized control study

    Directory of Open Access Journals (Sweden)

    Wael A. Ismail Madkour

    2015-12-01

    Full Text Available Background: Repeated failure of in vitro fertilization treatment is frustrating to the patients and their clinicians. Various treatment plans and a change of protocol have been suggested for “low responders”; however, patients who fail treatment repeatedly inspite of good quality embryos pose a special therapeutic challenge. Additional challenge would be imposed on that particular group when the local IVF regulating low does not permit surplus embryo freezing. Objective: To examine whether sequential transfer of embryos on day 3 and on day 5 after ovum pick-up improves IVF/ET success rates in patients with repeated consecutive IVF failures (⩾ 3 trials compared to day 3 alone, with the background that local regulation prohibits embryo freezing. Study design: Randomized controlled study. Women scheduled for IVF/ET with repeated consecutive IVF failures (⩾ 3 trials were randomized to either sequential transfer of embryos on day 3 and on day 5 after ovum pick-up (Group I = 74 or conventional day 3 transfer (Group II = 73 as a control. The primary outcome measures were clinical pregnancy rate and implantation rate. The secondary outcome measures were ongoing pregnancy rate and early pregnancy loss. Results: Baseline and cycle characteristics were comparable in both groups. Clinical pregnancy rate (per embryo transfer was significantly higher in sequential ET group (37. 8% compared to that in day 3 group (21.9% (P value <0.05. Also, implantation rate (per embryos transferred was significantly higher in sequential ET group (17.1% compared to that in control group (10.5% (P value <0.01. Similarly, ongoing pregnancy (per embryo transfer was significantly higher in sequential ET group (33. 8% compared to that in day 3 group (19.2% (P value <0.05. Conclusions: Patients with repeated implantation failures, treatment with the sequential embryo transfer approach had significantly improved pregnancy outcomes compared to regular day 3 transfers

  19. Initial teacher education in Japan and Spain. A comparative study

    Directory of Open Access Journals (Sweden)

    Eva Ramírez Carpeño

    2015-06-01

    Full Text Available The purpose of this article is to examine, from a comparative perspective, the initial teacher training systems in Spain and Japan. We will analyze the current design of teacher educational programs, from Infant level to Secondary level. The relevance of teacher performances has been endorsed by several studies, placing international attention on teachers’ training policies. The results show similar trends relating to programs’ structure and students’ selection. Nevertheless, there are many differences when analyzing duration, flexibility or accreditation, which could provided us with key elements to reflect upon our own educational context. Such reflections could contribute to the improvement of our teachers’ training systems, the promotion of theoretical and practical development on educational policies, and a higher quality of educational practices. 

  20. An ERP study on initial second language vocabulary learning.

    Science.gov (United States)

    Yum, Yen Na; Midgley, Katherine J; Holcomb, Phillip J; Grainger, Jonathan

    2014-04-01

    This study examined the very initial phases of orthographic and semantic acquisition in monolingual native English speakers learning Chinese words under controlled laboratory conditions. Participants engaged in 10 sessions of vocabulary learning, four of which were used to obtain ERPs. Performance in behavioral tests improved over sessions, and these data were used to define fast and slow learners. Most important is that ERPs in the two groups of learners revealed qualitatively distinct learning patterns. Only fast learners showed a left-lateralized increase in N170 amplitude with training. Furthermore, only fast learners showed an increased N400 amplitude with training, with a distinct anterior distribution. Slow learners, on the other hand, showed a posterior positive effect, with increasingly positive-going waveforms in occipital sites as training progressed. Possible mechanisms underlying these qualitative differences are discussed.

  1. Repeat Testing Effects on Credentialing Exams: Are Repeaters Misinformed or Uninformed?

    Science.gov (United States)

    Feinberg, Richard A.; Raymond, Mark R.; Haist, Steven A.

    2015-01-01

    To mitigate security concerns and unfair score gains, credentialing programs routinely administer new test material to examinees retesting after an initial failing attempt. Counterintuitively, a small but growing body of recent research suggests that repeating the identical form does not create an unfair advantage. This study builds upon and…

  2. GSTM1 and APE1 genotypes affect arsenic-induced oxidative stress: a repeated measures study

    Directory of Open Access Journals (Sweden)

    Quamruzzaman Quazi

    2007-12-01

    Full Text Available Abstract Background Chronic arsenic exposure is associated with an increased risk of skin, bladder and lung cancers. Generation of oxidative stress may contribute to arsenic carcinogenesis. Methods To investigate the association between arsenic exposure and oxidative stress, urinary 8-hydroxy-2'-deoxyguanosine (8-OHdG was evaluated in a cohort of 97 women recruited from an arsenic-endemic region of Bangladesh in 2003. Arsenic exposure was measured in urine, toenails, and drinking water. Drinking water and urine samples were collected on three consecutive days. Susceptibility to oxidative stress was evaluated by genotyping relevant polymorphisms in glutathione-s transferase mu (GSTM1, human 8-oxoguanine glycosylase (hOGG1 and apurinic/apyrimidinic endonuclease (APE1 genes using the Taqman method. Data were analyzed using random effects Tobit regression to account for repeated measures and 8-OHdG values below the detection limit. Results A consistent negative effect for APE1 was observed across water, toenail and urinary arsenic models. APE1 148 glu/glu + asp/glu genotype was associated with a decrease in logged 8-OHdG of 0.40 (95%CI -0.73, -0.07 compared to APE1 148 asp/asp. An association between total urinary arsenic and 8-OHdG was observed among women with the GSTM1 null genotype but not in women with GSTM1 positive. Among women with GSTM1 null, a comparison of the second, third, and fourth quartiles of total urinary arsenic to the first quartile resulted in a 0.84 increase (95% CI 0.27, 1.42, a 0.98 increase (95% CI 033, 1.66 and a 0.85 increase (95% CI 0.27, 1.44 in logged 8-OHdG, respectively. No effects between 8-OHdG and toenail arsenic or drinking water arsenic were observed. Conclusion These results suggest the APE1 variant genotype decreases repair of 8-OHdG and that arsenic exposure is associated with oxidative stress in women who lack a functional GSTM1 detoxification enzyme.

  3. Big Earth Data Initiative: Metadata Improvement: Case Studies

    Science.gov (United States)

    Kozimor, John; Habermann, Ted; Farley, John

    2016-01-01

    Big Earth Data Initiative (BEDI) The Big Earth Data Initiative (BEDI) invests in standardizing and optimizing the collection, management and delivery of U.S. Government's civil Earth observation data to improve discovery, access use, and understanding of Earth observations by the broader user community. Complete and consistent standard metadata helps address all three goals.

  4. Porous HMX initiation studies -- Sugar as an inert simulant

    Energy Technology Data Exchange (ETDEWEB)

    Sheffield, S.A.; Gustavsen, R.L.; Alcon, R.R.

    1997-11-01

    For several years the authors have been using magnetic particle velocity gauges to study the shock loading of porous HMX (65 and 73% TMD) of different particle sizes to determine their compaction and initiation characteristics. Because it has been difficult to separate the effects of compaction and reaction, an inert simulant was needed with properties similar to HMX. Sugar was selected as the simulant for several reasons: (1) the particle size distribution of C and H granulated sugar is similar to the coarse HMX the authors have been using (120 {micro}m average size), (2) the particle size of C and H confectioners (powdered) sugar is similar to the fine HMX in the studies (10 {micro}m average size), (3) it is an organic material, and (4) sugar was readily available. Because the densities of HMX and sugar are somewhat different, the authors chose to do the experiments on sugar compacts at 65 and 73% TMD. As expected, no reaction was observed in the sugar experiments. Compaction wave profiles were similar to those measured earlier for the HMX, i.e., the compaction waves in the coarse sugar were quite disperse while those in the fine sugar were much sharper. This indicates that the compaction wave profiles are controlled by particle size and not reaction. Also, the coarse sugar gauge signals exhibited a great deal of noise, thought to the be result of fracto-emission.

  5. Initial State Radiation Studies at BaBar

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, A.; /Dresden, Tech. U.

    2007-04-16

    We present results from BABAR on events containing a hard radiated photon from the e{sup +}e{sup -} initial state and several exclusive final states. For the {pi}{sup +}{pi}{sup -}{pi}{sup +}{pi}{sup -} final state the cross section is measured for center-of-mass energies from 0.6 to 4.5 GeV. Resonant structures are studied and confirmed to be dominated by the a{sub 1}(1260){pi}, with a contribution from f{sub 2}(1270){rho}(770). Similar studies are shown for {pi}{sup +}{pi}{sup -}K{sup +}K{sup -} and K{sup +}K{sup -}K{sup +}K{sup -} from their respective thresholds up to 4.5 GeV. From the {pi}{sup +}{pi}{sup -}{pi}{sup 0} final state the products of the branching fractions of the {omega} and {phi} mesons have been obtained and the cross section is measured from 1.05 to 3.00 GeV. In addition the J/{psi} branching fractions to all four final states have been measured.

  6. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Yan-Min Ma

    2014-06-01

    Full Text Available This study aimed to investigate the correlations among androgen receptor (AR CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and fifty-three healthy men (aged 22.8 ± 3.1 years were enrolled. The individuals were grouped as CAG short (CAG S if they harbored repeat length of ≤20 or as CAG long (CAG L if their CAG repeat length was >20. Body height/weight, penile length and other parameters were examined and recorded by the specified physicians; CAG repeat polymorphism was determined by the polymerase chain reaction (PCR method; and the serum levels of the sex hormones were detected by radioimmunoassay. Student's t-test or linear regression analysis was used to assess the associations among AR CAG repeat polymorphism, sex hormones and penile length. This investigation showed that the serum total testosterone (T level was positively associated with the AR CAG repeat length (P = 0.01; whereas, no significant correlation of T or AR CAG repeat polymorphism with the penile length was found (P = 0.593. Interestingly, an inverse association was observed between serum prolactin (PRL levels and penile length by linear regression analyses (β= −0.024, P = 0.039, 95% confidence interval (CI: −0.047, 0. Collectively, this study provides the first evidence that serum PRL, but not T or AR CAG repeat polymorphism, is correlated with penile length in the Han adult population from northwestern China.

  7. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China: a cross-sectional study.

    Science.gov (United States)

    Ma, Yan-Min; Wu, Kai-Jie; Ning, Liang; Zeng, Jin; Kou, Bo; Xie, Hong-Jun; Ma, Zhen-Kun; Wang, Xin-Yang; Gong, Yong-Guang; He, Da-Lin

    2014-01-01

    This study aimed to investigate the correlations among androgen receptor (AR) CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and fifty-three healthy men (aged 22.8 ± 3.1 years) were enrolled. The individuals were grouped as CAG short (CAG S ) if they harbored repeat length of ≤ 20 or as CAG long (CAG L ) if their CAG repeat length was >20. Body height/weight, penile length and other parameters were examined and recorded by the specified physicians; CAG repeat polymorphism was determined by the polymerase chain reaction (PCR) method; and the serum levels of the sex hormones were detected by radioimmunoassay. Student's t-test or linear regression analysis was used to assess the associations among AR CAG repeat polymorphism, sex hormones and penile length. This investigation showed that the serum total testosterone (T) level was positively associated with the AR CAG repeat length (P = 0.01); whereas, no significant correlation of T or AR CAG repeat polymorphism with the penile length was found (P = 0.593). Interestingly, an inverse association was observed between serum prolactin (PRL) levels and penile length by linear regression analyses (β= -0.024, P = 0.039, 95% confidence interval (CI): -0.047, 0). Collectively, this study provides the first evidence that serum PRL, but not T or AR CAG repeat polymorphism, is correlated with penile length in the Han adult population from northwestern China.

  8. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China:a cross-sectional study

    Institute of Scientific and Technical Information of China (English)

    YanMin Ma; DaLin He; KaiJie Wu; Liang Ning; Jin Zeng; Bo Kou; HongJun Xie; ZhenKun Ma; XinYang Wang; YongGuang Gong

    2014-01-01

    This study aimed to investigate the correlations among androgen receptor (AR) CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and iffty-three healthy men (aged 22.8 ± 3.1 years) were enrolled. The individuals were grouped as CAG short (CAGS) if they harbored repeat length of≤20 or as CAG long (CAGL) if their CAG repeat length was>20. Body height/weight, penile length and other parameters were examined and recorded by the speciifed physicians;CAG repeat polymorphism was determined by the polymerase chain reaction (PCR) method;and the serum levels of the sex hormones were detected by radioimmunoassay. Student’s t-test or linear regression analysis was used to assess the associations among AR CAG repeat polymorphism, sex hormones and penile length. This investigation showed that the serum total testosterone (T) level was positively associated with the AR CAG repeat length (P= 0.01); whereas, no signiifcant correlation of T or AR CAG repeat polymorphism with the penile length was found (P= 0.593). Interestingly, an inverse association was observed between serum prolactin (PRL) levels and penile length by linear regression analyses (b=-0.024, P= 0.039, 95%conifdence interval (CI):-0.047, 0). Collectively, this study provides the ifrst evidence that serum PRL, but not T or AR CAG repeat polymorphism, is correlated with penile length in the Han adult population from northwestern China.

  9. Fewer adults add salt at the table after initiation of a national salt campaign in the UK: a repeated cross-sectional analysis.

    Science.gov (United States)

    Sutherland, Jennifer; Edwards, Phil; Shankar, Bhavani; Dangour, Alan D

    2013-08-28

    In 2003, the UK Food Standards Agency and the Department of Health began attempts to reduce national salt intakes via reformulation of processed foods and a consumer awareness campaign on the negative impacts of salt on health. The present study uses large nationally representative samples of households in England to assess whether discretionary salt use was affected by the national salt reduction campaign. Large cross-sectional datasets from the Health Survey for England were used to analyse trends in adults adding salt at the table between 1997 and 2007. Since 1997, there has been a steady decline in salt use at the table. Ordinal logistic regression analysis controlling for age, sex, total household income, region, ethnicity and background trends revealed that the reduction in salt use was significantly greater after the campaign (OR 0·58; 95% CI 0·54, 0·63). Women (OR 0·71; 95% CI 0·68, 0·74), non-white ethnic groups (OR 0·69; 95% CI 0·62, 0·77), high-income households (OR 0·75; 95% CI 0·69, 0·82), middle-income households (OR 0·79; 95% CI 0·75, 0·84) and households in central (OR 0·90; 95% CI 0·84, 0·98) or the south of England (OR 0·82; 95% CI 0·77, 0·88) were less likely to add salt at the table. The results extend previous evidence of a beneficial response to the salt campaign by demonstrating the effect on salt use at the table. Future programmatic and research efforts may benefit from targeting specific population groups and improving the evidence base for evaluating the impact of the campaign.

  10. No Improved Performance With Repeated-Sprint Training in Hypoxia Versus Normoxia: A Double-Blind and Crossover Study.

    Science.gov (United States)

    Montero, David; Lundby, Carsten

    2017-02-01

    Few recent studies indicate that short-term repeated-sprint (RS) training in hypoxia (RSH) improves RS performance compared with identical training under normoxic conditions (RSN) in endurance-trained subjects. To determine the effects of RSH against RSN on RS performance under normoxic and moderate hypoxic conditions, using a randomized, doubleblind, crossover experimental design. Fifteen endurance-trained male subjects (age 25 ± 4 y) performed 4 wk of RS training (3 sessions/wk) in normobaric hypoxia (RSH, FiO2 = 13.8%) and normoxia (RSN, FiO2 = 20.9%) in a crossover manner. Before and after completion of training, RS tests were performed on a cycle ergometer with no prior exercise (RSNE), after an incremental exercise test (RSIE), and after a time-trial test (RSTT) in normoxia and hypoxia. Peak power outputs at the incremental exercise test and time-trial performance were unaltered by RSH in normoxia and hypoxia. RS performance was generally enhanced by RSH, as well as RSN, but there were no additional effects of RSH over RSN on peak and mean sprint power output and the number of repeated sprints performed in the RSNE, RSIE, and RSTT trials under normoxic and hypoxic conditions. The present double-blind crossover study indicates that RSH does not improve RS performance compared with RSN in normoxic and hypoxic conditions in endurance-trained subjects. Therefore, caution should be exercised when proposing RSH as an advantageous method to improve exercise performance.

  11. Initial Studies on Alkaloids from Lombok Medicinal Plants

    Directory of Open Access Journals (Sweden)

    John B. Bremner

    2001-01-01

    Full Text Available Initial investigation of medicinal plants from Lombok has resulted in the collection of 100 plant species predicted to have antimicrobial, including antimalarial, properties according to local medicinal uses. These plants represent 49 families and 80 genera; 23% of the plants tested positively for alkaloids. Among the plants testing positive, five have been selected for further investigation involving structure elucidation and antimicrobial testing on the extracted alkaloids. Initial work on structural elucidation of some of the alkaloids is reported briefly.

  12. Study of Updating Initiating Event Frequency using Prognostics

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Hyeonmin; Lee, Sang-Hwan; Park, Jun-seok; Kim, Hyungdae; Chang, Yoon-Suk; Heo, Gyunyoung [Kyung Hee Univ., Yongin (Korea, Republic of)

    2014-10-15

    The Probabilistic Safety Assessment (PSA) model enables to find the relative priority of accident scenarios, weak points in achieving accident prevention or mitigation, and insights to improve those vulnerabilities. Thus, PSA consider realistic calculation for precise and confidence results. However, PSA model still 'conservative' aspects in the procedures of developing a PSA model. One of the sources for the conservatism is caused by the assumption of safety analysis and the estimation of failure frequency. Recently, Surveillance, Diagnosis, and Prognosis (SDP) is a growing trend in applying space and aviation systems in particular. Furthermore, a study dealing with the applicable areas and state-of-the-art status of the SDP in nuclear industry was published. SDP utilizing massive database and information technology among such enabling techniques is worthwhile to be highlighted in terms of the capability of alleviating the conservatism in the conventional PSA. This paper review the concept of integrating PSA and SDP and suggest the updated methodology of Initiating Event (IE) using prognostics. For more detailed, we focus on IE of the Steam Generator Tube Rupture (SGTR) considering tube degradation. This paper is additional research of previous our suggested the research. In this paper, the concept of integrating PSA and SDP are suggested. Prognostics algorithms in SDP are applied at IE, Bes in the Level 1 PSA. As an example, updating SGTR IE and its ageing were considered. Tube ageing were analyzed by using PASTA and Monte Carlo method. After analyzing the tube ageing, conventional SGTR IE were updated by using Bayesian approach. The studied method can help to cover the static and conservatism in PSA.

  13. Drosophila melanogaster As a Model Organism to Study RNA Toxicity of Repeat Expansion-Associated Neurodegenerative and Neuromuscular Diseases

    Science.gov (United States)

    Koon, Alex C.; Chan, Ho Yin Edwin

    2017-01-01

    For nearly a century, the fruit fly, Drosophila melanogaster, has proven to be a valuable tool in our understanding of fundamental biological processes, and has empowered our discoveries, particularly in the field of neuroscience. In recent years, Drosophila has emerged as a model organism for human neurodegenerative and neuromuscular disorders. In this review, we highlight a number of recent studies that utilized the Drosophila model to study repeat-expansion associated diseases (READs), such as polyglutamine diseases, fragile X-associated tremor/ataxia syndrome (FXTAS), myotonic dystrophy type 1 (DM1) and type 2 (DM2), and C9ORF72-associated amyotrophic lateral sclerosis/frontotemporal dementia (C9-ALS/FTD). Discoveries regarding the possible mechanisms of RNA toxicity will be focused here. These studies demonstrate Drosophila as an excellent in vivo model system that can reveal novel mechanistic insights into human disorders, providing the foundation for translational research and therapeutic development. PMID:28377694

  14. 4-Repeat Tauopathy Neuroimaging Initiative - Cycle 2

    Science.gov (United States)

    2016-11-15

    Corticobasal Degeneration (CBD); Corticobasal Syndrome (CBS); Cortical-basal Ganglionic Degeneration (CBGD); Progressive Supranuclear Palsy (PSP); Nonfluent Variant Primary Progressive Aphasia (nfvPPA); Oligosymptomatic/Variant Progressive Supranuclear Palsy (o/vPSP)

  15. Tectonomagnetic study in the seismoactive area of Narmada–Son lineament, central India: Preliminary results on repeat field observations

    Indian Academy of Sciences (India)

    S Y Waghmare; S D Pimprikar; P B Gawali; L Carlo; A G Patil

    2009-06-01

    Repeated measurements of the total geomagnetic field on the five profiles have revealed a picture of stress-induced tectonomagnetic effect in the form of secular variation of the total geomagnetic field in the tectonically and seismically active area of Jabalpur and adjoining areas of the Narmada-Son lineament (NSL),central India.For this experiment,a reference base station was established within the study area at Jabalpur.Using proton precession magnetometers with a sensitivity of 0.1 nT, simultaneous measurements of total geomagnetic field were made annually at the base and all field stations.Five cycles of repeated observations have been performed between 2003 and 2007.For data analysis,a difference method has been applied and the residuals have been calculated as secular variations of the total geomagnetic field with values ranging from ± 0.1nT to about > ± 14.6nT/yr over the different stations.The anomalies in secular variation of the total geomagnetic field may be related to anomalous accumulation of tectonic stresses and tensions on the deep fault zones and crustal blocks due to recent geodynamic processes and active geological inhomogeneities in the NSL.

  16. Multi-laboratory validation study of multilocus variable-number tandem repeat analysis (MLVA) for Salmonella enterica serovar Enteritidis, 2015

    Science.gov (United States)

    Peters, Tansy; Bertrand, Sophie; Björkman, Jonas T; Brandal, Lin T; Brown, Derek J; Erdõsi, Tímea; Heck, Max; Ibrahem, Salha; Johansson, Karin; Kornschober, Christian; Kotila, Saara M; Le Hello, Simon; Lienemann, Taru; Mattheus, Wesley; Nielsen, Eva Møller; Ragimbeau, Catherine; Rumore, Jillian; Sabol, Ashley; Torpdahl, Mia; Trees, Eija; Tuohy, Alma; de Pinna, Elizabeth

    2017-01-01

    Multilocus variable-number tandem repeat analysis (MLVA) is a rapid and reproducible typing method that is an important tool for investigation, as well as detection, of national and multinational outbreaks of a range of food-borne pathogens. Salmonella enterica serovar Enteritidis is the most common Salmonella serovar associated with human salmonellosis in the European Union/European Economic Area and North America. Fourteen laboratories from 13 countries in Europe and North America participated in a validation study for MLVA of S. Enteritidis targeting five loci. Following normalisation of fragment sizes using a set of reference strains, a blinded set of 24 strains with known allele sizes was analysed by each participant. The S. Enteritidis 5-loci MLVA protocol was shown to produce internationally comparable results as more than 90% of the participants reported less than 5% discrepant MLVA profiles. All 14 participating laboratories performed well, even those where experience with this typing method was limited. The raw fragment length data were consistent throughout, and the inter-laboratory validation helped to standardise the conversion of raw data to repeat numbers with at least two countries updating their internal procedures. However, differences in assigned MLVA profiles remain between well-established protocols and should be taken into account when exchanging data. PMID:28277220

  17. Effect of repeated sterilization cycles on the physical properties of scaling instruments: a scanning electron microscopy study.

    Science.gov (United States)

    Porto, Alessandra Nogueira; Borges, Álvaro Henrique; Semenoff-Segundo, Alex; Raslan, Suzane A; Pedro, Fábio Luis Miranda; Jorge, Antônio Olavo Cardoso; Bandeca, Matheus Coelho

    2015-05-01

    Repeated sterilizations cycles cause undesirable alterations in the material properties of the instruments, such as corrosion, alterations in the hardness of the metal and the loss of the cutting sharpness of the instrument. This research examined the effect of repeated dry heat sterilization and autoclaves cycles on carbon steel (CS) and stainless steel (SS) curettes during the scaling and root planning. A total of 77 Gracey curettes were used in this study. Of these, 35 were SS and 42 were CS curettes submitted in different process: Dry heat, autoclave, inhibition of corrosion and autoclave, scaling, root planning and dry heat, scaling, root planning, inhibition of corrosion and autoclave. The inhibition of corrosion used on the carbon curettes (prior to sterilization in the autoclave) was sodium nitrite at 2%. The curettes received 10 consecutive cycles of sterilization and after that the cutting edges were examined in the electronic microscope, at 60 and 100 magnification times. The images were evaluated by three independent examiners, who compared the photographs of each group with the control group. The surface corrosion products and a deterioration of the edges were observed and the results showed that the SS curettes suffered little alteration with sterilization, scaling, root planning whereas the CS curettes were visibly affected by sterilization in the autoclave, but when the inhibition of corrosion was used prior to the sterilization, the oxidation was considerably reduced.

  18. Repeated-Doses Toxicity Study of the Essential Oil of Hyptis martiusii Benth. (Lamiaceae in Swiss Mice

    Directory of Open Access Journals (Sweden)

    Germana Freire Rocha Caldas

    2013-01-01

    Full Text Available Hyptis martiusii Benth. (Lamiaceae is found in abundance in Northeastern Brazil where it is used in traditional medicine to treat gastric disorders. Since there are no studies reporting the toxicity and safety profile of this species, we investigated repeated-doses toxicity of the essential oil of Hyptis martiusii (EOHM. Swiss mice of both sexes were orally treated with EOHM (100 and 500 mg/kg for 30 days, and biochemical, hematological, and morphological parameters were determined. No toxicity signs or deaths were recorded during the treatment with EOHM. The body weight gain was not affected, but there was an occasional variation in water and food consumption among mice of both sexes treated with both doses. The hematological and biochemical profiles did not show significant differences except for a decrease in the MCV and an increase in albumin, but these variations are within the limits described for the species. The microscopic analysis showed changes in liver, kidneys, lungs, and spleen; however, these changes do not have clinical relevance since they varied among the groups, including the control group. The results indicate that the treatment of repeated-doses with the essential oil of Hyptis martiusii showed low toxicity in mice.

  19. Broad and narrow personality traits as markers of one-time and repeated suicide attempts: A population-based study

    Directory of Open Access Journals (Sweden)

    Vitaro Frank

    2008-03-01

    Full Text Available Abstract Background Studying personality traits with the potential to differentiate between individuals engaging in suicide attempts of different degrees of severity could help us to understand the processes underlying the link of personality and nonfatal suicidal behaviours and to identify at-risk groups. One approach may be to examine whether narrow, i.e., lower-order personality traits may be more useful than their underlying, broad personality trait dimensions. Methods We investigated qualitative and quantitative differences in broad and narrow personality traits between one-time and repeated suicide attempters in a longitudinal, population-based sample of young French Canadian adults using two multivariate regression models. Results One broad (Compulsivity: OR = 2.0; 95% CI 1.2–3.5 and one narrow personality trait (anxiousness: OR = 1.1; 95% CI 1.01–1.1 differentiated between individuals with histories of repeated and one-time suicide attempts. Affective instability [(OR = 1.1; 95% CI 1.04–1.1] and anxiousness [(OR = .92; 95% CI .88–.95], on the other hand, differentiated between nonattempters and one-time suicide attempters. Conclusion Emotional and cognitive dysregulation and associated behavioural manifestations may be associated with suicide attempts of different severity. While findings associated with narrow traits may be easier to interpret and link to existing sociobiological theories, larger effect sizes associated with broad traits such as Compulsivity may be better suited to objectives with a more clinical focus.

  20. Initial study of Schroedinger eigenmaps for spectral target detection

    Science.gov (United States)

    Dorado-Munoz, Leidy P.; Messinger, David W.

    2016-08-01

    Spectral target detection refers to the process of searching for a specific material with a known spectrum over a large area containing materials with different spectral signatures. Traditional target detection methods in hyperspectral imagery (HSI) require assuming the data fit some statistical or geometric models and based on the model, to estimate parameters for defining a hypothesis test, where one class (i.e., target class) is chosen over the other classes (i.e., background class). Nonlinear manifold learning methods such as Laplacian eigenmaps (LE) have extensively shown their potential use in HSI processing, specifically in classification or segmentation. Recently, Schroedinger eigenmaps (SE), which is built upon LE, has been introduced as a semisupervised classification method. In SE, the former Laplacian operator is replaced by the Schroedinger operator. The Schroedinger operator includes by definition, a potential term V that steers the transformation in certain directions improving the separability between classes. In this regard, we propose a methodology for target detection that is not based on the traditional schemes and that does not need the estimation of statistical or geometric parameters. This method is based on SE, where the potential term V is taken into consideration to include the prior knowledge about the target class and use it to steer the transformation in directions where the target location in the new space is known and the separability between target and background is augmented. An initial study of how SE can be used in a target detection scheme for HSI is shown here. In-scene pixel and spectral signature detection approaches are presented. The HSI data used comprise various target panels for testing simultaneous detection of multiple objects with different complexities.

  1. Case study: videogame distraction reduces behavioral distress in a preschool-aged child undergoing repeated burn dressing changes: a single-subject design

    National Research Council Canada - National Science Library

    Sil, Soumitri; Dahlquist, Lynnda M; Burns, Andrew J

    2013-01-01

    This single-subject design study evaluated the feasibility and efficacy of passive and interactive videogame distraction on behavioral distress for a preschool-aged child receiving repeated burn dressing changes...

  2. Memory-based quantum repeater in quantum information communication

    Institute of Scientific and Technical Information of China (English)

    Wu Xiang-Sheng

    2004-01-01

    This paper studies the quantum repeater in quantum information communication. We propose to introduce the photon buffer mechanism for storing photons, which uses fibre delay loops as photon memories and a programmable 1 × N switcher for distributing photon delay time. Meanwhile, we also consider entanglement purification and entanglement swapping restoration at an entanglement purification or entanglement swapping failure and introduce a protection link mechanism that allows the photonic quantum repeater of a broken connection to initiate a connection restoration process.

  3. Prevention of eating disorders among minority youth: a matched-sample repeated measures study.

    Science.gov (United States)

    Cook-Cottone, Catherine; Jones, Lakaii A; Haugli, Sara

    2010-01-01

    The purpose of this study was to examine ethnic differences in primary prevention programs for eating disorders in young girls. In order to address the dearth of research in this area, this study examined the comparative response to an eating disorder prevention program on fifth-grade minority and White females. Pre- and post-test data were collected from 10 groups participating in the prevention program for a total of 50 girls. Minority participants and White participants were then matched based on Body Mass Index (BMI) and socioeconomic status in order to examine ethnic differences in group effectiveness. Findings indicated that minority and White participants were equally responsive to the prevention program.

  4. [The study of interaction between paralogous tandem repeats stellate and suppressor of stellate in the genome of Drosophila melanogaster].

    Science.gov (United States)

    Aravin, A A; Naumova, N M; Tulin, A V; Klenov, M S; Gvozdev, V A

    2000-04-01

    Testis-specific expression of tandemly repeated Stellate genes, located in eu- and heterochromatin regions of the X chromosome of Drosophila melanogaster, is suppressed by homologous Suppressor of Stellate repeats located on the Y chromosome. Using transgenic lines, we have demonstrated that three Su(Ste) copies failed to change the expression of the reporter construction carrying the bacterial beta-galactosidase gene under control of the Stellate gene regulatory sequence. Possible mechanisms of the Su(Ste) repeat suppressor activity are discussed.

  5. Discovery, Characterization, and Functional Study of a Novel MEF2D CAG Repeat in Duck (Anas platyrhynchos).

    Science.gov (United States)

    Wang, Yushi; Wang, Jiwen; Liu, Hehe; Zhang, Rongping; Zhang, Tao; Gan, Xiang; Huang, Huilan; Chen, Da; Li, Liang

    2016-08-01

    Myocyte enhancer transcription factor 2D (MEF2D) is an important transcription factor for promoting the growth and development of muscle. CAG repeats have been found in the coding sequence (CDS) of avian MEF2D; however, their functions remain unknown and require further investigation. Here, we examined the characteristics and functional role of MEF2D CAG repeat in duck. The full-length CDS of duck MEF2D was cloned for the first time, and a novel CAG repeat was identified and located in exon 9. Sequence analysis indicated that the protein domains of duck MEF2D are highly conserved relative to other vertebrates, whereas MEF2D CAG repeats with variable repeat numbers are specific to avian species. Furthermore, sequencing has revealed polymorphisms in MEF2D CAG repeat at both DNA and mRNA levels. Four MEF2D CAG repeat genotypes and 10 MEF2D cDNA variants with different CAG repeat numbers were detected in two duck populations. A t-test showed that the expanded CAG repeat generated significantly longer transcription products (p analysis demonstrated positive correlations between the expansion of the CAG repeat and five muscle-related traits. By using protein structure prediction, we suggested that the polymorphisms of the CAG repeat affect protein structures within protein domains. Taken together, these findings reveal that duck MEF2D CAG repeat is a potential functional element with polymorphisms and may cause differences in MEF2D function between duck and other vertebrate species.

  6. Repeated versus wide reading: A randomized control design study examining the impact of fluency interventions on underlying reading behavior.

    Science.gov (United States)

    Ardoin, Scott P; Binder, Katherine S; Foster, Tori E; Zawoyski, Andrea M

    2016-12-01

    Repeated readings (RR) has garnered much attention as an evidence based intervention designed to improve all components of reading fluency (rate, accuracy, prosody, and comprehension). Despite this attention, there is not an abundance of research comparing its effectiveness to other potential interventions. The current study presents the findings from a randomized control trial study involving the assignment of 168second grade students to a RR, wide reading (WR), or business as usual condition. Intervention students were provided with 9-10weeks of intervention with sessions occurring four times per week. Pre- and post-testing were conducted using Woodcock-Johnson III reading achievement measures (Woodcock, McGrew, & Mather, 2001, curriculum-based measurement (CBM) probes, measures of prosody, and measures of students' eye movements when reading. Changes in fluency were also monitored using weekly CBM progress monitoring procedures. Data were collected on the amount of time students spent reading and the number of words read by students during each intervention session. Results indicate substantial gains made by students across conditions, with some measures indicating greater gains by students in the two intervention conditions. Analyses do not indicate that RR was superior to WR. In addition to expanding the RR literature, this study greatly expands research evaluating changes in reading behaviors that occur with improvements in reading fluency. Implications regarding whether schools should provide more opportunities to repeatedly practice the same text (i.e., RR) or practice a wide range of text (i.e., WR) are provided. Copyright © 2016 Society for the Study of School Psychology. Published by Elsevier Ltd. All rights reserved.

  7. The Effect of Image Quality, Repeated Study, and Assessment Method on Anatomy Learning

    Science.gov (United States)

    Fenesi, Barbara; Mackinnon, Chelsea; Cheng, Lucia; Kim, Joseph A.; Wainman, Bruce C.

    2017-01-01

    The use of two-dimensional (2D) images is consistently used to prepare anatomy students for handling real specimen. This study examined whether the quality of 2D images is a critical component in anatomy learning. The visual clarity and consistency of 2D anatomical images was systematically manipulated to produce low-quality and high-quality…

  8. Mouth opening in patients irradiated for head and neck cancer : A prospective repeated measures study

    NARCIS (Netherlands)

    Kamstra, J. I.; Dijkstra, P. U.; van Leeuwen, M.; Roodenburg, J. L. N.; Langendijk, J. A.

    2015-01-01

    Objectives: Aims of this prospective cohort study were (1) to analyze the course of mouth opening up to 48 months post-radiotherapy (RT), (2) to assess risk factors predicting decrease in mouth opening, and (3) to develop a multivariable prediction model for change in mouth opening in a large sample

  9. Mouth opening in patients irradiated for head and neck cancer : A prospective repeated measures study

    NARCIS (Netherlands)

    Kamstra, J. I.; Dijkstra, P. U.; van Leeuwen, M.; Roodenburg, J. L. N.; Langendijk, J. A.

    Objectives: Aims of this prospective cohort study were (1) to analyze the course of mouth opening up to 48 months post-radiotherapy (RT), (2) to assess risk factors predicting decrease in mouth opening, and (3) to develop a multivariable prediction model for change in mouth opening in a large sample

  10. International Mycoplasma pneumoniae typing study: interpretation of M. pneumoniae multilocus variable-number tandem-repeat analysis

    Directory of Open Access Journals (Sweden)

    V.J. Chalker

    2015-09-01

    Full Text Available Typing of Mycoplasma pneumoniae by multiple-locus variable-number tandem repeat analysis (MLVA is increasingly in use. However, no specific internationally agreed guidance is available. Thirty M. pneumoniae DNA samples including serial dilutions of a type strain were sent to six international laboratories to perform MLVA and results were compared. Good correlation was observed, indicating that this methodology can be robustly performed in multiple sites. However, differences due to interpretation of fragment size, repeat sequence identification and repeat numbering led to inconsistency in the final profiles assigned by laboratories. We propose guidelines for interpreting M. pneumoniae MLVA typing and assigning the number of repeats.

  11. URINARY CREATINE AT REST AND AFTER REPEATED SPRINTS IN ATHLETES: A PILOT STUDY

    Directory of Open Access Journals (Sweden)

    I. Bezrati-Benayed

    2014-07-01

    Full Text Available Creatine plays a key role in muscle function and its evaluation is important in athletes. In this study, urinary creatine concentration was measured in order to highlight its possible significance in monitoring sprinters. The study included 51 sprinters and 25 age- and sex-matched untrained subjects as a control group. Body composition was measured and dietary intake estimated. Urine samples were collected before and after standardized physical exercise. Creatine was assessed by gas chromatography mass spectrometry. Basal urinary creatine (UC was significantly lower in sprinters than controls (34±30 vs. 74±3 μmol/mmol creatinine, p<0.05. UC was inversely correlated with body mass (r=-0.34, p<0.01 and lean mass (r=- 0.30, p<0.05, and positively correlated with fat mass (r=0.32, p<0.05. After acute exercise, urinary creatine significantly decreased in both athletes and controls. UC is low in sprinters at rest and further decreases after exercise, most likely due to a high uptake and use of creatine by muscles, as muscle mass and physical activity are supposed to be greater in athletes than untrained subjects. Further studies are needed to test the value of urinary creatine as a non-invasive marker of physical condition and as a parameter for managing Cr supplementation in athletes.

  12. Urinary creatine at rest and after repeated sprints in athletes: a pilot study.

    Science.gov (United States)

    Bezrati-Benayed, I; Nasrallah, F; Feki, M; Chamari, K; Omar, S; Alouane-Trabelsi, L; Ben Mansour, A; Kaabachi, N

    2014-03-01

    Creatine plays a key role in muscle function and its evaluation is important in athletes. In this study, urinary creatine concentration was measured in order to highlight its possible significance in monitoring sprinters. The study included 51 sprinters and 25 age- and sex-matched untrained subjects as a control group. Body composition was measured and dietary intake estimated. Urine samples were collected before and after standardized physical exercise. Creatine was assessed by gas chromatography mass spectrometry. Basal urinary creatine (UC) was significantly lower in sprinters than controls (34±30 vs. 74±3 µmol/mmol creatinine, p sprinters at rest and further decreases after exercise, most likely due to a high uptake and use of creatine by muscles, as muscle mass and physical activity are supposed to be greater in athletes than untrained subjects. Further studies are needed to test the value of urinary creatine as a non-invasive marker of physical condition and as a parameter for managing Cr supplementation in athletes.

  13. A Delphi Study and Initial Validation of Counselor Supervision Competencies

    Science.gov (United States)

    Neuer Colburn, Anita A.; Grothaus, Tim; Hays, Danica G.; Milliken, Tammi

    2016-01-01

    The authors addressed the lack of supervision training standards for doctoral counseling graduates by developing and validating an initial list of supervision competencies. They used content analysis, Delphi polling, and content validity methods to generate a list, vetted by 2 different panels of supervision experts, of 33 competencies grouped…

  14. Washington State Student Achievement Initiative Policy Study: Final Report

    Science.gov (United States)

    Jenkins, Davis; Wachen, John; Moore, Colleen; Shulock, Nancy

    2012-01-01

    In 2007, the Washington State Board for Community and Technical Colleges launched a performance funding policy called the Student Achievement Initiative (SAI) both to improve public accountability by more accurately describing what students achieve from enrolling in community colleges and to provide incentives to colleges through financial rewards…

  15. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China: a cross-sectional study

    OpenAIRE

    Yan-Min Ma; Kai-Jie Wu; Liang Ning; Jin Zeng; Bo Kou; Hong-Jun Xie; Zhen-Kun Ma; Xin-Yang Wang; Yong-Guang Gong; Da-Lin He

    2014-01-01

    This study aimed to investigate the correlations among androgen receptor (AR) CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and fifty-three healthy men (aged 22.8 ± 3.1 years) were enrolled. The individuals were grouped as CAG short (CAG S ) if they harbored repeat length of ≤20 or as CAG long (CAG L ) if their CAG repeat length was >20. Body height/weight, penile length and other parameters were examined and recorded by the specified ...

  16. Expanded complexity of unstable repeat diseases

    OpenAIRE

    Polak, Urszula; McIvor, Elizabeth; Dent, Sharon Y.R.; Wells, Robert D.; Napierala, Marek.

    2012-01-01

    Unstable Repeat Diseases (URDs) share a common mutational phenomenon of changes in the copy number of short, tandemly repeated DNA sequences. More than 20 human neurological diseases are caused by instability, predominantly expansion, of microsatellite sequences. Changes in the repeat size initiate a cascade of pathological processes, frequently characteristic of a unique disease or a small subgroup of the URDs. Understanding of both the mechanism of repeat instability and molecular consequen...

  17. The haemotoxicity of azathioprine in repeat dose studies in the female CD-1 mouse.

    Science.gov (United States)

    Molyneux, Gemma; Gibson, Frances M; Chen, Christabelle M; Marway, Harpal K; McKeag, Sean; Mifsud, Charles V J; Pilling, Andrew M; Whayman, Matthew J; Turton, John A

    2008-04-01

    Azathioprine (AZA) is a cytotoxic immunosuppressive drug used in the prevention of rejection in organ transplants and the treatment of auto-immune diseases. However, AZA is haemotoxic causing significant bone marrow depression. The present studies were to characterize the haemotoxicity of AZA in the female CD-1 mouse. In Experiment 1, a dose-ranging study, with AZA gavaged daily for 10 days, clinical evidence of toxicity was evident at 125 mg/kg and above. Experiment 2 was a dose-response study with AZA gavaged daily for 10 days at 40-120 mg/kg. At day 1 after the final dose, AZA induced a dose-related pancytopaenia, reduced femoral marrow cellularity, increases in serum levels of the cytokine fms-like tyrosine kinase 3 ligand, reduction in granulocyte-monocyte colony-forming units and erythroid colonies, and increased bone marrow apoptosis. Histology demonstrated hepatocyte hypertrophy, thymic atrophy, reduced splenic extramedullary haemopoiesis, and reduced cellularity of sternal bone marrow. In Experiment 3, AZA was dosed for 10 days at 100 mg/kg with autopsies at 1, 3, 9, 22, 29, 43 and 57 days postdosing. At 1, 3 and 9 days, haematological parameters reflected changes in Experiment 2. At 22/29 days, many blood parameters were returning towards normal; at 43/57 days, most parameters compared with controls. However, there was some evidence of a persistent (i.e. residual/late-stage) mild reduction in RBC and erythroid progenitor cell counts at day 43/57. We conclude that the CD-1 mouse provides an acceptable model for the haemotoxicity of AZA in man.

  18. Women's risk of repeat abortions is strongly associated with alcohol consumption: a longitudinal analysis of a Russian national panel study, 1994-2009.

    Directory of Open Access Journals (Sweden)

    Katherine Keenan

    Full Text Available Abortion rates in Russia, particularly repeat abortions, are among the highest in the world, and abortion complications make a substantial contribution to the country's high maternal mortality rate. Russia also has a very high rate of hazardous alcohol use. However, the association between alcohol use and abortion in Russia remains unexplored. We investigated the longitudinal predictors of first and repeat abortion, focussing on women's alcohol use as a risk factor. Follow-up data from 2,623 women of reproductive age (16-44 years was extracted from 14 waves of the Russian Longitudinal Monitoring Survey (RLMS, a nationally representative panel study covering the period 1994-2009. We used discrete time hazard models to estimate the probability of having a first and repeat abortion by social, demographic and health characteristics at the preceding study wave. Having a first abortion was associated with demographic factors such as age and parity, whereas repeat abortions were associated with low education and alcohol use. After adjustment for demographic and socioeconomic factors, the risk of having a repeat abortion increased significantly as women's drinking frequency increased (P<0.001, and binge drinking women were significantly more likely to have a repeat abortion than non-drinkers (OR 2.28, 95% CI 1.62-3.20. This association was not accounted for by contraceptive use or a higher risk of pregnancy. Therefore the determinants of first and repeat abortion in Russia between 1994-2009 were different. Women who had repeat abortions were distinguished by their heavier and more frequent alcohol use. The mechanism for the association is not well understood but could be explained by unmeasured personality factors, such as risk taking, or social non-conformity increasing the risk of unplanned pregnancy. Heavy or frequent drinkers constitute a particularly high risk group for repeat abortion, who could be targeted in prevention efforts.

  19. Magnetic Resonance Spectroscopy in Patients with Insomnia: A Repeated Measurement Study.

    Science.gov (United States)

    Spiegelhalder, Kai; Regen, Wolfram; Nissen, Christoph; Feige, Bernd; Baglioni, Chiara; Riemann, Dieter; Hennig, Jürgen; Lange, Thomas

    2016-01-01

    Chronic insomnia is one of the most prevalent central nervous system disorders. It is characterized by increased arousal levels, however, the neurobiological causes and correlates of hyperarousal in insomnia remain to be further determined. In the current study, magnetic resonance spectroscopy was used in the morning and evening in a well-characterized sample of 20 primary insomnia patients (12 females; 8 males; 42.7 ± 13.4 years) and 20 healthy good sleepers (12 females; 8 males; 44.1 ± 10.6 years). The most important inhibitory and excitatory neurotransmitters of the central nervous system, γ-aminobutyric acid (GABA) and glutamate/glutamine (Glx), were assessed in the anterior cingulate cortex (ACC) and dorsolateral prefrontal cortex (DLPFC). The primary hypothesis, a diurnal effect on GABA levels in patients with insomnia, could not be confirmed. Moreover, the current results did not support previous findings of altered GABA levels in individuals with insomnia. Exploratory analyses, however, suggested that GABA levels in the ACC may be positively associated with habitual sleep duration, and, thus, reduced GABA levels may be a trait marker of objective sleep disturbances. Moreover, there was a significant GROUP x MEASUREMENT TIME interaction effect on Glx in the DLPFC with increasing Glx levels across the day in the patients but not in the control group. Therefore, Glx levels may reflect hyperarousal at bedtime in those with insomnia. Future confirmatory studies should include larger sample sizes to investigate brain metabolites in different subgroups of insomnia.

  20. Global sensitivity analysis for repeated measures studies with informative drop-out: A semi-parametric approach.

    Science.gov (United States)

    Scharfstein, Daniel; McDermott, Aidan; Díaz, Iván; Carone, Marco; Lunardon, Nicola; Turkoz, Ibrahim

    2017-05-23

    In practice, both testable and untestable assumptions are generally required to draw inference about the mean outcome measured at the final scheduled visit in a repeated measures study with drop-out. Scharfstein et al. (2014) proposed a sensitivity analysis methodology to determine the robustness of conclusions within a class of untestable assumptions. In their approach, the untestable and testable assumptions were guaranteed to be compatible; their testable assumptions were based on a fully parametric model for the distribution of the observable data. While convenient, these parametric assumptions have proven especially restrictive in empirical research. Here, we relax their distributional assumptions and provide a more flexible, semi-parametric approach. We illustrate our proposal in the context of a randomized trial for evaluating a treatment of schizoaffective disorder. © 2017, The International Biometric Society.

  1. Zinc oxide nanoparticles: a 90-day repeated-dose dermal toxicity study in rats

    Directory of Open Access Journals (Sweden)

    Ryu HJ

    2014-12-01

    Full Text Available Hwa Jung Ryu,1,* Mu Yeb Seo,2,* Sung Kyu Jung,1 Eun Ho Maeng,2 Seung-Young Lee,2 Dong-Hyouk Jang,2 Taek-Jin Lee,2 Ki-Yeon Jo,2 Yu-Ri Kim,3 Kyu-Bong Cho,4 Meyoung-Kon Kim,3 Beom Jun Lee,5 Sang Wook Son1 1Department of Dermatology, Korea University College of Medicine, Seoul, 2Korea Testing and Research Institute, Gyunggido, 3Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul, 4Department of Clinical Laboratory Science, Shinheung College, Uijeongbu, 5College of Veterinary Medicine, Chungbuk National University, Cheongju, Republic of Korea *These authors contributed equally to this work and both should be considered first authors Abstract: Zinc oxide (ZnO works as a long-lasting, broad-spectrum physical sunblock, and can prevent skin cancer, sunburn, and photoaging. Nanosized ZnO particles are used often in sunscreens due to consumer preference over larger sizes, which appear opaque when dermally applied. Although the US Food and Drug Administration approved the use of nanoparticles (NPs in sunscreens in 1999, there are ongoing safety concerns. The aim of this study was to evaluate the subchronic toxicity of ZnO NPs after dermal application according to the Organization for Economic Cooperation and Development Test Guidelines 411 using Good Laboratory Practice. Sprague Dawley rats were randomly divided into eight (one control, one vehicle control, three experimental, and three recovery groups. Different concentrations of ZnO NPs were dermally applied to the rats in the experimental groups for 90 days. Clinical observations as well as weight and food consumption were measured and recorded daily. Hematology and biochemistry parameters were determined. Gross pathologic and histopathologic examinations were performed on selected tissues from all animals. Analyses of tissue were undertaken to determine target organ tissue distribution. There was no increased mortality in the experimental group. Although there

  2. The effect of image quality, repeated study, and assessment method on anatomy learning.

    Science.gov (United States)

    Fenesi, Barbara; Mackinnon, Chelsea; Cheng, Lucia; Kim, Joseph A; Wainman, Bruce C

    2017-06-01

    The use of two-dimensional (2D) images is consistently used to prepare anatomy students for handling real specimen. This study examined whether the quality of 2D images is a critical component in anatomy learning. The visual clarity and consistency of 2D anatomical images was systematically manipulated to produce low-quality and high-quality images of the human hand and human eye. On day 0, participants learned about each anatomical specimen from paper booklets using either low-quality or high-quality images, and then completed a comprehension test using either 2D images or three-dimensional (3D) cadaveric specimens. On day 1, participants relearned each booklet, and on day 2 participants completed a final comprehension test using either 2D images or 3D cadaveric specimens. The effect of image quality on learning varied according to anatomical content, with high-quality images having a greater effect on improving learning of hand anatomy than eye anatomy (high-quality vs. low-quality for hand anatomy P = 0.018; high-quality vs. low-quality for eye anatomy P = 0.247). Also, the benefit of high-quality images on hand anatomy learning was restricted to performance on short-answer (SA) questions immediately after learning (high-quality vs. low-quality on SA questions P = 0.018), but did not apply to performance on multiple-choice (MC) questions (high-quality vs. low-quality on MC questions P = 0.109) or after participants had an additional learning opportunity (24 hours later) with anatomy content (high vs. low on SA questions P = 0.643). This study underscores the limited impact of image quality on anatomy learning, and questions whether investment in enhancing image quality of learning aids significantly promotes knowledge development. Anat Sci Educ 10: 249-261. © 2016 American Association of Anatomists. © 2016 American Association of Anatomists.

  3. Does Repeated Ticking Maintain Tic Behavior? An Experimental Study of Eye Blinking in Healthy Individuals

    Directory of Open Access Journals (Sweden)

    Daniel J. V. Beetsma

    2013-01-01

    Full Text Available Tics in Tourette Syndrome (TS are often preceded by 'premonitory urges': annoying feelings or bodily sensations. We hypothesized that, by reducing annoyance of premonitory urges, tic behaviour may be reinforced. In a 2X2 experimental design in healthy participants, we studied the effects of premonitory urges (operationalized as air puffs on the eye and tic behaviour (deliberate eye blinking after a puff or a sound on changes in subjective evaluation of air puffs, and EMG responses on the m. orbicularis oculi. The experimental group with air puffs+ blinking experienced a decrease in subjective annoyance of the air puff, but habituation of the EMG response was blocked and length of EMG response increased. In the control groups (air puffs without instruction to blink, no air puffs, these effects were absent. When extrapolating to the situation in TS patients, these findings suggest that performance of tics is reinforced by reducing the subjective annoyance of premonitory urges, while simultaneously preventing habituation or even inducing sensitisation of the physiological motor response.

  4. Reported food intake and distribution of body fat: a repeated cross-sectional study

    Directory of Open Access Journals (Sweden)

    Stenlund Hans

    2006-12-01

    Full Text Available Abstract Background Body mass, as well as distribution of body fat, are predictors of both diabetes and cardiovascular disease. In Northern Sweden, despite a marked increase in average body mass, prevalence of diabetes was stagnant and myocardial infarctions decreased. A more favourable distribution of body fat is a possible contributing factor. This study investigates the relative importance of individual food items for time trends in waist circumference (WC and hip circumference (HC on a population level. Methods Independent cross-sectional surveys conducted in 1986, 1990, 1994 and 1999 in the two northernmost counties of Sweden with a common population of 250000. Randomly selected age stratified samples, altogether 2982 men and 3087 women aged 25–64 years. Questionnaires were completed and anthropometric measurements taken. For each food item, associations between frequency of consumption and waist and hip circumferences were estimated. Partial regression coefficients for every level of reported intake were multiplied with differences in proportion of the population reporting the corresponding levels of intake in 1986 and 1999. The sum of these product terms for every food item was the respective estimated impact on mean circumference. Results Time trends in reported food consumption associated with the more favourable gynoid distribution of adipose tissue were increased use of vegetable oil, pasta and 1.5% fat milk. Trends associated with abdominal obesity were increased consumption of beer in men and higher intake of hamburgers and French fried potatoes in women. Conclusion Food trends as markers of time trends in body fat distribution have been identified. The method is a complement to conventional approaches to establish associations between food intake and disease risk on a population level.

  5. Breath acidification in adolescent runners exposed to atmospheric pollution: A prospective, repeated measures observational study

    Directory of Open Access Journals (Sweden)

    Van Sickle David

    2008-03-01

    Full Text Available Abstract Background Vigorous outdoors exercise during an episode of air pollution might cause airway inflammation. The purpose of this study was to examine the effects of vigorous outdoor exercise during peak smog season on breath pH, a biomarker of airway inflammation, in adolescent athletes. Methods We measured breath pH both pre- and post-exercise on ten days during peak smog season in 16 high school athletes engaged in daily long-distance running in a downwind suburb of Atlanta. The association of post-exercise breath pH with ambient ozone and particulate matter concentrations was tested with linear regression. Results We collected 144 pre-exercise and 146 post-exercise breath samples from 16 runners (mean age 14.9 years, 56% male. Median pre-exercise breath pH was 7.58 (interquartile range: 6.90 to 7.86 and did not change significantly after exercise. We observed no significant association between ambient ozone or particulate matter and post-exercise breath pH. However both pre- and post-exercise breath pH were strikingly low in these athletes when compared to a control sample of 14 relatively sedentary healthy adults and to published values of breath pH in healthy subjects. Conclusion Although we did not observe an acute effect of air pollution exposure during exercise on breath pH, breath pH was surprisingly low in this sample of otherwise healthy long-distance runners. We speculate that repetitive vigorous exercise may induce airway acidification.

  6. Toxicity evaluation of zinc aluminium levodopa nanocomposite via oral route in repeated dose study

    Science.gov (United States)

    Kura, Aminu Umar; Cheah, Pike-See; Hussein, Mohd Zobir; Hassan, Zurina; Tengku Azmi, Tengku Ibrahim; Hussein, Nor Fuzina; Fakurazi, Sharida

    2014-05-01

    Nanotechnology, through nanomedicine, allowed drugs to be manipulated into nanoscale sizes for delivery to the different parts of the body, at the same time, retaining the valuable pharmacological properties of the drugs. However, efficient drug delivery and excellent release potential of these delivery systems may be hindered by possible untoward side effects. In this study, the sub-acute toxicity of oral zinc aluminium nanocomposite with and without levodopa was assessed using the Organization for Economic Co-operation and Development guidelines. No sign or symptom of toxicity was observed in orally treated rats with the nanocomposite at 5 and 500 mg/kg concentrations. Body weight gain, feeding, water intake, general survival and organosomatic index were not significantly different between control and treatment groups. Aspartate aminotransferase (AST) in 500 mg/kg levodopa nanocomposite (169 ± 30 U/L), 5 mg/kg levodopa nanocomposite (172 ± 49 U/L), and 500 mg/kg layered double hydroxides (LDH) nanocomposite (175 ± 25 U/L) were notably elevated compared to controls (143 ± 05 U/L); but the difference were not significant ( p > 0.05). However, the differences in aspartate aminotransferase/alanine aminotransferase (AST/ALT) ratio of 500 mg/kg levodopa nanocomposite (0.32 ± 0.12) and 500 mg/kg LDH nanocomposite (0.34 ± 0.12) were statistically significant ( p brain was found to be of similar morphology in both control and experimental groups. The kidneys of 500-mg/kg-treated rats with levodopa nanocomposite and LDH nanocomposite were found to have slight inflammatory changes, notably leukocyte infiltration around the glomeruli. The ultra-structure of the neurons from the substantia nigra of nanocomposite-exposed group was similar to those receiving only normal saline. The observed result has suggested possible liver and renal toxicity in orally administered levodopa intercalated nanocomposite; it is also dose-dependent that needs further assessment.

  7. Repeatability & Workability Evaluation of SIGMOD 2009

    KAUST Repository

    Manegold, Stefan

    2010-12-15

    SIGMOD 2008 was the first database conference that offered to test submitters\\' programs against their data to verify the repeatability of the experiments published [1]. Given the positive feedback concerning the SIGMOD 2008 repeatability initiative, SIGMOD 2009 modified and expanded the initiative with a workability assessment.

  8. Institutional initiatives in professional scientific ethics: three case studies

    Science.gov (United States)

    Nickless, Edmund; Bilham, Nic

    2015-04-01

    Learned and professional scientific bodies can play a vital role in promoting ethical behaviours, giving practical substance to theoretical consideration of geoethical principles and complementing the efforts of individual scientists and practitioners to behave in a professional and ethical manner. Institutions may do this through mandatory professional codes of conduct, by developing guidelines and initiatives to codify and stimulate the uptake of best practice, and through wider initiatives to engender a culture conducive to such behaviours. This presentation will outline three current institutional initiatives which directly or indirectly address scientific ethics: i. The UK Science Council's Declaration on Diversity, Equality and Inclusion. ii. Development and promulgation of the American Geosciences Institute's (AGI) Guidelines for Ethical Professional Conduct. iii. The American Geophysical Union's (AGU) Scientific Code of Conduct and Professional Ethics. The focus of the Science Council and its member bodies (including the Geological Society of London) on diversity is of central importance when considering ethical behaviours in science. First, improving equality and diversity in the science workforce is at the heart of ethical practice, as well as being essential to meeting current and future skills needs. Second, in addition to demographic diversity (whether in terms of gender, race, economic status, sexuality or gender identity, etc), an important dimension of diversity in science is to allow space for a plurality of scientific views, and to nurture dissenting voices - essential both to the development of scientific knowledge and to its effective communication to non-technical audiences.

  9. Understanding how adherence goals promote adherence behaviours: a repeated measure observational study with HIV seropositive patients

    Directory of Open Access Journals (Sweden)

    Jones Gareth

    2012-08-01

    behaviours over and above the effects of the behaviour-specific thinking and ii the relationship between adherence to exercise and to medical treatment is stronger among those with more favourable views about the goal. Results from this study should identify the key contributing factors to inform subsequent adherence research and afford a more streamlined assessment matrix. The project also aims to inform patient care practices. UK Clinical Research Network registration number UKCRN 7842.

  10. Estimation of acute oral toxicity using the No Observed Adverse Effect Level (NOAEL) from the 28 day repeated dose toxicity studies in rats.

    Science.gov (United States)

    Bulgheroni, Anna; Kinsner-Ovaskainen, Agnieszka; Hoffmann, Sebastian; Hartung, Thomas; Prieto, Pilar

    2009-02-01

    Acute systemic toxicity is one of the areas of particular concern due to the 2009 deadline set by the 7th Amendment of the Cosmetics Directive (76/768/EEC), which introduces a testing and marketing ban of cosmetic products with ingredients tested on animals. The scientific community is putting considerable effort into developing and validating non-animal alternatives in this area. However, it is unlikely that validated and regulatory accepted alternative methods and/or strategies will be available in March 2009. Following the initiatives undertaken in the pharmaceutical industry to waive the acute oral toxicity testing before going to clinical studies by using information from other in vivo studies, we proposed an approach to identify non-toxic compounds (LD50>2000mg/kg) using information from 28 days repeated dose toxicity studies. Taking into account the high prevalence of non-toxic substances (87%) in the New Chemicals Database, it was possible to set a NOAEL threshold of 200mg/kg that allowed the correct identification of 63% of non-toxic compounds, while testing of cosmetic ingredients.

  11. A new technique for repeated biopsies of the mammary gland in dairy cows allotted to Latin-square design studies.

    Science.gov (United States)

    de Lima, Luciano S; Martineau, Eric; De Marchi, Francilaine E; Palin, Marie-France; Dos Santos, Geraldo T; Petit, Hélène V

    2016-07-01

    The objective of this study was to develop a technique for carrying out repeated biopsies of the mammary gland of lactating dairy cows that provides enough material to monitor enzyme activities and gene expression in mammary secretory tissue. A total of 16 Holstein cows were subjected to 4 mammary biopsies each at 3-week intervals for a total of 64 biopsies. A 0.75-cm incision was made through the skin and subcutaneous tissue of the mammary gland and a trocar and cannula were inserted using a circular motion. The trocar was withdrawn and a syringe was plugged into the base of the cannula to create a vacuum for sampling mammary tissue. To reduce bleeding, hand pressure was put on the surgery site after biopsy and skin closure and ice was applied for at least 2 h after the biopsy using a cow bra. The entire procedure took an average of 25 min. Two attempts were usually enough to obtain 800 mg of tissue. Visual examination of milk samples 10 d after the biopsy indicated no trace of blood, except in samples from 2 cows. All wounds healed without infection and subcutaneous hematomas resorbed within 7 d. There was no incidence of mastitis throughout the lactation. This technique provides a new tool for biopsy of the mammary gland repeated at short intervals with the main effect being a decrease in milk production. Although secondary complications leading to illness or death are always a risk with any procedure, this biopsy technique was carried out without complications to the health of animals and with no incidence of mastitis during the lactation.

  12. Effects of Cold Water Immersion on Muscle Oxygenation During Repeated Bouts of Fatiguing Exercise: A Randomized Controlled Study.

    Science.gov (United States)

    Yeung, Simon S; Ting, Kin Hung; Hon, Maurice; Fung, Natalie Y; Choi, Manfi M; Cheng, Juno C; Yeung, Ella W

    2016-01-01

    Postexercise cold water immersion has been advocated to athletes as a means of accelerating recovery and improving performance. Given the effects of cold water immersion on blood flow, evaluating in vivo changes in tissue oxygenation during cold water immersion may help further our understanding of this recovery modality. This study aimed to investigate the effects of cold water immersion on muscle oxygenation and performance during repeated bouts of fatiguing exercise in a group of healthy young adults. Twenty healthy subjects performed 2 fatiguing bouts of maximal dynamic knee extension and flexion contractions both concentrically on an isokinetic dynamometer with a 10-min recovery period in between. Subjects were randomly assigned to either a cold water immersion (treatment) or passive recovery (control) group. Changes in muscle oxygenation were monitored continuously using near-infrared spectroscopy. Muscle performance was measured with isokinetic dynamometry during each fatiguing bout. Skin temperature, heart rate, blood pressure, and muscle soreness ratings were also assessed. Repeated measures ANOVA analysis was used to evaluate treatment effects. The treatment group had a significantly lower mean heart rate and lower skin temperature compared to the control group (P Cold water immersion attenuated a reduction in tissue oxygenation in the second fatiguing bout by 4% when compared with control. Muscle soreness was rated lower 1 day post-testing (P cold water immersion had no significant effect on muscle performance in subsequent exercise. As the results show that cold water immersion attenuated decreased tissue oxygenation in subsequent exercise performance, the metabolic response to exercise after cold water immersion is worthy of further exploration.

  13. High-Throughput Mycobacterial Interspersed Repetitive-Unit–Variable-Number Tandem-Repeat Genotyping for Mycobacterium tuberculosis Epidemiological Studies

    Science.gov (United States)

    Bidault, Floriane; Mosnier, Amandine; Bablishvili, Nino; Tukvadze, Nestani; Somphavong, Silaphet; Paboriboune, Phimpha; Ocheretina, Oksana; Pape, Jean William; Paranhos-Baccala, Glaucia; Berland, Jean-Luc

    2014-01-01

    The emergence of drug-resistant forms of tuberculosis (TB) represents a major public health concern. Understanding the transmission routes of the disease is a key factor for its control and for the implementation of efficient interventions. Mycobacterial interspersed repetitive-unit–variable-number tandem-repeat (MIRU-VNTR) marker typing is a well-described method for lineage identification and transmission tracking. However, the conventional manual genotyping technique is cumbersome and time-consuming and entails many risks for errors, thus hindering its implementation and dissemination. We describe here a new approach using the QIAxcel system, an automated high-throughput capillary electrophoresis system that also carries out allele calling. This automated method was assessed on 1,824 amplicons from 82 TB isolates and tested with sets of markers of 15 or 24 loci. Overall allele-calling concordance between the methods from 140 to 1,317 bp was 98.9%. DNA concentrations and repeatability and reproducibility performances showed no biases in allele calling. Furthermore, turnaround time using this automated system was reduced by 81% compared to the conventional manual agarose gel method. In sum, this new automated method facilitates MIRU-VNTR genotyping and provides reliable results. Therefore, it is well suited for field genotyping. The implementation of this method will help to achieve accurate and cost-effective epidemiological studies, especially in countries with a high prevalence of TB, where the high number of strains complicates the surveillance of circulating lineages and requires efficient interventions to be carried out in an urgent manner. PMID:25428144

  14. Studi Empiris Tingkat Underpricing pada Initial Public Offering

    Directory of Open Access Journals (Sweden)

    Daniel Sugama Stephanus

    2015-12-01

    Full Text Available At Initial Public Offering (IPO, underpricing still happened. This is due to asymmetric information between firms and underwriters. This research to analyze accounting factors and non-accounting factors which affect the level of underpricing. This research is quantitative research with regression analysis. The datas of this research are companies which did an IPO in 2010 – 2014. Accounting factors are ROA, DER, CR, and SIZE. Non-accounting factors are OFFER, AGE, auditor’s reputation, and underwriter’s reputation. Results showed that only underwriter’s reputation affects underpricing. This indicates that underwriter’s reputation is very important for firms to reduce underpricing in an IPO.

  15. Huntington CAG repeat size does not modify onset age in familial Parkinson’s disease: The GenePD Study

    Science.gov (United States)

    McNicoll, Christopher F.; Latourelle, Jeanne C.; MacDonald, Marcy E.; Lew, Mark F.; Suchowersky, Oksana; Klein, Christine; Golbe, Lawrence I.; Mark, Margery H.; Growdon, John H.; Wooten, G. Frederick; Watts, Ray L.; Guttman, Mark; Racette, Brad A.; Perlmutter, Joel S.; Ahmed, Anwar; Shill, Holly A.; Singer, Carlos; Saint-Hilaire, Marie H.; Massood, Tiffany; Huskey, Karen W.; DeStefano, Anita L.; Gillis, Tammy; Mysore, Jayalakshmi; Goldwurm, Stefano; Pezzoli, Gianni; Baker, Kenneth B.; Itin, Ilia; Litvan, Irene; Nicholson, Garth; Corbett, Alastair; Nance, Martha; Drasby, Edward; Isaacson, Stuart; Burn, David J.; Chinnery, Patrick F.; Pramstaller, Peter P.; Al-hinti, Jomana; Moller, Anette T.; Ostergaard, Karen; Sherman, Scott J.; Roxburgh, Richard; Snow, Barry; Slevin, John T.; Cambi, Franca; Gusella, James F.; Myers, Richard H.

    2009-01-01

    The ATP/ADP ratio reflects mitochondrial function and has been reported to be influenced by the size of the Huntington disease gene (HD) repeat. Impaired mitochondrial function has long been implicated in the pathogenesis of Parkinson’s disease (PD) and therefore, we evaluated the relationship of the HD CAG repeat size to PD onset age in a large sample of familial PD cases. PD affected siblings (n=495) with known onset ages from 248 families, were genotyped for the HD CAG repeat. Genotyping failed in 11 cases leaving 484 for analysis, including 35 LRRK2 carriers. All cases had HD CAG repeats (range 15 to 34) below the clinical range for HD, although 5.2 percent of the sample (n=25) had repeats in the intermediate range (the intermediate range lower limit=27; upper limit=35 repeats), suggesting that the prevalence of intermediate allele carriers in the general population is significant. No relation between the HD CAG repeat size and the age at onset for PD was found in this sample of familial PD. PMID:18649400

  16. Initial Stability Study of Calcium Phosphate Coated Dental Implants

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    Thin film of biodegradable calcium phosphate coated on threaded commercially pure titanium( cp- Ti) dental implants has been investigated as one of alternatives to eliminate the problem of the long-term instability of plasma sprayed HA coated implants. In order to compare in-vivo hone-to-implant response behavior among as-machined, HA coated and CMP coated groups, each group was implanted into New Zealand white mature male rabbits for 2 and 6 weeks, and then in- vivo biological behavior was examined in terms of H&E staining. Initial stability and removable torques of implants were compared among three groups. Measured removable torque of CMP coated specimen at 6 wceks after implantation was significantly higher than that of non-coated group, but slightly lower than that of HA coated group, without any inflammatory response at the surrounding of the implants. The initial stability (ISQ value; implant stability quotient ) of CMP coated specimen at 2 weeks after implantation was slightly lower than that of HA coated group and significantly higher than that of non-coated group. However, after 6 weeks, ISQ value of CMP coated group was slightly higher than that of HA coated group and significantly higher than that of non-coated group.

  17. Repeat spinal anesthesia in cesarean section: A comparison between 10 mg and 12 mg doses of intrathecal hyperbaric (0.05%) bupivacaine repeated after failed spinal anesthesia: A prospective, parallel group study.

    Science.gov (United States)

    Bhar, Debasish; RoyBasunia, Sandip; Das, Anjan; Chhaule, Subinay; Mondal, Sudipta Kumar; Bisai, Subrata; Chattopadhyay, Surajit; Mandal, Subrata Kumar

    2016-01-01

    Spinal anesthesia for cesarean section is not a 100% successful technique. At times, despite straightforward insertion and drug administration, intrathecal anesthesia for cesarean section fails to obtain any sensory or motor block. Very few studies and literature are available regarding repeat administration of spinal anesthesia and its drug dosage, especially after first spinal failure in cesarean section lower segment cesarean section (LSCS) due to fear of the excessive spread of drug. The aim of our study is to compare the outcome between two different doses of 0.5% hyperbaric bupivacaine repeated intrathecally after failed spinal. After taking informed consent and Ethical Committee approval this prospective, randomized single-blinded study was conducted in 100 parturients of American Society of Anesthesiologists I-II who were posted for elective LSCS and had Bromage score 0 and no sensory block even at L4 dermatome after 10 min of first spinal anesthesia; were included in the study. Group A (n = 50) patients received 2.4 ml and Group B (n = 50) patients received 2 ml of 0.5% hyperbaric bupivacaine respectively for administering repeat spinal anesthesia. Heart rate (HR), systolic blood pressure (SBP), diastolic blood pressure (DBP), oxygen saturation, respiratory rate and electrocardiogram were monitored both intra- and post-operatively and complications were recorded. Incidence of high spinal, bradycardia, hypotension, respiratory complications, and nausea vomiting are significantly higher in Group A compared to Group B (P cesarean section with 10 mg of 0.5% hyperbaric bupivacaine provided after first spinal anesthesia, the level of sensory block is below L4 and motor power in Bromage scale is 0.

  18. The 5' untranslated region and Gag product of Idefix, a long terminal repeat-retrotransposon from Drosophila melanogaster, act together to initiate a switch between translated and untranslated states of the genomic mRNA.

    Science.gov (United States)

    Meignin, Carine; Bailly, Jean-Luc; Arnaud, Frédérick; Dastugue, Bernard; Vaury, Chantal

    2003-11-01

    Idefix is a long terminal repeat (LTR)-retrotransposon present in Drosophila melanogaster which shares similarities with vertebrates retroviruses both in its genomic arrangement and in the mechanism of transposition. Like in retroviruses, its two LTRs flank a long 5' untranslated region (5'UTR) and three open reading frames referred to as the gag, pol, and env genes. Here we report that its 5'UTR, located upstream of the gag gene, can fold into highly structured domains that are known to be incompatible with efficient translation by ribosome scanning. Using dicistronic plasmids analyzed by both (i) in vitro transcription and translation in rabbit reticulocyte or wheat germ lysates and (ii) in vivo expression in transgenic flies, we show that the 5'UTR of Idefix exhibits an internal ribosome entry site (IRES) activity that is able to promote translation of a downstream cistron in a cap-independent manner. The functional state of this novel IRES depends on eukaryotic factors that are independent of their host origin. However, in vivo, its function can be down-regulated by trans-acting factors specific to tissues or developmental stages of its host. We identify one of these trans-acting factors as the Gag protein encoded by Idefix itself. Our data support a model in which nascent Gag is able to block translation initiated from the viral mRNA and thus its own translation. These data highlight the fact that LTR-retrotransposons may autoregulate their replication cycle through their Gag production.

  19. Thermal Studies on Boron-Based Initiator Formulation.

    Directory of Open Access Journals (Sweden)

    A. G. Rajendran

    1996-12-01

    Full Text Available Boron-potassium nitrate pyrotechnic composition can be converted into a hot wire-sensitive initiator formulation by the addition of an extra fuel. viz. lead thiocyanate. The ignition temperature of this composition depends on the percentage of thiocyanate in the mix and follows a binomial fit. The kinetic parameters. viz. activation energy E and pre-exponential factor A of the charge have been calculated from TG and DSC curves using different approaches developed by Coats-Redfern and Kissinger. Ignition delays measured from isothermal TG runs were found to yield equally good values of E and A. A comparison of these values for the tricomponent system' with those of the bicomponent systems as well as of the ingredients suggests that the starting reaction in this formulation is the reaction between lead thiocyanate and potassium nitrate which energises the main reaction between boron and potassium nitrate. leading to ignition.

  20. Mass Spectrometry Study of OH-initiated Photooxidation of Toluene

    Institute of Scientific and Technical Information of China (English)

    Ming-qiang Huang; Wei-iun Zhang; Zhen-ya Wang; Li Fang; Rui-hong Kong; Xiao-bin Shan; Fu-yi Liu; Liu-si Sheng

    2011-01-01

    The composition of products formed from photooxidation of the aromatic hydrocarbon toluene was investigated.The OH-initiated photooxidation experiments were conducted by irradiating toluene/CH3ONO/NO/air mixtures in a smog chamber,the gaseous products were detected under the supersonic beam conditions by utilizing vacuum ultraviolet photoionization mass spectrometer using synchrotron radiation in real-time.And an aerosol time-of-flight mass spectrometer was used to provide on-line measurements of the individual secondary organic aerosol particle resulting from irradiating toluene.The experimental results demonstrated that there were some differences between the gaseous products and that of particle-phase,the products of glyoxal,2-hydroxyl-3-oxo-butanal,nitrotoluene,and methyl-nitrophenol only existed in the particle-phase.However,furane,methylglyoxal,2-methylfurane,benzaldehyde,cresol,and benzoic acid were the predominant photooxidation products in both the gas phase and particle phase.

  1. Risk factors for complications in donors at first and repeat whole blood donation: a cohort study with assessment of the impact on donor return.

    Science.gov (United States)

    Wiersum-Osselton, Johanna C; Marijt-van der Kreek, Tanneke; Brand, Anneke; Veldhuizen, Ingrid; van der Bom, Johanna G; de Kort, Wim

    2014-01-01

    First-time donation is among recognised risk factors for vasovagal reactions to blood donation and reactions are known to reduce donor return. We assessed associations between potential risk factors and vasovagal reactions and needle-related complications in first-time whole blood donation in comparison to repeat donation and analysed the impact of complications on donor return. We performed a cohort study on whole blood donations in The Netherlands from 1/1/2010 to 31/12/2010 using data extracted from the blood service information system. Donation data up to 31/12/2011 were used to ascertain donor return. In 2010 28,786 donors made first whole blood donations and there were 522,958 repeat donations. Vasovagal reactions occurred in 3.9% of first donations by males and 3.5% of first donations by females compared to in 0.2% and 0.6%, respectively, of repeat donations. Associations of vasovagal reactions with other factors including age, body weight, systolic and diastolic blood pressure were similar in first-time and repeat donors. Needle-related complications occurred in 0.2% of male and 0.5% of female first-time donations and in 0.1% and 0.3%, respectively, of repeat donations. Among first-time donors, the return rate within 1 year was 82% following an uncomplicated first donation, but 55% and 61% following vasovagal reactions and needle-related complications, respectively; the corresponding percentages among repeat donors were 86%, 58% and 82%. Among first-time donors, females suffered less than males from vasovagal reactions. Other risk factors had similar associations among first-time and repeat donors. Vasovagal reactions and needle-related complications in both first-time and repeat donors are followed by reduced donor return.

  2. Variability in Muscle Damage after Eccentric Exercise and the Repeated Bout Effect

    Science.gov (United States)

    Chen, Trevor C.

    2006-01-01

    The first purpose of this study was to determine a possible explanation for the variability in the response to eccentric exercise by having participants repeat the same exercise 1 year apart. The second purpose was to examine whether initial injury in response to eccentric exercise was associated with the extent of the repeated bout effect (RBE).…

  3. Variability in Muscle Damage after Eccentric Exercise and the Repeated Bout Effect

    Science.gov (United States)

    Chen, Trevor C.

    2006-01-01

    The first purpose of this study was to determine a possible explanation for the variability in the response to eccentric exercise by having participants repeat the same exercise 1 year apart. The second purpose was to examine whether initial injury in response to eccentric exercise was associated with the extent of the repeated bout effect (RBE).…

  4. Expansion of protein domain repeats.

    Directory of Open Access Journals (Sweden)

    Asa K Björklund

    2006-08-01

    Full Text Available Many proteins, especially in eukaryotes, contain tandem repeats of several domains from the same family. These repeats have a variety of binding properties and are involved in protein-protein interactions as well as binding to other ligands such as DNA and RNA. The rapid expansion of protein domain repeats is assumed to have evolved through internal tandem duplications. However, the exact mechanisms behind these tandem duplications are not well-understood. Here, we have studied the evolution, function, protein structure, gene structure, and phylogenetic distribution of domain repeats. For this purpose we have assigned Pfam-A domain families to 24 proteomes with more sensitive domain assignments in the repeat regions. These assignments confirmed previous findings that eukaryotes, and in particular vertebrates, contain a much higher fraction of proteins with repeats compared with prokaryotes. The internal sequence similarity in each protein revealed that the domain repeats are often expanded through duplications of several domains at a time, while the duplication of one domain is less common. Many of the repeats appear to have been duplicated in the middle of the repeat region. This is in strong contrast to the evolution of other proteins that mainly works through additions of single domains at either terminus. Further, we found that some domain families show distinct duplication patterns, e.g., nebulin domains have mainly been expanded with a unit of seven domains at a time, while duplications of other domain families involve varying numbers of domains. Finally, no common mechanism for the expansion of all repeats could be detected. We found that the duplication patterns show no dependence on the size of the domains. Further, repeat expansion in some families can possibly be explained by shuffling of exons. However, exon shuffling could not have created all repeats.

  5. Knowledge and skill retention of in-service versus preservice nursing professionals following an informal training program in pediatric cardiopulmonary resuscitation: a repeated-measures quasiexperimental study.

    Science.gov (United States)

    Sankar, Jhuma; Vijayakanthi, Nandini; Sankar, M Jeeva; Dubey, Nandkishore

    2013-01-01

    Our objective was to compare the impact of a training program in pediatric cardiopulmonary resuscitation (CPR) on the knowledge and skills of in-service and preservice nurses at prespecified time points. This repeated-measures quasiexperimental study was conducted in the pediatric emergency and ICU of a tertiary care teaching hospital between January and March 2011. We assessed the baseline knowledge and skills of nursing staff (in-service nurses) and final year undergraduate nursing students (preservice nurses) using a validated questionnaire and a skill checklist, respectively. The participants were then trained on pediatric CPR using standard guidelines. The knowledge and skills were reassessed immediately after training and at 6 weeks after training. A total of 74 participants-28 in-service and 46 preservice professionals-were enrolled. At initial assessment, in-service nurses were found to have insignificant higher mean knowledge scores (6.6 versus 5.8, P = 0.08) while the preservice nurses had significantly higher skill scores (6.5 versus 3.2, P nurses performing better in knowledge test (10.5 versus 9.1, P = 0.01) and the preservice nurses performing better in skill test (9.8 versus 7.4, P skills of in-service and preservice nurses in pediatric CPR improved with training. In comparison to preservice nurses, the in-service nurses seemed to retain knowledge better with time than skills.

  6. Repeat induced abortion - a matter of individual behaviour or societal factors? A cross-sectional study among Swedish women.

    Science.gov (United States)

    Makenzius, Marlene; Tydén, Tanja; Darj, Elisabeth; Larsson, Margareta

    2011-10-01

    Almost 40% of all induced abortions in Sweden are repeat abortions; little is known about the risk factors. To investigate differences between women who had a first-time abortion and those with repeat abortion, and to identify factors associated with repeat abortion. A questionnaire was answered by 798 abortion-seeking women in Sweden during 2009. A regression model was used to assess risk factors for repeat abortions. In the age range 20-49 years, 41% of women had experienced at least one previous abortion. Risk factors for repeat abortion were parity (OR 2.57), lack of emotional support (OR 2.09), unemployment or sick leave (OR 1.65), tobacco use (OR 1.56), and low educational level (OR 1.5). Some women (n = 55) considered economic support and work opportunities could have enabled them to continue the pregnancy. Increased Sex and Relationship Education (SRE), easy access to high-quality contraception and counselling, were suggested (n = 86) as interventions for preventing unintended pregnancies. Even in a country with long established SRE and a public health policy to enhance sexual and reproductive health over a third of women requesting abortion have experienced one previously and the rate is maintained. Some specific factors are identified but, overall, a picture of vulnerability among women seeking repeat abortion stands out that needs to be considered in the prevention of unintended pregnancies.

  7. First worldwide proficiency study on variable-number tandem-repeat typing of Mycobacterium tuberculosis complex strains.

    Science.gov (United States)

    de Beer, Jessica L; Kremer, Kristin; Ködmön, Csaba; Supply, Philip; van Soolingen, Dick

    2012-03-01

    Although variable-number tandem-repeat (VNTR) typing has gained recognition as the new standard for the DNA fingerprinting of Mycobacterium tuberculosis complex (MTBC) isolates, external quality control programs have not yet been developed. Therefore, we organized the first multicenter proficiency study on 24-locus VNTR typing. Sets of 30 DNAs of MTBC strains, including 10 duplicate DNA samples, were distributed among 37 participating laboratories in 30 different countries worldwide. Twenty-four laboratories used an in-house-adapted method with fragment sizing by gel electrophoresis or an automated DNA analyzer, nine laboratories used a commercially available kit, and four laboratories used other methods. The intra- and interlaboratory reproducibilities of VNTR typing varied from 0% to 100%, with averages of 72% and 60%, respectively. Twenty of the 37 laboratories failed to amplify particular VNTR loci; if these missing results were ignored, the number of laboratories with 100% interlaboratory reproducibility increased from 1 to 5. The average interlaboratory reproducibility of VNTR typing using a commercial kit was better (88%) than that of in-house-adapted methods using a DNA analyzer (70%) or gel electrophoresis (50%). Eleven laboratories using in-house-adapted manual typing or automated typing scored inter- and intralaboratory reproducibilities of 80% or higher, which suggests that these approaches can be used in a reliable way. In conclusion, this first multicenter study has documented the worldwide quality of VNTR typing of MTBC strains and highlights the importance of international quality control to improve genotyping in the future.

  8. Nifty Nines and Repeating Decimals

    Science.gov (United States)

    Brown, Scott A.

    2016-01-01

    The traditional technique for converting repeating decimals to common fractions can be found in nearly every algebra textbook that has been published, as well as in many precalculus texts. However, students generally encounter repeating decimal numerals earlier than high school when they study rational numbers in prealgebra classes. Therefore, how…

  9. Nifty Nines and Repeating Decimals

    Science.gov (United States)

    Brown, Scott A.

    2016-01-01

    The traditional technique for converting repeating decimals to common fractions can be found in nearly every algebra textbook that has been published, as well as in many precalculus texts. However, students generally encounter repeating decimal numerals earlier than high school when they study rational numbers in prealgebra classes. Therefore, how…

  10. Repeat-until-success quantum repeaters

    Science.gov (United States)

    Bruschi, David Edward; Barlow, Thomas M.; Razavi, Mohsen; Beige, Almut

    2014-09-01

    We propose a repeat-until-success protocol to improve the performance of probabilistic quantum repeaters. Conventionally, these rely on passive static linear-optics elements and photodetectors to perform Bell-state measurements (BSMs) with a maximum success rate of 50%. This is a strong impediment for entanglement swapping between distant quantum memories. Every time a BSM fails, entanglement needs to be redistributed between the corresponding memories in the repeater link. The key ingredients of our scheme are repeatable BSMs. Under ideal conditions, these turn probabilistic quantum repeaters into deterministic ones. Under realistic conditions, our protocol too might fail. However, using additional threshold detectors now allows us to improve the entanglement generation rate by almost orders of magnitude, at a nominal distance of 1000 km, compared to schemes that rely on conventional BSMs. This improvement is sufficient to make the performance of our scheme comparable to the expected performance of some deterministic quantum repeaters.

  11. An Inquiry Study of Early Literacy. NCTE Reading Initiative.

    Science.gov (United States)

    Serebrin, Wayne; Long, Susi; Egawa, Kathy

    The focus of this inquiry study is young children's learning, and specifically, their use of literacy from their preschool years through age eight. The inquiry study is designed to function simultaneously on two levels: the first level (figure 1) invites study group members to think about themselves as learners, teachers, and scholars. At the…

  12. Collaborative work on evaluation of ovarian toxicity. 2) Two- or four-week repeated dose studies and fertility study of mifepristone in female rats.

    Science.gov (United States)

    Tamura, Toru; Yokoi, Ryohei; Okuhara, Yuji; Harada, Chiho; Terashima, Yukari; Hayashi, Morimichi; Nagasawa, Tatsuya; Onozato, Tomoya; Kobayashi, Kazuo; Kuroda, Junji; Kusama, Hiroshi

    2009-01-01

    In order to assess ovarian pathological changes and their relationship to changes in female fertility parameters, mifepristone, a progesterone receptor antagonist, was selected as the test article and was administered orally to female rats at dose levels of 0, 0.8, 4, 20 and 100 mg/kg for 2 or 4 weeks in repeated dose-toxicity studies and in a female fertility study at dose levels of 0, 0.8, 4 and 20 mg/kg from > 2 weeks before copulation to postcoital day 7. In the repeated dose toxicity studies, persistent estrus was seen in the vaginal smears, and multiple cysts in the ovaries at necropsy, increases in luteinized cysts and hypertrophy of previously formed corpora lutea were observed in the histopathological examination of ovaries in rats receiving 20 mg/kg or more for 2 or 4 weeks. In female fertility studies, persistent vaginal cornification was also observed at 20 mg/kg and the precoital interval was significantly shortened. All of the animals were completely infertile when dosed with 20 mg/kg during the post-coital period. An increase in pre-implantation losses was observed in the animals treated with 20 mg/kg during the pre-coital phase, while treatment with 4 mg/kg mifepristone during the post-coital phase induced an increase in post-implantation losses. These results suggested that a 2-week administration period would be sufficient to detect the ovarian toxicity of mifepristone in repeated dose toxicity study and the pathological findings in the ovaries would reflect the alterations in female reproductive endpoints in the female fertility study.

  13. Photometric Repeatability of Scanned Imagery: UVIS

    Science.gov (United States)

    Shanahan, Clare E.; McCullough, Peter; Baggett, Sylvia

    2017-08-01

    We provide the preliminary results of a study on the photometric repeatability of spatial scans of bright, isolated white dwarf stars with the UVIS channel of the Wide Field Camera 3 (WFC3) on the Hubble Space Telescope (HST). We analyze straight-line scans from the first pair of identical orbits of HST program 14878 to assess if sub 0.1% repeatability can be attained with WFC3/UVIS. This study is motivated by the desire to achieve better signal-to-noise in the UVIS contamination and stability monitor, in which observations of standard stars in staring mode have been taken from the installation of WFC3 in 2009 to the present to assess temporal photometric stability. Higher signal to noise in this program would greatly benefit the sensitivity to detect contamination, and to better characterize the observed small throughput drifts over time. We find excellent repeatability between identical visits of program 14878, with sub 0.1% repeatability achieved in most filters. These! results support the initiative to transition the staring mode UVIS contamination and photometric stability monitor from staring mode images to spatial scans.

  14. Inter-Simple Sequence Repeat (ISSR Markers to Study Genetic Diversity Among Cotton Cultivars in Associated with Salt Tolerance

    Directory of Open Access Journals (Sweden)

    Ali Akbar ABDI

    2012-11-01

    Full Text Available Developing salt-tolerant crops is very important as a significant proportion of cultivated land is salt-affected. Screening and selection of salt tolerant genotypes of cotton using DNA molecular markers not only introduce tolerant cultivars useful for hybridization and breeding programs but also detect DNA regions involved in mechanism of salinity tolerance. To study this, 28 cotton cultivars, including 8 Iranian cotton varieties were grown in pots under greenhouse condition and three salt treatments were imposed with salt solutions (0, 70 and 140 mM NaCl. Eight agronomic traits including root length, root fresh weight, root dry weight, chlorophyll and fluorescence index, K+ and Na+ contents in shoot (above ground biomass, and K+/Na+ ratio were measured. Cluster analysis of cultivars based on measured agronomic traits, showed �Cindose� and �Ciacra� as the most tolerant cultivars, and �B-557� and �43347� as the most sensitive cultivars of salt damage. A total of 65 polymorphic DNA fragments were generated at 14 inter-simple sequence repeat (ISSR loci. Plants of 28 cultivars of cotton grouped into three clusters based on ISSR markers. Regression analysis of markers in relation with traits data showed that 23, 33 and 30 markers associated with the measured traits in three salt treatments respectively. These markers might help breeders in any marker assisted selection program in order to improving cotton cultivars against salt stress.

  15. Are diagnostic criteria for acute malnutrition affected by hydration status in hospitalized children? A repeated measures study

    Directory of Open Access Journals (Sweden)

    Fegan Gregory

    2011-09-01

    Full Text Available Abstract Introduction Dehydration and malnutrition commonly occur together among ill children in developing countries. Dehydration (change in total body water is known to alter weight. Although muscle tissue has high water content, it is not known whether mid-upper arm circumference (MUAC may be altered by changes in tissue hydration. We aimed to determine whether rehydration alters MUAC, MUAC Z score (MUACz, weight-for-length Z-score (WFLz and classification of nutritional status among hospitalised Kenyan children admitted with signs of dehydration. Study procedure We enrolled children aged from 3 months to 5 years admitted to a rural Kenyan district hospital with clinical signs compatible with dehydration, and without kwashiorkor. Anthropometric measurements were taken at admission and repeated after 48 hours of treatment, which included rehydration by WHO protocols. Changes in weight observed during this period were considered to be due to changes in hydration status. Results Among 325 children (median age 11 months the median weight gain (rehydration after 48 hours was 0.21 kg, (an increase of 2.9% of admission body weight. Each 1% change in weight was associated with a 0.40 mm (95% CI: 0.30 to 0.44 mm, p Conclusion MUAC is less affected by dehydration than WFLz and is therefore more suitable for nutritional assessment of ill children. However, both WFLz and MUAC misclassify SAM among dehydrated children. Nutritional status should be re-evaluated following rehydration, and management adjusted accordingly.

  16. A Study for the Characteristic Changes Under the Repeated Thermal Exposure in the Process of Repairing Aircraft Sandwich Structures

    Science.gov (United States)

    Kim, Yun Hae; Han, Joong Won; Kim, Don Won; Choi, Byung Keun; Murakami, R.

    Delamination can be observed in the sound areas during and/or after a couple times exposure to the elevated curing temperature due to the repeated repair condition. This study was conducted for checking the degree of degradation of properties of the cured parts and delamination between skin prepreg and honeycomb core. Specimens with glass honeycomb sandwich construction and glass/epoxy prepreg were prepared. The specimens were cured 1 to 5 times at 260°F in an autoclave and each additionally exposed 50, 100 and 150 hours in the 260°F oven. Each specimen was tested for tensile strength, compressive strength, flatwise tensile strength and interlaminar shear strength. To monitor the characteristics of the resin itself, the cured resin was tested using DMA and DSC. As a results, the decrease of Tg value were observed in the specific specimen which is exposed over 50 hrs at 260°F. This means the change or degradative of resin properties is also related to the decrease of flatwise tensile properties. Accordingly, minimal exposure on the curing temperature is recommended for parts in order to prevent the delation and maintain the better condition.

  17. Public perception of drinking water safety in South Africa 2002–2009: a repeated cross-sectional study

    Directory of Open Access Journals (Sweden)

    Wright Jim A

    2012-07-01

    Full Text Available Abstract Background In low and middle income countries, public perceptions of drinking water safety are relevant to promotion of household water treatment and to household choices over drinking water sources. However, most studies of this topic have been cross-sectional and not considered temporal variation in drinking water safety perceptions. The objective of this study is to explore trends in perceived drinking water safety in South Africa and its association with disease outbreaks, water supply and household characteristics. Methods This repeated cross-sectional study draws on General Household Surveys from 2002–2009, a series of annual nationally representative surveys of South African households, which include a question about perceived drinking water safety. Trends in responses to this question were examined from 2002–2009 in relation to reported cholera cases. The relationship between perceived drinking water safety and organoleptic qualities of drinking water, supply characteristics, and socio-economic and demographic household characteristics was explored in 2002 and 2008 using hierarchical stepwise logistic regression. Results The results suggest that perceived drinking water safety has remained relatively stable over time in South Africa, once the expansion of improved supplies is controlled for. A large cholera outbreak in 2000–02 had no apparent effect on public perception of drinking water safety in 2002. Perceived drinking water safety is primarily related to water taste, odour, and clarity rather than socio-economic or demographic characteristics. Conclusion This suggests that household perceptions of drinking water safety in South Africa follow similar patterns to those observed in studies in developed countries. The stability over time in public perception of drinking water safety is particularly surprising, given the large cholera outbreak that took place at the start of this period.

  18. Contributions by the CAG-repeat Polymorphism of the Androgen Receptor Gene and Circulating Androgens to Muscle Size. Odense Androgen Study - A Population-based Study of 20-29 Year-old Danish Men

    DEFF Research Database (Denmark)

    Nielsen, Torben Leo; Hagen, Claus; Wraae, Kristian;

    2007-01-01

    Context: The number of CAG-repeats within the CAG-repeat polymorphism of the androgen receptor gene is inversely correlated with the transcriptional activity of the androgen receptor. Objective: To study the effect of the CAG-repeat number and circulating androgens on muscle size, to examine......-repeat number correlated inversely with thigh and axial muscle area and with lower and upper extremity lean body mass. Except for upper extremity lean body mass, these findings remained significant in multivariate analyses controlling for circulating androgens, physical activity, smoking, alcohol intake...

  19. Experimental studies of some moderately fast processes initiated by radiation

    Science.gov (United States)

    Butler, J.; Hodgson, B. W.; M. Hoey, Brigid; Land, E. J.; Lea, J. S.; Lindley, Elizabeth J.; Rushton, F. A. P.; Swallow, A. J.

    Numerous improvements have been made to the Paterson Institute linear accelerator since its installation in 1967. New light sources, improved light guidance, smaller cells and a wider range of photo-detecting devices are now in routine use. Data are collected and processed by a computer-based method which has replaced the original oscilloscope-based system. Processes taking place over more than a few seconds can be studied with an arrangement combining pulse radiolysis with an ordinary spectrophotometer and arrangements for "single-shot" studies of faster processes are now being designed. Detection methods are also available which do not rely on transmission of light, and transient changes in conductivity can be measured. Among the systems which have been extensively studied are the Fricke dosimeter, in which measured overall yields can now be quantitatively correlated with the rate constants of 34 individual reactions taking place. Studies have also been conducted with peptides and proteins in which electrochemically-driven charge transfers have been demonstrated between methionine, tryptophan, tyrosine and cysteine/cystine units. Free radical reactions in Mitomycin C have been elucidated which are consistent with pulse radiolysis observations and the formation of radiolytic products as determined by HPLC. Adriamycin reduction has also been studied: the Adriamycin semiquinone is unusually stable with respect to dismutation but its lifetime is limited by a decomposition process in which daunosamine is expelled. The expulsion is followed by a further rearrangement. Many of the reactions investigated require tens or hundreds of seconds to reach essential completion.

  20. STUDIES ON THE INITIATION MECHANISM OF CERIC ION AND ACETYLACETONE REDOX SYSTEM IN VINYL POLYMERIZATION

    Institute of Scientific and Technical Information of China (English)

    QIU Kunyuan; GUO Xinqiu; ZHANG Dong; FENG Xinde

    1991-01-01

    The initiation mechanism of acrylamide (AAM)polymerization using ceric ion/acetylacetone system as an initiator has been studied. The redox polymerization was revealed by the low value of overall activation energy ofAAm polymerization. The structure of free radicals formed from above-mentioned initiation sytem were detected by radical trapping and ESR spectra techniques and the end groups of polymers obtained were determined by FT-IR spectra analysis method. Based on these results the initiation mechanism is proposed.

  1. Evaluating a Tacit Knowledge Sharing Initiative: A Case Study

    Science.gov (United States)

    Gubbins, Claire; Corrigan, Siobhan; Garavan, Thomas N.; O'Connor, Christy; Leahy, Damien; Long, David; Murphy, Eamonn

    2012-01-01

    Purpose: This paper aims to present a case study illustrating the issues involved in the tacit knowledge conversion process and to determine whether such conversion delivers value to the organisation in terms of business value and return on investment (ROI). Design/methodology/approach: A single-case multiple baseline participants experimental…

  2. Residential Grief Camps: An Initial Phenomenological Study of Staff Perspectives

    Science.gov (United States)

    Brown, Tiffany B.; Kimball, Thomas G.

    2012-01-01

    Research has focused primarily on the impact of death on family functioning and the stages and tasks of grief, though little attention has been given to grief camps or the experiences of those who work there. This study explored the experiences of staff at a four-day overnight children's grief camp. Eight participants reported their experience of…

  3. Small modular biopower initiative Phase 1 feasibility studies executive summaries

    Energy Technology Data Exchange (ETDEWEB)

    Bain, R.

    2000-03-06

    The Phase 1 objective is a feasibility study that includes a market assessment, resource assessment, preliminary system design, and assessment of relevant environmental and safety considerations, and evaluation of financial and cost issues, and a preliminary business plan and commercialization strategy. Each participating company will share at least 20% of the cost of the first phase.

  4. Repeated Insulin-like Growth Factor 1 (IGF1 treatment in a patient with Rett Syndrome: a single case study

    Directory of Open Access Journals (Sweden)

    Giorgio ePini

    2014-06-01

    Full Text Available Rett syndrome (RTT is a devastating neurodevelopmental disorder that has no cure. Patients show regression of acquired skills, motor and speech impairment, cardio-respiratory distress, microcephaly and stereotyped hand movements. The majority of RTT patients display mutations in the gene that codes for the Methyl-CpG binding protein 2 (MeCP2, which is involved in the development of the central nervous system, especially synaptic and circuit maturation. Thus, agents that promote brain development and synaptic function are good candidates for ameliorating the symptoms of RTT. In particular, Insulin-like growth Factor 1 (IGF1 and its active peptide (1-3IGF1 cross the Blood Brain Barrier, and therefore are ideal treatments for RTT Indeed, both (1-3IGF1 and IGF1 treatment significantly ameliorates RTT symptoms in a mouse model of the disease In a previous study we established that IGF1 is safe and well tolerated on Rett patients. In this open label clinical case study, we assess the safety and tolerability of IGF1 administration in two cycles of the treatment. Before and after each cycle we monitored the clinical and blood parameters, autonomic function and social and cognitive abilities, and we found that IGF1 was well tolerated each time and did not induce any side effect, nor it interfered with the other treatments that the patient was undergoing. We noticed a moderate improvement in the cognitive, social and autonomic abilities of the patient after each cycle but the benefits were not retained between the two cycles, consistent with the preclinical observation that treatments for RTT should be administered through life. We find that repeated IGF1 treatment is safe and well tolerated in Rett patients but observed effects are not retained between cycles. These results have applications to other pathologies considering that IGF1 has been shown to be effective in other disorders of the autism spectrum.

  5. Repeated insulin-like growth factor 1 treatment in a patient with rett syndrome: a single case study.

    Science.gov (United States)

    Pini, Giorgio; Scusa, M Flora; Benincasa, Alberto; Bottiglioni, Ilaria; Congiu, Laura; Vadhatpour, Cyrus; Romanelli, Anna Maria; Gemo, Ilaria; Puccetti, Chetti; McNamara, Rachel; O'Leary, Seán; Corvin, Aiden; Gill, Michael; Tropea, Daniela

    2014-01-01

    Rett syndrome (RTT) is a devastating neurodevelopmental disorder that has no cure. Patients show regression of acquired skills, motor, and speech impairment, cardio-respiratory distress, microcephaly, and stereotyped hand movements. The majority of RTT patients display mutations in the gene that codes for the Methyl-CpG binding protein 2 (MeCP2), which is involved in the development of the central nervous system, especially synaptic and circuit maturation. Thus, agents that promote brain development and synaptic function are good candidates for ameliorating the symptoms of RTT. In particular, insulin-like growth factor 1 (IGF1) and its active peptide (1-3) IGF1 cross the Blood Brain Barrier, and therefore are ideal treatments for RTT Indeed, both (1-3) IGF1 and IGF1 treatment significantly ameliorates RTT symptoms in a mouse model of the disease In a previous study, we established that IGF1 is safe and well tolerated on Rett patients. In this open label clinical case study, we assess the safety and tolerability of IGF1 administration in two cycles of the treatment. Before and after each cycle, we monitored the clinical and blood parameters, autonomic function, and social and cognitive abilities, and we found that IGF1 was well tolerated each time and did not induce any side effect, nor it interfered with the other treatments that the patient was undergoing. We noticed a moderate improvement in the cognitive, social, and autonomic abilities of the patient after each cycle but the benefits were not retained between the two cycles, consistent with the pre-clinical observation that treatments for RTT should be administered through life. We find that repeated IGF1 treatment is safe and well tolerated in Rett patients but observed effects are not retained between cycles. These results have applications to other pathologies considering that IGF1 has been shown to be effective in other disorders of the autism spectrum.

  6. Intermediate CAG repeat expansion in the ATXN2 gene is a unique genetic risk factor for ALS--a systematic review and meta-analysis of observational studies.

    Directory of Open Access Journals (Sweden)

    Ming-Dong Wang

    Full Text Available Amyotrophic lateral sclerosis (ALS is a rare degenerative condition of the motor neurons. Over 10% of ALS cases are linked to monogenic mutations, with the remainder thought to be due to other risk factors, including environmental factors, genetic polymorphisms, and possibly gene-environmental interactions. We examined the association between ALS and an intermediate CAG repeat expansion in the ATXN2 gene using a meta-analytic approach. Observational studies were searched with relevant disease and gene terms from MEDLINE, EMBASE, and PsycINFO from January 2010 through to January 2014. All identified articles were screened using disease terms, gene terms, population information, and CAG repeat information according to PRISMA guidelines. The final list of 17 articles was further evaluated based on the study location, time period, and authors to exclude multiple usage of the same study populations: 13 relevant articles were retained for this study. The range 30-33 CAG repeats in the ATXN2 gene was most strongly associated with ALS. The meta-analysis revealed that the presence of an intermediate CAG repeat (30-33 in the ATXN2 gene was associated with an increased risk of ALS [odds ratio (OR = 4.44, 95%CI: 2.91-6.76] in Caucasian ALS patients. There was no significant difference in the association of this CAG intermediate repeat expansion in the ATXN2 gene between familial ALS cases (OR = 3.59, 1.58-8.17 and sporadic ALS cases (OR = 3.16, 1.88-5.32. These results indicate that the presence of intermediate CAG repeat expansion in the ATXN2 gene is a specific genetic risk factor for ALS, unlike monogenic mutations with an autosomal dominant transmission mode, which cause a more severe phenotype of ALS, with a higher prevalence in familial ALS.

  7. Intermediate CAG repeat expansion in the ATXN2 gene is a unique genetic risk factor for ALS--a systematic review and meta-analysis of observational studies.

    Science.gov (United States)

    Wang, Ming-Dong; Gomes, James; Cashman, Neil R; Little, Julian; Krewski, Daniel

    2014-01-01

    Amyotrophic lateral sclerosis (ALS) is a rare degenerative condition of the motor neurons. Over 10% of ALS cases are linked to monogenic mutations, with the remainder thought to be due to other risk factors, including environmental factors, genetic polymorphisms, and possibly gene-environmental interactions. We examined the association between ALS and an intermediate CAG repeat expansion in the ATXN2 gene using a meta-analytic approach. Observational studies were searched with relevant disease and gene terms from MEDLINE, EMBASE, and PsycINFO from January 2010 through to January 2014. All identified articles were screened using disease terms, gene terms, population information, and CAG repeat information according to PRISMA guidelines. The final list of 17 articles was further evaluated based on the study location, time period, and authors to exclude multiple usage of the same study populations: 13 relevant articles were retained for this study. The range 30-33 CAG repeats in the ATXN2 gene was most strongly associated with ALS. The meta-analysis revealed that the presence of an intermediate CAG repeat (30-33) in the ATXN2 gene was associated with an increased risk of ALS [odds ratio (OR) = 4.44, 95%CI: 2.91-6.76)] in Caucasian ALS patients. There was no significant difference in the association of this CAG intermediate repeat expansion in the ATXN2 gene between familial ALS cases (OR = 3.59, 1.58-8.17) and sporadic ALS cases (OR = 3.16, 1.88-5.32). These results indicate that the presence of intermediate CAG repeat expansion in the ATXN2 gene is a specific genetic risk factor for ALS, unlike monogenic mutations with an autosomal dominant transmission mode, which cause a more severe phenotype of ALS, with a higher prevalence in familial ALS.

  8. Learning Assistant Supported Student Outcomes (LASSO) study initial findings

    CERN Document Server

    Van Dusen, Ben; Otero, Valerie

    2015-01-01

    This study investigates how faculty, student, and course features are linked to student outcomes in Learning Assistant (LA) supported courses. Over 4,500 students and 17 instructors from 13 LA Alliance member institutions participated in the study. Each participating student completed an online concept inventory at the start (pre) and end (post) of their term. The physics concept inventories included Force and Motion Concept Evaluation (FMCE) and the Brief Electricity and Magnetism Assessment (BEMA). Concepts inventories from the fields of biology and chemistry were also included. Our analyses utilize hierarchical linear models that nest student level data (e.g. pre/post scores and gender) within course level data (e.g. discipline and course enrollment) to build models that examine student outcomes across institutions and disciplines. We report findings on the connections between students' outcomes and their gender, race, and time spent working with LAs as well as instructors' experiences with LAs.

  9. A review of the reporting and handling of missing data in cohort studies with repeated assessment of exposure measures

    Directory of Open Access Journals (Sweden)

    Karahalios Amalia

    2012-07-01

    Full Text Available Abstract Background Retaining participants in cohort studies with multiple follow-up waves is difficult. Commonly, researchers are faced with the problem of missing data, which may introduce biased results as well as a loss of statistical power and precision. The STROBE guidelines von Elm et al. (Lancet, 370:1453-1457, 2007; Vandenbroucke et al. (PLoS Med, 4:e297, 2007 and the guidelines proposed by Sterne et al. (BMJ, 338:b2393, 2009 recommend that cohort studies report on the amount of missing data, the reasons for non-participation and non-response, and the method used to handle missing data in the analyses. We have conducted a review of publications from cohort studies in order to document the reporting of missing data for exposure measures and to describe the statistical methods used to account for the missing data. Methods A systematic search of English language papers published from January 2000 to December 2009 was carried out in PubMed. Prospective cohort studies with a sample size greater than 1,000 that analysed data using repeated measures of exposure were included. Results Among the 82 papers meeting the inclusion criteria, only 35 (43% reported the amount of missing data according to the suggested guidelines. Sixty-eight papers (83% described how they dealt with missing data in the analysis. Most of the papers excluded participants with missing data and performed a complete-case analysis (n = 54, 66%. Other papers used more sophisticated methods including multiple imputation (n = 5 or fully Bayesian modeling (n = 1. Methods known to produce biased results were also used, for example, Last Observation Carried Forward (n = 7, the missing indicator method (n = 1, and mean value substitution (n = 3. For the remaining 14 papers, the method used to handle missing data in the analysis was not stated. Conclusions This review highlights the inconsistent reporting of missing data in cohort studies and the continuing

  10. A review of the reporting and handling of missing data in cohort studies with repeated assessment of exposure measures.

    Science.gov (United States)

    Karahalios, Amalia; Baglietto, Laura; Carlin, John B; English, Dallas R; Simpson, Julie A

    2012-07-11

    Retaining participants in cohort studies with multiple follow-up waves is difficult. Commonly, researchers are faced with the problem of missing data, which may introduce biased results as well as a loss of statistical power and precision. The STROBE guidelines von Elm et al. (Lancet, 370:1453-1457, 2007); Vandenbroucke et al. (PLoS Med, 4:e297, 2007) and the guidelines proposed by Sterne et al. (BMJ, 338:b2393, 2009) recommend that cohort studies report on the amount of missing data, the reasons for non-participation and non-response, and the method used to handle missing data in the analyses. We have conducted a review of publications from cohort studies in order to document the reporting of missing data for exposure measures and to describe the statistical methods used to account for the missing data. A systematic search of English language papers published from January 2000 to December 2009 was carried out in PubMed. Prospective cohort studies with a sample size greater than 1,000 that analysed data using repeated measures of exposure were included. Among the 82 papers meeting the inclusion criteria, only 35 (43%) reported the amount of missing data according to the suggested guidelines. Sixty-eight papers (83%) described how they dealt with missing data in the analysis. Most of the papers excluded participants with missing data and performed a complete-case analysis (n=54, 66%). Other papers used more sophisticated methods including multiple imputation (n=5) or fully Bayesian modeling (n=1). Methods known to produce biased results were also used, for example, Last Observation Carried Forward (n=7), the missing indicator method (n=1), and mean value substitution (n=3). For the remaining 14 papers, the method used to handle missing data in the analysis was not stated. This review highlights the inconsistent reporting of missing data in cohort studies and the continuing use of inappropriate methods to handle missing data in the analysis. Epidemiological journals

  11. Duct Leakage Repeatability Testing

    Energy Technology Data Exchange (ETDEWEB)

    Walker, Iain [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Sherman, Max [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2014-01-01

    Duct leakage often needs to be measured to demonstrate compliance with requirements or to determine energy or Indoor Air Quality (IAQ) impacts. Testing is often done using standards such as ASTM E1554 (ASTM 2013) or California Title 24 (California Energy Commission 2013 & 2013b), but there are several choices of methods available within the accepted standards. Determining which method to use or not use requires an evaluation of those methods in the context of the particular needs. Three factors that are important considerations are the cost of the measurement, the accuracy of the measurement and the repeatability of the measurement. The purpose of this report is to evaluate the repeatability of the three most significant measurement techniques using data from the literature and recently obtained field data. We will also briefly discuss the first two factors. The main question to be answered by this study is to determine if differences in the repeatability of these tests methods is sufficient to indicate that any of these methods is so poor that it should be excluded from consideration as an allowed procedure in codes and standards.

  12. The paperless labeling initiative: a proof-of-concept study.

    Science.gov (United States)

    Ruchalski, Charles

    2004-01-01

    Traditional paper professional package inserts (PPIs) are used on a daily basis by a variety of healthcare providers to locate and disseminate drug information. Unfortunately, paper PPIs are sometimes not accessible to the healthcare provider, appear unreadable due to varied font sizes, and are often considered not to be user-friendly. In December 2000, the Food and Drug Administration proposed regulations that would revise the format of PPIs. To determine whether electronic delivery of PPI information is achievable in community pharmacy practice settings. Electronic PPIs are an alternative means of delivering this information. This 12-week proof-of-concept study evaluated the Health Information Designs/Thomson Healthcare and Etreby Computer Company for electronic delivery of PPIs in 6 chain and 4 independent community pharmacies, with 5 pharmacies evaluating each system. Participating pharmacists were asked 9 questions designed to determine the feasibility of implementing electronic PPI delivery, as well as pharmacist satisfaction with each system. Pharmacists deemed both systems to be accessible and user-friendly. Pharmacists from both groups felt that the electronic PPIs were challenging to read and that printing took too long. Future studies in a more diverse selection of dispensing sites, including pharmacies (community and hospital based), clinics, and physician practices, need to be performed to maximize the use of electronic PPIs.

  13. Origin and fate of repeats in bacteria.

    Science.gov (United States)

    Achaz, G; Rocha, E P C; Netter, P; Coissac, E

    2002-07-01

    We investigated 53 complete bacterial chromosomes for intrachromosomal repeats. In previous studies on eukaryote chromosomes, we proposed a model for the dynamics of repeats based on the continuous genesis of tandem repeats, followed by an active process of high deletion rate, counteracted by rearrangement events that may prevent the repeats from being deleted. The present study of long repeats in the genomes of Bacteria and Archaea suggests that our model of interspersed repeats dynamics may apply to them. Thus the duplication process might be a consequence of very ancient mechanisms shared by all three domains. Moreover, we show that there is a strong negative correlation between nucleotide composition bias and the repeat density of genomes. We hypothesise that in highly biased genomes, non-duplicated small repeats arise more frequently by random effects and are used as primers for duplication mechanisms, leading to a higher density of large repeats.

  14. Initial MPTS study results: Design considerations and issues

    Science.gov (United States)

    Maynard, O. E.

    1980-01-01

    One of the key issues identified during investigations of microwave power transmission systems from 1965 to 1976 was the need to assure that the billions of diodes on ground-based rectennas are sufficiently reliable to support long life times of approximately 30 years. Major systems studies conducted focused on waveguides; radio frequency interference and biological considerations; the relationship between performance, weight, and cost; risk assessment; crossed field directional amplifier noise; a 48 kW klystron; effects of the environment on propagation and phase control; rectenna technology; a rationale for the ground power density region; alternate technologies for orbital assembly; ionospheric effects and phase control; and reception conversion (rf to dc collector/converter).

  15. ProtRepeatsDB: a database of amino acid repeats in genomes

    Directory of Open Access Journals (Sweden)

    Chauhan Virander S

    2006-07-01

    Full Text Available Abstract Background Genome wide and cross species comparisons of amino acid repeats is an intriguing problem in biology mainly due to the highly polymorphic nature and diverse functions of amino acid repeats. Innate protein repeats constitute vital functional and structural regions in proteins. Repeats are of great consequence in evolution of proteins, as evident from analysis of repeats in different organisms. In the post genomic era, availability of protein sequences encoded in different genomes provides a unique opportunity to perform large scale comparative studies of amino acid repeats. ProtRepeatsDB http://bioinfo.icgeb.res.in/repeats/ is a relational database of perfect and mismatch repeats, access to which is designed as a resource and collection of tools for detection and cross species comparisons of different types of amino acid repeats. Description ProtRepeatsDB (v1.2 consists of perfect as well as mismatch amino acid repeats in the protein sequences of 141 organisms, the genomes of which are now available. The web interface of ProtRepeatsDB consists of different tools to perform repeat s; based on protein IDs, organism name, repeat sequences, and keywords as in FASTA headers, size, frequency, gene ontology (GO annotation IDs and regular expressions (REGEXP describing repeats. These tools also allow formulation of a variety of simple, complex and logical queries to facilitate mining and large-scale cross-species comparisons of amino acid repeats. In addition to this, the database also contains sequence analysis tools to determine repeats in user input sequences. Conclusion ProtRepeatsDB is a multi-organism database of different types of amino acid repeats present in proteins. It integrates useful tools to perform genome wide queries for rapid screening and identification of amino acid repeats and facilitates comparative and evolutionary studies of the repeats. The database is useful for identification of species or organism specific

  16. Twenty-eight-day repeated inhalation toxicity study of nano-sized lanthanum oxide in male sprague-dawley rats.

    Science.gov (United States)

    Shin, Seo-Ho; Lim, Cheol-Hong; Kim, Yong-Soon; Lee, Yong-Hoon; Kim, Sung-Hwan; Kim, Jong-Choon

    2017-04-01

    Although the use of lanthanum has increased in field of high-tech industry worldwide, potential adverse effects to human health and to the environment are largely unknown. The present study aimed to investigate the potential toxicity of nano-sized lanthanum oxide (La2 O3 ) following repeated inhalation exposure in male Sprague-Dawley rats. Male rats were exposed nose-only to nano-sized La2 O3 for 28 days (5 days/week) at doses of 0, 0.5, 2.5, and 10 mg/m(3) . In the experimental period, we evaluated treatment-related changes including clinical signs, body weight, hematology, serum biochemistry, necropsy findings, organ weight, and histopathology findings. We also analyzed lanthanum distribution in the major organs and in the blood, bronchoalveolar lavage fluids (BALF), and oxidative stress in lung tissues. Lanthanum level was highest in lung tissues and showed a dose-dependent relation. Alveolar proteinosis was observed in all treatment groups and was accompanied by an increase in lung weight; moreover, lung inflammation was observed in the 2.5 mg/m(3) and higher dose groups and was accompanied by an increase in white blood cells. In the BALF, total cell counts including macrophages and neutrophils, lactate dehydrogenase, albumin, nitric oxide, and tumor necrosis factor-alpha increased significantly in all treatment groups. Furthermore, these changes tended to deteriorate in the 10 mg/m(3) group at the end of the recovery period. In the present experimental conditions, we found that the lowest-observed-adverse-effect level of nano-sized La2 O3 was 0.5 mg/m(3) in male rats, and the target organ was the lung. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 1226-1240, 2017. © 2016 Wiley Periodicals, Inc.

  17. Study of OH-initiated degradation of 2-aminoethanol

    Directory of Open Access Journals (Sweden)

    M. Karl

    2011-10-01

    Full Text Available The degradation of 2-aminoethanol (MEA by the hydroxyl radical (OH was studied in the European Photoreactor (EUPHORE, a large outdoor environmental chamber. High-Temperature Proton-Transfer-Reaction Mass Spectrometry (HT-PTR-MS and Fast Fourier Transform Infrared (FT-IR were used to follow concentrations of reactants in the gas phase. Aerosol mass concentrations were tracked with Aerosol Mass Spectrometry (AMS. The chamber aerosol model MAFOR was applied to quantify losses of MEA to the particle phase. The rate constant k(OH+MEA was determined relative to the rate constant of the 1,3,5-trimethylbenzene reaction with OH and was found to be (9.2 ± 1.1×10−11 cm3 molecule−1 s−1, and thus the reaction between OH radicals and MEA proceeds a factor of 2–3 faster than estimated by structure-activity relationship (SAR methods. Main uncertainty of the relative rate determination is the unknown temporal behaviour of the loss rate of MEA to chamber wall surfaces during the sunlit experiments. Nucleation and growth of particles observed in the experiments could be reproduced by the chamber model that accounted for condensation of gaseous oxidation products, condensation of ethanolaminium nitrate and nucleation involving MEA and nitric acid.

  18. Ultrasound cylindrical phased array for transoesophageal thermal therapy: initial studies

    Energy Technology Data Exchange (ETDEWEB)

    Melodelima, David [INSERM, Unite 556, 151 Cours Albert Thomas, 69424 Lyon (France); Lafon, Cyril [INSERM, Unite 556, 151 Cours Albert Thomas, 69424 Lyon (France); Prat, Frederic [Centre Hospitalier Bicetre, 78 Avenue General Leclerc, 94275 Le Kremlin Bicetre (France); Birer, Alain [INSERM, Unite 556, 151 Cours Albert Thomas, 69424 Lyon (France); Cathignol, Dominique [INSERM, Unite 556, 151 Cours Albert Thomas, 69424 Lyon (France)

    2002-12-07

    This work was undertaken to investigate the feasibility of constructing a cylindrical phased array composed of 64 elements spread around the periphery (OD 10.6 mm) for transoesophageal ultrasound thermotherapy. The underlying operating principle of this applicator is to rotate a plane ultrasound beam electronically. For this purpose, eight adjacent transducers were successively excited with appropriate delay times so as to generate a plane wave. The exposure direction was changed by exciting a different set of eight elements. For these feasibility studies, we used a cylindrical prototype (OD 10.6 mm) composed of 16 elementary transducers distributed over a quarter of the cylinder, all operating at 4.55 MHz. The active part was mechanically reinforced by a rigid damper structure behind the transducers. It was shown that an ultrasound field similar to that emitted by a plane transducer could be generated. Ex vivo experiments on pig's liver demonstrated that the ultrasound beam could be accurately rotated to generate sector-based lesions to a suitable depth (up to 19 mm). Throughout these experiments, exposures lasting 20 s were delivered at an acoustic intensity of 17 W cm{sup -2}. By varying the power from exposure to exposure, the depth of the lesion at different angles could be controlled.

  19. [C-11]raclopride-PET studies of the Huntington's disease rate of progression : Relevance of the trinucleotide repeat length

    NARCIS (Netherlands)

    Antonini, A; Leenders, KL; Eidelberg, D

    1998-01-01

    We used [C-11]raclopride and positron emission tomography (PET) to assess the relationship between striatal dopamine D2 receptor binding, trinucleotide repeat number (GAG), and subject age in 10 asymptomatic and 8 symptomatic carriers of the Huntington's disease (HD) mutation. In both preclinical an

  20. Pharmacokinetic evaluation of pamidronate after oral administration: a study on dose proportionality, absolute bioavailability, and effect of repeated administration

    DEFF Research Database (Denmark)

    Hyldstrup, Lars; Flesch, G; Hauffe, S A

    1993-01-01

    30 minutes at constant infusion rate. Repeated peroral doses (75 and 150 mg) were administered to 12 females (aged 51-70 years) for 10 consecutive days. Urinary excretion of pamidronate after peroral and i.v. administration was used for estimation of pamidronate absorption. Renal excretion...

  1. Primary and Repeat Cesarean Deliveries: A Population-based Study in the United States, 1979-2010.

    Science.gov (United States)

    Ananth, Cande V; Friedman, Alexander M; Keyes, Katherine M; Lavery, Jessica A; Hamilton, Ava; Wright, Jason D

    2017-07-01

    Despite the temporal increase in cesarean deliveries, the extent to which maternal age, period, and maternal birth cohorts may have contributed to these trends remains unknown. We performed an analysis of 123 million singleton deliveries in the United States (1979-2010). We estimated rate ratio (RR) with 95% confidence interval (CI) for primary and repeat cesarean deliveries. We examined changes in cesarean rates with weighted Poisson regression models across three time-scales: maternal age, year of delivery, and birth cohort (mother's birth year). The primary cesarean rate increased by 68% (95% confidence interval [CI]: 67%, 69%) between 1979 (11.0%) and 2010 (18.5%). Repeat cesarean deliveries increased by 178% (95% CI: 176, 179) from 5.2% in 1979 to 14.4% in 2010. Cesarean rates increased with advancing age. Compared with 1979, the RR for the period effect in primary and repeat cesarean deliveries increased up to 1990, fell to a nadir at 1993, and began to rise thereafter. A small birth cohort effect was evident, with women born before 1950 at increased risk of primary cesarean; no cohort effect was seen for repeat cesarean deliveries. Adjustment for maternal BMI had a small effect on these findings. Period effects in primary cesarean were explained by a combination of trends in obesity and chronic hypertension, as well as demographic shifts over time. Maternal age and period appear to have important contributions to the temporal increase in the cesarean rates, although the effect of parity on these associations remains undetermined.

  2. A Cross-Sectional Study on the Perceptions and Practices of Teenagers With Inflammatory Bowel Disease About Repeated Stool Sampling

    NARCIS (Netherlands)

    Heida, Anke; Dijkstra, Alie; Dantuma, Sietske K.; van Rheenen, Patrick F.

    2016-01-01

    Purpose: Repeated stool sampling to monitor disease activity is increasingly used in teenagers with inflammatory bowel disease (IBD). Knowledge about their perceptions and practices regarding collection of feces will increase the success rate of this monitoring strategy. Methods: We sent a survey to

  3. Experimental Study on the Small Flyer Initiating Behavior of Fine-grained Explosives

    Institute of Scientific and Technical Information of China (English)

    TAN Ying-xin; TAN Ru-mei; ZHANG Jing-lin

    2005-01-01

    The initiating behavior of fine-grained explosives by small flyer is studied. The diameter of small flyer in this device is 1mm. The test results indicate that the granularity of explosives has great effect on its flyer initiating sensitivity.The flyer initiating sensitivity of the fine-grained explosives is higher and the critical initiating energy is lower than that of common explosives. For common explosive, the flyer initiating sensitivity increases as the density is reduced. But for the fine-grained explosive, the test results are exactly opposite.

  4. Repeated administration of D-amphetamine induces loss of [I-123]FP-CIT binding to striatal dopamine transporters in rat brain: a validation study

    NARCIS (Netherlands)

    J. Booij; K. de Bruin; W.B. Gunning

    2006-01-01

    In recent years, several PET and SPECT studies have shown loss of striatal dopamine transporter (DAT) binding in arnphetamine (AMPH) users. However, the use of DAT SPECT tracers to detect AMPH-induced changes in DAT binding has not been validated. We therefore examined if repeated administration of

  5. Prospective study on the determinants of repeat attendance and attendance patterns in breast cancer screening using the Theory of Planned Behaviour

    NARCIS (Netherlands)

    Drossaert, C.H.C.; Boer, H.; Seydel, E.R.

    2003-01-01

    This prospective study, using the Theory of Planned Behaviour (TPB) as a theoretical framework, was carried out to identify the determinants of repeat attendance and attendance patterns in organised breast screening. A group of 2657 women filled out a baseline questionnaire, approximately 8 weeks af

  6. Optimizing prostate biopsy for repeat transrectal prostate biopsies patients

    Institute of Scientific and Technical Information of China (English)

    Xiaojun Deng; Jianwei Cao; Feng Liu; Weifeng Wang; Jidong Hao; Jiansheng Wan; Hui Liu

    2014-01-01

    Objective:Diagnosis of patients with negative prostate biopsy and persistent suspicion of prostate cancer re-mains a serious problem. In this study, we investigated the application of optimizing prostate biopsy for patients who need repeat prostate biopsy. Methods:In this prospective, non-randomized phase-I clinical trial, the prostate cancer detection rate of initial detection scheme was compared with optimizing prostate biopsy scheme. The number of punctures of initial detection scheme was the same as that of optimizing prostate biopsy scheme. The puncture direction of optimizing prostate biopsy was a 45° angle to the sagittal plane from front, middle, and back. The two cores from each lateral lobe were horizontal y inwardly inclined 45°. Results:A total of 45 patients with initial negative biopsy for cancer were received the optimizing prostate biopsy scheme. The cancer detection rate was 17.8%(8/45), and prostate intraepithelial neoplasm (PIN) was 6.7%(3/45). The pa-tients receiving repeat transrectal prostate biopsies were pathological y diagnosed as lower Gleason grade prostate cancers. Conclusion:The cancer detection rate of repeat biopsy prostate cancer is lower than that of initial biopsy. Our study showed that the optimizing prostate biopsy is important to improve the detection rate of repeat transrectal prostate biopsies patients.

  7. Repeated fine-needle aspiration cytology for the diagnosis and follow-up of thyroid nodules

    Directory of Open Access Journals (Sweden)

    Agnaldo José Graciano

    2014-10-01

    Full Text Available INTRODUCTION: The recently-proposed Bethesda reporting system has offered clinical recommendations for each category of reported thyroid cytology, including repeated fine-needle aspiration (FNA for non-diagnostic and atypia/follicular lesions of undetermined significance, but there are no sound indications for repeated examination after an initial benign exam. OBJECTIVE: To investigate the clinical validity of repeated FNA in the management of patients with thyroid nodules. METHOD: The present study evaluated 412 consecutive patients who had repeated aspiration biopsies of thyroid nodules after an initial non-diagnostic, atypia/follicular lesion of undetermined significance, or benign cytology. RESULTS: The majority of patients were female (93.5% ranging from 13 to 83 years. Non-diagnostic cytology was the most common indication for a repeated examination in 237 patients (57.5%, followed by benign (36.8%, and A/FLUS (5.6% cytology. A repeated examination altered the initial diagnosis in 70.5% and 78.3% of the non-diagnostic and A/FLUS patients, respectively, whereas only 28.9% of patients with a benign cytology presented with a different diagnosis on a sequential FNA. CONCLUSIONS: Repeat FNA is a valuable procedure in cases with initial non-diagnostic or A/FLUS cytology, but its routine use for patients with an initial benign examination appears to not increase the expected likelihood of a malignant finding.

  8. Automatization and familiarity in repeated checking

    NARCIS (Netherlands)

    Dek, Eliane C P; van den Hout, Marcel A.; Giele, Catharina L.; Engelhard, Iris M.

    2014-01-01

    Repeated checking paradoxically increases memory uncertainty. This study investigated the underlying mechanism of this effect. We hypothesized that as a result of repeated checking, familiarity with stimuli increases, and automatization of the checking procedure occurs, which should result in decrea

  9. Reported frequency of physical activity in a large epidemiological study: relationship to specific activities and repeatability over time

    Directory of Open Access Journals (Sweden)

    Reeves Gillian K

    2011-06-01

    Full Text Available Abstract Background How overall physical activity relates to specific activities and how reported activity changes over time may influence interpretation of observed associations between physical activity and health. We examine the relationships between various physical activities self-reported at different times in a large cohort study of middle-aged UK women. Methods At recruitment, Million Women Study participants completed a baseline questionnaire including questions on frequency of strenuous and of any physical activity. About 3 years later 589,896 women also completed a follow-up questionnaire reporting the hours they spent on a range of specific activities. Time spent on each activity was used to estimate the associated excess metabolic equivalent hours (MET-hours and this value was compared across categories of physical activity reported at recruitment. Additionally, 18,655 women completed the baseline questionnaire twice, at intervals of up to 4 years; repeatability over time was assessed using the weighted kappa coefficient (κweighted and absolute percentage agreement. Results The average number of hours per week women reported doing specific activities was 14.0 for housework, 4.5 for walking, 3.0 for gardening, 0.2 for cycling, and 1.4 for all strenuous activity. Time spent and the estimated excess MET-hours associated with each activity increased with increasing frequency of any or strenuous physical activity reported at baseline (tests for trend, P weighted = 0.71 for questionnaires administered less than 6 months apart, and 52% (κweighted = 0.51 for questionnaires more than 2 years apart. Corresponding values for any physical activity were 57% (κweighted = 0.67 and 47% (κweighted = 0.58. Conclusions In this cohort, responses to simple questions on the frequency of any physical activity and of strenuous activity asked at baseline were associated with hours spent on specific activities and the associated estimated excess MET

  10. Collaborative work on evaluation of ovarian toxicity. 17) Two- or four-week repeated-dose studies and fertility study of sulpiride in female rats.

    Science.gov (United States)

    Ishii, Shun-ichiro; Ube, Masayuki; Okada, Miyoko; Adachi, Tamiko; Sugimoto, Jiro; Inoue, Yoshimi; Uno, Yoshifumi; Mutai, Mamoru

    2009-01-01

    To find the appropriate dosing period to detect ovarian toxicity, sulpiride, a D2 antagonist was orally dosed to female rats at dose levels of 1, 10, and 100 mg/kg/day daily for 2 or 4 weeks in repeated-dose toxicity studies. In addition, sulpiride at the same dose levels was given to female rats daily during the pre-mating period, mating period, and Days 0-7 of gestation to assess its effect on fertility. In ovarian histology in the 2-week study, increases in atretic follicle were seen at 1 mg/kg or more and increases in follicular cysts at 10 mg/kg or more. In the 4-week study, these findings were seen at 1 mg/kg or more, and a decrease in large follicles was seen at 10 mg/kg or more. Increased body weight gain was observed at 10 mg/kg or more in the 2- and 4-week studies. The females in these groups exhibited development of mammary alveolus by sulpiride-induced hyperprolactinemia. In the fertility study, sulpiride-treated females showing persistent diestrus resulted in successful mating, and almost all females got pregnant. However, increased implantation loss was observed at 10 mg/kg or more, which was considered to be caused by the adverse effect of sulpiride on oocyte development. From these results, sulpiride-induced ovarian toxicity was seen at 1 mg/kg or more in the 2- and 4-week repeated-dose toxicity studies, and the observed ovarian changes were considered to be related to adverse effects on female fertility.

  11. Initial thin film penetration studies at the Colorado Center for Lunar Dust and Atmospheric Studies

    Science.gov (United States)

    Shu, A. J.; Collette, A.; Drake, K. J.; Gruen, E.; Horanyi, M.; Kempf, S.; Munsat, T.; Northway, P.; Robertson, S. H.; Srama, R.; Sternovsky, Z.; Thomas, E.; Colorado CenterLunar Dust; Atmospheric Studies

    2011-12-01

    Initial studies of damage caused by hypervelocity impacts of various micrometeorite materials into a range of targets are being performed at the Colorado Center for Lunar Dust and Atmospheric Studies (CCLDAS). Cratering studies are initially focused on polyvinylidene fluoride (PVDF) films in order to characterize the crater dependencies on impactor mass, size, and speed, and to better understand its capabilities as a dust detector. Additional cratering studies include optical glass, and geological samples as targets. These studies will lead to a better understanding of damage to spacecraft windows and instruments, and space weathering on airless bodies. In parallel, penetration studies will be conducted to determine how hole sizes in thin film materials depend on the properties of the film and the projectile. These thin film penetration studies will be critical to the design of dust detectors similar to that used on NASA's Stardust and New Horizons spacecraft, and in the design of solar sails. Thin film detectors can also be used to characterize beam profiles of laboratory dust accelerators. These studies are being performed at the 3MV hypervelocity dust accelerator at CCLDAS. The facility can accelerate dust particles up to 10's of km/s with user control over the velocity and mass ranges of particles reaching the target chamber. Complementary studies will be conducted at the Johnson Space Center Light Gas Gun using the same target and particle properties. These parallel studies will allow us to cover an extended range of acceleration parameters as well as better understand the similarities and differences between electrostatic accelerators and light gas guns.

  12. A Preliminary Study of the Effects of Repeated Massage on Hypothalamic–Pituitary–Adrenal and Immune Function in Healthy Individuals: A Study of Mechanisms of Action and Dosage

    Science.gov (United States)

    Schettler, Pamela; Bresee, Catherine

    2012-01-01

    Abstract Objectives This study gathers preliminary data about the biologic effects of repeated Swedish massage therapy compared to a light-touch control condition. Design The study design was a 5-week comparison of repeated Swedish massage and light touch on oxytocin (OT), arginine-vasopressin (AVP), adrenal corticotropin hormone (ACTH), cortisol (CORT), circulating phenotypic lymphocyte markers, and mitogen-stimulated cytokine function. Setting The setting was an outpatient research unit in an academic medical center. Participants The study subjects were medically and psychiatrically healthy young adults. Intervention The study comprised 45 minutes of Swedish massage or light touch, using highly specified and identical protocols, either weekly or twice weekly for 5 weeks. Outcome measures The outcome measures were mean differences between massage and light touch on OT, AVP, ACTH, CORT, lymphocyte markers, and cytokine levels. Results Compared to the touch control condition, weekly Swedish massage stimulated a sustained pattern of increased circulating phenotypic lymphocyte markers and decreased mitogen-stimulated cytokine production, similar to what was previously reported for a single massage session, while having minimal effect on hypothalamic–pituitary–adrenal function. Twice-weekly massage produced a different response pattern with increased OT levels, decreased AVP, and decreased CORT but little effect on circulating lymphocyte phenotypic markers and a slight increase in mitogen-stimulated interferon-γ, tumor necrosis factor-α, interleukin (IL)-1b and IL-2 levels, suggesting increased production of pro-inflammatory cytokines. Conclusions There are sustained cumulative biologic actions for the massage and touch interventions that persist for several days or a week, and these differ profoundly depending on the dosage (frequency) of sessions. Confirmatory studies in larger samples are needed. PMID:22775448

  13. Repeat workers' compensation claims: risk factors, costs and work disability

    Directory of Open Access Journals (Sweden)

    Collie Alex

    2011-06-01

    Full Text Available Abstract Background The objective of our study was to describe factors associated with repeat workers' compensation claims and to compare the work disability arising in workers with single and multiple compensation claims. Methods All initial injury claims lodged by persons of working age during a five year period (1996 to 2000 and any repeat claims were extracted from workers' compensation administrative data in the state of Victoria, Australia. Groups of workers with single and multiple claims were identified. Descriptive analysis of claims by affliction, bodily location, industry segment, occupation, employer and workplace was undertaken. Survival analysis determined the impact of these variables on the time between the claims. The economic impact and duration of work incapacity associated with initial and repeat claims was compared between groups. Results 37% of persons with an initial claim lodged a second claim. This group contained a significantly greater proportion of males, were younger and more likely to be employed in manual occupations and high-risk industries than those with single claims. 78% of repeat claims were for a second injury. Duration between the claims was shortest when the working conditions had not changed. The initial claims of repeat claimants resulted in significantly (p lower costs and work disability than the repeat claims. Conclusions A substantial proportion of injured workers experience a second occupational injury or disease. These workers pose a greater economic burden than those with single claims, and also experience a substantially greater cumulative period of work disability. There is potential to reduce the social, health and economic burden of workplace injury by enacting prevention programs targeted at these workers.

  14. Beverage Intake Assessment Questionnaire: Relative Validity and Repeatability in a Spanish Population with Metabolic Syndrome from the PREDIMED-PLUS Study

    Science.gov (United States)

    Ferreira-Pêgo, Cíntia; Nissensohn, Mariela; Kavouras, Stavros A.; Babio, Nancy; Serra-Majem, Lluís; Martín Águila, Adys; Mauromoustakos, Andy; Álvarez Pérez, Jacqueline; Salas-Salvadó, Jordi

    2016-01-01

    We assess the repeatability and relative validity of a Spanish beverage intake questionnaire for assessing water intake from beverages. The present analysis was performed within the framework of the PREDIMED-PLUS trial. The study participants were adults (aged 55–75) with a BMI ≥27 and <40 kg/m2, and at least three components of Metabolic Syndrome (MetS). A trained dietitian completed the questionnaire. Participants provided 24-h urine samples, and the volume and urine osmolality were recorded. The repeatability of the baseline measurement at 6 and 1 year was examined by paired Student’s t-test comparisons. A total of 160 participants were included in the analysis. The Bland–Altman analysis showed relatively good agreement between total daily fluid intake assessed using the fluid-specific questionnaire, and urine osmolality and 24-h volume with parameter estimates of −0.65 and 0.22, respectively (R2 = 0.20; p < 0.001). In the repeatability test, no significant differences were found between neither type of beverage nor total daily fluid intake at 6 months and 1-year assessment, compared to baseline. The proposed fluid-specific assessment questionnaire designed to assess the consumption of water and other beverages in Spanish adult individuals was found to be relatively valid with good repeatability. PMID:27483318

  15. TU-AB-BRA-05: Repeatability of [F-18]-NaF PET Imaging Biomarkers for Bone Lesions: A Multicenter Study

    Energy Technology Data Exchange (ETDEWEB)

    Lin, C; Bradshaw, T; Perk, T; Harmon, S; Jeraj, R [University of Wisconsin - Madison, School of Medicine and Public Health, Madison, WI (United States); Liu, G

    2015-06-15

    Purpose: Quantifying the repeatability of imaging biomarkers is critical for assessing therapeutic response. While therapeutic efficacy has been traditionally quantified by SUV metrics, imaging texture features have shown potential for use as quantitative biomarkers. In this study we evaluated the repeatability of quantitative {sup 18}F-NaF PET-derived SUV metrics and texture features in bone lesions from patients in a multicenter study. Methods: Twenty-nine metastatic castrate-resistant prostate cancer patients received whole-body test-retest NaF PET/CT scans from one of three harmonized imaging centers. Bone lesions of volume greater than 1.5 cm{sup 3} were identified and automatically segmented using a SUV>15 threshold. From each lesion, 55 NaF PET-derived texture features (including first-order, co-occurrence, grey-level run-length, neighbor gray-level, and neighbor gray-tone difference matrix) were extracted. The test-retest repeatability of each SUV metric and texture feature was assessed with Bland-Altman analysis. Results: A total of 315 bone lesions were evaluated. Of the traditional SUV metrics, the repeatability coefficient (RC) was 12.6 SUV for SUVmax, 2.5 SUV for SUVmean, and 4.3 cm{sup 3} for volume. Their respective intralesion coefficients of variation (COVs) were 12%, 17%, and 6%. Of the texture features, COV was lowest for entropy (0.03%) and highest for kurtosis (105%). Lesion intraclass correlation coefficient (ICC) was lowest for maximum correlation coefficient (ICC=0.848), and highest for entropy (ICC=0.985). Across imaging centers, repeatability of texture features and SUV varied. For example, across imaging centers, COV for SUVmax ranged between 11–23%. Conclusion: Many NaF PET-derived SUV metrics and texture features for bone lesions demonstrated high repeatability, such as SUVmax, entropy, and volume. Several imaging texture features demonstrated poor repeatability, such as SUVtotal and SUVstd. These results can be used to establish

  16. Effects of repeatability measures on results of fMRI sICA: a study on simulated and real resting-state effects.

    Science.gov (United States)

    Remes, Jukka J; Starck, Tuomo; Nikkinen, Juha; Ollila, Esa; Beckmann, Christian F; Tervonen, Osmo; Kiviniemi, Vesa; Silven, Olli

    2011-05-15

    Spatial independent components analysis (sICA) has become a widely applied data-driven method for fMRI data, especially for resting-state studies. These sICA approaches are often based on iterative estimation algorithms and there are concerns about accuracy due to noise. Repeatability measures such as ICASSO, RAICAR and ARABICA have been introduced as remedies but information on their effects on estimates is limited. The contribution of this study was to provide more of such information and test if the repeatability analyses are necessary. We compared FastICA-based ordinary and repeatability approaches concerning mixing vector estimates. Comparisons included original FastICA, FSL4 Melodic FastICA and original and modified ICASSO. The effects of bootstrapping and convergence threshold were evaluated. The results show that there is only moderate improvement due to repeatability measures and only in the bootstrapping case. Bootstrapping attenuated power from time courses of resting-state network related ICs at frequencies higher than 0.1 Hz and made subsets of low frequency oscillations more emphasized IC-wise. The convergence threshold did not have a significant role concerning the accuracy of estimates. The performance results suggest that repeatability measures or strict converge criteria might not be needed in sICA analyses of fMRI data. Consequently, the results in existing sICA fMRI literature are probably valid in this sense. A decreased accuracy of original bootstrapping ICASSO was observed and corrected by using centrotype mixing estimates but the results warrant for thorough evaluations of data-driven methods in general. Also, given the fMRI-specific considerations, further development of sICA methods is strongly encouraged. Copyright © 2010 Elsevier Inc. All rights reserved.

  17. A European pharmaceutical company initiative challenging the regulatory requirement for acute toxicity studies in pharmaceutical drug development.

    Science.gov (United States)

    Robinson, Sally; Delongeas, Jean-Luc; Donald, Elizabeth; Dreher, David; Festag, Matthias; Kervyn, Sophie; Lampo, Ann; Nahas, Kamil; Nogues, Vicente; Ockert, Deborah; Quinn, Kirsty; Old, Sally; Pickersgill, Nigel; Somers, Kev; Stark, Claudia; Stei, Peter; Waterson, Lynne; Chapman, Kathryn

    2008-04-01

    Regulatory guidelines indicate acute toxicity studies in animals are considered necessary for pharmaceuticals intended for human use. This is the only study type where lethality is mentioned as an endpoint. The studies are carried out, usually in rodents, to support marketing of new drugs and to identify the minimum lethal dose. A European initiative including 18 companies has undertaken an evidence-based review of acute toxicity studies and assessed the value of the data generated. Preclinical and clinical information was shared on 74 compounds. The analysis indicated acute toxicity data was not used to (i) terminate drugs from development (ii) support dose selection for repeat dose studies in animals or (iii) to set doses in the first clinical trials in humans. The conclusion of the working group is that acute toxicity studies are not needed prior to first clinical trials in humans. Instead, information can be obtained from other studies, which are performed at more relevant doses for humans and are already an integral part of drug development. The conclusions have been discussed and agreed with representatives of regulatory bodies from the US, Japan and Europe.

  18. A study of the evolution of inverted-topology repeats from LeuT-fold transporters using AlignMe.

    Science.gov (United States)

    Khafizov, Kamil; Staritzbichler, René; Stamm, Marcus; Forrest, Lucy R

    2010-12-21

    X-ray crystal structures have revealed that numerous secondary transporter proteins originally categorized into different sequence families share similar structures, namely, the LeuT fold. The core of this fold consists of two units of five transmembrane helices, whose conformations have been proposed to exchange to form the two alternate states required for transport. That these two units are related implies that LeuT-like transporters evolved from gene-duplication and fusion events. Thus, the origins of this structural repeat may be relevant to the evolution of transport function. However, the lack of significant sequence similarity requires sensitive sequence search methods for analyzing their evolution. To this end, we developed a software application called AlignMe, which can use various types of input information, such as residue hydrophobicity, to perform pairwise alignments of sequences and/or of hydropathy profiles of (membrane) proteins. We used AlignMe to analyze the evolutionary relationships between repeats of the LeuT fold. In addition, we identified proteins from the so-called DedA family that potentially share a common ancestor with these repeats. DedA domains have been implicated in, e.g., selenite uptake; they are found widely distributed across all kingdoms of life; two or more DedA domains are typically found per genome, and some may adopt dual topologies. These results suggest that DedA proteins existed in ancient organisms and may function as dimers, as required for a would-be ancestor of the LeuT fold. In conclusion, we provide novel insights into the evolution of this important structural motif and thus potentially into the alternating-access mechanism of transport itself.

  19. Repeat-pulse 13CO2 labeling of canola and field pea: implications for soil organic matter studies.

    Science.gov (United States)

    Sangster, Amy; Knight, Diane; Farrell, Richard; Bedard-Haughn, Angela

    2010-10-15

    Both the quantity and quality of plant residues can impact soil properties and processes. Isotopic tracers can be used to trace plant residue decomposition if the tracer is homogeneously distributed throughout the plant. Continuous labeling will homogeneously label plants but is not widely accessible because elaborate equipment is needed. In order to determine if the more accessible repeat-pulse labeling method could be used to trace plant residue decomposition, this labeling procedure was employed using (13)CO(2) to enrich field pea and canola plants in a controlled environment. Plants were exposed weekly to pulses of 33 atom% (13)CO(2) and grown to maturity. The distribution of the label throughout the plant parts (roots, stem, leaves, and pod) and biochemical fractions (ADF and ADL) was determined. The label was not homogeneously distributed throughout the plant; in particular, the pod fractions were less enriched than other fractions indicating the importance of continuing labeling well into plant maturity for pod-producing plants. The ADL fraction was also less enriched than the ADF fraction. Because of the heterogeneity of the label throughout the plant, caution should be applied when using the repeat-pulse method to trace the fate of (13)C-labeled residues in the soil. However, root contributions to below-ground C were successfully determined from the repeat-pulse labeled root material, as was (13)C enrichment of soil within the top 15 cm. Canola contributed more above- and below-ground residue C than field pea; however, canola was also higher in ADF and ADL fractions indicating a more recalcitrant residue.

  20. Exploring Career Agency during Self-Initiated Repatriation: A Study of Chinese Sea Turtles

    Science.gov (United States)

    Guo, Chun; Porschitz, Emily T.; Alves, Jose

    2013-01-01

    Purpose: Drawing on career and self-initiated expatriation/repatriation literatures, this paper aims to examine the career experiences of Chinese self-initiated repatriates after their return to China. Design/methodology/approach: The authors conducted an exploratory, qualitative study involving in-depth interviews with 20 Chinese individuals who…

  1. Exploring Career Agency during Self-Initiated Repatriation: A Study of Chinese Sea Turtles

    Science.gov (United States)

    Guo, Chun; Porschitz, Emily T.; Alves, Jose

    2013-01-01

    Purpose: Drawing on career and self-initiated expatriation/repatriation literatures, this paper aims to examine the career experiences of Chinese self-initiated repatriates after their return to China. Design/methodology/approach: The authors conducted an exploratory, qualitative study involving in-depth interviews with 20 Chinese individuals who…

  2. RAN translation at CGG repeats induces ubiquitin proteasome system impairment in models of fragile X-associated tremor ataxia syndrome

    OpenAIRE

    Oh, Seok Yoon; He, Fang; Krans, Amy; Frazer, Michelle; Taylor, J. Paul; Paulson, Henry L.; Todd, Peter K

    2015-01-01

    Fragile X-associated tremor ataxia syndrome (FXTAS) is a neurodegenerative disorder caused by a CGG trinucleotide repeat expansion in the 5′ UTR of the Fragile X gene, FMR1. FXTAS is thought to arise primarily from an RNA gain-of-function toxicity mechanism. However, recent studies demonstrate that the repeat also elicits production of a toxic polyglycine protein, FMRpolyG, via repeat-associated non-AUG (RAN)-initiated translation. Pathologically, FXTAS is characterized by ubiquitin-positive ...

  3. Evaluation of Spatial Development Initiatives: Case studies of the Maputo Development Corridor and the West Coast Investment Initiative

    OpenAIRE

    David Bek; Ian Taylor

    2001-01-01

    Spatial Development Initiatives (SDIs) form an integral part of the South African government strategy to attract investment. SDIs are claimed to be short-term and targeted undertakings to foster economic growth. This working paper reviews two SDI projects, namely the Maputo Development Corridor (MDC) and the West Coast Investment Initiative (WCII). The paper outlines many strengths within the MDC and WCII and draws out lessons to be learned that could improve the delivery of ongoing and futur...

  4. Study of n-Butyl Acrylate Self-Initiation Reaction Experimentally and via Macroscopic Mechanistic Modeling

    Directory of Open Access Journals (Sweden)

    Ahmad Arabi Shamsabadi

    2016-04-01

    Full Text Available This paper presents an experimental study of the self-initiation reaction of n-butyl acrylate (n-BA in free-radical polymerization. For the first time, the frequency factor and activation energy of the monomer self-initiation reaction are estimated from measurements of n-BA conversion in free-radical homo-polymerization initiated only by the monomer. The estimation was carried out using a macroscopic mechanistic mathematical model of the reactor. In addition to already-known reactions that contribute to the polymerization, the model considers a n-BA self-initiation reaction mechanism that is based on our previous electronic-level first-principles theoretical study of the self-initiation reaction. Reaction rate equations are derived using the method of moments. The reaction-rate parameter estimates obtained from conversion measurements agree well with estimates obtained via our purely-theoretical quantum chemical calculations.

  5. Heart rate variability and DNA methylation levels are altered after short-term metal fume exposure among occupational welders: a repeated-measures panel study

    OpenAIRE

    2014-01-01

    Background: In occupational settings, boilermakers are exposed to high levels of metallic fine particulate matter (PM2.5) generated during the welding process. The effect of welding PM2.5 on heart rate variability (HRV) has been described, but the relationship between PM2.5, DNA methylation, and HRV is not known. Methods: In this repeated-measures panel study, we recorded resting HRV and measured DNA methylation levels in transposable elements Alu and long interspersed nuclear element-1 (LINE...

  6. Replication Validity of Initial Association Studies: A Comparison between Psychiatry, Neurology and Four Somatic Diseases

    Science.gov (United States)

    Dumas-Mallet, Estelle; Button, Katherine; Boraud, Thomas; Munafo, Marcus; Gonon, François

    2016-01-01

    Context There are growing concerns about effect size inflation and replication validity of association studies, but few observational investigations have explored the extent of these problems. Objective Using meta-analyses to measure the reliability of initial studies and explore whether this varies across biomedical domains and study types (cognitive/behavioral, brain imaging, genetic and “others”). Methods We analyzed 663 meta-analyses describing associations between markers or risk factors and 12 pathologies within three biomedical domains (psychiatry, neurology and four somatic diseases). We collected the effect size, sample size, publication year and Impact Factor of initial studies, largest studies (i.e., with the largest sample size) and the corresponding meta-analyses. Initial studies were considered as replicated if they were in nominal agreement with meta-analyses and if their effect size inflation was below 100%. Results Nominal agreement between initial studies and meta-analyses regarding the presence of a significant effect was not better than chance in psychiatry, whereas it was somewhat better in neurology and somatic diseases. Whereas effect sizes reported by largest studies and meta-analyses were similar, most of those reported by initial studies were inflated. Among the 256 initial studies reporting a significant effect (p<0.05) and paired with significant meta-analyses, 97 effect sizes were inflated by more than 100%. Nominal agreement and effect size inflation varied with the biomedical domain and study type. Indeed, the replication rate of initial studies reporting a significant effect ranged from 6.3% for genetic studies in psychiatry to 86.4% for cognitive/behavioral studies. Comparison between eight subgroups shows that replication rate decreases with sample size and “true” effect size. We observed no evidence of association between replication rate and publication year or Impact Factor. Conclusion The differences in reliability

  7. Success factors for strategic change initiatives: a qualitative study of healthcare administrators' perspectives.

    Science.gov (United States)

    Kash, Bita Arbab; Spaulding, Aaron; Johnson, Christopher E; Gamm, Larry

    2014-01-01

    Success factors related to the implementation of change initiatives are well documented and discussed in the management literature, but they are seldom studied in healthcare organizations engaged in multiple strategic change initiatives. The purpose of this study was to identify key success factors related to implementation of change initiatives based on rich qualitative data gathered from health leader interviews at two large health systems implementing multiple change initiatives. In-depth personal interviews with 61 healthcare leaders in the two large systems were conducted and inductive qualitative analysis was employed to identify success factors associated with 13 change initiatives. Results from this analysis were compared to success factors identified in the literature, and generalizations were drawn that add significantly to the management literature, especially to that in the healthcare sector. Ten specific success factors were identified for the implementation of change initiatives. The top three success factors were (1) culture and values, (2) business processes, and (3) people and engagement. Two of the identified success factors are unique to the healthcare sector and not found in the literature on change models: service quality and client satisfaction (ranked fourth of 10) and access to information (ranked ninth). Results demonstrate the importance of human resource functions, alignment of culture and values with change, and business processes that facilitate effective communication and access to information to achieve many change initiatives. The responses also suggest opportunities for leaders of healthcare organizations to more formally recognize the degree to which various change initiatives are dependent on one another.

  8. Modelling studies on neurodegenerative disease-causing triplet repeat sequences d(GGC/GCC)n and d(CAG/CTG)n

    Indian Academy of Sciences (India)

    Shibasish Chowdhury; Manju Bansal

    2001-12-01

    Model building and molecular mechanics studies have been carried out to examine the potential structures for d(GGC/GCC)5 and d(CAG/CTG)5 that might relate to their biological function and association with triplet repeat expansion diseases. Model building studies suggested that hairpin and quadruplex structures could be formed with these repeat sequences. Molecular mechanics studies have demonstrated that the hairpin and hairpin dimer structures of triplet repeat sequences formed by looping out of the two strands are as favourable as the corresponding B-DNA type hetero duplex structures. Further, at high salt condition, Greek key type quadruplex structures are energetically comparable with hairpin dimer and B-DNA type duplex structures. All tetrads in the quadruplex structures are well stacked and provide favourable stacking energy values. Interestingly, in the energy minimized hairpin dimer and Greek key type quadruplex structures, all the bases even in the non-G tetrads are cyclically hydrogen bonded, even though the A, C and T-tetrads were not hydrogen bonded in the starting structures.

  9. Contributions by the CAG-repeat Polymorphism of the Androgen Receptor Gene and Circulating Androgens to Muscle Size. Odense Androgen Study - A Population-based Study of 20-29 Year-old Danish Men

    DEFF Research Database (Denmark)

    Nielsen, Torben Leo; Hagen, Claus; Wraae, Kristian

    2007-01-01

    Context: The number of CAG-repeats within the CAG-repeat polymorphism of the androgen receptor gene is inversely correlated with the transcriptional activity of the androgen receptor. Objective: To study the effect of the CAG-repeat number and circulating androgens on muscle size, to examine the ...... muscle size increased exponentially with decreasing androgen levels and was tripled at total testosterone levels...... the CAG-repeat number in relation to body fat mass and circulating androgens, and to identify the best hormonal marker of low muscle size amongst total testosterone, bioavailable testosterone, and dihydrotestosterone. Design, Setting, and Participants: Population-based study of 783 Danish men aged 20...... continuous outcomes (thigh and axial muscle area, lower extremity, upper extremity, and trunk lean body mass, and total body fat mass) and five binary outcomes of low muscle size defined as men with muscle size below the lower 10 percentile of each continuous outcome of muscle size. Results: The CAG...

  10. Study of detonation initiation in kerosene-oxidizer mixtures in short tubes

    Science.gov (United States)

    Kindracki, J.

    2014-11-01

    The paper describes experimental studies of detonation initiation in a kerosene-oxidizer mixture in a short test tube. The aim of the study is to determine the minimum diameter of the tube and the minimum level of energy that enables direct initiation of the detonation. Knowledge about these values will inform the design of a jet engine combustion chamber in which thermal energy will be generated by a rotating detonation process. The test tube and the oxidizer inside the tube were heated using specially designed heaters installed outside of the tube. The heated oxidizer provided thermal conditions similar to the conditions for a compressor with small to medium static pressure. The study was conducted for four different tube diameters and for various energies of initiation. As a result, measurements of pressure waveforms were obtained for various cases of fuel injection, which were then compared against the results of the shock wave generated by the initiator. This study provides a value for the energy (the pressure of the mixture in the initiator), which provided direct initiation of detonation for a kerosene-oxidizer mixture. Different tube diameters led to the initiation of detonation for various oxygen-nitrogen compositions as an oxidizer.

  11. A numerical study of crack initiation in a bcc iron system based on dynamic bifurcation theory

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiantao, E-mail: xli@math.psu.edu [Pennsylvania State University, University Park, Pennsylvania 16802 (United States)

    2014-10-28

    Crack initiation under dynamic loading conditions is studied under the framework of dynamic bifurcation theory. An atomistic model for BCC iron is considered to explicitly take into account the detailed molecular interactions. To understand the strain-rate dependence of the crack initiation process, we first obtain the bifurcation diagram from a computational procedure using continuation methods. The stability transition associated with a crack initiation, as well as the connection to the bifurcation diagram, is studied by comparing direct numerical results to the dynamic bifurcation theory [R. Haberman, SIAM J. Appl. Math. 37, 69–106 (1979)].

  12. Diabetic Foot Prevention: Repeatability of the Loran Platform Plantar Pressure and Load Distribution Measurements in Nondiabetic Subjects during Bipedal Standing—A Pilot Study

    Directory of Open Access Journals (Sweden)

    Martha Zequera

    2011-01-01

    Full Text Available This study was designed to assess the repeatability of the Loran Platform and evaluate the variability of plantar pressure and postural balance, during barefoot standing in nondiabetic subjects, for future diabetic foot clinical evaluation. Measurements were taken for eight nondiabetic subjects (4 females, 4 males, aged 47±7.2 years who had no musculoskeletal symptoms. Five variables were measured with the platform in the barefoot standing position. Ten measurements were taken using two different techniques for feet and posture positioning, during three sessions, once a week. For most measurements, no significant effect over time was found with Student's t-test (P<.000125. The ANOVA test of statistical significance confirmed that measurement differences between subjects showed higher variations than measurements taken from the same subject (P<.001. The measurements taken by the Loran Platform system were found to be repeatable.

  13. A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene.

    Science.gov (United States)

    Leonova, J; Hanson, C

    1999-01-01

    This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.

  14. Green initiative impact on stock prices: A quantitative study of the clean energy industry

    Science.gov (United States)

    Jurisich, John M.

    The purpose of this quantitative ex post facto research study was to explore the relationship between green initiative expense disclosures and stock prices of 46 NASDAQ listed Clean Edge Green Energy global companies from 2007 to 2010. The independent variables were sales and marketing, environmental, customer and supplier, community, and corporate governance practices that were correlated with the dependent variable in the study of stock prices. Expense disclosures were examined in an effort to measure the impact of green initiative programs and to expose the interrelationships between green initiative expense disclosures and fluctuations of stock prices. The data for the research was secondary data from existing annual reports. A statistically significant relationship was revealed between environmental practices and changes in stock prices. The study results also provided substantial evidence for leadership and managerial decision making to reduce or increase green initiative practices to maximize shareholder wealth of their respective organizations.

  15. `Walking in a Foreign and Unknown Landscape': Studying the History of Mathematics in Initial Teacher Education

    Science.gov (United States)

    Povey, Hilary

    2013-07-01

    This article develops the argument that students in initial teacher education benefit in terms of who they are becoming from developing awareness of and engagement in the history of mathematics. Initially, current school mathematics practices in the UK are considered and challenged. Then the role of teachers' relationship to mathematical subject knowledge and of teachers' engagement in critical thinking are considered. Connections are made between these concerns and studying the history of mathematics in initial teacher education classrooms. I then draw on the perspectives and practices of the mathematics teacher educators at one institution to understand these connections better and to exemplify them. Issues of equity are threaded throughout.

  16. A comparative evaluation of tray spacer thickness and repeat pour on the accuracy of monophasic polyvinyl siloxane impression material: In vitro study

    Directory of Open Access Journals (Sweden)

    Sandeep Kumar

    2014-01-01

    Full Text Available Purpose: This study was aimed to determine the effect of various tray spacer thickness and subsequent repeated pours on the accuracy and dimensional stability of the impression made from monophasic polyvinyl siloxane material. Materials and Methods: Custom trays with different spacer thickness (2, 4 and 6 mm were used for making an impression of a master model simulating 3 unit fixed partial denture with monophasic polyvinyl siloxane material. These impressions were poured with die stone and repoured. Distance between the reference points were measured and subjected to statistical analysis. Result: Casts obtained from 1 st , 2 nd and 3 rd pour of the impression in 2, 4 and 6 mm spacer thickness tray have similar dimensional accuracy amongst each other and with the master model except in molar diameter and inter-abutment distances of cast obtained from 6 mm spacer thickness tray. Conclusion: The vertical distance of stone dies were decreased, whereas horizontal distance increased as the thickness of impression material is increased. There were statistically non-significant changes occurring among the repeated pours in 2, 4 and 6 mm spacer thickness. Clinical Implication: 2 and 4 mm spacer thickness are acceptable for making an impression for three unit fixed partial denture with monophasic polyvinyl siloxane material and it was not affected by two subsequent (1 st and 2 nd repeated pours.

  17. Vaginal birth after cesarean section (VBAC versus emergency repeat cesarean section at teaching hospitals in India: an ICMR task force study

    Directory of Open Access Journals (Sweden)

    B. S. Dhillon

    2014-06-01

    Results: A total of 155863 deliveries occurred during the study duration, there were 28.1% (n=43824 cesarean section and (10.1% (n=15664 were the number of previous cesarean section. In 84% (n=13151 had repeat cesarean delivery and 2513 (16% delivered vaginally. A trial of labor was planned in 4035 (25.8% women. The success rate of VBAC was 62.3% with 2513 women had successful vaginal delivery and 1522 (37.7% delivered by emergency repeat cesarean section. Major indication of emergency cesarean section was CPD (52.9%, foetal distress (25.8%, severe PIH/eclampsia (5.0%, previous 2 CS (0.7%, APH (1.4% and others (2.7%. In majority, surgical technique was conventional and in 3.7% the Misgav-Ladach technique was used. Scar dehiscence and surgical complications were observed in 5.4% and 4.0% of cases respectively. Blood transfusion was given in 7.0% and post-operative complications were seen in 6.8%. Perinatal and maternal mortality was 18.0/1000 and 257/100000 deliveries respectively. Conclusions: Safety in childbirth for women with prior cesarean is a major public health concern. Repeat caesarean section and planned vaginal birth after cesarean section are both associated with benefits and harms and correct management represents one of the most significant and challenging issues in obstetric practice. [Int J Reprod Contracept Obstet Gynecol 2014; 3(3.000: 592-597

  18. The effect of repeated immersion of gypsum cast in sodium hypochlorite and glutaraldehyde on its physical properties: An in vitro study

    Directory of Open Access Journals (Sweden)

    Rachuri Narendra Kumar

    2012-01-01

    Full Text Available Background: One method used to disinfect a dental cast is immersion in a disinfecting solution. Repeated immersion of a cast in disinfectant may affect its physical properties. Purpose: The purpose of this study was to evaluate the changes in dimensional accuracy and hardness of the dental casts as a result of repeated disinfection in 0.525% sodium hypochlorite and 2% glutaraldehyde solutions. Materials and Methods: Sixty specimens were made of type III dental stone. Twenty specimens were immersed in slurry, a supernatant solution of calcium sulfate in distilled water (control casts, 20 specimens in 0.525% sodium hypochlorite, and 20 specimens in 2% glutaraldehyde solutions for 30 min and air dried for 24 h. This process was repeated for 7 times for testing. Linear dimensional change and hardness were determined according to American National Standards Institute/American Dental Association (ANSI/ADA standards. The data were analyzed using two-way analysis of variance. Results: For specimens prepared with type III stones, treatment was by immersion in slurry (group I - control casts, and by immersion in 0.525% sodium hypochlorite (group II - test group 1 and in 2% glutaraldehyde solution (group III - test group 2. The specimens treated with sodium hypochlorite and glutaraldehyde showed more linear dimensional change compared to the specimens treated in slurry. However, the difference between test casts and control casts was significant. But the difference between the two test groups was not significant. Both the test groups showed decrease in hardness of the specimens compared to that specimens in control group. But the difference between two test groups was not significant in hardness.However,the values remained close to ANSI/ADA standards. Conclusion: The results demonstrated that repeated immersion of type III dental stone specimens in slurry with distilled water, 0.525% sodium hypochlorite and 2% glutaraldehyde, along with drying in air

  19. Personal semantics: Is it distinct from episodic and semantic memory? An electrophysiological study of memory for autobiographical facts and repeated events in honor of Shlomo Bentin.

    Science.gov (United States)

    Renoult, Louis; Tanguay, Annick; Beaudry, Myriam; Tavakoli, Paniz; Rabipour, Sheida; Campbell, Kenneth; Moscovitch, Morris; Levine, Brian; Davidson, Patrick S R

    2016-03-01

    Declarative memory is thought to consist of two independent systems: episodic and semantic. Episodic memory represents personal and contextually unique events, while semantic memory represents culturally-shared, acontextual factual knowledge. Personal semantics refers to aspects of declarative memory that appear to fall somewhere in between the extremes of episodic and semantic. Examples include autobiographical knowledge and memories of repeated personal events. These two aspects of personal semantics have been studied little and rarely compared to both semantic and episodic memory. We recorded the event-related potentials (ERPs) of 27 healthy participants while they verified the veracity of sentences probing four types of questions: general (i.e., semantic) facts, autobiographical facts, repeated events, and unique (i.e., episodic) events. Behavioral results showed equivalent reaction times in all 4 conditions. True sentences were verified faster than false sentences, except for unique events for which no significant difference was observed. Electrophysiological results showed that the N400 (which is classically associated with retrieval from semantic memory) was maximal for general facts and the LPC (which is classically associated with retrieval from episodic memory) was maximal for unique events. For both ERP components, the two personal semantic conditions (i.e., autobiographical facts and repeated events) systematically differed from semantic memory. In addition, N400 amplitudes also differentiated autobiographical facts from unique events. Autobiographical facts and repeated events did not differ significantly from each other but their corresponding scalp distributions differed from those associated with general facts. Our results suggest that the neural correlates of personal semantics can be distinguished from those of semantic and episodic memory, and may provide clues as to how unique events are transformed to semantic memory.

  20. Repeat concussions in the national football league.

    Science.gov (United States)

    Casson, Ira R; Viano, David C; Powell, John W; Pellman, Elliot J

    2011-01-01

    Repeat concussion is an important issue in the National Football League (NFL). An initial description of repeat injuries was published for 6 years (1996-2001). The characteristics and frequency of repeat concussion in the NFL have not changed in the subsequent 6 years (2002-2007). Case control. From 1996 to 2007, concussions were reported using a standardized form documenting signs and symptoms, loss of consciousness and medical action taken. Data on repeat concussions were analyzed for the 12 years and compared between the 2 periods. In 2002-2007, 152 players had repeat concussions (vs 160 in 1996-2001); 44 had 3+ head injuries (vs 52). The positions most often associated with repeat concussion in 2002-2007 were the defensive secondary, kick unit, running back, and linebacker. The odds for repeat concussion were elevated for wide receivers, tight ends, and linebackers but lower than in the earlier period. During 2002-2007, over half of players with repeat concussion were removed from play, and fewer immediately returned (vs 1996-2001). The average duration between concussions was 1.25 years for 2002-2007 and 1.65 years for the 12-year period. Over 12 years, 7.6% of all repeat concussions occurred within 2 weeks of the prior concussion. The defensive secondary, kick unit, running back, and linebacker have the highest incidence of repeat concussion. During 2002-2007, more than half of players with repeat concussion were removed from play, and only a fraction immediately returned. Although concussion was managed more conservatively by team physicians in the recent 6 years, repeat concussions occurred at similar rates during both periods.

  1. A review of repeat prostate biopsies and the influence of technique on cancer detection: our experience.

    LENUS (Irish Health Repository)

    Quinlan, M R

    2012-02-01

    BACKGROUND: Follow-up of patients with an initial negative prostate biopsy, but surrounding whom a suspicion of prostate cancer persists, is difficult. In addition, debate exists as to the optimal technique for repeat prostate biopsy. AIMS: To assess the cancer detection rate on repeat prostate biopsy. METHODS: We reviewed patients who underwent prostate biopsy in our department in 2005 who had >or=1 previous biopsy within the preceding 5 years. Cancer detection rate on repeat biopsy and the influence of the number of biopsy cores were recorded. RESULTS: Cancer detection rate on repeat biopsy was 15.4%, with approximately 60% detected on the first repeat biopsy, but approximately 10% not confirmed until the fourth repeat biopsy. Gleason score was similar regardless of the time of diagnosis (6.1-6.5). Mean interval between first biopsy and cancer diagnosis (range 18-55 months) depended on the number of repeat procedures. There was an association between the number of biopsy cores and cancer detection. CONCLUSIONS: This study supports the practice of increasing the number of cores taken on initial and first repeat biopsy to maximise prostate cancer detection and reduce the overall number of biopsies needed.

  2. Content-Related Interactions and Methods of Reasoning within Self-Initiated Organic Chemistry Study Groups

    Science.gov (United States)

    Christian, Karen Jeanne

    2011-01-01

    Students often use study groups to prepare for class or exams; yet to date, we know very little about how these groups actually function. This study looked at the ways in which undergraduate organic chemistry students prepared for exams through self-initiated study groups. We sought to characterize the methods of social regulation, levels of…

  3. An experiential profile of initial romantic attraction for white, heterosexual, South African men : a phenomenological study

    OpenAIRE

    2014-01-01

    M.A. (Clinical Psychology) Initial romantic attraction is a universal social phenomenon and can broadly be defined as the awareness for the potential of a long-term romantic relationship or the positive regard an individual has for another. In essence, it is the initial feelings an individual has toward a potential mate. Due to the significance of romantic relationships it is a well-researched topic however, most existing studies on the topic are quantitative in nature focusing on testing ...

  4. Re-imagining initial teacher identity and learning study: final report

    OpenAIRE

    2013-01-01

    The aim of this research, the Re-imagining Initial Teacher Identity and Learning Study (RIITILS) was to continue writing from and to extend the Learning to Teach Study 1 (LETS1). LETS1, funded by the Department of Education and Skills (DES), was the first study of its kind on the Postgraduate Diploma in Education (PGDE) in Ireland, and involved the development and implementation of a study of initial teacher education in the PGDE in post-primary education, in one School of Education. Its aim ...

  5. Ambient particulate air pollution and circulating antioxidant enzymes: A repeated-measure study in healthy adults in Beijing, China.

    Science.gov (United States)

    Wu, Shaowei; Wang, Bin; Yang, Di; Wei, Hongying; Li, Hongyu; Pan, Lu; Huang, Jing; Wang, Xin; Qin, Yu; Zheng, Chanjuan; Shima, Masayuki; Deng, Furong; Guo, Xinbiao

    2016-01-01

    The association of systemic antioxidant activity with ambient air pollution has been unclear. A panel of 40 healthy college students underwent repeated blood collection for 12 occasions under three exposure scenarios before and after relocating from a suburban area to an urban area in Beijing, China in 2010-2011. We measured various air pollutants including fine particles (PM2.5) and determined circulating levels of antioxidant enzymes extracellular superoxide dismutase (EC-SOD) and glutathione peroxidase 1 (GPX1) in the laboratory. An interquartile range increase of 63.4 μg/m(3) at 3-d PM2.5 moving average was associated with a 6.3% (95% CI: 0.6, 12.4) increase in EC-SOD and a 5.5% (95% CI: 1.3, 9.8) increase in GPX1. Several PM2.5 chemical constituents, including negative ions (nitrate and chloride) and metals (e.g., iron and strontium), were consistently associated with increases in EC-SOD and GPX1. Our results support activation of circulating antioxidant enzymes following exposure to particulate air pollution. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. A Study on the Efficiency Improvement of Dye-Sensitized Solar Cell (DSSC) by Repeated Dye Coating.

    Science.gov (United States)

    Seo, Young Ho; Choi, Eun Chang; Hong, Byungyou

    2015-10-01

    Dye-sensitized solar cell (DSSC) is being extensively investigated as the next generation energy source. Despite of the attractive features like simple fabrication process and its economic efficiency, there are some problems such as low efficiency, long fabrication time and low long-term stability. Conventionally, the dye adsorption on TiO2 photo-electrode film needs long time in the solvent with low concentration of dye to get the high efficiency. In this work, the dye coating process was considerably shortened, albeit plenty of dye was used comparing with the conventional way. Our needs were met for the best result in our working environment and the relevant conditions to our work were obtained, which were the coating temperature of 70 °C, the dye concentration of 10 mM and the coating time of 3 min. And this coating process was successively repeated several times to maximize the dye adsorption and to improve the cell efficiency. Therefore, the efficiency increased by 13% in the proper condition.

  7. A theoretical and experimental study on geometric nonlinearity of initially curved cantilever beams

    Directory of Open Access Journals (Sweden)

    Sushanta Ghuku

    2016-03-01

    Full Text Available This paper presents a theoretical and experimental study on large deflection behavior of initially curved cantilever beams subjected to various types of loadings. The physical system as a straight cantilever beam subjected to a tip concentrated load is considered in this study. Nonlinear differential equations are obtained for large deflection analysis of such a straight cantilever beam, and this problem is known to involve geometrical nonlinearity. The equations are solved numerically with the help of MATLAB® computational platform to get deflection profiles of the concerned problem. These results are imposed subsequently on the center line of an initially curved beam to get theoretical load-deflection behavior of curved beam problems. To verify the theoretical model, experiment is carried out with the master leaf of a leaf spring bundle by modeling it as an initially curved cantilever beam. The effects of initial clamping and geometry variations in the eye-region are observed from experimental investigation which is commonly neglected in the mathematical formulation. Comparisons of the theoretical results with the experimental results are quite good, but the avenues for further improvement are also reported. The proposed approach is further extended to study large deflection behavior of an initially curved cantilever beam subjected to distributed and combined load. These results are successfully validated with existing results for straight beams and some new results are furnished for initially curved cantilever beams.

  8. The 5′ Untranslated Region and Gag product of Idefix, a Long Terminal Repeat-Retrotransposon from Drosophila melanogaster, Act Together To Initiate a Switch between Translated and Untranslated States of the Genomic mRNA

    OpenAIRE

    Meignin, Carine; Bailly, Jean-Luc; Arnaud, Frédérick; Dastugue, Bernard; Vaury, Chantal

    2003-01-01

    Idefix is a long terminal repeat (LTR)-retrotransposon present in Drosophila melanogaster which shares similarities with vertebrates retroviruses both in its genomic arrangement and in the mechanism of transposition. Like in retroviruses, its two LTRs flank a long 5′ untranslated region (5′UTR) and three open reading frames referred to as the gag, pol, and env genes. Here we report that its 5′UTR, located upstream of the gag gene, can fold into highly structured domains that are known to be i...

  9. An automatic scanning method for high throughput microscopic system to facilitate medical genetic diagnosis: an initial study

    Science.gov (United States)

    Qiu, Yuchen; Chen, Xiaodong; Li, Zheng; Li, Yuhua; Chen, Wei R.; Zheng, Bin; Li, Shibo; Liu, Hong

    2012-03-01

    The purpose of this paper is to report a new automatic scanning scheme for high throughput microscopic systems aiming to facilitate disease diagnosis in genetic laboratories. To minimize the impact of the random vibration and mechanical drifting of the scanning stage in microscopic image acquisition, auto-focusing operations are usually applied repeatedly during the scanning process. Such methods ensure the acquisition of well focused images for clinical diagnosis, but are time consuming. The technique investigated in this preliminary study applies the auto-focusing operations at a limited number of locations on the slide. For the rest of the imaging field, the focusing position is quickly adjusted through linear interpolation. In this initial validation study, blood pathological slides containing both metaphase and interphase cells are scanned. For a selected area of 6.9mm×6.9mm, a number of 2×2, 3×2, 3×3, and 4×4 positions are evenly sampled for auto-focusing operations. Respectively, 25, 29, 40, and 41 clinically meaningful cells are identified for each sampling scheme. For the specific case investigated, the results demonstrate that the 4 position auto-focusing scheme could obtain the adequate number of clinically meaningful cells for the diagnosis. The schemes with more auto-focusing operations provide an option for high reliability diagnosis when clinically necessary. More comprehensive research is planned, and that may lead to optimal design of trade-off for developing the scanning scheme of the high throughput microscopic systems.

  10. TU-C-12A-05: Repeatability Study of Reduced Field-Of-View Diffusion-Weighted MRI On Human Thyroid Gland

    Energy Technology Data Exchange (ETDEWEB)

    Shukla-Dave, A; Lu, Y; Hatzoglou, V; Stambuk, H; Mazaheri, Y [Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Banerjee, S; Shankaranarayanan, A [GE Healthcare, Menlo Park, California (United States); Deasy, J [Memorial Sloan Kettering Cancer Center, New York, NY (United States)

    2014-06-15

    Purpose: To investigate the repeatability of reduced field-of-view diffusion-weighted imaging (rFOV DWI) in quantifying apparent diffusion coefficients (ADCs) for human thyroid glands in a clinical setting. Methods: Nine healthy human volunteers were enrolled and underwent 3T MRI exams. For each volunteer, 3 longitudinal exams (2 weeks apart) with 2 repetitive sessions within each exam, including rFOV and conventional full field-of-view (fFOV) DWI scans, were performed. In the acquired DWI images, a fixed-size region of interest (ROI; diameter=8mm) was placed on thyroid glands to calculate ADC. ADC was calculated using a monoexponential function with a noise correction scheme. The repeatability of ADC was assessed by using coefficient variation (CV) across sessions or exams, which was defined to be: r = 1-CV, 0 < r < 1, where CV=STD/m, STD is the standard deviation of ADC, and m is the average of ADC across sessions or exams. An experienced radiologist assessed and scored rFOV and fFOV DW images based on image characteristics (1, nondiagnostic; 2, poor; 3, satisfactory; 4, good; and 5, excellent).Analysis of variance (ANOVA) was performed to compare ADC values, CV of ADC, repeatability of ADC across sessions and exams, and radiologic scores between rFOV and fFOV DWI techniques. Results: There was no significant difference in ADC values across sessions and exams either in rFOV or fFOV DWI. The average CVs of both rFOV and fFOV DWI were less than 13%. The repeatability of ADC measurement between rFOV and fFOV DWI was not significantly different. The overall image quality was significantly higher with rFOV DWI than with fFOV DWI. Conclusion: This study suggested that ADCs from both rFOV and fFOV DWI were repeatable, but rFOV DWI had superior imaging quality for human thyroid glands in a clinical setting.

  11. Mid-Childhood Bone Mass After Exposure to Repeat Doses of Antenatal Glucocorticoids: A Randomized Trial.

    Science.gov (United States)

    McKinlay, Christopher J D; Cutfield, Wayne S; Battin, Malcolm R; Dalziel, Stuart R; Crowther, Caroline A; Harding, Jane E

    2017-05-01

    Treatment of women at risk for preterm birth with repeat doses of glucocorticoids reduces neonatal morbidity, but could have adverse effects on skeletal development. We assessed whether exposure to repeat antenatal betamethasone alters bone mass in children whose mothers participated in the Australasian Collaborative Trial of Repeat Doses of Corticosteroids. Women were randomized to a single dose of betamethasone or placebo, ≥7 days after an initial course of glucocorticoids, repeated each week that they remained at risk for preterm birth at children underwent whole-body dual-energy radiograph absorptiometry at 6 to 8 years' corrected age. Of 212 eligible childhood survivors, 185 were studied (87%; 91 repeat betamethasone group; 94 placebo [single course] group). Children exposed to repeat antenatal betamethasone and those exposed to placebo had similar whole-body bone mineral content (median repeat betamethasone: 553 g, interquartile range: 442-712 g; placebo: 567 g, interquartile range: 447-750 g; geometric mean ratio: 0.99; 95% confidence interval: 0.94-1.03, P = .55) and bone area (median repeat betamethasone 832 cm(2), interquartile range: 693-963 cm(2); placebo: 822 cm(2), interquartile range: 710-1020 cm(2); geometric mean ratio: 0.99, 95% confidence interval: 0.92-1.07, P = .75). Exposure to repeat doses of antenatal betamethasone compared with a single course of glucocorticoids does not alter bone mass in mid-childhood. Copyright © 2017 by the American Academy of Pediatrics.

  12. The Dynamics of Initiative in Communication Networks

    CERN Document Server

    Mollgaard, Anders

    2016-01-01

    Human social interaction is often intermittent. Two acquainted persons can have extended periods without social interaction punctuated by periods of repeated interaction. In this case, the repeated interaction can be characterized by a seed initiative by either of the persons and a number of follow-up interactions. The tendency to initiate social interaction plays an important role in the formation of social networks and is in general not symmetric between persons. In this paper, we study the dynamics of initiative by analysing and modeling a detailed call and text message network sampled from a group of 700 individuals. We show that in an average relationship between two individuals, one part is almost twice as likely to initiate communication compared to the other part. The asymmetry has social consequences and ultimately might lead to the discontinuation of a relationship. We explain the observed asymmetry by a positive feedback mechanism where individuals already taking initiative are more likely to take ...

  13. Software Development Initiatives to Identify and Mitigate Security Threats - Two Systematic Mapping Studies

    Directory of Open Access Journals (Sweden)

    Paulina Silva

    2016-12-01

    Full Text Available Software Security and development experts have addressed the problem of building secure software systems. There are several processes and initiatives to achieve secure software systems. However, most of these lack empirical evidence of its application and impact in building secure software systems. Two systematic mapping studies (SM have been conducted to cover the existent initiatives for identification and mitigation of security threats. The SMs created were executed in two steps, first in 2015 July, and complemented through a backward snowballing in 2016 July. Integrated results of these two SM studies show a total of 30 relevant sources were identified; 17 different initiatives covering threats identification and 14 covering the mitigation of threats were found. All the initiatives were associated to at least one activity of the Software Development Lifecycle (SDLC; while 6 showed signs of being applied in industrial settings, only 3 initiatives presented experimental evidence of its results through controlled experiments, some of the other selected studies presented case studies or proposals.

  14. Dietary patterns are associated with disease risk among participants in the women's health initiative observational study

    Science.gov (United States)

    Coronary heart disease (CHD) is the leading cause of death in women. A nested case-control study tested whether dietary patterns predicted CHD events among 1224 participants in the Women’s Health Initiative-Observational Study (WHI-OS) with centrally confirmed CHD, fatal or nonfatal myocardial infar...

  15. Initiating Transdisciplinarity in Academic Case Study Teaching: Experiences from a Regional Development Project in Salzburg, Austria

    Science.gov (United States)

    Muhar, Andreas; Vilsmaier, Ulli; Glanzer, Michaela; Freyer, Bernhard

    2006-01-01

    Purpose: The purpose of this paper is to describe experiences with the initiation of transdisciplinarity in academic case study teaching with special reference to regional planning, based on the case study "Leben 2014 (Life 2014)--perspectives for regional development in the national park region Ober-pinz-gau, Salzburg".…

  16. Here Today Gone Tomorrow: Conceptualizing Instructional Leadership through Case Studies of Unsustained Initiatives

    Science.gov (United States)

    Shulman, Vivian; Sullivan, Susan

    2015-01-01

    This study examines two case studies of failed leadership in school-based professional development. We describe the two initiatives and look to current leadership theories to help account for the events that occurred. The sociologist Bourdieu's concept of "habitus" offers an approach to understanding the relationship between individual…

  17. Recursive quantum repeater networks

    CERN Document Server

    Van Meter, Rodney; Horsman, Clare

    2011-01-01

    Internet-scale quantum repeater networks will be heterogeneous in physical technology, repeater functionality, and management. The classical control necessary to use the network will therefore face similar issues as Internet data transmission. Many scalability and management problems that arose during the development of the Internet might have been solved in a more uniform fashion, improving flexibility and reducing redundant engineering effort. Quantum repeater network development is currently at the stage where we risk similar duplication when separate systems are combined. We propose a unifying framework that can be used with all existing repeater designs. We introduce the notion of a Quantum Recursive Network Architecture, developed from the emerging classical concept of 'recursive networks', extending recursive mechanisms from a focus on data forwarding to a more general distributed computing request framework. Recursion abstracts independent transit networks as single relay nodes, unifies software layer...

  18. Effect of repeated intracoronary injection of bone marrow cells in patients with ischaemic heart failure the Danish stem cell study - congestive heart failure trial (DanCell-CHF)

    DEFF Research Database (Denmark)

    Diederichsen, A.C.; Møller, Jacob Eifer; Thayssen, P.;

    2008-01-01

    BACKGROUND: It has been suggested that myocardial regeneration may be achieved by a single intracoronary bone marrow derived stem cell infusion in selected patients with ischaemic heart disease. The effect is uncertain in patients with chronic ischaemic heart failure and it is not known whether...... repeated infusions would have additional positive effects. AIMS: To assess whether two treatments of intracoronary infusion of bone marrow stem cells, administered 4 months apart, could improve left ventricular (LV) systolic function in patients with chronic ischaemic heart failure. METHODS: The study......, NYHA class improved (pstem cell treatment in patients with chronic ischaemic heart failure Udgivelsesdato: 2008/7...

  19. The Role of Family on Hookah Smoking Initiation in Women: A Qualitative Study

    Science.gov (United States)

    Baheiraei, Azam; Sighaldeh, Shirin Shahbazi; Ebadi, Abbas; Kelishadi, Roya; Majdzadeh, Reza

    2015-01-01

    Hookah smoking has recently emerged as a popular alternative to cigarette smoking particularly among young adults and women. This study focused on the role of family members’ smoking behaviours as a possible risk factor for initiation of hookah smoking in women. 36 in-depth interviews were conducted with Iranian women of diverse ages for understanding the factors contributing to the initiation of hookah smoking. Four main themes were identified from the data. This study focused on the role of family as a facilitator for hookah smoking initiation. The results of this study indicate that the entry of hookah into homes can be effective in the spread of hookah smoking among adult and young women, in three ways: Girls’ participation in the preparation of hookah and the frequent observation of people who smoke hookah at home can be effective in hookah smoking initiation among young girls; the husband of a young woman has an important role in the initiation of smoking hookah; when parents invite children to smoke hookah at home, in order to protect them against public censure, the mother (a middle aged woman) may intend to start smoking hookah. Therefore, tobacco use prevention interventions should be focused on targeting the family as well. PMID:26156895

  20. Hysteresis of magnetostructural transitions: Repeatable and non-repeatable processes

    Energy Technology Data Exchange (ETDEWEB)

    Provenzano, Virgil [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States); Della Torre, Edward; Bennett, Lawrence H. [Department of Electrical and Computer Engineering, The George Washington University, Washington, DC 20052 (United States); ElBidweihy, Hatem, E-mail: Hatem@gwmail.gwu.edu [Department of Electrical and Computer Engineering, The George Washington University, Washington, DC 20052 (United States)

    2014-02-15

    The Gd{sub 5}Ge{sub 2}Si{sub 2} alloy and the off-stoichiometric Ni{sub 50}Mn{sub 35}In{sub 15} Heusler alloy belong to a special class of metallic materials that exhibit first-order magnetostructural transitions near room temperature. The magnetic properties of this class of materials have been extensively studied due to their interesting magnetic behavior and their potential for a number of technological applications such as refrigerants for near-room-temperature magnetic refrigeration. The thermally driven first-order transitions in these materials can be field-induced in the reverse order by applying a strong enough field. The field-induced transitions are typically accompanied by the presence of large magnetic hysteresis, the characteristics of which are a complicated function of temperature, field, and magneto-thermal history. In this study we show that the virgin curve, the major loop, and sequentially measured MH loops are the results of both repeatable and non-repeatable processes, in which the starting magnetostructural state, prior to the cycling of field, plays a major role. Using the Gd{sub 5}Ge{sub 2}Si{sub 2} and Ni{sub 50}Mn{sub 35}In{sub 15} alloys, as model materials, we show that a starting single phase state results in fully repeatable processes and large magnetic hysteresis, whereas a mixed phase starting state results in non-repeatable processes and smaller hysteresis.

  1. Multiscale simulation and nanoindentation experimental study of initial plasticity of Fe single crystal

    Institute of Scientific and Technical Information of China (English)

    YUAN Lin; SHAN De-bin; GUO Bin

    2009-01-01

    It is very important to understand the initial plastic behavior of metals at microscale. In order to research the initial plasticity of body centered cubic metals in micro-/nano-scale, the multiscale simulation method and experimental study were used to study the nanoindentation process of Fe single crystal. The results show that the first abruption of load-displacement curve in nanoindentation of Fe single crystal can be attributed to the first transition from elastic to plastic deformation characterized by the dislocation emission.

  2. Fixed-flexion knee radiography using a new positioning device produced highly repeatable measurements of joint space width: ELSA-Brasil Musculoskeletal Study (ELSA-Brasil MSK).

    Science.gov (United States)

    Telles, Rosa Weiss; Costa-Silva, Luciana; Machado, Luciana A C; Reis, Rodrigo Citton Padilha Dos; Barreto, Sandhi Maria

    To describe the performance of a non-fluoroscopic fixed-flexion PA radiographic protocol with a new positioning device, developed for the assessment of knee osteoarthritis (OA) in Brazilian Longitudinal Study of Adult Health Musculoskeletal Study (ELSA-Brasil MSK). A test-retest design including 19 adults (38 knee images) was conducted. Feasibility of the radiographic protocol was assessed by image quality parameters and presence of radioanatomic alignment according to intermargin distance (IMD) values. Repeatability was assessed for IMD and joint space width (JSW) measured at three different locations. Approximately 90% of knee images presented excellent quality. Frequencies of nearly perfect radioanatomic alignment (IMD ≤1mm) ranged from 29% to 50%, and satisfactory alignment was found in up to 71% and 76% of the images (IMD ≤1.5mm and ≤1.7mm, respectively). Repeatability analyses yielded the following results: IMD [SD of mean difference=1.08; coefficient of variation (%CV)=54.68%; intraclass correlation coefficient (ICC) (95%CI)=0.59 (0.34-0.77)]; JSW [SD of mean difference=0.34-0.61; %CV=4.48%-9.80%; ICC (95%CI)=0.74 (0.55-0.85)-0.94 (0.87-0.97)]. Adequately reproducible measurements of IMD and JSW were found in 68% and 87% of the images, respectively. Despite the difficulty in achieving consistent radioanatomic alignment between subsequent radiographs in terms of IMD, the protocol produced highly repeatable JSW measurements when these were taken at midpoint and 10mm from the medial extremity of the medial tibial plateau. Therefore, measurements of JSW at these locations can be considered adequate for the assessment of knee OA in ELSA-Brasil MSK. Copyright © 2016. Published by Elsevier Editora Ltda.

  3. E-travel Adoption by Small Travel Enterprises (STEs): An Initial Study in Indonesia and Malaysia

    OpenAIRE

    Vera Pujani; Yazrina Yahya; Alfitman Alfitman; Refdinal Nazir

    2015-01-01

    This paper aims to investigate e-travel adoption of tourism industries in Indonesia and Malaysia particularly by STEs. The qualitative research was undertaken using case analysis from in-depth interviews of 10-STEs as intial study both in Indonesia and Malaysia. The finding result of e-travel adoption by STEs in a cross-cultural study was identified from the findings present in the initial study based on personal, organizational and website characteristics. The majority of personal characteri...

  4. Automated quality checks on repeat prescribing.

    OpenAIRE

    Rogers, Jeremy E; Wroe, Christopher J; Roberts, Angus; Swallow, Angela; Stables, David; Cantrill, Judith A; Rector, Alan L.

    2003-01-01

    BACKGROUND: Good clinical practice in primary care includes periodic review of repeat prescriptions. Markers of prescriptions that may need review have been described, but manually checking all repeat prescriptions against the markers would be impractical. AIM: To investigate the feasibility of computerising the application of repeat prescribing quality checks to electronic patient records in United Kingdom (UK) primary care. DESIGN OF STUDY: Software performance test against benchmark manual...

  5. Early cannabis initiation and educational attainment: is the association causal? Data from the French TEMPO study.

    Science.gov (United States)

    Melchior, Maria; Bolze, Camille; Fombonne, Eric; Surkan, Pamela J; Pryor, Laura; Jauffret-Roustide, Marie

    2017-05-18

    : Adolescent cannabis use has been reported to predict later educational attainment; however, results of past studies may be confounded by inappropriate control for factors that make some youths more likely to use cannabis precociously than others. We aimed to test the possibility of a causal relationship between early cannabis initiation and later academic achievement. : Analyses are based on data collected among TEMPO cohort study participants (France, 2009, n  = 1103, 22-35 years). Participants were previously assessed in childhood (1991) and adolescence (1999); additionally, their parents had taken part in a longitudinal epidemiological cohort study (GAZEL). Early cannabis initiation was defined as use at age 16 or earlier. Educational attainment was defined as the completion of a high-school degree ('Baccalauréat'). Early (up to and including age 16 years) and late (after age 16 years) cannabis-use initiators were compared with non-users using logistic regression models controlled for inverse probability weights (IPWs) of exposure calculated based on participants' socio-demographic, juvenile and parental characteristics. : In age- and sex-adjusted analyses, early cannabis initiators were more likely than non-users to have low educational attainment [odds ratio (OR): 1.77, 95% confidence interval (CI) 1.22-2.55]. In IPWs-controlled analyses, this association somewhat decreased (OR: 1.64, 95% CI 1.13-2.40). Late cannabis initiators did not have lower educational attainment than non-users. Early cannabis use and educational attainment appeared more strongly associated in young women than in young men. : Early cannabis can cause low educational attainment. Youths who initiate cannabis use early require attention from addiction and education specialists to reduce their odds of poor long-term outcomes.

  6. Adapting "Lesson Study" to Investigate Classroom Pedagogy in Initial Teacher Education: What Student-Teachers Think

    Science.gov (United States)

    Cajkler, Wasyl; Wood, Phil

    2016-01-01

    This paper reports findings from a project that explored the use of a modified form of "lesson study" in a one-year programme of secondary school initial teacher education (ITE). Twelve mentors and student-teachers worked in pairs to design and teach two "research lessons" in the course of two eight-week teaching practice…

  7. An Empirical Case Study of a Child Sexual Abuse Prevention Initiative in Georgia

    Science.gov (United States)

    Schober, Daniel J.; Fawcett, Stephen B.; Thigpen, Sally; Curtis, Anna; Wright, Renee

    2012-01-01

    Objective: This empirical case study describes Prevent Child Abuse Georgia's effort to prevent child sexual abuse (CSA) by educating communities throughout the state on supporting preventive behaviour. The initiative consisted of three major components: (1) dissemination of CSA prevention messages and materials; (2) a statewide helpline that…

  8. Educative Mentors? The Role of Classroom Teachers in Initial Teacher Education. A New Zealand Study

    Science.gov (United States)

    Trevethan, Helen

    2017-01-01

    Classroom experience is an important part of initial teacher education (ITE) and the teachers who work with student teachers in schools have a significant impact on learning in this context. While many studies have documented what the role of these teachers should be, it is also important to consider how the role is conceptualised by the teachers…

  9. An Empirical Case Study of a Child Sexual Abuse Prevention Initiative in Georgia

    Science.gov (United States)

    Schober, Daniel J.; Fawcett, Stephen B.; Thigpen, Sally; Curtis, Anna; Wright, Renee

    2012-01-01

    Objective: This empirical case study describes Prevent Child Abuse Georgia's effort to prevent child sexual abuse (CSA) by educating communities throughout the state on supporting preventive behaviour. The initiative consisted of three major components: (1) dissemination of CSA prevention messages and materials; (2) a statewide helpline that…

  10. Antecedents of the initiation of watching sexually explicit Internet material: A longitudinal study among adolescents

    NARCIS (Netherlands)

    Vandenbosch, L.; Peter, J.

    2016-01-01

    Little research to date has focused on adolescents’ initiation of watching sexually explicit Internet material (SEIM) and its antecedents. Based on 400 adolescents who had never watched SEIM at baseline (in a three-wave panel study among 1,467 13–17-year-old Dutch adolescents), we examined

  11. The Initiation of Dating in Adolescence : The Effect of Parental Divorce. The TRAILS Study

    NARCIS (Netherlands)

    Ivanova, Katya; Mills, Melinda; Veenstra, Rene

    2011-01-01

    This study examined the effect of parental divorce on the time it took adolescents to initiate their first romantic relationships. Individual differences in temperament and pubertal development and the age of the adolescent at the time of divorce were also taken into account. Hypotheses were tested

  12. Evaluating IGE: An Initial Literature Review and Exploratory Study. Technical Report No. 404.

    Science.gov (United States)

    Katzenmeyer, Conrad G.; And Others

    The results of an initial evaluation study of Individually Guided Education (IGE) are presented. A matched sample of IGE and non-IGE schools was compared on a variety of direct and indirect outcome measures. Findings indicated general support for the achievement of direct outcomes, with few differences between IGE and control schools shown on…

  13. An initial in-orbit performance study of Silicon Tungsten tracKer on DAMPE

    Science.gov (United States)

    Qiao, Rui

    2016-07-01

    The dark matter particle explorer (DAMPE) was launched in December 2015 and taking data since then. One of its major payloads, Silicon Tungsten tracker (STK) plays an important role in tracking and ion charge identification. From the study of first few months of data collection of STK, the noise behaviors, DAC/MIPs calibration and an initial charge detection result will be presented.

  14. The Initiation of Dating in Adolescence: The Effect of Parental Divorce. The TRAILS Study

    Science.gov (United States)

    Ivanova, Katya; Mills, Melinda; Veenstra, Rene

    2011-01-01

    This study examined the effect of parental divorce on the time it took adolescents to initiate their first romantic relationships. Individual differences in temperament and pubertal development and the age of the adolescent at the time of divorce were also taken into account. Hypotheses were tested using event history analysis with a sample of…

  15. Married Thai Working Mothers: Coping with Initial Part-Time Doctoral Study

    Science.gov (United States)

    Thinnam, Thanit

    2011-01-01

    Advanced educational attainment can "grow" a career. But acquiring a doctoral qualification adds study to existing work and family responsibilities, especially for women. This phenomenological research explores the experiences of eight Thai working mothers enrolled in the initial stage of part-time doctoral programs in Thailand. A…

  16. Radiation or chemoradiation: initial utility study of selected therapy for local advanced stadium cervical cancer

    Science.gov (United States)

    Pramitasari, D. A.; Gondhowiardjo, S.; Nuranna, L.

    2017-08-01

    This study aimed to compare radiation only or chemo radiation treatment of local advanced cervical cancers by examining the initial response of tumors and acute side effects. An initial assessment employed value based medicine (VBM) by obtaining utility values for both types of therapy. The incidences of acute lower gastrointestinal, genitourinary, and hematology side effects in patients undergoing chemoradiation did not differ significantly from those undergoing radiation alone. Utility values for patients who underwent radiation alone were higher compared to those who underwent chemoradiation. It was concluded that the complete response of patients who underwent chemoradiation did not differ significantly from those who underwent radiation alone.

  17. Development and initial testing of functional task exercise on older adults with cognitive impairment at risk of Alzheimer's disease--FcTSim programme--a feasibility study.

    Science.gov (United States)

    Law, Lawla L F; Barnett, Fiona; Yau, Matthew K; Gray, Marion A

    2013-12-01

    The purpose of this study was to illustrate the development of a new functional task-based exercise programme and initially test its feasibility as well as effectiveness for older adults with mild cognitive impairment (MCI). This study used a single-group repeated-measures design. A total of 11 patients (mean age 71.8 years) were recruited to participate in a structured functional task exercise programme for 10 weeks. All outcome measures were undertaken at baseline, post-intervention and post-3-month follow-up using the Neurobehavioral Cognitive Status Examination (NCSE), Verbal Fluency Test (VFT), Chinese Version Verbal Learning Test (CVVLT), Lawton Instrumental Activities of Daily Living Scale (Lawton IADL) and Problems in Everyday Living test (PEDL). Data were analysed using a repeated-measures analysis of variance. Cohen's d effect size was used to assess the practical significant effects. The participants showed significant improvement in NCSE composite score, VFT, CVVLT total free recall, CVVLT 10-minute delayed free recall, Lawton IADL and PEDL. Results of this study demonstrate that the newly designed functional task exercise programme, which uses simulated tasks, is feasible and beneficial to cognitive functions and functional status of older persons with MCI. The findings of the current study further reinforce occupational therapy practitioners' understanding that "occupation" is a "means" and an "end". Further study with a larger population is needed to draw more definitive conclusions. Copyright © 2013 John Wiley & Sons, Ltd.

  18. Initiation and persistence with clopidogrel treatment after acute myocardial infarction: a nationwide study

    DEFF Research Database (Denmark)

    Abildstrøm, Steen Zabell; Sørensen, Rikke; Gislason, G H

    2008-01-01

    AIMS: To identify possible underuse by analysing initiation and persistence with clopidogrel treatment in an unselected population of patients admitted with myocardial infarction (MI) with or without subsequent percutaneous coronary intervention (PCI). METHODS: Patients admitted with first-time MI...... from 2000 to 2005 and subsequent prescription claims of clopidogrel were identified by individual-level linkage of nationwide administrative registries in Denmark. Independent factors affecting initiation and persistence with treatment were analysed by multivariable logistic regression models and Cox...... proportional hazard models. RESULTS: A total of 46,190 MI patients were included in the study, of whom 14,939 were treated with PCI. From 2000 to 2005 initiation of clopidogrel increased from 80.4 to 93.7% among MI patients with PCI and from 2.8 to 39.3% among MI patients without PCI. MI patients...

  19. Strengthening concept learning by repeated testing.

    Science.gov (United States)

    Wiklund-Hörnqvist, Carola; Jonsson, Bert; Nyberg, Lars

    2014-02-01

    The aim of this study was to examine whether repeated testing with feedback benefits learning compared to rereading of introductory psychology key-concepts in an educational context. The testing effect was examined immediately after practice, after 18 days, and at a five-week delay in a sample of undergraduate students (n = 83). The results revealed that repeated testing with feedback significantly enhanced learning compared to rereading at all delays, demonstrating that repeated retrieval enhances retention compared to repeated encoding in the short- and the long-term. In addition, the effect of repeated testing was beneficial for students irrespectively of working memory capacity. It is argued that teaching methods involving repeated retrieval are important to consider by the educational system.

  20. Quartz crystal microbalance study of the kinetics of surface initiated polymerization

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Surface initiated polymerization (SIP) is a valuable tool in synthesizing functional polymer brushes,yet the kinetic understanding of SIP lags behind the development of its application. We apply quartz crystal microbalance (QCM) to address two issues that are not fully addressed yet play a central role in the rational design of functional polymer brushes,namely quantitative determination of the kinetics and the initiator efficiency (IE) of SIP. SIP are monitored online using QCM. Two quantitative frequencythickness (f-T) relations make the direct determination and comparison of the rate of polymerization possible even for different monomers. Based on the bi-termination model,the kinetics of SIP is simply described by two variables,which are related to two polymerization constants,namely a = 1/(kp,s,app-[M][R·]0) and b = kt,s,app/(kp,s,app[M]). Factors that could alter the kinetics of SIP are studied,including (i) the molecular weight of monomers,(ii) the solvent used,(iii) the initial density of the initiator,(iv) the concentration of monomer,[M],and (v) the catalyst system (ratio among the ingredients,metal,ligands,and additives). The dynamic nature of IE is also described by these two variables,IE = a/(a + bt). Instead of the molecular weight and the polydispersity,we suggest that film thickness,the two kinetic parameters (a and b),and the initial density of the initiator and IE be the parameters that characterize ultrathin polymer brushes. Besides the kinetics study of SIP,the reported method has many other applications,for example,in the fast screening of catalyst system for SIP and other polymerization systems.

  1. The study of nursing students’ learning initiative in the course reform of aged caring

    Directory of Open Access Journals (Sweden)

    Sun Wenjing

    2017-01-01

    Full Text Available Purpose: Analyzing the influence of nursing students’ learning initiative in the course reform of aged caring. Discuss the way of the aged care reform. Method: To reform the course of aged care in our school level 2013 88 nursing undergraduate. The specific content: learning aged care theory, learning Japanese care technology basic knowledge, adding Japanese and Taiwan’s nursing concepts to the traditional aged care teaching, performing sitcoms about old people’s disease and nursing way , reporting the plan of aged care by PowerPoint, organizing student volunteers to visit the nursing home and so on. The specific content lasted four months. Adopting the learning initiative (ALS scale developed by Zang Yuli and others after course reform. Measure the students’ learning initiative before and after the teaching. Result: Nursing student’s self-study ability was in the middle and lower level before the course reform(59.26±7.38; After the course reform, nursing student gain higher score than before learning on the three aspects contain “Learning motivation”,“Learning goals” and “Solid study”. The difference has statistically significant.(P<0.05.Conclusion: Through the aged care course reform, nursing students strengthen the study enthusiasm and initiative; enhance nursing student’s self-study ability. It is conducive to improve the learning interest of aged care course for nursing students.

  2. Who has a repeat abortion? Identifying women at risk of repeated terminations of pregnancy: analysis of routinely collected health care data.

    Science.gov (United States)

    McCall, Stephen J; Flett, Gillian; Okpo, Emmanuel; Bhattacharya, Sohinee

    2016-04-01

    Repeat termination of pregnancy highlights the issues of unplanned pregnancies and effective post-termination contraceptive practices. To examine the risk factors at the time of a first termination that are associated with subsequent repeat termination. Registry-based study. Grampian region of Scotland, UK. A retrospective study using data from the Termination of Pregnancy Database, NHS Grampian for the period 1997-2013. Associations between repeat termination and women's sociodemographic characteristics and contraceptive use were assessed using multivariable logistic regression models. This study showed that 23.4% of women who had an initial termination (n=13 621) underwent a repeat termination. Women who had repeat terminations were more likely to be aged under 20 years at their initial termination with an adjusted odds ratio (AOR) of 5.59 [95% confidence interval (CI) 4.17-7.49], to belong to the most deprived social quintile [AOR 1.23 (95% CI 1.05-1.43)], and to be more likely to have had two or more previous livebirths [AOR 1.51 (95% CI 1.12-2.02)] or miscarriages [AOR 1.40 (95% CI 1.02-1.92)]. The likelihood of having a repeat termination was increased in women who had a contraceptive implant as post-termination contraception [AOR 1.78 (95% CI 1.50-2.11)] compared to women who left with none or unknown methods following the first termination. In those who had repeat terminations, women who had an implant or Depo-Provera(®) were at increased odds of repeat termination in the 2-5 years interval compared to the 0-2 years after their initial termination. Teenage pregnancy, social deprivation, two or more previous livebirths or miscarriages at the time of the initial termination were identified as risk factors for repeat terminations. Post-termination contraception with implants and Depo-Provera® were associated with repeat termination 2-5 years after the first termination. Published by the BMJ Publishing Group Limited. For permission to use (where not

  3. The Pentapeptide Repeat Proteins

    Energy Technology Data Exchange (ETDEWEB)

    Vetting,M.; Hegde, S.; Fajardo, J.; Fiser, A.; Roderick, S.; Takiff, H.; Blanchard, J.

    2006-01-01

    The Pentapeptide Repeat Protein (PRP) family has over 500 members in the prokaryotic and eukaryotic kingdoms. These proteins are composed of, or contain domains composed of, tandemly repeated amino acid sequences with a consensus sequence of [S, T,A, V][D, N][L, F]-[S, T,R][G]. The biochemical function of the vast majority of PRP family members is unknown. The three-dimensional structure of the first member of the PRP family was determined for the fluoroquinolone resistance protein (MfpA) from Mycobacterium tuberculosis. The structure revealed that the pentapeptide repeats encode the folding of a novel right-handed quadrilateral {beta}-helix. MfpA binds to DNA gyrase and inhibits its activity. The rod-shaped, dimeric protein exhibits remarkable size, shape and electrostatic similarity to DNA.

  4. Can a Repeated Sprint Ability Test Help Clear a Previously Injured Soccer Player for Fully Functional Return to Activity? A Pilot Study.

    Science.gov (United States)

    Padulo, Johnny; Attene, Giuseppe; Ardigò, Luca P; Bragazzi, Nicola L; Maffulli, Nicola; Zagatto, Alessandro M; Dello Iacono, Antonio

    2017-07-01

    To investigate the effects of fatigue induced by a repeated sprint ability (RSA) test on the neuromuscular responses of soccer players with a recent history of lower limb injuries (CH) and a matched control group in good fitness condition (GH). This was a case-control study. Nine CH and 9 GH. Allocation to CH or GH. Each player was assessed for blood lactate concentration and jumping performance [squat jump (SJ) and countermovement jump (CMJ)] before/after RSA. Post-RSA rate of perceived exertion (RPE) was obtained. Receiver operating characteristic analysis was performed to calculate RSA sensitivity and specificity in distinguishing between CH and GH. Intraclass correlation coefficient was used to assess reliability. No baseline differences were found for any variable. ΔSJ before/after RSA was -14 ± 2% and -5 ± 2% in CH and GH, respectively (P Repeated sprint ability is a simple, low-cost field test potentially able to assist in clinical decision making for return to sport.

  5. Family Cohesion and Romantic and Sexual Initiation: A Three Wave Longitudinal Study.

    OpenAIRE

    van der Graaf, H.; Schoot, A.G.J. van de; Woertman, L.; Hawk, S.T.; Meeus, Wim

    2011-01-01

    Although the relation between family relationships and the timing of sexual debut has been the focus of many studies, research on mediating factors is scarce. This study examines whether low levels of family cohesion result in an earlier onset of romantic and sexual experiences, and whether the link between family cohesion and an early sexual debut is mediated by early romantic initiation. A longitudinal sample of 314 adolescent girls and 222 boys, aged 12–17 at Wave 1, completed questionnair...

  6. Repeating the Past

    Science.gov (United States)

    Moore, John W.

    1998-05-01

    As part of the celebration of the Journal 's 75th year, we are scanning each Journal issue from 25, 50, and 74 years ago. Many of the ideas and practices described are so similar to present-day "innovations" that George Santayana's adage (1) "Those who cannot remember the past are condemned to repeat it" comes to mind. But perhaps "condemned" is too strong - sometimes it may be valuable to repeat something that was done long ago. One example comes from the earliest days of the Division of Chemical Education and of the Journal.

  7. Phylogenetic study and molecular identification of 31 Dendrobium species using inter-simple sequence repeat (ISSR) markers

    National Research Council Canada - National Science Library

    Wang, H.-Z; Feng, S.-G; Lu, J.-J; Shi, N.-N; Liu, J.-J

    2009-01-01

    The genetic diversity of the genus Dendrobium is not well known and the phylogenetic relationship of Dendrobium species are mainly determined by studies of the comparative vegetative anatomy and plant systematics...

  8. Depersonalisation and schizophrenia: Comparative study of initial and multiple episodes of schizophrenia.

    Science.gov (United States)

    Luque-Luque, Rogelio; Chauca-Chauca, Geli Marie; Alonso-Lobato, Pablo; Jaen-Moreno, M Jose

    2016-01-01

    The phenomena of depersonalisation/derealisation have classically been associated with the initial phases of psychosis, and it is assumed that they would precede (even by years) the onset of clinical psychosis, being much more common in the prodromal and acute phases of the illness. The aims of the present study are to analyse the differences in depersonalisation/derealisation between patients with initial and multiple episodes and the factors that could influence this. A descriptive, controlled and cross-sectional study of 48 patients diagnosed with paranoid schizophrenia (20 with an initial episode and 28 with multiple episodes). These patients were assessed using scales such as the Cambridge Depersonalization Scale, the Positive and Negative Symptom Scale, and the Dissociative Experiences Scale. Participants with initial episodes score higher on both the Cambridge Depersonalisation Scale, and the subscale of the Dissociative Experiences Scale that evaluates such experiences. There were no associations between these types of experience and the positive symptoms subscale of the Positive and Negative Symptom Scale. Depersonalisation/derealisation experiences appear with greater frequency, duration and intensity in patients in the early stages of the illnesses, gradually decreasing as they become chronic. Copyright © 2016 SEP y SEPB. Published by Elsevier España. All rights reserved.

  9. Experimental study of breach process of landslide dams by overtopping and its initiation mechanisms

    Institute of Scientific and Technical Information of China (English)

    杨阳; 曹叔尤; 杨克君; 李文萍

    2015-01-01

    The present paper studies the physics of the breach erosion process, particularly, the breach initiation process in over- topped landslide dams. Due to great complexities involved, only homogeneous landslide dams are considered. The flume experime- nts of dam overtopping are conducted to study the breach growth process. And in order to reveal the effects of the seepage during the breach development, the permeability characteristics of the dam materials are also taken into consideration. With the experimental observation, the details of the breach growth are examined, and the whole breach process could be distinguished into five stages, i.e., Stage I, the seepage erosion, Stage II, the formation of the initial breach, Stage III, the erosion toward the head, Stage IV, the expan- sion and incision of the breach, and Stage V, the re-equilibration of the river channel through the breach. It is shown that once trigge- red the entire breach process goes continually without stop, which highlights the significant impact of the early stages on the later deformation of the dam. Evidence shows that the initial breach of the dam is most likely to take place in the downstream slope of the dam, near the upper edge of the seepage face. The experimental results show a “headcut” mechanism of the breach initiation.

  10. Study of Initial Vorticity Forcing for Block Onset by a 4-Dimensional Variational Approach

    Institute of Scientific and Technical Information of China (English)

    QIAO Fangli; ZHANG Shaoqing; YIN Xunqiang

    2005-01-01

    With the aid of a global barotropic model, the role of the interaction of the synoptic-scale disturbance and the planetary flow in block onset is examined by a 4-dimensional variational approach. A cost function is defined to measure the squared errors of the forecasted stream functions during block onset period (day 4 and day 5 in this study) over a selected blocking domain. The sensitivity of block onset with respect to the initial synoptic-scale disturbance is studied by examining the gradient of the defined cost function with respect to the initial (during the first 24 hours) vorticity forcing, which is evaluated by the adjoint integration. Furthermore, the calculated cost function and gradient are connected with the limited-memory quasi-Newton optimization algorithm for solving the optimal initial vorticity forcing for block onset. For two studied cases of block onset (northern Atlantic and northern Pacific) introducing the optimal initial vorticity forcing, the nonlinear barotropic advection process mostly reconstructs these blocking onset processes. The results show that the formation of blocking can be correctly described by a barotropic nonlinear advection process, in which the wave- (synoptic-scale) flow (planetary-scale)interaction plays a very important role. On an appropriate planetary-scale flow, a certain synoptic-scale disturbance can cause the blocking onset by the interaction between the synoptic scale perturbations and the planetary scale basic flows. The extended forecasts show that the introduction of the optimal initial vorticity forcing can predict the blocking process up to the 7th or 8th day in this simple model case. The experimental results in this study show that the 4-dimensional variational approach has a good potential to be applied to study the dynamics of the medium-range weather processes. This simple model case study is only an initial trial. Applying the framework in this study to a complex model will further our understanding of

  11. Factors associated with the frequency of initial total mastectomy: results of a multi-institutional study.

    Science.gov (United States)

    Feigelson, Heather Spencer; James, Ted A; Single, Richard M; Onitilo, Adedayo A; Aiello Bowles, Erin J; Barney, Tom; Bakerman, Jordan E; McCahill, Laurence E

    2013-05-01

    Several previous studies have reported conflicting data on recent trends in use of initial total mastectomy (TM); the factors that contribute to TM variation are not entirely clear. Using a multi-institution database, we analyzed how practice, patient, and tumor characteristics contributed to variation in TM for invasive breast cancer. We collected detailed clinical and pathologic data about breast cancer diagnosis, initial, and subsequent breast cancer operations performed on all female patients from 4 participating institutions from 2003 to 2008. We limited this analysis to 2,384 incident cases of invasive breast cancer, stages I to III, and excluded patients with clinical indications for mastectomy. Predictors of initial TM were identified with univariate analyses and random effects multivariable logistic regression models. Initial TM was performed on 397 (16.7%) eligible patients. Use of preoperative MRI more than doubled the rate of TM (odds ratio [OR] = 2.44; 95% CI, 1.58-3.77; p < 0.0001). Increasing tumor size, high nuclear grade, and age were also associated with increased rates of initial TM. Differences by age and ethnicity were observed, and significant variation in the frequency of TM was seen at the individual surgeon level (p < 0.001). Our results were similar when restricted to tumors <20 mm. We identified factors associated with initial TM, including preoperative MRI and individual surgeon, that contribute to the current debate about variation in use of TM for the management of breast cancer. Additional evaluation of patient understanding of surgical options and outcomes in breast cancer and the impact of the surgeon provider is warranted. Copyright © 2013 American College of Surgeons. Published by Elsevier Inc. All rights reserved.

  12. KINGDOM OF SAUDI ARABIA GEOSPATIAL INFORMATION INFRASTRUCTURE – AN INITIAL STUDY

    Directory of Open Access Journals (Sweden)

    S. H. Alsultan

    2015-10-01

    Full Text Available This paper reviews the current Geographic Information System (Longley et al. implementation and status in the Kingdom of Saudi Arabia (KSA. Based on the review, several problems were identified and discussed. The characteristic of these problems show that the country needs a national geospatial centre. As a new initiative for a national geospatial centre, a study is being conducted especially on best practice from other countries, availability of national committee for standards and policies on data sharing, and the best proposed organization structure inside the administration for the KSA. The study also covers the degree of readiness and awareness among the main GIS stakeholders within the country as well as private parties. At the end of this paper, strategic steps for the national geospatial management centre were proposed as the initial output of the study.

  13. Psycho-social Needs Impact on Hookah Smoking Initiation among Women: A Qualitative Study from Iran.

    Science.gov (United States)

    Baheiraei, Azam; Shahbazi Sighaldeh, Shirin; Ebadi, Abbas; Kelishadi, Roya; Majdzadeh, Seyed Reza

    2015-01-01

    In Iranian women, the use of hookah is the most common method of tobacco smoking. This study aimed to find the role of psycho-social needs and gaps as a possible risk factor for hookah smoking initiation in women. This qualitative study was conducted during 2012-2013 in Tehran, Iran. Thirty-six women participated in the study. They were current or former users of hookah. Data were collected through in-depth individual interviews and was analyzed through content analysis. Four main categories were identified from the data. This study focused on the category: Psycho-social needs and gaps. This category has five sub-categories which explain why women begin to smoke hookah including curiosity; desire for non-feminine, forbidden, and negative activities; need for amusement and recreation; for others: To show off; attract attention; satisfy and join others and protection. From this study, a variety of factors which contribute to the initiation of hookah smoking among women have been identified. Keeping young girls and women away from seemingly happy gatherings of hookah smokers; Providing appropriate recreational facilities for young women and training families on how to help their children in the event of a crisis-like intention to take up smoking behavior, can be some effective ways for reducing hookah smoking initiation among women.

  14. Why is it difficult to implement e-health initiatives? A qualitative study

    Directory of Open Access Journals (Sweden)

    Wallace Paul

    2011-01-01

    Full Text Available Abstract Background The use of information and communication technologies in healthcare is seen as essential for high quality and cost-effective healthcare. However, implementation of e-health initiatives has often been problematic, with many failing to demonstrate predicted benefits. This study aimed to explore and understand the experiences of implementers -- the senior managers and other staff charged with implementing e-health initiatives and their assessment of factors which promote or inhibit the successful implementation, embedding, and integration of e-health initiatives. Methods We used a case study methodology, using semi-structured interviews with implementers for data collection. Case studies were selected to provide a range of healthcare contexts (primary, secondary, community care, e-health initiatives, and degrees of normalization. The initiatives studied were Picture Archiving and Communication System (PACS in secondary care, a Community Nurse Information System (CNIS in community care, and Choose and Book (C&B across the primary-secondary care interface. Implementers were selected to provide a range of seniority, including chief executive officers, middle managers, and staff with 'on the ground' experience. Interview data were analyzed using a framework derived from Normalization Process Theory (NPT. Results Twenty-three interviews were completed across the three case studies. There were wide differences in experiences of implementation and embedding across these case studies; these differences were well explained by collective action components of NPT. New technology was most likely to 'normalize' where implementers perceived that it had a positive impact on interactions between professionals and patients and between different professional groups, and fit well with the organisational goals and skill sets of existing staff. However, where implementers perceived problems in one or more of these areas, they also perceived a lower

  15. Computational Study of the Thermodynamics of Atmospheric Nitration of PAHs via OH-Radical-Initiated Reaction

    Science.gov (United States)

    Jariyasopit, N.; Cheong, P.; Simonich, S. L.

    2011-12-01

    Nitrated polycyclic aromatic hydrocarbons (NPAHs) are an important class of PAH derivatives that are more toxic than their parent PAHs (1) and are emitted from direct emission and secondary emission to the atmosphere. The secondary emissions, particularly the OH-radical initiated and NO3-radical-initiated reactions, have been shown to influence the NPAH concentrations in the atmosphere. Gas-phase reactions are thought to be the major sources of NPAHs containing four or fewer rings (2). Besides NPAHs, PAHs lead to a number of other products including oxygenated, hydroxy substituted and ring-opened PAH derivatives (3). For some PAHs, the OH-initiated and NO3-initiated reactions result in the formation of different NPAH isomers, allowing the ratio of these isomers to be used in the determination of direct or secondary emission sources. Previous studies have shown that the PAH gas-phase reactions with OH radical is initiated by the addition of OH radical to the aromatic ring to form hydroxycyclohexadienyl radicals (4). In the presence of NO2, these reactive intermediates readily nitrate with the elimination of water (4). The hydroxycyclohexadienyl-type radical intermediates are also prone to react with other species in the atmosphere or revert back to the original compound (3). The objective of this study was to investigate the thermodynamics of PAH nitration through day-time OH-radical-initiated reactions. The theoretical investigation were carried out using Density Functioanl Theory (B3LYP) and the 6-31G(d) basis set, as implemented in Gaussian03. A number of different PAHs were studied including fluoranthene, pyrene, as well as the molecular weight 302 PAHs such as dibenzo[a,l]pyrene. Computations were also used to predict unknown NPAHs formed by OH-radical-initiated reaction. All intermediates for the OH-radical addition and the following nitration were computed. We have discovered that the thermodynamic stability of the intermediates involved in the PAH

  16. Repeat urine cultures in children with urinary tract infection

    Directory of Open Access Journals (Sweden)

    Risky Vitria Prasetyo

    2012-05-01

    Full Text Available Background Urinary tract infections (UTIs are the second leading cause of infection in children, following respiratory tract infections. Repeat urine cultures after antibiotic treatment are routinely obtained in clinical practice to verify proof of bacteriologic cure. The American Academy of Pediatrics does not recommended repeat cultures, due to increased cost and discomfort to patients. Objective To determine the frequency of positive repeat urine cultures after 3 days of antibiotics in children with UTIs. Methods We conducted a retrospective study on children with UTIs who visited the Division of Pediatric Nephrology, Department of Child Health at Dr. Soetomo Hospital, Surabaya from January 2006 to December 2011. Results of repeat urine cultures were obtained after 3 days of antibiotic treatment. Descriptive statistics were used to analyze the data. Results Of the 779 pediatric UTI cases, repeat urine cultures were performed in 264 (33.9% cases. Of the 264 patients who comprised our study, there were similar numbers of girls and boys (50.4% vs. 49.6%, respectively. The mean age of patients was 43.9 (SD 1.59 months and 35.5% of subjects were aged under 1 year. In the initial urine cultures of our subjects, Escherichia coli was the most common organism found, with 92 cases (34.8%, compared to 58 cases (21.9% of Klebsiella pneumoniae and 29 cases (10.9% of Pseudomonas aeruginosa. Rrepeat urine cultures showed no bacterial growth in 168 cases (63.6%. Conclusion Mostly negative repeat urine cultures will probably obviate the need of this test in daily routine practice. [Paediatr Indones. 2012;52:170-4].

  17. Second time around: Corticospinal responses following repeated sports-related concussions within the same season. A transcranial magnetic stimulation study

    Directory of Open Access Journals (Sweden)

    Alan J Pearce

    2014-01-01

    Conclusions: This multiple-case study has demonstrated that concussion result in increased intracortical inhibition and reduction in cognitive and motor performance. Further, TMS, in conjunction with tests of cognitive and motor performance, can be useful as a prognostic technique in assessing recovery from acute concussion injury.

  18. Reduction of smoking in Dutch adolescents over the past decade and its health gains : a repeated cross-sectional study

    NARCIS (Netherlands)

    Gielkens-Sijstermans, Cindy M.; Mommers, Monique A.; Hoogenveen, Rudolf T.; Feenstra, Talitha L.; de Vreede, Jacqueline; Bovens, Fons M.; van Schayck, Onno C.

    Background: Smoking is the main preventable lifestyle-related risk factor threatening human health. In this study, time trends in smoking behaviour between 1996 and 2005 among adolescents enrolled in secondary school were assessed. Methods: In 1996, 2001 and 2005, a survey was conducted in the

  19. A repeated-measures study of recreational water exposure, non-point source pollution, and risk of illness

    Science.gov (United States)

    Discharge of stormwater runoff onto beaches is a major cause of beach closings and advisories in the United States. Prospective studies of recreational water quality and health have often been limited to two time points (baseline and follow-up). Little is known about the risk of ...

  20. All-optical repeater.

    Science.gov (United States)

    Silberberg, Y

    1986-06-01

    An all-optical device containing saturable gain, saturable loss, and unsaturable loss is shown to transform weak, distorted optical pulses into uniform standard-shape pulses. The proposed device performs thresholding, amplification, and pulse shaping as required from an optical repeater. It is shown that such a device could be realized by existing semiconductor technology.

  1. Bidirectional Manchester repeater

    Science.gov (United States)

    Ferguson, J.

    1980-01-01

    Bidirectional Manchester repeater is inserted at periodic intervals along single bidirectional twisted pair transmission line to detect, amplify, and transmit bidirectional Manchester 11 code signals. Requiring only 18 TTL 7400 series IC's, some line receivers and drivers, and handful of passive components, circuit is simple and relatively inexpensive to build.

  2. The necessity of repeated assessment of imaging studies contained in medical records in medico-legal opinions

    Directory of Open Access Journals (Sweden)

    Aleksandra Borowska-Solonynko

    2014-12-01

    Full Text Available The paper presents two case reports of living victims, in which imaging studies of the chest conducted at a medical facility were an essential part of the medico-legal opinion. The first case was that of a young male hospitalized due to CT evidence of bilateral rib fractions, who claimed to have been assaulted by police officers. The other case was that of a six week old baby hospitalized due to chest X-ray evidence of right hand side rib fractions. The chest X-ray was performed due to one bruise found on the baby’s forehead and two small bruises on the back, which gave rise to suspicions of child abuse. In both cases, expert witnesses in radiology definitively excluded the presence of any fractures. These cases indicate that a new assessment of imaging studies contained in medical records is needed. Expert opinions based solely on the description of imaging studies may result in grave consequences.

  3. Repeated dose 28-days oral toxicity study of Carica papaya L. leaf extract in Sprague Dawley rats.

    Science.gov (United States)

    Afzan, Adlin; Abdullah, Noor Rain; Halim, Siti Zaleha; Rashid, Badrul Amini; Semail, Raja Hazlini Raja; Abdullah, Noordini; Jantan, Ibrahim; Muhammad, Hussin; Ismail, Zakiah

    2012-04-10

    Carica papaya L. leaves have been used in ethnomedicine for the treatment of fevers and cancers. Despite its benefits, very few studies on their potential toxicity have been described. The aim of the present study was to characterize the chemical composition of the leaf extract from 'Sekaki' C. papaya cultivar by UPLC-TripleTOF-ESI-MS and to investigate the sub-acute oral toxicity in Sprague Dawley rats at doses of 0.01, 0.14 and 2 g/kg by examining the general behavior, clinical signs, hematological parameters, serum biochemistry and histopathology changes. A total of twelve compounds consisting of one piperidine alkaloid, two organic acids, six malic acid derivatives, and four flavonol glycosides were characterized or tentatively identified in the C. papaya leaf extract. In the sub-acute study, the C. papaya extract did not cause mortality nor were treatment-related changes in body weight, food intake, water level, and hematological parameters observed between treatment and control groups. Some biochemical parameters such as the total protein, HDL-cholesterol, AST, ALT and ALP were elevated in a non-dose dependent manner. Histopathological examination of all organs including liver did not reveal morphological alteration. Other parameters showed non-significant differences between treatment and control groups. The present results suggest that C. papaya leaf extract at a dose up to fourteen times the levels employed in practical use in traditional medicine in Malaysia could be considered safe as a medicinal agent.

  4. Antioxidative Reaction of Carotenes against Peroxidation of Fatty Acids Initiated by Nitrogen Dioxide: A Theoretical Study.

    Science.gov (United States)

    Chen, Shau-Jiun; Huang, Li-Yen; Hu, Ching-Han

    2015-07-30

    In this study, we investigated the antioxidative functions of carotenes (CARs) against the peroxidation of lipids initiated by nitrogen dioxide using density functional theory. The hydrogen-atom transfer (HAT), radical adduct formation (RAF), and electron transfer (ET) mechanisms were investigated. We chose β-carotene (β-CAR) and lycopene (LYC) and compared their NO2(•) initiations and peroxidations with those of linoleic acid (LAH), the model of the lipid. We found that for CARs ET is more likely to occur in the most polar (water) environment than are HAT and RAF. In less polar environments, CARs react more readily with NO2(•) via HAT and RAF than does the lipid model, LAH. Comparatively, reaction barriers for the RAF between CARs and NO2(•) are smaller than those for the HAT. The additions of O2 to the radical intermediates O2N-CAR(•) and CAR(-H)(•) involve sizable barriers and are endergonic. Other than HAT of LAH, we revealed that lipid peroxidation is likely to be initiated by -NO2 addition and the subsequent barrierless addition of O2. Finally, LYC is a more effective antioxidative agent against NO2(•)-initiated lipid peroxidation than is β-CAR.

  5. Generosity pays in the presence of direct reciprocity: a comprehensive study of 2 × 2 repeated games.

    Directory of Open Access Journals (Sweden)

    Luis A Martinez-Vaquero

    Full Text Available By applying a technique previously developed to study ecosystem assembly [Capitán et al., Phys. Rev. Lett. 103, 168101 (2009] we study the evolutionary stable strategies of iterated 2 × 2 games. We focus on memory-one strategies, whose probability to play a given action depends on the actions of both players in the previous time step. We find the asymptotically stable populations resulting from all possible invasions of any known stable population. The results of this invasion process are interpreted as transitions between different populations that occur with a certain probability. Thus the whole process can be described as a Markov chain whose states are the different stable populations. With this approach we are able to study the whole space of symmetric 2 × 2 games, characterizing the most probable results of evolution for the different classes of games. Our analysis includes quasi-stationary mixed equilibria that are relevant as very long-lived metastable states and is compared to the predictions of a fixation probability analysis. We confirm earlier results on the success of the Pavlov strategy in a wide range of parameters for the iterated Prisoner's Dilemma, but find that as the temptation to defect grows there are many other possible successful strategies. Other regions of the diagram reflect the equilibria structure of the underlying one-shot game, albeit often some non-expected strategies arise as well. We thus provide a thorough analysis of iterated 2 × 2 games from which we are able to extract some general conclusions. Our most relevant finding is that a great deal of the payoff parameter range can still be understood by focusing on win-stay, lose-shift strategies, and that very ambitious ones, aspiring to obtaining always a high payoff, are never evolutionary stable.

  6. Changes in surgical team performance and safety climate attitudes following expansion of perioperative services: a repeated-measures study.

    Science.gov (United States)

    Gillespie, Brigid M; Harbeck, Emma; Kang, Evelyn; Steel, Catherine; Fairweather, Nicole; Chaboyer, Wendy

    2017-08-10

    Objective The aim of the present study was to describe process changes in surgical team performance and team members' attitudes to safety culture following hospital relocation and expansion of perioperative services.Methods The study was a naturalistic study using structured observations and surveys to assess non-technical skills (NTS; i.e. communication, teamwork, situational awareness, decision making and leadership) in surgery. This interrupted time series design used mixed-linear regression models to examine the effect of phase (before and after hospital relocation) on surgical teams' NTS and their processes that may affect performance. Differences in self-reported teamwork and safety climate attitudes were also examined.Results In all, 186 procedures (100 before and 81 after hospital relocation) were observed across teams working in general, paediatric, orthopaedic and thoracic surgeries. Interobserver agreement ranged from 86% to 95%. An effect of phase was found, indicating that there were significant improvements after relocation in the use of NTS by the teams observed (P=0.020; 95% confidence interval 1.9-4.7).Conclusions The improvements seen in surgical teams' NTS performance and safety culture attitudes may be related to the move to a new state-of-the-art perioperative department.What is known about the topic? Patient safety in surgery relies on optimal team performance, underpinned by effective NTS.What does this paper add? The NTS of surgical teams may be improved through ergonomic innovations that promote teams' shared mental models.What are the implications for practitioners? Effective multidisciplinary teamwork relies on a combination of NTS and ergonomic factors, which inherently contribute to team performance and safety climate attitudes.

  7. Feedback from an image of finger and an actual finger produce similar prismatic after-effect: a repeated measures study

    DEFF Research Database (Denmark)

    Wilms, Inge Linda; Assentoft, Emilie

    2014-01-01

    by seeing their fingertip. In the second condition subjects saw an image of a fingertip. The results indicate that the two conditions are significantly different. The study is an important step in understanding what actually makes a difference in training when trying to convert paper-and-pencil training...... if it is the format rather than the indirectness of the feedback creating this difference. 27 healthy subjects were subjected to a single session of Prism Adaptation Training under two different feedback conditions. In the first feedback condition, subjects were exposed to visual feedback on pointing precision...

  8. Initiation of a comparative metagenomic study of the Red Sea and Pacific Ocean marine microbiomes

    KAUST Repository

    Kodzius, Rimantas

    2014-03-26

    The marine microbiome is a fundamental component of the biosphere. Its bacteria are abundant and play critical roles within the ocean environment. The majority of this important group of bacteria are genetically uncharacterized. Relatively few species have been studied in the laboratory. However, by applying metagenomic analyses to marine microbial populations, genomic ‘snapshots’ may be taken and from appropriate time series experiments their dynamics established. As a key component of the CBRC Centre Research Program (2014-2020), we are initiating a comparative study of the Red Sea and North Eastern Japanese coast and bay complexes. These environments differ in physical characteristics significantly. The Red Sea exhibits consistently high salinity, temperature and insolation characteristics, whereas the Japanese waters are less saline, cooler and receive lower insolation. Here, we present initial data and analytical pipelines for Phase 1 of our collaborative research program.

  9. Social-cognitive and school factors in initiation of smoking among adolescents: a prospective cohort study

    DEFF Research Database (Denmark)

    Bidstrup, Pernille Envold; Frederiksen, Kirsten; Siersma, Volkert

    2009-01-01

    -efficacy, social influence (norms), social influence (behavior), social influence (pressure), and attitude. We used multilevel analyses to estimate the associations between social-cognitive factors at baseline and smoking initiation as well as the random effects of school, school class, and gender group......AIMS: The aim of the present study was to examine the association between social-cognitive factors, school factors, and smoking initiation among adolescents who had never smoked. METHODS: The study was based on longitudinal data on Danish adolescents attending randomly selected public schools....... Adolescents enrolled in grade 7 (mean age, 13 years) who had never smoked (n = 912) were followed up for 6 months after baseline. Those who had still never smoked were followed up again 18 months after baseline, in grade 8 (n = 442). Social-cognitive factors were examined with five measures: self...

  10. Kinetics of the initial stage of immunoagglutionation studied with the scanning flow cytometer

    CERN Document Server

    Surovtsev, Ivan V; Shvalov, Alexander N; Nekrasov, Vyacheslav M; Sivolobova, Galina F; Grazhdantseva, Antonina A; Maltsev, Valeri P; Chernyshev, Andrey V

    2008-01-01

    The use of a scanning flow cytometer (SFC) to study the evolution of monomers, dimers and higher multimers of latex particles at the initial stage of the immunoagglutination is described. The SFC can measure the light-scattering pattern (indicatrix) of an individual particle over an angular range of 10-60 deg. A comparison of the experimentally measured and theoretically calculated indicatrices allows one to discriminate different types of latex particles (i.e. monomers, dimers, etc.) and, therefore, to study the evolution of immunoagglutination process. Validity of the approach was verified by simultaneous measurements of light-scattering patterns and fluorescence from individual polymer particles. Immunoagglutination was initiated by mixing bovine serum albumin (BSA)-covered latex particles (of 1.8 um in diameter) with anti-BSA IgG. The analysis of experimental data was performed on the basis of a mathematical model of diffusion-limited immunoagglutination aggregation with a steric factor. The steric factor...

  11. Vegetarian diets in the Adventist Health Study 2: a review of initial published findings.

    Science.gov (United States)

    Orlich, Michael J; Fraser, Gary E

    2014-07-01

    The Adventist Health Study 2 is a large cohort that is well suited to the study of the relation of vegetarian dietary patterns to health and disease risk. Here we review initial published findings with regard to vegetarian diets and several health outcomes. Vegetarian dietary patterns were associated with lower body mass index, lower prevalence and incidence of diabetes mellitus, lower prevalence of the metabolic syndrome and its component factors, lower prevalence of hypertension, lower all-cause mortality, and in some instances, lower risk of cancer. Findings with regard to factors related to vegetarian diets and bone health are also reviewed. These initial results show important links between vegetarian dietary patterns and improved health. © 2014 American Society for Nutrition.

  12. Vegetarian diets in the Adventist Health Study 2: a review of initial published findings1234

    Science.gov (United States)

    Orlich, Michael J; Fraser, Gary E

    2014-01-01

    The Adventist Health Study 2 is a large cohort that is well suited to the study of the relation of vegetarian dietary patterns to health and disease risk. Here we review initial published findings with regard to vegetarian diets and several health outcomes. Vegetarian dietary patterns were associated with lower body mass index, lower prevalence and incidence of diabetes mellitus, lower prevalence of the metabolic syndrome and its component factors, lower prevalence of hypertension, lower all-cause mortality, and in some instances, lower risk of cancer. Findings with regard to factors related to vegetarian diets and bone health are also reviewed. These initial results show important links between vegetarian dietary patterns and improved health. PMID:24898223

  13. Long-term facial improvement after repeated BoNT-A injections and mirror biofeedback exercises for chronic facial synkinesis: a case-series study.

    Science.gov (United States)

    Mandrini, Silvia; Comelli, Mario; Dall'angelo, Anna; Togni, Rossella; Cecini, Miriam; Pavese, Chiara; Dalla Toffola, Elena

    2016-12-01

    Only few studies have considered the effects of the combined treatment with onabotulinumtoxinA (BoNT-A) injections and biofeedback (BFB) rehabilitation in the recovery of postparetic facial synkinesis (PPFS). To explore the presence of a persistent improvement in facial function out of the pharmacological effect of BoNT-A in subjects with established PPFS, after repeated sessions of BoNT-A injections combined with an educational facial training program using mirror biofeedback (BFB) exercises. Secondary objective was to investigate the trend of the presumed persistent improvement. Case-series study. Outpatient Clinic of Physical Medicine and Rehabilitation Unit. Twenty-seven patients (22 females; mean age 45±16 years) affected by an established peripheral facial palsy, treated with a minimum of three BoNT-A injections in association with mirror BFB rehabilitation. The interval between consecutive BoNT-A injections was at least five months. At baseline and before every BoNT-A injection+mirror BFB session (when the effect of the previous BoNT-A injection had vanished), patients were assessed with the Italian version of Sunnybrook Facial Grading System (SB). The statistical analysis considered SB composite and partial scores before each treatment session compared to the baseline scores. A significant improvement of the SB composite and partial scores was observed until the fourth session. Considering the "Symmetry of Voluntary Movement" partial score, the main improvement was observed in the muscles of the lower part of the face. In a chronic stage of postparetic facial synkinesis, patients may benefit from a combined therapy with repeated BoNT-A injections and an educational facial training program with mirror BFB exercises, gaining an improvement of the facial function up to the fourth session. This improvement reflects the acquired ability to use facial muscle correctly. It doesn't involve the injected muscles but those trained with mirror biofeedback exercises

  14. Repeated dose studies with pure Epigallocatechin-3-gallate demonstrated dose and route dependant hepatotoxicity with associated dyslipidemia

    Directory of Open Access Journals (Sweden)

    Balaji Ramachandran

    2016-01-01

    Full Text Available EGCG (Epigallocatechin-3-gallate is the major active principle catechin found in green tea. Skepticism regarding the safety of consuming EGCG is gaining attention, despite the fact that it is widely being touted for its potential health benefits, including anti-cancer properties. The lack of scientific data on safe dose levels of pure EGCG is of concern, while EGCG has been commonly studied as a component of GTE (Green tea extract and not as a single active constituent. This study has been carried out to estimate the maximum tolerated non-toxic dose of pure EGCG and to identify the treatment related risk factors. In a fourteen day consecutive treatment, two different administration modalities were compared, offering an improved [i.p (intraperitoneal] and limited [p.o (oral] bioavailability. A trend of dose and route dependant hepatotoxicity was observed particularly with i.p treatment and EGCG increased serum lipid profile in parallel to hepatotoxicity. Fourteen day tolerable dose of EGCG was established as 21.1 mg/kg for i.p and 67.8 mg/kg for p.o. We also observed that, EGCG induced effects by both treatment routes are reversible, subsequent to an observation period for further fourteen days after cessation of treatment. It was demonstrated that the severity of EGCG induced toxicity appears to be a function of dose, route of administration and period of treatment.

  15. Study on critical heat flux in narrow rectangular channel with repeated-rib roughness. 1. Experimental facility and preliminary experiments

    Energy Technology Data Exchange (ETDEWEB)

    Kinoshita, Hidetaka; Terada, Atsuhiko; Kaminaga, Masanori; Hino, Ryutaro [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    2001-10-01

    In the design of a spallation target system, the water cooling system, for example a proton beam window and a safety hull, is used with narrow channels, in order to remove high heat flux and prevent lowering of system performance by absorption of neutron. And in narrow channel, heat transfer enhancement using 2-D rib is considered for reduction the cost of cooling component and decrease inventory of water in the cooling system, that is, decrease of the amount of irradiated water. But few studies on CHF with rib have been carried out. Experimental and analytical studies with rib-roughened test section, in 10:1 ratio of pitch to height, are being carried out in order to clarify the CHF in rib-roughened channel. This paper presents the review of previous researches on heat transfer in channel with rib roughness, overview of the test facility and the preliminary experimental and analytical results. As a result, wall friction factors were about 3 times as large as that of smooth channel, and heat transfer coefficients are about 2 times as large as that of smooth channel. The obtained CHF was as same as previous mechanistic model by Sudo. (author)

  16. Repeated head trauma is associated with smaller thalamic volumes and slower processing speed: the Professional Fighters' Brain Health Study.

    Science.gov (United States)

    Bernick, Charles; Banks, Sarah J; Shin, Wanyong; Obuchowski, Nancy; Butler, Sam; Noback, Michael; Phillips, Michael; Lowe, Mark; Jones, Stephen; Modic, Michael

    2015-08-01

    Cumulative head trauma may alter brain structure and function. We explored the relationship between exposure variables, cognition and MRI brain structural measures in a cohort of professional combatants. 224 fighters (131 mixed martial arts fighters and 93 boxers) participating in the Professional Fighters Brain Health Study, a longitudinal cohort study of licensed professional combatants, were recruited, as were 22 controls. Each participant underwent computerised cognitive testing and volumetric brain MRI. Fighting history including years of fighting and fights per year was obtained from self-report and published records. Statistical analyses of the baseline evaluations were applied cross-sectionally to determine the relationship between fight exposure variables and volumes of the hippocampus, amygdala, thalamus, caudate, putamen. Moreover, the relationship between exposure and brain volumes with cognitive function was assessed. Increasing exposure to repetitive head trauma measured by number of professional fights, years of fighting, or a Fight Exposure Score (FES) was associated with lower brain volumes, particularly the thalamus and caudate. In addition, speed of processing decreased with decreased thalamic volumes and with increasing fight exposure. Higher scores on a FES used to reflect exposure to repetitive head trauma were associated with greater likelihood of having cognitive impairment. Greater exposure to repetitive head trauma is associated with lower brain volumes and lower processing speed in active professional fighters. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  17. AFOSR Indo-UK -US Joint Physics Initiative for Study of Angular Optical Mode Fiber Amplification

    Science.gov (United States)

    2017-02-20

    AFRL-AFOSR-UK-TR-2017-0011 AFOSR Indo-UK -US Joint Physics Initiative for study of angular optical mode fiber amplification Johan Nilsson UNIVERSITY...20-02-2017 2. REPORT TYPE Final 3. DATES COVERED (From - To) 30 Sep 2015 to 29 Sep 2016 4. TITLE AND SUBTITLE AFOSR Indo-UK -US Joint Physics ...optical mode fiber amplication - Physics of transverse mode instability in large area high-energy fiber lasers January 19 2017 Name of Principal

  18. Violence towards health care workers in a Public Health Care Facility in Italy: a repeated cross-sectional study

    Directory of Open Access Journals (Sweden)

    Magnavita Nicola

    2012-05-01

    Full Text Available Abstract Background Violence at work is one of the major concerns in health care activities. The aim of this study was to identify the prevalence of physical and non-physical violence in a general health care facility in Italy and to assess the relationship between violence and psychosocial factors, thereby providing a basis for appropriate intervention. Methods All health care workers from a public health care facility were invited to complete a questionnaire containing questions on workplace violence. Three questionnaire-based cross-sectional surveys were conducted. The response rate was 75 % in 2005, 71 % in 2007, and 94 % in 2009. The 2009 questionnaire contained the VIF (Violent Incident Form for reporting violent incidents, the DCS (demand/control/support model for job strain, the Colquitt 20 item questionnaire for perceived organizational justice, and the GHQ-12 General Health Questionnaire for the assessment of mental health. Results One out of ten workers reported physical assault, and one out of three exposure to non-physical violence in the workplace in the previous year. Nurses and physicians were the most exposed occupational categories, whereas the psychiatric and emergency departments were the services at greatest risk of violence. Workers exposed to non-physical violence were subject to high job strain, low support, low perceived organizational justice, and high psychological distress. Conclusion Our study shows that health care workers in an Italian local health care facility are exposed to violence. Workplace violence was associated with high demand and psychological disorders, while job control, social support and organizational justice were protective factors.

  19. Fatigue In U12 Soccer-7 Players During Repeated One-Day Tournament Games - A Pilot Study.

    Science.gov (United States)

    Sanchez-Sanchez, Javier; Sanchez, Mario; Hernandez, Daniel; Ramirez-Campillo, Rodrigo; Martínez, Cristian; Nakamura, Fabio Y

    2017-07-12

    The aim of this study was to describe and compare the distances and displacement speeds of U12 Soccer-7 athletes during four tournament Soccer-7 games (TG) played in less than 24-h (experimental condition) with those recorded during two league Soccer-7 games (LG) with 24-h of rest prior to the match (control condition). Ten participants (age = 10.3 ± 0.5 years) were recruited for the study. Main data analyzed during games included distance completed relative to match duration (Drel), maximal velocity and distance completed at different running speeds (including acceleration, deceleration, standing, walking, jogging, medium-intensity running, high-intensity running and sprinting). For data collection during games, athletes wore a GPS unit. Different (p0.05) and during the two LG between 84.2 ± 10.9 m/min and 87.5 ± 9.9 m/min (P>0.05). Moreover, similar Drel was recorded during TG and LG (86.8 m/min and 85.9 m/min, respectively). Compared to LG, during TG maximal velocity was lower (23.0 km/h and 21.3 km/h, respectively; Pgame of the tournament, in the preceding games the distance covered at low speeds (3.1-8.0 km/h) was lower (37.7% and 32.4%, respectively; Pgames with less than 24-h of inter-day rest negatively affects displacement speeds distribution (but not overall relative distances) in U12 Soccer-7 athletes. These results may help to better plan training and competition schedules to youth players.

  20. Effects of ambient air pollution on functional status in patients with chronic congestive heart failure: a repeated-measures study

    Directory of Open Access Journals (Sweden)

    Phillips Russell S

    2007-09-01

    Full Text Available Abstract Background Studies using administrative data report a positive association between ambient air pollution and the risk of hospitalization for congestive heart failure (HF. Circulating levels of B-type natriuretic peptide (BNP are directly associated with cardiac hemodynamics and symptom severity in patients with HF and, therefore, serves as a marker of functional status. We tested the hypothesis that BNP levels would be positively associated with short-term changes in ambient pollution levels among 28 patients with chronic stable HF and impaired systolic function. Methods BNP was measured in whole blood at 0, 6, and 12 weeks. We used linear mixed models to evaluate the association between fine particulate matter (PM2.5, carbon monoxide, sulfur dioxide, nitrogen dioxide, ozone, and black carbon and log(BNP. Lags of 0 to 3 days were considered in separate models. We calculated the intraclass correlation coefficient and within-subject coefficient of variation as measures of reproducibility. Results We found no association between any pollutant and measures of BNP at any lag. For example, a 10 μg/m3 increase in PM2.5 was associated with a 0.8% (95% CI: -16.4, 21.5; p = 0.94 increase in BNP on the same day. The within-subject coefficient of variation was 45% on the natural scale and 9% on the log scale. Conclusion These results suggest that serial BNP measurements are unlikely to be useful in a longitudinal study of air pollution-related acute health effects. The magnitude of expected ambient air pollution health effects appears small in relation to the considerable within-person variability in BNP levels in this population.

  1. Evaluating methamphetamine use and risks of injection initiation among street youth: the ARYS study

    Directory of Open Access Journals (Sweden)

    Montaner Julio SG

    2006-05-01

    Full Text Available Abstract Many Canadian cities are experiencing ongoing infectious disease and overdose epidemics among injection drug users (IDU. These health concerns have recently been exacerbated by the increasing availability and use of methamphetamine. The challenges of reducing health-related harms among IDU have led to an increased recognition that strategies to prevent initiation into injection drug use must receive renewed focus. In an effort to better explore the factors that may protect against or facilitate entry into injection drug use, the At Risk Youth Study (ARYS has recently been initiated in Vancouver, Canada. The local setting is unique due to the significant infrastructure that has been put in place to reduce HIV transmission among active IDU. The ARYS study will seek to examine the impact of these programs, if any, on non-injection drug users. In addition, Vancouver has been the site of widespread use of methamphetamine in general and has seen a substantial increase in the use of crystal methamphetamine among street youth. Hence, the ARYS cohort is well positioned to examine the harms associated with methamphetamine use, including its potential role in facilitating initiation into injection drug use. This paper provides some background on the epidemiology of illicit drug use among street youth in North America and outlines the methodology of ARYS, a prospective cohort study of street youth in Vancouver, Canada.

  2. Cognitive training of self-initiation of semantic encoding strategies in schizophrenia: A pilot study.

    Science.gov (United States)

    Guimond, Synthia; Lepage, Martin

    2016-01-01

    Available cognitive remediation interventions have a significant but relatively small to moderate impact on episodic memory in schizophrenia. The present study aimed to evaluate the efficacy and feasibility of a brief novel episodic memory training targeting the self-initiation of semantic encoding strategies. To select patients with such deficits, 28 participants with schizophrenia performed our Semantic Encoding Memory Task (SEMT) that provides a measure of self-initiated semantic encoding strategies. This task identified a deficit in 13 participants who were then offered two 60-minute training sessions one week apart. After the training, patients performed an alternate version of the SEMT. The CVLT-II (a standardised measure of semantic encoding strategies) and the BVMT-R (a control spatial memory task) were used to quantify memory pre- and post-training. After the training, participants were significantly better at self-initiating semantic encoding strategies in the SEMT (p = .004) and in the CVLT-II (p = .002). No significant differences were found in the BVMT-R. The current study demonstrates that a brief and specific training in memory strategies can help patients to improve a deficient memory process in schizophrenia. Future studies will need to test this intervention further using a randomised controlled trial, and to explore its functional impact.

  3. X-ray diffraction study of microstructural changes during fatigue damage initiation in steel pipes

    Energy Technology Data Exchange (ETDEWEB)

    Pinheiro, B., E-mail: bianca@lts.coppe.ufrj.br [Laboratory of Mechanics of Lille (LML), UMR CNRS 8107, University of Lille 1, Boulevard Paul Langevin, Cite Scientifique, 59655 Villeneuve d' Ascq (France); Lesage, J. [Laboratory of Mechanics of Lille (LML), UMR CNRS 8107, University of Lille 1, Boulevard Paul Langevin, Cite Scientifique, 59655 Villeneuve d' Ascq (France); Pasqualino, I. [Subsea Technology Laboratory (LTS), Ocean Engineering Department, COPPE/Federal University of Rio de Janeiro, PO Box 68508, Cidade Universitaria, CEP 21945-970, Rio de Janeiro/RJ (Brazil); Benseddiq, N. [Laboratory of Mechanics of Lille (LML), UMR CNRS 8107, University of Lille 1, Boulevard Paul Langevin, Cite Scientifique, 59655 Villeneuve d' Ascq (France); Bemporad, E. [Interdepartmental Laboratory of Electron Microscopy (LIME), University of Rome TRE, Via Della Vasca Navale 79, 00146 Rome (Italy)

    2012-01-15

    Highlights: Black-Right-Pointing-Pointer In this work we study the fatigue damage evolution in an API 5L X60 steel. Black-Right-Pointing-Pointer Microstructural changes and residual stresses are evaluated during fatigue tests. Black-Right-Pointing-Pointer Microdeformations and macro residual stresses are estimated by X-ray diffraction. Black-Right-Pointing-Pointer Results are discussed in view of an indicator of fatigue damage initiation. Black-Right-Pointing-Pointer This indicator could allow the prediction of residual life before macrocracking. - Abstract: Steel pipes used in the oil and gas industry undergo the action of cyclic loads that can cause their failure by fatigue. A consistent evaluation of the fatigue damage during the initiation phase should fundamentally be based on a nanoscale approach, i.e., at the scale of the dislocation network, in order to take into account the micromechanisms of fatigue damage that precede macrocrack initiation and propagation until the final fracture. In this work, microstructural changes related to fatigue damage initiation are investigated in the API 5L X60 grade steel, used in pipe manufacturing. Microdeformations and macro residual stress are evaluated using X-ray diffraction in real time during alternating bending fatigue tests performed on samples cut off from an X60 steel pipe. The aim of this ongoing work is to provide ground for further development of an indicator of fatigue damage initiation in X60 steel. This damage indicator could allow a good residual life prediction of steel pipes previously submitted to fatigue loading, before macroscopic cracking, and help to increase the reliability of these structures.

  4. 'Initial' Soil Moisture Effects on the Climate in China——A Regional Climate Model Study

    Institute of Scientific and Technical Information of China (English)

    SHI Xueli

    2009-01-01

    In this study, the effects of 'initial' soil moisture (SM) in arid and semi-arid Northwestern China on subsequent climate were investigated with a regional climate model. Besides the control simulations (denoted as CTL), a series of sensitivity experi-ments were conducted, including the DRY and WET experiments, in which the simulated 'initial' SM over the region 30-50°N, 75 -105°E was only 5% and 50%, and up to 150% and 200% of the simulated value in the CTL, respectively. The results show that SM change can modify the subsequent climate in not only the SM-change region proper but also the far downstream regions in Eastern and even Northeastern China. The SM-change effects are generally more prominent in the WET than in the DRY experiments. After the SM is initially increased, the SM in the SM-change region is always higher than that in the CTL, the latent (sensible) heat flux there increases (decreases), and the surface air temperature decreases. Spatially, the most prominent changes in the WET experiments are surface air temperature decrease, geopotential height decrease and corresponding abnormal changes of cyclonic wind vectors at the mid-upper troposphere levels. Generally opposite effects exist in the DRY experiments but with much weaker intensity. In addi-tion, the differences between the results obtained from the two sets of sensitivity experiments and those of the CTL are not always consistent with the variation of the initial SM. Being different from the variation of temperature, the rainfall modifications caused by initial SM change are not so distinct and in fact they show some common features in the WET and DRY experiments. This might imply that SM is only one of the factors that impact the subsequent climate, and its effect is involved in complex processes within the atmosphere, which needs further investigation.

  5. eHealth and mHealth initiatives in Bangladesh: A scoping study

    Science.gov (United States)

    2014-01-01

    Background The health system of Bangladesh is haunted by challenges of accessibility and affordability. Despite impressive gains in many health indicators, recent evidence has raised concerns regarding the utilization, quality and equity of healthcare. In the context of new and unfamiliar public health challenges including high population density and rapid urbanization, eHealth and mHealth are being promoted as a route to cost-effective, equitable and quality healthcare in Bangladesh. The aim of this paper is to highlight such initiatives and understand their true potential. Methods This scoping study applies a combination of research tools to explore 26 eHealth and mHealth initiatives in Bangladesh. A screening matrix was developed by modifying the framework of Arksey & O’Malley, further complemented by case study and SWOT analysis to identify common traits among the selected interventions. The WHO health system building blocks approach was then used for thematic analysis of these traits. Results Findings suggest that most eHealth and mHealth initiatives have proliferated within the private sector, using mobile phones. The most common initiatives include tele-consultation, prescription and referral. While a minority of projects have a monitoring and evaluation framework, less than a quarter have undertaken evaluation. Most of the initiatives use a health management information system (HMIS) to monitor implementation. However, these do not provide for effective sharing of information and interconnectedness among the various actors. There are extremely few individuals with eHealth training in Bangladesh and there is a strong demand for capacity building and experience sharing, especially for implementation and policy making. There is also a lack of research evidence on how to design interventions to meet the needs of the population and on potential benefits. Conclusion This study concludes that Bangladesh needs considerable preparation and planning to sustain e

  6. eHealth and mHealth initiatives in Bangladesh: a scoping study.

    Science.gov (United States)

    Ahmed, Tanvir; Lucas, Henry; Khan, Azfar Sadun; Islam, Rubana; Bhuiya, Abbas; Iqbal, Mohammad

    2014-06-16

    The health system of Bangladesh is haunted by challenges of accessibility and affordability. Despite impressive gains in many health indicators, recent evidence has raised concerns regarding the utilization, quality and equity of healthcare. In the context of new and unfamiliar public health challenges including high population density and rapid urbanization, eHealth and mHealth are being promoted as a route to cost-effective, equitable and quality healthcare in Bangladesh. The aim of this paper is to highlight such initiatives and understand their true potential. This scoping study applies a combination of research tools to explore 26 eHealth and mHealth initiatives in Bangladesh. A screening matrix was developed by modifying the framework of Arksey & O'Malley, further complemented by case study and SWOT analysis to identify common traits among the selected interventions. The WHO health system building blocks approach was then used for thematic analysis of these traits. Findings suggest that most eHealth and mHealth initiatives have proliferated within the private sector, using mobile phones. The most common initiatives include tele-consultation, prescription and referral. While a minority of projects have a monitoring and evaluation framework, less than a quarter have undertaken evaluation. Most of the initiatives use a health management information system (HMIS) to monitor implementation. However, these do not provide for effective sharing of information and interconnectedness among the various actors. There are extremely few individuals with eHealth training in Bangladesh and there is a strong demand for capacity building and experience sharing, especially for implementation and policy making. There is also a lack of research evidence on how to design interventions to meet the needs of the population and on potential benefits. This study concludes that Bangladesh needs considerable preparation and planning to sustain eHealth and mHealth initiatives successfully

  7. Characterization of regional left ventricular function in nonhuman primates using magnetic resonance imaging biomarkers: a test-retest repeatability and inter-subject variability study.

    Directory of Open Access Journals (Sweden)

    Smita Sampath

    Full Text Available Pre-clinical animal models are important to study the fundamental biological and functional mechanisms involved in the longitudinal evolution of heart failure (HF. Particularly, large animal models, like nonhuman primates (NHPs, that possess greater physiological, biochemical, and phylogenetic similarity to humans are gaining interest. To assess the translatability of these models into human diseases, imaging biomarkers play a significant role in non-invasive phenotyping, prediction of downstream remodeling, and evaluation of novel experimental therapeutics. This paper sheds insight into NHP cardiac function through the quantification of magnetic resonance (MR imaging biomarkers that comprehensively characterize the spatiotemporal dynamics of left ventricular (LV systolic pumping and LV diastolic relaxation. MR tagging and phase contrast (PC imaging were used to quantify NHP cardiac strain and flow. Temporal inter-relationships between rotational mechanics, myocardial strain and LV chamber flow are presented, and functional biomarkers are evaluated through test-retest repeatability and inter subject variability analyses. The temporal trends observed in strain and flow was similar to published data in humans. Our results indicate a dominant dimension based pumping during early systole, followed by a torsion dominant pumping action during late systole. Early diastole is characterized by close to 65% of untwist, the remainder of which likely contributes to efficient filling during atrial kick. Our data reveal that moderate to good intra-subject repeatability was observed for peak strain, strain-rates, E/circumferential strain-rate (CSR ratio, E/longitudinal strain-rate (LSR ratio, and deceleration time. The inter-subject variability was high for strain dyssynchrony, diastolic strain-rates, peak torsion and peak untwist rate. We have successfully characterized cardiac function in NHPs using MR imaging. Peak strain, average systolic strain

  8. Between two roles - Experiences of newly trained nurse practitioners in surgical care in Sweden: A qualitative study using repeated interviews.

    Science.gov (United States)

    Jangland, Eva; Yngman Uhlin, Pia; Arakelian, Erebouni

    2016-11-01

    The position of Nurse Practitioner is a new role in Nordic countries. The transition from a registered nurse to the Nurse Practitioner role has been reported to be a personal challenge. This study, guided by the Nordic theoretical model for use in the education of advanced practice nurses, represents a unique opportunity to describe this transition for newly graduated Nurse Practitioners in an interprofessional surgical care team in Sweden. The aim was to explore how the first Nurse Practitioners in surgical care experienced the transition into a new role and what competences they used in the team. Eight new Nurse Practitioners with parallel work in clinical practice were interviewed twice around the time of their graduation. The qualitative analyses show that the participants integrated several central competences, but the focus in this early stage in their new role was on direct clinical praxis, consultation, cooperation, case management, and coaching. Transition from the role of clinical nurse specialist to nurse practitioner was a challenging process in which the positive response from patients was a driving force for the new Nurse Practitioners. The participants felt prepared for and determined to solve the challenging situations they approached working in the interprofessional team.

  9. (1)H NMR-based metabolomics study on repeat dose toxicity of fine particulate matter in rats after intratracheal instillation.

    Science.gov (United States)

    Zhang, Yannan; Hu, Hejing; Shi, Yanfeng; Yang, Xiaozhe; Cao, Lige; Wu, Jing; Asweto, Collins Otieno; Feng, Lin; Duan, Junchao; Sun, Zhiwei

    2017-07-01

    Systemic metabolic effects and toxicity mechanisms of ambient fine particulate matter (PM2.5) remain uncertain. In order to investigate the mechanisms in PM2.5 toxicity, we explored the endogenous metabolic changes and possible influenced metabolic pathways in rats after intratracheal instillation of PM2.5 by using a (1)H nuclear magnetic resonance (NMR)-based metabolomics approach. Liver and kidney histopathology examinations were also performed. Chemical characterization demonstrated that PM2.5 was a complex mixture of elements. Histopathology showed cellular edema in liver and glomerulus atrophy of the PM2.5 treated rats. We systematically analyzed the metabolites changes of serum and urine in rats using (1)H NMR techniques in combination with multivariate statistical analysis. Significantly reduced levels of lactate, alanine, dimethylglycine, creatine, glycine and histidine in serum, together with increased levels of citrate, arginine, hippurate, allantoin and decreased levels of allthreonine, lactate, alanine, acetate, succinate, trimethylamine, formate in urine were observed of PM2.5 treated rats. The mainly affected metabolic pathways by PM2.5 were glycine, serine and threonine metabolism, glyoxylate and dicarboxylate metabolism, citrate cycle (TCA cycle), nitrogen metabolism and methane metabolism. Our study provided important information on assessing the toxicity of PM2.5 and demonstrated that metabolomics approach can be employed as a tool to understand the toxicity mechanism of complicated environmental pollutants. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Socioeconomic inequalities in smoking in The Netherlands before and during the Global Financial Crisis: a repeated cross-sectional study.

    Science.gov (United States)

    Benson, Fiona E; Kuipers, Mirte A G; Nierkens, Vera; Bruggink, Jan-Willem; Stronks, Karien; Kunst, Anton E

    2015-05-06

    The Global Financial Crisis (GFC) increased levels of financial strain, especially in those of low socioeconomic status (SES). Financial strain can affect smoking behaviour. This study examines socioeconomic inequalities in current smoking and smoking cessation in The Netherlands before and during the Global Financial Crisis (GFC). Participants were 66,960 Dutch adults (≥ 18 years) who took part in the annual national Health Survey (2004-2011). Period was dichotomised: 'pre-' and 'during-GFC'. SES measures used were income, education and neighbourhood deprivation. Outcomes were current smoking rates (smokers/total population) and smoking cessation ratios (former smokers/ever smokers). Multilevel logistic regression models controlled for individual characteristics and tested for interaction between period and SES. In both periods, high SES respondents (in all indicators) had lower current smoking levels and higher cessation ratios than those of middle or low SES. Inequalities in current smoking increased significantly in poorly educated adults of 45-64 years of age (Odds Ratio (OR) low educational level compared with high: 2.00[1.79-2.23] compared to pre-GFC 1.67[1.50-1.86], p for interaction = 0.02). Smoking cessation inequalities by income in 18-30 year olds increased with borderline significance during the GFC (OR low income compared to high income: 0.73[0.58-0.91]) compared to pre-GFC (OR: 0.98[0.80-1.20]), p for interaction = 0.051). Overall, socioeconomic inequalities in current smoking and smoking cessation were unchanged during the GFC. However, current smoking inequalities by education, and smoking cessation inequalities by income, increased in specific age groups. Increased financial strain caused by the crisis may disproportionately affect smoking behaviour in some disadvantaged groups.

  11. Burden of hospital admission and repeat angiography in angina pectoris patients with and without coronary artery disease: a registry-based cohort study.

    Directory of Open Access Journals (Sweden)

    Lasse Jespersen

    Full Text Available AIMS: To evaluate risk of hospitalization due to cardiovascular disease (CVD and repeat coronary angiography (CAG in stable angina pectoris (SAP with no obstructive coronary artery disease (CAD versus obstructive CAD, and asymptomatic reference individuals. METHODS AND RESULTS: We followed 11,223 patients with no prior CVD having a first-time CAG in 1998-2009 due to SAP symptoms and 5,695 asymptomatic reference individuals from the Copenhagen City Heart Study through registry linkage for 7.8 years (median. In recurrent event survival analysis, patients with SAP had 3-4-fold higher risk of hospitalization for CVD irrespective of CAG findings and cardiovascular comorbidity. Multivariable adjusted hazard ratios(95%CI for patients with angiographically normal coronary arteries was 3.0(2.5-3.5, for angiographically diffuse non-obstructive CAD 3.9(3.3-4.6 and for 1-3-vessel disease 3.6-4.1(range(all P<0.001. Mean accumulated hospitalization time was 3.5(3.0-4.0(days/10 years follow-up in reference individuals and 4.5(3.8-5.2/7.0(5.4-8.6/6.7(5.2-8.1/6.1(5.2-7.4/8.6(6.6-10.7 in patients with angiographically normal coronary arteries/angiographically diffuse non-obstructive CAD/1-, 2-, and 3-vessel disease, respectively (all P<0.05, age-adjusted. SAP symptoms predicted repeat CAG with multivariable adjusted hazard ratios for patients with angiographically normal coronary arteries being 2.3(1.9-2.9, for angiographically diffuse non-obstructive CAD 5.5(4.4-6.8 and for obstructive CAD 6.6-9.4(range(all P<0.001. CONCLUSIONS: Patients with SAP symptoms and angiographically normal coronary arteries or angiographically diffuse non-obstructive CAD suffer from considerably greater CVD burdens in terms of hospitalization for CVD and repeat CAG compared with asymptomatic reference individuals even after adjustment for cardiac risk factors and exclusion of cardiovascular comorbidity as cause. Contrary to common perception, excluding obstructive CAD by CAG in such

  12. Facilitating the Development and Evaluation of a Citizen Science Web Site: A Case Study of Repeat Photography and Climate Change in Southwest Alaska's National Parks

    Science.gov (United States)

    Mullen, Karina C.; Newman, Gregory; Thompson, Jessica L.

    2013-01-01

    Interviews with national park visitors across the country revealed that climate change education through place-based, hands-on learning using repeat photographs and technology is appealing to park visitors. This manuscript provides a summary of the development of a repeat photography citizen science Web site for national parks in Southwest Alaska.…

  13. Facilitating the Development and Evaluation of a Citizen Science Web Site: A Case Study of Repeat Photography and Climate Change in Southwest Alaska's National Parks

    Science.gov (United States)

    Mullen, Karina C.; Newman, Gregory; Thompson, Jessica L.

    2013-01-01

    Interviews with national park visitors across the country revealed that climate change education through place-based, hands-on learning using repeat photographs and technology is appealing to park visitors. This manuscript provides a summary of the development of a repeat photography citizen science Web site for national parks in Southwest Alaska.…

  14. Characterization of robotic system passive path repeatability during specimen removal and reinstallation for in vitro knee joint testing.

    Science.gov (United States)

    Goldsmith, Mary T; Smith, Sean D; Jansson, Kyle S; LaPrade, Robert F; Wijdicks, Coen A

    2014-10-01

    Robotic testing systems are commonly utilized for the study of orthopaedic biomechanics. Quantification of system error is essential for reliable use of robotic systems. Therefore, the purpose of this study was to quantify a 6-DOF robotic system's repeatability during knee biomechanical testing and characterize the error induced in passive path repeatability by removing and reinstalling the knee. We hypothesized removing and reinstalling the knee would substantially alter passive path repeatability. Testing was performed on four fresh-frozen cadaver knees. To determine repeatability and reproducibility, the passive path was collected three times per knee following the initial setup (intra-setup), and a single time following two subsequent re-setups (inter-setup). Repeatability was calculated as root mean square error. The intra-setup passive path had a position repeatability of 0.23 mm. In contrast, inter-setup passive paths had a position repeatability of 0.89 mm. When a previously collected passive path was replayed following re-setup of the knee, resultant total force repeatability across the passive path increased to 28.2N (6.4N medial-lateral, 25.4N proximal-distal, and 10.5 N anterior-posterior). This study demonstrated that removal and re-setup of a knee can have substantial, clinically significant changes on our system's repeatability and ultimately, accuracy of the reported results. Copyright © 2014 IPEM. Published by Elsevier Ltd. All rights reserved.

  15. Synthesis and Evaluation of a Novel Co-Initiator for Dentin Adhesives: Polymerization Kinetics and Leachables Study

    Science.gov (United States)

    Ge, Xueping; Ye, Qiang; Song, Linyong; Laurence, Jennifer S.; Spencer, Paulette

    2015-04-01

    A new tertiary amine co-initiator containing three methacrylate-urethane groups was synthesized for the application in dentin adhesives. The photopolymerization kinetics and leaching of unreacted components from methacrylate-based dental polymers formulated with this new co-initiator were determined. The newly synthesized co-initiator showed good chemical stability and decreased amine release from the initiator system. This study provides important information for the future development of biocompatible dentin adhesives/composites.

  16. Changes in Body Composition in the Two Years after Initiation of Haemodialysis: A Retrospective Cohort Study

    Science.gov (United States)

    Keane, David; Gardiner, Claire; Lindley, Elizabeth; Lines, Simon; Woodrow, Graham; Wright, Mark

    2016-01-01

    Malnutrition is common in haemodialysis (HD) and is linked to poor outcomes. This study aimed to describe changes in body composition after the initiation of HD and investigate whether any routinely collected parameters were associated with these changes. The study cohort came from the HD population of a single centre between 2009 and 2014. Body composition measurements were obtained from a database of bioimpedance results using the Body Composition Monitor (BCM), while demographics and laboratory values came from the renal unit database. Primary outcomes were changes in normohydration weight, lean tissue mass and adipose tissue mass over the two years after HD initiation. A total of 299 patients were included in the primary analyses, showing an increase in adipose tissue, loss of lean tissue and no significant change in normohydration weight. None of the routinely collected parameters were associated with the lean tissue changes. Loss of lean tissue over the first year of dialysis was associated with increased mortality. The results showing loss of lean tissue that is not limited to those traditionally assumed to be at high risk supports interventions to maintain or improve lean tissue as soon as possible after the initiation of HD. It highlights the importance of monitoring nutrition and the potential for routine use of bioimpedance. PMID:27827911

  17. STUDIES ON RADICAL POLYMERIZATION OF METHYL METHACRYLATE INITIATED WITH ORGANIC PEROXIDE-AMINE SYSTEMS

    Institute of Scientific and Technical Information of China (English)

    QIU Kunyuan; SHUI Li; FENG Xinde

    1984-01-01

    Radical polymerization of methyl methacrylate (MMA) initiated with various diacyl peroxideamine systems was studied. Benzoyl peroxide (BPO) and lauroyl peroxide (LPO) were used as diacyl peroxide component, N,N-dimethyl aniline (DMA) and its para substituted derivatives, i.e., N,N-dimethyl-p-toluidine (DMT), p-hydroxymethyl-N,N-dimethyl aniline (HDMA), p-nitro-N,N-dimethyl aniline (NDMA) and p-dimethylamino benzaldehyde (DMAB) were used as amine components. It was found that the peroxide-DMT systems give higher rates of bulk polymerization Rp of MMA than the organic hydroperoxide-DMT systems with the following descending order BPO-DMT>LPO-DMT>CHP (cumene hydroperoxide)-DMT>TBH (tert-butyl hydroperoxide)-DMT.The aromatic tertiary amines possess obvious structural effect on the Rp values in the diacyl peroxideamine system. The overall activation energy of MMA polymerization was determined and the kinetics of polymerization of MMA initiated with BPO-DMT system was investigated.

  18. Organic molecular beam deposition system and initial studies of organic layer growth

    Energy Technology Data Exchange (ETDEWEB)

    Andreasson, M [Applied Semiconductor Physics, Microtechnology and Nanoscience, Chalmers University of Technology, S-41296 Goeteborg (Sweden); Ilver, L [Department of Experimental Physics, Chalmers University of Technology, S-41296 Goeteborg (Sweden); Kanski, J [Department of Experimental Physics, Chalmers University of Technology, S-41296 Goeteborg (Sweden); Andersson, T G [Applied Semiconductor Physics, Microtechnology and Nanoscience, Chalmers University of Technology, S-41296 Goeteborg (Sweden)

    2006-09-01

    This work describes an organic molecular beam deposition system with substrate entry/exit chamber, buffer chamber and with the possibility to transfer substrate from a III-V molecular beam deposition system. Flux calibrations of organic molecules and the initial growth of organic layers are described. For this purpose, the molecules 3,4,9,10 perylene tetra carboxylic dianhydride and copper phtalocyanine were used. Layers were grown on oxidized and hydrogen passivated Si(100), Indium tin oxide and glass respectively. The growth was investigated with atomic force microscopy, reflection high energy electron diffraction and ultraviolet photoemission spectroscopy. An investigation with x-ray photoelectron and Raman spectroscopy on the effect of atmospheric exposure is also included, showing little effect of surface pollution when the samples were handled carefully. The initial formation (monolayers) of copper phtalocyanine thin films was studied by ultraviolet photoemission spectroscopy.

  19. First-principles study on initial stage of oxidation on Si(110) surface

    Energy Technology Data Exchange (ETDEWEB)

    Nagasawa, Takahiro; Shiba, Seiji; Sueoka, Koji [Department of System Engineering, Okayama Prefectural University, 111 Kuboki, Soja, Okayama 719-1197 (Japan)

    2011-03-15

    There is a great deal of engineering interest in Si (110) wafers as the substrates of large scale integrations (LSIs) in the next generation. However, few studies on Si (110) surface have been reported in comparison with those on other low-index surfaces, still less the mechanism of surface oxidation. We analyzed the surface structure and the initial stage of oxidation on the Si (110)-(16 x 2) clean surface with first-principles calculation. The results of our calculations showed that first, the stable structure of the Si (110) clean surface was the adatom-tetramer-interstitial (ATI) reconstruction. Second, pairs of pentagon (PPs) were preferentially oxidized in the initial stage of the oxidation. Third, the oxidation growth should progress with the clustering of O atoms. (copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  20. Numerical Study on Initial Field of Pollution in the Bohai Sea with an Adjoint Method

    Directory of Open Access Journals (Sweden)

    Chunhui Wang

    2013-01-01

    Full Text Available Based on the simulation of a marine ecosystem dynamical model in the Bohai Sea, routine monitoring data are assimilated to study the initial field of pollution by using the adjoint method. In order to reduce variables that need to be optimized and make the simulation results more reasonable, an independent grid is selected every four grids both in longitude and latitude, and only the pollutant concentrations of these independent grids needed to be optimized while the other grids were calculated by interpolation method. Based on this method, the stability and reliability of this model were proved by a set of twin experiments. Therefore, this model could be applied in real experiment to simulate the initial field of the total nitrogen (totalN in May, 2009. Moreover, the distribution of totalN in any time step could be calculated by this model, and the monthly mean distribution in May in the Bohai Sea could be obtained.

  1. Study on optimization of agent initial positions in land combat simulation

    Institute of Scientific and Technical Information of China (English)

    WU Chunguo; LIANG Yanchun; LEE Heow Pueh; LU Chun; YANG Xiaowei

    2004-01-01

    The use of computational-intelligence-based techniques in the optimization of agent initial positions in land combat simulations is studied. A novel method for the reduction of support vectors in the support vector machine (SVM) is presented. The optimization on the width of the Gaussian kernel function and the combination of the SVM with the radial basis function neural network are performed in the proposed method. Simulation results show that the proposed method can improve the running efficiency drastically compared with that using the traditional SVM with the same precision. We also summarize and present some experiences and trends in the study on the optimization problem in land combat simulation.

  2. The Lusi seismic experiment: An initial study to understand the effect of seismic activity to Lusi

    Energy Technology Data Exchange (ETDEWEB)

    Karyono, E-mail: karyonosu@gmail.com [Agency for Meteorology, Climatology and Geophysics (BMKG), Jakarta (Indonesia); OSLO University (Norway); Padjadjaran University (UNPAD), Bandung (Indonesia); Mazzini, Adriano; Sugiharto, Anton [OSLO University (Norway); Lupi, Matteo [ETH Zurich (Switzerland); Syafri, Ildrem [Padjadjaran University (UNPAD), Bandung (Indonesia); Masturyono,; Rudiyanto, Ariska; Pranata, Bayu; Muzli,; Widodo, Handi Sulistyo; Sudrajat, Ajat [Agency for Meteorology, Climatology and Geophysics (BMKG), Jakarta (Indonesia)

    2015-04-24

    The spectacular Lumpur Sidoarjo (Lusi) eruption started in northeast Java on the 29 of May 2006 following a M6.3 earthquake striking the island [1,2]. Initially, several gas and mud eruption sites appeared along the reactivated strike-slip Watukosek fault system [3] and within weeks several villages were submerged by boiling mud. The most prominent eruption site was named Lusi. The Lusi seismic experiment is a project aims to begin a detailed study of seismicity around the Lusi area. In this initial phase we deploy 30 seismometers strategically distributed in the area around Lusi and along the Watukosek fault zone that stretches between Lusi and the Arjuno Welirang (AW) complex. The purpose of the initial monitoring is to conduct a preliminary seismic campaign aiming to identify the occurrence and the location of local seismic events in east Java particularly beneath Lusi.This network will locate small event that may not be captured by the existing BMKG network. It will be crucial to design the second phase of the seismic experiment that will consist of a local earthquake tomography of the Lusi-AW region and spatial and temporal variations of vp/vs ratios. The goal of this study is to understand how the seismicity occurring along the Sunda subduction zone affects to the behavior of the Lusi eruption. Our study will also provide a large dataset for a qualitative analysis of earthquake triggering studies, earthquake-volcano and earthquake-earthquake interactions. In this study, we will extract Green’s functions from ambient seismic noise data in order to image the shallow subsurface structure beneath LUSI area. The waveform cross-correlation technique will be apply to all of recordings of ambient seismic noise at 30 seismographic stations around the LUSI area. We use the dispersive behaviour of the retrieved Rayleigh waves to infer velocity structures in the shallow subsurface.

  3. The Lusi seismic experiment: An initial study to understand the effect of seismic activity to Lusi

    Science.gov (United States)

    Karyono, Mazzini, Adriano; Lupi, Matteo; Syafri, Ildrem; Masturyono, Rudiyanto, Ariska; Pranata, Bayu; Muzli, Widodo, Handi Sulistyo; Sudrajat, Ajat; Sugiharto, Anton

    2015-04-01

    The spectacular Lumpur Sidoarjo (Lusi) eruption started in northeast Java on the 29 of May 2006 following a M6.3 earthquake striking the island [1,2]. Initially, several gas and mud eruption sites appeared along the reactivated strike-slip Watukosek fault system [3] and within weeks several villages were submerged by boiling mud. The most prominent eruption site was named Lusi. The Lusi seismic experiment is a project aims to begin a detailed study of seismicity around the Lusi area. In this initial phase we deploy 30 seismometers strategically distributed in the area around Lusi and along the Watukosek fault zone that stretches between Lusi and the Arjuno Welirang (AW) complex. The purpose of the initial monitoring is to conduct a preliminary seismic campaign aiming to identify the occurrence and the location of local seismic events in east Java particularly beneath Lusi.This network will locate small event that may not be captured by the existing BMKG network. It will be crucial to design the second phase of the seismic experiment that will consist of a local earthquake tomography of the Lusi-AW region and spatial and temporal variations of vp/vs ratios. The goal of this study is to understand how the seismicity occurring along the Sunda subduction zone affects to the behavior of the Lusi eruption. Our study will also provide a large dataset for a qualitative analysis of earthquake triggering studies, earthquake-volcano and earthquake-earthquake interactions. In this study, we will extract Green's functions from ambient seismic noise data in order to image the shallow subsurface structure beneath LUSI area. The waveform cross-correlation technique will be apply to all of recordings of ambient seismic noise at 30 seismographic stations around the LUSI area. We use the dispersive behaviour of the retrieved Rayleigh waves to infer velocity structures in the shallow subsurface.

  4. The Dynamics of Initiative in Communication Networks.

    Science.gov (United States)

    Mollgaard, Anders; Mathiesen, Joachim

    2016-01-01

    Human social interaction is often intermittent. Two acquainted persons can have extended periods without social interaction punctuated by periods of repeated interaction. In this case, the repeated interaction can be characterized by a seed initiative by either of the persons and a number of follow-up interactions. The tendency to initiate social interaction plays an important role in the formation of social networks and is in general not symmetric between persons. In this paper, we study the dynamics of initiative by analysing and modeling a detailed call and text message network sampled from a group of 700 individuals. We show that in an average relationship between two individuals, one part is almost twice as likely to initiate communication compared to the other part. The asymmetry has social consequences and ultimately might lead to the discontinuation of a relationship. We explain the observed asymmetry by a positive feedback mechanism where individuals already taking initiative are more likely to take initiative in the future. In general, people with many initiatives receive attention from a broader spectrum of friends than people with few initiatives. Lastly, we compare the likelihood of taking initiative with the basic personality traits of the five factor model.

  5. Quantum repeaters based on CNOT gate under decoherence

    Institute of Scientific and Technical Information of China (English)

    TONG Zhao-yang; LIAO Ping; KUANG Le-man

    2007-01-01

    In this paper, we study single-qubit and single-user quantum repeaters based on CNOT gates under de, co-herence using the Kraus-operator representations of decoher-ence.We investigate the influence of decoherence on the information-disturbance trade-off of quantum repeaters. It is found that decoherence may lead to the appearance of three subspaces, called as the normal subspace, the anoma-lous subspace, and the decoherence-free subspace (DFS), re-spectively. It is indicated that in the normal subspace deco-herence decreases the transmission and estimation fidelities, in the anomalous subspace decoherence enhances these fideli-ties, and in the DFS these fidelities do not change. The con-cept of the quality factor is introduced to evaluate the quality of the quantum repeater. It is indicated that the quality factor can be efficiently controlled and manipulated by changing the initial state of the probe qubit. It is found that under certain conditions the quantum repeater can be optimal even in the presence of decoherence.

  6. The development of ingroup favoritism in repeated social dilemmas

    Directory of Open Access Journals (Sweden)

    Angela Rachael Dorrough

    2015-04-01

    Full Text Available In two comprehensive and fully incentivized studies, we investigate the development of ingroup favoritism as one of two aspects of parochial altruism in repeated social dilemmas. Specifically, we test whether ingroup favoritism is a fixed phenomenon that can be observed from the very beginning and remains stable over time, or whether it develops (increases vs. decreases during repeated contact. Ingroup favoritism is assessed through cooperation behavior in a repeated continuous prisoner’s dilemma where participants sequentially interact with ten members of the ingroup (own city and university and subsequently with ten members of the outgroup (other city and university, or vice versa. In none of the experiments do we observe initial differences in cooperation behavior for interaction partners from the ingroup, as compared to outgroup, and we only observe small differences in expectations regarding the interaction partners’ cooperation behavior. After repeated interaction, however, including a change of groups, clear ingroup favoritism can be observed. Instead of being due to gradual and potentially biased updating of expectations, we found that these emerging differences were mainly driven by the change of interaction partners’ group membership that occurred after round 10. This indicates that in social dilemma settings ingroup favoritism is to some degree dynamic in that it is enhanced and sometimes only observable if group membership is activated by thinking about both the interaction with the ingroup and the outgroup.

  7. The artifcial catchment Chicken Creek as a tool to study initial ecosystem development

    Science.gov (United States)

    Schaaf, W.; Elmer, M.; Fischer, A.; Gerwin, W.; Nenov, R.

    2011-12-01

    The artificial catchment Chicken Creek was constructed in 2005 to study the increasingly complex interactions of processes and structures during initial development of ecosystems. The 6ha area serves as the central research site for the Transregional Collaborative Research Center 38. Both internal and external factors could be identified as driving forces for the formation of structures and patterns in the artificial catchment during the first five years of development. Initial structures formed by the construction process (e.g. catchment morphology, subsurface structures like clay dams and dumping cones, caterpillar tracks at the surface) and initial substrate characteristics (e.g. texture, geochemistry) were decisive both for the distribution and flow of precipitation water and for vegetation succession. External factors like episodic events (e.g. heavy thunderstorms) triggered erosion and dissection during this initial phase, promoted by the low vegetation cover and the unconsolidated sandy substrate. These processes resulted in transport and redistribution of water and sediment within the catchment, mainly along the main slope, and the formation of new structural elements like gullies and channels, a sedimentation fan above and sediments within the pond. As a result, we observed an overall differentiation of the site, e.g. with respect to water availability and texture redistribution, into areas with abrasion or accumulation processes dominating and areas with stable surfaces. During further development, both external factors and processes within the catchment continued to influence the site. For example, beside the initial soil seed bank, the surrounding environment of the catchment clearly affected species invasion. The dissection and stability of surfaces may be an important factor for the establishment of plants and habitats as well as for the formation of vegetation patterns and biological soil crusts. The transformation of the initial geo-system into

  8. An exploratory study assessing reasons behind initiation, continuation or stoppage of alcohol after first use

    Directory of Open Access Journals (Sweden)

    B S Chavan

    2015-01-01

    Full Text Available Objective: Few studies have investigated the reasons for alcohol initiation and continuation. The present study examined reasons for trying alcohol for the first time and its subsequent use. Furthermore, the study attempted to discover the possible predictors that make an individual vulnerable to alcohol use. Methodology: A total of 280 first-year college students from six different colleges were contacted. Using the method of equal probability, every third subject from each class was selected. All the selected subjects were interviewed and administered semi-structured questionnaire for gathering information regarding their experience with alcohol. Results: In our study, experimentation and peer pressure were found to be the main reasons for both alcohol use and its re-use. The first time drinkers differed a lot from those with multiple users in terms of reasons for trying alcohol, the effect of alcohol, family history of alcohol use, and self-view about alcohol use. The results depicted that the gender, educational stream, and family history of alcohol use are the factors that make an individual vulnerable to alcohol use. Conclusion: First-year of college is a unique transitional period. First-year students with high levels of sensation seeking may be especially at high-risk to begin or escalate heavy drinking. Studying the nature of alcohol initiation may not only be helpful in planning awareness programs but also in preventing underage drinking and alcohol abuse.

  9. Childhood experiences and repeated suicidal behavior

    DEFF Research Database (Denmark)

    Krarup, Gertrud; Nielsen, Bent; Rask, P

    1991-01-01

    The aim of this study was to elucidate the influence of various events in childhood on suicidal behavior in adult age. For this purpose, 99 patients admitted to the Department of Psychiatry of Odense University Hospital after making a suicide attempt were followed for 5 years, to register repeated...... suicidal behavior. The results showed that three fourths of the patients attempted suicide more than once (62% nonfatal and 14% fatal outcome). The sex distribution was about the same among the first-evers as among the repeaters. Most repeaters were younger people in their twenties and thirties......, and the first-evers on average were past the age of 40. Somewhat unexpectedly, significantly more repeaters than first-evers had grown up with both their parents. However, the results also showed that significantly more repeaters than first-evers had had an unhappy childhood. This indicates...

  10. Teacher Education Partnerships: Integration of Case Studies within an Initial Teacher Education Program

    Directory of Open Access Journals (Sweden)

    Patricia Goldblatt

    2009-01-01

    Full Text Available This paper outlines the partnership between the Faculty of Education at Brock University and the Ontario College of Teachers as the self-regulatory body for the teaching profession in Ontario. The paper explores how two institutions collaborated to use case study methodology with faculty members in an initial teacher education program. The paper explores the planning and delivery of a case study institute to faculty members of the Teacher Education Department at Brock University and how self-study was incorporated to reflect on the partnership. This paper details the partnership and the links between self-study of teacher education practices and the constructivist approach of case study methodology.

  11. High-bandwidth hybrid quantum repeater.

    Science.gov (United States)

    Munro, W J; Van Meter, R; Louis, Sebastien G R; Nemoto, Kae

    2008-07-25

    We present a physical- and link-level design for the creation of entangled pairs to be used in quantum repeater applications where one can control the noise level of the initially distributed pairs. The system can tune dynamically, trading initial fidelity for success probability, from high fidelity pairs (F=0.98 or above) to moderate fidelity pairs. The same physical resources that create the long-distance entanglement are used to implement the local gates required for entanglement purification and swapping, creating a homogeneous repeater architecture. Optimizing the noise properties of the initially distributed pairs significantly improves the rate of generating long-distance Bell pairs. Finally, we discuss the performance trade-off between spatial and temporal resources.

  12. Studying the Effect of Initial Damage on Failure Probability of One Story Steel Buildings

    Directory of Open Access Journals (Sweden)

    F. Nateghi

    2013-01-01

    Full Text Available Progressive collapse is a kind of failure in which the collapse of one or several load bearing elementsis ended in partial or total collapse of structures. If earthquakes induce progressive collapse, seismic and gravityloads cause initial failure propagating to other parts of structures. Therefore, seismic progressive collapse canoccur in structures regardless the number of stories. In this paper the behavior of a one story steel building isstudied to investigate the effect of initial damaged column position on the seismic progressive collapse. In thisregard the critical position of damaged column has been identified first and then, the effect of damaged columnis studied. Accordingly, nonlinear dynamic analysis has been used to obtain the fragility curves of the structureand investigate its failure probability. A damage index has also been used to validate the results. Based on theresults obtained in this research, the initial failure of a middle column can increase the failure probability ofstructures during earthquakes. Besides, among the evaluated design parameters, the failure probability ischanged significantly in the columns in accordance with their axial loads.

  13. The FERMI @ Elettra Technical Optimization Study: PreliminaryParameter Set and Initial Studies

    Energy Technology Data Exchange (ETDEWEB)

    Byrd, John; Corlett, John; Doolittle, Larry; Fawley, William; Lidia, Steven; Penn, Gregory; Ratti, Alex; Staples, John; Wilcox,Russell; Wurtele, Jonathan; Zholents, Alexander

    2005-08-01

    The goal of the FERMI {at} Elettra Technical Optimization Study is to produce a machine design and layout consistent with user needs for radiation in the approximate ranges 100 nm to 40 nm, and 40 nm to 10 nm, using seeded FEL's. The Study will involve collaboration between Italian and US physicists and engineers, and will form the basis for the engineering design and the cost estimation.

  14. Hypoxic Repeat Sprint Training Improves Rugby Player's Repeated Sprint but Not Endurance Performance.

    Science.gov (United States)

    Hamlin, Michael J; Olsen, Peter D; Marshall, Helen C; Lizamore, Catherine A; Elliot, Catherine A

    2017-01-01

    This study aims to investigate the performance changes in 19 well-trained male rugby players after repeat-sprint training (six sessions of four sets of 5 × 5 s sprints with 25 s and 5 min of active recovery between reps and sets, respectively) in either normobaric hypoxia (HYP; n = 9; FIO2 = 14.5%) or normobaric normoxia (NORM; n = 10; FIO2 = 20.9%). Three weeks after the intervention, 2 additional repeat-sprint training sessions in hypoxia (FIO2 = 14.5%) was investigated in both groups to gauge the efficacy of using "top-up" sessions for previously hypoxic-trained subjects and whether a small hypoxic dose would be beneficial for the previously normoxic-trained group. Repeated sprint (8 × 20 m) and Yo-Yo Intermittent Recovery Level 1 (YYIR1) performances were tested twice at baseline (Pre 1 and Pre 2) and weekly after (Post 1-3) the initial intervention (intervention 1) and again weekly after the second "top-up" intervention (Post 4-5). After each training set, heart rate, oxygen saturation, and rate of perceived exertion were recorded. Compared to baseline (mean of Pre 1 and Pre 2), both the hypoxic and normoxic groups similarly lowered fatigue over the 8 sprints 1 week after the intervention (Post 1: -1.8 ± 1.6%, -1.5 ± 1.4%, mean change ± 90% CI in HYP and NORM groups, respectively). However, from Post 2 onwards, only the hypoxic group maintained the performance improvement compared to baseline (Post 2: -2.1 ± 1.8%, Post 3: -2.3 ± 1.7%, Post 4: -1.9 ± 1.8%, and Post 5: -1.2 ± 1.7%). Compared to the normoxic group, the hypoxic group was likely to have substantially less fatigue at Post 3-5 (-2.0 ± 2.4%, -2.2 ± 2.4%, -1.6 ± 2.4% Post 3, Post 4, Post 5, respectively). YYIR1 performances improved throughout the recovery period in both groups (13-37% compared to baseline) with unclear differences found between groups. The addition of two sessions of "top-up" training after intervention 1, had little effect on either group. Repeat-sprint training in

  15. Hypoxic Repeat Sprint Training Improves Rugby Player's Repeated Sprint but Not Endurance Performance

    Science.gov (United States)

    Hamlin, Michael J.; Olsen, Peter D.; Marshall, Helen C.; Lizamore, Catherine A.; Elliot, Catherine A.

    2017-01-01

    This study aims to investigate the performance changes in 19 well-trained male rugby players after repeat-sprint training (six sessions of four sets of 5 × 5 s sprints with 25 s and 5 min of active recovery between reps and sets, respectively) in either normobaric hypoxia (HYP; n = 9; FIO2 = 14.5%) or normobaric normoxia (NORM; n = 10; FIO2 = 20.9%). Three weeks after the intervention, 2 additional repeat-sprint training sessions in hypoxia (FIO2 = 14.5%) was investigated in both groups to gauge the efficacy of using “top-up” sessions for previously hypoxic-trained subjects and whether a small hypoxic dose would be beneficial for the previously normoxic-trained group. Repeated sprint (8 × 20 m) and Yo-Yo Intermittent Recovery Level 1 (YYIR1) performances were tested twice at baseline (Pre 1 and Pre 2) and weekly after (Post 1–3) the initial intervention (intervention 1) and again weekly after the second “top-up” intervention (Post 4–5). After each training set, heart rate, oxygen saturation, and rate of perceived exertion were recorded. Compared to baseline (mean of Pre 1 and Pre 2), both the hypoxic and normoxic groups similarly lowered fatigue over the 8 sprints 1 week after the intervention (Post 1: −1.8 ± 1.6%, −1.5 ± 1.4%, mean change ± 90% CI in HYP and NORM groups, respectively). However, from Post 2 onwards, only the hypoxic group maintained the performance improvement compared to baseline (Post 2: −2.1 ± 1.8%, Post 3: −2.3 ± 1.7%, Post 4: −1.9 ± 1.8%, and Post 5: −1.2 ± 1.7%). Compared to the normoxic group, the hypoxic group was likely to have substantially less fatigue at Post 3–5 (−2.0 ± 2.4%, −2.2 ± 2.4%, −1.6 ± 2.4% Post 3, Post 4, Post 5, respectively). YYIR1 performances improved throughout the recovery period in both groups (13–37% compared to baseline) with unclear differences found between groups. The addition of two sessions of “top-up” training after intervention 1, had little effect on either

  16. Investigating the health implications of social policy initiatives at the local level: study design and methods

    Directory of Open Access Journals (Sweden)

    Carey Gemma E

    2010-12-01

    Full Text Available Abstract Background In this paper we present the research design and methods of a study that seeks to capture local level responses to an Australian national social policy initiative, aimed at reducing inequalities in the social determinants of health. Methods/Design The study takes a policy-to-practice approach and combines policy and stakeholder interviewing with a comparative case study analysis of two not-for-profit organisations involved in the delivery of federal government policy. Discussion Before the health impacts of broad-scale policies, such as the one described in this study, can be assessed at the population level, we need to understand the implementation process. This is consistent with current thinking in political science and social policy, which has emphasised the importance of investigating how, and if, policies are translated into operational realities.

  17. E-travel Adoption by Small Travel Enterprises (STEs: An Initial Study in Indonesia and Malaysia

    Directory of Open Access Journals (Sweden)

    Vera Pujani

    2015-06-01

    Full Text Available This paper aims to investigate e-travel adoption of tourism industries in Indonesia and Malaysia particularly by STEs. The qualitative research was undertaken using case analysis from in-depth interviews of 10-STEs as intial study both in Indonesia and Malaysia. The finding result of e-travel adoption by STEs in a cross-cultural study was identified from the findings present in the initial study based on personal, organizational and website characteristics. The majority of personal characteristics were relatively similar in both countries. However, few differences are present in organizational and website characteristics. E-travel adoption in both countries is influenced by the business experiences of owners/managers, various technological aspects, and the nature of use and benefits. The following study, the user-based survey would be undertaken to complete The e-travel adoption model in Indonesia and Malaysia.

  18. Initial Investigation on Privacy Preferences: A Preliminary Study on User Priority, Concern, Perception and Expectation

    Directory of Open Access Journals (Sweden)

    Nor Asiakin Hasbullah

    2011-01-01

    Full Text Available This paper reports on the findings of an initial study on the user’s preference towards their own privacy. The study is important in having user’s opinion especially when dealing with security of their privacy. It is vital to know what the most important priorities are when dealing with privacy as this could lead to the requirements that the user expected when using a website. In addition, this study tried to gather information of user perceptions on privacy and the expectations that they have when dealing with organizations through a survey by using questionnaires. Results showed that Malaysians does have privacy concerns when dealing with organizations. Therefore, this study has achieved the objective s of gathering data on user perceptions and expectations towards privacy.

  19. Local and Nonlocal Impacts of Soil Moisture Initialization on AGCM Seasonal Forecasts: A Model Sensitivity Study.

    Science.gov (United States)

    Zhang, H.; Frederiksen, C. S.

    2003-07-01

    Using a version of the Australian Bureau of Meteorology Research Centre (BMRC) atmospheric general circulation model, this study investigates the model's sensitivity to different soil moisture initial conditions in its dynamically extended seasonal forecasts of June-August 1998 climate anomalies, with focus on the south and northeast China regions where severe floods occurred. The authors' primary aim is to understand the model's responses to different soil moisture initial conditions in terms of the physical and dynamical processes involved. Due to a lack of observed global soil moisture data, the efficacy of using soil moisture anomalies derived from the NCEP-NCAR reanalysis is assessed. Results show that by imposing soil moisture percentile anomalies derived from the reanalysis data into the BMRC model initial condition, the regional features of the model's simulation of seasonal precipitation and temperature anomalies are modulated. Further analyses reveal that the impacts of soil moisture conditions on the model's surface temperature forecasts are mainly from localized interactions between land surface and the overlying atmosphere. In contrast, the model's sensitivity in its forecasts of rainfall anomalies is mainly due to the nonlocal impacts of the soil moisture conditions. Over the monsoon-dominated east Asian region, the contribution from local water recycling, through surface evaporation, to the model simulation of precipitation is limited. Rather, it is the horizontal moisture transport by the regional atmospheric circulation that is the dominant factor in controlling the model rainfall. The influence of different soil moisture conditions on the model forecasts of rainfall anomalies is the result of the response of regional circulation to the anomalous soil moisture condition imposed. Results from the BMRC model sensitivity study support similar findings from other model studies that have appeared in recent years and emphasize the importance of improving

  20. Characteristics of participants with self-reported hemochromatosis or iron overload at HEIRS Study initial screening

    OpenAIRE

    Barton, James C.; Acton, Ronald T; Leiendecker-Foster, Catherine; Lovato, Laura; Adams, Paul C; Eckfeldt, John H.; Mclaren, Christine E.; Reiss, Jacob A.; McLaren, Gordon D; Reboussin, David M.; Gordeuk, Victor R.; Speechley, Mark R; Press, Richard D.; Dawkins, Fitzroy W.

    2008-01-01

    There are few descriptions of young adults with self-reported hemochromatosis or iron overload (H/IO). We analyzed initial screening data in 7,343 HEmochromatosis and IRon Overload Screening (HEIRS) Study participants ages 25–29 years, including race/ethnicity and health information; transferrin saturation (TS) and ferritin (SF) measurements; and HFE C282Y and H63D genotypes. We used denaturing high-pressure liquid chromatography and sequencing to detect mutations in HJV, TFR2, HAMP, SLC40A1,...

  1. Repeated administration of D-amphetamine induces loss of [{sup 123}I]FP-CIT binding to striatal dopamine transporters in rat brain: a validation study

    Energy Technology Data Exchange (ETDEWEB)

    Booij, Jan [Department of Nuclear Medicine, Academic Medical Center, 1105 AZ Amsterdam (Netherlands)]. E-mail: j.booij@amc.uva.nl; Bruin, Kora de [Department of Nuclear Medicine, Academic Medical Center, 1105 AZ Amsterdam (Netherlands); Gunning, W. Boudewijn [Department of Neurology, Epilepsy Centre Kempenhaeghe, 5590 AB Heeze (Netherlands)

    2006-04-15

    In recent years, several PET and SPECT studies have shown loss of striatal dopamine transporter (DAT) binding in amphetamine (AMPH) users. However, the use of DAT SPECT tracers to detect AMPH-induced changes in DAT binding has not been validated. We therefore examined if repeated administration of D-AMPH or methamphetamine (METH) may induce loss of binding to striatal DATs in rats by using an experimental biodistribution study design and a SPECT tracer for the DAT ([{sup 123}I]FP-CIT). Methods: Groups of male rats (n=10 per group) were treated with D-AMPH (10 mg/kg body weight), METH (10 mg/kg body weight), or saline, twice a day for 5 consecutive days. Five days later, [{sup 123}I]FP-CIT was injected intravenously, and 2 h later, the rats were sacrificed and radioactivity was assayed. Results: In D-AMPH but not METH-treated rats, striatal [{sup 123}I]FP-CIT uptake was significantly lower (approximately 17%) than in the control group. Conclusion: These data show that [{sup 123}I]FP-CIT can be used to detect AMPH-induced changes in DAT binding and may validate the use of DAT radiotracers to study AMPH-induced changes in striatal DAT binding in vivo.

  2. Influence of coefficient of variation in determining significant difference of quantitative values obtained from 28-day repeated-dose toxicity studies in rats.

    Science.gov (United States)

    Kobayashi, Katsumi; Sakuratani, Yuki; Abe, Takemaru; Yamazaki, Kazuko; Nishikawa, Satoshi; Yamada, Jun; Hirose, Akihiko; Kamata, Eiichi; Hayashi, Makoto

    2011-01-01

    In order to understand the influence of coefficient of variation (CV) in determining significant difference of quantitative values of 28-day repeated-dose toxicity studies, we examined 59 parameters of 153 studies conducted in accordance with Chemical Substance Control Law in 12 test facilities. Sex difference was observed in 12 parameters and 10 parameters showed large CV in females. The minimum CV was 0.74% for sodium. CV of electrolytes was comparatively small, whereas enzymes had large CV. Large differences in CV were observed for major parameters among 7-8 test facilities. The changes in CV were grossly classified into 11. Our study revealed that a statistical significant difference is usually detected if there is a difference of 7% in mean values between the groups and the groups have a CV of about 7%. A parameter with a CV as high as 30% may be significantly different, if the difference of the mean between the groups is 30%. It would be ideal to use median value to assess the treatment-related effect, rather than mean, when the CV is very high. We recommend using CV of the body weight as a standard to judge the adverse effect level.

  3. Common interruptions in the repeating tripeptide sequence of non-fibrillar collagens: sequence analysis and structural studies on triple-helix peptide models.

    Science.gov (United States)

    Thiagarajan, Geetha; Li, Yingjie; Mohs, Angela; Strafaci, Christopher; Popiel, Magdalena; Baum, Jean; Brodsky, Barbara

    2008-02-22

    Interruptions in the repeating (Gly-X1-X2)(n) amino acid sequence pattern are found in the triple-helix domains of all non-fibrillar collagens, and perturbations to the triple-helix at such sites are likely to play a role in collagen higher-order structure and function. This study defines the sequence features and structural consequences of the most common interruption, where one residue is missing from the tripeptide pattern, Gly-X1-X2-Gly-AA(1)-Gly-X1-X2, designated G1G interruptions. Residues found within G1G interruptions are predominantly hydrophobic (70%), followed by a significant amount of charged residues (16%), and the Gly-X1-X2 triplets flanking the interruption are atypical. Studies on peptide models indicate the degree of destabilization is much greater when Pro is in the interruption, GP, than when hydrophobic residues (GF, GY) are present, and a rigid Gly-Pro-Hyp tripeptide adjacent to the interruption leads to greater destabilization than a flexible Gly-Ala-Ala sequence. Modeling based on NMR data indicates the Phe residue within a GF interruption is located on the outside of the triple helix. The G1G interruptions resemble a previously studied collagen interruption GPOGAAVMGPO, designated G4G-type, in that both are destabilizing, but allow continuation of rod-like triple helices and maintenance of the single residue stagger throughout the imperfection, with a loss of axial register of the superhelix on both sides. Both kinds of interruptions result in a highly localized perturbation in hydrogen bonding and dihedral angles, but the hydrophobic residue of a G4G interruption packs near the central axis of the superhelix, while the hydrophobic residue of a G1G interruption is located on the triple-helix surface. The different structural consequences of G1G and G4G interruptions in the repeating tripeptide sequence pattern suggest a physical basis for their differential susceptibility to matrix metalloproteinases in type X collagen.

  4. A STUDY ON LIMITATION OF GOVERNMENT INITIATIVE MODEL FOR ALTERNATIVE FUEL VEHICLE (AFV PROMOTION IN CHINA

    Directory of Open Access Journals (Sweden)

    Byunghun Choi

    2016-04-01

    Full Text Available Chinese responsibility for reducing Greenhouse Gas or carbon dioxide emission increases continuously. Chinese government suggested two targets; Alternative Fuel Vehicle output volume 500 thousand and AFV market share 5% by the end of 2011. However any of two targets did not come true. Therefore this study accessed the question, ‘why Chinese government initiative model for AFV promotion has been so poor?’ This study reviewed the transition process for AFV policies in China and made a structural analysis for three key policies since 2009. As a result the number of articles for related industries or factor endowments was relatively more than firm strategy or demand conditions. Also this study accessed the AFV strategy of Six SOEs from the perspective of social responsibility. Six SOEs have more concentrated on electric vehicle rather than hybrid vehicle with following the government leadership. However major EV or HEV models of them mostly were made by Joint Ventures being under control of foreign makers and the JVs have actually controlled over AFV business. So the limitation of Chinese government initiative model resulted from supplier-centric approach with targeting for public transportation and institution consumer, and it caused a failure to create the demand conditions of general customers.

  5. A Modeling and Verification Study of Summer Precipitation Systems Using NASA Surface Initialization Datasets

    Science.gov (United States)

    Jonathan L. Case; Kumar, Sujay V.; Srikishen, Jayanthi; Jedlovec, Gary J.

    2010-01-01

    One of the most challenging weather forecast problems in the southeastern U.S. is daily summertime pulse-type convection. During the summer, atmospheric flow and forcing are generally weak in this region; thus, convection typically initiates in response to local forcing along sea/lake breezes, and other discontinuities often related to horizontal gradients in surface heating rates. Numerical simulations of pulse convection usually have low skill, even in local predictions at high resolution, due to the inherent chaotic nature of these precipitation systems. Forecast errors can arise from assumptions within parameterization schemes, model resolution limitations, and uncertainties in both the initial state of the atmosphere and land surface variables such as soil moisture and temperature. For this study, it is hypothesized that high-resolution, consistent representations of surface properties such as soil moisture, soil temperature, and sea surface temperature (SST) are necessary to better simulate the interactions between the surface and atmosphere, and ultimately improve predictions of summertime pulse convection. This paper describes a sensitivity experiment using the Weather Research and Forecasting (WRF) model. Interpolated land and ocean surface fields from a large-scale model are replaced with high-resolution datasets provided by unique NASA assets in an experimental simulation: the Land Information System (LIS) and Moderate Resolution Imaging Spectroradiometer (MODIS) SSTs. The LIS is run in an offline mode for several years at the same grid resolution as the WRF model to provide compatible land surface initial conditions in an equilibrium state. The MODIS SSTs provide detailed analyses of SSTs over the oceans and large lakes compared to current operational products. The WRF model runs initialized with the LIS+MODIS datasets result in a reduction in the overprediction of rainfall areas; however, the skill is almost equally as low in both experiments using

  6. Evidence of cormorant-induced mortality, disparate migration strategies and repeatable circadian rhythm in the endangered North Sea houting (Coregonus oxyrinchus): A telemetry study mapping the postspawning migration

    DEFF Research Database (Denmark)

    Jensen, Lasse Fast; Rognon, Paul C.B.; Aarestrup, Kim

    2017-01-01

    , possibly indicating constrained navigation through the lakes. The migration into the Wadden Sea correlated with temperature indicating osmoregulatory constraints of sea entry. Unlike most salmonid species, migration occurred both day and night. Moreover, fish exhibited repeatable individual differences...

  7. An assessment of survival among Korean elderly patients initiating dialysis: a national population-based study.

    Directory of Open Access Journals (Sweden)

    Shina Lee

    Full Text Available BACKGROUND: Although the proportion of the elderly patients with incident end-stage renal disease (ESRD patients has been increasing in Korea, there has been a lack of information on outcomes of dialysis treatment. This study aimed to assess the survival rate and to elucidate predictors for all-cause mortality among elderly Korean patients initiating dialysis. METHODS: We analyzed 11,301 patients (6,138 men aged 65 years or older who had initiated dialysis from 2005 to 2008 and had followed up (median, 37.8 months; range, 3-84 months. Baseline demographics, comorbidities and mortality data were obtained using the database from the Health Insurance Review & Assessment Service. RESULTS: The unadjusted 5-year survival rate was 37.6% for all elderly dialysis patients, and the rate decreased with increasing age categories; 45.9% (65∼69, 37.5% (70∼74, 28.4% (75∼79, 24.1% (80∼84, and 13.7% (≥85 years. The multivariate Cox proportional hazard model revealed that age, sex, dialysis modality, the type of insurance, and comorbidities such as diabetes mellitus, myocardial infarction, congestive heart failure, peripheral vascular disease, cerebrovascular disease, dementia, chronic pulmonary disease, hemiparesis, liver disease, and any malignancy were independent predictors for mortality. In addition, survival rate was significantly higher in patients on hemodialysis compared to patients on peritoneal dialysis during the whole follow-up period in the intention-to-treat analysis. CONCLUSIONS: Survival rate was significantly associated with age, sex, and various comorbidities in Korean elderly patients initiating dialysis. The results of our study can help to provide relevant guidance on the individualization strategy in elderly ESRD patients requiring dialysis.

  8. Simulated Conversations With Virtual Humans to Improve Patient-Provider Communication and Reduce Unnecessary Prescriptions for Antibiotics: A Repeated Measure Pilot Study

    Science.gov (United States)

    2017-01-01

    Background Despite clear evidence that antibiotics do not cure viral infections, the problem of unnecessary prescribing of antibiotics in ambulatory care persists, and in some cases, prescribing patterns have increased. The overuse of antibiotics for treating viral infections has created numerous economic and clinical consequences including increased medical costs due to unnecessary hospitalizations, antibiotic resistance, disruption of gut bacteria, and obesity. Recent research has underscored the importance of collaborative patient-provider communication as a means to reduce the high rates of unnecessary prescriptions for antibiotics. However, most patients and providers do not feel prepared to engage in such challenging conversations. Objectives The aim of this pilot study was to assess the ability of a brief 15-min simulated role-play conversation with virtual humans to serve as a preliminary step to help health care providers and patients practice, and learn how to engage in effective conversations about antibiotics overuse. Methods A total of 69 participants (35 providers and 34 patients) completed the simulation once in one sitting. A pre-post repeated measures design was used to assess changes in patients’ and providers’ self-reported communication behaviors, activation, and preparedness, intention, and confidence to effectively communicate in the patient-provider encounter. Changes in patients’ knowledge and beliefs regarding antibiotic use were also evaluated. Results Patients experienced a short-term positive improvement in beliefs about appropriate antibiotic use for infection (F1,30=14.10, P=.001). Knowledge scores regarding the correct uses of antibiotics improved immediately postsimulation, but decreased at the 1-month follow-up (F1,30=31.16, P.10) Patients with lower levels of activation exhibited positive, short-term benefits in increased intent and confidence to discuss their needs and ask questions in the clinic visit, positive attitudes

  9. The effects of repeated administration of camphor-crataegus berry extract combination on blood pressure and on attentional performance - a randomized, placebo-controlled, double-blind study.

    Science.gov (United States)

    Erfurt, L; Schandry, R; Rubenbauer, S; Braun, U

    2014-09-25

    The present study investigated the effects of repeated administration of Korodin(®), a combination of camphor and crataegus berry extract, on blood pressure and attentional functioning. This study was conducted based on a randomized, placebo-controlled, double-blind design. 54 persons participated (33 female, 21 male) with a mean age of 24.3 years. Blood pressure and body mass index were in the normal range. Participants received 20 drops of either Korodin(®) or a placebo for four times with interjacent time intervals of about 10 min. Blood pressure was measured sphygmomanometrically before and after each administration. Attentional performance was quantified by using two paper-and-pencil tests, the d2 Test of Attention and Digit Symbol Test. Greater increases in blood pressure occurred after the four Korodin(®) administrations in comparison to the four placebo administrations. The performance in two parameters of d2 Test of Attention was consistently superior after the intake of Korodin(®). The excellent tolerability and safety of Korodin(®), even after a total consumption of 80 drops, was confirmed. Copyright © 2014 Elsevier GmbH. All rights reserved.

  10. Determination of the ideal sampling technique to reduce repeated procedures:a comparative study including 393 fine-needle aspirations for thyroid nodules.

    Science.gov (United States)

    Uzunkaya, Fatih; Özden, Ahmet

    2017-02-27

    Fine-needle aspiration biopsy is an established method for the evaluation of thyroid nodules, but it has not been standardized worldwide yet. Adequacy of the aspirations is affected by several factors. The aim of this study is to determine the main factors affecting the adequacy and to suggest a procedural technique expected to reduce repeated procedures. A total of 393 aspiration procedures performed using either 22-gauge or 27-gauge needles were included in the study. The samplings were classified as inadequate or adequate according to the cytopathological reports, and results were compared. The rate of adequate samplings was higher in the 27-gauge group and the difference was statistically significant. Neither the size of nodules nor the number of slides used for smearing affected the adequacy. There was not a statistically significant relation between the needle size and the nodule size or the number of slides in terms of adequacy. Needle size is an important factor that affects the adequacy of samplings. The nodule size and the number of slides do not affect the adequacy. However, bloody and thicker smears are difficult for pathologists to evaluate and result in inadequacy.

  11. Diurnal variations of plasma homocysteine, total antioxidant status, and biological markers of muscle injury during repeated sprint: effect on performance and muscle fatigue--a pilot study.

    Science.gov (United States)

    Hammouda, Omar; Chtourou, Hamdi; Chahed, Henda; Ferchichi, Salyma; Kallel, Choumous; Miled, Abdelhedi; Chamari, Karim; Souissi, Nizar

    2011-12-01

    The aim of this study was (i) to evaluate whether homocysteine (Hcy), total antioxidant status (TAS), and biological markers of muscle injury would be affected by time of day (TOD) in football players and (ii) to establish a relationship between diurnal variation of these biomarkers and the daytime rhythm of power and muscle fatigue during repeated sprint ability (RSA) exercise. In counterbalanced order, 12 football (soccer) players performed an RSA test (5 x[6 s of maximal cycling sprint + 24 s of rest]) on two different occasions: 07:00-08:30 h and 17:00-18:30 h. Fasting blood samples were collected from a forearm vein before and 3-5 min after each RSA test. Core temperature, rating of perceived exertion, and performances (i.e., Sprint 1, Sprint 2, and power decrease) during the RSA test were significantly higher at 17:00 than 07:00 h (p RSA test. However, biomarkers of antioxidant status' resting levels (i.e., total antioxidant status, uric acid, and total bilirubin) were higher in the morning. This TOD effect was suppressed after exercise for TAS and uric acid. In conclusion, the present study confirms diurnal variation of Hcy, selected biological markers of cellular damage, and antioxidant status in young football players. Also, the higher performances and muscle fatigue showed in the evening during RSA exercise might be due to higher levels of biological markers of muscle injury and lower antioxidant status at this TOD.

  12. Repeatability of clades as a criterion of reliability: a case study for molecular phylogeny of Acanthomorpha (Teleostei) with larger number of taxa.

    Science.gov (United States)

    Chen, Wei-Jen; Bonillo, Céline; Lecointre, Guillaume

    2003-02-01

    Although much progress has been made recently in teleostean phylogeny, relationships among the main lineages of the higher teleosts (Acanthomorpha), containing more than 60% of all fish species, remain poorly defined. This study represents the most extensive taxonomic sampling effort to date to collect new molecular characters for phylogenetic analysis of acanthomorph fishes. We compiled and analyzed three independent data sets, including: (i) mitochondrial ribosomal fragments from 12S and 16s (814bp for 97 taxa); (ii) nuclear ribosomal 28S sequences (847bp for 74 taxa); and (iii) a nuclear protein-coding gene, rhodopsin (759bp for 86 taxa). Detailed analyses were conducted on each data set separately and the principle of taxonomic congruence without consensus trees was used to assess confidence in the results as follows. Repeatability of clades from separate analyses was considered the primary criterion to establish reliability, rather than bootstrap proportions from a single combined (total evidence) data matrix. The new and reliable clades emerging from this study of the acanthomorph radiation were: Gadiformes (cods) with Zeioids (dories); Beloniformes (needlefishes) with Atheriniformes (silversides); blenioids (blennies) with Gobiesocoidei (clingfishes); Channoidei (snakeheads) with Anabantoidei (climbing gouramies); Mastacembeloidei (spiny eels) with Synbranchioidei (swamp-eels); the last two pairs of taxa grouping together, Syngnathoidei (aulostomids, macroramphosids) with Dactylopteridae (flying gurnards); Scombroidei (mackerels) plus Stromatoidei plus Chiasmodontidae; Ammodytidae (sand lances) with Cheimarrhichthyidae (torrentfish); Zoarcoidei (eelpouts) with Cottoidei; Percidae (perches) with Notothenioidei (Antarctic fishes); and a clade grouping Carangidae (jacks), Echeneidae (remoras), Sphyraenidae (barracudas), Menidae (moonfish), Polynemidae (threadfins), Centropomidae (snooks), and Pleuronectiformes (flatfishes).

  13. 26-week repeated oral dose toxicity study of UP446, a combination of defined extracts of Scutellaria baicalensis and Acacia catechu, in beagle dogs.

    Science.gov (United States)

    Yimam, Mesfin; Lee, Young Chul; Jia, Qi

    2016-07-01

    The needs for relatively safe botanical alternatives to relieve symptoms associated to arthritis have continued to grow in parallel with the ageing population. UP446, a standardized bioflavonoid composition from the roots of Scutellaria baicalensis and the heartwoods of Acacia catechu, has been used as over the counter joint care dietary supplements and a prescription medical food. Significant safety data have been documented in rodents and human for this composition. Here we evaluated the potential adverse effects of orally administered UP446 in beagle dogs following a 26-week repeated oral dose toxicity study. UP446 at doses of 250, 500 and 1000 mg/kg/day were administered orally to beagle dogs for 26 weeks. A 4-week recovery group from the high dose (1000 mg/kg) and vehicle treated groups were included. No morbidity or mortality was observed for the duration of the study. No significant differences between groups in body weights, food consumption, ophthalmological examinations, electrocardiograms, urinalysis, hematology, clinical chemistry, organ weights, gross pathology and histopathology were documented. Emesis, loose feces and diarrhea were noted in both genders at the 1000 mg/kg treatment groups. These clinical signs were considered to be reversible as they were not evident in the recovery period. In conclusion, the no-observed-adverse-effect-level (NOAEL) of UP446 was considered to be 500 mg/kg/day both in male and female beagle dogs.

  14. Combination of the clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 technique with the piggybac transposon system for mouse in utero electroporation to study cortical development.

    Science.gov (United States)

    Cheng, Man; Jin, Xubin; Mu, Lili; Wang, Fangyu; Li, Wei; Zhong, Xiaoling; Liu, Xuan; Shen, Wenchen; Liu, Ying; Zhou, Yan

    2016-09-01

    In utero electroporation (IUE) is commonly used to study cortical development of cerebrum by downregulating or overexpressing genes of interest in neural progenitor cells (NPCs) of small mammals. However, exogenous plasmids are lost or diluted over time. Furthermore, gene knockdown based on short-hairpin RNAs may exert nonspecific effects that lead to aberrant neuronal migration. Genomic engineering by the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) system has great research and therapeutic potentials. Here we integrate the CRISPR/Cas9 components into the piggyBac (PB) transposon system (the CRISPR/Cas9-PB toolkit) for cortical IUEs. The mouse Sry-related HMG box-2 (Sox2) gene was selected as the target for its application. Most transduced cortical NPCs were depleted of SOX2 protein as early as 3 days post-IUE, whereas expressions of SOX1 and PAX6 remained intact. Furthermore, both the WT Cas9 and the D10A nickase mutant Cas9n showed comparable knockout efficiency. Transduced cortical cells were purified with fluorescence-activated cell sorting, and effective gene editing at the Sox2 loci was confirmed. Thus, application of the CRISPR/Cas9-PB toolkit in IUE is a promising strategy to study gene functions in cortical NPCs and their progeny. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  15. Forces in initial archwires during leveling and aligning: An in-vitro study

    Science.gov (United States)

    Reddy, Rajesh Kumar; Katari, Pavan K.; Bypureddy, Tarun T.; Anumolu, Venkata Naga Sri Harsha; Kartheek, Yenugupalli; Sairam, Nemala. R. V.

    2016-01-01

    Aim: This in-vitro study measured the force deflection behavior of selected initial alignment archwires by conducting three-point bending tests under controlled tests. The study tested three wire designs, namely, co-axial multistranded stainless steel wires, nickel–titanium, and copper–nickel–titanium archwires. Materials and Methods: The archwires were ligated to a specially designed metal jig, simulating the arch. A testing machine (Instron) recorded activation and deactivation forces of different deflections at 37°C. Forces on activation and deactivation were compared by one-way analysis of variance (ANOVA). Results: Significant differences (P < 0.05) in activation and deactivation forces were observed among the tested wires. The co-axial multistranded wire had the lowest mean activation and deactivation forces, whereas conventional nickel–titanium wires had more mean activation and deactivation forces at different deflections. Conclusion: The activation and deactivation forces were higher for nickel–titanium followed by copper–nickel titanium and co-axial wires. The amount of percentage force loss was more for co-axial wire, indicating that these wires are not ideal for initial leveling and aligning. PMID:27891306

  16. Study of the Initiation Phase of Thick, Metallic Liners at 1MA

    Science.gov (United States)

    Bott, Simon; Blesener, I. C.; Hoyt, C. L.; Gourdain, P. A.; Greenly, J. B.; Hammer, D. A.; Kusse, B. R.; Chittenden, J. P.; Weinwurm, M.; Cuneo, M. E.

    2012-10-01

    We present a study investigating the initiation of plasma in solid, metallic liners where the liner thickness is large compared to the collisionless skin depth. The current pulse on the 1 MA, 100ns COBRA generator is comparable to the early stages of the current pulse on the Z generator, and studies in the low current regime may highlight details of the liner initiation pertinent to the MagLIF fusion scheme [1]. We present optical emission data from aluminum liners using gated imaging and streak photography, which show a dependence of onset of emission with the size of a small power-feed gap introduced at the cathode. We also show measurements of the B-field inside the liner, using miniature Bdot probes, which show a dependence on the liner diameter and thickness. These data will be compared to magneto-hydrodynamic simulations. Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000. Work at Cornell University is supported by the NNSA-SSAA through Cooperative Agreement DE-FC03-02NA00057. [4pt] [1] Slutz et al, Phys Plasmas, 17, 056303 (2010)

  17. The european FAZIA initiative: a high-performance digital telescope array for heavy-ion studies

    CERN Document Server

    Casini, G; Pasquali, G; Pastore, G; Bini, M; Carboni, S; Olmi, A; Piantelli, S; Poggi, G; Stefanini, A; Valdre', S; Bonnet, E; Borderie, B; Bougault, R; Bruno, M; Chbihi, A; Cinausero, M; Degerlier, M; Edelbruck, P; Frankland, J D; Gramegna, F; Gruyer, D; Guerzoni, M; Kordjasz, A; Kozik, T; Neindre, N Le; Lopez, O; Marchi, T; Marini, P; Morelli, L; Ordine, A; Parlog, M; Rivet, M F; Rosato, E; Salomon, F; Spadaccini, G; Twarog, T; Vient, E; Vigilante, M

    2013-01-01

    The european Fazia collaboration aims at building a new modular array for charged product identification to be employed for heavy-ion studies. The elementary module of the array is a Silicon-Silicon-CsI telescope, optimized for ion identification also via pulse shape analysis. The achievement of top performances imposes specific electronics which has been developed by FAZIA and features high quality charge and current preamplifiers, coupled to fully digital front-end. During the initial R&D phase, original and novel solutions have been tested in prototypes, obtaining unprecedented ion identification capabilities. FAZIA is now constructing a demonstrator array consisting of about two hundreds telescopes arranged in a compact and transportable configuration. In this contribution, we mainly summarize some aspects studied by FAZIA to improve the ion identification. Then we will briefly discuss the FAZIA program centered on experiments to be done with the demonstrator. First results on the isospin dynamics obt...

  18. Initial technology assessment for the Large-Aperture UV-Optical-Infrared (LUVOIR) mission concept study

    Science.gov (United States)

    Bolcar, Matthew R.; Feinberg, Lee; France, Kevin; Rauscher, Bernard J.; Redding, David; Schiminovich, David

    2016-07-01

    The NASA Astrophysics Division's 30-Year Roadmap prioritized a future large-aperture space telescope operating in the ultra-violet/optical/infrared wavelength regime. The Association of Universities for Research in Astronomy envisioned a similar observatory, the High Definition Space Telescope. And a multi-institution group also studied the Advanced Technology Large Aperture Space Telescope. In all three cases, a broad science case is outlined, combining general astrophysics with the search for biosignatures via direct-imaging and spectroscopic characterization of habitable exoplanets. We present an initial technology assessment that enables such an observatory that is currently being studied for the 2020 Decadal Survey by the Large UV/Optical/Infrared (LUVOIR) surveyor Science and Technology Definition Team. We present here the technology prioritization for the 2016 technology cycle and define the required technology capabilities and current state-of-the-art performance. Current, planned, and recommended technology development efforts are also reported.

  19. Uranium in the Wyoming Landscape Conservation Initiative study area, southwestern Wyoming

    Science.gov (United States)

    Wilson, Anna B.

    2015-10-20

    Wyoming has led the nation as the producer of uranium ore since 1995 and contains the largest reserves of any state. Approximately one third of Wyoming’s total production came from deposits in, or immediately adjacent to, the Wyoming Landscape Conservation Initiative (WLCI) study area in the southwestern corner of the state including all of Carbon, Lincoln, Sublette, Sweetwater, Uinta, and parts of southern Fremont Counties. Conventional open-pit and underground mining methods were employed in the study area until the early 1990s. Since the early 1990s, all uranium mining has been by in-situ recovery (also called in-situ leach). It is estimated that statewide remaining resources of 141,000 tonnes of uranium are about twice the 84,000 tonnes of uranium that the state has already produced.

  20. High fidelity studies of exploding foil initiator bridges, Part 2: Experimental results

    Science.gov (United States)

    Neal, William; Bowden, Mike

    2017-01-01

    Simulations of high voltage detonators, such as Exploding Bridgewire (EBW) and Exploding Foil Initiators (EFI), have historically been simple, often empirical, one-dimensional models capable of predicting parameters such as current, voltage, and in the case of EFIs, flyer velocity. Experimental methods have correspondingly generally been limited to the same parameters. With the advent of complex, first principles magnetohydrodynamic codes such as ALEGRA MHD, it is now possible to simulate these components in three dimensions and predict greater range of parameters than before. A significant improvement in experimental capability was therefore required to ensure these simulations could be adequately verified. In this second paper of a three part study, data is presented from a flexible foil EFI header experiment. This study has shown that there is significant bridge expansion before time of peak voltage and that heating within the bridge material is spatially affected by the microstructure of the metal foil.

  1. Initial Wave Breaking Dynamics of Peregrine-Type Rogue Waves: A Numerical and Experimental Study

    CERN Document Server

    Peric, R; Chabchoub, A

    2014-01-01

    The Peregrine breather, today widely regarded as a prototype for spatio-temporally localized rogue waves on the ocean caused by nonlinear focusing, is analyzed by direct numerical simulations based on two-phase Navier-Stokes equations. A finite-volume approach with a volume of fluid method is applied to study the Peregrine breather dynamics up to the initial stages of wave breaking. The comparison of the numerical results with laboratory experiments to validate the numerical approach shows very good agreement and suggests that the chosen method is an effective tool to study modulation instability and breather dynamics in water waves with high accuracy even up to the onset of wave breaking. The numerical results also indicate some previously unnoticed characteristics of the flow fields below the water surface of breathers, which might be of significance for short-term prediction of rogue waves. Recurrent wave breaking is also observed.

  2. Initial Technology Assessment for the Large-Aperture UV-Optical-Infrared (LUVOIR) Mission Concept Study

    Science.gov (United States)

    Bolcar, Matthew R.; Feinberg, Lee; France, Kevin; Rauscher, Bernard J.; Redding, David; Schiminovich, David

    2016-01-01

    The NASA Astrophysics Division's 30-Year Roadmap prioritized a future large-aperture space telescope operating in the ultra-violet/optical/infrared wavelength regime. The Association of Universities for Research in Astronomy envisioned a similar observatory, the High Definition Space Telescope. And a multi-institution group also studied the Advanced Technology Large Aperture Space Telescope. In all three cases, a broad science case is outlined, combining general astrophysics with the search for biosignatures via direct-imaging and spectroscopic characterization of habitable exoplanets. We present an initial technology assessment that enables such an observatory that is currently being studied for the 2020 Decadal Survey by the Large UV/Optical/Infrared (LUVOIR) surveyor Science and Technology Definition Team. We present here the technology prioritization for the 2016 technology cycle and define the required technology capabilities and current state-of-the-art performance. Current, planned, and recommended technology development efforts are also reported.

  3. Initial Technology Assessment for the Large UV-Optical-Infrared (LUVOIR) Mission Concept Study

    Science.gov (United States)

    Bolcar, Matthew R.; Feinberg, Lee D.; France, Kevin; Rauscher, Bernard J.; Redding, David; Schiminovich, David

    2016-01-01

    The NASA Astrophysics Divisions 30-Year Roadmap prioritized a future large-aperture space telescope operating in the ultra-violet-optical-infrared wavelength regime. The Association of Universities for Research in Astronomy envisioned a similar observatory, the High Definition Space Telescope. And a multi-institution group also studied the Advanced Technology Large Aperture Space Telescope. In all three cases, a broad science case is outlined, combining general astrophysics with the search for bio-signatures via direct-imaging and spectroscopic characterization of habitable exo-planets. We present an initial technology assessment that enables such an observatory that is currently being studied for the 2020 Decadal Survey by the Large UV-Optical Infrared (LUVOIR) surveyor Science and Technology Definition Team. We present here the technology prioritization for the 2016 technology cycle and define the required technology capabilities and current state-of-the-art performance. Current, planned, and recommended technology development efforts are also reported.

  4. Residential Lighting End-Use Consumption Study: Estimation Framework and Initial Estimates

    Energy Technology Data Exchange (ETDEWEB)

    Gifford, Will R.; Goldberg, Miriam L.; Tanimoto, Paulo M.; Celnicker, Dane R.; Poplawski, Michael E.

    2012-12-01

    The U.S. DOE Residential Lighting End-Use Consumption Study is an initiative of the U.S. Department of Energy’s (DOE’s) Solid-State Lighting Program that aims to improve the understanding of lighting energy usage in residential dwellings. The study has developed a regional estimation framework within a national sample design that allows for the estimation of lamp usage and energy consumption 1) nationally and by region of the United States, 2) by certain household characteristics, 3) by location within the home, 4) by certain lamp characteristics, and 5) by certain categorical cross-classifications (e.g., by dwelling type AND lamp type or fixture type AND control type).

  5. NMR studies of the GTP/GDP binding domain of translation initiation factor IF2

    NARCIS (Netherlands)

    Tishchenko, Evgeny Vladimirovich

    2005-01-01

    Translation Initiation Factor 2 (IF2) plays an important role in the initiation stage of bacterial protein biosynthesis. This protein binds both fMet-tRNA and 30S ribosomal subunit in the presence of GTP, and it stimulates the formation of the 70S initiation complex. The NMR samples of the 15N-, 15N

  6. Medication reconciliation as a medication safety initiative in Ethiopia: a study protocol.

    Science.gov (United States)

    Mekonnen, Alemayehu B; McLachlan, Andrew J; Brien, Jo-Anne E; Mekonnen, Desalew; Abay, Zenahebezu

    2016-11-24

    Medication related adverse events are common, particularly during transitions of care, and have a significant impact on patient outcomes and healthcare costs. Medication reconciliation (MedRec) is an important initiative to achieve the Quality Use of Medicines, and has been adopted as a standard practice in many developed countries. However, the impact of this strategy is rarely described in Ethiopia. The aims of this study are to explore patient safety culture, and to develop, implement and evaluate a theory informed MedRec intervention, with the aim of minimising the incidence of medication errors during hospital admission. The study will be conducted in a resource limited setting. There are three phases to this project. The first phase is a mixed methods study of healthcare professionals' perspectives of patient safety culture and patients' experiences of medication related adverse events. In this phase, the Hospital Survey on Patient Safety Culture will be used along with semi-structured indepth interviews to investigate patient safety culture and experiences of medication related adverse events. The second phase will use a semi-structured interview guide, designed according to the 12 domains of the Theoretical Domains Framework, to explore the barriers and facilitators to medication safety activities delivered by hospital pharmacists. The third phase will be a single centre, before and after study, that will evaluate the impact of pharmacist conducted admission MedRec in an emergency department (ED). The main outcome measure is the incidence and potential clinical severity of medication errors. We will then analyse the differences in the incidence and severity of medication errors before and after initiation of an ED pharmacy service. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  7. Medication reconciliation as a medication safety initiative in Ethiopia: a study protocol

    Science.gov (United States)

    Mekonnen, Alemayehu B; McLachlan, Andrew J; Brien, Jo-anne E; Mekonnen, Desalew; Abay, Zenahebezu

    2016-01-01

    Introduction Medication related adverse events are common, particularly during transitions of care, and have a significant impact on patient outcomes and healthcare costs. Medication reconciliation (MedRec) is an important initiative to achieve the Quality Use of Medicines, and has been adopted as a standard practice in many developed countries. However, the impact of this strategy is rarely described in Ethiopia. The aims of this study are to explore patient safety culture, and to develop, implement and evaluate a theory informed MedRec intervention, with the aim of minimising the incidence of medication errors during hospital admission. Methods and analyses The study will be conducted in a resource limited setting. There are three phases to this project. The first phase is a mixed methods study of healthcare professionals' perspectives of patient safety culture and patients' experiences of medication related adverse events. In this phase, the Hospital Survey on Patient Safety Culture will be used along with semi-structured indepth interviews to investigate patient safety culture and experiences of medication related adverse events. The second phase will use a semi-structured interview guide, designed according to the 12 domains of the Theoretical Domains Framework, to explore the barriers and facilitators to medication safety activities delivered by hospital pharmacists. The third phase will be a single centre, before and after study, that will evaluate the impact of pharmacist conducted admission MedRec in an emergency department (ED). The main outcome measure is the incidence and potential clinical severity of medication errors. We will then analyse the differences in the incidence and severity of medication errors before and after initiation of an ED pharmacy service. PMID:27884844

  8. The effect of technical replicate (repeats) on Nix Pro Color Sensor™ measurement precision for meat: A case-study on aged beef colour stability.

    Science.gov (United States)

    Holman, Benjamin W B; Collins, Damian; Kilgannon, Ashleigh K; Hopkins, David L

    2017-09-04

    The Nix Pro Colour Sensor™ (NIX) can be potentially used to measure meat colour, but procedural guidelines that assure measurement reproducibility and repeatability (precision) must first be established. Technical replicate number (r) will minimise response variation, measureable as standard error of predicted mean (SEM), and contribute to improved precision. Consequently, we aimed to explore the effects of r on NIX precision when measuring aged beef colour (colorimetrics; L*, a*, b*, hue and chroma values). Each colorimetric SEM declined with increasing r to indicate improved precision and followed a diminishing rate of improvement that allowed us to recommend r=7 for meat colour studies using the NIX. This definition was based on practical limitations and a* variability, as additional r would be required if other colorimetrics or advanced levels of precision are necessary. Beef ageing and display period, holding temperature, loin and sampled portion were also found to contribute to colorimetric variation, but were incorporated within our definition of r. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  9. Multi locus variable-number tandem repeat (MLVA typing tools improved the surveillance of Salmonella enteritidis: a 6 years retrospective study.

    Directory of Open Access Journals (Sweden)

    Sophie Bertrand

    Full Text Available Surveillance of Salmonella enterica subsp. enterica serovar Enteritidis is generally considered to benefit from molecular techniques like multiple-locus variable-number of tandem repeats analysis (MLVA, which allow early detection and confinement of outbreaks. Here, a surveillance study, including phage typing, antimicrobial susceptibility testing and MLVA on 1,535 S. Enteritidis isolates collected between 2007 and 2012, was used to evaluate the added value of MLVA for public health surveillance in Belgium. Phage types PT4, PT8, PT21, PT1, PT6, PT14b, PT28 and PT13 dominate the Belgian S. Enteritidis population. The isolates of S. Enteritidis were most frequently susceptible to all antibiotics tested. 172 different MLVA profiles were detected, of which 9 frequent profiles included 67.2% of the S. Enteritidis population. During a serial passage experiment on selected isolates to investigate the in vitro stability of the 5 MLVA loci, no variations over time were observed indicating that the MLVA profiles were stable. The MLVA profile of isolates originating from different outbreaks in the Democratic Republic of the Congo (DRC between 2010 and 2011 were distinct from any of the MLVA profiles found in Belgian isolates throughout the six year observational period and demonstrates that MLVA improves public health surveillance of S. Enteritidis. However, MLVA should be complemented with other subtyping methods when investigating outbreaks is caused by the most common MLVA profile.

  10. Multi locus variable-number tandem repeat (MLVA) typing tools improved the surveillance of Salmonella enteritidis: a 6 years retrospective study.

    Science.gov (United States)

    Bertrand, Sophie; De Lamine de Bex, Guillaume; Wildemauwe, Christa; Lunguya, Octavie; Phoba, Marie France; Ley, Benedikt; Jacobs, Jan; Vanhoof, Raymond; Mattheus, Wesley

    2015-01-01

    Surveillance of Salmonella enterica subsp. enterica serovar Enteritidis is generally considered to benefit from molecular techniques like multiple-locus variable-number of tandem repeats analysis (MLVA), which allow early detection and confinement of outbreaks. Here, a surveillance study, including phage typing, antimicrobial susceptibility testing and MLVA on 1,535 S. Enteritidis isolates collected between 2007 and 2012, was used to evaluate the added value of MLVA for public health surveillance in Belgium. Phage types PT4, PT8, PT21, PT1, PT6, PT14b, PT28 and PT13 dominate the Belgian S. Enteritidis population. The isolates of S. Enteritidis were most frequently susceptible to all antibiotics tested. 172 different MLVA profiles were detected, of which 9 frequent profiles included 67.2% of the S. Enteritidis population. During a serial passage experiment on selected isolates to investigate the in vitro stability of the 5 MLVA loci, no variations over time were observed indicating that the MLVA profiles were stable. The MLVA profile of isolates originating from different outbreaks in the Democratic Republic of the Congo (DRC) between 2010 and 2011 were distinct from any of the MLVA profiles found in Belgian isolates throughout the six year observational period and demonstrates that MLVA improves public health surveillance of S. Enteritidis. However, MLVA should be complemented with other subtyping methods when investigating outbreaks is caused by the most common MLVA profile.

  11. Second time around:Corticospinal responses following repeated sports-related concussions within the same season. A transcranial magnetic stimulation study

    Institute of Scientific and Technical Information of China (English)

    Alan J Pearce; Daniel T Corp; Charlotte B Davies; Brendan P Major; Jerome J Maller

    2014-01-01

    Objective:To investigate the degree of neurophysiological and cognitive performance changes resulting from repeat concussions sustained in a single season ofAustralianRules football. Methods:Three amateur football players were recruited after sustainingtwo concussions during a single season of playing.Each player was assessed at multiple time points by transcranial magnetic stimulation(TMS) and electromyography, as well as tested for fine motor and cognitive performance after each concussion.Results:In all three cases, concussions resulted in reduction in fine dexterity and visuomotor reaction time, cognitive attention performance and increase in intracortical inhibition fromTMS.No changes in performance orTMS outcomes were found as a result of the order of the concussions.However, changes observed were dependent on the severity of the concussion.Conclusions:This multiple-case study has demonstrated that concussion result in increased intracortical inhibition and reduction in cognitive and motor performance. Further,TMS, in conjunction with tests of cognitive and motor performance, can be useful as a prognostic technique in assessing recovery from acute concussion injury.

  12. Comparative systems toxicology analysis of cigarette smoke and aerosol from a candidate modified risk tobacco product in organotypic human gingival epithelial cultures: A 3-day repeated exposure study.

    Science.gov (United States)

    Zanetti, Filippo; Titz, Bjoern; Sewer, Alain; Lo Sasso, Giuseppe; Scotti, Elena; Schlage, Walter K; Mathis, Carole; Leroy, Patrice; Majeed, Shoaib; Torres, Laura Ortega; Keppler, Brian R; Elamin, Ashraf; Trivedi, Keyur; Guedj, Emmanuel; Martin, Florian; Frentzel, Stefan; Ivanov, Nikolai V; Peitsch, Manuel C; Hoeng, Julia

    2017-03-01

    Smoking is one of the major lifestyle-related risk factors for periodontal diseases. Modified risk tobacco products (MRTP) offer a promising alternative in the harm reduction strategy for adult smokers unable to quit. Using a systems toxicology approach, we investigated and compared the exposure effects of a reference cigarette (3R4F) and a heat-not-burn technology-based candidate MRTP, the Tobacco Heating System (THS) 2.2. Human gingival epithelial organotypic cultures were repeatedly exposed (3 days) for 28 min at two matching concentrations of cigarette smoke (CS) or THS2.2 aerosol. Results showed only minor histopathological alterations and minimal cytotoxicity upon THS2.2 aerosol exposure compared to CS (1% for THS2.2 aerosol vs. 30% for CS, at the high concentration). Among the 14 proinflammatory mediators analyzed, only 5 exhibited significant alterations with THS2.2 exposure compared with 11 upon CS exposure. Transcriptomic and metabolomic analysis indicated a general reduction of the impact in THS2.2 aerosol-exposed samples with respect to CS (∼79% lower biological impact for the high THS2.2 aerosol concentration compared to CS, and 13 metabolites significantly perturbed for THS2.2 vs. 181 for CS). This study indicates that exposure to THS2.2 aerosol had a lower impact on the pathophysiology of human gingival organotypic cultures than CS. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. Field study of the urinary excretion of ethoxyacetic acid during repeated daily exposure to the ethyl ether of ethylene glycol and the ethyl ether of ethylene glycol acetate.

    Science.gov (United States)

    Veulemans, H; Groeseneken, D; Masschelein, R; Van Vlem, E

    1987-06-01

    The urinary excretion of ethoxyacetic acid (EAA) was studied in a group of five women daily exposed to the ethyl ether of ethylene glycol (EGEE) and the ethyl ether of ethylene glycol acetate (EGEE-Ac) during 5 d of normal production and 7 d after a 12-d production stop. The mean combined exposure concentration of EGEE and EGEE-Ac (expressed in equivalent weight of EGEE) was 14.0 mg/m3 with occasional slight excursions above the current Belgian occupational exposure limit. The daily combined exposure profiles for EGEE and EGEE-Ac were rather constant during the first observation period, but they tended to decrease during the last week. The urinary EAA excretion clearly increased during the work week. Over the weekends the elimination was far from complete, and even after a prolonged nonexposure period of 12 d traces of the metabolite were still detectable. Based on the observations from the first period, a good linear correlation (r = 0.92) was found between the average exposure over 5 d (14.4 mg/m3) and the EAA excretion at the end of the week (105.7 mg/g creatinine). An EAA estimate of 150 +/- 35 mg/g was found to correspond with repeated 5-d full-shift exposures to the respective occupational exposure limit of EGEE (19 mg/m3) or EGEE-Ac (27 mg/m3).

  14. Presence of repeater F-waves in the early stage of Guillain-Barré syndrome.

    Science.gov (United States)

    Geijo-Barrientos, Emilio; González, Ofelia; Pastore-Olmedo, Carlos

    2012-03-01

    The absence or a prolonged latency of late responses, like F-waves, is a common neurophysiological finding with diagnostic utility in the early Guillain-Barré syndrome. However, the presence and the number of repeater F-waves have not been studied in this disease. In four patients, we report the transient presence of repeater F-waves in nerves of the lower limbs shortly after the onset of the disease. In each patient, the initial (diagnostic) nerve conduction study showed a high incidence of repeater F-waves in the tibial or in the peroneal nerves of one side, with normal distal motor latencies; in the other nerves explored the F-waves were fully abolished and the motor potentials were abnormal. In a second study, done 2-6 weeks later, we observed the abolition of the F-waves or a significant increase of its minimal latency in those nerves in which we had detected the repeaters. The presence of a high number of repeater F-waves with normal latencies in some nerves may be a transient and initial electrophysiological sign useful in the early diagnosis of this disease.

  15. Animation shows promise in initiating timely cardiopulmonary resuscitation: results of a pilot study.

    Science.gov (United States)

    Attin, Mina; Winslow, Katheryn; Smith, Tyler

    2014-04-01

    Delayed responses during cardiac arrest are common. Timely interventions during cardiac arrest have a direct impact on patient survival. Integration of technology in nursing education is crucial to enhance teaching effectiveness. The goal of this study was to investigate the effect of animation on nursing students' response time to cardiac arrest, including initiation of timely chest compression. Nursing students were randomized into experimental and control groups prior to practicing in a high-fidelity simulation laboratory. The experimental group was educated, by discussion and animation, about the importance of starting cardiopulmonary resuscitation upon recognizing an unresponsive patient. Afterward, a discussion session allowed students in the experimental group to gain more in-depth knowledge about the most recent changes in the cardiac resuscitation guidelines from the American Heart Association. A linear mixed model was run to investigate differences in time of response between the experimental and control groups while controlling for differences in those with additional degrees, prior code experience, and basic life support certification. The experimental group had a faster response time compared with the control group and initiated timely cardiopulmonary resuscitation upon recognition of deteriorating conditions (P < .0001). The results demonstrated the efficacy of combined teaching modalities for timely cardiopulmonary resuscitation. Providing opportunities for repetitious practice when a patient's condition is deteriorating is crucial for teaching safe practice.

  16. A microscopic study of crack initiation mechanisms in 7075 aluminum alloy sheets.

    Science.gov (United States)

    Jones, D. L.; Liebowitz, H.

    1973-01-01

    A study of the opening mode of crack initiation in 7075-T6 aluminum alloy sheets has been conducted with the aid of a scanning electron microscope. Observations were made from several orientations, including the top view of the specimen which showed the notch profile and the edge view of the specimen which showed the entire notch front along the specimen thickness. It was found that the edge view exhibited the first signs of permanent deformation at about 55% of the breaking strength. These changes took the form of deformation bands which were aligned in the direction of the tensile axis and apparently defined limiting regions of homogeneous slip. It is felt that the appearance of microcracks at loads approaching the breaking strength was of fundamental importance in the formation of the final fracture surface. Many of these microcraks were initiated at intermetallic particles and other metallurgically weak regions on the notch surface. It was also possible to correlate the strain in the notch with the stress intensity factor for the various loads. Very large plastic strains were observed on the notch tip as compared to published values of elongation at fracture for unnotched specimens.

  17. Time-resolved study of laser initiated shock wave propagation in superfluid 4He

    Science.gov (United States)

    Garcia, Allan; Buelna, Xavier; Popov, Evgeny; Eloranta, Jussi

    2016-09-01

    Intense shock waves in superfluid 4He between 1.7 and 2.1 K are generated by rapidly expanding confined plasma from laser ablation of a metal target immersed in the liquid. The resulting shock fronts in the liquid with initial velocities up to ca. Mach 10 are visualized by time-resolved shadowgraph photography. These high intensity shocks decay within 500 ns into less energetic shock waves traveling at Mach 2, which have their lifetime in the microsecond time scale. Based on the analysis using the classical Rankine-Hugoniot theory, the shock fronts created remain in the solid phase up to 1 μs and the associated thermodynamic state appears outside the previously studied region. The extrapolated initial shock pressure of 0.5 GPa is comparable to typical plasma pressures produced during liquid phase laser ablation. A secondary shock originating from fast heat propagation on the metal surface is also observed and a lower limit estimate for the heat propagation velocity is measured as 7 × 104 m/s. In the long-time limit, the high intensity shocks turn into liquid state waves that propagate near the speed of sound.