WorldWideScience

Sample records for repeated cumulative study

  1. Repeated mild injury causes cumulative damage to hippocampal cells

    NARCIS (Netherlands)

    E.J. Matser (Amy); C.I. de Zeeuw (Chris); J.T. Weber (John)

    2002-01-01

    textabstractAn interesting hypothesis in the study of neurotrauma is that repeated traumatic brain injury may result in cumulative damage to cells of the brain. However, post-injury sequelae are difficult to address at the cellular level in vivo. Therefore, it is necessary to compl

  2. Adaptive and repeated cumulative meta-analyses of safety data during a new drug development process.

    Science.gov (United States)

    Quan, Hui; Ma, Yingqiu; Zheng, Yan; Cho, Meehyung; Lorenzato, Christelle; Hecquet, Carole

    2015-01-01

    During a new drug development process, it is desirable to timely detect potential safety signals. For this purpose, repeated meta-analyses may be performed sequentially on accumulating safety data. Moreover, if the amount of safety data from the originally planned program is not enough to ensure adequate power to test a specific hypothesis (e.g., the noninferiority hypothesis of an event of interest), the total sample size may be increased by adding new studies to the program. Without appropriate adjustment, it is well known that the type I error rate will be inflated because of repeated analyses and sample size adjustment. In this paper, we discuss potential issues associated with adaptive and repeated cumulative meta-analyses of safety data conducted during a drug development process. We consider both frequentist and Bayesian approaches. A new drug development example is used to demonstrate the application of the methods.

  3. Cumulative assessment : Strategic choices to influence students' study effort

    NARCIS (Netherlands)

    Kerdijk, Wouter; Tio, Rene A.; Mulder, B. Florentine; Cohen-Schotanus, Janke

    2013-01-01

    Background: It has been asserted that assessment can and should be used to drive students' learning. In the current study, we present a cumulative assessment program in which test planning, repeated testing and compensation are combined in order to influence study effort. The program is aimed at hel

  4. The effect of camera viewing angle on posture assessment repeatability and cumulative spinal loading.

    Science.gov (United States)

    Sutherland, C A; Albert, W J; Wrigley, A T; Callaghan, J P

    2007-06-01

    Video-based task analysis in the workplace is often limited by equipment location and production line arrangement, therefore making it difficult to capture the motion in a single plane. The purpose of this study was to investigate the effects of camera placement on an observer's ability to accurately assess working postures in three dimensions and the resultant influence on the reliability and repeatability of calculated cumulative loading variables. Four video cameras were placed at viewing angles of 0 degrees, 45 degrees, 60 degrees and 90 degrees to the frontal plane, enabling the simultaneous collection of views of four lifting tasks (two symmetric and two asymmetric). A total of 11 participants were trained in the use of the 3DMatch 3-D posture matching software package (developed at the University of Waterloo) and were required to analyse 16 lifting trials. Four of the participants were randomly selected to return within 72 h and repeat the analysis protocol to test intra-observer repeatability. Posture matching agreement between camera views was higher when the body segments had a minimal range of motion during the task. There was no significant participant main effect; however, there was a significant (p 0.75). Joint anterior shear and joint posterior shear both provided fair to good reliability (0.4 > ICC camera viewing angle on an observer's ability to match working postural exposure was found to be small.

  5. Repeated mild lateral fluid percussion brain injury in the rat causes cumulative long-term behavioral impairments, neuroinflammation, and cortical loss in an animal model of repeated concussion.

    Science.gov (United States)

    Shultz, Sandy R; Bao, Feng; Omana, Vanessa; Chiu, Charlotte; Brown, Arthur; Cain, Donald Peter

    2012-01-20

    There is growing evidence that repeated brain concussion can result in cumulative and long-term behavioral symptoms, neuropathological changes, and neurodegeneration. Little is known about the factors and mechanisms that contribute to these effects. The current study addresses the need to investigate and better understand the effects of repeated concussion through the development of an animal model. Male Long-Evans rats received 1, 3, or 5 mild lateral fluid percussion injuries or sham injuries spaced 5 days apart. After the final injury, rats received either a short (24 h) or long (8 weeks) post-injury recovery period, followed by a detailed behavioral analysis consisting of tests for rodent anxiety-like behavior, cognition, social behavior, sensorimotor function, and depression-like behavior. Brains were examined immunohistochemically to assess neuroinflammation and cortical damage. Rats given 1, 3, or 5 mild percussion injuries displayed significant short-term cognitive impairments. Rats given repeated mild percussion injuries displayed significantly worse short- and long-term cognitive impairments. Rats given 5 mild percussion injuries also displayed increased anxiety- and depression-like behaviors. Neuropathological analysis revealed short-term neuroinflammation in 3-injury rats, and both short- and long-term neuroinflammation in 5-injury rats. There was also evidence that repeated injuries induced short- and long-term cortical damage. These cumulative and long-term changes are consistent with findings in human patients suffering repeated brain concussion, provide support for the use of repeated mild lateral fluid percussion injuries to study repeated concussion in the rat, and suggest that neuroinflammation may be important for understanding the cumulative and chronic effects of repeated concussion.

  6. The cumulative analgesic effect of repeated electroacupuncture involves synaptic remodeling in the hippocampal CA3 region

    Institute of Scientific and Technical Information of China (English)

    Qiuling Xu; Tao Liu; Shuping Chen; Yonghui Gao; Junying Wang; Lina Qiao; Junling Liu

    2012-01-01

    In the present study, we examined the analgesic effect of repeated electroacupuncture at bilateral Zusanli (ST36) and Yanglingquan (GB34) once a day for 14 consecutive days in a rat model of chronic sciatic nerve constriction injury-induced neuropathic pain. In addition, concomitant changes in calcium/calmodulin-dependent protein kinase II expression and synaptic ultrastructure of neurons in the hippocampal CA3 region were examined. The thermal pain threshold (paw withdrawal latency) was increased significantly in both groups at 2 weeks after electroacupuncture intervention compared with 2 days of electroacupuncture. In ovariectomized rats with chronic constriction injury, the analgesic effect was significantly reduced. Electroacupuncture for 2 weeks significantly diminished the injury-induced increase in synaptic cleft width and thinning of the postsynaptic density, and it significantly suppressed the down-regulation of intracellular calcium/ calmodulin-dependent protein kinase II expression in the hippocampal CA3 region. Repeated electroacupuncture intervention had a cumulative analgesic effect on injury-induced neuropathic pain reactions, and it led to synaptic remodeling of hippocampal neurons and upregulated calcium/calmodulin-dependent protein kinase II expression in the hippocampal CA3 region.

  7. Repeated Radionuclide therapy in metastatic paraganglioma leading to the highest reported cumulative activity of 131I-MIBG

    Directory of Open Access Journals (Sweden)

    Ezziddin Samer

    2012-01-01

    Full Text Available Abstract 131I-MIBG therapy for neuroendocrine tumours may be dose limited. The common range of applied cumulative activities is 10-40 GBq. We report the uneventful cumulative administration of 111 GBq (= 3 Ci 131I-MIBG in a patient with metastatic paraganglioma. Ten courses of 131I-MIBG therapy were given within six years, accomplishing symptomatic, hormonal and tumour responses with no serious adverse effects. Chemotherapy with cisplatin/vinblastine/dacarbazine was the final treatment modality with temporary control of disease, but eventually the patient died of progression. The observed cumulative activity of 131I-MIBG represents the highest value reported to our knowledge, and even though 12.6 GBq of 90Y-DOTATOC were added intermediately, no associated relevant bone marrow, hepatic or other toxicity were observed. In an individual attempt to palliate metastatic disease high cumulative activity alone should not preclude the patient from repeat treatment.

  8. A study of cumulative fatigue damage in AISI 4130 steel

    Science.gov (United States)

    Jeelani, S.; Musial, M.

    1986-01-01

    Experimental data were obtained using AISI 4130 steel under stress ratios of -1 and 0. A study of cumulative fatigue damage using Miner's and Kramer's equations for stress ratios of -1 and 0 for low-high, low-high-mixed, high-low, and high-low-mixed stress sequences has revealed that there is a close agreement between the theoretical and experimental values of fatigue damage and fatigue life. Kramer's equation predicts less conservative and more realistic cumulative fatigue damage than the popularly used Miner's rule does.

  9. The cumulative impacts of repeated heavy rainfall, flooding and altered water quality on the high-latitude coral reefs of Hervey Bay, Queensland, Australia.

    Science.gov (United States)

    Butler, I R; Sommer, B; Zann, M; Zhao, J-X; Pandolfi, J M

    2015-07-15

    Terrestrial runoff and flooding have resulted in major impacts on coral communities worldwide, but we lack detailed understanding of flood plume conditions and their ecological effects. Over the course of repeated flooding between 2010 and 2013, we measured coral cover and water quality on the high-latitude coral reefs of Hervey Bay, Queensland, Australia. In 2013, salinity, total suspended solids, total nitrogen and total phosphorus were altered for up to six months post-flooding. Submarine groundwater caused hypo-saline conditions for a further four months. Despite the greater magnitude of flooding in 2013, declines in coral abundance (∼28%) from these floods were lower than the 2011 flood (∼40%), which occurred immediately after a decade of severe drought. There was an overall cumulative decrease of coral by ∼56% from 2010 to 2013. Our study highlights the need for local scale monitoring and research to facilitate informed management and conservation of catchments and marine environments.

  10. Prolonged repeated acupuncture stimulation induces habituation effects in pain-related brain areas: an FMRI study.

    Science.gov (United States)

    Li, Chuanfu; Yang, Jun; Park, Kyungmo; Wu, Hongli; Hu, Sheng; Zhang, Wei; Bu, Junjie; Xu, Chunsheng; Qiu, Bensheng; Zhang, Xiaochu

    2014-01-01

    Most previous studies of brain responses to acupuncture were designed to investigate the acupuncture instant effect while the cumulative effect that should be more important in clinical practice has seldom been discussed. In this study, the neural basis of the acupuncture cumulative effect was analyzed. For this experiment, forty healthy volunteers were recruited, in which more than 40 minutes of repeated acupuncture stimulation was implemented at acupoint Zhusanli (ST36). Three runs of acupuncture fMRI datasets were acquired, with each run consisting of two blocks of acupuncture stimulation. Besides general linear model (GLM) analysis, the cumulative effects of acupuncture were analyzed with analysis of covariance (ANCOVA) to find the association between the brain response and the cumulative duration of acupuncture stimulation in each stimulation block. The experimental results showed that the brain response in the initial stage was the strongest although the brain response to acupuncture was time-variant. In particular, the brain areas that were activated in the first block and the brain areas that demonstrated cumulative effects in the course of repeated acupuncture stimulation overlapped in the pain-related areas, including the bilateral middle cingulate cortex, the bilateral paracentral lobule, the SII, and the right thalamus. Furthermore, the cumulative effects demonstrated bimodal characteristics, i.e. the brain response was positive at the beginning, and became negative at the end. It was suggested that the cumulative effect of repeated acupuncture stimulation was consistent with the characteristic of habituation effects. This finding may explain the neurophysiologic mechanism underlying acupuncture analgesia.

  11. Prolonged repeated acupuncture stimulation induces habituation effects in pain-related brain areas: an FMRI study.

    Directory of Open Access Journals (Sweden)

    Chuanfu Li

    Full Text Available Most previous studies of brain responses to acupuncture were designed to investigate the acupuncture instant effect while the cumulative effect that should be more important in clinical practice has seldom been discussed. In this study, the neural basis of the acupuncture cumulative effect was analyzed. For this experiment, forty healthy volunteers were recruited, in which more than 40 minutes of repeated acupuncture stimulation was implemented at acupoint Zhusanli (ST36. Three runs of acupuncture fMRI datasets were acquired, with each run consisting of two blocks of acupuncture stimulation. Besides general linear model (GLM analysis, the cumulative effects of acupuncture were analyzed with analysis of covariance (ANCOVA to find the association between the brain response and the cumulative duration of acupuncture stimulation in each stimulation block. The experimental results showed that the brain response in the initial stage was the strongest although the brain response to acupuncture was time-variant. In particular, the brain areas that were activated in the first block and the brain areas that demonstrated cumulative effects in the course of repeated acupuncture stimulation overlapped in the pain-related areas, including the bilateral middle cingulate cortex, the bilateral paracentral lobule, the SII, and the right thalamus. Furthermore, the cumulative effects demonstrated bimodal characteristics, i.e. the brain response was positive at the beginning, and became negative at the end. It was suggested that the cumulative effect of repeated acupuncture stimulation was consistent with the characteristic of habituation effects. This finding may explain the neurophysiologic mechanism underlying acupuncture analgesia.

  12. Ten-year cumulative incidence of diabetic retinopathy. The Beijing Eye Study 2001/2011.

    Directory of Open Access Journals (Sweden)

    Jie Xu

    Full Text Available To assess the cumulative 10-year incidence of diabetic retinopathy (DR and its associated factors in a population living in Greater Beijing.The population-based longitudinal Beijing Eye Study, which included 4439 subjects (age in 2001: 40+years in 2001, was repeated in 2011 with 2695 subjects participating (66.4% of the survivors. The study participants underwent a detailed ophthalmic examination. Fundus photographs were examined for the new development of DR.After excluding individuals with DR at baseline (n = 87 or no sufficient fundus photographs in 2011 (n = 6, the study included 2602 subjects with a mean age of 64.6±9.7 years (median: 64.0 years; range: 50 to 93 years. In the 10-year period, 109 subjects (39 men developed new DR with an incidence of 4.2% (95% confidence interval (CI: 3.45,5.03. In multiple logistic regression analysis, incident DR was significantly associated with higher HbA1c value (P<0.001; Odds Ratio (OR: 1.73; 95% Confidence Interval (CI: 1.35,2.21, longer duration of diabetes mellitus (P<0.001; OR: 1.16; 95% CI: 1.10,1.22, higher serum concentration of creatinine (P = 0.02; OR: 1.01; 95% CI: 1.002,1.022, lower educational level (P = 0.049; OR: 0.74; 95% CI: 0.55,0.99, higher estimated cerebrospinal fluid pressure (P = 0.038; OR: 1.10; 95% CI: 1.01,1.22, and shorter axial length (P<0.001; OR: 0.48; 95% CI: 0.33,0.71.The cumulative 10-year incidence (mean: 4.2% of DR in a North Chinese population was significantly associated with a higher HbA1c value, longer known duration of diabetes mellitus, higher estimated CSFP and shorter axial length (P<0.001. Shorter axial length (or hyperopia and, potentially, higher CSFP may be additional risk factors to be taken into account when counseling and treating patients with diabetes mellitus.

  13. CEAMF study, volume 2 : cumulative effects indicators, thresholds, and case studies : final

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2003-03-01

    The four types of cumulative effects on the environment are: alteration, loss, and fragmentation of habitat; disturbance; barriers to movement; and direct and indirect mortality. Defining where and how human activities can be continued without irreversible net harm to the environment is part of cumulative effects management. Various land-use and habitat indicators were tested in the Blueberry and Sukunka study areas of British Columbia, to address the environmental effects associated with oil and gas development. As recommended, a tiered threshold approach was used to allow for flexibility in different land management regimes and ecological settings. Success will depend on defining acceptable change, threshold values, standard public database, standard processes to calculate indicator values using the database, and project-specific and cooperative management actions. A pilot study was suggested to test the candidate thresholds and implementation process. The two areas proposed for consideration were the Jedney Enhanced Resource Development Resource Management Zone in the Fort St. John Forest District, and the Etsho Enhanced Resource Development Resource Management Zone in the Fort Nelson Forest District. Both are of interest to the petroleum and forest sectors, and support the woodland caribou, a species which is extremely sensitive to cumulative effects of habitat fragmentation and disturbance. 117 refs., 11 tabs., 39 figs.

  14. Measurement error correction for the cumulative average model in the survival analysis of nutritional data: application to Nurses' Health Study.

    Science.gov (United States)

    Qiu, Weiliang; Rosner, Bernard

    2010-01-01

    The use of the cumulative average model to investigate the association between disease incidence and repeated measurements of exposures in medical follow-up studies can be dated back to the 1960s (Kahn and Dawber, J Chron Dis 19:611-620, 1966). This model takes advantage of all prior data and thus should provide a statistically more powerful test of disease-exposure associations. Measurement error in covariates is common for medical follow-up studies. Many methods have been proposed to correct for measurement error. To the best of our knowledge, no methods have been proposed yet to correct for measurement error in the cumulative average model. In this article, we propose a regression calibration approach to correct relative risk estimates for measurement error. The approach is illustrated with data from the Nurses' Health Study relating incident breast cancer between 1980 and 2002 to time-dependent measures of calorie-adjusted saturated fat intake, controlling for total caloric intake, alcohol intake, and baseline age.

  15. Cumulative Advantage in the Skill Development of STEM Graduate Students: A Mixed-Methods Study

    Science.gov (United States)

    Feldon, David F.; Maher, Michelle A.; Roksa, Josipa; Peugh, James

    2016-01-01

    Studies of skill development often describe a process of cumulative advantage, in which small differences in initial skill compound over time, leading to increasing skill gaps between those with an initial advantage and those without. We offer evidence of a similar phenomenon accounting for differential patterns of research skill development in…

  16. Cumulative versus end-of-course assessment : effects on self-study time and test performance

    NARCIS (Netherlands)

    Kerdijk, Wouter; Cohen-Schotanus, Janke; Mulder, B. Florentine; Muntinghe, Friso L. H.; Tio, Rene A.

    2015-01-01

    ContextStudents tend to postpone preparation for a test until the test is imminent, which raises various risks associated with cramming' behaviours, including that for suboptimal learning. Cumulative assessment utilises spaced testing to stimulate students to study more frequently and to prevent pro

  17. Cumulative incidence of childhood autism: a total population study of better accuracy and precision.

    Science.gov (United States)

    Honda, Hideo; Shimizu, Yasuo; Imai, Miho; Nitto, Yukari

    2005-01-01

    Most studies on the frequency of autism have had methodological problems. Most notable of these have been differences in diagnostic criteria between studies, degree of cases overlooked by the initial screening, and type of measurement. This study aimed to replicate the first report on childhood autism to address cumulative incidence as well as prevalence, as defined in the International Statistical Classification of Diseases and Related Health Problems, 10th revision (ICD-10) Diagnostic Criteria for Research. Here, the same methodological accuracy (exactness of a measurement to the true value) as the first study was used, but population size was four times larger to achieve greater precision (reduction of random error). A community-oriented system of early detection and early intervention for developmental disorders was established in the northern part of Yokohama, Japan. The city's routine health checkup for 18-month-old children served as the initial mass screening, and all facilities that provided child care services aimed to detect all cases of childhood autism and refer them to the Yokohama Rehabilitation Center. Cumulative incidence up to age 5 years was calculated for childhood autism among a birth cohort from four successive years (1988 to 1991). Cumulative incidence of childhood autism was 27.2 per 10000. Cumulative incidences by sex were 38.4 per 10000 in males, and 15.5 per 10000 in females. The male:female ratio was 2.5:1. The proportions of children with high-functioning autism who had Binet IQs of 70 and over and those with Binet IQs of 85 and over were 25.3% and 13.7% respectively. Data on cumulative incidence of childhood autism derived from this study are the first to be drawn from an accurate, as well as precise, screening methodology.

  18. Studying cumulative ozone exposures in Europe during a 7-year period

    Science.gov (United States)

    Bastrup-Birk, Annemarie; Brandt, JøRgen; Zlatev, Zahari; Uria, Ignacio

    1997-10-01

    Ozone is one of the most harmful pollutants in the troposphere. High ozone concentrations can damage plants, animals and humans. The damaging effects depend on the magnitude of a critical level of a special parameter, the cumulative ozone exposure. This is why cumulative ozone exposures must be carefully studied. It is important to determine the relationships between relevant emissions (NOx emissions, human-made VOC emissions, and/or a combination of NOx emissions and human-made VOC emissions) and cumulative ozone exposures. All these issues are discussed in this paper. Meteorological data from seven consecutive years, from 1989 to 1995, have been used in the experiments with different scenarios for varying the emissions (the NOx emissions, the human-made VOC emissions, as well as both the NOx emissions and the human-made VOC emissions). The particular air pollution model used in this study is the Danish Eulerian Model. Several hundred runs with different input data (meteorological data and/or emission data) have been performed. Advanced visualization techniques are used to interpret the large amount of digital data collected in these runs and to show clearly different trends and relationships that are normally hidden behind millions and millions of numbers. The model results were compared with measurements taken at more than 80 stations located in different European countries. The experiments indicate that it is sufficient to carry out computations over 5 consecutive years in order to eliminate the influence of extreme meteorological conditions (very warm or very cold summer months) on the cumulative ozone exposures, while this effect is clearly seen if less than 5 years are used in the experiments. It is shown that the relationship between the emissions (NOx and/or human-made VOC emissions) and the cumulative ozone exposures is in general nonlinear. Finally, it is illustrated that the critical values for ozone exposures are exceeded in most of Europe (in many

  19. Role of sulfite additives in wine induced asthma: single dose and cumulative dose studies

    OpenAIRE

    Vally, H; Thompson, P.

    2001-01-01

    BACKGROUND—Wine appears to be a significant trigger for asthma. Although sulfite additives have been implicated as a major cause of wine induced asthma, direct evidence is limited. Two studies were undertaken to assess sulfite reactivity in wine sensitive asthmatics. The first study assessed sensitivity to sulfites in wine using a single dose sulfited wine challenge protocol followed by a double blind, placebo controlled challenge. In the second study a cumulative dose su...

  20. Prolonged Repeated Acupuncture Stimulation Induces Habituation Effects in Pain-Related Brain Areas: An fMRI Study

    Science.gov (United States)

    Li, Chuanfu; Yang, Jun; Park, Kyungmo; Wu, Hongli; Hu, Sheng; Zhang, Wei; Bu, Junjie; Xu, Chunsheng; Qiu, Bensheng; Zhang, Xiaochu

    2014-01-01

    Most previous studies of brain responses to acupuncture were designed to investigate the acupuncture instant effect while the cumulative effect that should be more important in clinical practice has seldom been discussed. In this study, the neural basis of the acupuncture cumulative effect was analyzed. For this experiment, forty healthy volunteers were recruited, in which more than 40 minutes of repeated acupuncture stimulation was implemented at acupoint Zhusanli (ST36). Three runs of acupuncture fMRI datasets were acquired, with each run consisting of two blocks of acupuncture stimulation. Besides general linear model (GLM) analysis, the cumulative effects of acupuncture were analyzed with analysis of covariance (ANCOVA) to find the association between the brain response and the cumulative duration of acupuncture stimulation in each stimulation block. The experimental results showed that the brain response in the initial stage was the strongest although the brain response to acupuncture was time-variant. In particular, the brain areas that were activated in the first block and the brain areas that demonstrated cumulative effects in the course of repeated acupuncture stimulation overlapped in the pain-related areas, including the bilateral middle cingulate cortex, the bilateral paracentral lobule, the SII, and the right thalamus. Furthermore, the cumulative effects demonstrated bimodal characteristics, i.e. the brain response was positive at the beginning, and became negative at the end. It was suggested that the cumulative effect of repeated acupuncture stimulation was consistent with the characteristic of habituation effects. This finding may explain the neurophysiologic mechanism underlying acupuncture analgesia. PMID:24821143

  1. Cumulative Prevalence of Psychiatric Disorders by Young Adulthood: A Prospective Cohort Analysis From the Great Smoky Mountains Study

    Science.gov (United States)

    Copeland, William; Shanahan, Lilly; Costello, E. Jane; Angold, Adrian

    2011-01-01

    Objective: No longitudinal studies beginning in childhood have estimated the cumulative prevalence of psychiatric illness from childhood into young adulthood. The objective of this study was to estimate the cumulative prevalence of psychiatric disorders by young adulthood and to assess how inclusion of not otherwise specified diagnoses affects…

  2. A prospective study of cumulative job stress in relation to mental health

    Science.gov (United States)

    Godin, Isabelle; Kittel, France; Coppieters, Yves; Siegrist, Johannes

    2005-01-01

    Background This study tests associations between psychosocial stress at work measured by the effort-reward imbalance model in a dynamic perspective, and multiple indicators of poor mental health, in a prospective design. Methods 1986 male and female employees from four Belgian enterprises were followed-up over one year within the framework of the Somstress study. Based on two consecutive measurements, an index of cumulative job stress was constructed and its associations with five indicators of mental health were studied, excluding caseness at entry (for depression, anxiety, somatisation, chronic fatigue and psychotropic drug consumption respectively). Taking into account the longitudinal design, four categories of job stress are defined: 1) employees free from stress at both measures, 2) job stress present at first measure but not at the second one, 3) recent onset of job stress as evidenced by second measure 4) workers exposed to stress at both measures. Multivariate logistic regression with appropriate adjustments was applied. Results In bivariate analysis, a clear graded association of cumulative job stress with all five mental health indicators is observed, both in men and women. In multivariate logistic regression analysis, recent onset of stress is strongly associated with poor mental health among men (odds ratios ranging from 1.8 to 4.6), while cumulative stress shows strongest effects on mental health in women (odds ratios ranging from 1.4 to 7.1). Conclusion Cumulative experience and recent onset of job stress in terms of high effort spent and low reward received is associated with elevated risk of all five indicators of poor mental health at follow-up in a large cohort of employees. PMID:15958170

  3. A prospective study of cumulative job stress in relation to mental health

    Directory of Open Access Journals (Sweden)

    Coppieters Yves

    2005-06-01

    Full Text Available Abstract Background This study tests associations between psychosocial stress at work measured by the effort-reward imbalance model in a dynamic perspective, and multiple indicators of poor mental health, in a prospective design. Methods 1986 male and female employees from four Belgian enterprises were followed-up over one year within the framework of the Somstress study. Based on two consecutive measurements, an index of cumulative job stress was constructed and its associations with five indicators of mental health were studied, excluding caseness at entry (for depression, anxiety, somatisation, chronic fatigue and psychotropic drug consumption respectively. Taking into account the longitudinal design, four categories of job stress are defined: 1 employees free from stress at both measures, 2 job stress present at first measure but not at the second one, 3 recent onset of job stress as evidenced by second measure 4 workers exposed to stress at both measures. Multivariate logistic regression with appropriate adjustments was applied. Results In bivariate analysis, a clear graded association of cumulative job stress with all five mental health indicators is observed, both in men and women. In multivariate logistic regression analysis, recent onset of stress is strongly associated with poor mental health among men (odds ratios ranging from 1.8 to 4.6, while cumulative stress shows strongest effects on mental health in women (odds ratios ranging from 1.4 to 7.1. Conclusion Cumulative experience and recent onset of job stress in terms of high effort spent and low reward received is associated with elevated risk of all five indicators of poor mental health at follow-up in a large cohort of employees.

  4. Cumulative glycemia and microangiopathy in subjects with impaired glucose regulation in the Inter99 study

    DEFF Research Database (Denmark)

    Munch, Inger Christine; Larsen, Michael; Kessel, Line

    2011-01-01

    participants. RESULTS: Lens fluorescence, a quantitative index of life-long cumulative glycemia, was increased by 7.5% (CI(95) 0.37-15.1%) in subjects with impaired fasting glucose, by 13.0% (CI(95) 5.5-21%) in subjects with combined impaired fasting glucose and impaired glucose tolerance (IFG+IGT), and by 11......AIMS: To assess cumulative glycemia, microvascular characteristics, and associated risk factors for diabetes in subjects with impaired glucose regulation. METHODS: Cross-sectional, population-based study comprising systemic characteristics in 6487 participants and ocular characteristics in 970.......8% (CI(95) 6.8-17.1%) in subjects with screen-detected diabetes compared to normoglycemic subjects, adjusted for age, sex, and smoking. The prevalences of microalbuminuria and retinopathy were significantly increased in subjects with screen-detected diabetes after adjusting for age, sex and systolic...

  5. Race, Space, and Cumulative Disadvantage: A Case Study of the Subprime Lending Collapse.

    Science.gov (United States)

    Rugh, Jacob S; Albright, Len; Massey, Douglas S

    2015-05-01

    In this article, we describe how residential segregation and individual racial disparities generate racialized patterns of subprime lending and lead to financial loss among black borrowers in segregated cities. We conceptualize race as a cumulative disadvantage because of its direct and indirect effects on socioeconomic status at the individual and neighborhood levels, with consequences that reverberate across a borrower's life and between generations. Using Baltimore, Maryland as a case study setting, we combine data from reports filed under the Home Mortgage Disclosure Act with additional loan-level data from mortgage-backed securities. We find that race and neighborhood racial segregation are critical factors explaining black disadvantage across successive stages in the process of lending and foreclosure, controlling for differences in borrower credit scores, income, occupancy status, and loan-to-value ratios. We analyze the cumulative cost of predatory lending to black borrowers in terms of reduced disposable income and lost wealth. We find the cost to be substantial. Black borrowers paid an estimated additional 5 to 11 percent in monthly payments and those that completed foreclosure in the sample lost an excess of $2 million in home equity. These costs were magnified in mostly black neighborhoods and in turn heavily concentrated in communities of color. By elucidating the mechanisms that link black segregation to discrimination we demonstrate how processes of cumulative disadvantage continue to undermine black socioeconomic status in the United States today.

  6. A nationwide, population-based, long-term follow-up study of repeated self-harm in Taiwan

    Directory of Open Access Journals (Sweden)

    Chung Chi-Hsiang

    2012-09-01

    Full Text Available Abstract Background Previous follow-up studies of repeated self-harm show that the cumulative risk of repeated self-harm within one year is 5.7%–15%, with females at greatest risk. However, relatively few studies have focused on the Far East. The objective of this study was to calculate the cumulative risk of repeated self-harm over different lengths of follow-up time (3 months, 6 months, and 1–8 years, to determine factors influencing repeated self-harm and to explore the interaction between gender and self-harm methods. Methods We used self-harm patient who hospitalized due to first-time self-harm between 2000 and 2007 from 1,230 hospitals in Taiwan. Hospitalization for repeated self-harm among members of this cohort was tracked after 3 months, 6 months, and 1–8 years. Tracking continued until December 31, 2008. We analyzed the cumulative risk and risk factors of repeated self-harm by using negative binomial regression. Results Of the 39,875 individual study samples, 3,388 individuals (8.50% were found to have repeatedly self-harmed. The cumulative risk of repeated self-harm within three months was 7.19% and within one year was 8%. Within 8 years, it was 8.70%. Females were more likely to repeatedly self-harm than males (RR = 1.21, 95% CI = 1.15–1.76. The main method of self-harm was solid or liquid substances (RR = 1.88, 95% CI = 1.23–2.04 or cutting or piercing (RR = 1.36, 95% CI = 1.02–1.82, and in patients with psychiatric disorders were more likely to self-harm (RR = 1.61, 95% CI = 1.48–1.75. Conclusions The key time for intervention for repeated self-harm is within three months. Appropriate prevention programs should be developed based on gender differences.

  7. Analysis of repeated outcome measures from longitudinal studies

    Institute of Scientific and Technical Information of China (English)

    Yuanjia WANG; Naihua DUAN

    2011-01-01

    @@ In many clinical studies repeated measurements of an outcome are collected over time.For example,in an 8-week study of treatment for obsessive compulsive disorder,the severity of the disorder may be measured weekly using the Yale-Brown-Obsessive-Compulsive-Disorder-Scale (YBOCS).For each study participant who completes the study,there will be nine repeated measures of YBOCS (a baseline assessment plus eight assessments during the course of treatment).Such a study in which participants are followed and measured repeatedly over time is called a longitudinal study and the resulting data are called longitudinal data.

  8. Percent relative cumulative frequency analysis in indirect calorimetry: application to studies of transgenic mice.

    Science.gov (United States)

    Riachi, Marc; Himms-Hagen, Jean; Harper, Mary-Ellen

    2004-12-01

    Indirect calorimetry is commonly used in research and clinical settings to assess characteristics of energy expenditure. Respiration chambers in indirect calorimetry allow measurements over long periods of time (e.g., hours to days) and thus the collection of large sets of data. Current methods of data analysis usually involve the extraction of only a selected small proportion of data, most commonly the data that reflects resting metabolic rate. Here, we describe a simple quantitative approach for the analysis of large data sets that is capable of detecting small differences in energy metabolism. We refer to it as the percent relative cumulative frequency (PRCF) approach and have applied it to the study of uncoupling protein-1 (UCP1) deficient and control mice. The approach involves sorting data in ascending order, calculating their cumulative frequency, and expressing the frequencies in the form of percentile curves. Results demonstrate the sensitivity of the PRCF approach for analyses of oxygen consumption (.VO2) as well as respiratory exchange ratio data. Statistical comparisons of PRCF curves are based on the 50th percentile values and curve slopes (H values). The application of the PRCF approach revealed that energy expenditure in UCP1-deficient mice housed and studied at room temperature (24 degrees C) is on average 10% lower (p calorimetry is increasingly used, and the PRCF approach provides a novel and powerful means for data analysis.

  9. Retrospective study of cumulative diagnostic radiation exposure during childhood in patients with spina bifida.

    Science.gov (United States)

    Smookler, Gregory; Deavenport-Saman, Alexis

    2015-10-01

    The Biological Effects of Ionizing Radiation Committee of the National Academy of Sciences in 2005 and other expert panels have warned that risk of cancer increases with higher doses of radiation. Children with spina bifida and hydrocephalus have far greater exposure to radiation than the average person, starting almost directly after birth and continuing throughout their lifetimes. The purpose of this study was to estimate the amount of ionizing radiation that patients with spina bifida and hydrocephalus are exposed to during childhood from diagnostic imaging. Thirty patients, ages 18 years or older, with spina bifida and hydrocephalus were randomly selected from a spina bifida clinic and their radiology records were reviewed. Descriptive analyses were conducted. The total radiation exposure was then calculated for the study group, and the mean effective dose per patient was determined. In the study group, during their first 18 years, each patient had a mean of 55.1 studies and a median of 45 radiologic studies, a mean of 9.6 brain CT scans, and a mean cumulative effective dose of 81.9 mSv (2.6 mSv/patient/year over 18 years) and a median cumulative effective dose of 77.2 mSV of accumulated radiation exposure (4.5 mSv/patient/year over 18 years). Clinicians should recognize that increased radiation exposure puts patients with spina bifida and hydrocephalus at higher risk for cancer. The population of children and adults with spina bifida and hydrocephalus should be surveyed for incidence of cancer. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Cumulative beam break-up study of the spallation neutron source superconducting linac

    CERN Document Server

    Jeon, D; Krafft, G A; Yunn, B; Sundelin, R; Delayen, J; Kim, S; Doleans, M

    2002-01-01

    Beam instabilities due to High Order Modes (HOMs) are a concern to superconducting (SC) linacs such as the Spallation Neutron Source (SNS) linac. The effects of pulsed mode operation on transverse and longitudinal beam breakup instability are studied for H sup - beam in a consistent manner for the first time. Numerical simulation indicates that cumulative transverse beam breakup instabilities are not a concern in the SNS SC linac, primarily due to the heavy mass of H sup - beam and the HOM frequency spread resulting from manufacturing tolerances. As little as +-0.1 MHz HOM frequency spread stabilizes all the instabilities from both transverse HOMs, and also acts to stabilize the longitudinal HOMs. Such an assumed frequency spread of +-0.1 MHz HOM is small, and hence conservative compared with measured values of sigma=0.00109(f sub H sub O sub M -f sub 0)/f sub 0 obtained from Cornell and the Jefferson Lab Free Electron Laser cavities. However, a few cavities may hit resonance lines and generate a high heat lo...

  11. A Longitudinal Study of Reading Comprehension Achievement from Grades 3 to 10: Investigating Models of Stability, Cumulative Growth, and Compensation

    Science.gov (United States)

    Kwiatkowska-White, Bozena; Kirby, John R.; Lee, Elizabeth A.

    2016-01-01

    This longitudinal study of 78 Canadian English-speaking students examined the applicability of the stability, cumulative, and compensatory models in reading comprehension development. Archival government-mandated assessments of reading comprehension at Grades 3, 6, and 10, and the Canadian Test of Basic Skills measure of reading comprehension…

  12. Serious, Minor, and Non-Delinquents in Early Adolescence : The Impact of Cumulative Risk and Promotive Factors. The TRAILS Study

    NARCIS (Netherlands)

    van der Laan, A.M.; Veenstra, R.; Bogaerts, S.; Verhulst, F.C.; Ormel, J.

    2010-01-01

    This study uses a social-ecological approach to the development of delinquency. The authors emphasize that a balance between eliminating risk and enhancing protection across domains is essential in reducing problems and promoting competence. The cumulative risk and promotive effects of temperament,

  13. A Longitudinal Study of Reading Comprehension Achievement from Grades 3 to 10: Investigating Models of Stability, Cumulative Growth, and Compensation

    Science.gov (United States)

    Kwiatkowska-White, Bozena; Kirby, John R.; Lee, Elizabeth A.

    2016-01-01

    This longitudinal study of 78 Canadian English-speaking students examined the applicability of the stability, cumulative, and compensatory models in reading comprehension development. Archival government-mandated assessments of reading comprehension at Grades 3, 6, and 10, and the Canadian Test of Basic Skills measure of reading comprehension…

  14. The Interacting Axes of Environmental, Health, and Social Justice Cumulative Impacts: A Case Study of the Blueberry River First Nations.

    Science.gov (United States)

    Gislason, Maya K; Andersen, Holly K

    2016-10-18

    We consider the case of intensive resource extractive projects in the Blueberry River First Nations in Northern British Columbia, Canada, as a case study. Drawing on the parallels between concepts of cumulative environmental and cumulative health impacts, we highlight three axes along which to gauge the effects of intensive extraction projects. These are environmental, health, and social justice axes. Using an intersectional analysis highlights the way in which using individual indicators to measure impact, rather than considering cumulative effects, hides the full extent by which the affected First Nations communities are impacted by intensive extraction projects. We use the case study to contemplate several mechanisms at the intersection of these axes whereby the negative effects of each not only add but also amplify through their interactions. For example, direct impact along the environmental axis indirectly amplifies other health and social justice impacts separately from the direct impacts on those axes. We conclude there is significant work still to be done to use cumulative indicators to study the impacts of extractive industry projects-like liquefied natural gas-on peoples, environments, and health.

  15. The Interacting Axes of Environmental, Health, and Social Justice Cumulative Impacts: A Case Study of the Blueberry River First Nations

    Directory of Open Access Journals (Sweden)

    Maya K Gislason

    2016-10-01

    Full Text Available We consider the case of intensive resource extractive projects in the Blueberry River First Nations in Northern British Columbia, Canada, as a case study. Drawing on the parallels between concepts of cumulative environmental and cumulative health impacts, we highlight three axes along which to gauge the effects of intensive extraction projects. These are environmental, health, and social justice axes. Using an intersectional analysis highlights the way in which using individual indicators to measure impact, rather than considering cumulative effects, hides the full extent by which the affected First Nations communities are impacted by intensive extraction projects. We use the case study to contemplate several mechanisms at the intersection of these axes whereby the negative effects of each not only add but also amplify through their interactions. For example, direct impact along the environmental axis indirectly amplifies other health and social justice impacts separately from the direct impacts on those axes. We conclude there is significant work still to be done to use cumulative indicators to study the impacts of extractive industry projects—like liquefied natural gas—on peoples, environments, and health.

  16. Cumulative Vulnerability: A Case Study on intrafamilial violence, Drug Addiction and Adolescent Pregnancy.

    Science.gov (United States)

    Miura, Paula Orchiucci; Passarini, Gislaine Martins Ricardo; Ferreira, Loraine Seixas; Paixão, Rui Alexandre Paquete; Tardivo, Leila Salomão de La Plata Cury; Barrientos, Dora Mariela Salcedo

    2014-12-01

    A pregnant adolescent's vulnerability increases when she is a victim of intrafamilial violence and drug addiction, which cause physical and biopsychosocial damage to the mother and her baby. Objective Present and analyze the case of an adolescent who is addicted to drugs, pregnant and the victim of lifelong intrafamilial violence. Method A case study based on a semi-structured interview conducted in the Obstetrics Emergency Unit at the Teaching Hospital of the University of São Paulo. The data were interpreted and analyzed using Content Analysis. Results intrafamilial violence experienced at the beginning of the adolescent's early relationships seriously affected her emotional maturity, triggering the development of psychopathologies and leaving her more susceptible to the use and abuse of alcohol and other drugs. The adolescent is repeating her history with her daughter, reproducing the cycle of violence. Conclusion Adolescent pregnancy combined with intrafamilial violence and drug addiction and multiplies the adolescent's psychosocial vulnerability increased the adolescent's vulnerability.

  17. Associations of cumulative Pb exposure and longitudinal changes in Mini-Mental Status Exam scores, global cognition and domains of cognition: The VA Normative Aging Study.

    Science.gov (United States)

    Farooqui, Zishaan; Bakulski, Kelly M; Power, Melinda C; Weisskopf, Marc G; Sparrow, David; Spiro, Avron; Vokonas, Pantel S; Nie, Linda H; Hu, Howard; Park, Sung Kyun

    2017-01-01

    Lead (Pb) exposure has been associated with poorer cognitive function cross-sectionally in aging adults, however the association between cumulative Pb exposure and longitudinal changes in cognition is little characterized. In a 1993-2007 subcohort of the VA Normative Aging Study (Mini-mental status exam (MMSE) n=741; global cognition summary score n=715), we used linear mixed effects models to test associations between cumulative Pb exposure (patella or tibia bone Pb) and repeated measures of cognition (MMSE, individual cognitive tests, and global cognition summary). Cox proportional hazard modeling assessed the risk of an MMSE score falling below 25. Among men 51-98 at baseline, higher patella Pb concentration (IQR: 21μg/g) was associated with -0.13 lower baseline MMSE (95% CI: -0.25, -0.004) and faster longitudinal MMSE decline (-0.016 units/year, 95% CI: -0.032, -0.0004) over 15 years. Each IQR increase in patella Pb was associated with increased risk of a MMSE score below 25 (HR=1.21, 95% CI: 0.99, 1.49; p=0.07). There were no significant associations between Pb and global cognition (both baseline and longitudinal change). Patella Pb was associated with faster longitudinal decline in Word List Total Recall in the language domain (0.014 units/year, 95% CI: -0.026, -0.001) and Word List Delayed Recall in the memory domain (0.014 units/year, 95% CI: -0.027, -0.002). We found weaker associations with tibia Pb. Cumulative Pb exposure is associated with faster declines in MMSE and Word List Total and Delayed Recall tests. These findings support the hypothesis that Pb exposure accelerates cognitive aging. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Repeat colonoscopy after a colonoscopy with a negative result in Ontario: a population-based cohort study.

    Science.gov (United States)

    Hol, Lieke; Sutradhar, Rinku; Gu, Sumei; Baxter, Nancy N; Rabeneck, Linda; Tinmouth, Jill M; Paszat, Lawrence F

    2015-01-01

    Data suggest the overuse of repeat colonoscopies, especially in patients at low risk for colorectal cancer. Our objective was to evaluate the time to repeat colonoscopies in low-risk patients aged 50-79 years old and the associated patient- and endoscopist-related factors. All patients aged 50-79 years of age who underwent a complete outpatient colonoscopy with a negative result between 2000 and 2007 were identified from the Ontario Health Insurance Plan database. A colonoscopy performed within 5.5 years of follow-up after the index colonoscopy was considered an early repeat colonoscopy. Patient, endoscopist and endoscopy setting characteristics were recorded and their association with an early repeat colonoscopy was determined using an extended Cox proportional hazards regression model. The cohort consisted of 546 467 patients: 55.4% of the patients were female with a mean age of 61.1 years (95% confidence interval [CI] 61.1-61.2). The cumulative percentage of early repeat colonoscopy after 5.5 years was 33.7%. The rate decreased significantly between 2000 and 2007 (hazard ratio [HR] 0.35, 95% CI 0.34-0.36). General surgeons were associated with a higher risk of early repeat colonoscopy than gastroenterologists (HR 1.27, 95% CI 1.25-1.28). Endoscopists practising in a nonhospital setting were more likely to perform an early repeat colonoscopy (HR 1.26, 95% CI 1.22-1.30) than endoscopists at a hospital. This study showed that there was overuse of early repeat colonoscopy in more than 30% of patients who were at low risk for colorectal cancer. The risk decreased significantly between 2000 and 2007 but was still greater than 20% in 2007. Our findings can be used to develop targeted educational interventions among subgroups of endoscopists with a higher rate of early repeat colonoscopy.

  19. Successive failure, repeat entrepreneurship and no learning: A case study

    Directory of Open Access Journals (Sweden)

    Marius Pretorius

    2011-02-01

    Full Text Available Orientation: Current theories of repeat entrepreneurship provide little explanation for the effect of failure as a ‘trigger’ for creating successive ventures or learning from repeated failures. Research purpose: This study attempts to establish the role of previous failures on the ventures that follow them and to determine the process of learning from successive failures.Motivation for the study: Successive failures offer potentially valuable insights into the relationship between failures on the ventures that follow and the process of learning from failure.Research design, approach and method: The researchers investigated a single case study of one entrepreneur’s successive failures over 20 years.Main findings: Although the causes varied, all the failures had fundamental similarities. This suggested that the entrepreneur had not learnt from them. The previous failures did not trigger the subsequent ventures. Instead, they played a role in causing the failures. Learning from failure does not happen immediately but requires deliberate reflection. Deliberate reflection is a prerequisite for learning from failure as the entrepreneur repeated similar mistakes time after time until he reflected on each failure.Practical/managerial implications: It confirms that failure is a part of entrepreneurial endeavours. However, learning from it requires deliberate reflection. Failure does not ‘trigger’ the next venture and educators should note this.Contribution/value-add: Knowing the effect of failure on consecutive ventures may help us to understand the development of prototypes (mental frameworks and expand the theory about entrepreneurial prototype categories.

  20. Fur-bearers in the field : study examines cumulative effects of activity at Chinchaga

    Energy Technology Data Exchange (ETDEWEB)

    Jaremko, D.

    2005-08-01

    The challenges facing the oil and gas industry regarding cumulative environmental impacts were discussed. This issue has become important to the oil and gas industry, particularly as communities, governments, environmental groups and investors seek better understanding of the long-term consequences of development and how its effects can be mitigated. Long-term studies and baseline data are important. For the last 8 winters, Ernst Environmental Services (EES) has conducted wildlife monitoring at Chinchaga, which straddles the border between north-Western Alberta and northeastern British Columbia (BC). The area has been described as one of the last boreal wilderness areas in the province. It also has a very rich oil field. There are now more than 140 wells, and this boom has brought along much associated infrastructure, including pipelines, winter roads and a gas plant on the BC side. Each winter, as activity increases, EES uses snow-tracking, photo documentation, remote-camera monitoring and scat collection to capture data about the effects of drilling activities. Scat is collected for stress-level analysis. Although initial studies indicate that wolverines have not been displaced by oil and gas activity, new data has shown that wolverines have returned to territories where oil and gas activity has stopped. Data continues to support the idea that activity does not displace moose, marten, lynx or fisher populations. Using this data, the EES has made several recommendations about wildlife and industry interactions, including no use of recreational vehicles; no harassment of wildlife; the restriction of engine retarder brakes in specified areas; and no idling of vehicles. Additionally, well sites should not be located in old-growth areas, all activities should stop by March 15, and workers should be educated about the consequences of their actions. Controversies concerning the EES's methods were presented. It was suggested that the inefficacy of the procedure was

  1. Repeating tests: different roles in research studies and clinical medicine.

    Science.gov (United States)

    Monach, Paul A

    2012-10-01

    Researchers often decide whether to average multiple results in order to produce more precise data, and clinicians often decide whether to repeat a laboratory test in order to confirm its validity or to follow a trend. Some of the major sources of variation in laboratory tests (analytical imprecision, within-subject biological variation and between-subject variation) and the effects of averaging multiple results from the same sample or from the same person over time are discussed quantitatively in this article. This analysis leads to the surprising conclusion that the strategy of averaging multiple results is only necessary and effective in a limited range of research studies. In clinical practice, it may be important to repeat a test in order to eliminate the possibility of a rare type of error that has nothing to do analytical imprecision or within-subject variation, and for this reason, paradoxically, it may be most important to repeat tests with the highest sensitivity and/or specificity (i.e., ones that are critical for clinical decision-making).

  2. PET functional volume delineation: a robustness and repeatability study

    Energy Technology Data Exchange (ETDEWEB)

    Hatt, Mathieu [CHU Morvan, INSERM, U650, LaTIM, Brest (France); CHU MORVAN, LaTIM, INSERM U650, Brest (France); Cheze-le Rest, Catherine [CHU Morvan, INSERM, U650, LaTIM, Brest (France); CHU, Academic Department of Nuclear Medicine, Brest (France); Albarghach, Nidal; Pradier, Olivier [CHU Morvan, INSERM, U650, LaTIM, Brest (France); CHU, Institute of Oncology, Brest (France); Visvikis, Dimitris [CHU Morvan, INSERM, U650, LaTIM, Brest (France)

    2011-04-15

    Current state-of-the-art algorithms for functional uptake volume segmentation in PET imaging consist of threshold-based approaches, whose parameters often require specific optimization for a given scanner and associated reconstruction algorithms. Different advanced image segmentation approaches previously proposed and extensively validated, such as among others fuzzy C-means (FCM) clustering, or fuzzy locally adaptive bayesian (FLAB) algorithm have the potential to improve the robustness of functional uptake volume measurements. The objective of this study was to investigate robustness and repeatability with respect to various scanner models, reconstruction algorithms and acquisition conditions. Robustness was evaluated using a series of IEC phantom acquisitions carried out on different PET/CT scanners (Philips Gemini and Gemini Time-of-Flight, Siemens Biograph and GE Discovery LS) with their associated reconstruction algorithms (RAMLA, TF MLEM, OSEM). A range of acquisition parameters (contrast, duration) and reconstruction parameters (voxel size) were considered for each scanner model, and the repeatability of each method was evaluated on simulated and clinical tumours and compared to manual delineation. For all the scanner models, acquisition parameters and reconstruction algorithms considered, the FLAB algorithm demonstrated higher robustness in delineation of the spheres with low mean errors (10%) and variability (5%), with respect to threshold-based methodologies and FCM. The repeatability provided by all segmentation algorithms considered was very high with a negligible variability of <5% in comparison to that associated with manual delineation (5-35%). The use of advanced image segmentation algorithms may not only allow high accuracy as previously demonstrated, but also provide a robust and repeatable tool to aid physicians as an initial guess in determining functional volumes in PET. (orig.)

  3. Cumulative Vulnerability: A Case Study on intrafamilial violence, Drug Addiction and Adolescent Pregnancy

    Directory of Open Access Journals (Sweden)

    Paula Orchiucci Miura

    2014-12-01

    Full Text Available A pregnant adolescent’s vulnerability increases when she is a victim of intrafamilial violence and drug addiction, which cause physical and biopsychosocial damage to the mother and her baby. Objective Present and analyze the case of an adolescent who is addicted to drugs, pregnant and the victim of lifelong intrafamilial violence. Method A case study based on a semi-structured interview conducted in the Obstetrics Emergency Unit at the Teaching Hospital of the University of São Paulo. The data were interpreted and analyzed using Content Analysis. Results intrafamilial violence experienced at the beginning of the adolescent’s early relationships seriously affected her emotional maturity, triggering the development of psychopathologies and leaving her more susceptible to the use and abuse of alcohol and other drugs. The adolescent is repeating her history with her daughter, reproducing the cycle of violence. Conclusion Adolescent pregnancy combined with intrafamilial violence and drug addiction and multiplies the adolescent’s psychosocial vulnerability increased the adolescent’s vulnerability.

  4. The role of cumulative physical work load in symptomatic knee osteoarthritis – a case-control study in Germany

    Directory of Open Access Journals (Sweden)

    Abolmaali Nasreddin

    2008-07-01

    Full Text Available Abstract Objectives To examine the dose-response relationship between cumulative exposure to kneeling and squatting as well as to lifting and carrying of loads and symptomatic knee osteoarthritis (OA in a population-based case-control study. Methods In five orthopedic clinics and five practices we recruited 295 male patients aged 25 to 70 with radiographically confirmed knee osteoarthritis associated with chronic complaints. A total of 327 male control subjects were recruited. Data were gathered in a structured personal interview. To calculate cumulative exposure, the self-reported duration of kneeling and squatting as well as the duration of lifting and carrying of loads were summed up over the entire working life. Results The results of our study support a dose-response relationship between kneeling/squatting and symptomatic knee osteoarthritis. For a cumulative exposure to kneeling and squatting > 10.800 hours, the risk of having radiographically confirmed knee osteoarthritis as measured by the odds ratio (adjusted for age, region, weight, jogging/athletics, and lifting or carrying of loads is 2.4 (95% CI 1.1–5.0 compared to unexposed subjects. Lifting and carrying of loads is significantly associated with knee osteoarthritis independent of kneeling or similar activities. Conclusion As the knee osteoarthritis risk is strongly elevated in occupations that involve both kneeling/squatting and heavy lifting/carrying, preventive efforts should particularly focus on these "high-risk occupations".

  5. A comparative study of floor construction on sloping sites: an analysis of cumulative energy demand and greenhouse gas emissions

    Directory of Open Access Journals (Sweden)

    Grace Ding

    2016-03-01

    Full Text Available In order to make environmentally aware decisions, there is growing interest in the comparative energy and greenhouse gas (GHG performance of competing construction methods. Little research has been done concerning competing ground floor construction methods, especially given different site variables, such as slope and soil type. A life cycle assessment approach was adopted to analyse environmental impacts, including cumulative energy demand and GHG emissions for detached housing construction in Australia. Data was drawn from 24 case study housing projects, including 12 reinforced concrete and 12 suspended timber floor projects. The data presented in the paper compares cumulative energy demand, GHG and the constituent parts of competing construction methods. The findings indicate that the timber floors use/create significantly less cumulative energy demand and GHG emissions than concrete floors—approximately 2.1 to 2.7 times less energy and 2.3 to 2.9 times less GHG. These findings are limited to the site slope and foundation soil types identified in the paper. The main application of the work is in guidance concerning the lowest environmental impact options for detached housing construction.

  6. Methodological Considerations in Screening for Cumulative Environmental Health Impacts: Lessons Learned from a Pilot Study in California

    Directory of Open Access Journals (Sweden)

    Lauren Zeise

    2012-08-01

    Full Text Available Polluting facilities and hazardous sites are often concentrated in low-income communities of color already facing additional stressors to their health. The influence of socioeconomic status is not considered in traditional models of risk assessment. We describe a pilot study of a screening method that considers both pollution burden and population characteristics in assessing the potential for cumulative impacts. The goal is to identify communities that warrant further attention and to thereby provide actionable guidance to decision- and policy-makers in achieving environmental justice. The method uses indicators related to five components to develop a relative cumulative impact score for use in comparing communities: exposures, public health effects, environmental effects, sensitive populations and socioeconomic factors. Here, we describe several methodological considerations in combining disparate data sources and report on the results of sensitivity analyses meant to guide future improvements in cumulative impact assessments. We discuss criteria for the selection of appropriate indicators, correlations between them, and consider data quality and the influence of choices regarding model structure. We conclude that the results of this model are largely robust to changes in model structure.

  7. Studies of an expanded trinucleotide repeat in transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Bingham, P.; Wang, S.; Merry, D. [Univ. of Pennsylvania, Philadelphia, PA (United States)

    1994-09-01

    Spinal and bulbar muscular atrophy (SBMA) is a progressive motor neuron disease caused by expansion of a trinucleotide repeat in the androgen receptor gene (AR{sup exp}). AR{sup exp} repeats expand further or contract in approximately 25% of transmissions. Analogous {open_quotes}dynamic mutations{close_quotes} have been reported in other expanded trinucleotide repeat disorders. We have been developing a mouse model of this disease using a transgenic approach. Expression of the SBMA AR was documented in transgenic mice with an inducible promoter. No phenotypic effects of transgene expression were observed. We have extended our previous results on stability of the expanded trinucleotide repeat in transgenic mice in two lines carrying AR{sup exp}. Tail DNA was amplified by PCR using primers spanning the repeat on 60 AR{sup exp} transgenic mice from four different transgenic lines. Migration of the PCR product through an acrylamide gel showed no change of the 45 CAG repeat length in any progeny. Similarly, PCR products from 23 normal repeat transgenics showed no change from the repeat length of the original construct. Unlike the disease allele in humans, the expanded repeat AR cDNA in transgenic mice showed no change in repeat length with transmission. The relative stability of CAG repeats seen in the transgenic mice may indicate either differences in the fidelity of replicative enzymes, or differences in error identification and repair between mice and humans. Integration site or structural properties of the transgene itself might also play a role.

  8. Public service impacts of geothermal development: cumulative impacts study of the Geysers KGRA. Final staff report

    Energy Technology Data Exchange (ETDEWEB)

    Matthews, K.M.

    1983-07-01

    The number of workers currently involved in the various aspects of geothermal development in the Geysers are identified. Using two different development scenarios, projections are made for the number of power plants needed to reach the electrical generation capacity of the steam resource in the Geysers. The report also projects the cumulative number of workers needed to develop the steam field and to construct, operate, and maintain these power plants. Although the number of construction workers fluctuates, most are not likely to become new, permanent residents of the KGRA counties. The administrative and public service costs of geothermal development to local jurisdications are examined, and these costs are compared to geothermal revenues accruing to the local governments. Revenues do not cover the immediate fiscal needs resulting from increases in local road maintenance and school enrollment attributable to geothermal development. Several mitigation options are discussed and a framework presented for calculating mitigation costs for school and road impacts.

  9. Inequality and cumulative advantage in science careers: a case study of high-impact journals

    CERN Document Server

    Petersen, Alexander M

    2014-01-01

    Analyzing a large data set of publications drawn from the most competitive journals in the natural and social sciences we show that research careers exhibit the broad distributions of individual achievement characteristic of systems in which cumulative advantage plays a key role. While most researchers are personally aware of the competition implicit in the publication process, little is known about the levels of inequality at the level of individual researchers. We analyzed both productivity and impact measures for a large set of researchers publishing in high-impact journals. For each researcher cohort we calculated Gini inequality coefficients, with average Gini values around 0.48 for total publications and 0.73 for total citations. For perspective, these observed values are well in excess of the inequality levels observed for personal income in developing countries. Investigating possible sources of this inequality, we identify two potential mechanisms that act at the level of the individual that may play...

  10. Implementing a cumulative supermatrix approach for a comprehensive phylogenetic study of the Teloschistales (Pezizomycotina, Ascomycota)

    DEFF Research Database (Denmark)

    Gaya, Ester; Högnabba, Filip; Holguin, Ángela

    2012-01-01

    Teloschistineae, 22 of the 43 genera within the Physciineae, 49 genera of the closely related orders Lecanorales, Lecideales, and Peltigerales, and the dubiously placed family Brigantiaeaceae and genus Sipmaniella. Although the progressive addition of taxa (cumulative supermatrix approach) with increasing amounts...... of missing data did not dramatically affect the loss of support and resolution, the monophyly of the Teloschistales in the current sense was inconsistent, depending on the loci-taxa combination analyzed. Therefore, we propose a new, but provisional, classification for the re-circumscribed orders Caliciales...... and Teloschistales (previously referred to as Physciineae and Teloschistineae, respectively). We report here that the family Brigantiaeaceae, previously regarded as incertae sedis within the subclass Lecanoromycetidae, and Sipmaniella, are members of the Teloschistales in a strict sense. Within this order, one...

  11. Hysterectomy in very obese and morbidly obese patients: a systematic review with cumulative analysis of comparative studies.

    Science.gov (United States)

    Blikkendaal, Mathijs D; Schepers, Evelyn M; van Zwet, Erik W; Twijnstra, Andries R H; Jansen, Frank Willem

    2015-10-01

    Some studies suggest that also regarding the patient with a body mass index (BMI) ≥35 kg/m(2) the minimally invasive approach to hysterectomy is superior. However, current practice and research on the preference of gynaecologists still show that the rate of abdominal hysterectomy (AH) increases as the BMI increases. A systematic review with cumulative analysis of comparative studies was performed to evaluate the outcomes of AH, laparoscopic hysterectomy (LH) and vaginal hysterectomy (VH) in very obese and morbidly obese patients (BMI ≥35 kg/m(2)). PubMed and EMBASE were searched for records on AH, LH and VH for benign indications or (early stage) malignancy through October 2014. Included studies were graded on level of evidence. Studies with a comparative design were pooled in a cumulative analysis. Two randomized controlled trials, seven prospective studies and 14 retrospective studies were included (2232 patients; 1058 AHs, 959 LHs, and 215 VHs). The cumulative analysis identified that, compared to LH, AH was associated with more wound dehiscence [risk ratio (RR) 2.58, 95 % confidence interval (CI) 1.71-3.90; P = 0.000], more wound infection (RR 4.36, 95 % CI 2.79-6.80; P = 0.000), and longer hospital admission (mean difference 2.9 days, 95 % CI 1.96-3.74; P = 0.000). The pooled conversion rate was 10.6 %. Compared to AH, VH was associated with similar advantages as LH. Compared to AH, both LH and VH are associated with fewer postoperative complications and shorter length of hospital stay. Therefore, the feasibility of LH and VH should be considered prior the abdominal approach to hysterectomy in very obese and morbidly obese patients.

  12. Cumulative impacts study of The Geysers KGRA: public-service impacts of geothermal development

    Energy Technology Data Exchange (ETDEWEB)

    Matthews, K.M.

    1982-05-01

    Geothermal development in The Geysers KGRA has affected local public services and fiscal resources in Sonoma, Lake, Mendocino, and Napa counties. Each of these counties underwent rapid population growth between 1970 and 1980, some of which can be attributed to geothermal development. The number of workers currently involved in the various aspects of geothermal development in The Geysers is identified. Using three different development scenarios, projections are made for the number of power plants needed to reach the electrical generation capacity of the steam resource in The Geysers. The report also projects the cumulative number of workers needed to develop the steam field and to construct, operate, and maintain these power plants. Although the number of construction workers fluctuates, most are not likely to become new, permanent residents of the KGRA counties. The administrative and public service costs of geothermal development to local jurisdictions are examined and compared to geothermal revenues accruing to the local governments. Revenues do not cover the immediate fiscal needs resulting from increases in local road maintenance and school enrollment attributable to geothermal development. Several mitigation options are discussed, and a framework is presented for calculating mitigation costs per unit of public service.

  13. Cytogenetic studies in couples experiencing repeated pregnancy losses.

    Science.gov (United States)

    De Braekeleer, M; Dao, T N

    1990-07-01

    A computerized database generated from the literature on cytogenetic studies in couples experiencing repeated pregnancy losses has been set up at the University of Quebec at Chicoutimi. At the present time, it contains data on 22,199 couples (44,398 individuals). The statistical analyses showed a relationship between the distribution of the chromosome abnormalities and the number of abortions. An uneven distribution of the chromosomal structural rearrangements according to the sex of the carrier was found (P less than 0.05). Overall, 4.7% of the couples ascertained for two or more spontaneous abortions included one carrier. It also appeared that only translocations (both reciprocal and Robertsonian) and inversions were associated with a higher risk of pregnancy wastage. Therefore, genetic counselling should be offered to these couples and investigations performed on their extended families.

  14. A cumulative analysis of odontogenic cysts from major dental institutions of Bangalore city: A study of 252 cases

    Directory of Open Access Journals (Sweden)

    Prashanth Ramachandra

    2011-01-01

    Full Text Available Background: The objective of this study was to perform a cumulative analysis of odontogenic cysts obtained from the data of major dental institutions of Bangalore city, as well as to evaluate their distribution during a 5-year period and compare the results with other international studies. Materials and Methods: Data for the study were obtained from the reports of patients diagnosed with odontogenic cysts between 2005 and 2010 from different dental institutions of Bangalore. Case records of patients that fit the histological classification of the World Health Organization (WHO (2005 were included in the study and the following variables were analyzed: age, gender, anatomic location, and histological type. Results: In a total of 252 cyst specimens diagnosed, 79.76% were odontogenic cysts and 20.24% were nonodontogenic cysts. Among the odontogenic cysts most frequent lesions were radicular cysts (50.25%, followed by keratocysts (27.36% and dentigerous cysts (22.39%. Conclusions: Our study provides a cumulative data of odontogenic cysts in the population of Bangalore city. The results of our study showed a similar frequency of odontogenic cysts as compared to other populations of the world, with radicular cyst being identified as the most frequent odontogenic cyst. Keratocyst was the second most common cyst followed by dentigerous cyst.

  15. Testing a cumulative and aggregate exposure model using biomonitoring studies and dietary records for Italian vineyard spray operators.

    Science.gov (United States)

    Kennedy, Marc C; Glass, C Richard; Fustinoni, Silvia; Moretto, Angelo; Mandic-Rajcevic, Stefan; Riso, Patrizia; Turrini, Aida; van der Voet, Hilko; Hetmanski, Michel T; Fussell, Richard J; van Klaveren, Jacob D

    2015-05-01

    The need for improved tools to estimate the cumulative and aggregate exposure to compounds such as plant protection products (PPPs) is recognised in the EU Regulation 1107/2009. A new model has been developed to estimate the exposure within a population to single compounds or compounds within a Cumulative Action Group, considering dietary and non-dietary sources and multiple exposure routes. To test the model a field study was carried out in Italy with operators applying tebuconazole fungicides, with measurements of dermal exposure collected. Whole urine samples were collected and analysed to provide values for the absorbed dose of tebuconazole, with duplicate diet samples collected and analysed as a measure of dietary exposures. The model provided predicted values of exposure for combined dietary and non-dietary routes of exposures which were compared to the measured absorbed dose values based on urinary analysis. The model outputs provided mean daily exposure values of 1.77 (± 1.96) µg a.s./kg BW which are comparable to measured mean values from the biomonitoring field study of 1.73 (± 1.31) µg a.s./kg BW. To supplement the limited measurement data available, comparisons against other models were also made and found to be comparable.

  16. Study of simple sequence repeat (SSR) polymorphism for biotic ...

    African Journals Online (AJOL)

    home

    2013-10-02

    Oct 2, 2013 ... back cross breeding; SSRs, simple sequence repeats; PIC, polymorphism ..... PIC values were reported in barley wheat and rice (Gu et ... doubled-haploid rice population. Theor. ... Grover A, Aishwarya V, Sharma PC (2007).

  17. A Comparative Study of the College Entrance Examination Board Validity Study Service and Freshmen Cumulative Point Averages.

    Science.gov (United States)

    Bukowski, Joseph E.

    The success with which freshmen cumulative point averages may be predicted from a combination of a student's high school rank, Scholastic Aptitude Test (SAT) score (Verbal) and SAT score (Mathematics) was investigated. A multiple regression formula developed by the College Entrance Examination Board was used to combine the three predictors into a…

  18. A Comparative Study of the College Entrance Examination Board Validity Study Service and Freshmen Cumulative Point Averages.

    Science.gov (United States)

    Bukowski, Joseph E.

    The success with which freshmen cumulative point averages may be predicted from a combination of a student's high school rank, Scholastic Aptitude Test (SAT) score (Verbal) and SAT score (Mathematics) was investigated. A multiple regression formula developed by the College Entrance Examination Board was used to combine the three predictors into a…

  19. A study of the relationship between peak skin dose and cumulative air kerma in interventional neuroradiology and cardiology

    Energy Technology Data Exchange (ETDEWEB)

    Neil, S; Padgham, C; Martin, C J [Health Physics, Gartnavel Royal Hospital, Glasgow G12 0XH (United Kingdom)

    2010-12-01

    A study of peak skin doses (PSDs) during neuroradiology and cardiology interventional procedures has been carried out using Gafchromic XR-RV2 film. Use of mosaics made from squares held in cling film has allowed doses to the head to be mapped successfully. The displayed cumulative air kerma (CAK) has been calibrated in terms of cumulative entrance surface dose (CESD) and results indicate that this can provide a reliable indicator of the PSD in neuroradiology. Results linking PSD to CESD for interventional cardiology were variable, but CAK is still considered to provide the best option for use as an indicator of potential radiation-induced effects. A CESD exceeding 3 Gy is considered a suitable action level for triggering follow-up of patients in neuroradiology and cardiology for possible skin effects. Application of dose action levels defined in this way would affect 8% of neurological embolisation procedures and 5% of cardiology ablation and multiple stent procedures at the hospitals where the investigations were carried out. A close relationship was observed between CESD and dose-area product (DAP) for particular types of procedure, and DAPs of 200-300 Gy cm{sup 2} could be used as trigger levels where CAK readings were not available. The DAP value would depend on the mean field size and would need to be determined for each application.

  20. The Soft Cumulative Constraint

    CERN Document Server

    Petit, Thierry

    2009-01-01

    This research report presents an extension of Cumulative of Choco constraint solver, which is useful to encode over-constrained cumulative problems. This new global constraint uses sweep and task interval violation-based algorithms.

  1. Exposing Students to Repeat Photography: Increasing Cultural Understanding on a Short-Term Study Abroad

    Science.gov (United States)

    Lemmons, Kelly K.; Brannstrom, Christian; Hurd, Danielle

    2014-01-01

    Traditionally, repeat photography has been used to analyze land cover change. This paper describes how repeat photography may be used as a tool to enhance the short-term study abroad experience by facilitating cultural interaction and understanding. We present evidence from two cases and suggest a five-step repeat photography method for educators…

  2. Exposing Students to Repeat Photography: Increasing Cultural Understanding on a Short-Term Study Abroad

    Science.gov (United States)

    Lemmons, Kelly K.; Brannstrom, Christian; Hurd, Danielle

    2014-01-01

    Traditionally, repeat photography has been used to analyze land cover change. This paper describes how repeat photography may be used as a tool to enhance the short-term study abroad experience by facilitating cultural interaction and understanding. We present evidence from two cases and suggest a five-step repeat photography method for educators…

  3. Single and repeated elective abortions in Japan: a psychosocial study.

    Science.gov (United States)

    Kitamura, T; Toda, M A; Shima, S; Sugawara, M

    1998-09-01

    Despite its social, legal and medical importance, termination of pregnancy (TOP) (induced abortion) has rarely been the focus of psychosocial research. Of a total of 1329 women who consecutively attended the antenatal clinic of a general hospital in Japan, 635 were expecting their first baby. Of these 635 women, 103 (16.2%) had experienced TOP once previously (first aborters), while 47 (7.4%) had experienced TOP two or more times (repeated aborters). Discriminant function analysis was performed using psychosocial variables found to be significantly associated with either first abortion or repeated abortion in bivariate analyses. This revealed that both first and repeated aborters could be predicted by smoking habits and an unwanted current pregnancy while the repeated aborters appear to differ from first aborters in having a longer pre-marital dating period, non-arranged marriages, smoking habits, early maternal loss experience or a low level of maternal care during childhood. These findings suggest that both the frequency of abortion and its repetition have psychosocial origins.

  4. Lead-Related Genetic Loci, Cumulative Lead Exposure and Incident Coronary Heart Disease: The Normative Aging Study

    Science.gov (United States)

    Weisskopf, Marc G.; Sparrow, David; Schwartz, Joel; Hu, Howard; Park, Sung Kyun

    2016-01-01

    Background Cumulative exposure to lead is associated with cardiovascular outcomes. Polymorphisms in the δ-aminolevulinic acid dehydratase (ALAD), hemochromatosis (HFE), heme oxygenase-1 (HMOX1), vitamin D receptor (VDR), glutathione S-transferase (GST) supergene family (GSTP1, GSTT1, GSTM1), apolipoprotein E (APOE),angiotensin II receptor-1 (AGTR1) and angiotensinogen (AGT) genes, are believed to alter toxicokinetics and/or toxicodynamics of lead. Objectives We assessed possible effect modification by genetic polymorphisms in ALAD, HFE, HMOX1, VDR, GSTP1, GSTT1, GSTM1, APOE, AGTR1 and AGT individually and as the genetic risk score (GRS) on the association between cumulative lead exposure and incident coronary heart disease (CHD) events. Methods We used K-shell-X-ray fluorescence to measure bone lead levels. GRS was calculated on the basis of 22 lead-related loci. We constructed Cox proportional hazard models to compute adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) for incident CHD. We applied inverse probability weighting to account for potential selection bias due to recruitment into the bone lead sub-study. Results Significant effect modification was found by VDR, HMOX1, GSTP1, APOE, and AGT genetic polymorphisms when evaluated individually. Further, the bone lead-CHD associations became larger as GRS increases. After adjusting for potential confounders, a HR of CHD was 2.27 (95%CI: 1.50–3.42) with 2-fold increase in patella lead levels, among participants in the top tertile of GRS. We also detected an increasing trend in HRs across tertiles of GRS (p-trend = 0.0063). Conclusions Our findings suggest that lead-related loci as a whole may play an important role in susceptibility to lead-related CHD risk. These findings need to be validated in a separate cohort containing bone lead, lead-related genetic loci and incident CHD data. PMID:27584680

  5. Multiple procedures and cumulative individual radiation exposure in interventional cardiology: A long-term retrospective study

    Energy Technology Data Exchange (ETDEWEB)

    Weltermann, Birgitta M.; Rock, Thomas; Berndt, Peter; Viehmann, Anja; Reinders, Sabrina; Gesenhues, Stefan [University of Duisburg-Essen, Institute for General Medicine, University Hospital, Essen (Germany); Brix, Gunnar; Schegerer, Alexander [Federal Office for Radiation Protection, Department of Radiation Protection and Health, Neuherberg (Germany)

    2015-09-15

    Various studies address discrepancies between guideline recommendations for coronary angiographies and clinical practice. While the issue of the appropriateness of recurrent angiographies was studied focusing on the role of the cardiologist, little is known about individual patients' histories and the associated radiation exposures. We analyzed all patients with coronary artery disease (CAD) in an academic teaching practice who underwent at least one angiography with or without intervention between 2004 and 2009. All performed angiographies in these patients were analyzed and rated by three physicians for appropriateness levels according to cardiology guidelines. Typical exposure data from the medical literature were used to estimate individual radiation exposure. In the cohort of 147 patients, a total of 441 procedures were analyzed: between 1981 and 2009, three procedures were performed per patient (range 1-19) on average. Appropriateness ratings were 'high/intermediate' in 71 %, 'low/no' in 27.6 % and data were insufficient for ratings in 1.4 %. Procedures with 'low/no' ratings were associated with potentially avoidable exposures of up to 186 mSv for single patients. Using retrospective data, we exemplify the potential benefit of guideline adherence to decrease patients' radiation exposures. (orig.)

  6. Serum progesterone elevation adversely affects cumulative live birth rate in different ovarian responders during in vitro fertilization and embryo transfer: a large retrospective study.

    Science.gov (United States)

    Bu, Zhiqin; Zhao, Feifei; Wang, Keyan; Guo, Yihong; Su, Yingchun; Zhai, Jun; Sun, Yingpu

    2014-01-01

    In order to explore the relationship between serum progesterone (P) level on the day of human chorionic gonadotrophin (HCG) administration and cumulative live birth rate in patients with different ovarian response during in vitro fertilization (IVF), we carried out this retrospective cohort study including a total of 4,651 patients undergoing their first IVF cycles from January 2011 to December 2012. All patients with a final live birth outcome (4,332 patients) were divided into three groups according to ovarian response: poor ovarian responder (≤5 oocytes, 785 patients), intermediate ovarian responder (6-19 oocytes, 3065 patients) and high ovarian responder (≥20 oocytes, 482 patients). The thresholds for serum P elevation were 1.60 ng/ml, 2.24 ng/ml, and 2.50 ng/ml for poor, intermediate, and high ovarian responders, respectively. Cumulative live birth rate per oocyte retrieval cycle was calculated in each group. The relationship between serum P level and cumulative live birth rate was evaluated by both univariate and multivariate logistic regression analysis. Cumulative live birth rate per oocyte retrieval cycle was inversely associated with serum P level in patients with different ovarian response. For all responders, patients with elevated P level had significantly higher number of oocytes retrieved, but lower high quality embryo rate, and lower cumulative live birth rate compared with patients with normal serum P level. In addition, serum P level adversely affected cumulative live birth rate by both univariate and multivariate logistic regression analysis, independent of ovarian response. Serum P elevation on the day of HCG administration adversely affects cumulative live birth rate per oocyte retrieval cycle in patients with different ovarian response.

  7. Reactor pulse repeatability studies at the annular core research reactor

    Energy Technology Data Exchange (ETDEWEB)

    DePriest, K.R. [Applied Nuclear Technologies, Sandia National Laboratories, Mail Stop 1146, Post Office Box 5800, Albuquerque, NM 87185-1146 (United States); Trinh, T.Q. [Nuclear Facility Operations, Sandia National Laboratories, Mail Stop 0614, Post Office Box 5800, Albuquerque, NM 87185-1146 (United States); Luker, S. M. [Applied Nuclear Technologies, Sandia National Laboratories, Mail Stop 1146, Post Office Box 5800, Albuquerque, NM 87185-1146 (United States)

    2011-07-01

    The Annular Core Research Reactor (ACRR) at Sandia National Laboratories is a water-moderated pool-type reactor designed for testing many types of objects in the pulse and steady-state mode of operations. Personnel at Sandia began working to improve the repeatability of pulse operations for experimenters in the facility. The ACRR has a unique UO{sub 2}-BeO fuel that makes the task of producing repeatable pulses difficult with the current operating procedure. The ACRR produces a significant quantity of photoneutrons through the {sup 9}Be({gamma}, n){sup 8}Be reaction in the fuel elements. The photoneutrons are the result of the gammas produced during fission and in fission product decay, so their production is very much dependent on the reactor power history and changes throughout the day/week of experiments in the facility. Because the photoneutrons interfere with the delayed-critical measurements required for accurate pulse reactivity prediction, a new operating procedure was created. The photoneutron effects at delayed critical are minimized when using the modified procedure. In addition, the pulse element removal time is standardized for all pulse operations with the modified procedure, and this produces less variation in reactivity removal times. (authors)

  8. Association between CAG repeat polymorphisms and the risk of prostate cancer: a meta-analysis by race, study design and the number of (CAG)n repeat polymorphisms.

    Science.gov (United States)

    Sun, Jun-Hyun; Lee, Sang-Ah

    2013-11-01

    Although a number of studies have been conducted on the association between prostate cancer and CAG repeat polymorphisms of the androgen receptor gene, this association remains elusive and controversial. In this meta-analysis, we aimed to evaluate the effects of (CAG)n repeat genetic polymorphisms on the incidence of prostate cancer, particularly as regards race, study design and the number of (CAG)n repeats. To collect articles published on the association between CAG repeats and prostate cancer, publications were identified from the National Center for Biotechnology Information (NCBI) database of epidemiological studies published up to October 2011; our identification of publications was not limited by a language barrier. The following search keywords were used: prostate cancer risk, CAG repeat polymorphism, androgen receptor gene and human. Stata version 10 was used for the meta-analysis and the publication bias was measured through the Begg's test and Egger's test. This meta-analysis included 47 studies with 13,346 cases and 15,172 control or non-cases and consisted of 31 reports based on Caucasians, ten on Asians, one on Hispanics and four on combined ethnic groups. The carriers of a shorter CAG repeat sequence had an increased risk of prostate cancer (OR 1.21, 95% CI 1.10-1.34 for all subjects; OR 1.21, 95% CI 1.10-1.34 for prospective studies; OR 1.32, 95% CI 1.15-1.51 for retrospective studies) regardless of the exact length of the CAG repeat, compared with carriers of a longer repeat sequence. In terms of race, the risk of carrying a shorter CAG repeat sequence was 1.10- and 1.83-fold higher than that of a longer repeat sequence in Caucasians and Asians, respectively. For the specific number of CAG repeat polymorphisms, carriers of repeats were observed to have a higher risk of prostate cancer (OR 1.16, 95% CI 1.04-1.29) compared with carriers with ≥ 22 CAG repeat polymorphisms, particularly for Asians (OR 2.06, 95% CI 1.00-4.24). This meta

  9. Lifetime cumulative risk factors predict cardiovascular disease mortality in a 50-year follow-up study in Finland.

    Science.gov (United States)

    Reinikainen, Jaakko; Laatikainen, Tiina; Karvanen, Juha; Tolonen, Hanna

    2015-02-01

    Systolic blood pressure, total cholesterol and smoking are known predictors of cardiovascular disease (CVD) mortality. Less is known about the effect of lifetime accumulation and changes of risk factors over time as predictors of CVD mortality, especially in very long follow-up studies. Data from the Finnish cohorts of the Seven Countries Study were used. The baseline examination was in 1959 and seven re-examinations were carried out at approximately 5-year intervals. Cohorts were followed up for mortality until the end of 2011. Time-dependent Cox models with regular time-updated risk factors, time-dependent averages of risk factors and latest changes in risk factors, using smoothing splines to discover nonlinear effects, were used to analyse the predictive effect of risk factors for CVD mortality. A model using cumulative risk factors, modelled as the individual-level averages of several risk factor measurements over time, predicted CVD mortality better than a model using the most recent measurement information. This difference seemed to be most prominent for systolic blood pressure. U-shaped effects of the original predictors can be explained by partitioning a risk factor effect between the recent level and the change trajectory. The change in body mass index predicted the risk although body mass index itself did not. The lifetime accumulation of risk factors and the observed changes in risk factor levels over time are strong predictors of CVD mortality. It is important to investigate different ways of using the longitudinal risk factor measurements to take full advantage of them. © The Author 2014; all rights reserved. Published by Oxford University Press on behalf of the International Epidemiological Association.

  10. Testing of a cumulative and aggregate exposure model using biomonitoring studies and dietary records for Italian vineyard spray operators.

    NARCIS (Netherlands)

    Kennedy, M.C.; Glass, C.R.; Fustinoni, S.; Moretto, A.; Mandic-Rajcevic, S.; Riso, P.; Turrini, A.; Voet, van der H.; Hetmanski, M.T.; Fussel, R.J.; Klaveren, van J.D.

    2015-01-01

    The need for improved tools to estimate the cumulative and aggregate exposure to compounds such as plant protection products (PPPs) is recognised in the EU Regulation 1107/2009. A new model has been developed to estimate the exposure within a population to single compounds or compounds within a Cumu

  11. Analysing Repeat Visitation on Country Level with Passive Mobile Positioning Method: an Estonian Case Study

    Directory of Open Access Journals (Sweden)

    Andres Kuusik

    2013-01-01

    Full Text Available The purpose of this paper is to investigate the capabilities and limits of the passive mobile positioning (PMP method in studying loyalty of tourists on the macro level. The repeat visitors were identified using database of call activities of roaming phones in Estonia since 25.04.2005 till 31.01.2009. For this purpose was developed model which selected repeat visits on the basis of time interval. The findings of the study revealed that it is possible to observe the duration, density, seasonality and dynamics of repeat visitations. In addition the local destinations and events most loved by repeat visitors and the trajectory they are using could be also identified. Another important finding revealed that repeat visitors stay longer in destination than first time visitors. The results presented in this paper could be used by Estonian Ministry of Economic Affairs and Communications and by Enterprise Estonia developing the Estonian tourism policy

  12. Dose-Response Relationship between Cumulative Occupational Lead Exposure and the Associated Health Damages: A 20-Year Cohort Study of a Smelter in China.

    Science.gov (United States)

    Wu, Yue; Gu, Jun-Ming; Huang, Yun; Duan, Yan-Ying; Huang, Rui-Xue; Hu, Jian-An

    2016-03-16

    Long-term airborne lead exposure, even below official occupational limits, has been found to cause lead poisoning at higher frequencies than expected, which suggests that China's existing occupational exposure limits should be reexamined. A retrospective cohort study was conducted on 1832 smelting workers from 1988 to 2008 in China. These were individuals who entered the plant and came into continuous contact with lead at work for longer than 3 months. The dose-response relationship between occupational cumulative lead exposure and lead poisoning, abnormal blood lead, urinary lead and erythrocyte zinc protoporphyrin (ZPP) were analyzed and the benchmark dose lower bound confidence limits (BMDLs) were calculated. Statistically significant positive correlations were found between cumulative lead dust and lead fumes exposures and workplace seniority, blood lead, urinary lead and ZPP values. A dose-response relationship was observed between cumulative lead dust or lead fumes exposure and lead poisoning (p lead dust and fumes doses were 0.68 mg-year/m³ and 0.30 mg-year/m³ for lead poisoning, respectively. The BMDLs of workplace airborne lead concentrations associated with lead poisoning were 0.02 mg/m³ and 0.01 mg/m³ for occupational exposure lead dust and lead fume, respectively. In conclusion, BMDLs for airborne lead were lower than occupational exposure limits, suggesting that the occupational lead exposure limits need re-examination and adjustment. Occupational cumulative exposure limits (OCELs) should be established to better prevent occupational lead poisoning.

  13. Cumulative association between age-related macular degeneration and less studied genetic variants in PLEKHA1/ARMS2/HTRA1: a meta and gene-cluster analysis.

    Science.gov (United States)

    Yu, Weihong; Dong, Shuqian; Zhao, Chuntao; Wang, Haina; Dai, Fei; Yang, Jingyun

    2013-10-01

    The objective of this study is to examine the cumulative effect of the less studied genetic variants in PLEKHA1/ARMS2/HTRA1 on age-related macular degeneration (AMD). We performed an extensive literature search for studies on the association between AMD and the less studied genetic variants in PLEKHA1/ARMS2/HTRA1. Multiple meta-analyses were performed to evaluate the association between individual genetic variants and AMD. A gene-cluster analysis was used to investigate the cumulative effect of these less studied genetic variants on AMD. A total of 23 studies from 20 published papers met the eligibility criteria and were included in our analyses. Several genetic variants in the gene cluster are significantly associated with AMD in our meta-analyses or in individual studies. Gene-cluster analysis reveals a strong cumulative association between these genetic variants in this gene cluster and AMD (p studies in our meta-analyses; and rs3793917, the SNP with the largest sample size, were not significantly associated with AMD (both p's > 0.12). Sensitivity analyses reveal significant association of AMD with rs2736911 in Chinese but not in Caucasian, with c.372_815del443ins54 in Caucasian but not in Chinese, and with rs1049331 in both ethnic groups. These less studied genetic variants have a significant cumulative effect on wet AMD. Our study provides evidence of the joint contribution of genetic variants in PLEKHA1/ARMS2/HTRA1 to AMD risk, in addition to the two widely studied genetic variants whose association with AMD was well established.

  14. Cumulative inflammatory load is associated with short leukocyte telomere length in the Health, Aging and Body Composition Study.

    Directory of Open Access Journals (Sweden)

    Aoife O'Donovan

    Full Text Available BACKGROUND: Leukocyte telomere length (LTL is an emerging marker of biological age. Chronic inflammatory activity is commonly proposed as a promoter of biological aging in general, and of leukocyte telomere shortening in particular. In addition, senescent cells with critically short telomeres produce pro-inflammatory factors. However, in spite of the proposed causal links between inflammatory activity and LTL, there is little clinical evidence in support of their covariation and interaction. METHODOLOGY/PRINCIPAL FINDINGS: To address this issue, we examined if individuals with high levels of the systemic inflammatory markers interleukin-6 (IL-6, tumor necrosis factor-α (TNF-α and C-reactive protein (CRP had increased odds for short LTL. Our sample included 1,962 high-functioning adults who participated in the Health, Aging and Body Composition Study (age range: 70-79 years. Logistic regression analyses indicated that individuals with high levels of either IL-6 or TNF-α had significantly higher odds for short LTL. Furthermore, individuals with high levels of both IL-6 and TNF-α had significantly higher odds for short LTL compared with those who had neither high (OR = 0.52, CI = 0.37-0.72, only IL-6 high (OR = 0.57, CI = 0.39-0.83 or only TNF-α high (OR = 0.67, CI = 0.46-0.99, adjusting for a wide variety of established risk factors and potential confounds. In contrast, CRP was not associated with LTL. CONCLUSIONS/SIGNIFICANCE: Results suggest that cumulative inflammatory load, as indexed by the combination of high levels of IL-6 and TNF-α, is associated with increased odds for short LTL. In contrast, high levels of CRP were not accompanied by short LTL in this cohort of older adults. These data provide the first large-scale demonstration of links between inflammatory markers and LTL in an older population.

  15. Cumulative health risk assessment of co-occurring mycotoxins of deoxynivalenol and its acetyl derivatives in wheat and maize: case study, Shanghai, China.

    Science.gov (United States)

    Han, Zheng; Nie, Dongxia; Ediage, Emmanuel Njumbe; Yang, Xianli; Wang, Jianhua; Chen, Bo; Li, Shuguang; On, Stephen L W; De Saeger, Sarah; Wu, Aibo

    2014-12-01

    Humans are naturally and frequently exposed to a multitude of mycotoxins, but health risk assessments are usually performed on individual mycotoxins, which may underestimate the total risks. In this study, we assessed for the first time the cumulative health risks of concomitant exposure via dietary intake (DI) to multiple mycotoxins, namely deoxynivalenol (DON) and its acetyl derivatives of 3-acetyldeoxynivalenol (3-ADON) and 15-acetyldeoxynivalenol (15-ADON), based on the concentration addition (CA) concept. A cross-sectional study was conducted in seven districts in Shanghai, China with 1269 participants and 330 wheat and maize samples analyzed. After probabilistic analysis using Monte Carlo simulation, the results showed no health risks to the population in Shanghai considering individual mycotoxins. However, if the cumulative health risks were calculated based on the combined consideration of DON with either 3-ADON or 15-ADON or both, the DI values in 95th percentile were up to 1087 ng/kg body weight/day, exceeding the Provisional Maximum Tolerable Daily Intake (PMTDI) of 1000 ng/kg body weight/day and hence representing potential health risks to the population in Shanghai. The integrated study proposed here could be a model strategy for cumulative health risk assessment on the co-occurring hazards in the fields of food safety combined with environmental contaminants.

  16. Cumulative High-Grade Squamous Intraepithelial Lesion Rate and Need for Surgical Intervention of Atypical Squamous Cells of Undetermined Significance Cytology-Diagnosed Patients: A Prospective Study.

    Science.gov (United States)

    Petousis, Stamatios; Kalogiannidis, Ioannis; Margioula-Siarkou, Chrysoula; Mamopoulos, Apostolos; Mavromatidis, George; Prapas, Nikolaos; Rousso, David

    2017-01-01

    Τhe study aimed to study the rate of atypical squamous cells of undetermined significance (ASCUS) that progressed to high-grade squamous intraepithelial lesions (HGSIL), as well as the number of patients who finally necessitated a surgical intervention during follow-up. A prospective study was conducted on patients admitted for colposcopy during 2007-2012. We exclusively included those who presented with newly ASCUS diagnosis, while patients with a history of cervical intraepithelial neoplasia (CIN) were excluded. Primary end points were the cumulative rate of HGSIL during follow-up and the rate of surgical procedures performed because of such lesions. There were 134 ASCUS cases included. Overall, there were 48 (35.8%) surgical excision procedures performed to treat or eliminate HGSIL during the follow-up period. According to the final histopathology of surgical specimens, the cumulative rate of CIN2 or higher cervical lesions was 28.4% (n = 38). The cumulative rate of CIN2+ during follow-up period was almost 30% for patients with ASCUS, with the necessity for interventional treatment being even higher. © 2016 S. Karger AG, Basel.

  17. Cumulative fatigue damage models

    Science.gov (United States)

    Mcgaw, Michael A.

    1988-01-01

    The problem of calculating expected component life under fatigue loading conditions is complicated by the fact that component loading histories contain, in many cases, cyclic loads of widely varying amplitudes. In such a case a cumulative damage model is required, in addition to a fatigue damage criterion, or life relationship, in order to compute the expected fatigue life. The traditional cumulative damage model used in design is the linear damage rule. This model, while being simple to use, can yield grossly unconservative results under certain loading conditions. Research at the NASA Lewis Research Center has led to the development of a nonlinear cumulative damage model, named the double damage curve approach (DDCA), that has greatly improved predictive capability. This model, which considers the life (or loading) level dependence of damage evolution, was applied successfully to two polycrystalline materials, 316 stainless steel and Haynes 188. The cumulative fatigue behavior of the PWA 1480 single-crystal material is currently being measured to determine the applicability of the DDCA for this material.

  18. Studying the p+Pb ridges using two-particle correlations and cumulants with the ATLAS detector

    CERN Document Server

    Radhakrishnan, S; The ATLAS collaboration

    2013-01-01

    ATLAS measurements, using two particle correlations and multi particle cumulants, of the relative azimuth ($Deltaphi$) correlations in particle production extending over large pseudorapidity ($eta$) separations (ridge) seen in high multiplicity pPb collisions are presented. The dataset used is $sqrt{s_{NN}} = 5.02$ Tev p+Pb collisions of integrated luminosity about 1 $mu b$. The away side ($Deltaphi sim pi $) ridge in central events (with large energy measured by the forward calorimeter in the Pb fragmentation side, $Sigma E_{t}^{Pb}$) , after subtraction of that in a low $Sigma E_{t}^{Pb}$ event class, is similar in magnitude and $p_{t}$ dependence to the near side ridge ($Deltaphi sim 0$) ridge. The resulting distribution in $Deltaphi$ is consistent with a $cos(2Deltaphi)$ modulation and the magnitude of this modulation ($s_{2}$) shows similar $p_{t}$ dependence as the magnitude of the $cos(2Deltaphi)$ modulation in heavy ion collisions (elliptic flow). The results from Cumulant analysis show similar $p_t$ ...

  19. Application of plasma focus installations for a study of the influence of deuterium cumulative flows on materials

    Indian Academy of Sciences (India)

    L I Ivanov; A I Dedyurin; I V Borovitskaya; O N Krokhin; V Ya Nikulin; S N Polukhin; A A Tikhomirov; A S Fedotov

    2003-12-01

    In this work, as an example of an application of the plasma focus (PF) device, we study the influence on alloys of vanadium of a cumulative flow producing in the PF device. The experiment was done in a 4-kJ PF device with various gas fillings and various anode shapes. It was found that the velocity of the axial cumulative flow depends on the type of gas and is about $5\\cdot 10^{7}$ cm/s for deuterium and $2\\cdot 10^{7}$ cm/s for argon fillings of plasma focus chamber; the shape of the flow is changed from a broad conical fly for deuterium to a quasi-one-directional stream for argon. The dynamics and structure of such flows are investigated by means of laser diagnostics and an image converter camera. The experiments show that cumulative flows produce various defects in tested samples. The appearance of a large number of cracks on the surface of vanadium under the impulse influence of deuterium plasma shows that pure vanadium cannot be used for the construction of thermonuclear fusion reactors. Such PF installations could also be used effectively for the study of other material and construction elements proposed for the use in thermonuclear machines.

  20. Using Physiologically-Based Pharmacokinetic Models to Incorporate Chemical and Non-Chemical Stressors into Cumulative Risk Assessment: A Case Study of Pesticide Exposures

    Directory of Open Access Journals (Sweden)

    Jonathan I. Levy

    2012-05-01

    Full Text Available Cumulative risk assessment has been proposed as an approach to evaluate the health risks associated with simultaneous exposure to multiple chemical and non-chemical stressors. Physiologically based pharmacokinetic/pharmacodynamic (PBPK/PD models can allow for the inclusion and evaluation of multiple stressors, including non-chemical stressors, but studies have not leveraged PBPK/PD models to jointly consider these disparate exposures in a cumulative risk context. In this study, we focused on exposures to organophosphate (OP pesticides for children in urban low-income environments, where these children would be simultaneously exposed to other pesticides (including pyrethroids and non-chemical stressors that may modify the effects of these exposures (including diet. We developed a methodological framework to evaluate chemical and non-chemical stressor impacts on OPs, utilizing an existing PBPK/PD model for chlorpyrifos. We evaluated population-specific stressors that would influence OP doses or acetylcholinesterase (AChE inhibition, the relevant PD outcome. We incorporated the impact of simultaneous exposure to pyrethroids and dietary factors on OP dose through the compartments of metabolism and PD outcome within the PBPK model, and simulated combinations of stressors across multiple exposure ranges and potential body weights. Our analyses demonstrated that both chemical and non-chemical stressors can influence the health implications of OP exposures, with up to 5-fold variability in AChE inhibition across combinations of stressor values for a given OP dose. We demonstrate an approach for modeling OP risks in the presence of other population-specific environmental stressors, providing insight about co-exposures and variability factors that most impact OP health risks and contribute to children’s cumulative health risk from pesticides. More generally, this framework can be used to inform cumulative risk assessment for any compound impacted by

  1. Corneal epithelial toxicity of antiglaucoma formulations: in vitro study of repeated applications

    Directory of Open Access Journals (Sweden)

    Meloni M

    2012-09-01

    Full Text Available Marisa Meloni,1 Giampiero Cattaneo,2 Barbara De Servi11VitroScreen In Vitro Research Laboratories, 2Thea Farma, Milan, ItalyBackground: By using a biologically relevant and sensitive three-dimensional model of human corneal epithelium and multiple endpoint analysis, assessment of the potential for eye irritation and long-term compatibility of four registered ophthalmological preparations, ie, Timolabak®, Timoptol®, Nyogel®, and Timogel®, was performed. This approach enables classification of the potential for irritation, discriminating between mildly irritant and non-irritant ocular substances.Methods: The exposure protocol included two time periods, ie, 24 hours (acute application and 72 hours (repeated applications twice daily. This approach allows assessment of not only the acute reaction but also possible recovery, as well as mimicking the potential cumulative effects associated with long-term application. Using benzalkonium chloride (BAK 0.01% as a positive control, the following parameters were quantified: cellular viability by MTT test, histological analysis by hematoxylin and eosin staining, passive release of interleukin-1a by enzyme-linked immunosorbent assay, and OCLN gene expression by quantitative real-time polymerase chain reaction.Results: Cell viability was reduced to under the 50% cutoff value after acute exposure (24 hours to BAK 0.01%, and after repeated application (72 hours of Timoptol and Nyogel. Histological analysis after acute exposure showed signs of superficial damage with all formulations, and severe changes after repeated applications of Timoptol, BAK 0.01%, and Nyogel. Timolabak and Timogel did not significantly alter the morphology of the human corneal epithelial cells after the different exposure times. Interleukin-1α release was greater than that for the negative control (>20 pg/mL and the positive control (BAK 0.01%, Nyogel, and Timoptol treatments and not different after treatment with Timolabak and

  2. Computational study of the human dystrophin repeats: interaction properties and molecular dynamics.

    Science.gov (United States)

    Legrand, Baptiste; Giudice, Emmanuel; Nicolas, Aurélie; Delalande, Olivier; Le Rumeur, Elisabeth

    2011-01-01

    Dystrophin is a large protein involved in the rare genetic disease Duchenne muscular dystrophy (DMD). It functions as a mechanical linker between the cytoskeleton and the sarcolemma, and is able to resist shear stresses during muscle activity. In all, 75% of the dystrophin molecule consists of a large central rod domain made up of 24 repeat units that share high structural homology with spectrin-like repeats. However, in the absence of any high-resolution structure of these repeats, the molecular basis of dystrophin central domain's functions has not yet been deciphered. In this context, we have performed a computational study of the whole dystrophin central rod domain based on the rational homology modeling of successive and overlapping tandem repeats and the analysis of their surface properties. Each tandem repeat has very specific surface properties that make it unique. However, the repeats share enough electrostatic-surface similarities to be grouped into four separate clusters. Molecular dynamics simulations of four representative tandem repeats reveal specific flexibility or bending properties depending on the repeat sequence. We thus suggest that the dystrophin central rod domain is constituted of seven biologically relevant sub-domains. Our results provide evidence for the role of the dystrophin central rod domain as a scaffold platform with a wide range of surface features and biophysical properties allowing it to interact with its various known partners such as proteins and membrane lipids. This new integrative view is strongly supported by the previous experimental works that investigated the isolated domains and the observed heterogeneity of the severity of dystrophin related pathologies, especially Becker muscular dystrophy.

  3. Computational study of the human dystrophin repeats: interaction properties and molecular dynamics.

    Directory of Open Access Journals (Sweden)

    Baptiste Legrand

    Full Text Available Dystrophin is a large protein involved in the rare genetic disease Duchenne muscular dystrophy (DMD. It functions as a mechanical linker between the cytoskeleton and the sarcolemma, and is able to resist shear stresses during muscle activity. In all, 75% of the dystrophin molecule consists of a large central rod domain made up of 24 repeat units that share high structural homology with spectrin-like repeats. However, in the absence of any high-resolution structure of these repeats, the molecular basis of dystrophin central domain's functions has not yet been deciphered. In this context, we have performed a computational study of the whole dystrophin central rod domain based on the rational homology modeling of successive and overlapping tandem repeats and the analysis of their surface properties. Each tandem repeat has very specific surface properties that make it unique. However, the repeats share enough electrostatic-surface similarities to be grouped into four separate clusters. Molecular dynamics simulations of four representative tandem repeats reveal specific flexibility or bending properties depending on the repeat sequence. We thus suggest that the dystrophin central rod domain is constituted of seven biologically relevant sub-domains. Our results provide evidence for the role of the dystrophin central rod domain as a scaffold platform with a wide range of surface features and biophysical properties allowing it to interact with its various known partners such as proteins and membrane lipids. This new integrative view is strongly supported by the previous experimental works that investigated the isolated domains and the observed heterogeneity of the severity of dystrophin related pathologies, especially Becker muscular dystrophy.

  4. Repeat endocarditis: analysis of risk factors based on the International Collaboration on Endocarditis - Prospective Cohort Study.

    Science.gov (United States)

    Alagna, L; Park, L P; Nicholson, B P; Keiger, A J; Strahilevitz, J; Morris, A; Wray, D; Gordon, D; Delahaye, F; Edathodu, J; Miró, J M; Fernández-Hidalgo, N; Nacinovich, F M; Shahid, R; Woods, C W; Joyce, M J; Sexton, D J; Chu, V H

    2014-06-01

    Repeat episodes of infective endocarditis (IE) can occur in patients who survive an initial episode. We analysed risk factors and 1-year mortality of patients with repeat IE. We considered 1874 patients enrolled in the International Collaboration on Endocarditis - Prospective Cohort Study between January 2000 and December 2006 (ICE-PCS) who had definite native or prosthetic valve IE and 1-year follow-up. Multivariable analysis was used to determine risk factors for repeat IE and 1-year mortality. Of 1874 patients, 1783 (95.2%) had single-episode IE and 91 (4.8%) had repeat IE: 74/91 (81%) with new infection and 17/91 (19%) with presumed relapse. On bivariate analysis, repeat IE was associated with haemodialysis (p 0.002), HIV (p 0.009), injection drug use (IDU) (p < 0.001), Staphylococcus aureus IE (p 0.003), healthcare acquisition (p 0.006) and previous IE before ICE enrolment (p 0.001). On adjusted analysis, independent risk factors were haemodialysis (OR, 2.5; 95% CI, 1.2-5.3), IDU (OR, 2.9; 95% CI, 1.6-5.4), previous IE (OR, 2.8; 95% CI, 1.5-5.1) and living in the North American region (OR, 1.9; 95% CI, 1.1-3.4). Patients with repeat IE had higher 1-year mortality than those with single-episode IE (p 0.003). Repeat IE is associated with IDU, previous IE and haemodialysis. Clinicians should be aware of these risk factors in order to recognize patients who are at risk of repeat IE.

  5. Repeat film analysis and its implications for quality assurance in dental radiology: An institutional case study

    Directory of Open Access Journals (Sweden)

    Shruthi Acharya

    2015-01-01

    Full Text Available Context: The goal of any radiologist is to produce the highest quality diagnostic radiographs, while keeping patient exposure as low as reasonably achievable (ALARA. Aims: The aim of this study was to describe the reasons for radiograph rejections through a repeat film analysis in an Indian dental school. Settings and Design: An observational study conducted in the Department of Oral Medicine and Radiology, Manipal College of Dental Sciences, Manipal. Materials and Methods: During a 6-month study period, a total of 9,495 intra-oral radiographs and 2339 extraoral radiographs taken in the Radiology Department were subjected to repeat film analysis. Statistical Analysis Used: SPSS Version 16. Descriptive analysis used. Results: The results showed that the repeat rates were 7.1% and 5.86% for intraoral and extraoral radiographs, respectively. Among the causes for errors reported, positioning error (38.7% was the most common, followed by improper angulations (26.1%, and improper film placement (11.2% for intra-oral radiographs. The study found that the maximum frequency of repeats among extraoral radiographs was for panoramic radiographs (49% followed by lateral cephalogram (33%, and paranasal sinus view (14%. It was also observed that repeat rate of intraoral radiographs was highest for internees (44.7%, and undergraduate students (28.2%. Conclusions: The study pointed to a need for more targeted interventions to achieve the goal of keeping patient exposure ALARA in a dental school setting.

  6. A study of allelic polymorphism of four short tandem repeats in the population of northwestern Russia

    Energy Technology Data Exchange (ETDEWEB)

    Aseev, M.V.; Skakun, V.N.; Baranov, V.S. [Ott Institute of Obstetrics and Gynecology, St. Petersburg (Russian Federation)

    1995-06-01

    Characteristics of the allelic polymorphisms of the trimeric AGC repeat of the androgen receptor gene (Xq11-12), exon 1 (AR); the tetrameric ATCT repeat of the von Willebrand factor gene (12p12), intron 40 (vWF); the AGAT repeat of the hypoxanthine phosphoribosyltransferase gene (Xq26) (HPRT); and the AGAT repeat of anonymous DNA sequences of the short arm of chromosome X (STRX1) were studied in 160 DNA samples from unrelated inhabitants of northwestern Russia using the method of polymerase chain reaction. Seventeen, ten, eight, and nine alleles were revealed electrophoretically for short tandem repeats of AR, vWF, HPRT, and STRX1, respectively. The heterozygosity indices for these repeats were 0.80, 0.70, 0.54, and 0.58, respectively. The values for AR and vWF correlated with those expected according to the Hardy-Weinberg equilibrium, whereas the values for HPRT and STRX1 differed significantly from those theoretically expected. The individualization potentials were 0.045, 0.135, 0.095, and 0.061 for the short tandem repeats of AR, vWF, HPRT, and STRX1, respectively. The distribution of genotypes for the set of these four loci in the population studied was determined. The possibilities of using the studied polymorphic marker systems in molecular diagnosis of the corresponding monogenic diseases - spinal and bulbar muscle atrophy (AR), Lesch-Nyhan disease (HPRT), and von Willebrand disease (vWF) - as well as in population human genetics, testing of personal identity, and molecular approaches to the estimation of mutagenic activity are discussed. 17 refs., 2 figs., 6 tabs.

  7. Cumulant expansions for atmospheric flows

    CERN Document Server

    Ait-Chaalal, Farid; Meyer, Bettina; Marston, J B

    2015-01-01

    The equations governing atmospheric flows are nonlinear, and consequently the hierarchy of cumulant equations is not closed. But because atmospheric flows are inhomogeneous and anisotropic, the nonlinearity may manifests itself only weakly through interactions of mean fields with disturbances such as thermals or eddies. In such situations, truncations of the hierarchy of cumulant equations hold promise as a closure strategy. We review how truncations at second order can be used to model and elucidate the dynamics of turbulent atmospheric flows. Two examples are considered. First, we study the growth of a dry convective boundary layer, which is heated from below, leading to turbulent upward energy transport and growth of the boundary layer. We demonstrate that a quasilinear truncation of the equations of motion, in which interactions of disturbances among each other are neglected but interactions with mean fields are taken into account, can successfully capture the growth of the convective boundary layer. Seco...

  8. Anterior segment biometry: a study and review of resolution and repeatability data.

    Science.gov (United States)

    Reinstein, Dan Z; Gobbe, Marine; Archer, Timothy J

    2012-07-01

    To obtain comparable resolution and repeatability data for a selection of anterior segment imaging devices. A standard letter of request was sent in May 2008 to each device manufacturer requesting resolution and repeatability data for its device to be provided according to specific definitions and protocol; if this was not already published in the peer-reviewed domain, compliant raw data were required. Where applicable, repeatability data were reported for corneal vertex corneal thickness; epithelial and flap thickness; minimum corneal thickness; corneal, epithelial and flap thickness mapping for the central 6-mm diameter; minimum residual stromal thickness; angle-to-angle diameter; sulcus-to-sulcus diameter; and anterior chamber depth. To summarize published repeatability data, a complete review of the peer-reviewed literature waas performed. Nine of the 13 manufacturers contacted agreed to take part and provided the data requested: Pentacam HD (Oculus Optikgeräte GmbH), Galilei (Ziemer), Visante OCT (Carl Zeiss Meditec), SL-OCT (Haag-Streit), RTVue (Optovue), Artemis (ArcScan), Vumax (Sonomed), HiScan (Opticon), and Eye Cubed (Ellex/Innovative). Only one (Carl Zeiss Meditec) of 9 manufacturers was able to provide the data directly upon request, without performing a prospective study. Five of the 9 manufacturers were able to provide a complete set of repeatability data for all parameters measurable with their device; the remaining 4 manufacturers admitted that repeatability of some parameters was unknown. Both literature and manufacturers' data on file were lacking and required the study to be performed. This report provides an imperfect, but most comprehensive to date, resolution and repeatability data review of biometric devices intended for surgical planning. Copyright 2012, SLACK Incorporated.

  9. Receptionist input to quality and safety in repeat prescribing in UK general practice: ethnographic case study.

    Science.gov (United States)

    Swinglehurst, Deborah; Greenhalgh, Trisha; Russell, Jill; Myall, Michelle

    2011-11-03

    To describe, explore, and compare organisational routines for repeat prescribing in general practice to identify contributors and barriers to safety and quality. Ethnographic case study. Four urban UK general practices with diverse organisational characteristics using electronic patient records that supported semi-automation of repeat prescribing. 395 hours of ethnographic observation of staff (25 doctors, 16 nurses, 4 healthcare assistants, 6 managers, and 56 reception or administrative staff), and 28 documents and other artefacts relating to repeat prescribing locally and nationally. Potential threats to patient safety and characteristics of good practice. Observation of how doctors, receptionists, and other administrative staff contributed to, and collaborated on, the repeat prescribing routine. Analysis included mapping prescribing routines, building a rich description of organisational practices, and drawing these together through narrative synthesis. This was informed by a sociological model of how organisational routines shape and are shaped by information and communications technologies. Results Repeat prescribing was a complex, technology-supported social practice requiring collaboration between clinical and administrative staff, with important implications for patient safety. More than half of requests for repeat prescriptions were classed as "exceptions" by receptionists (most commonly because the drug, dose, or timing differed from what was on the electronic repeat list). They managed these exceptions by making situated judgments that enabled them (sometimes but not always) to bridge the gap between the idealised assumptions about tasks, roles, and interactions that were built into the electronic patient record and formal protocols, and the actual repeat prescribing routine as it played out in practice. This work was creative and demanded both explicit and tacit knowledge. Clinicians were often unaware of this input and it did not feature in policy

  10. Planned Repeat Cesarean Section at Term and Adverse Childhood Health Outcomes: A Record-Linkage Study.

    Directory of Open Access Journals (Sweden)

    Mairead Black

    2016-03-01

    Full Text Available Global cesarean section (CS rates range from 1% to 52%, with a previous CS being the commonest indication. Labour following a previous CS carries risk of scar rupture, with potential for offspring hypoxic brain injury, leading to high rates of repeat elective CS. However, the effect of delivery by CS on long-term outcomes in children is unclear. Increasing evidence suggests that in avoiding exposure to maternal bowel flora during labour or vaginal birth, offspring delivered by CS may be adversely affected in terms of energy uptake from the gut and immune development, increasing obesity and asthma risks, respectively. This study aimed to address the evidence gap on long-term childhood outcomes following repeat CS by comparing adverse childhood health outcomes after (1 planned repeat CS and (2 unscheduled repeat CS with those that follow vaginal birth after CS (VBAC.A data-linkage cohort study was performed. All second-born, term, singleton offspring delivered between 1 January 1993 and 31 December 2007 in Scotland, UK, to women with a history of CS (n = 40,145 were followed up until 31 January 2015. Outcomes assessed included obesity at age 5 y, hospitalisation with asthma, learning disability, cerebral palsy, and death. Cox regression and binary logistic regression were used as appropriate to compare outcomes following planned repeat CS (n = 17,919 and unscheduled repeat CS (n = 8,847 with those following VBAC (n = 13,379. Risk of hospitalisation with asthma was greater following both unscheduled repeat CS (3.7% versus 3.3%, adjusted hazard ratio [HR] 1.18, 95% CI 1.05-1.33 and planned repeat CS (3.6% versus 3.3%, adjusted HR 1.24, 95% CI 1.09-1.42 compared with VBAC. Learning disability and death were more common following unscheduled repeat CS compared with VBAC (3.7% versus 2.3%, adjusted odds ratio 1.64, 95% CI 1.17-2.29, and 0.5% versus 0.4%, adjusted HR 1.50, 95% CI 1.00-2.25, respectively. Risk of obesity at age 5 y and risk of cerebral

  11. A population-based case-control study of Selective Serotonin Reuptake Inhibitors (SSRIs and breast cancer: The impact of duration of use, cumulative dose and latency

    Directory of Open Access Journals (Sweden)

    Lévesque LE

    2010-12-01

    Full Text Available Abstract Background Selective serotonin reuptake inhibitors (SSRIs, a popular class of antidepressants, may increase breast cancer risk by stimulating the secretion of prolactin, a potential tumour promoter. We evaluated the effects of duration of SSRI use, cumulative dose, and latency on the risk of breast cancer by conducting a population-based case-control study utilizing Saskatchewan health databases. Methods Cases included 1,701 women with primary invasive breast cancer diagnosed from 2003 to 2006, and controls consisted of 17,017 women, randomly selected from the population registry. Use of SSRIs was compiled using the Saskatchewan prescription database. Unconditional logistic regression was conducted to evaluate the impact of duration of combined SSRI use (total number of prescriptions dispensed, cumulative dose (total dosage received and timing of use (two or more years, two to seven years and more than seven years prior to index date on the risk of breast cancer. Results Overall, SSRI use was not associated with an increased risk of breast cancer regardless of our definition of cumulative use (total number of prescriptions dispensed and total dosage. In addition, our results indicate that prolonged SSRI use does not have a latent effect on breast cancer risk. Also, our findings are not suggestive of an increased risk of breast cancer with the use of individual SSRIs. Conclusions Our study improved upon most previous studies by having a longer follow-up period, a larger sample size of long-term SSRI users and consideration of risk during specific exposure time windows that take latency into account. Given the potential health benefits of using SSRIs, our results suggest that the issue of breast cancer risk may no longer be a concern for women requiring long-term SSRIs.

  12. Cumulative Timers for Microprocessors

    Science.gov (United States)

    Battle, John O.

    2007-01-01

    It has been proposed to equip future microprocessors with electronic cumulative timers, for essentially the same reasons for which land vehicles are equipped with odometers (total-distance-traveled meters) and aircraft are equipped with Hobbs meters (total-engine-operating time meters). Heretofore, there has been no way to determine the amount of use to which a microprocessor (or a product containing a microprocessor) has been subjected. The proposed timers would count all microprocessor clock cycles and could only be read by means of microprocessor instructions but, like odometers and Hobbs meters, could never be reset to zero without physically damaging the chip.

  13. Cumulative Vehicle Routing Problems

    OpenAIRE

    Kara, &#;mdat; Kara, Bahar Yeti&#;; Yeti&#;, M. Kadri

    2008-01-01

    This paper proposes a new objective function and corresponding formulations for the vehicle routing problem. The new cost function defined as the product of the distance of the arc and the flow on that arc. We call a vehicle routing problem with this new objective function as the Cumulative Vehicle Routing Problem (CumVRP). Integer programming formulations with O(n2) binary variables and O(n2) constraints are developed for both collection and delivery cases. We show that the CumVRP is a gener...

  14. Longitudinal study of repeated sprint performance in youth soccer players of contrasting skeletal maturity status

    NARCIS (Netherlands)

    Valente-dos-Santos, Joao; Coelho-e-Silva, Manuel J.; Severino, Vitor; Duarte, Joao; Martins, Raul S.; Figueiredo, Antonio J.; Seabra, Andre T.; Philippaerts, Renaat M.; Cumming, Sean P.; Elferink-Gemser, Marije; Malina, Robert M.

    The purpose of the study was to evaluate the developmental changes in performance in a repeated-sprint ability (RSA) test in young soccer players of contrasting maturity status. A total of 83 regional level Portuguese youth soccer players, aged 11-13 years at baseline was assessed annually. Stature,

  15. Longitudinal study of repeated sprint performance in youth soccer players of contrasting maturity status

    NARCIS (Netherlands)

    V. Duarte; A. Seabra; A. Figueiredo; S. Cumming; R. Martins; R. Philippaerts; M. Coelho e Silva; J. Valente dos Santos; V. Severino; Marije Elferink-Gemser

    2012-01-01

    The purpose of the study was to evaluate the developmental changes in performance in a repeated-sprint ability (RSA) test in young soccer players of contrasting maturity status. A total of 83 regional level Portuguese youth soccer players, aged 11- 13 years at baseline was assessed annually.

  16. 40 CFR 799.9305 - TSCA Repeated dose 28-day oral toxicity study in rodents.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 31 2010-07-01 2010-07-01 true TSCA Repeated dose 28-day oral toxicity study in rodents. 799.9305 Section 799.9305 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... strains of young healthy adult animals should be employed. The females should be nulliparous and...

  17. [Reconstruction of urban land space based on minimum cumulative resistance model: a case study of Xintang Town, Guangzhou City].

    Science.gov (United States)

    Zhong, Shi-Yu; Wu, Qing; Li, Yu; Cheng, Jin-Ping

    2012-11-01

    Based on the source-sink landscape theory and the principles of ecosystem services, the minimum cumulative resistance (MCR) model was modified, where the urban center construction land was taken as the expansion source, and the contribution rate of ecological land ecosystem services value was considered as the resistance coefficient. With the modified MCR, the urban spatial expansion process of Xintang Town, Guangzhou City was successfully simulated, and, based on the protection of ecological security pattern, the optimum path for reconstructing urban land space was put forward. The simulated urban spatial expansion short path in 1988-2008 was in accordance with the real situation. By the modified MCR, the urban space was divided into four zones of high, higher, medium, and low resistance, with the area of 80.84, 78.90, 24.26, and 61.88 km2, respectively. The expansion path of the urban space was along the route from low to medium and then to high resistance zones successively. The land suitable for eco-protection and construction had an area of 159.74 km2 and 86.14 km2, while the ecological conflict area (17.37 km2) was mainly located in higher and high resistance zones, being 10.38 and 6.99 km2, respectively. The modified MCR could not only effectively reflect the distribution area of urban land use and the conflict relationship between urban construction and ecological protection, but also reasonably judge the best developmental short path for urban spatial expansion.

  18. A Preliminary Study of the Effects of Repeated Massage on Hypothalamic–Pituitary–Adrenal and Immune Function in Healthy Individuals: A Study of Mechanisms of Action and Dosage

    Science.gov (United States)

    Schettler, Pamela; Bresee, Catherine

    2012-01-01

    Abstract Objectives This study gathers preliminary data about the biologic effects of repeated Swedish massage therapy compared to a light-touch control condition. Design The study design was a 5-week comparison of repeated Swedish massage and light touch on oxytocin (OT), arginine-vasopressin (AVP), adrenal corticotropin hormone (ACTH), cortisol (CORT), circulating phenotypic lymphocyte markers, and mitogen-stimulated cytokine function. Setting The setting was an outpatient research unit in an academic medical center. Participants The study subjects were medically and psychiatrically healthy young adults. Intervention The study comprised 45 minutes of Swedish massage or light touch, using highly specified and identical protocols, either weekly or twice weekly for 5 weeks. Outcome measures The outcome measures were mean differences between massage and light touch on OT, AVP, ACTH, CORT, lymphocyte markers, and cytokine levels. Results Compared to the touch control condition, weekly Swedish massage stimulated a sustained pattern of increased circulating phenotypic lymphocyte markers and decreased mitogen-stimulated cytokine production, similar to what was previously reported for a single massage session, while having minimal effect on hypothalamic–pituitary–adrenal function. Twice-weekly massage produced a different response pattern with increased OT levels, decreased AVP, and decreased CORT but little effect on circulating lymphocyte phenotypic markers and a slight increase in mitogen-stimulated interferon-γ, tumor necrosis factor-α, interleukin (IL)-1b and IL-2 levels, suggesting increased production of pro-inflammatory cytokines. Conclusions There are sustained cumulative biologic actions for the massage and touch interventions that persist for several days or a week, and these differ profoundly depending on the dosage (frequency) of sessions. Confirmatory studies in larger samples are needed. PMID:22775448

  19. Prevalence and cumulative incidence of abnormal cervical cytology among HIV-infected Thai women: a 5.5-year retrospective cohort study

    Directory of Open Access Journals (Sweden)

    Thamkhantho Manopchai

    2011-01-01

    Full Text Available Abstract Background Cervical cancer is one of the most common AIDS-related malignancies in Thailand. To prevent cervical cancer, The US Public Health Service and The Infectious Disease Society of America have recommended that all HIV-infected women should obtain 2 Pap smears 6 months apart after the initial HIV diagnosis and, if results of both are normal, should undergo annual cytological screening. However, there has been no evidence in supporting whether this guideline is appropriate in all settings - especially in areas where HIV-infected women are living in resource-constrained condition. Methods To determine the appropriate interval of Pap smear screenings for HIV-infected Thai women and risk factors for subsequent abnormal cervical cytology, we assessed the prevalence, cumulative incidence and associated factors of cervical cell abnormalities (atypical squamous cell of undetermined significance or higher grades, ASCUS+ among this group of patients. Results The prevalence of ASCUS+ was 15.4% at the first visit, and the cumulative incidence of ASCUS+ gradually increased to 37% in the first 3.5 years of follow-up appointments (first 7 times, and tended to plateau in the last 2 years. For multivariate correlation analysis, women with a CD4 count P = 0.043. There were no associations of subsequent ASCUS+ with age, pregnancy, contraceptive method, highly active anti-retroviral treatment, assumed duration of infection, or the CD4 count nadir level. Conclusion There are high prevalence and cumulative incidence of ASCUS+ in HIV-infected Thai women. With a high lost-to-follow-up rate, an appropriate interval of Pap smear screening cannot be concluded from the present study. Nevertheless, the HIV-infected Thai women may require more than two normal semi-annual Pap smears before shifting to routinely annual cytologic screening.

  20. Optimal selection of individuals for repeated covariate measurements in follow-up studies.

    Science.gov (United States)

    Reinikainen, Jaakko; Karvanen, Juha; Tolonen, Hanna

    2016-12-01

    Repeated covariate measurements bring important information on the time-varying risk factors in long epidemiological follow-up studies. However, due to budget limitations, it may be possible to carry out the repeated measurements only for a subset of the cohort. We study cost-efficient alternatives for the simple random sampling in the selection of the individuals to be remeasured. The proposed selection criteria are based on forms of the D-optimality. The selection methods are compared with the simulation studies and illustrated with the data from the East-West study carried out in Finland from 1959 to 1999. The results indicate that cost savings can be achieved if the selection is focused on the individuals with high expected risk of the event and, on the other hand, on those with extreme covariate values in the previous measurements. © The Author(s) 2014.

  1. A new family of cumulative indexes for measuring scientific performance.

    Directory of Open Access Journals (Sweden)

    Marcin Kozak

    Full Text Available In this paper we propose a new family of cumulative indexes for measuring scientific performance which can be applied to many metrics, including h index and its variants (here we apply it to the h index, h(2 index and Google Scholar's i10 index. These indexes follow the general principle of repeating the index calculation for the same publication set. Using bibliometric data and reviewer scores for accepted and rejected fellowship applicants we examine how valid the cumulative variant is compared to the original variant. These analyses showed that the cumulative indexes result in higher correlations with the reviewer scores than their original variants. Thus, the cumulative indexes better reflect the assessments by peers than the original variants and are useful extensions of the original indexes. In contrast to many other measures of scientific performance proposed up to now, the cumulative indexes seem not only to be effective, but they are also easy to understand and calculate.

  2. Brexpiprazole Alters Monoaminergic Systems following Repeated Administration: an in Vivo Electrophysiological Study

    OpenAIRE

    Oosterhof, Chris A.; Mansari, Mostafa El; Bundgaard, Christoffer; Blier, Pierre

    2015-01-01

    Background: Brexpiprazole was recently approved as adjunctive therapy for depression and treatment of schizophrenia in adults. To complement results from a previous study in which its acute effects were characterized, the present study assessed the effect of repeated brexpiprazole administration on monoaminergic systems. Methods: Brexpiprazole (1mg/kg, subcutaneous) or vehicle was administered once daily for 2 and 14 days. Single-unit electrophysiological recordings from noradrenaline neurons...

  3. Cumulative environmental effects. Summary

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-07-01

    This report presents a compilation of knowledge about the state of the environment and human activity in the Norwegian part of the North Sea and Skagerrak. The report gives an overview of pressures and impacts on the environment from normal activity and in the event of accidents. This is used to assess the cumulative environmental effects, which factors have most impact and where the impacts are greatest, and to indicate which problems are expected to be most serious in the future. The report is intended to provide relevant information that can be used in the management of the marine area in the future. It also provides input for the identification of environmental targets and management measures for the North Sea and Skagerrak.(Author)

  4. Mariner 4 - A study of the cumulative flux of dust particles over a heliocentric range of 1-1.56 AU 1964-1967

    Science.gov (United States)

    Alexander, W. M.; Bohn, J. L.

    1974-01-01

    Between December 1964 and December 1967, the Mariner 4 dust particle experiment obtained data concerning the distribution of minute zodiacal dust cloud particles over a heliocentric range of 1-1.56 AU. The first measurement was over the complete heliocentric range, while the two additional measurements were made between 1.1 and 1.25 AU in 1966, and between 1.2 and 1.5 AU in 1967. The initial results of these measurements presented the mean cumulative flux for the respective data periods. The results of a detailed study and comparison of the three measurements are presented, with particular emphasis on the variation of the flux as a function of heliocentric range. A small, but statistically significant, increase in the flux is observed between 1.15 and 1.4 AU. The initial reports showed a lower cumulative flux for the latter two measurements. However, a detailed analysis containing corrections for spacecraft attitude indicate that all three measurements yield similar results, and that the particles detected were in low inclination orbits.

  5. A mobile test facility based on a magnetic cumulative generator to study the stability of the power plants under impact of lightning currents

    Science.gov (United States)

    Shurupov, A. V.; Zavalova, V. E.; Kozlov, A. V.; Shurupov, M. A.

    2016-12-01

    The report presents the results of the development and field testing of a mobile test facility based on a helical magnetic cumulative generator (MCGTF). The system is designed for full-scale modeling of lightning currents to study the safety of power plants of any type, including nuclear power plants. Advanced technologies of high-energy physics for solving both engineering and applied problems underlie this pilot project. The energy from the magnetic cumulative generator (MCG) is transferred to a high-impedance load with high efficiency of more than 50% using pulse transformer coupling. Modeling of the dynamics of the MEG that operates in a circuit with lumped parameters allows one to apply the law of inductance output during operation of the MCG, thus providing the required front of the current pulse in the load without using any switches. The results of field testing of the MCGTF are presented for both the ground loop and the model load. The ground loop generates a load resistance of 2-4 Ω. In the tests, the ohmic resistance of the model load is 10 Ω. It is shown that the current pulse parameters recorded in the resistive-inductive load are close to the calculated values.

  6. A mobile test facility based on a magnetic cumulative generator to study the stability of the power plants under impact of lightning currents

    Energy Technology Data Exchange (ETDEWEB)

    Shurupov, A. V.; Zavalova, V. E., E-mail: zavalova@fites.ru; Kozlov, A. V.; Shurupov, M. A. [Russian Academy of Sciences, Joint Institute for High Temperatures (Russian Federation)

    2016-12-15

    The report presents the results of the development and field testing of a mobile test facility based on a helical magnetic cumulative generator (MCGTF). The system is designed for full-scale modeling of lightning currents to study the safety of power plants of any type, including nuclear power plants. Advanced technologies of high-energy physics for solving both engineering and applied problems underlie this pilot project. The energy from the magnetic cumulative generator (MCG) is transferred to a high-impedance load with high efficiency of more than 50% using pulse transformer coupling. Modeling of the dynamics of the MEG that operates in a circuit with lumped parameters allows one to apply the law of inductance output during operation of the MCG, thus providing the required front of the current pulse in the load without using any switches. The results of field testing of the MCGTF are presented for both the ground loop and the model load. The ground loop generates a load resistance of 2–4 Ω. In the tests, the ohmic resistance of the model load is 10 Ω. It is shown that the current pulse parameters recorded in the resistive-inductive load are close to the calculated values.

  7. Evaluation of statistical tools used in short-term repeated dose administration toxicity studies with rodents.

    Science.gov (United States)

    Kobayashi, Katsumi; Pillai, K Sadasivan; Sakuratani, Yuki; Abe, Takemaru; Kamata, Eiichi; Hayashi, Makoto

    2008-02-01

    In order to know the different statistical tools used to analyze the data obtained from twenty-eight-day repeated dose oral toxicity studies with rodents and the impact of these statistical tools on interpretation of data obtained from the studies, study reports of 122 numbers of twenty-eight-day repeated dose oral toxicity studies conducted in rats were examined. It was found that both complex and easy routes of decision trees were followed for the analysis of the quantitative data. These tools include Scheffe's test, non-parametric type Dunnett's and Scheffe's tests with very low power. Few studies used the non-parametric Dunnett type test and Mann-Whitney's U test. Though Chi-square and Fisher's tests are widely used for analysis of qualitative data, their sensitivity to detect a treatment-related effect is questionable. Mann-Whitney's U test has better sensitivity to analyze qualitative data than the chi-square and Fisher's tests. We propose Dunnett's test for analysis of quantitative data obtained from twenty-eight-day repeated dose oral toxicity tests and for qualitative data, Mann-Whitney's U test. For both tests, one-sided test with p=0.05 may be applied.

  8. Acute and repeated dose toxicity studies of different β-cyclodextrin-based nanosponge formulations.

    Science.gov (United States)

    Shende, Pravin; Kulkarni, Yogesh A; Gaud, R S; Deshmukh, Kiran; Cavalli, Roberta; Trotta, Francesco; Caldera, Fabrizio

    2015-05-01

    Nanosponges (NS) show promising results in different fields such as medicine, agriculture, water purification, fire engineering and so on. The present study was designed to evaluate toxicity of different NS formulations (namely, S1-S6) synthesized with different cross-linking agents such as carbonyl diimidazole, pyromellitic dianhydride and hexamethylene diisocynate; and preparation methods in experimental animals. Acute and repeated dose toxicity studies of formulations were carried out as per OECD guidelines 423 and 407, respectively. For acute toxicity study, formulations were administered to female rats at doses of 300 and 2000 mg/kg orally. The general behaviour of the rats was continuously monitored for 1 h after dosing, periodically during the first 24 h and daily thereafter for a total of 14 days. On day 14, animals were fasted overnight, weighed, and sacrificed. After sacrification, animals were subjected to necropsy. For repeated dose toxicity study, rats of either sex were orally administered with formulations at the dose of 300 mg/kg per day for a period of 28 days. The maximally tolerated dose of all formulations was found to be 2000 mg/kg. Repeated administration of formulations for 28 days did not show any significant changes in haematological and biochemical parameters in experimental animals. These results indicate that the formulations are safe, when tested in experimental animals.

  9. Repeated vertebral augmentation for new vertebral compression fractures of postvertebral augmentation patients: a nationwide cohort study

    Directory of Open Access Journals (Sweden)

    Liang CL

    2015-03-01

    Full Text Available Cheng-Loong Liang,1 Hao-Kwan Wang,1 Fei-Kai Syu,2 Kuo-Wei Wang,1 Kang Lu,1 Po-Chou Liliang1 1Department of Neurosurgery, E-Da Hospital, I-Shou University, Kaohsiung City, Taiwan; 2Department of Pharmacy, China Medical University Hospital, Taichung City, Taiwan Purpose: Postvertebral augmentation vertebral compression fractures are common; repeated vertebral augmentation is usually performed for prompt pain relief. This study aimed to evaluate the incidence and risk factors of repeat vertebral augmentation.Methods: We performed a retrospective, nationwide, population-based longitudinal observation study, using the National Health Insurance Research Database (NHIRD of Taiwan. All patients who received vertebral augmentation for vertebral compression fractures were evaluated. The collected data included patient characteristics (demographics, comorbidities, and medication exposure and repeat vertebral augmentation. Kaplan–Meier and stratified Cox proportional hazard regressions were performed for analyses.Results: The overall incidence of repeat vertebral augmentation was 11.3% during the follow-up until 2010. Patients with the following characteristics were at greater risk for repeat vertebral augmentation: female sex (AOR=1.24; 95% confidence interval [CI]: 1.10–2.36, advanced age (AOR=1.60; 95% CI: 1.32–2.08, diabetes mellitus (AOR=4.31; 95% CI: 4.05–5.88, cerebrovascular disease (AOR=4.09; 95% CI: 3.44–5.76, dementia (AOR=1.97; 95% CI: 1.69–2.33, blindness or low vision (AOR=3.72; 95% CI: 2.32–3.95, hypertension (AOR=2.58; 95% CI: 2.35–3.47, and hyperlipidemia (AOR=2.09; 95% CI: 1.67–2.22. Patients taking calcium/ vitamin D (AOR=2.98; 95% CI: 1.83–3.93, bisphosphonates (AOR=2.11; 95% CI: 1.26–2.61, or calcitonin (AOR=4.59; 95% CI: 3.40–5.77 were less likely to undergo repeat vertebral augmentation; however, those taking steroids (AOR=7.28; 95% CI: 6.32–8.08, acetaminophen (AOR=3.54; 95% CI: 2.75–4.83, or nonsteroidal

  10. The cumulative incidence of conventional risk factors of cardiovascular disease and their population attributable risk in an Iranian population: The Isfahan Cohort Study

    Directory of Open Access Journals (Sweden)

    Masoumeh Sadeghi

    2014-01-01

    Full Text Available Background: Cardiovascular diseases (CVDs are the leading cause of death in Iran. The present study evaluated the 7-year incidence of CVD risk factors among the participants of Isfahan cohort study (ICS. Materials and Methods: ICS was a longitudinal study on adults over 35 years of age from the urban and rural areas in three counties in central Iran. Data on clinical examination and blood measurements were collected in 2001. Subjects were followed and similar data were collected in 2007. Cumulative incidence was calculated through dividing new cases of each risk factor by the population free of that risk factor at baseline. Incidence proportion was determined for major CVD risk factors including hypertension (HTN, hypercholesterolemia (HC, hypertriglyceridemia (HTg, obesity, diabetes mellitus (DM, metabolic syndrome (MetS, and smoking. Results: A total number of 6323 adults free of CVDs were recruited. After 7 years of follow-up, 3283 individuals were re-evaluated in 2007. The participants′ age was 49.2 ± 10.3 years in 2001 (mean ± SD. The 7-year cumulative incidence of HTN, HC, HTg, overweight, obesity, DM, MetS, and smoking was 22.8%, 37.4%, 28.0%, 26.3%, 7.4%, 9.5%, 23.9%, and 5.9% in men and 22.2%, 55.4%, 33.5%, 35.0%, 18.8%, 11.3%, 36.1%, and 0.7% in women, respectively. Among those with overweight or obesity, 14.7% of men and 7.9% of women decreased their weight up to the normal level. Conclusions: The present study revealed a high incidence of CVD risk factors especially dyslipidemia, obesity, MetS and HTN. Therefore, the application of life-style modification interventions seems necessary.

  11. Chromosomal abnormalities in couples with repeated fetal loss: An Indian retrospective study

    Directory of Open Access Journals (Sweden)

    Frenny J Sheth

    2013-01-01

    Full Text Available Background: Recurrent pregnancy loss is a common occurrence and a matter of concern for couples planning the pregnancy. Chromosomal abnormalities, mainly balanced rearrangements, are common in couples with repeated miscarriages. Purpose: The purpose of this study is to evaluate the contribution of chromosomal anomalies causing repeated spontaneous miscarriages and provide detailed characterization of a few structurally altered chromosomes. Materials and Methods: A retrospective cytogenetic study was carried out on 4859 individuals having a history of recurrent miscarriages. The cases were analyzed using G-banding and fluorescence in situ hybridization wherever necessary. Results: Chromosomal rearrangements were found in 170 individuals (3.5%. Translocations were seen in 72 (42.35% cases. Of these, reciprocal translocations constituted 42 (24.70% cases while Robertsonian translocations were detected in 30 (17.64% cases. 7 (4.11% cases were mosaic, 8 (4.70% had small supernumerary marker chromosomes and 1 (0.6% had an interstitial microdeletion. Nearly, 78 (1.61% cases with heteromorphic variants were seen of which inversion of Y chromosome (57.70% and chromosome 9 pericentromeric variants (32.05% were predominantly involved. Conclusions: Chromosomal analysis is an important etiological investigation in couples with repeated miscarriages. Characterization of variants/marker chromosome enable calculation of a more precise recurrent risk in a subsequent pregnancy thereby facilitating genetic counseling and deciding further reproductive options.

  12. UBIQUITOUS POLLUTANTS FROM CUMULATIVE ...

    Science.gov (United States)

    The occurrence of pharmaceuticals and personal care products (PPCPS) as environmental pollutants is a multifaceted issue whose scope continues to become better delineated since the escalation of concerted attention beginning in the 1980s. PPCPs typically occur as trace environmental pollutants (primarily in surface but also in ground waters) as a result of their widespread, continuous, combined usage in a broad range of human and veterinary therapeutic activities and practices. With respect to the risk-assessment paradigm, the growing body of published work has focused primarily on the origin and occurrence of these substances. Comparatively less is known about human and ecological exposure, and even less about the known or even potential hazards associated with exposure to these anthropogenic substances, many of which are highly bioactive. The continually growing, worldwide importance of freshwater resources underscores the need for ensuring that any aggregate or cumulative impacts on water supplies and resultant potential for human or ecological exposure be minimized. This has prompted the more recent investigations on waste treatment processes for one of the major sources of environmental disposition, namely sewage. Despite the paucity of health effects data for long-term, simultaneous exposure to multiple xenobiotics (particularly PPCPS) at low doses (a major toxicological issue that can be described by the

  13. On the Applicability of Elastic Network Models for the Study of RNA CUG Trinucleotide Repeat Overexpansion.

    Directory of Open Access Journals (Sweden)

    Àlex L González

    Full Text Available Non-coding RNAs play a pivotal role in a number of diseases promoting an aberrant sequestration of nuclear RNA-binding proteins. In the particular case of myotonic dystrophy type 1 (DM1, a multisystemic autosomal dominant disease, the formation of large non-coding CUG repeats set up long-tract hairpins able to bind muscleblind-like proteins (MBNL, which trigger the deregulation of several splicing events such as cardiac troponin T (cTNT and insulin receptor's, among others. Evidence suggests that conformational changes in RNA are determinant for the recognition and binding of splicing proteins, molecular modeling simulations can attempt to shed light on the structural diversity of CUG repeats and to understand their pathogenic mechanisms. Molecular dynamics (MD are widely used to obtain accurate results at atomistic level, despite being very time consuming, and they contrast with fast but simplified coarse-grained methods such as Elastic Network Model (ENM. In this paper, we assess the application of ENM (traditionally applied on proteins for studying the conformational space of CUG repeats and compare it to conventional and accelerated MD conformational sampling. Overall, the results provided here reveal that ANM can provide useful insights into dynamic rCUG structures at a global level, and that their dynamics depend on both backbone and nucleobase fluctuations. On the other hand, ANM fail to describe local U-U dynamics of the rCUG system, which require more computationally expensive methods such as MD. Given that several limitations are inherent to both methods, we discuss here the usefulness of the current theoretical approaches for studying highly dynamic RNA systems such as CUG trinucleotide repeat overexpansions.

  14. Cumulative Stress and Cortisol Disruption among Black and Hispanic Pregnant Women in an Urban Cohort

    Science.gov (United States)

    Suglia, Shakira Franco; Staudenmayer, John; Cohen, Sheldon; Enlow, Michelle Bosquet; Rich-Edwards, Janet W.; Wright, Rosalind J.

    2010-01-01

    While adult hypothalamic-pituitary-adrenocortical (HPA) axis functioning is thought to be altered by traumatic experiences, little data exist on the effects of cumulative stress on HPA functioning among pregnant women or among specific racial and ethnic groups. Individuals may be increasingly vulnerable to physiological alterations when experiencing cumulative effects of multiple stressors. These effects may be particularly relevant in urban poor communities where exposure to multiple stressors is more prevalent. The goal of this study was to explore the effects of multiple social stressors on HPA axis functioning in a sample of urban Black (n = 68) and Hispanic (n = 132) pregnant women enrolled in the Asthma Coalition on Community, Environment, and Social Stress (ACCESS). Pregnant women were administered the Revised Conflict Tactics Scale (R-CTS) survey to assess interpersonal violence, the Experiences of Discrimination (EOD) survey, the Crisis in Family Systems-Revised (CRISYS-R) negative life events survey, and the My Exposure to Violence (ETV) survey, which ascertains exposure to community violence. A cumulative stress measure was derived from these instruments. Salivary cortisol samples were collected five times per day over three days to assess area under the curve (AUC), morning change, and basal awakening response in order to characterize diurnal salivary cortisol patterns. Repeated measures mixed models, stratified by race/ethnicity, were performed adjusting for education level, age, smoking status, body mass index and weeks pregnant at time of cortisol sampling. The majority of Hispanic participants (57%) had low cumulative stress exposure, while the majority of Black participants had intermediate (35%) or high (41%) cumulative stress exposure. Results showed that among Black but not Hispanic women, cumulative stress was associated with lower morning cortisol levels, including a flatter waking to bedtime rhythm. These analyses suggest that the combined

  15. Cumulative Stress and Cortisol Disruption among Black and Hispanic Pregnant Women in an Urban Cohort.

    Science.gov (United States)

    Suglia, Shakira Franco; Staudenmayer, John; Cohen, Sheldon; Enlow, Michelle Bosquet; Rich-Edwards, Janet W; Wright, Rosalind J

    2010-12-01

    While adult hypothalamic-pituitary-adrenocortical (HPA) axis functioning is thought to be altered by traumatic experiences, little data exist on the effects of cumulative stress on HPA functioning among pregnant women or among specific racial and ethnic groups. Individuals may be increasingly vulnerable to physiological alterations when experiencing cumulative effects of multiple stressors. These effects may be particularly relevant in urban poor communities where exposure to multiple stressors is more prevalent. The goal of this study was to explore the effects of multiple social stressors on HPA axis functioning in a sample of urban Black (n = 68) and Hispanic (n = 132) pregnant women enrolled in the Asthma Coalition on Community, Environment, and Social Stress (ACCESS). Pregnant women were administered the Revised Conflict Tactics Scale (R-CTS) survey to assess interpersonal violence, the Experiences of Discrimination (EOD) survey, the Crisis in Family Systems-Revised (CRISYS-R) negative life events survey, and the My Exposure to Violence (ETV) survey, which ascertains exposure to community violence. A cumulative stress measure was derived from these instruments. Salivary cortisol samples were collected five times per day over three days to assess area under the curve (AUC), morning change, and basal awakening response in order to characterize diurnal salivary cortisol patterns. Repeated measures mixed models, stratified by race/ethnicity, were performed adjusting for education level, age, smoking status, body mass index and weeks pregnant at time of cortisol sampling. The majority of Hispanic participants (57%) had low cumulative stress exposure, while the majority of Black participants had intermediate (35%) or high (41%) cumulative stress exposure. Results showed that among Black but not Hispanic women, cumulative stress was associated with lower morning cortisol levels, including a flatter waking to bedtime rhythm. These analyses suggest that the combined

  16. Study of Optimal Perimetric Testing in Children (OPTIC: Feasibility, Reliability and Repeatability of Perimetry in Children.

    Directory of Open Access Journals (Sweden)

    Dipesh E Patel

    Full Text Available To investigate feasibility, reliability and repeatability of perimetry in children.A prospective, observational study recruiting 154 children aged 5-15 years, without an ophthalmic condition that affects the visual field (controls, identified consecutively between May 2012 and November 2013 from hospital eye clinics. Perimetry was undertaken in a single sitting, with standardised protocols, in a randomised order using the Humphrey static (SITA 24-2 FAST, Goldmann and Octopus kinetic perimeters. Data collected included test duration, subjective experience and test quality (incorporating examiner ratings on comprehension of instructions, fatigue, response to visual and auditory stimuli, concentration and co-operation to assess feasibility and reliability. Testing was repeated within 6 months to assess repeatability.Overall feasibility was very high (Goldmann=96.1%, Octopus=89% and Humphrey=100% completed the tests. Examiner rated reliability was 'good' in 125 (81.2% children for Goldmann, 100 (64.9% for Octopus and 98 (63.6% for Humphrey perimetry. Goldmann perimetry was the most reliable method in children under 9 years of age. Reliability improved with increasing age (multinomial logistic regression (Goldmann, Octopus and Humphrey, p<0.001. No significant differences were found for any of the three test strategies when examining initial and follow-up data outputs (Bland-Altman plots, n=43, suggesting good test repeatability, although the sample size may preclude detection of a small learning effect.Feasibility and reliability of formal perimetry in children improves with age. By the age of 9 years, all the strategies used here were highly feasible and reliable. Clinical assessment of the visual field is achievable in children as young as 5 years, and should be considered where visual field loss is suspected. Since Goldmann perimetry is the most effective strategy in children aged 5-8 years and this perimeter is no longer available, further

  17. Using Bayesian analysis in repeated preclinical in vivo studies for a more effective use of animals.

    Science.gov (United States)

    Walley, Rosalind; Sherington, John; Rastrick, Joe; Detrait, Eric; Hanon, Etienne; Watt, Gillian

    2016-05-01

    Whilst innovative Bayesian approaches are increasingly used in clinical studies, in the preclinical area Bayesian methods appear to be rarely used in the reporting of pharmacology data. This is particularly surprising in the context of regularly repeated in vivo studies where there is a considerable amount of data from historical control groups, which has potential value. This paper describes our experience with introducing Bayesian analysis for such studies using a Bayesian meta-analytic predictive approach. This leads naturally either to an informative prior for a control group as part of a full Bayesian analysis of the next study or using a predictive distribution to replace a control group entirely. We use quality control charts to illustrate study-to-study variation to the scientists and describe informative priors in terms of their approximate effective numbers of animals. We describe two case studies of animal models: the lipopolysaccharide-induced cytokine release model used in inflammation and the novel object recognition model used to screen cognitive enhancers, both of which show the advantage of a Bayesian approach over the standard frequentist analysis. We conclude that using Bayesian methods in stable repeated in vivo studies can result in a more effective use of animals, either by reducing the total number of animals used or by increasing the precision of key treatment differences. This will lead to clearer results and supports the "3Rs initiative" to Refine, Reduce and Replace animals in research. Copyright © 2016 John Wiley & Sons, Ltd.

  18. Cumulative incidence for wait-list death in relation to length of queue for coronary-artery bypass grafting: a cohort study

    Directory of Open Access Journals (Sweden)

    Levy Adrian R

    2006-08-01

    Full Text Available Abstract Background In deciding where to undergo coronary-artery bypass grafting, the length of surgical wait lists is often the only information available to cardiologists and their patients. Our objective was to compare the cumulative incidence for death on the wait list according to the length of wait lists at the time of registration for the operation. Methods The study cohort included 8966 patients who registered to undergo isolated coronary-artery bypass grafting (82.4% men; 71.9% semi-urgent; 22.4% non-urgent. The patients were categorized according to wait-list clearance time at registration: either "1 month or less" or "more than 1 month". Cumulative incidence for wait-list death was compared between the groups, and the significance of difference was tested by means of regression models. Results Urgent patients never registered on a wait list with a clearance time of more than 1 month. Semi-urgent patients registered on shorter wait lists more often than non-urgent patients (79.1% vs. 44.7%. In semi-urgent and non-urgent patients, the observed proportion of wait-list deaths by 52 weeks was lower in category "1 month or less" than in category "more than 1 month" (0.8% [49 deaths] vs. 1.6% [39 deaths], P P Conclusion Long wait lists for coronary-artery bypass grafting are associated with increased probability that a patient dies before surgery. Physicians who advise patients where to undergo cardiac revascularization should consider the risk of pre-surgical death that is associated with the length of a surgical wait list.

  19. Implementation of repeat HIV testing during pregnancy in Kenya: a qualitative study.

    Science.gov (United States)

    Rogers, Anna Joy; Weke, Elly; Kwena, Zachary; Bukusi, Elizabeth A; Oyaro, Patrick; Cohen, Craig R; Turan, Janet M

    2016-07-11

    Repeat HIV testing in late pregnancy has the potential to decrease rates of mother-to-child transmission of HIV by identifying mothers who seroconvert after having tested negative for HIV in early pregnancy. Despite being national policy in Kenya, the available data suggest that implementation rates are low. We conducted 20 in-depth semi-structured interviews with healthcare providers and managers to explore barriers and enablers to implementation of repeat HIV testing guidelines for pregnant women. Participants were from the Nyanza region of Kenya and were purposively selected to provide variation in socio-demographics and job characteristics. Interview transcripts were coded and analyzed in Dedoose software using a thematic analysis approach. Four themes were identified a priori using Ferlie and Shortell's Framework for Change and additional themes were allowed to emerge from the data. Participants identified barriers and enablers at the client, provider, facility, and health system levels. Key barriers at the client level from the perspective of providers included late initial presentation to antenatal care and low proportions of women completing the recommended four antenatal visits. Barriers to offering repeat HIV testing for providers included heavy workloads, time limitations, and failing to remember to check for retest eligibility. At the facility level, inconsistent volume of clients and lack of space required for confidential HIV retesting were cited as barriers. Finally, at the health system level, there were challenges relating to the HIV test kit supply chain and the design of nationally standardized antenatal patient registers. Enablers to improving the implementation of repeat HIV testing included client dissemination of the benefits of antenatal care through word-of-mouth, provider cooperation and task shifting, and it was suggested that use of an electronic health record system could provide automatic reminders for retest eligibility. This study

  20. The role of exposure history on HIV acquisition: insights from repeated low-dose challenge studies.

    Directory of Open Access Journals (Sweden)

    Roland R Regoes

    Full Text Available To assess the efficacy of HIV vaccine candidates or preventive treatment, many research groups have started to challenge monkeys repeatedly with low doses of the virus. Such challenge data provide a unique opportunity to assess the importance of exposure history for the acquisition of the infection. I developed stochastic models to analyze previously published challenge data. In the mathematical models, I allowed for variation of the animals' susceptibility to infection across challenge repeats, or across animals. In none of the studies I analyzed, I found evidence for an immunizing effect of non-infecting challenges, and in most studies, there is no evidence for variation in the susceptibilities to the challenges across animals. A notable exception was a challenge experiment by Letvin et al. Sci Translat Med (2011 conducted with the strain SIVsmE660. The challenge data of this experiment showed significant susceptibility variation from animal-to-animal, which is consistent with previously established genetic differences between the involved animals. For the studies which did not show significant immunizing effects and susceptibility differences, I conducted a power analysis and could thus exclude a very strong immunization effect for some of the studies. These findings validate the assumption that non-infecting challenges do not immunize an animal - an assumption that is central in the argument that repeated low-dose challenge experiments increase the statistical power of preclinical HIV vaccine trials. They are also relevant for our understanding of the role of exposure history for HIV acquisition and forecasting the epidemiological spread of HIV.

  1. Ethnography's Capacity to Contribute to the Cumulation of Theory: A Case Study of Differentiation-Polarisation Theory

    Science.gov (United States)

    Hillyard, Sam

    2010-01-01

    The paper sets out to examine the role that ethnographic work can and should play in the development of sociological theory, focusing on the case study of differentiation-polarisation theory. It provides a detailed discussion of the work of Hargreaves (1967), Lacey (1970) and Ball (1981) and assesses the degree to which their work was ethnographic…

  2. Factors associated with repeated outbreak of anthrax in Bangladesh: qualitative and quantitative study

    Directory of Open Access Journals (Sweden)

    Jayedul Hassan

    2015-06-01

    Full Text Available Anthrax, caused by Bacillus anthracis is an acute, febrile disease of warm blooded animals including humans. Social norms and poverty in addition to climatic factors such as soil conditions, seasons of year, ambient temperature and rainfall influence the persistence of the B. anthracis and anthrax outbreaks. The present study was designed to reveal the factors influencing the repeated outbreak of anthrax in Bangladesh. Considering the previous outbreaks of anthrax, Sirajganj, Bogra, Kushtia, Tangail and Mymensingh districts of Bangladesh were selected for this study. To elucidate the factors, qualitative data relating to the animal management, knowledge and behavior of the people; and quantitative data relating to soil conditions, ambient temperature and rainfall were acquired, and analyzed critically. Based on the outbreak histories, a year was divided into two seasons, anthrax prone season (May-November and anthrax dry season (December-April. Anthrax spores could be isolated from 11.67% (n=14/120 of the soil samples collected from the study areas. The present study revealed that poor knowledge, lack of awareness, improper carcass disposal, inadequate vaccination, high Ca content and moisture in the soil along with high ambient temperature and rainfall during the anthrax prone season were the possible influencing factors of repeated outbreaks of anthrax in the study areas. Intensive propaganda to create public awareness of anthrax together with proper vaccination may reduce anthrax outbreaks in Bangladesh.

  3. Feasibility Study for Evaluating Cumulative Exposure of Downstream Migrant Juvenile Salmonids to Total Dissolved Gas. Final Report 1996.

    Energy Technology Data Exchange (ETDEWEB)

    Abernethy, C.Scott; Dauble, Dennis D.; Johnson, Robert L. [Pacific Northwest National Laboratory, Richland, WA (United States)

    1997-11-01

    A feasibility study was initiated to determine if downstream migrant salmonids could be monitored to determine potential relationships between total dissolved gas (TDG) exposure and signs of gas bubble trauma (GBT). The primary objectives were to: (1) establish logistical requirements for in-river monitoring of TDG exposure, including net pen design, deployment, and navigation constraints; (2) resolve uncertainties associated with effects of the net pen on fish behavior; (3) test the accuracy and precision of in-river monitoring equipment used to measure fish distribution and water quality; and (4) determine the application of hydrologic/flow models to predictions of TDG exposure. In-river measurements included water velocity, boat position, and selected water quality parameters (temperature, dissolved oxygen, pH, depth, conductivity). Fish distribution within the net pen was monitored using scanning sonar, and a split-beam echo sounder was used to evaluate vertical distribution of fish m in the river adjacent to the net pen. Three test drifts were conducted from late July through late August. The studies demonstrated that it was feasible to assemble and deploy a large net pen for mobile monitoring of TDG exposure. Accurate monitoring of vertical and lateral distribution of smolts was performed, and diel differences in behavior were documented. Further, the fish sounded in response to researcher activity on the perimeter platform. Thus, in-transit monitoring for GBT or mortality would affect fish depth distribution and exposure to TDG. Principal recommendations for future studies are directed at improving maneuverability of the net pen in adverse weather conditions and applying new acoustics technology to simultaneously collect fish distribution data from within and outside of the pen. 6 refs., 17 figs., 2 tabs.

  4. A prospective study of gynecological cancer risk in relation to adiposity factors: cumulative incidence and association with plasma adipokine levels.

    Directory of Open Access Journals (Sweden)

    Meei-Maan Wu

    Full Text Available BACKGROUND: Associations of obesity and obesity-related metabolic factors (adiposity factors with uterine corpus cancer (UCC and ovarian cancer (OVC risk have been described. Still, a cause-effect relationship and the underlying mediators remain unclear, particularly for low-incidence populations. We aimed to prospectively determine whether adiposity factors could predict the development of UCC and OVC in Taiwanese women. To explore the biological mediators linking adiposity factors to cancer risk, we examined the association of two adipokines, leptin and adiponectin, with the gynecological cancers. METHODS: Totally, 11,258 women, aged 30-65, were recruited into the Community-Based Cancer Screening Program (CBCSP study during 1991-1993, and were followed for UCC and OVC cases until December 31, 2011. Cox proportional hazard models were used to estimate hazard ratios (HRs. Adiposity factors and risk covariates were assessed at recruitment. Newly-developed cancer cases were determined from data in the government's National Cancer Registry and Death Certification System. For adipokienes study, a nested case-control study was conducted within the cohort. Baseline plasma samples of 40 incident gynecological cancer cases and 240 age-menopause-matched controls were assayed for adipokines levels. FINDINGS: There were 38 and 30 incident cases of UCC and OVC, respectively, diagnosed during a median 19.9 years of follow-up. Multivariate analysis showed that alcohol intake (HR = 16.00, 95%  = 4.83-53.00, high triglyceride levels (HR = 2.58, 95% = 1.28-5.17, and years of endogenous estrogen exposure per 5-year increment (HR = 1.91, 95%  = 1.08-3.38 were associated with increased UCC risk. High body mass index (BMI ≥ 27 kg/m(2, HR = 2.90, 95%  = 1.30-6.46 was associated with increased OVC risk. Analysis further showed an independent effect of adipokines on UCC and OVC risk after adjustment of the risk covariates. CONCLUSION: We provided evidence

  5. Prospective longitudinal cohort study on cumulative 5-year delivery and adoption rates among 1338 couples initiating infertility treatment

    DEFF Research Database (Denmark)

    Pinborg, A; Hougaard, C O; Andersen, Anders Nyboe

    2009-01-01

    BACKGROUND The objective was to assess crude 5-year delivery rates after assisted reproductive technology (ART) treatment, intrauterine inseminations (IUI), spontaneous conceptions (SC) and adoptions in a large infertile cohort. METHODS A prospective longitudinal survey comprised 1338 infertile...... couples starting public infertility programmes offering IUIs and three free ART cycles during 2000-2001. The cohort was cross-linked with the National Medical Birth Register to obtain delivery rates for all 1338 couples. More detailed data were available from 817 women responding to a 5-year follow......-up questionnaire (response rate 74.7%). Fifty-seven percent (466/817) of the couples had received treatment prior to inclusion in the study with an average of 4.1+/-2.8 infertility treatments before referral. RESULTS Of the 1338 couples, 69.4% had at least one delivery within 5-years of follow-up. For women

  6. Could Testosterone Replacement Therapy in Hypogonadal Men Ameliorate Anemia, a Cardiovascular Risk Factor? An Observational, 54-Week Cumulative Registry Study.

    Science.gov (United States)

    Zhang, Li Tao; Shin, Yu Seob; Kim, Ji Yong; Park, Jong Kwan

    2016-04-01

    In this study we investigated if testosterone undecanoate attenuates anemia and the risk of cardiovascular disease in patients with hypogonadism. A registry study consisted of 58 participants with a subnormal total testosterone level (less than 2.35 ng/ml) and at least mild symptoms of testosterone deficiency. All patients received an injection of 1,000 mg testosterone undecanoate at the initial visit, followed by injection at 6, 18, 30, 42 and 54 weeks. Serum hormones, hemoglobin, hematocrit, anemia risk factors, lipid profiles, whole blood viscosity and anthropometry were measured. Total testosterone (from mean ± SD 1.87 ± 1.09 to 5.52 ± 1.92 ng/ml, p testosterone (from 3.04 ± 2.03 to 7.23 ± 2.90 pg/ml, p testosterone undecanoate therapy. Hemoglobin and hematocrit significantly increased after testosterone undecanoate therapy by an average of 2.46 gm/dl (p testosterone undecanoate therapy (p = 0.047). A reduction in total cholesterol (from 165.89 ± 39.16 to 153.80 ± 154.27 mg/dl, p = 0.002), increased whole blood viscosity and increased hematocrit were observed until 54 weeks compared with baseline. However, whole blood viscosity and hematocrit stabilized after 18 weeks. After 54 weeks testosterone undecanoate decreased the prevalence of anemia and components of the metabolic syndrome. A longer duration of testosterone undecanoate therapy of more than 18 weeks may be effective and safe in reducing blood viscosity and improving anemia. Copyright © 2016 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  7. Accuracy and repeatability of an inertial measurement unit system for field-based occupational studies.

    Science.gov (United States)

    Schall, Mark C; Fethke, Nathan B; Chen, Howard; Oyama, Sakiko; Douphrate, David I

    2016-04-01

    The accuracy and repeatability of an inertial measurement unit (IMU) system for directly measuring trunk angular displacement and upper arm elevation were evaluated over eight hours (i) in comparison to a gold standard, optical motion capture (OMC) system in a laboratory setting, and (ii) during a field-based assessment of dairy parlour work. Sample-to-sample root mean square differences between the IMU and OMC system ranged from 4.1° to 6.6° for the trunk and 7.2°-12.1° for the upper arm depending on the processing method. Estimates of mean angular displacement and angular displacement variation (difference between the 90th and 10th percentiles of angular displacement) were observed to change IMU system may serve as an acceptable instrument for directly measuring trunk and upper arm postures in field-based occupational exposure assessment studies with long sampling durations. Practitioner Summary: Few studies have evaluated inertial measurement unit (IMU) systems in the field or over long sampling durations. Results of this study indicate that the IMU system evaluated has reasonably good accuracy and repeatability for use in a field setting over a long sampling duration.

  8. Association study of the trinucleotide repeat polymorphism within SMARCA2 and schizophrenia

    Directory of Open Access Journals (Sweden)

    Danics Zoltan

    2006-06-01

    Full Text Available Abstract Background Brahma (BRM is a key component of the multisubunit SWI/SNF complex, a complex which uses the energy of ATP hydrolysis to remodel chromatin. BRM contains an N-terminal polyglutamine domain, encoded by a polymorphic trinucleotide (CAA/CAG repeat, the only known polymorphism in the coding region of the gene (SMARCA2. We have examined the association of this polymorphism with schizophrenia in a family-based and case/control study. SMARCA2 was chosen as a candidate gene because of its specific role in developmental pathways, its high expression level in the brain and some evidence of its association with schizophrenia spectrum disorder from genome-wide linkage analysis. Results Family-based analysis with 281 complete and incomplete triads showed that there is no significant preferential transmission of any of the alleles to the affected offspring. Also, in the case/control analysis, similar allele and genotype distributions were observed between affected cases (n = 289 and unaffected controls (n = 273 in each of three Caucasian populations studied: French Canadian, Tunisian and other Caucasians of European origin. Conclusion Results from our family-based and case-control association study suggest that there is no association between the trinucleotide repeat polymorphism within SMARCA2 and schizophrenia.

  9. Investigation of the toxicity of some organophosphorus pesticides in a repeated dose study in rats.

    Science.gov (United States)

    Baconi, Daniela Luiza; Bârcă, Maria; Manda, Gina; Ciobanu, Anne Marie; Bălălău, C

    2013-01-01

    The study aimed to the investigation of the toxicity of organophosphorus pesticides malathion (MLT) and diazinon (DZN) in Wistar rats in a repeated dose study for 35 days. MLT and DZN in corn oil vehicle were oral administered. Body and organs weights, plasma and brain cholinesterase activities, serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) activities, histopathological changes in liver and kidney, and some parameters of the immune function, such as leukocyte formula, spleen weight and cellularity, spleen lymphocytes proliferation in response to concanavalin A (Con A) were investigated; the potential oxidative stress (malondialdehyde in plasma and brain, and blood catalase activity) was also evaluated. No clinical toxicity signs attributed to pesticides were noted; no significant changes in the organ weights have been found. Body weight tends slightly to increase, predominantly in DZN treated rats. The results suggest that plasma cholinesterase is more susceptible than brain cholinesterase to the inhibitory effect of DZN and MLT. Other serum biochemical parameters showed no significant difference. DZN produced a marked increase of the number of spleen lymphocytes without a significant gain of the relative spleen weight. The both pesticides produced an increase of the number of mononuclear cells÷weight spleen. The splenic lymphocyte proliferation has not been influenced by MLT or DZN treatment. Histopathological observations identified some changes (vasodilatation, microvacuoles, and granular dystrophy) in the liver, with MLT, inducing macrovacuolar steatosis. The study indicates that repeated exposure, at subclinical doses, to organophosphorus MLT and DZN causes some biochemical, histopathological and immune alterations in rats.

  10. Analysis of Memory Codes and Cumulative Rehearsal in Observational Learning

    Science.gov (United States)

    Bandura, Albert; And Others

    1974-01-01

    The present study examined the influence of memory codes varying in meaningfulness and retrievability and cumulative rehearsal on retention of observationally learned responses over increasing temporal intervals. (Editor)

  11. Investigation of practical approaches to evaluating cumulative dose for cone beam computed tomography (CBCT) from standard CT dosimetry measurements: a Monte Carlo study

    Science.gov (United States)

    Abuhaimed, Abdullah; Martin, Colin J.; Sankaralingam, Marimuthu; Gentle, David J.

    2015-07-01

    A function called Gx(L) was introduced by the International Commission on Radiation Units and Measurements (ICRU) Report-87 to facilitate measurement of cumulative dose for CT scans within long phantoms as recommended by the American Association of Physicists in Medicine (AAPM) TG-111. The Gx(L) function is equal to the ratio of the cumulative dose at the middle of a CT scan to the volume weighted CTDI (CTDIvol), and was investigated for conventional multi-slice CT scanners operating with a moving table. As the stationary table mode, which is the basis for cone beam CT (CBCT) scans, differs from that used for conventional CT scans, the aim of this study was to investigate the extension of the Gx(L) function to CBCT scans. An On-Board Imager (OBI) system integrated with a TrueBeam linac was simulated with Monte Carlo EGSnrc/BEAMnrc, and the absorbed dose was calculated within PMMA, polyethylene (PE), and water head and body phantoms using EGSnrc/DOSXYZnrc, where the body PE body phantom emulated the ICRU/AAPM phantom. Beams of width 40-500 mm and beam qualities at tube potentials of 80-140 kV were studied. Application of a modified function of beam width (W) termed Gx(W), for which the cumulative dose for CBCT scans f (0) is normalized to the weighted CTDI (CTDIw) for a reference beam of width 40 mm, was investigated as a possible option. However, differences were found in Gx(W) with tube potential, especially for body phantoms, and these were considered to be due to differences in geometry between wide beams used for CBCT scans and those for conventional CT. Therefore, a modified function Gx(W)100 has been proposed, taking the form of values of f (0) at each position in a long phantom, normalized with respect to dose indices f 100(150)x measured with a 100 mm pencil ionization chamber within standard 150 mm PMMA phantoms, using the same scanning parameters, beam widths and positions within the phantom. f 100(150)x averages the dose resulting from

  12. Potential Role of the Last Half Repeat in TAL Effectors Revealed by a Molecular Simulation Study

    Directory of Open Access Journals (Sweden)

    Hua Wan

    2016-01-01

    Full Text Available TAL effectors (TALEs contain a modular DNA-binding domain that is composed of tandem repeats. In all naturally occurring TALEs, the end of tandem repeats is invariantly a truncated half repeat. To investigate the potential role of the last half repeat in TALEs, we performed comparative molecular dynamics simulations for the crystal structure of DNA-bound TALE AvrBs3 lacking the last half repeat and its modeled structure having the last half repeat. The structural stability analysis indicates that the modeled system is more stable than the nonmodeled system. Based on the principle component analysis, it is found that the AvrBs3 increases its structural compactness in the presence of the last half repeat. The comparison of DNA groove parameters of the two systems implies that the last half repeat also causes the change of DNA major groove binding efficiency. The following calculation of hydrogen bond reveals that, by stabilizing the phosphate binding with DNA at the C-terminus, the last half repeat helps to adopt a compact conformation at the protein-DNA interface. It further mediates more contacts between TAL repeats and DNA nucleotide bases. Finally, we suggest that the last half repeat is required for the high-efficient recognition of DNA by TALE.

  13. Potential Role of the Last Half Repeat in TAL Effectors Revealed by a Molecular Simulation Study

    Science.gov (United States)

    Wan, Hua; Chang, Shan; Hu, Jian-ping; Tian, Xu-hong

    2016-01-01

    TAL effectors (TALEs) contain a modular DNA-binding domain that is composed of tandem repeats. In all naturally occurring TALEs, the end of tandem repeats is invariantly a truncated half repeat. To investigate the potential role of the last half repeat in TALEs, we performed comparative molecular dynamics simulations for the crystal structure of DNA-bound TALE AvrBs3 lacking the last half repeat and its modeled structure having the last half repeat. The structural stability analysis indicates that the modeled system is more stable than the nonmodeled system. Based on the principle component analysis, it is found that the AvrBs3 increases its structural compactness in the presence of the last half repeat. The comparison of DNA groove parameters of the two systems implies that the last half repeat also causes the change of DNA major groove binding efficiency. The following calculation of hydrogen bond reveals that, by stabilizing the phosphate binding with DNA at the C-terminus, the last half repeat helps to adopt a compact conformation at the protein-DNA interface. It further mediates more contacts between TAL repeats and DNA nucleotide bases. Finally, we suggest that the last half repeat is required for the high-efficient recognition of DNA by TALE. PMID:27803930

  14. Does repeated reading predict reading development over time? A study of children from Grade 3 to 4.

    Science.gov (United States)

    Gellert, Anna S

    2014-08-01

    The purpose of this study was to investigate whether immediate gains in reading fluency achieved during repeated reading of text can predict long-term reading development over and above traditional predictors of reading development. Eighty-one Grade 3 children read texts three times consecutively and were instructed either to read as quickly as possible (speed-focused repeated reading), or to retell the text afterwards (meaning-focused repeated reading). Measures of text reading fluency, sentence reading fluency, and text comprehension were administered to the children in Grades 3 and 4 to assess their reading development over time. The results indicate that children's immediate response to repeated reading can contribute to the prediction of their development of reading fluency over time. Even after controlling for individual differences in general cognitive ability, word reading fluency, rapid automatized naming, and vocabulary, the experimental measure with meaning-focused repeated reading remained a significant predictor.

  15. 5-Day repeated inhalation and 28-day post-exposure study of graphene.

    Science.gov (United States)

    Shin, Jae Hoon; Han, Sung Gu; Kim, Jin Kwon; Kim, Boo Wook; Hwang, Joo Hwan; Lee, Jong Seong; Lee, Ji Hyun; Baek, Jin Ee; Kim, Tae Gyu; Kim, Keun Soo; Lee, Heon Sang; Song, Nam Woong; Ahn, Kangho; Yu, Il Je

    2015-01-01

    Graphene has recently been attracting increasing attention due to its unique electronic and chemical properties and many potential applications in such fields as semiconductors, energy storage, flexible electronics, biosensors and medical imaging. However, the toxicity of graphene in the case of human exposure has not yet been clarified. Thus, a 5-day repeated inhalation toxicity study of graphene was conducted using a nose-only inhalation system for male Sprague-Dawley rats. A total of three groups (20 rats per group) were compared: (1) control (ambient air), (2) low concentration (0.68 ± 0.14 mg/m(3) graphene) and (3) high concentration (3.86 ± 0.94 mg/m(3) graphene). The rats were exposed to graphene for 6 h/day for 5 days, followed by recovery for 1, 3, 7 or 28 days. The bioaccumulation and macrophage ingestion of the graphene were evaluated in the rat lungs. The exposure to graphene did not change the body weights or organ weights of the rats after the 5-day exposure and during the recovery period. No statistically significant difference was observed in the levels of lactate dehydrogenase, protein and albumin between the exposed and control groups. However, graphene ingestion by alveolar macrophages was observed in the exposed groups. Therefore, these results suggest that the 5-day repeated exposure to graphene only had a minimal toxic effect at the concentrations and time points used in this study.

  16. Validation of a track repeating algorithm for intensity modulated proton therapy: clinical cases study

    Science.gov (United States)

    Yepes, Pablo P.; Eley, John G.; Liu, Amy; Mirkovic, Dragan; Randeniya, Sharmalee; Titt, Uwe; Mohan, Radhe

    2016-04-01

    Monte Carlo (MC) methods are acknowledged as the most accurate technique to calculate dose distributions. However, due its lengthy calculation times, they are difficult to utilize in the clinic or for large retrospective studies. Track-repeating algorithms, based on MC-generated particle track data in water, accelerate dose calculations substantially, while essentially preserving the accuracy of MC. In this study, we present the validation of an efficient dose calculation algorithm for intensity modulated proton therapy, the fast dose calculator (FDC), based on a track-repeating technique. We validated the FDC algorithm for 23 patients, which included 7 brain, 6 head-and-neck, 5 lung, 1 spine, 1 pelvis and 3 prostate cases. For validation, we compared FDC-generated dose distributions with those from a full-fledged Monte Carlo based on GEANT4 (G4). We compared dose-volume-histograms, 3D-gamma-indices and analyzed a series of dosimetric indices. More than 99% of the voxels in the voxelized phantoms describing the patients have a gamma-index smaller than unity for the 2%/2 mm criteria. In addition the difference relative to the prescribed dose between the dosimetric indices calculated with FDC and G4 is less than 1%. FDC reduces the calculation times from 5 ms per proton to around 5 μs.

  17. Repeat Colonoscopy within 6 Months after Initial Outpatient Colonoscopy in Ontario: A Population-Based Cross-Sectional Study

    Directory of Open Access Journals (Sweden)

    Lawrence Paszat

    2017-01-01

    Full Text Available Background. The goal of this study is to examine utilization of early repeat colonoscopy ≤ 6 months after an index procedure. Methods. We identified persons having repeat colonoscopy ≤ 6 months following outpatient colonoscopy without prior colonoscopy ≤ 5 years or prior diagnosis of colorectal cancer (CRC. We modeled repeat colonoscopy using a generalized estimating equation with an exchangeable correlation structure to account for clustering of patients by endoscopist. Results. The population included 334,663 persons, 7,892 (2.36% of whom had an early repeat colonoscopy within 6 months. Overall, endoscopist prior year colonoscopy volume was inversely related to repeat ≤ 6 months. Repeat colonoscopy ≤ 6 months varied by the clinical setting of the index colonoscopy (adjusted OR = 1.41 (95% CI 1.29–1.55 at nonhospital facilities compared to teaching or community hospitals. Among those who had polypectomy or biopsy, the adjusted OR for early repeat ≤ 6 months was elevated among those whose index colonoscopy was at a nonhospital facility (OR 1.44, 95% CI 1.30–1.60, compared to those at a teaching hospital or community hospital. Conclusions. Repeat colonoscopy ≤ 6 months after an index procedure is associated with the clinical setting of the index colonoscopy.

  18. Influence of pretreatment systolic blood pressure on the effect of carvedilol in patients with severe chronic heart failure: the Carvedilol Prospective Randomized Cumulative Survival (COPERNICUS) study.

    Science.gov (United States)

    Rouleau, Jean L; Roecker, Ellen B; Tendera, Michal; Mohacsi, Paul; Krum, Henry; Katus, Hugo A; Fowler, Michael B; Coats, Andrew J S; Castaigne, Alain; Scherhag, Armin; Holcslaw, Terry L; Packer, Milton

    2004-04-21

    We sought to evaluate the influence of pretreatment systolic blood pressure (SBP) on the efficacy and safety of carvedilol in patients with chronic heart failure (CHF). Although beta-blockers reduce the risk of death in CHF, there is little reported experience with these drugs in patients with a low pretreatment SBP, who may respond poorly to beta-blockade. We studied 2,289 patients with severe CHF who participated in the Carvedilol Prospective Randomized Cumulative Survival (COPERNICUS) trial. Compared with placebo, carvedilol improved the clinical status and reduced the risk of death and the combined risk of death or hospitalization for any reason, for a cardiovascular reason, or for worsening heart failure (p 0.10). However, because patients with the lowest SBP were at highest risk of an event, they experienced the greatest absolute benefit from treatment with carvedilol. The lower the pretreatment SBP, the more likely that patients would report an adverse event, be intolerant of high doses of the study drug, or require permanent withdrawal of treatment (p < 0.001 for all). However, these risks were primarily related to the severity of the underlying illness and not to treatment with carvedilol. The current study provides little support for concerns about using beta-blockers (particularly those with vasodilatory actions) in patients with severe CHF who have a low SBP. Pretreatment blood pressure can identify patients who have the greatest need for risk reduction with carvedilol.

  19. Seroepidemiological studies indicate frequent and repeated exposure to Campylobacter spp. during childhood.

    Science.gov (United States)

    Ang, C W; Teunis, P F M; Herbrink, P; Keijser, J; Van Duynhoven, Y H T P; Visser, C E; Van Pelt, W

    2011-09-01

    The annual number of episodes of clinical gastroenteritis caused by Campylobacter spp. in The Netherlands is estimated to be 75 000, i.e. once per 200 person life-years. This number is based on extrapolation of culture results from population-based studies. The number of culture-confirmed cases of Campylobacter infection peaks in the first 3 years of life and again between the ages of 20 and 25 years. The seroepidemiology of Campylobacter describes the relationship between age and exposure to Campylobacter and reflects both symptomatic and asymptomatic infections. Using a validated ELISA system, antibodies to Campylobacter were measured in an age-stratified sample (n=456) of the PIENTER serum collection of the Dutch general population. The seroprevalence of Campylobacter IgG antibodies increased with age, reaching almost 100% at age 20 years. Antibody levels steadily increased with age until young adulthood, suggesting repeated exposure to Campylobacter. In conclusion, seroepidemiological data demonstrated repeated exposures to Campylobacter throughout life, most of which do not lead to clinical symptoms. From young adulthood, >95% of the population in The Netherlands had serological evidence for exposure to Campylobacter.

  20. Effects of repeated walking in a perturbing environment: a 4-day locomotor learning study.

    Science.gov (United States)

    Blanchette, Andreanne; Moffet, Helene; Roy, Jean-Sébastien; Bouyer, Laurent J

    2012-07-01

    Previous studies have shown that when subjects repeatedly walk in a perturbing environment, initial movement error becomes smaller, suggesting that retention of the adapted locomotor program occurred (learning). It has been proposed that the newly learned locomotor program may be stored separately from the baseline program. However, how locomotor performance evolves with repeated sessions of walking with the perturbation is not yet known. To address this question, 10 healthy subjects walked on a treadmill on 4 consecutive days. Each day, locomotor performance was measured using kinematics and surface electromyography (EMGs), before, during, and after exposure to a perturbation, produced by an elastic tubing that pulled the foot forward and up during swing, inducing a foot velocity error in the first strides. Initial movement error decreased significantly between days 1 and 2 and then remained stable. Associated changes in medial hamstring EMG activity stabilized only on day 3, however. Aftereffects were present after perturbation removal, suggesting that daily adaptation involved central command recalibration of the baseline program. Aftereffects gradually decreased across days but were still visible on day 4. Separation between the newly learned and baseline programs may take longer than suggested by the daily improvement in initial performance in the perturbing environment or may never be complete. These results therefore suggest that reaching optimal performance in a perturbing environment should not be used as the main indicator of a completed learning process, as central reorganization of the motor commands continues days after initial performance has stabilized.

  1. Study of four week repeated dose toxic test of Sweet Bee Venom in Beagle Dogs

    Directory of Open Access Journals (Sweden)

    Jae-Seuk Park

    2010-12-01

    Full Text Available Objectives: This study was performed to analyse four week repeated dose toxicity of Sweet Bee Venom(Sweet BV extracted from the bee venom in Beagle dogs. Methods: All experiments were conducted under the regulations of Good Laboratory Practice (GLP at Biotoxtech Company, a non-clinical study authorized institution. Male and female Beagle dogs of 5-6 months old were chosen for the pilot study of four week repeated dose toxicity of Sweet BV which was administered at the level of 0.56㎎/㎏ body weight which is eighty times higher than the clinical application dosage as the high dosage, followed by 0.28 and 0.14㎎/㎏ as midium and low dosage, respectively. Equal amount of excipient(normal saline to the Sweet BV experiment groups was administered as the control group every day for four weeks. Results: 1. No mortality was witnessed in all of the experiment groups. 2. All experiment groups were appealed pain sense in the treating time compared to the control group, and hyperemia and movement disorder were observed around the area of administration in all experiment groups, and higher occurrence in the higher dosage treatment. 3. For weight measurement, Neither male nor female groups showed significant changes. 4. In the urine analysis, CBC and biochemistry didn't show any significant changes in the experiment groups compared with control group. 5. For weight measurement of organs, experiment groups didn't show any significant changes compared with control group. 6. To verify abnormalities of organs and tissues, thigh muscle which treated with Sweet BV, cerebrum, liver, lung, kidney, and spinal cords were removed and conducted histologocal observation with H-E staining. In the histologocal observation of thigh muscle, cell infiltration, inflammatory, degeneration, necrosis of muscle fiber, and fibrosis were found in both thigh tissue. And the changes were depend on the dose of Sweet BV. But another organs were not detected in any abnormalities. 7

  2. Reducing impaired driving through the identification of Repeat Target Vehicles: A case study.

    Science.gov (United States)

    Stewart, James

    2012-02-01

    One of the most persistent groups of impaired drivers that are seemingly unaffected by social pressure, moral appeals, and the fear of arrest is that of the repeat impaired driver. This smaller group accounts for a disproportionate number of all impaired driving trips, often with high blood alcohol contents. New approaches are needed to identify and deal with the repeat impaired driver. We propose a method based on the discovery that almost 10% of all impaired driving calls for service involve repeat vehicles. Using the number of times a vehicle appears in our data, the average time to repeat, and the personality characteristics of the repeat impaired driver, we are able to create a comprehensive and predictive description of a Repeat Target Vehicle (RTV). Our method provides an opportunity to explore new and innovative crime reduction strategies that were never before possible. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. A study on ten short tandem repeat systems: African immigrant and Spanish population data.

    Science.gov (United States)

    Gamero, J J; Romero, J L; Gonzalez, J L; Arufe, M I; Cuesta, M I; Corte-Real, F; Carvalho, M; Anjos, M J; Vieira, D N; Vide, M C

    2000-06-05

    This work presents the results obtained from a genetic-population study for the D1S1656 system in the population of Southwest Spain (Huelva, Cádiz and Sevilla), Spaniards of Caucasian origin from North Africa (Ceuta), as well as in the black Central West African and Moroccan immigrant populations in Spain. The results of a study of the autochtonous population of the Canary Islands (n=138), and immigrant Central West African populations in Spain (n=132), obtained for nine short tandem repeat (STR) loci (D3S1358, VWA, FGA, D8S1179, D21S11, D18S51, D5S818, D13S317, D7S820), as well as the amelogenin locus, all contained in Profiler Plus (Perkin-Elmer) PCR amplification kits, are also presented. Except for the FGA and VWA data on immigrant Central West African populations in Spain, no deviations from the Hardy-Weinberg equilibrium were detected.

  4. A Prospective Study of Psychiatric Comorbidity and Recidivism Among Repeat DUI Offenders

    OpenAIRE

    Nelson, Sarah E.; Belkin, Katerina; LaPlante, Debi A.; Bosworth, Leslie; Shaffer, Howard J.

    2015-01-01

    Psychiatric comorbidity has emerged as a key element distinguishing DUI offenders from others, and, in some cases, distinguishing repeat offenders from first-time offenders. This paper utilizes a prospective design to determine whether the comorbid disorders identified among repeat DUI offenders can predict recidivism. Seven hundred forty-three repeat DUI offenders were recruited from a two-week inpatient treatment program at which they received a standardized mental health assessment and fol...

  5. Bayesian latent variable models for hierarchical clustered count outcomes with repeated measures in microbiome studies.

    Science.gov (United States)

    Xu, Lizhen; Paterson, Andrew D; Xu, Wei

    2017-04-01

    Motivated by the multivariate nature of microbiome data with hierarchical taxonomic clusters, counts that are often skewed and zero inflated, and repeated measures, we propose a Bayesian latent variable methodology to jointly model multiple operational taxonomic units within a single taxonomic cluster. This novel method can incorporate both negative binomial and zero-inflated negative binomial responses, and can account for serial and familial correlations. We develop a Markov chain Monte Carlo algorithm that is built on a data augmentation scheme using Pólya-Gamma random variables. Hierarchical centering and parameter expansion techniques are also used to improve the convergence of the Markov chain. We evaluate the performance of our proposed method through extensive simulations. We also apply our method to a human microbiome study.

  6. [Repeat induced abortion: A multicenter study on medical abortions in France in 2014].

    Science.gov (United States)

    Opatowski, M; Bardy, F; David, P; Dunbavand, A; Saurel-Cubizolles, M-J

    2017-01-01

    To describe the social characteristics of women seeking a medical abortion, and the conditions of that abortion, according to whether they had one or more previous induced abortions. An observational study was carried out in 11 French units in 2013-2014, among women 18 years or older. A self-administered questionnaire on the abortion context and social situation was given to them, as well as a diary to record the pain level for each of five days following the mifepristone intake. The sample included 453 women. Among the respondents, 22% had had one previous abortion and 8% had had two or more. Women having had a previous voluntary abortion were more often isolated and in a poorer social situation than women having their first abortion. Better support for contraception after abortion could reduce the number of repeated abortions. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  7. A Review on the Study of "Repeating Earthquakes" by Cross-correlation of Seismic Waveforms~%A Review on the Study of "Repeating Earthquakes" by Cross-correlation of Seismic Waveforms~

    Institute of Scientific and Technical Information of China (English)

    Li Yutong; Jiang Changsheng

    2012-01-01

    "Repeating earthquakes", identified by cross-correlation of seismic waveforms, are found to be much more abundant in the nature than conventionally expected. In recent years, with the development of digital seismic networks, waveform cross correlation and "repeating earthquakes" have caused much attention to the measuring the variation of crustal medium properties and estimation of location accuracy and fault slip rate at depth or earthquake recurrence intervals. Moreover, as a useful tool, the "repeating earthquake" approach has also been used in the assessment of the accuracy of seismic phase picking, hypocenter location, fault structure and physics of earthquake sources, as well as the study of earthquake prediction. In this paper, we summarized the latest research and applications of "repeating earthquakes".

  8. Causal inference in longitudinal comparative effectiveness studies with repeated measures of a continuous intermediate variable.

    Science.gov (United States)

    Wang, Chen-Pin; Jo, Booil; Brown, C Hendricks

    2014-09-10

    We propose a principal stratification approach to assess causal effects in nonrandomized longitudinal comparative effectiveness studies with a binary endpoint outcome and repeated measures of a continuous intermediate variable. Our method is an extension of the principal stratification approach originally proposed for the longitudinal randomized study "Prevention of Suicide in Primary Care Elderly: Collaborative Trial" to assess the treatment effect on the continuous Hamilton depression score adjusting for the heterogeneity of repeatedly measured binary compliance status. Our motivation for this work comes from a comparison of the effect of two glucose-lowering medications on a clinical cohort of patients with type 2 diabetes. Here, we consider a causal inference problem assessing how well the two medications work relative to one another on two binary endpoint outcomes: cardiovascular disease-related hospitalization and all-cause mortality. Clinically, these glucose-lowering medications can have differential effects on the intermediate outcome, glucose level over time. Ultimately, we want to compare medication effects on the endpoint outcomes among individuals in the same glucose trajectory stratum while accounting for the heterogeneity in baseline covariates (i.e., to obtain 'principal effects' on the endpoint outcomes). The proposed method involves a three-step model estimation procedure. Step 1 identifies principal strata associated with the intermediate variable using hybrid growth mixture modeling analyses. Step 2 obtains the stratum membership using the pseudoclass technique and derives propensity scores for treatment assignment. Step 3 obtains the stratum-specific treatment effect on the endpoint outcome weighted by inverse propensity probabilities derived from Step 2.

  9. The PICTURE study: diagnostic accuracy of multiparametric MRI in men requiring a repeat prostate biopsy.

    Science.gov (United States)

    Simmons, Lucy A M; Kanthabalan, Abi; Arya, Manit; Briggs, Tim; Barratt, Dean; Charman, Susan C; Freeman, Alex; Gelister, James; Hawkes, David; Hu, Yipeng; Jameson, Charles; McCartan, Neil; Moore, Caroline M; Punwani, Shonit; Ramachandran, Navin; van der Meulen, Jan; Emberton, Mark; Ahmed, Hashim U

    2017-04-25

    Transrectal prostate biopsy has limited diagnostic accuracy. Prostate Imaging Compared to Transperineal Ultrasound-guided biopsy for significant prostate cancer Risk Evaluation (PICTURE) was a paired-cohort confirmatory study designed to assess diagnostic accuracy of multiparametric magnetic resonance imaging (mpMRI) in men requiring a repeat biopsy. All underwent 3 T mpMRI and transperineal template prostate mapping biopsies (TTPM biopsies). Multiparametric MRI was reported using Likert scores and radiologists were blinded to initial biopsies. Men were blinded to mpMRI results. Clinically significant prostate cancer was defined as Gleason ⩾4+3 and/or cancer core length ⩾6 mm. Two hundred and forty-nine had both tests with mean (s.d.) age was 62 (7) years, median (IQR) PSA 6.8 ng ml (4.98-9.50), median (IQR) number of previous biopsies 1 (1-2) and mean (s.d.) gland size 37 ml (15.5). On TTPM biopsies, 103 (41%) had clinically significant prostate cancer. Two hundred and fourteen (86%) had a positive prostate mpMRI using Likert score ⩾3; sensitivity was 97.1% (95% confidence interval (CI): 92-99), specificity 21.9% (15.5-29.5), negative predictive value (NPV) 91.4% (76.9-98.1) and positive predictive value (PPV) 46.7% (35.2-47.8). One hundred and twenty-nine (51.8%) had a positive mpMRI using Likert score ⩾4; sensitivity was 80.6% (71.6-87.7), specificity 68.5% (60.3-75.9), NPV 83.3% (75.4-89.5) and PPV 64.3% (55.4-72.6). In men advised to have a repeat prostate biopsy, prostate mpMRI could be used to safely avoid a repeat biopsy with high sensitivity for clinically significant cancers. However, such a strategy can miss some significant cancers and overdiagnose insignificant cancers depending on the mpMRI score threshold used to define which men should be biopsied.

  10. SU-E-J-263: Repeatability of SUV and Texture Parameters in Serial PET Studies

    Energy Technology Data Exchange (ETDEWEB)

    Schwartz, J; Humm, J; Nehmeh, S; Schoder, H [Memorial Sloan-Kettering Cancer Center, New York, NY (United States)

    2015-06-15

    Purpose: Standardized uptake values (SUV) are standard quantitative PET measures of FDG tumor uptake used,and are used as a tool to monitor response to therapy. Textural analysis is emerging as a new tool for assessing intratumoral heterogeneity which may allow better tissue characterization and improved prediction of response and survival rate.Understanding what variations may be expected in these parameters is key in order to make decisions based on how the change throughout the course of treatment. The aim of this study was to assess repeatability in SUV measures and texture parameters,and establish criteria that differentiate changes associated with treatment rather than statistical variability. Methods: Eighty patients,167 random lesions total,were scanned in a GE Discovery STE PET/CT Scanner. One field-of-view was chosen centered on the largest lesion observed in a clinical whole-body FDG PET.Immediately following,a gated 9 min scan was acquired in list mode,without changing the patient’s position between any scans. Data was replayed into 3 time bins,3 min each,in order to insure equivalent noise characteristics in each replicate.Data was reconstructed into 128×128×47 square matrices.One VOI was drawn over each lesion for each patient and used to segment all 3 replicates. The mean.max and peak SUV were calculated for each VOI and replicate. First-order textural features were also calculated (skewness and kurtosis). Repeatability was calculated as the average standard deviation over the mean for the 3 repeated measurements for each lesion. Results: The average percent error in the SUV max,peak and mean were 3.4%(0– 12.9%),1.9% (0–7.5%),2.8% (0–12.2%),respectively.For skewness and kurtosis they were 10.9% and 17.8%. Conclusion: We have shown that there is a large variation in %error in SUV measures across patients. SUVpeak is the least variable and kurtosis and skewness parameters are less reliable thatn SUVs.Higher order textures are be.

  11. Prognostic usefulness of repeated echocardiographic evaluation after acute myocardial infarction. TRACE Study Group. TRAndolapril Cardiac Evaluation

    DEFF Research Database (Denmark)

    Korup, E; Køber, L; Torp-Pedersen, C;

    1999-01-01

    The prognostic value of repeated echocardiographic measurement of left ventricular function after acute myocardial infarction was evaluated. We found that repeated measurements of wall motion index in survivors of acute myocardial infarction, with no reinfarction, provide important prognostic inf...... information about death and worsening of heart failure....

  12. Studies of the CAG repeat in the Machado-Joseph disease gene in Taiwan.

    Science.gov (United States)

    Hsieh, M; Tsai, H F; Lu, T M; Yang, C Y; Wu, H M; Li, S Y

    1997-08-01

    Machado-Joseph disease (MJD) is an autosomal dominant spinocerebellar degeneration characterized by cerebellar ataxia and pyramidal signs associated in varying degrees with a dystonic-rigid extrapyramidal syndrome or peripheral amyotrophy. Unstable CAG trinucleotide repeat expansion in the MJD gene on the long arm of chromosome 14 has been identified as the pathological mutation for MJD. While investigating the distribution of CAG repeat lengths of the MJD gene in Taiwan's population, we have identified 18 MJD-affected patients and 12 at-risk individuals in seven families. In addition, we have analyzed the range of CAG repeat lengths in 96 control individuals. The CAG repeat number ranged from 13 to 44 in the controls and 72-85 in the affected and at-risk individuals. Our results indicated that the CAG repeat number was inversely correlated with the age of onset. The differences in CAG repeat length between parent and child and between siblings are greater with paternal transmission than maternal transmission. Our data show a tendency towards the phenomenon of anticipation in the MJD families but do not support unidirectional expansion of CAG repeats during transmission. We also demonstrated that PCR amplification of the CAG repeats in the MJD gene from villous DNA was possible and might prove useful as a diagnostic tool for affected families in the future.

  13. A study on the trinucleotide repeat associated with Huntington`s disease in the Chinese

    Energy Technology Data Exchange (ETDEWEB)

    Bing-wen Soong; Jih-tsuu Wang [Neurological Institute, Taipei (Taiwan, Province of China)

    1994-09-01

    Analysis of the polymorphic (CAG)n repeat in the hungingtin gene in the chinese confirmed the presence of an expanded repeat on all Huntington`s disease chromosomes. Measurement of the specific CAG repeat sequence in 34 HD chromosomes from 15 unrelated families and 190 control chromosomes from the Chinese population showed a range from 9 to 29 repeats in normal subjects and 40 to 58 in affected subjects. The size distributions of normal and affected alleles did not overlap. A clear correlation bewteen early onset of symptoms and very high repeat number was seen, but the spread of the age-at-onset in the major repeat range producing characteristic HD it too wide to be of diagnostic value. There was also variability in the transmitted repeat size for both sexes in the HD size range. Maternal HD alleles showed a moderate instability with a preponderance of size decrease, while paternal HD alleles had a tendency to increase in repeat size on transmission, the degree of which appeared proportional to the initial size.

  14. A Prospective Study of Psychiatric Comorbidity and Recidivism Among Repeat DUI Offenders.

    Science.gov (United States)

    Nelson, Sarah E; Belkin, Katerina; LaPlante, Debi A; Bosworth, Leslie; Shaffer, Howard J

    2015-04-13

    Psychiatric comorbidity has emerged as a key element distinguishing DUI offenders from others, and, in some cases, distinguishing repeat offenders from first-time offenders. This paper utilizes a prospective design to determine whether the comorbid disorders identified among repeat DUI offenders can predict recidivism. Seven hundred forty-three repeat DUI offenders were recruited from a two-week inpatient treatment program at which they received a standardized mental health assessment and followed across five years post-treatment to track DUI offense, motor vehicle-related offenses, and general criminal offenses. Psychiatric comorbidity, though it did not predict DUI recidivism specifically, predicted criminal re-offense more generally. In addition, there was a specific relationship between lifetime attention deficit disorder and repeated motor vehicle-related offenses. These findings suggest that for many repeat offenders, DUI is one outlet in a constellation of criminal behavior, and that psychiatric comorbidity increases vulnerability for criminal re-offense.

  15. Strengths and limitations of using repeat-dose toxicity studies to predict effects on fertility.

    Science.gov (United States)

    Dent, M P

    2007-08-01

    The upcoming European chemicals legislation REACH (Registration, Evaluation, and Authorisation of Chemicals) will require the risk assessment of many thousands of chemicals. It is therefore necessary to develop intelligent testing strategies to ensure that chemicals of concern are identified whilst minimising the testing of chemicals using animals. Xenobiotics may perturb the reproductive cycle, and for this reason several reproductive studies are recommended under REACH. One of the endpoints assessed in this battery of tests is mating performance and fertility. Animal tests that address this endpoint use a relatively large number of animals and are also costly in terms of resource, time, and money. If it can be shown that data from non-reproductive studies such as in-vitro or repeat-dose toxicity tests are capable of generating reliable alerts for effects on fertility then some animal testing may be avoided. Available rat sub-chronic and fertility data for 44 chemicals that have been classified by the European Union as toxic to fertility were therefore analysed for concordance of effects. Because it was considered appropriate to read across data for some chemicals these data sets were considered relevant for 73 of the 102 chemicals currently classified as toxic to reproduction (fertility) under this system. For all but 5 of these chemicals it was considered that a well-performed sub-chronic toxicity study would have detected pathology in the male, and in some cases, the female reproductive tract. Three showed evidence of direct interaction with oestrogen or androgen receptors (linuron, nonylphenol, and fenarimol). The remaining chemicals (quinomethionate and azafenidin) act by modes of action that do not require direct interaction with steroid receptors. However, both these materials caused in-utero deaths in pre-natal developmental toxicity studies, and the relatively low NOAELs and the nature of the hazard identified in the sub-chronic tests provides an alert

  16. Exploring the risk factors for differences in the cumulative incidence of coeliac disease in two neighboring countries : the prospective DIABIMMUNE study

    NARCIS (Netherlands)

    Simre, Kärt; Uibo, Oivi; Peet, Aleksandr; Tillmann, Vallo; Kool, Pille; Hämäläinen, Anu-Maaria; Härkönen, Taina; Siljander, Heli; Virtanen, Suvi; Ilonen, Jorma; Knip, Mikael; Uibo, Raivo; Harmsen, Hermie J.

    2016-01-01

    BACKGROUND: During the last several decades the prevalence of coeliac disease (CD) has increased worldwide. AIM: To compare the cumulative incidence of CD between Estonian and Finnish children and to identify the risk factors. MATERIALS AND METHODS: Children were recruited as part of the DIABIMMUNE

  17. CUMULANTS OF STOCHASTIC RESPONSE FOR A CLASS OF SPECIAL NONHOLONOMIC SYSTEMS

    Institute of Scientific and Technical Information of China (English)

    SHANG MEI; ZHANG YI

    2001-01-01

    This paper studies the response cumulants for a kind of special nonholonomic systems under non-Gaussian, delta- correlated excitations. We present a new methodology for formulating the equations governing the evolution of the response cumulants of the stochastic dynamic systems. The response cumulant differential equations (CDEs) derived can be used to calculate the response cumulants for both linear and nonlinear systems. One example is given to illustrate how to use the CDEs for calculating response cumulants.

  18. Non-target effects of repeated chlorothalonil application on soil nitrogen cycling: The key functional gene study.

    Science.gov (United States)

    Zhang, Manyun; Xu, Zhihong; Teng, Ying; Christie, Peter; Wang, Jun; Ren, Wenjie; Luo, Yongming; Li, Zhengao

    2016-02-01

    The widespread and increasing application of chlorothalonil (CTN) raises concerns about its non-target impacts, but little information is available on the effect of CTN on the key functional genes related to soil nitrogen (N) cycling, especially in the case of repeated applications. In the present study, a microcosm incubation was conducted to determine CTN residues and the impacts on the abundances of key functional genes related to N cycling after repeated CTN applications. The results demonstrated that repeated CTN applications at the recommended application rate and five times the recommended rate led to the accumulation of CTN residue in soil at concentrations of 5.59 and 78.79 mg kg(-1), respectively, by the end of incubation. Real time PCR (RT-PCR) revealed that repeated CTN applications had negative effects on the chiA and aprA gene abundances. There were significantly negative correlations between CTN residues and abundances of AOA and AOB genes. In addition, the abundances of key functional genes involved in soil denitrification were declined by repeated CTN applications with the sole exception of the nosZ gene. This study suggests that repeated CTN applications could lead to the accumulation of CTN residue and generate somewhat inconsistent and erratic effects on the abundances of key functional genes related to soil N cycling.

  19. Impact of repeated measures and sample selection on genome-wide association studies of fasting glucose

    Science.gov (United States)

    Rasmussen-Torvik, Laura J.; Alonso, Alvaro; Li, Man; Kao, Wen; Köttgen, Anna; Yan, Yuer; Couper, David; Boerwinkle, Eric; Bielinski, Suzette J.; Pankow, James S.

    2010-01-01

    Although GWAS have been performed in longitudinal studies, most used only a single trait measure. GWAS of fasting glucose have generally included only normoglycemic individuals. We examined the impact of both repeated measures and sample selection on GWAS in ARIC, a study which obtained four longitudinal measures of fasting glucose and included both individuals with and without prevalent diabetes. The sample included Caucasians and the Affymetrix 6.0 chip was used for genotyping. Sample sizes for GWAS analyses ranged from 8372 (first study visit) to 5782 (average fasting glucose). Candidate SNP analyses with SNPs identified through fasting glucose or diabetes GWAS were conducted in 9133 individuals, including 761 with prevalent diabetes. For a constant sample size, smaller p-values were obtained for the average measure of fasting glucose compared to values at any single visit, and two additional significant GWAS signals were detected. For four candidate SNPs (rs780094, rs10830963, rs7903146, and rs4607517), the strength of association between genotype and glucose was significantly (p-interaction fasting glucose candidate SNPs (rs780094, rs10830963, rs560887, rs4607517, rs13266634) the association with measured fasting glucose was more significant in the smaller sample without prevalent diabetes than in the larger combined sample of those with and without diabetes. This analysis demonstrates the potential utility of averaging trait values in GWAS studies and explores the advantage of using only individuals without prevalent diabetes in GWAS of fasting glucose. PMID:20839289

  20. Ovarian response and cumulative live birth rate of women undergoing in-vitro fertilisation who had discordant anti-Mullerian hormone and antral follicle count measurements: a retrospective study.

    Science.gov (United States)

    Li, Hang Wun Raymond; Lee, Vivian Chi Yan; Lau, Estella Yee Lan; Yeung, William Shu Biu; Ho, Pak Chung; Ng, Ernest Hung Yu

    2014-01-01

    To evaluate ovarian response and cumulative live birth rate of women undergoing in-vitro fertilization (IVF) treatment who had discordant baseline serum anti-Mullerian hormone (AMH) level and antral follicle count (AFC). This is a retrospective cohort study on 1,046 women undergoing the first IVF cycle in Queen Mary Hospital, Hong Kong. Subjects receiving standard IVF treatment with the GnRH agonist long protocol were classified according to their quartiles of baseline AMH and AFC measurements after GnRH agonist down-regulation and before commencing ovarian stimulation. The number of retrieved oocytes, ovarian sensitivity index (OSI) and cumulative live-birth rate for each classification category were compared. Among our studied subjects, 32.2% were discordant in their AMH and AFC quartiles. Among them, those having higher AMH within the same AFC quartile had higher number of retrieved oocytes and cumulative live-birth rate. Subjects discordant in AMH and AFC had intermediate OSI which differed significantly compared to those concordant in AMH and AFC on either end. OSI of those discordant in AMH and AFC did not differ significantly whether either AMH or AFC quartile was higher than the other. When AMH and AFC are discordant, the ovarian responsiveness is intermediate between that when both are concordant on either end. Women having higher AMH within the same AFC quartile had higher number of retrieved oocytes and cumulative live-birth rate.

  1. A Framework for Treating Cumulative Trauma with Art Therapy

    Science.gov (United States)

    Naff, Kristina

    2014-01-01

    Cumulative trauma is relatively undocumented in art therapy practice, although there is growing evidence that art therapy provides distinct benefits for resolving various traumas. This qualitative study proposes an art therapy treatment framework for cumulative trauma derived from semi-structured interviews with three art therapists and artistic…

  2. A Framework for Treating Cumulative Trauma with Art Therapy

    Science.gov (United States)

    Naff, Kristina

    2014-01-01

    Cumulative trauma is relatively undocumented in art therapy practice, although there is growing evidence that art therapy provides distinct benefits for resolving various traumas. This qualitative study proposes an art therapy treatment framework for cumulative trauma derived from semi-structured interviews with three art therapists and artistic…

  3. Cumulative Estrogen Exposure and Prospective Memory in Older Women

    Science.gov (United States)

    Hesson, Jacqueline

    2012-01-01

    This study looked at cumulative lifetime estrogen exposure, as estimated with a mathematical index (Index of Cumulative Estrogen Exposure (ICEE)) that included variables (length of time on estrogen therapy, age at menarche and menopause, postmenopausal body mass index, time since menopause, nulliparity and duration of breastfeeding) known to…

  4. Thermal stability of chicken brain {alpha}-spectrin repeat 17: a spectroscopic study

    Energy Technology Data Exchange (ETDEWEB)

    Brenner, Annette K. [University of Bergen, Department of Chemistry (Norway); Kieffer, Bruno [Ecole Superieure de Biotechnologie de Strasbourg, IGBMC Biomolecular NMR Group, CNRS UMR 7104 (France); Trave, Gilles [Ecole Superieure de Biotechnologie de Strasbourg, Equipe Oncoproteines, IREBS, UMR 7242 (France); Froystein, Nils Age [University of Bergen, Department of Chemistry (Norway); Raae, Arnt J., E-mail: arnt.raae@mbi.uib.no [University of Bergen, Department of Molecular Biology (Norway)

    2012-06-15

    Spectrin is a rod-like multi-modular protein that is mainly composed of triple-helical repeats. These repeats show very similar 3D-structures but variable conformational and thermodynamical stabilities, which may be of great importance for the flexibility and dynamic behaviour of spectrin in the cell. For instance, repeat 17 (R17) of the chicken brain spectrin {alpha}-chain is four times less stable than neighbouring repeat 16 (R16) in terms of Increment G. The structure of spectrin repeats has mainly been investigated by X-ray crystallography, but the structures of a few repeats, e.g. R16, have also been determined by NMR spectroscopy. Here, we undertook a detailed characterization of the neighbouring R17 by NMR spectroscopy. We assigned most backbone resonances and observed NOE restraints, relaxation values and coupling constants that all indicated that the fold of R17 is highly similar to that of R16, in agreement with previous X-ray analysis of a tandem repeat of the two domains. However, {sup 15}N heteronuclear NMR spectra measured at different temperatures revealed particular features of the R17 domain that might contribute to its lower stability. Conformational exchange appeared to alter the linker connecting R17 to R16 as well as the BC-loop in close proximity. In addition, heat-induced splitting was observed for backbone resonances of a few spatially related residues including V99 of helix C, which in R16 is replaced by the larger hydrophobic tryptophan residue that is relatively conserved among other spectrin repeats. These data support the view that the substitution of tryptophan by valine at this position may contribute to the lower stability of R17.

  5. Essays on diffusion and repeat sales of consumer durables : a study of the consumer electronics market

    OpenAIRE

    Kaya, Maria

    2008-01-01

    Although repeat purchases dominate overall sales of consumer durables, diffusion of innovations research has paid them far less attention than new product adoptions. A large survey of 8,077 households allowed a detailed investigation of the differences between households in terms of their repeat purchase behavior of durables. Asymmetric effects were investigated using competing hazard models and showed that consumer innovativeness has a strong impact on discretionary replacements. A modified ...

  6. Laparoscopic versus open nephroureterectomy for the treatment of upper urinary tract urothelial carcinoma: a systematic review and cumulative analysis of comparative studies.

    Science.gov (United States)

    Ni, Shaobin; Tao, Weiyang; Chen, Qiyin; Liu, Lianxin; Jiang, Hongchi; Hu, Hailong; Han, Ruifa; Wang, Chunyang

    2012-06-01

    Laparoscopic nephroureterectomy (LNU) has increasingly been used as a minimally invasive alternative to open nephroureterectomy (ONU), but studies comparing the efficacy and safety of the two surgical procedures are still limited. Evaluate the oncologic and perioperative outcomes of LNU versus ONU in the treatment of upper urinary tract urothelial carcinoma. A systematic review and cumulative analysis of comparative studies reporting both oncologic and perioperative outcomes of LNU and ONU was performed through a comprehensive search of the Medline, Embase, and the Cochrane Library electronic databases. All analyses were performed using the Review Manager (RevMan) v.5 (Nordic Cochrane Centre, Copenhagen, Denmark) and Meta-analysis In eXcel (MIX) 2.0 Pro (BiostatXL) software packages. Twenty-one eligible studies (1235 cases and 3093 controls) were identified. A significantly higher proportion of pTa/Tis was observed in LNU compared to ONU (27.52% vs 22.59%; p = 0.047), but there were no significant differences in other stages and pathologic grades (all p>0.05). For patients who underwent LNU, the 5-yr cancer-specific survival (CSS) rate was significantly higher, at 9% (p = 0.03), compared to those who underwent ONU, while the overall recurrence rate and bladder recurrence rate were notably lower, at 15% (p = 0.01) and 17% (p = 0.02), respectively. However, there were no statistically significant differences in 2-yr CSS, 5-yr recurrence-free survival (RFS), 5-yr overall survival (OS), 2-yr OS, and metastasis rates between LNU and ONU (all p>0.05). Moreover, there were no significant differences between LNU and ONU in terms of intraoperative complications, postoperative complications, and perioperative mortality (all p>0.05). The results of our study were mainly limited by the retrospective design of most of the individual studies included as well as selection biases based on different management of regional lymph nodes and pathologic characteristics. Our data suggest

  7. CAG repeat polymorphisms in the androgen receptor and breast cancer risk in women: a meta-analysis of 17 studies.

    Science.gov (United States)

    Mao, Qixing; Qiu, Mantang; Dong, Gaochao; Xia, Wenjie; Zhang, Shuai; Xu, Youtao; Wang, Jie; Rong, Yin; Xu, Lin; Jiang, Feng

    2015-01-01

    The association between polymorphic CAG repeats in the androgen receptor gene in women and breast cancer susceptibility has been studied extensively. However, the conclusions regarding this relationship remain conflicting. The purpose of this meta-analysis was to identify whether androgen receptor CAG repeat lengths were related to breast cancer susceptibility. The MEDLINE, PubMed, and EMBASE databases were searched through to December 2014 to identify eligible studies. Data and study quality were rigorously assessed by two investigators according to the Newcastle-Ottawa Quality Assessment Scale. The publication bias was assessed by the Begg's test. Seventeen eligible studies were included in this meta-analysis. The overall analysis suggested no association between CAG polymorphisms and breast cancer risk (odds ratio [OR] 1.031, 95% confidence interval [CI] 0.855-1.245). However, in the subgroup analysis, we observed that long CAG repeats significantly increased the risk of breast cancer in the Caucasian population (OR 1.447, 95% CI 1.089-1.992). Additionally, the risk was significantly increased in Caucasian women carrying two alleles with CAG repeats ≥22 units compared with those with two shorter alleles (OR 1.315, 95% CI 1.014-1.707). These findings suggest that long CAG repeats increase the risk of breast cancer in Caucasian women. However, larger scale case-control studies are needed to validate our results.

  8. Intimate partner violence and repeat induced abortion in Italy: A cross sectional study.

    Science.gov (United States)

    Citernesi, Angela; Dubini, Valeria; Uglietti, Anna; Ricci, Elena; Cipriani, Sonia; Parazzini, Fabio

    2015-01-01

    To investigate the impact of intimate partner violence (IPV) on the risk of repeat induced abortion (RIA), we compared IPV history among women with and without previous induced abortion (IA). All consecutive women aged 18 years or more requiring IA in 12 Italian abortion clinics were eligible for inclusion in the study. They were asked to fill in an anonymous, self-developed questionnaire assessing sociodemographic data and their history of different types of violence and related risk factors. The analysis included 1030 women, 624 (60.6%) of whom reported a previous IA. Past or current IPV was reported by 19.3%: 7.0% reported sexual violence, 11.3% physical abuse and 12.1% psychological abuse. Past or current IPV was reported by 22.3% of women with RIA and 14.8% of those undergoing their first IA (adjusted odds ratio 1.57, 95% confidence interval 1.07-2.30; p = 0.02). When we considered sexual, psychological and physical abuse separately, we found that any kind of abuse was more frequent in women with RIA than in women with no previous IA. This study underlines the impact of IPV on the risk of RIA and suggests the need for screening for IPV among women requiring abortion, in order to identify women at risk of RIA and to improve their general and reproductive health.

  9. Repeated open application test with methyldibromo glutaronitrile, a multicentre study within the EECDRG.

    Science.gov (United States)

    Gruvberger, B; Andersen, K E; Brandão, F M; Bruynzeel, D P; Bruze, M; Frosch, P J; Goossens, A; Lahti, A; Maibach, H I; Menné, T; Orton, D; Seidenari, S

    2005-01-01

    Contact allergy to and allergic contact dermatitis from methyldibromo glutaronitrile (MDBGN) have frequently been reported. This study was initiated to help determine the optimal patch test preparation for MDBGN. In 51 patients with a doubtful or a positive patch test reaction to at least 1 of 4 test preparations with MDBGN in petrolatum at 1.0% w/w, 0.5%, 0.3% and 0.1%, a repeated open application test (ROAT) with moisturizers with and without MDBGN at 0.03% w/w was performed on the upper arms for 2 weeks. 18 of the 51 (35.3%) patients developed a positive ROAT. In all patients, there was a positive ROAT only to the moisturizer with MDBGN (P < 0.001). A statistically significant association was also found between the patch test reactivity (PTRL) and the outcome of the ROAT (P < 0.001). If only considering those with a PTRL above 0.3%, thus with negative or doubtful test reactions to 0.1% and 0.3%, there were still statistically significantly more patients with a positive ROAT to the moisturizer with MDBGN than to the moisturizer without MDBGN. The study demonstrates that patch testing with MDBGN at 0.3% and 0.1% will miss clinically relevant patch test reactions to MDBGN.

  10. Repeated exposure of acidic beverages on esthetic restorative materials: An in-vitro surface microhardness study.

    Science.gov (United States)

    Xavier, Arun M; Sunny, Steffy M; Rai, Kavita; Hegde, Amitha M

    2016-07-01

    A manifold increase in the consumption of aerated beverages has witnessed a twin increase in tooth wear and raised demand for esthetic restorative materials. This study aimed to evaluate the surface microhardness changes of esthetic restorative materials following treatment with aerated beverages in an in-vitro situation. The initial surface microhardness of the restorative materials GC Fuji II LC, GC Fuji IX, Nano Glass ionomer, Resin and Nano composite was recorded. These materials were studied under 3 groups that included those exposed to the acidic beverages daily, weekly once in a month and those that had no exposures at all. The final surface microhardness of the materials was recorded following experimentation and was subjected to statistical comparisons. The restorative materials were compared for their surface microhardness changes following respective treatments using the T-test and One-way ANOVA analysis. Inter-comparisons between the groups showed statistical significance (pmaterials revealed surface microhardness loss; the maximum reduction noticed with the Nano glass ionomer cement tested (pmaterials markedly reduced upon repeated exposures with acidic beverages; the product with phosphoric acid producing the maximum surface microhardness loss. Restorative materials, acidic beverages, surface microhardness, resin composites, glass ionomers.

  11. A semiparametric censoring bias model for estimating the cumulative risk of a false-positive screening test under dependent censoring.

    Science.gov (United States)

    Hubbard, Rebecca A; Miglioretti, Diana L

    2013-03-01

    False-positive test results are among the most common harms of screening tests and may lead to more invasive and expensive diagnostic testing procedures. Estimating the cumulative risk of a false-positive screening test result after repeat screening rounds is, therefore, important for evaluating potential screening regimens. Existing estimators of the cumulative false-positive risk are limited by strong assumptions about censoring mechanisms and parametric assumptions about variation in risk across screening rounds. To address these limitations, we propose a semiparametric censoring bias model for cumulative false-positive risk that allows for dependent censoring without specifying a fixed functional form for variation in risk across screening rounds. Simulation studies demonstrated that the censoring bias model performs similarly to existing models under independent censoring and can largely eliminate bias under dependent censoring. We used the existing and newly proposed models to estimate the cumulative false-positive risk and variation in risk as a function of baseline age and family history of breast cancer after 10 years of annual screening mammography using data from the Breast Cancer Surveillance Consortium. Ignoring potential dependent censoring in this context leads to underestimation of the cumulative risk of false-positive results. Models that provide accurate estimates under dependent censoring are critical for providing appropriate information for evaluating screening tests.

  12. The Study on the Ferrokinetics and Acquired Immunity in Repeated Hookworm Infections

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Mun Ho; Lee, Pyl Ung [Seoul National University College of Medicine, Seoul (Korea, Republic of)

    1967-09-15

    In order to confirm whether acquired immunity or resistance can be developed by the repeated hookworm infections, the 150 mature actively moving filariform ancylostoma duodenale larvae obtained from the severe hookworm anemia patients were orally given to 8 healthy volunteers in three divided doses, 50 in each, at 5 day interval. Also the hematological changes as well as several ferrokinetics using {sup 59}Fe were done and were compared with 10 controls. The clinical symptoms and signs were checked every day for the first 3 weeks and then twice weekly until the end of the experiment. The appearance of the ova in the stool was examined by the formalin ether method and the ova was counted by the Stoll's method. The following laboratory tests were done:1) Red blood cell count, venous blood hematocrit (micromethod), hemoglobin count (cyanomethemoglobin method) were checked every 5 to 7 day interval. 2) Plasma iron concentration (Barkan's modified method) was determined every 2 to 3 week interval. 3) Radioisotope studies:a) Ferrokinetics: Huff et al and Bothwell's method were applied. Erythropoietic Index (% of normal)= ['Subject's turnover/100 ml whole bloodX100'] over ['Average normal turnover/100 ml whole blood'] b) Quantitative measurement of the gastrointestinal absorption of iron:Radioiron ({sup 59}Fe) balance method was applied. c) Determination of the plasma erythropoietin activity: Fried's method was applied. Following were the results: 1) The serum iron level was lower. The red cell volume was decreased, but with relative increase of plasma volume. 2) The plasma iron disappearance time was accelerated and the plasma iron turnover rate was decreased. The red cell iron turnover rate was markedly increased, while all of the red cell iron concentration, circulating red cell iron, plasma iron pool were decreased. The daily iron pool turnover and red cell renewal rate were increased. 3) The erythropoietic index

  13. Structural Studies of a Four-MBT Repeat Protein MBTD1

    Energy Technology Data Exchange (ETDEWEB)

    Eryilmaz, Jitka; Pan, Patricia; Amaya, Maria F.; Allali-Hassani, Abdellah; Dong, Aiping; Adams-Cioaba, Melanie A.; MacKenzie, Farrell; Vedadi, Masoud; Min, Jinrong; (Toronto); (Toronto)

    2010-08-17

    The Polycomb group (PcG) of proteins is a family of important developmental regulators. The respective members function as large protein complexes involved in establishment and maintenance of transcriptional repression of developmental control genes. MBTD1, Malignant Brain Tumor domain-containing protein 1, is one such PcG protein. MBTD1 contains four MBT repeats. We have determined the crystal structure of MBTD1 (residues 130-566aa covering the 4 MBT repeats) at 2.5 {angstrom} resolution by X-ray crystallography. The crystal structure of MBTD1 reveals its similarity to another four-MBT-repeat protein L3MBTL2, which binds lower methylated lysine histones. Fluorescence polarization experiments confirmed that MBTD1 preferentially binds mono- and di-methyllysine histone peptides, like L3MBTL1 and L3MBTL2. All known MBT-peptide complex structures characterized to date do not exhibit strong histone peptide sequence selectivity, and use a 'cavity insertion recognition mode' to recognize the methylated lysine with the deeply buried methyl-lysine forming extensive interactions with the protein while the peptide residues flanking methyl-lysine forming very few contacts. Nevertheless, our mutagenesis data based on L3MBTL1 suggested that the histone peptides could not bind to MBT repeats in any orientation. The four MBT repeats in MBTD1 exhibits an asymmetric rhomboid architecture. Like other MBT repeat proteins characterized so far, MBTD1 binds mono- or dimethylated lysine histones through one of its four MBT repeats utilizing a semi-aromatic cage.

  14. Resistance repeatability study of ion-beam deposited vanadium oxide thin films

    Science.gov (United States)

    Alvarez, P.; Pearson, D. I. C.; Pochon, S.; Thomas, O.; Cooke, M.; Gunn, R.

    2016-09-01

    Ion Beam Sputter Deposition (IBSD) is a versatile technique particularly suited to applications requiring high quality, high performance layer materials as it allows independent and accurate control of the process parameters. Vanadium oxides, used for example in the fabrication of microbolometers, optical switches or optical storage, exhibit interesting properties such as a high Temperature Coefficient of Resistance (TCR), relatively low 1/f noise and a semiconductormetal phase transition close to room temperature. However, it is very challenging to control the stoichiometry of the deposited film as there are at least 25 different oxidation states of vanadium, few of which display the required electrical characteristics. In the present study, vanadium oxide thin layers were deposited by IBSD using an Oxford Ionfab300+ and analyzed with regard to their electrical properties. The impact of the system parameters on the resistance repeatability, wafer-to-wafer and batch-to-batch, was thoroughly investigated to provide the end user with a clear understanding of the factors affecting film resistivity while ensuring at the same time a steep variation of resistance with temperature, as notably required for uncooled bolometers. These parameters were balanced to also achieve a good deposition rate, throughput and uniformity over large device areas, compatible with the requirements of industrial applications.

  15. Comparative Genomic Hybridization Selection of Blastocysts for Repeated Implantation Failure Treatment: A Pilot Study

    Science.gov (United States)

    Greco, Ermanno; Bono, Sara; Ruberti, Alessandra; Lobascio, Anna Maria; Greco, Pierfrancesco; Biricik, Anil; Spizzichino, Letizia; Greco, Alessia; Tesarik, Jan; Minasi, Maria Giulia; Fiorentino, Francesco

    2014-01-01

    The aim of this study is to determine if the use of preimplantation genetic screening (PGS) by array comparative genomic hybridization (array CGH) and transfer of a single euploid blastocyst in patients with repeated implantation failure (RIF) can improve clinical results. Three patient groups are compared: 43 couples with RIF for whom embryos were selected by array CGH (group RIF-PGS), 33 couples with the same history for whom array CGH was not performed (group RIF NO PGS), and 45 good prognosis infertile couples with array CGH selected embryos (group NO RIF PGS). A single euploid blastocyst was transferred in groups RIF-PGS and NO RIF PGS. Array CGH was not performed in group RIF NO PGS in which 1-2 blastocysts were transferred. One monoembryonic sac with heartbeat was found in 28 patients of group RIF PGS and 31 patients of group NO RIF PGS showing similar clinical pregnancy and implantation rates (68.3% and 70.5%, resp.). In contrast, an embryonic sac with heartbeat was only detected in 7 (21.2%) patients of group RIF NO PGS. In conclusion, PGS by array CGH with single euploid blastocyst transfer appears to be a successful strategy for patients with multiple failed IVF attempts. PMID:24779011

  16. Repeated dose (14 days) rat intramuscular toxicology study of Her1 vaccine.

    Science.gov (United States)

    Mancebo, A; Casacó, A; Sánchez, B; González, B; Gómez, D; León, A; Bada, A M; Arteaga, M E; González, Y; González, C; Pupo, M; Fuentes, Dasha

    2012-12-01

    Our goal was to assess the toxicity of two strengths (200 and 400 μg) of HER1 cancer vaccine (Center of Molecular Immunology, Cuba), presented in two different formulations, in Sprague Dawley rats after repeated intramuscular administration (14 days). Four groups (5 animals/sex) were established: Control, Placebo (adjuvant), and two Treated groups receiving a dose representing ten times of human total dose (10×), 28.6 and 57.1 μg/kg. Clinical observations, body weight and rectal temperature were measured during the study. Clinical pathology analysis was performed, besides gross necropsy and histological examination of tissues on animals at the end of the assay. The assay ended with a 100% survival. Injection site damage, with the presence of cysts and granulomas, was observed in adjuvant and vaccine treated groups, with most severe cases predominating at higher strength. Administration of Placebo and Her1 vaccine induced increase in polymorphonuclear cells, with relative lymphopenia conditioned by primary neutrophilia. In summary, results suggest that Her1 immunization was capable of inducing an inflammatory effect at the injection site, leading to systemic alterations, more significant at higher strength (400 μg, 57.1 μg/kg), probably affected by the immunizations' schedule used. The vaccine was shown to be well tolerated without any obvious signs of systemic toxicity, with findings largely attributable to the adjuvant used.

  17. Study on the homocysteine metabolism of patients with unexplained repeated spontaneous abortion

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Objective:To study the metabolism abnormality of homocysteine(Hcy) in unexplained repeated spontaneous abortion(URSA).Methods:The level of Hcy in sera was measured with hyperpressure liquid chromatography(HPLC);Folic acid and vitamin B12 were detected by radioimmune assay;anticardiolipin antibody (ACA) was detected by ELISA.Results:(1)The level of serum Hcy in URSA group was significantly higher than that in control group,showing a statistical significant difference(P<0.01).The level of Hcy was correlated with ages,but not correlated with areas,numbers of miscarriage,gestation age,primary or secondary abortions.(2)The levels of folic acid and vitamin B12 in URSA group were significantly lower than those in control group.The levels of serum folic acid and vitamin B12 were not correlated with age,area,numbers of miscarriage and abortion periods.(3)ACA positive rate in URSA was significantly higher than that in control group.The level of Hcy in ACA(+) group was significantly higher than that in ACA(-) group among URSA patients.Conclusions:Hyperhomocysteinemia,low folic acid state,and ACA were all the independent risk factors for URSA.Lacking of folic acid and vitamin B12 is one of the important causes of hyperhomocysteinemia.ACA and hyperhomocysteinemia may have synergistic action in the occurrence of URSA.

  18. Use of the Maximum Cumulative Ratio As an Approach for Prioritizing Aquatic Coexposure to Plant Protection Products: A Case Study of a Large Surface Water Monitoring Database.

    Science.gov (United States)

    Vallotton, Nathalie; Price, Paul S

    2016-05-17

    This paper uses the maximum cumulative ratio (MCR) as part of a tiered approach to evaluate and prioritize the risk of acute ecological effects from combined exposures to the plant protection products (PPPs) measured in 3 099 surface water samples taken from across the United States. Assessments of the reported mixtures performed on a substance-by-substance approach and using a Tier One cumulative assessment based on the lowest acute ecotoxicity benchmark gave the same findings for 92.3% of the mixtures. These mixtures either did not indicate a potential risk for acute effects or included one or more individual PPPs that had concentrations in excess of their benchmarks. A Tier Two assessment using a trophic level approach was applied to evaluate the remaining 7.7% of the mixtures. This assessment reduced the number of mixtures of concern by eliminating the combination of endpoint from multiple trophic levels, identified invertebrates and nonvascular plants as the most susceptible nontarget organisms, and indicated that a only a very limited number of PPPs drove the potential concerns. The combination of the measures of cumulative risk and the MCR enabled the identification of a small subset of mixtures where a potential risk would be missed in substance-by-substance assessments.

  19. Cumulate Fragments in Silicic Ignimbrites

    Science.gov (United States)

    Bachmann, O.; Ellis, B. S.; Wolff, J.

    2014-12-01

    Increasingly, studies are concluding that silicic ignimbrites are the result of the amalgamation of multiple discrete magma batches. Yet the existence of discrete batches presents a conundrum for magma generation and storage; if silicic magma batches are not generated nearly in situ in the upper crust, they must traverse, and reside within, a thermally hostile environment with large temperature gradients, resulting in low survivability in their shallow magmatic hearths. The Snake River Plain (Idaho, USA) is a type example of this 'multi-batch' assembly with ignimbrites containing multiple populations of pyroxene crystals, glass shards, and crystal aggregates. The ubiquitous crystal aggregates hint at a mechanism to facilitate the existence of multiple, relatively small batches of rhyolite in the upper crust. These aggregates contain the same plagioclase, pyroxene, and oxide mineral compositions as single phenocrysts of the same minerals in their host rocks, but they have significantly less silicic bulk compositions and lack quartz and sanidine, which occur as single phenocrysts in the deposits. This implies significant crystallization followed by melt extraction from mushy reservoir margins. The extracted melt then continues to evolve (crystallizing sanidine and quartz) while the melt-depleted margins provide an increasingly rigid and refractory network segregating the crystal-poor batches of magma. The hot, refractory, margins insulate the crystal-poor lenses, allowing (1) extended residence in the upper crust, and (2) preservation of chemical heterogeneities among batches. In contrast, systems that produce cumulates richer in low-temperature phases (quartz, K-feldspars, and/or biotite) favour remelting upon recharge, leading to less segregation of eruptible melt pockets and the formation of gradationally zoned ignimbrites. The occurrence of similar crystal aggregates from a variety of magmatic lineages suggests the generality of this process.

  20. Structural Vibration Monitoring Using Cumulative Spectral Analysis

    Directory of Open Access Journals (Sweden)

    Satoru Goto

    2013-01-01

    Full Text Available This paper describes a resonance decay estimation for structural health monitoring in the presence of nonstationary vibrations. In structural health monitoring, the structure's frequency response and resonant decay characteristics are very important for understanding how the structure changes. Cumulative spectral analysis (CSA estimates the frequency decay by using the impulse response. However, measuring the impulse response of buildings is impractical due to the need to shake the building itself. In a previous study, we reported on system damping monitoring using cumulative harmonic analysis (CHA, which is based on CSA. The current study describes scale model experiments on estimating the hidden resonance decay under non-stationary noise conditions by using CSA for structural condition monitoring.

  1. Identification and characterization of simple sequence repeats (SSRs) for population studies of Puccinia novopanici.

    Science.gov (United States)

    Orquera-Tornakian, Gabriela K; Garrido, Patricia; Kronmiller, Brent; Hunger, Robert; Tyler, Brett M; Garzon, Carla D; Marek, Stephen M

    2017-08-01

    Switchgrass (Panicum virgatum L.) can be severely affected by rust disease. Recently switchgrass rust caused by P. emaculata (now confirmed to be Puccinia novopanici) has received most of the attention by the research community because this pathogen is responsible for reducing the biomass production and biofuel feedstock quality of switchgrass. Microsatellite markers found in the literature were either not informative (no allele frequency) or showed few polymorphisms in the target populations, therefore additional markers are needed for future studies of the genetic variation and population structure of P. novopanici. This study reports the development and characterization of novel simple sequence repeat (SSR) markers from a Puccinia emaculata s.l. microsatellite-enriched library and expressed sequence tags (ESTs). Microsatellites were evaluated for polymorphisms on P. emaculata s.l. urediniospores collected in Iowa (IA), Mississippi (MS), Oklahoma (OK), South Dakota (SD) and Virginia (VA). Puccinia novopanici single spore whole genome amplifications were used as templates to validate the SSR reactions protocol and to assess a preliminary population genetics statistics of the pathogen. Eighteen microsatellite markers were polymorphic (average PIC=0.72) on individual urediniospores, with an average of 8.3 alleles per locus (range 3 to 17). Of the 49 SSRs loci initially identified in P. emaculata s.l., 18 were transferable to P. striiformis f. sp. tritici, 23 to P. triticina, 20 to P. sorghi and 31 to P. andropogonis. Thus, these markers could be useful for DNA fingerprinting and population structure analysis for population genetics, epidemiology and ecological studies of P. novopanici and potentially other related Puccinia species. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Repeat sleeve gastrectomy compared with primary sleeve gastrectomy: a single-center, matched case study.

    Science.gov (United States)

    Rebibo, Lionel; Fuks, David; Verhaeghe, Pierre; Deguines, Jean-Baptiste; Dhahri, Abdennaceur; Regimbeau, Jean-Marc

    2012-12-01

    Longitudinal sleeve gastrectomy (LSG) has been validated for the treatment of morbid obesity. However, treatment failures can appear several months after SG. Additional malabsorptive surgery is generally recommended in such cases. The objective of the present study was to evaluate the outcomes of repeat SG (re-SG) relative to first-line SG. This was a retrospective study included 15 patients underwent re-SG after failure of first-line SG (i.e. University Hospital, France; Public Practice). These patients were matched (for age, gender, body mass index and comorbidities) 1:2 with 30 patients having undergone first-line SG. The efficacy criteria comprised intra-operative data and postoperative data. The overall study population comprised 45 patients. The re-SG and first-line SG groups did not differ significantly in terms of median age (p = NS). The median BMI was similar in the two groups (43 kg/m(2) vs. 42.3 kg/m(2), p = NS). The two groups were similar in terms of the prevalence of comorbidities. The mean operating time was longer in the re-SG group (116 vs. 86 min; p ≤ 0.01). The postoperative complication rate was twice as high in the re-SG group (p = 0.31). Two patients in the re-SG group developed a gastric fistula (p = 0.25) and one of the latter died. At 12 months, the Excess Weight Loss was 66% (re-SG group) and 77% (first-line SG group) (p = 0.05). Re-SG is feasible but appears to be associated with a greater risk of complications. Nevertheless, re-SG can produce results (in terms of weight loss), equivalent to those obtained after first-line SG.

  3. Quantum repeated games revisited

    CERN Document Server

    Frackiewicz, Piotr

    2011-01-01

    We present a scheme for playing quantum repeated 2x2 games based on the Marinatto and Weber's approach to quantum games. As a potential application, we study twice repeated Prisoner's Dilemma game. We show that results not available in classical game can be obtained when the game is played in the quantum way. Before we present our idea, we comment on the previous scheme of playing quantum repeated games.

  4. Responsiveness of 5-HT2C receptors in repeatedly diazepam-injected rats: a behavioral and neurochemical study.

    Science.gov (United States)

    Khan, Asma; Haleem, Darakhshan J

    2008-01-01

    The role of 5-hydroxytryptamine (serotonin; 5-HT)2C receptors in anxiety and the anxiolytic effects of drugs is well documented. In view of the withdrawal anxiety associated with repeated diazepam intake, the present study concerns the efficacy of 5-HT2C receptors in rats treated with diazepam. Results show that diazepam injections at a dose of 2 mg/kg daily for two weeks increased weekly food intake and growth rate. Anxiolytic effects of the drug monitored in a light/dark activity box were not significant after single administration. One week and two weeks of administration elicited anxiolytic effects, which were smaller after two weeks of administration as compared to one week, suggesting the development of tolerance to the anxiolytic profile of diazepam. Moreover, three days' withdrawal from repeated administration elicited anxiogenic behavior in the light/dark activity box. The behavioral and neurochemical effects of 1-(m-chlorophenyl)piperazine (m-CPP) (3 mg/kg), a 5-HT2C agonist, were monitored following withdrawal (three days) from two weeks of diazepam administration. Results showed that hypophagic as well as anxiogenic-like effects of m-CPP were not different from repeated saline or repeated diazepam-injected animals. Administration of m-CPP increased 5-HT metabolism in repeated saline as well as repeated diazepam-injected animals. However, m-CPP-induced increases in 5-HT metabolism were greater in repeated diazepam-injected animals. Results are discussed in the context of the role of 5-HT2C receptors in the precipitation of withdrawal anxiety.

  5. Genetic structure of the Azores Islands: a study using 15 autosomal short tandem repeat loci.

    Science.gov (United States)

    Santos, Cristina; Alvarez, Luis; Aluja, Maria Pilar; Bruges-Armas, Jacome; Lima, Manuela

    2009-12-01

    The Azores archipelago (Portugal), located in the Atlantic Ocean, 1,500 km from the European mainland, is formed by nine islands of volcanic origin. The relative position of these islands allows the definition of three geographical groups: Eastern, Central and Western. Previous studies of the Azores using Short Tandem Repeats (STRs) have highlighted differences in the frequencies of several loci, when compared to Mainland Portugal or Madleira Island. Furthermore, linkage disequilibrium (LD), described for Azorean samples has been tentatively explained as reflecting the presence of genetic sub-structuring in the archipelago. To provide information concerning the genetic profile of the Azores Islands and to evaluate the presence of substructuring we have determined the allelic frequencies of 15 autosomal STR loci, using the AmpFlSTR Identifiler Kit, in representative samples from the Azorean Islands. Either considering the Azores as a whole, or analysing by island all the loci were in conformity with Hardy-Weinberg equilibrium. Average gene diversity ranged from 0.7669 in Corvo to 0.7972 in Terceira Island. Allelic independence between loci, tested for the global sample, detected significant LD (after correction for multiple tests) for pairs D21S11/D7S820 and D3S1358/D5S818. The exact test of population differentiation, combining the information of the 15 markers analysed, revealed significant differences between the three groups of islands, and between islands. Inter-island analysis reinforces the previous data that suggested the existence of sub-structuring in the Azores archipelago. Moreover, the data generated by this study can be used in a future forensic genetic database of the Azores after the appropriate enlacement of sample size by island, preventing, in that way, misinterpretations caused by population substructuring and small sample sizes.

  6. Electro-cumulation CNF project

    CERN Document Server

    Grishin, V G

    2000-01-01

    bound or free ion current within solid substances; non-plain symmetry; cumulation of the ion interaction. Experimental result: an Ice SuperPolarization. Cold nuclear fusion ? At http://www.shortway.to/to2084 . Keywords: ion, current, solid, symmetry, cumulation, cold nuclear fusion, polarization, depolarization, ionic conductor, superionic conductor, ice, crystal, strain, V-center, V-centre, doped crystal, interstitial impurity, intrinsic color center, high pressure technology, Bridgman, experiment, crowdion, dielectric, proton, layer, defect, lattice, dynamics, electromigration, mobility, muon catalysis, concentration, doping, dopant, conductivity, pycnonuclear reaction, permittivity, dielectric constant, point defects, interstitials, polarizability, imperfection, defect centers, glass, epitaxy, sodium hydroxide, metallic substrate, crystallization, point, tip, susceptibility, ferroelectric, ordering, force, correlation, collective, shift, distortion, coalescence, crowdions, electrolysis.

  7. LONGITUDINAL STUDY OF REPEATED SPRINT PERFORMANCE IN YOUTH SOCCER PLAYERS OF CONTRASTING SKELETAL MATURITY STATUS

    Directory of Open Access Journals (Sweden)

    João Valente-dos-Santos

    2012-09-01

    Full Text Available The purpose of the study was to evaluate the developmental changes in performance in a repeated-sprint ability (RSA test in young soccer players of contrasting maturity status. A total of 83 regional level Portuguese youth soccer players, aged 11- 13 years at baseline was assessed annually. Stature, body mass, 7x34.2-m sprint protocol (25-s active recovery, 20-m multi-stage continuous shuttle endurance run and counter-movement jump (CMJ without the use of the arms were measured. Fat-free mass (FFM was determined by age and gender- specific formulas. Developmental changes in total sprint time across ages were predicted using multilevel modeling. Corresponding measurements were performed on an independent cross-sectional subsample of 52 youth soccer players 11-17 years to evaluate the predictive model. CA, CA2, maturational status (SA-CA, body size (mass and stature, FFM, aerobic endurance, lower limb explosive strength and annual volume training significantly improved the statistical fit of the RSA multilevel model. In 'late' maturing athletes, the best model for predicting change in RSA was expressed by the following equation: 86.54 - 2.87 x CA + 0.05 x CA2 - 0.25 x FFM + 0.15 x body mass + 0.05 x stature - 0.05 x aerobic endurance - 0.09 x lower limb explosive strength - 0.01 x annual volume training. The best fitting models for players who were 'on time' and 'early' maturing were identical to the best model for late maturing players, less 0.64 seconds and 1.74 seconds, respectively. Multilevel modeling provided performance curves that permitted the prediction of individual RSA performance across adolescent years in regional level soccer players

  8. A 13-week dermal repeat-dose neurotoxicity study of hydrodesulfurized kerosene in rats.

    Science.gov (United States)

    Breglia, Rudolph; Bui, Quang; Burnett, Donald; Koschier, Francis; Lapadula, Elizabeth; Podhasky, Paula; Schreiner, Ceinwen; White, Russell

    2014-01-01

    A 13-week dermal repeat-dose toxicity study was conducted with hydrodesulfurized (HDS) kerosene, a test material that also met the commercial specifications for aviation turbine fuel (jet A). The objectives were to assess the potential for target organ toxicity and neurotoxicity. The HDS kerosene was applied to the shaved backs of Sprague-Dawley CD rats, 12/sex/group, 6 h/d, 5 d/wk in doses of 0 (vehicle control), 165 mg/kg (20% HDS kerosene), 330 mg/kg (40% HDS kerosene), or 495 mg/kg (60% HDS kerosene). Additional rats (12/sex) from the control and the high-dose groups were held without treatment for 4 weeks to assess recovery. Standard parameters of toxicity were investigated during the in-life phase. At necropsy, organs were weighed and selected tissues were processed for microscopic evaluation. Neurobehavioral evaluations included tests of motor activity and functional observations that were conducted pretest, at intervals during the exposure period and after recovery. No test substance-related effects on mortality, clinical observations (except dermal irritation), body weight, or clinical chemistry values were observed. A dose-related increase in skin irritation, confirmed histologically as minimal, was evident at the dosing site. The only statistically significant change considered potentially treatment related was an increase in the neutrophil count in females at 13 weeks. No test article-related effects were observed in the neurobehavioral assessments or gross or microscopic findings in the peripheral or central nervous system tissues in any of the dose groups. Excluding skin irritation, the no observed adverse effect level value for all effects was considered 495 mg/kg/d.

  9. Population genetic study of 10 short tandem repeat loci from 600 domestic dogs in Korea

    Science.gov (United States)

    Moon, Seo Hyun; Jang, Yoon-Jeong

    2016-01-01

    Dogs have long shared close relationships with many humans. Due to the large number of dogs in human populations, they are often involved in crimes. Occasionally, canine biological evidence such as saliva, bloodstains and hairs can be found at crime scenes. Accordingly, canine DNA can be used as forensic evidence. The use of short tandem repeat (STR) loci from biological evidence is valuable for forensic investigations. In Korea, canine STR profiling-related crimes are being successfully analyzed, leading to diverse crimes such as animal cruelty, dog-attacks, murder, robbery, and missing and abandoned dogs being solved. However, the probability of random DNA profile matches cannot be analyzed because of a lack of canine STR data. Therefore, in this study, 10 STR loci were analyzed in 600 dogs in Korea (344 dogs belonging to 30 different purebreds and 256 crossbred dogs) to estimate canine forensic genetic parameters. Among purebred dogs, a separate statistical analysis was conducted for five major subgroups, 97 Maltese, 47 Poodles, 31 Shih Tzus, 32 Yorkshire Terriers, and 25 Pomeranians. Allele frequencies, expected (Hexp) and observed heterozygosity (Hobs), fixation index (F), probability of identity (P(ID)), probability of sibling identity (P(ID)sib) and probability of exclusion (PE) were then calculated. The Hexp values ranged from 0.901 (PEZ12) to 0.634 (FHC2079), while the P(ID)sib values were between 0.481 (FHC2079) and 0.304 (PEZ12) and the P(ID)sib was about 3.35 × 10−5 for the combination of all 10 loci. The results presented herein will strengthen the value of canine DNA to solving dog-related crimes. PMID:26645337

  10. Pilot study: Assessing repeatability of the EcoWalk platform resistive pressure sensors to measure plantar pressure during barefoot standing

    Science.gov (United States)

    Zequera, Martha; Perdomo, Oscar; Wilches, Carlos; Vizcaya, Pedro

    2013-06-01

    Plantar pressure provides useful information to assess the feet's condition. These systems have emerged as popular tools in clinical environment. These systems present errors and no compensation information is presented by the manufacturer, leading to uncertainty in the measurements. Ten healthy subjects, 5 females and 5 males, were recruited. Lateral load distribution, antero-posterior load distribution, average pressure, contact area, and force were recorded. The aims of this study were to assess repeatability of the EcoWalk system and identify the range of pressure values observed in the normal foot. The coefficient of repeatability was less than 4% for all parameters considered.

  11. Reduction and technical simplification of testing protocol for walking based on repeatability analyses: An Interreg IVa pilot study

    Directory of Open Access Journals (Sweden)

    Nejc Sarabon

    2010-12-01

    Full Text Available The aim of this study was to define the most appropriate gait measurement protocols to be used in our future studies in the Mobility in Ageing project. A group of young healthy volunteers took part in the study. Each subject carried out a 10-metre walking test at five different speeds (preferred, very slow, very fast, slow, and fast. Each walking speed was repeated three times, making a total of 15 trials which were carried out in a random order. Each trial was simultaneously analysed by three observers using three different technical approaches: a stop watch, photo cells and electronic kinematic dress. In analysing the repeatability of the trials, the results showed that of the five self-selected walking speeds, three of them (preferred, very fast, and very slow had a significantly higher repeatability of the average walking velocity, step length and cadence than the other two speeds. Additionally, the data showed that one of the three technical methods for gait assessment has better metric characteristics than the other two. In conclusion, based on repeatability, technical and organizational simplification, this study helped us to successfully define a simple and reliable walking test to be used in the main study of the project.

  12. Exposure to phthalates in 5-6 years old primary school starters in Germany--a human biomonitoring study and a cumulative risk assessment.

    Science.gov (United States)

    Koch, Holger M; Wittassek, Matthias; Brüning, Thomas; Angerer, Jürgen; Heudorf, Ursel

    2011-06-01

    We determined the internal exposure of 111 German primary school starters by analyzing urinary metabolites of six phthalates: butyl benzyl phthalate (BBzP), di-iso-butyl phthalate (DiBP), di-n-butyl phthalate (DnBP), di (2-ethylhexyl) phthalate (DEHP), di-iso-nonyl phthalate (DiNP) and di-iso-decylphthalate (DiDP). From the urinary metabolite levels, we calculated daily intakes and related these values to Tolerable Daily Intake (TDI) values. By introducing the concept of a relative cumulative Tolerable Daily Intake (TDI(cum)) value, we tried to account for the cumulative exposure to several of the above-mentioned phthalates. The TDI(cum) was derived as follows: the daily intake (DI) calculated from the metabolite level was divided by the TDI for each phthalate; this ratio was multiplied by 100% indicating the TDI percentage for which the DI accounted. Finally the % TDIs of the different phthalates were totalled to get the TDI(cum). A TDI(cum) above 100% is a potential cause for concern. We confirmed the ubiquitous exposure of the children to all phthalates investigated. Exposures were within range of levels previously reported for GerES, albeit slightly lower. Regarding daily intakes, two children exceeded the TDI for DnBP, whereas one child closely approached the TDI for DEHP. 24% of the children exceeded the TDI(cum) for the three most critical phthalates: DEHP, DnBP and DiBP. Furthermore, 54% of the children had total exposures that used up more than 50% the TDI(cum). Therefore, the overall exposure to a number of phthalates, and the knowledge that these phthalates (and other anti-androgens) act in a dose-additive manner, urgently warrants a cumulative risk assessment approach.

  13. Prospective study on determinants of repeat attendance and attendance patterns in breast cancer screening using the Theory of Planned Behaviour.

    NARCIS (Netherlands)

    Drossaert, Constance H.C.; Boer, Hendrik; Seydel, E.R.

    2003-01-01

    This prospective study, using the Theory of Planned Behaviour (TPB) as a theoretical framework, was carried out to identify the determinants of repeat attendance and attendance patterns in organised breast screening. A group of 2657 women filled out a baseline questionnaire, approximately 8 weeks

  14. Cumulative Paired φ-Entropy

    Directory of Open Access Journals (Sweden)

    Ingo Klein

    2016-07-01

    Full Text Available A new kind of entropy will be introduced which generalizes both the differential entropy and the cumulative (residual entropy. The generalization is twofold. First, we simultaneously define the entropy for cumulative distribution functions (cdfs and survivor functions (sfs, instead of defining it separately for densities, cdfs, or sfs. Secondly, we consider a general “entropy generating function” φ, the same way Burbea et al. (IEEE Trans. Inf. Theory 1982, 28, 489–495 and Liese et al. (Convex Statistical Distances; Teubner-Verlag, 1987 did in the context of φ-divergences. Combining the ideas of φ-entropy and cumulative entropy leads to the new “cumulative paired φ-entropy” ( C P E φ . This new entropy has already been discussed in at least four scientific disciplines, be it with certain modifications or simplifications. In the fuzzy set theory, for example, cumulative paired φ-entropies were defined for membership functions, whereas in uncertainty and reliability theories some variations of C P E φ were recently considered as measures of information. With a single exception, the discussions in the scientific disciplines appear to be held independently of each other. We consider C P E φ for continuous cdfs and show that C P E φ is rather a measure of dispersion than a measure of information. In the first place, this will be demonstrated by deriving an upper bound which is determined by the standard deviation and by solving the maximum entropy problem under the restriction of a fixed variance. Next, this paper specifically shows that C P E φ satisfies the axioms of a dispersion measure. The corresponding dispersion functional can easily be estimated by an L-estimator, containing all its known asymptotic properties. C P E φ is the basis for several related concepts like mutual φ-information, φ-correlation, and φ-regression, which generalize Gini correlation and Gini regression. In addition, linear rank tests for scale that

  15. Assessing the repeatability of terrestrial laser scanning for monitoring gully topography: A case study from Aratula, Queensland, Australia

    Science.gov (United States)

    Goodwin, Nicholas Robert; Armston, John; Stiller, Isaac; Muir, Jasmine

    2016-06-01

    Terrestrial laser scanning (TLS) technology is a powerful tool for quantifying gully morphology and monitoring change over time. This is due to the high sampling density, sub-centimetre positional accuracies (x, y, z), flexibility of survey configurations and ability to link multiple TLS scans together. However, to ensure correct interpretation of results, research is needed to test the repeatability of TLS derived products to quantify the accuracy and separate 'false' from 'true' geomorphic change. In this study, we use the RIEGL VZ400 scanner to test the repeatability of TLS datasets for mapping gully morphology. We then quantify change following a rainfall event of approximately 100 mm. Our study site, located in south-east Queensland, Australia was chosen to be challenging from a repeatability perspective with high topographic variability. The TLS data capture involved three sets of linked scans: one survey pre-rainfall, to be compared to two surveys post-rainfall acquired on consecutive days. Change is considered negligible in the two post-rainfall scans to test survey repeatability. To verify TLS accuracy, an independent dataset of gully extent and spot heights were acquired using traditional total station techniques. Results confirm that the TLS datasets can be registered multi-temporally at sub-centimetre levels of accuracy in three dimensions. Total station and TLS elevation samples showed strong agreement with a mean error and standard deviation (SD) of residuals equal to 0.052 and 0.047 m, respectively (n = 889). Significantly, our repeatability tests found that return type and pulse deviation influence the accuracy and repeatability of DEMs in gully environments. Analysis of consecutive day datasets showed that DEMs derived from first return data recorded 40% higher SD of residual error than DEMs using multiple return data. A significant empirical relationship between pulse deviation and the variance of residuals for repeat DEMs is also shown (r2 = 0

  16. The study of the cumulative effects of the application of urban sewage sludge on an eroded soil cultivated in the Algerian steppe

    Science.gov (United States)

    Boutmedjet, Ahmed; Boukkaya, Nassira; Houyou, zohra; Ouakid, Mohamed; Bielders, Charles

    2014-05-01

    Since the seventies, desertification is one of the major problems faced by the Mediterranean climate regions. These problems are inherent in the soil and climate characteristics of these regions, but their magnitude and acuity depend mainly on human activities. The process of desertification that affects more and more land is more pronounced as soil degradation, which accelerates constantly reduced resources farmland and pasture. Especially in areas bordering the Sahara, as the Algerian steppe, a real belt between the Sahara and the Algerian tell As part of the study of the cumulative effect of the application of urban sewage sludge on sandy soil and culture that is a cereal (barley), we had results that enabled us to identify some precepts,. The short-term effects studied in this experiment indicate that the amendment of the sewage sludge had a beneficial effect on the fertilizing qualities of the soil and therefore the performance of barley. To observations of Culture (barley), indicate that the best grain yield was obtained with D3 (28.76 quintals / ha) and D2 (33.91 quintals / ha). This is due to the effect of the sludge by the addition of required nutrients crop production. The lowest yield (24.11 quintals / ha) being obtained for the control (D0). It is the same for straw yield, with 47.5 quintals / ha in D2. The D3 treatment (30 t / ha) has previously presented the best results, but after 3 years we noticed that the best yields are obtained with D2 (10 t / ha). Except the pH and the rate of limestone that are related to changes in the characteristics of the site, there was an improvement in some physical and chemical properties of the soil. The contributions of sewage sludge amended greater quality soil biology D2 (number and effective species collected). Increasing the organic matter content (1.45%) and electrical conductivity (0.18 microseconds / cm) in the soil is only significant for the highest dose (30t/ha), although a tendency to enrichment in

  17. Progress study on the mechanism of CAG repeats dynamic mutation in polyQ disease

    Directory of Open Access Journals (Sweden)

    WANG Chun-rong

    2012-06-01

    Full Text Available Polyglutamine (polyQ disease is a group of neurodegenerative disorders caused by abnormal expansion of CAG repeats within coding regions of certain causative genes, which are translated into a series of abnormally expanded polyQ tracts causing cytotoxicity. So far, nine diseases caused by expanded polyQ tracts have been demonstrated including Huntington's disease (HD, spinobulbar muscular atrophy (SBMA, dentatorubral-pallidoluysian atrophy (DRPLA and several spinocerebellar ataxias subtypes (SCA. In human, long CAG repeats tend to expand during transmissions from parent to offspring, named as dynamic mutation, leading to an earlier age of disease onset and more severe symptoms in subsequent generations. The review presents some novel mechanisms based on dynamic mutation.

  18. PCR bias in amplification of androgen receptor alleles, a trinucleotide repeat marker used in clonality studies.

    OpenAIRE

    Mutter, G L; Boynton, K A

    1995-01-01

    Trinucleotide CAG repeats in the X-linked human androgen receptor gene (HUMARA) have proved a useful means of determining X chromosome haplotypes, and when combined with methylation analysis of nearby cytosine residues permits identification of non-random X inactivation in tumors of women. Co-amplification of two alleles in a heterozygote generates PCR products which differ in the number of CAG units, and thus their melting and secondary structure characteristics. We have shown that under opt...

  19. A genetic and structural study of genome rearrangements mediated by high copy repeat Ty1 elements.

    Directory of Open Access Journals (Sweden)

    Jason E Chan

    2011-05-01

    Full Text Available Ty elements are high copy number, dispersed repeated sequences in the Saccharomyces cerevisiae genome known to mediate gross chromosomal rearrangements (GCRs. Here we found that introduction of Ty912, a previously identified Ty1 element, onto the non-essential terminal region of the left arm of chromosome V led to a 380-fold increase in the rate of accumulating GCRs in a wild-type strain. A survey of 48 different mutations identified those that either increased or decreased the rate of Ty-mediated GCRs and demonstrated that suppression of Ty-mediated GCRs differs from that of both low copy repeat sequence- and single copy sequence-mediated GCRs. The majority of the Ty912-mediated GCRs observed were monocentric nonreciprocal translocations mediated by RAD52-dependent homologous recombination (HR between Ty912 and a Ty element on another chromosome arm. The remaining Ty912-mediated GCRs appeared to involve Ty912-mediated formation of unstable dicentric translocation chromosomes that were resolved by one or more Ty-mediated breakage-fusion-bridge cycles. Overall, the results demonstrate that the Ty912-mediated GCR assay is an excellent model for understanding mechanisms and pathways that suppress genome rearrangements mediated by high copy number repeat sequences, as well as the mechanisms by which such rearrangements occur.

  20. Study of the repeatability of histone genes in the ploidy series of wheat and Aegilops

    Energy Technology Data Exchange (ETDEWEB)

    Vakhitov, V.A.; Kulikov, A.M.

    1986-10-01

    The hDNA content and number of histone genes in the genomes of different wheat and Aegilops species have been determined by molecular hybridization of DNA with /sup 125/I-histone DNA of Drosophila (L-repeat) on nitrocellulose filters. It has been demonstrated that the proportion of hDNA in the total DNA of diploid and polyploid wheat species is (1.3-7.7) x 10/sup -3/% (57-850 genes), and in the ploidy series of Aegilops species (2.0-8.0) x 10/sup -3/% (89-780 genes). The repeatability of the histone genes generally increases at each ploidy level in the species with higher DNA content. At the same time, it has been demonstrated that the DNA content is not the only factor determining repeatability of the histone genes, as some diploid and allopolyploid species have similar number of these genes. It has been concluded that genetic mechanisms are involved in the regulation of the number of histone genes.

  1. Repeatability study of mechanomyography in submaximal isometric contractions using coefficient of variation and intraclass correlation coefficient.

    Science.gov (United States)

    Akataki, K; Mita, K; Itoh, Y

    1999-01-01

    The within-day and between-day repeatability of the mechanomyogram (MMG) was assessed using the coefficient of variation (CV) and the intraclass correlation coefficient (ICC) and was compared with that of the electromyogram (EMG). The MMG and EMG were recorded simultaneously during isometric elbow flexion trials at different submaximal levels of 10% to 90% MVC. The testing session consisting of 9 submaximal trials was repeated 8 times on the same day for estimation of the within-day variation. In order to examine the between-day variation, the same testing session was also performed 8 times over 3 weeks with a 2-day rest interval between each session. The CVs within-day and between-day in both the MMG and EMG did not demonstrate any significant differences relating to the magnitude of force exerted. The CVs combined over all the force levels were approximately 10% within the same day and 25% between days for both the MMG and EMG. These corresponded to the within-day ICC of approximately 0.95 and the between-day ICC of 0.80. The repeatability of the MMG during submaximal isometric contractions of biceps brachii muscles is considered to be similar to that of the more established EMG.

  2. The Algebra of the Cumulative Percent Operation.

    Science.gov (United States)

    Berry, Andrew J.

    2002-01-01

    Discusses how to help students avoid some pervasive reasoning errors in solving cumulative percent problems. Discusses the meaning of ."%+b%." the additive inverse of ."%." and other useful applications. Emphasizes the operational aspect of the cumulative percent concept. (KHR)

  3. Adaptive strategies for cumulative cultural learning.

    Science.gov (United States)

    Ehn, Micael; Laland, Kevin

    2012-05-21

    The demographic and ecological success of our species is frequently attributed to our capacity for cumulative culture. However, it is not yet known how humans combine social and asocial learning to generate effective strategies for learning in a cumulative cultural context. Here we explore how cumulative culture influences the relative merits of various pure and conditional learning strategies, including pure asocial and social learning, critical social learning, conditional social learning and individual refiner strategies. We replicate the Rogers' paradox in the cumulative setting. However, our analysis suggests that strategies that resolved Rogers' paradox in a non-cumulative setting may not necessarily evolve in a cumulative setting, thus different strategies will optimize cumulative and non-cumulative cultural learning.

  4. Cumulative Production Per Township - SaMiRa

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This dataset contains a selected township grid within the Sagebrush Mineral Resource Assessment project (SaMiRa) study area attributed with cumulative oil and gas...

  5. Entanglement entropy and particle number cumulants of disordered fermions

    Science.gov (United States)

    Burmistrov, I. S.; Tikhonov, K. S.; Gornyi, I. V.; Mirlin, A. D.

    2017-08-01

    We study the entanglement entropy and particle number cumulants for a system of disordered noninteracting fermions in d dimensions. We show, both analytically and numerically, that for a weak disorder the entanglement entropy and the second cumulant (particle number variance) are proportional to each other with a universal coefficient. The corresponding expressions are analogous to those in the clean case but with a logarithmic factor regularized by the mean free path rather than by the system size. We also determine the scaling of higher cumulants by analytical (weak disorder) and numerical means. Finally, we predict that the particle number variance and the entanglement entropy are nonanalytic functions of disorder at the Anderson transition.

  6. "Buddha's Light" of Cumulative Particles

    CERN Document Server

    Kopeliovich, Vladimir B; Potashnikova, Irina K

    2014-01-01

    We show analytically that in the cumulative particles production off nuclei multiple interactions lead to a glory-like backward focusing effect. Employing the small phase space method we arrived at a characteristic angular dependence of the production cross section $d\\sigma \\sim 1/ \\sqrt {\\pi - \\theta}$ near the strictly backward direction. This effect takes place for any number $n\\geq 3 $ of interactions of rescattered particle, either elastic or inelastic (with resonance excitations in intermediate states), when the final particle is produced near corresponding kinematical boundary. Such a behaviour of the cross section near the backward direction is in qualitative agreement with some of available data.

  7. A Resource Cost Aware Cumulative

    Science.gov (United States)

    Simonis, Helmut; Hadzic, Tarik

    We motivate and introduce an extension of the well-known cumulative constraint which deals with time and volume dependent cost of resources. Our research is primarily interested in scheduling problems under time and volume variable electricity costs, but the constraint equally applies to manpower scheduling when hourly rates differ over time and/or extra personnel incur higher hourly rates. We present a number of possible lower bounds on the cost, including a min-cost flow, different LP and MIP models, as well as greedy algorithms, and provide a theoretical and experimental comparison of the different methods.

  8. Deployment Repeatability

    Science.gov (United States)

    2016-04-01

    controlled to great precision, but in a Cubesat , there may be no attitude determination at all. Such a Cubesat might treat sun angle and tumbling rates as...could be sensitive to small differences in motor controller timing. In these cases, the analyst might choose to model the entire deployment path, with...knowledge of the material damage model or motor controller timing precision. On the other hand, if many repeated and environmentally representative

  9. Variability in prefrontal hemodynamic response during exposure to repeated self-selected music excerpts, a near-infrared spectroscopy study.

    Science.gov (United States)

    Moghimi, Saba; Schudlo, Larissa; Chau, Tom; Guerguerian, Anne-Marie

    2015-01-01

    Music-induced brain activity modulations in areas involved in emotion regulation may be useful in achieving therapeutic outcomes. Clinical applications of music may involve prolonged or repeated exposures to music. However, the variability of the observed brain activity patterns in repeated exposures to music is not well understood. We hypothesized that multiple exposures to the same music would elicit more consistent activity patterns than exposure to different music. In this study, the temporal and spatial variability of cerebral prefrontal hemodynamic response was investigated across multiple exposures to self-selected musical excerpts in 10 healthy adults. The hemodynamic changes were measured using prefrontal cortex near infrared spectroscopy and represented by instantaneous phase values. Based on spatial and temporal characteristics of these observed hemodynamic changes, we defined a consistency index to represent variability across these domains. The consistency index across repeated exposures to the same piece of music was compared to the consistency index corresponding to prefrontal activity from randomly matched non-identical musical excerpts. Consistency indexes were significantly different for identical versus non-identical musical excerpts when comparing a subset of repetitions. When all four exposures were compared, no significant difference was observed between the consistency indexes of randomly matched non-identical musical excerpts and the consistency index corresponding to repetitions of the same musical excerpts. This observation suggests the existence of only partial consistency between repeated exposures to the same musical excerpt, which may stem from the role of the prefrontal cortex in regulating other cognitive and emotional processes.

  10. Cumulative exposure to childhood adversity, and treated attention deficit/hyperactivity disorder: a cohort study of 543 650 adolescents and young adults in Sweden.

    Science.gov (United States)

    Björkenstam, E; Björkenstam, C; Jablonska, B; Kosidou, K

    2017-07-25

    Though childhood adversity (CA) has been associated with the risk of attention deficit/hyperactivity disorder (ADHD), little is known about the effect of cumulative CAs and whether there are clusters of CAs that are more closely related with ADHD. We used a Swedish cohort of 543 650 individuals born 1987-1991. Register-based CAs included familial death, substantial parental substance abuse and psychiatric disorder, substantial parental criminality, parental separation, household public assistance recipiency, and residential instability. Individuals were followed from year 2006 when they were 15-19 years of age, for treated ADHD, defined as a registered ICD diagnosis and/or prescription of medications to treat ADHD. Logistic regression analysis was used to calculate odds ratios (OR) with 95% confidence intervals (CI). Latent Class Analyses (LCA) were used to identify clusters based on the different CAs. All CAs increased the odds of ADHD in late adolescence and early adulthood; ORs ranged from 1.6 (95% CI 1.5-1.8) for familial death to 2.7 (95% CI 2.6-2.9) for household public assistance. We found a dose-response relationship between cumulative CA and ADHD; individuals with 4+ CAs had a markedly increased risk for ADHD (OR 5.5, 95% CI 5.0-6.0). LCA analyses revealed six distinct classes of CA associated with ADHD, of which 'exposure to most adversities' entailed highest risk. CA is a strong risk factor for ADHD, particularly when accumulated. Early and efficient detection of CA is of importance for interventions targeted to improve long-term mental health outcomes among disadvantaged children.

  11. Evaluating Exposure-Response Associations for Non-Hodgkin Lymphoma with Varying Methods of Assigning Cumulative Benzene Exposure in the Shanghai Women's Health Study.

    Science.gov (United States)

    Friesen, Melissa C; Bassig, Bryan A; Vermeulen, Roel; Shu, Xiao-Ou; Purdue, Mark P; Stewart, Patricia A; Xiang, Yong-Bing; Chow, Wong-Ho; Ji, Bu-Tian; Yang, Gong; Linet, Martha S; Hu, Wei; Gao, Yu-Tang; Zheng, Wei; Rothman, Nathaniel; Lan, Qing

    2017-01-01

    To provide insight into the contributions of exposure measurements to job exposure matrices (JEMs), we examined the robustness of an association between occupational benzene exposure and non-Hodgkin lymphoma (NHL) to varying exposure assessment methods. NHL risk was examined in a prospective population-based cohort of 73087 women in Shanghai. A mixed-effects model that combined a benzene JEM with >60000 short-term, area benzene inspection measurements was used to derive two sets of measurement-based benzene estimates: 'job/industry-specific' estimates (our presumed best approach) were derived from the model's fixed effects (year, JEM intensity rating) and random effects (occupation, industry); 'calibrated JEM' estimates were derived using only the fixed effects. 'Uncalibrated JEM' (using the ordinal JEM ratings) and exposure duration estimates were also calculated. Cumulative exposure for each subject was calculated for each approach based on varying exposure definitions defined using the JEM's probability ratings. We examined the agreement between the cumulative metrics and evaluated changes in the benzene-NHL associations. For our primary exposure definition, the job/industry-specific estimates were moderately to highly correlated with all other approaches (Pearson correlation 0.61-0.89; Spearman correlation > 0.99). All these metrics resulted in statistically significant exposure-response associations for NHL, with negligible gain in model fit from using measurement-based estimates. Using more sensitive or specific exposure definitions resulted in elevated but non-significant associations. The robust associations observed here with varying benzene assessment methods provide support for a benzene-NHL association. While incorporating exposure measurements did not improve model fit, the measurements allowed us to derive quantitative exposure-response curves.

  12. Repeated hands-and-knees positioning during labour: a randomized pilot study.

    Science.gov (United States)

    Hodnett, Ellen D; Stremler, Robyn; Halpern, Stephen H; Weston, Julie; Windrim, Rory

    2013-01-01

    Background. Caesarean birth rates in North America continue to rise, in the absence of benefit for mothers and babies. One reason may be that hospitalized labouring women spend most of their labours in recumbent or semi-recumbent positions. Although hands-and-knees position has theoretical advantages, efforts to encourage its adoption in practice are severely hampered by the lack of compelling evidence that it is beneficial. Before a definitive, large scale trial, with spontaneous vaginal birth as the primary outcome, could be justified in terms of time, effort, and expense, several feasibility and acceptability questions had to be addressed. We aimed to enrol 60 women in a pilot study to assess feasibility and acceptability of the trial protocol, and to obtain estimates of treatment effects on method of birth and persistent back pain. Methods. We conducted a pilot study at two North American hospitals. In ten months of recruitment, 30 nulliparous women in labour at term were randomly allocated to either usual care (use of any position during labour except hands-and-knees) or to try hands-and-knees for 15 min every hour during labour. Data were collected about compliance, acceptability, persistent back pain, intrapartum interventions, and women's views of their experiences. Results. Although mean length of time from randomization to delivery was over 12 hours, only 9 of the 16 women allocated to repeated hands-and-knees used it more than twice. Two of the 14 in the usual care group used hands-and-knees once. Twenty-seven women had regional analgesia (15 in the hands-and-knees group and 12 in the usual care group). Eleven in the hands-and-knees group and 14 in the usual care group had spontaneous vaginal births. One woman (in the hands-and-knees group) had a vacuum extraction. Four women in the hands-and-knees group and none in the usual care group gave birth by caesarean section. Hourly back pain ratings were highly variable in both groups, covering the full range

  13. Repeated hands-and-knees positioning during labour: a randomized pilot study

    Directory of Open Access Journals (Sweden)

    Ellen D. Hodnett

    2013-02-01

    Full Text Available Background. Caesarean birth rates in North America continue to rise, in the absence of benefit for mothers and babies. One reason may be that hospitalized labouring women spend most of their labours in recumbent or semi-recumbent positions. Although hands-and-knees position has theoretical advantages, efforts to encourage its adoption in practice are severely hampered by the lack of compelling evidence that it is beneficial. Before a definitive, large scale trial, with spontaneous vaginal birth as the primary outcome, could be justified in terms of time, effort, and expense, several feasibility and acceptability questions had to be addressed. We aimed to enrol 60 women in a pilot study to assess feasibility and acceptability of the trial protocol, and to obtain estimates of treatment effects on method of birth and persistent back pain.Methods. We conducted a pilot study at two North American hospitals. In ten months of recruitment, 30 nulliparous women in labour at term were randomly allocated to either usual care (use of any position during labour except hands-and-knees or to try hands-and-knees for 15 min every hour during labour. Data were collected about compliance, acceptability, persistent back pain, intrapartum interventions, and women’s views of their experiences.Results. Although mean length of time from randomization to delivery was over 12 hours, only 9 of the 16 women allocated to repeated hands-and-knees used it more than twice. Two of the 14 in the usual care group used hands-and-knees once. Twenty-seven women had regional analgesia (15 in the hands-and-knees group and 12 in the usual care group. Eleven in the hands-and-knees group and 14 in the usual care group had spontaneous vaginal births. One woman (in the hands-and-knees group had a vacuum extraction. Four women in the hands-and-knees group and none in the usual care group gave birth by caesarean section. Hourly back pain ratings were highly variable in both groups

  14. A paradox of cumulative culture.

    Science.gov (United States)

    Kobayashi, Yutaka; Wakano, Joe Yuichiro; Ohtsuki, Hisashi

    2015-08-21

    Culture can grow cumulatively if socially learnt behaviors are improved by individual learning before being passed on to the next generation. Previous authors showed that this kind of learning strategy is unlikely to be evolutionarily stable in the presence of a trade-off between learning and reproduction. This is because culture is a public good that is freely exploited by any member of the population in their model (cultural social dilemma). In this paper, we investigate the effect of vertical transmission (transmission from parents to offspring), which decreases the publicness of culture, on the evolution of cumulative culture in both infinite and finite population models. In the infinite population model, we confirm that culture accumulates largely as long as transmission is purely vertical. It turns out, however, that introduction of even slight oblique transmission drastically reduces the equilibrium level of culture. Even more surprisingly, if the population size is finite, culture hardly accumulates even under purely vertical transmission. This occurs because stochastic extinction due to random genetic drift prevents a learning strategy from accumulating enough culture. Overall, our theoretical results suggest that introducing vertical transmission alone does not really help solve the cultural social dilemma problem. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. CAG repeat polymorphisms in the androgen receptor and breast cancer risk in women: a meta-analysis of 17 studies

    Directory of Open Access Journals (Sweden)

    Mao Q

    2015-08-01

    Full Text Available Qixing Mao,1–3,* Mantang Qiu,1–3,* Gaochao Dong,3 Wenjie Xia,1–3 Shuai Zhang,1,3 Youtao Xu,1,3 Jie Wang,3 Yin Rong,1,3 Lin Xu,1,3 Feng Jiang1,3 1Department of Thoracic Surgery, Nanjing Medical University Affiliated Cancer Institute of Jiangsu Province, 2Fourth Clinical College of Nanjing Medical University, 3Jiangsu Key Laboratory of Molecular and Translational Cancer Research, Nanjing, People’s Republic of China *These authors contributed equally to this work Abstract: The association between polymorphic CAG repeats in the androgen receptor gene in women and breast cancer susceptibility has been studied extensively. However, the conclusions regarding this relationship remain conflicting. The purpose of this meta-analysis was to identify whether androgen receptor CAG repeat lengths were related to breast cancer susceptibility. The MEDLINE, PubMed, and EMBASE databases were searched through to December 2014 to identify eligible studies. Data and study quality were rigorously assessed by two investigators according to the Newcastle-Ottawa Quality Assessment Scale. The publication bias was assessed by the Begg’s test. Seventeen eligible studies were included in this meta-analysis. The overall analysis suggested no association between CAG polymorphisms and breast cancer risk (odds ratio [OR] 1.031, 95% confidence interval [CI] 0.855–1.245. However, in the subgroup analysis, we observed that long CAG repeats significantly increased the risk of breast cancer in the Caucasian population (OR 1.447, 95% CI 1.089–1.992. Additionally, the risk was significantly increased in Caucasian women carrying two alleles with CAG repeats ≥22 units compared with those with two shorter alleles (OR 1.315, 95% CI 1.014–1.707. These findings suggest that long CAG repeats increase the risk of breast cancer in Caucasian women. However, larger scale case-control studies are needed to validate our results. Keywords: androgen, CAG repeat polymorphism, women

  16. Cumulative Risks of Foster Care Placement for Danish Children

    DEFF Research Database (Denmark)

    Fallesen, Peter; Emanuel, Natalia; Wildeman, Christopher

    2014-01-01

    Although recent research suggests that the cumulative risk of foster care placement is far higher for American children than originally suspected, little is known about the cumulative risk of foster care placement in other countries, which makes it difficult to gauge the degree to which factor...... is for Danish children. Results suggest that at the beginning of the study period (in 1998) the cumulative risk of foster care placement for Danish children was roughly in line with the risk for American children. Yet, by the end of the study period (2010), the risk had declined to half the risk for American...... foster care placement is salient in other contexts. In this article, we provide companion estimates to those provided in recent work on the US by using Danish registry data and synthetic cohort life tables to show how high and unequally distributed the cumulative risk of foster care placement...

  17. Cumulative radiation exposure in children with cystic fibrosis.

    LENUS (Irish Health Repository)

    O'Reilly, R

    2010-02-01

    This retrospective study calculated the cumulative radiation dose for children with cystic fibrosis (CF) attending a tertiary CF centre. Information on 77 children with a mean age of 9.5 years, a follow up time of 658 person years and 1757 studies including 1485 chest radiographs, 215 abdominal radiographs and 57 computed tomography (CT) scans, of which 51 were thoracic CT scans, were analysed. The average cumulative radiation dose was 6.2 (0.04-25) mSv per CF patient. Cumulative radiation dose increased with increasing age and number of CT scans and was greater in children who presented with meconium ileus. No correlation was identified between cumulative radiation dose and either lung function or patient microbiology cultures. Radiation carries a risk of malignancy and children are particularly susceptible. Every effort must be made to avoid unnecessary radiation exposure in these patients whose life expectancy is increasing.

  18. Repeat prenatal corticosteroid prior to preterm birth: a systematic review and individual participant data meta-analysis for the PRECISE study group (prenatal repeat corticosteroid international IPD study group: assessing the effects using the best level of evidence - study protocol

    Directory of Open Access Journals (Sweden)

    Crowther Caroline A

    2012-02-01

    Full Text Available Abstract Background The aim of this individual participant data (IPD meta-analysis is to assess whether the effects of repeat prenatal corticosteroid treatment given to women at risk of preterm birth to benefit their babies are modified in a clinically meaningful way by factors related to the women or the trial protocol. Methods/Design The Prenatal Repeat Corticosteroid International IPD Study Group: assessing the effects using the best level of Evidence (PRECISE Group will conduct an IPD meta-analysis. The PRECISE International Collaborative Group was formed in 2010 and data collection commenced in 2011. Eleven trials with up to 5,000 women and 6,000 infants are eligible for the PRECISE IPD meta-analysis. The primary study outcomes for the infants will be serious neonatal outcome (defined by the PRECISE International IPD Study Group as one of death (foetal, neonatal or infant; severe respiratory disease; severe intraventricular haemorrhage (grade 3 and 4; chronic lung disease; necrotising enterocolitis; serious retinopathy of prematurity; and cystic periventricular leukomalacia; use of respiratory support (defined as mechanical ventilation or continuous positive airways pressure or other respiratory support; and birth weight (Z-scores. For the children, the primary study outcomes will be death or any neurological disability (however defined by trialists at childhood follow up and may include developmental delay or intellectual impairment (developmental quotient or intelligence quotient more than one standard deviation below the mean, cerebral palsy (abnormality of tone with motor dysfunction, blindness (for example, corrected visual acuity worse than 6/60 in the better eye or deafness (for example, hearing loss requiring amplification or worse. For the women, the primary outcome will be maternal sepsis (defined as chorioamnionitis; pyrexia after trial entry requiring the use of antibiotics; puerperal sepsis; intrapartum fever requiring the use

  19. Some Characterization Results on Dynamic Cumulative Residual Tsallis Entropy

    Directory of Open Access Journals (Sweden)

    Madan Mohan Sati

    2015-01-01

    Full Text Available We propose a generalized cumulative residual information measure based on Tsallis entropy and its dynamic version. We study the characterizations of the proposed information measure and define new classes of life distributions based on this measure. Some applications are provided in relation to weighted and equilibrium probability models. Finally the empirical cumulative Tsallis entropy is proposed to estimate the new information measure.

  20. Mapping cumulative human impacts in the eastern North Sea

    DEFF Research Database (Denmark)

    Stock, A.; Andersen, Jesper; Heinänen, S.

    of the MSFD; and 3) to deepen the understanding of how errors in expert judgment affect the resulting cumulative human impact maps by means of Monte Carlo simulations. We combined existing data sets on the spatial distribution of 33 anthropogenic stressors (linked to the MSFD pressures) and 28 key habitats....... In contrast, the predicted impacts for much of the Norwegian EEZ and areas far offshore were lower. The Monte Carlo simulations confirmed earlier findings that mapping cumulative impacts is generally "robust", but also showed that specific combinations of errors can seriously change local and regional...... on marine ecosystems have only recently been developed. The aims of our study were: 1) to develop a map of cumulative human impacts for the Danish, Swedish, Norwegian and German parts of the Greater North Sea; 2) to adjust the existing methods for mapping cumulative human impacts to fit the requirements...

  1. Statistical Properties of repeating FRB 121102

    CERN Document Server

    Wang, F Y

    2016-01-01

    Fast radio bursts (FRBs) are millisecond-duration radio signals possibly occurring at cosmological distances. However the physical model of FRBs is mystery, many models have been proposed. Here we study the frequency distributions of peak flux, fluence, duration and waiting time for repeating FRB 121102. The cumulative distributions of peak flux, fluence and duration show power-law forms. The waiting time distribution also shows power-law distribution, and is consistent with a non-stationary Poisson process. We also use the statistical results to test the proposed models for FRBs. Comparing with the model predications, we find that the theoretical models proposed by Dai et al. (2016) and Katz (2016) are favored. These distributions are consistent with the predications from avalanche models of driven systems.

  2. Uncontrolled variables in frying studies: differences in repeatability between thermoxidation and frying experiments

    Directory of Open Access Journals (Sweden)

    Dobarganes, Carmen

    2007-09-01

    Full Text Available Palm oil, soybean oil and partially hydrogenated soybean oil were used to define the repeatability of oil degradation under thermoxidation in the absence of food and during the frying of potatoes. Total polar compounds and their constituent polymeric triglycerides, oxidized monomeric triglycerides and diglycerides were analyzed. The oils were thermoxidized under standard conditions in a Rancimat apparatus at 180 °C for 25 hours. Discontinuous frying experiments were carried out in triplicate in three apparently identical domestic fryers. Five batches of potatoes were fried per day in each fryer. Oils were heated at 180 °C in periods of 5 h per day during 5 consecutive days so that the total heating period was 25 h. Repeatability was high in the thermoxidation assays and rather low in the frying experiments. Significant differences between the oils were found in the thermoxidation experiments, while no significant differences were found in the frying assays due to large standard deviations. The participation of variables related to the fryer performance which are difficult to control, was deduced. Among them, differences in the heating/cooling cycles at high temperature might be important. The contribution of fryer performance to the decreased repeatability was confirmed in further frying experiments with palm oil. Results showed that repeatability for the same fryer was higher than that obtained when different fryers were considered.Se estudia la repetibilidad de los resultados obtenidos en el calentamiento de los aceites y grasas a temperatura elevada utilizando aceite de palma, aceite de soja y aceite de soja parcialmente hidrogenado. Partiendo de la repetibilidad de las determinaciones analíticas utilizadas para la evaluación de la degradación de los aceites y grasas a elevada temperatura, el análisis de compuestos polares y de su distribución en polímeros de triglicéridos, triglicéridos monómeros oxidados y diglicéridos, se

  3. Use of short tandem repeat sequences to study Mycobacterium leprae in leprosy patients in Malawi and India.

    Directory of Open Access Journals (Sweden)

    Saroj K Young

    2008-04-01

    Full Text Available Inadequate understanding of the transmission of Mycobacterium leprae makes it difficult to predict the impact of leprosy control interventions. Genotypic tests that allow tracking of individual bacterial strains would strengthen epidemiological studies and contribute to our understanding of the disease.Genotyping assays based on variation in the copy number of short tandem repeat sequences were applied to biopsies collected in population-based epidemiological studies of leprosy in northern Malawi, and from members of multi-case households in Hyderabad, India. In the Malawi series, considerable genotypic variability was observed between patients, and also within patients, when isolates were collected at different times or from different tissues. Less within-patient variability was observed when isolates were collected from similar tissues at the same time. Less genotypic variability was noted amongst the closely related Indian patients than in the Malawi series.Lineages of M. leprae undergo changes in their pattern of short tandem repeat sequences over time. Genetic divergence is particularly likely between bacilli inhabiting different (e.g., skin and nerve tissues. Such variability makes short tandem repeat sequences unsuitable as a general tool for population-based strain typing of M. leprae, or for distinguishing relapse from reinfection. Careful use of these markers may provide insights into the development of disease within individuals and for tracking of short transmission chains.

  4. Revisiting the TALE repeat.

    Science.gov (United States)

    Deng, Dong; Yan, Chuangye; Wu, Jianping; Pan, Xiaojing; Yan, Nieng

    2014-04-01

    Transcription activator-like (TAL) effectors specifically bind to double stranded (ds) DNA through a central domain of tandem repeats. Each TAL effector (TALE) repeat comprises 33-35 amino acids and recognizes one specific DNA base through a highly variable residue at a fixed position in the repeat. Structural studies have revealed the molecular basis of DNA recognition by TALE repeats. Examination of the overall structure reveals that the basic building block of TALE protein, namely a helical hairpin, is one-helix shifted from the previously defined TALE motif. Here we wish to suggest a structure-based re-demarcation of the TALE repeat which starts with the residues that bind to the DNA backbone phosphate and concludes with the base-recognition hyper-variable residue. This new numbering system is consistent with the α-solenoid superfamily to which TALE belongs, and reflects the structural integrity of TAL effectors. In addition, it confers integral number of TALE repeats that matches the number of bound DNA bases. We then present fifteen crystal structures of engineered dHax3 variants in complex with target DNA molecules, which elucidate the structural basis for the recognition of bases adenine (A) and guanine (G) by reported or uncharacterized TALE codes. Finally, we analyzed the sequence-structure correlation of the amino acid residues within a TALE repeat. The structural analyses reported here may advance the mechanistic understanding of TALE proteins and facilitate the design of TALEN with improved affinity and specificity.

  5. Spa Goers' Repeated Visits for Health and Wellness and the Influential Factors: An Exploratory Study of the UK Spa Goers.

    Science.gov (United States)

    Choi, Myungsuk; Poade, Donna; Sohn, Minsung; Choi, Mankyu

    2016-01-01

    Dissemination of spa services across the globe and its market saturation drive demand for differentiated communication methods. This study aims to explore the influential factors on spa goers' repeated visits and their practical applications in the health and wellness spa industry. The identified factors were used as the measurement variables to examine the relation with spa goers' repeated visits. The proposed concept was tested by a mixed method combining a self-administered questionnaire and semistructured interview with 54 survey participants and 6 interviewees. It was meaningful to use a sample of the UK spa goers from the southwest region since global spa trends stem from the EU spas, and the United Kingdom is one of the market leaders. The data were analyzed using frequency, percentage, multiple logistic regression analysis, and coding process. The survey findings demonstrated that the most significant influential factor on the repeated spa visits is a memorable experience of which showed 13.7 times higher probability than the reference up-to-date facility. The details of memorable experiences were discovered throughout the interviews that include the rediscovery of self, feeling of connectedness, recharge for positive emotions, self-reward through escapism, and experience of noncommercialized local products and attractions. Therefore, using experiential marketing methods can be effective spa service marketing.

  6. The prodromal phase of leucine-rich repeat kinase 2-associated Parkinson disease: Clinical and imaging Studies.

    Science.gov (United States)

    Pont-Sunyer, Claustre; Tolosa, Eduardo; Caspell-Garcia, Chelsea; Coffey, Christopher; Alcalay, Roy N; Chan, Piu; Duda, John E; Facheris, Maurizio; Fernández-Santiago, Rubén; Marek, Kenneth; Lomeña, Francisco; Marras, Connie; Mondragon, Elisabet; Saunders-Pullman, Rachel; Waro, Bjorg

    2017-05-01

    Asymptomatic, nonmanifesting carriers of leucine-rich repeat kinase 2 mutations are at increased risk of developing PD. Clinical and neuroimaging features may be associated with gene carriage and/or may demarcate individuals at greater risk for phenoconversion to PD. To investigate clinical and dopamine transporter single-photon emission computed tomography imaging characteristics of leucine-rich repeat kinase 2 asymptomatic carriers. A total of 342 carriers' and 259 noncarriers' relatives of G2019S leucine-rich repeat kinase 2/PD patients and 39 carriers' and 31 noncarriers' relatives of R1441G leucine-rich repeat kinase 2/PD patients were evaluated. Motor and nonmotor symptoms were assessed using specific scales and questionnaires. Neuroimaging quantitative data were obtained in 81 carriers and compared with 41 noncarriers. G2019S carriers scored higher in motor scores and had lower radioligand uptake compared to noncarriers, but no differences in nonmotor symptoms scores were observed. R1441G carriers scored higher in motor scores, had lower radioligand uptake, and had higher scores in depression, dysautonomia, and Rapid Eye Movements Sleep Behavior Disorder Screening Questionnaire scores, but had better cognition scores than noncarriers. Among G2019S carriers, a group with "mild motor signs" was identified, and was significantly older, with worse olfaction and lower radioligand uptake. G2019S and R1441G carriers differ from their noncarriers' relatives in higher motor scores and slightly lower radioligand uptake. Nonmotor symptoms were mild, and different nonmotor profiles were observed in G2019S carriers compared to R1441G carriers. A group of G2019S carriers with known prodromal features was identified. Longitudinal studies are required to determine whether such individuals are at short-term risk of developing overt parkinsonism. © 2017 International Parkinson and Movement Disorder Society. © 2017 International Parkinson and Movement Disorder Society.

  7. Variability in prefrontal hemodynamic response during exposure to repeated self-selected music excerpts, a near-infrared spectroscopy study.

    Directory of Open Access Journals (Sweden)

    Saba Moghimi

    Full Text Available Music-induced brain activity modulations in areas involved in emotion regulation may be useful in achieving therapeutic outcomes. Clinical applications of music may involve prolonged or repeated exposures to music. However, the variability of the observed brain activity patterns in repeated exposures to music is not well understood. We hypothesized that multiple exposures to the same music would elicit more consistent activity patterns than exposure to different music. In this study, the temporal and spatial variability of cerebral prefrontal hemodynamic response was investigated across multiple exposures to self-selected musical excerpts in 10 healthy adults. The hemodynamic changes were measured using prefrontal cortex near infrared spectroscopy and represented by instantaneous phase values. Based on spatial and temporal characteristics of these observed hemodynamic changes, we defined a consistency index to represent variability across these domains. The consistency index across repeated exposures to the same piece of music was compared to the consistency index corresponding to prefrontal activity from randomly matched non-identical musical excerpts. Consistency indexes were significantly different for identical versus non-identical musical excerpts when comparing a subset of repetitions. When all four exposures were compared, no significant difference was observed between the consistency indexes of randomly matched non-identical musical excerpts and the consistency index corresponding to repetitions of the same musical excerpts. This observation suggests the existence of only partial consistency between repeated exposures to the same musical excerpt, which may stem from the role of the prefrontal cortex in regulating other cognitive and emotional processes.

  8. Childhood Cumulative Risk Exposure and Adult Amygdala Volume and Function.

    Science.gov (United States)

    Evans, Gary W; Swain, James E; King, Anthony P; Wang, Xin; Javanbakht, Arash; Ho, S Shaun; Angstadt, Michael; Phan, K Luan; Xie, Hong; Liberzon, Israel

    2016-06-01

    Considerable work indicates that early cumulative risk exposure is aversive to human development, but very little research has examined the neurological underpinnings of these robust findings. This study investigates amygdala volume and reactivity to facial stimuli among adults (mean 23.7 years of age, n = 54) as a function of cumulative risk exposure during childhood (9 and 13 years of age). In addition, we test to determine whether expected cumulative risk elevations in amygdala volume would mediate functional reactivity of the amygdala during socioemotional processing. Risks included substandard housing quality, noise, crowding, family turmoil, child separation from family, and violence. Total and left hemisphere adult amygdala volumes were positively related to cumulative risk exposure during childhood. The links between childhood cumulative risk exposure and elevated amygdala responses to emotionally neutral facial stimuli in adulthood were mediated by the corresponding amygdala volumes. Cumulative risk exposure in later adolescence (17 years of age), however, was unrelated to subsequent adult amygdala volume or function. Physical and socioemotional risk exposures early in life appear to alter amygdala development, rendering adults more reactive to ambiguous stimuli such as neutral faces. These stress-related differences in childhood amygdala development might contribute to the well-documented psychological distress as a function of early risk exposure.

  9. PCR bias in amplification of androgen receptor alleles, a trinucleotide repeat marker used in clonality studies.

    Science.gov (United States)

    Mutter, G L; Boynton, K A

    1995-04-25

    Trinucleotide CAG repeats in the X-linked human androgen receptor gene (HUMARA) have proved a useful means of determining X chromosome haplotypes, and when combined with methylation analysis of nearby cytosine residues permits identification of non-random X inactivation in tumors of women. Co-amplification of two alleles in a heterozygote generates PCR products which differ in the number of CAG units, and thus their melting and secondary structure characteristics. We have shown that under optimal conditions amplification efficiency of two HUMARA alleles is near-equivalent, generating PCR products in a ratio proportional to that of the genomic template. In contrast, reduction of template quantity, damage of template by ultraviolet irradiation or addition of monovalent salts (sodium chloride, sodium acetate or ammonium acetate) produces highly variable imbalances of allelic PCR products, with a strong tendency to preferentially amplify lower molecular weight alleles. Variability and biasing was diminished by substitution of 7-deaza-2'-dGTP for dGTP during amplification, an intervention which reduces stability of intramolecular and intermolecular GC base pairing. We conclude that DNA which is scanty, damaged or salt contaminated may display amplification bias of GC-rich PCR targets, potentially confounding accurate interpretation or reproducibility of assays which require co-amplification of alleles.

  10. Analyzing repeated measures semi-continuous data, with application to an alcohol dependence study.

    Science.gov (United States)

    Liu, Lei; Strawderman, Robert L; Johnson, Bankole A; O'Quigley, John M

    2016-02-01

    Two-part random effects models (Olsen and Schafer,(1) Tooze et al.(2)) have been applied to repeated measures of semi-continuous data, characterized by a mixture of a substantial proportion of zero values and a skewed distribution of positive values. In the original formulation of this model, the natural logarithm of the positive values is assumed to follow a normal distribution with a constant variance parameter. In this article, we review and consider three extensions of this model, allowing the positive values to follow (a) a generalized gamma distribution, (b) a log-skew-normal distribution, and (c) a normal distribution after the Box-Cox transformation. We allow for the possibility of heteroscedasticity. Maximum likelihood estimation is shown to be conveniently implemented in SAS Proc NLMIXED. The performance of the methods is compared through applications to daily drinking records in a secondary data analysis from a randomized controlled trial of topiramate for alcohol dependence treatment. We find that all three models provide a significantly better fit than the log-normal model, and there exists strong evidence for heteroscedasticity. We also compare the three models by the likelihood ratio tests for non-nested hypotheses (Vuong(3)). The results suggest that the generalized gamma distribution provides the best fit, though no statistically significant differences are found in pairwise model comparisons.

  11. NMR studies on domain diffusion and alignment in modular GB1 repeats.

    Science.gov (United States)

    Walsh, Joseph D; Meier, Katlyn; Ishima, Rieko; Gronenborn, Angela M

    2010-10-20

    Modular proteins contain individual domains that are often connected by flexible, unstructured linkers. Using a model system based on the GB1 domain, we constructed tandem repeat proteins and investigated the rotational diffusion and long-range angular ordering behavior of individual domains by measuring NMR relaxation parameters and residual dipolar couplings. Although they display almost identical protein-solvent interfaces, each domain exhibits distinct rotational diffusion and alignment properties. The diffusion tensor anisotropy of the N-terminal domain (NTD) is D(‖)/D(⊥) = 1.5-1.6, similar to that of single-GB1 domains (D(‖)/D(⊥) = 1.6-1.7), whereas the value for the C-terminal domain (CTD) is D(‖)/D(⊥) = 2.0-2.2. In addition, the two domains have different rotational correlation times. These effects are observed for linkers of three to 24 residues, irrespective of linker length. The NTD and CTD also differ in their degree of magnetic alignment, even with a flexible linker of 18 residues, exhibiting D(a) values of 7.7 Hz and 9.7 Hz, respectively. Our results suggest that diffusion differences and long-range influences may persist in modular protein systems, even for systems that have highly flexible linkers and exhibit no domain-domain or domain-linker interactions.

  12. Does sequential embryo transfer improve pregnancy rate in patients with repeated implantation failure? A randomized control study

    Directory of Open Access Journals (Sweden)

    Wael A. Ismail Madkour

    2015-12-01

    Full Text Available Background: Repeated failure of in vitro fertilization treatment is frustrating to the patients and their clinicians. Various treatment plans and a change of protocol have been suggested for “low responders”; however, patients who fail treatment repeatedly inspite of good quality embryos pose a special therapeutic challenge. Additional challenge would be imposed on that particular group when the local IVF regulating low does not permit surplus embryo freezing. Objective: To examine whether sequential transfer of embryos on day 3 and on day 5 after ovum pick-up improves IVF/ET success rates in patients with repeated consecutive IVF failures (⩾ 3 trials compared to day 3 alone, with the background that local regulation prohibits embryo freezing. Study design: Randomized controlled study. Women scheduled for IVF/ET with repeated consecutive IVF failures (⩾ 3 trials were randomized to either sequential transfer of embryos on day 3 and on day 5 after ovum pick-up (Group I = 74 or conventional day 3 transfer (Group II = 73 as a control. The primary outcome measures were clinical pregnancy rate and implantation rate. The secondary outcome measures were ongoing pregnancy rate and early pregnancy loss. Results: Baseline and cycle characteristics were comparable in both groups. Clinical pregnancy rate (per embryo transfer was significantly higher in sequential ET group (37. 8% compared to that in day 3 group (21.9% (P value <0.05. Also, implantation rate (per embryos transferred was significantly higher in sequential ET group (17.1% compared to that in control group (10.5% (P value <0.01. Similarly, ongoing pregnancy (per embryo transfer was significantly higher in sequential ET group (33. 8% compared to that in day 3 group (19.2% (P value <0.05. Conclusions: Patients with repeated implantation failures, treatment with the sequential embryo transfer approach had significantly improved pregnancy outcomes compared to regular day 3 transfers

  13. Cumulative Environmental Management Association : Wood Buffalo Region

    Energy Technology Data Exchange (ETDEWEB)

    Friesen, B. [Syncrude Canada Ltd., Edmonton, AB (Canada)

    2001-07-01

    The recently announced oil sands development of the Wood Buffalo Region in Alberta was the focus of this power point presentation. Both mining and in situ development is expected to total $26 billion and 2.6 million barrels per day of bitumen production. This paper described the economic, social and environmental challenges facing the resource development of this region. In addition to the proposed oil sands projects, this region will accommodate the needs of conventional oil and gas production, forestry, building of pipelines and power lines, municipal development, recreation, tourism, mining exploration and open cast mining. The Cumulative Environmental Management Association (CEMA) was inaugurated as a non-profit association in April 2000, and includes 41 members from all sectors. Its major role is to ensure a sustainable ecosystem and to avoid any cumulative impacts on wildlife. Other work underway includes the study of soil and plant species diversity, and the effects of air emissions on human health, wildlife and vegetation. The bioaccumulation of heavy metals and their impacts on surface water and fish is also under consideration to ensure the quality and quantity of surface water and ground water. 3 figs.

  14. Higher Order Cumulants in Colorless Partonic Plasma

    CERN Document Server

    Cherif, S; Ladrem, M

    2016-01-01

    Any physical system considered to study the QCD deconfinement phase transition certainly has a finite volume, so the finite size effects are inevitably present. This renders the location of the phase transition and the determination of its order as an extremely difficult task, even in the simplest known cases. In order to identify and locate the colorless QCD deconfinement transition point in finite volume $T_{0}(V)$, a new approach based on the finite-size cumulant expansion of the order parameter and the $\\mathscr{L}_{m,n}$-Method is used.We have shown that both cumulants of higher order and their ratios, associated to the thermodynamical fluctuations of the order parameter, in QCD deconfinement phase transition behave in a particular enough way revealing pronounced oscillations in the transition region. The sign structure and the oscillatory behavior of these in the vicinity of the deconfinement phase transition point might be a sensitive probe and may allow one to elucidate their relation to the QCD phase...

  15. Cumulative increased risk of incident type 2 diabetes mellitus with increasing triglyceride glucose index in normal-weight people: The Rural Chinese Cohort Study.

    Science.gov (United States)

    Zhang, Ming; Wang, Bingyuan; Liu, Yu; Sun, Xizhuo; Luo, Xinping; Wang, Chongjian; Li, Linlin; Zhang, Lu; Ren, Yongcheng; Zhao, Yang; Zhou, Junmei; Han, Chengyi; Zhao, Jingzhi; Hu, Dongsheng

    2017-03-01

    Risk of type 2 diabetes mellitus (T2DM) is increased in metabolically obese but normal-weight people. However, we have limited knowledge of how to prevent T2DM in normal-weight people. We aimed to evaluate the association between triglyceride glucose (TyG) index and incident T2DM among normal-weight people in rural China. We included data from 5706 people with normal body mass index (BMI) (18.5-23.9 kg/m(2)) without baseline T2DM in a rural Chinese cohort followed for a median of 6.0 years. A Cox proportional-hazard model was used to assess the risk of incident T2DM by quartiles of TyG index and difference in TyG index between follow-up and baseline (TyG-D), estimating hazard ratios (HRs) and 95% confidence intervals (CIs). A generalized additive plot was used to show the nonparametric smoothed exposure-response association between risk of T2DM and TyG index as a continuous variable. TyG was calculated as ln [fasting triglyceride level (mg/dl) × fasting plasma glucose level (mg/dl)/2]. Risk of incident T2DM was increased with quartiles 2, 3 and 4 versus quartile 1 of TyG index (adjusted HR [aHR] 2.48 [95% CI 1.20-5.11], 3.77 [1.83-7.79], and 5.30 [2.21-12.71], P trend Risk of incident T2DM was increased with quartile 4 versus quartile 1 of TyG-D (aHR 3.91 [2.22-6.87]). The results were consistent when analyses were restricted to participants without baseline metabolic syndrome and impaired fasting glucose level. The generalized additive plot showed cumulative increased risk of T2DM with increasing TyG index. Risk of incident T2DM is increased with increasing TyG index among rural Chinese people, so the index might be an important indicator for identifying people at high risk of T2DM.

  16. GSTM1 and APE1 genotypes affect arsenic-induced oxidative stress: a repeated measures study

    Directory of Open Access Journals (Sweden)

    Quamruzzaman Quazi

    2007-12-01

    Full Text Available Abstract Background Chronic arsenic exposure is associated with an increased risk of skin, bladder and lung cancers. Generation of oxidative stress may contribute to arsenic carcinogenesis. Methods To investigate the association between arsenic exposure and oxidative stress, urinary 8-hydroxy-2'-deoxyguanosine (8-OHdG was evaluated in a cohort of 97 women recruited from an arsenic-endemic region of Bangladesh in 2003. Arsenic exposure was measured in urine, toenails, and drinking water. Drinking water and urine samples were collected on three consecutive days. Susceptibility to oxidative stress was evaluated by genotyping relevant polymorphisms in glutathione-s transferase mu (GSTM1, human 8-oxoguanine glycosylase (hOGG1 and apurinic/apyrimidinic endonuclease (APE1 genes using the Taqman method. Data were analyzed using random effects Tobit regression to account for repeated measures and 8-OHdG values below the detection limit. Results A consistent negative effect for APE1 was observed across water, toenail and urinary arsenic models. APE1 148 glu/glu + asp/glu genotype was associated with a decrease in logged 8-OHdG of 0.40 (95%CI -0.73, -0.07 compared to APE1 148 asp/asp. An association between total urinary arsenic and 8-OHdG was observed among women with the GSTM1 null genotype but not in women with GSTM1 positive. Among women with GSTM1 null, a comparison of the second, third, and fourth quartiles of total urinary arsenic to the first quartile resulted in a 0.84 increase (95% CI 0.27, 1.42, a 0.98 increase (95% CI 033, 1.66 and a 0.85 increase (95% CI 0.27, 1.44 in logged 8-OHdG, respectively. No effects between 8-OHdG and toenail arsenic or drinking water arsenic were observed. Conclusion These results suggest the APE1 variant genotype decreases repair of 8-OHdG and that arsenic exposure is associated with oxidative stress in women who lack a functional GSTM1 detoxification enzyme.

  17. Repeated head trauma is associated with smaller thalamic volumes and slower processing speed: the Professional Fighters' Brain Health Study.

    Science.gov (United States)

    Bernick, Charles; Banks, Sarah J; Shin, Wanyong; Obuchowski, Nancy; Butler, Sam; Noback, Michael; Phillips, Michael; Lowe, Mark; Jones, Stephen; Modic, Michael

    2015-08-01

    Cumulative head trauma may alter brain structure and function. We explored the relationship between exposure variables, cognition and MRI brain structural measures in a cohort of professional combatants. 224 fighters (131 mixed martial arts fighters and 93 boxers) participating in the Professional Fighters Brain Health Study, a longitudinal cohort study of licensed professional combatants, were recruited, as were 22 controls. Each participant underwent computerised cognitive testing and volumetric brain MRI. Fighting history including years of fighting and fights per year was obtained from self-report and published records. Statistical analyses of the baseline evaluations were applied cross-sectionally to determine the relationship between fight exposure variables and volumes of the hippocampus, amygdala, thalamus, caudate, putamen. Moreover, the relationship between exposure and brain volumes with cognitive function was assessed. Increasing exposure to repetitive head trauma measured by number of professional fights, years of fighting, or a Fight Exposure Score (FES) was associated with lower brain volumes, particularly the thalamus and caudate. In addition, speed of processing decreased with decreased thalamic volumes and with increasing fight exposure. Higher scores on a FES used to reflect exposure to repetitive head trauma were associated with greater likelihood of having cognitive impairment. Greater exposure to repetitive head trauma is associated with lower brain volumes and lower processing speed in active professional fighters. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  18. [A case-control study of factors associated with repeat teen pregnancy based on a sample from a university maternity hospital].

    Science.gov (United States)

    Silva, Andréa de Albuquerque Arruda; Coutinho, Isabela C; Katz, Leila; Souza, Alex Sandro Rolland

    2013-03-01

    Repeat teen pregnancy is a frequent issue and is considered an aggravating factor for increased maternal and fetal morbidity and social problems. The aim of the study was to identify factors associated with repeat teen pregnancy. A case-control study was conducted in 90 postpartum adolescents with more than one pregnancy (cases) and 90 adult women with a history of only one pregnancy during adolescence (controls). Statistical analysis used hierarchical logistic regression with 5% significance. Early sexual initiation (< 15 years), early age at first pregnancy (< 16 years), not raising the children themselves, and low family income (< one minimum wage) were associated with repeat teenage pregnancy, while partner change was inversely associated. Repeat teen pregnancy was mainly associated with reproductive and socioeconomic factors. Partner change appeared as a protective factor. Measures should be adopted during the postpartum period of teenage mothers in order to avoid repeat pregnancy.

  19. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Yan-Min Ma

    2014-06-01

    Full Text Available This study aimed to investigate the correlations among androgen receptor (AR CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and fifty-three healthy men (aged 22.8 ± 3.1 years were enrolled. The individuals were grouped as CAG short (CAG S if they harbored repeat length of ≤20 or as CAG long (CAG L if their CAG repeat length was >20. Body height/weight, penile length and other parameters were examined and recorded by the specified physicians; CAG repeat polymorphism was determined by the polymerase chain reaction (PCR method; and the serum levels of the sex hormones were detected by radioimmunoassay. Student's t-test or linear regression analysis was used to assess the associations among AR CAG repeat polymorphism, sex hormones and penile length. This investigation showed that the serum total testosterone (T level was positively associated with the AR CAG repeat length (P = 0.01; whereas, no significant correlation of T or AR CAG repeat polymorphism with the penile length was found (P = 0.593. Interestingly, an inverse association was observed between serum prolactin (PRL levels and penile length by linear regression analyses (β= −0.024, P = 0.039, 95% confidence interval (CI: −0.047, 0. Collectively, this study provides the first evidence that serum PRL, but not T or AR CAG repeat polymorphism, is correlated with penile length in the Han adult population from northwestern China.

  20. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China: a cross-sectional study.

    Science.gov (United States)

    Ma, Yan-Min; Wu, Kai-Jie; Ning, Liang; Zeng, Jin; Kou, Bo; Xie, Hong-Jun; Ma, Zhen-Kun; Wang, Xin-Yang; Gong, Yong-Guang; He, Da-Lin

    2014-01-01

    This study aimed to investigate the correlations among androgen receptor (AR) CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and fifty-three healthy men (aged 22.8 ± 3.1 years) were enrolled. The individuals were grouped as CAG short (CAG S ) if they harbored repeat length of ≤ 20 or as CAG long (CAG L ) if their CAG repeat length was >20. Body height/weight, penile length and other parameters were examined and recorded by the specified physicians; CAG repeat polymorphism was determined by the polymerase chain reaction (PCR) method; and the serum levels of the sex hormones were detected by radioimmunoassay. Student's t-test or linear regression analysis was used to assess the associations among AR CAG repeat polymorphism, sex hormones and penile length. This investigation showed that the serum total testosterone (T) level was positively associated with the AR CAG repeat length (P = 0.01); whereas, no significant correlation of T or AR CAG repeat polymorphism with the penile length was found (P = 0.593). Interestingly, an inverse association was observed between serum prolactin (PRL) levels and penile length by linear regression analyses (β= -0.024, P = 0.039, 95% confidence interval (CI): -0.047, 0). Collectively, this study provides the first evidence that serum PRL, but not T or AR CAG repeat polymorphism, is correlated with penile length in the Han adult population from northwestern China.

  1. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China:a cross-sectional study

    Institute of Scientific and Technical Information of China (English)

    YanMin Ma; DaLin He; KaiJie Wu; Liang Ning; Jin Zeng; Bo Kou; HongJun Xie; ZhenKun Ma; XinYang Wang; YongGuang Gong

    2014-01-01

    This study aimed to investigate the correlations among androgen receptor (AR) CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and iffty-three healthy men (aged 22.8 ± 3.1 years) were enrolled. The individuals were grouped as CAG short (CAGS) if they harbored repeat length of≤20 or as CAG long (CAGL) if their CAG repeat length was>20. Body height/weight, penile length and other parameters were examined and recorded by the speciifed physicians;CAG repeat polymorphism was determined by the polymerase chain reaction (PCR) method;and the serum levels of the sex hormones were detected by radioimmunoassay. Student’s t-test or linear regression analysis was used to assess the associations among AR CAG repeat polymorphism, sex hormones and penile length. This investigation showed that the serum total testosterone (T) level was positively associated with the AR CAG repeat length (P= 0.01); whereas, no signiifcant correlation of T or AR CAG repeat polymorphism with the penile length was found (P= 0.593). Interestingly, an inverse association was observed between serum prolactin (PRL) levels and penile length by linear regression analyses (b=-0.024, P= 0.039, 95%conifdence interval (CI):-0.047, 0). Collectively, this study provides the ifrst evidence that serum PRL, but not T or AR CAG repeat polymorphism, is correlated with penile length in the Han adult population from northwestern China.

  2. Cumulative risks of foster care placement for Danish children.

    Science.gov (United States)

    Fallesen, Peter; Emanuel, Natalia; Wildeman, Christopher

    2014-01-01

    Although recent research suggests that the cumulative risk of foster care placement is far higher for American children than originally suspected, little is known about the cumulative risk of foster care placement in other countries, which makes it difficult to gauge the degree to which factor foster care placement is salient in other contexts. In this article, we provide companion estimates to those provided in recent work on the US by using Danish registry data and synthetic cohort life tables to show how high and unequally distributed the cumulative risk of foster care placement is for Danish children. Results suggest that at the beginning of the study period (in 1998) the cumulative risk of foster care placement for Danish children was roughly in line with the risk for American children. Yet, by the end of the study period (2010), the risk had declined to half the risk for American children. Our results also show some variations by parental ethnicity and sex, but these differences are small. Indeed, they appear quite muted relative to racial/ethnic differences in these risks in the United States. Last, though cumulative risks are similar between Danish and American children (especially at the beginning of the study period), the age-specific risk profiles are markedly different, with higher risks for older Danish children than for older American children.

  3. Maintenance hemodialysis patients have high cumulative radiation exposure.

    LENUS (Irish Health Repository)

    Kinsella, Sinead M

    2010-10-01

    Hemodialysis is associated with an increased risk of neoplasms which may result, at least in part, from exposure to ionizing radiation associated with frequent radiographic procedures. In order to estimate the average radiation exposure of those on hemodialysis, we conducted a retrospective study of 100 patients in a university-based dialysis unit followed for a median of 3.4 years. The number and type of radiological procedures were obtained from a central radiology database, and the cumulative effective radiation dose was calculated using standardized, procedure-specific radiation levels. The median annual radiation dose was 6.9 millisieverts (mSv) per patient-year. However, 14 patients had an annual cumulative effective radiation dose over 20 mSv, the upper averaged annual limit for occupational exposure. The median total cumulative effective radiation dose per patient over the study period was 21.7 mSv, in which 13 patients had a total cumulative effective radiation dose over 75 mSv, a value reported to be associated with a 7% increased risk of cancer-related mortality. Two-thirds of the total cumulative effective radiation dose was due to CT scanning. The average radiation exposure was significantly associated with the cause of end-stage renal disease, history of ischemic heart disease, transplant waitlist status, number of in-patient hospital days over follow-up, and death during the study period. These results highlight the substantial exposure to ionizing radiation in hemodialysis patients.

  4. Cumulative human impacts on marine predators

    DEFF Research Database (Denmark)

    Maxwell, Sara M; Hazen, Elliott L; Bograd, Steven J

    2013-01-01

    Stressors associated with human activities interact in complex ways to affect marine ecosystems, yet we lack spatially explicit assessments of cumulative impacts on ecologically and economically key components such as marine predators. Here we develop a metric of cumulative utilization and impact...

  5. Association between diastolic blood pressure and cumulative work time

    Directory of Open Access Journals (Sweden)

    Ricardo Cordeiro

    1999-01-01

    Full Text Available Diastolic blood pressure was viewed as a generic indicator of aging, and its association with cumulative work time was studied after controlling for age as a potential confounding factor. The study was conducted among production line workers at a Brazilian tannery in July 1993. The association between diastolic blood pressure and cumulative work time was verified by fitting a second-order linear regression model, where diastolic blood pressure was a function of worker's age and cumulative work time. By fitting the model, one can predict that, in the beginning of working life at the tannery, on average each 1-year period is associated with an increase of about 1.5 mmHg in diastolic blood pressure. The fit obtained highlights one component directly associated with work as part of the rate of pressure increase in the study group. This component is twice as high as that directly associated with age.

  6. Effect of correlation on cumulants in heavy-ion collisions

    CERN Document Server

    Mishra, D K; Netrakanti, P K

    2015-01-01

    We study the effects of correlation on cumulants and their ratios of net-proton multiplicity distribution which have been measured for central (0-5\\%) Au+Au collisions at Relativistic Heavy Ion Collider (RHIC). This effect has been studied assuming individual proton and anti-proton distributions as Poisson or Negative Binomial Distribution (NBD). In-spite of significantly correlated production due to baryon number, electric charge conservation and kinematical correlations of protons and anti-protons, the measured cumulants of net-proton distribution follow the independent production model. In the present work we demonstrate how the introduction of correlations will affect the cumulants and their ratios for the difference distributions. We have also demonstrated this study using the proton and anti-proton distributions obtained from HIJING event generator.

  7. No Improved Performance With Repeated-Sprint Training in Hypoxia Versus Normoxia: A Double-Blind and Crossover Study.

    Science.gov (United States)

    Montero, David; Lundby, Carsten

    2017-02-01

    Few recent studies indicate that short-term repeated-sprint (RS) training in hypoxia (RSH) improves RS performance compared with identical training under normoxic conditions (RSN) in endurance-trained subjects. To determine the effects of RSH against RSN on RS performance under normoxic and moderate hypoxic conditions, using a randomized, doubleblind, crossover experimental design. Fifteen endurance-trained male subjects (age 25 ± 4 y) performed 4 wk of RS training (3 sessions/wk) in normobaric hypoxia (RSH, FiO2 = 13.8%) and normoxia (RSN, FiO2 = 20.9%) in a crossover manner. Before and after completion of training, RS tests were performed on a cycle ergometer with no prior exercise (RSNE), after an incremental exercise test (RSIE), and after a time-trial test (RSTT) in normoxia and hypoxia. Peak power outputs at the incremental exercise test and time-trial performance were unaltered by RSH in normoxia and hypoxia. RS performance was generally enhanced by RSH, as well as RSN, but there were no additional effects of RSH over RSN on peak and mean sprint power output and the number of repeated sprints performed in the RSNE, RSIE, and RSTT trials under normoxic and hypoxic conditions. The present double-blind crossover study indicates that RSH does not improve RS performance compared with RSN in normoxic and hypoxic conditions in endurance-trained subjects. Therefore, caution should be exercised when proposing RSH as an advantageous method to improve exercise performance.

  8. [Cumulative trauma disorders: work or professional disease?].

    Science.gov (United States)

    de Carvalho, Marcus Vitor Diniz; Cavalcanti, Francisco Ivo Dantas; Soriano, Evelyne Pessoa; de Miranda, Hênio Ferreira

    2009-06-01

    This study aimed at reviewing the Brazilian legislation applied to occupational health. It refers to the diseases embodied in the Repetition Strain Injury (RSI) and Cumulative Trauma Disorders (CTD) regarded as work or professional diseases. This analysis allowed to perform the historical evolution of legislation concerning the issue, noting that the state of the art of regulation on RSI-CTD is anchored in specific regulation present in the Normative Instruction 98/2003, that establishes the diagnostic criteria and classification of RSI-CTD. It was concluded that according to the existing legislation in Brazil, the pathologies related to RSI-CTD are considered as work diseases and their legal effects are similar to the work-related accidents.

  9. PER3 polymorphism predicts cumulative sleep homeostatic but not neurobehavioral changes to chronic partial sleep deprivation.

    Directory of Open Access Journals (Sweden)

    Namni Goel

    Full Text Available BACKGROUND: The variable number tandem repeat (VNTR polymorphism 5-repeat allele of the circadian gene PERIOD3 (PER3(5/5 has been associated with cognitive decline at a specific circadian phase in response to a night of total sleep deprivation (TSD, relative to the 4-repeat allele (PER3(4/4. PER3(5/5 has also been related to higher sleep homeostasis, which is thought to underlie this cognitive vulnerability. To date, no study has used a candidate gene approach to investigate the response to chronic partial sleep deprivation (PSD, a condition distinct from TSD and one commonly experienced by millions of people on a daily and persistent basis. We evaluated whether the PER3 VNTR polymorphism contributed to cumulative neurobehavioral deficits and sleep homeostatic responses during PSD. METHODOLOGY/PRINCIPAL FINDINGS: PER3(5/5 (n = 14, PER3(4/5 (n = 63 and PER3(4/4 (n = 52 healthy adults (aged 22-45 y demonstrated large, but equivalent cumulative decreases in cognitive performance and physiological alertness, and cumulative increases in sleepiness across 5 nights of sleep restricted to 4 h per night. Such effects were accompanied by increasing daily inter-subject variability in all groups. The PER3 genotypes did not differ significantly at baseline in habitual sleep, physiological sleep structure, circadian phase, physiological sleepiness, cognitive performance, or subjective sleepiness, although during PSD, PER3(5/5 subjects had slightly but reliably elevated sleep homeostatic pressure as measured physiologically by EEG slow-wave energy in non-rapid eye movement sleep compared with PER3(4/4 subjects. PER3 genotypic and allelic frequencies did not differ significantly between Caucasians and African Americans. CONCLUSIONS/SIGNIFICANCE: The PER3 VNTR polymorphism was not associated with individual differences in neurobehavioral responses to PSD, although it was related to one marker of sleep homoeostatic response during PSD. The comparability of PER3

  10. Drosophila melanogaster As a Model Organism to Study RNA Toxicity of Repeat Expansion-Associated Neurodegenerative and Neuromuscular Diseases

    Science.gov (United States)

    Koon, Alex C.; Chan, Ho Yin Edwin

    2017-01-01

    For nearly a century, the fruit fly, Drosophila melanogaster, has proven to be a valuable tool in our understanding of fundamental biological processes, and has empowered our discoveries, particularly in the field of neuroscience. In recent years, Drosophila has emerged as a model organism for human neurodegenerative and neuromuscular disorders. In this review, we highlight a number of recent studies that utilized the Drosophila model to study repeat-expansion associated diseases (READs), such as polyglutamine diseases, fragile X-associated tremor/ataxia syndrome (FXTAS), myotonic dystrophy type 1 (DM1) and type 2 (DM2), and C9ORF72-associated amyotrophic lateral sclerosis/frontotemporal dementia (C9-ALS/FTD). Discoveries regarding the possible mechanisms of RNA toxicity will be focused here. These studies demonstrate Drosophila as an excellent in vivo model system that can reveal novel mechanistic insights into human disorders, providing the foundation for translational research and therapeutic development. PMID:28377694

  11. Cumulative Trauma Among Mayas Living in Southeast Florida.

    Science.gov (United States)

    Millender, Eugenia I; Lowe, John

    2016-01-04

    Mayas, having experienced genocide, exile, and severe poverty, are at high risk for the consequences of cumulative trauma that continually resurfaces through current fear of an uncertain future. Little is known about the mental health and alcohol use status of this population. This correlational study explored t/he relationship of cumulative trauma as it relates to social determinants of health (years in the United States, education, health insurance status, marital status, and employment), psychological health (depression symptoms), and health behaviors (alcohol use) of 102 Guatemalan Mayas living in Southeast Florida. The results of this study indicated that, as specific social determinants of health and cumulative trauma increased, depression symptoms (particularly among women) and the risk for harmful alcohol use (particularly among men) increased. Identifying risk factors at an early stage before serious disease or problems are manifest provides room for early screening leading to early identification, early treatment, and better outcomes.

  12. Tectonomagnetic study in the seismoactive area of Narmada–Son lineament, central India: Preliminary results on repeat field observations

    Indian Academy of Sciences (India)

    S Y Waghmare; S D Pimprikar; P B Gawali; L Carlo; A G Patil

    2009-06-01

    Repeated measurements of the total geomagnetic field on the five profiles have revealed a picture of stress-induced tectonomagnetic effect in the form of secular variation of the total geomagnetic field in the tectonically and seismically active area of Jabalpur and adjoining areas of the Narmada-Son lineament (NSL),central India.For this experiment,a reference base station was established within the study area at Jabalpur.Using proton precession magnetometers with a sensitivity of 0.1 nT, simultaneous measurements of total geomagnetic field were made annually at the base and all field stations.Five cycles of repeated observations have been performed between 2003 and 2007.For data analysis,a difference method has been applied and the residuals have been calculated as secular variations of the total geomagnetic field with values ranging from ± 0.1nT to about > ± 14.6nT/yr over the different stations.The anomalies in secular variation of the total geomagnetic field may be related to anomalous accumulation of tectonic stresses and tensions on the deep fault zones and crustal blocks due to recent geodynamic processes and active geological inhomogeneities in the NSL.

  13. Multi-laboratory validation study of multilocus variable-number tandem repeat analysis (MLVA) for Salmonella enterica serovar Enteritidis, 2015

    Science.gov (United States)

    Peters, Tansy; Bertrand, Sophie; Björkman, Jonas T; Brandal, Lin T; Brown, Derek J; Erdõsi, Tímea; Heck, Max; Ibrahem, Salha; Johansson, Karin; Kornschober, Christian; Kotila, Saara M; Le Hello, Simon; Lienemann, Taru; Mattheus, Wesley; Nielsen, Eva Møller; Ragimbeau, Catherine; Rumore, Jillian; Sabol, Ashley; Torpdahl, Mia; Trees, Eija; Tuohy, Alma; de Pinna, Elizabeth

    2017-01-01

    Multilocus variable-number tandem repeat analysis (MLVA) is a rapid and reproducible typing method that is an important tool for investigation, as well as detection, of national and multinational outbreaks of a range of food-borne pathogens. Salmonella enterica serovar Enteritidis is the most common Salmonella serovar associated with human salmonellosis in the European Union/European Economic Area and North America. Fourteen laboratories from 13 countries in Europe and North America participated in a validation study for MLVA of S. Enteritidis targeting five loci. Following normalisation of fragment sizes using a set of reference strains, a blinded set of 24 strains with known allele sizes was analysed by each participant. The S. Enteritidis 5-loci MLVA protocol was shown to produce internationally comparable results as more than 90% of the participants reported less than 5% discrepant MLVA profiles. All 14 participating laboratories performed well, even those where experience with this typing method was limited. The raw fragment length data were consistent throughout, and the inter-laboratory validation helped to standardise the conversion of raw data to repeat numbers with at least two countries updating their internal procedures. However, differences in assigned MLVA profiles remain between well-established protocols and should be taken into account when exchanging data. PMID:28277220

  14. Effect of repeated sterilization cycles on the physical properties of scaling instruments: a scanning electron microscopy study.

    Science.gov (United States)

    Porto, Alessandra Nogueira; Borges, Álvaro Henrique; Semenoff-Segundo, Alex; Raslan, Suzane A; Pedro, Fábio Luis Miranda; Jorge, Antônio Olavo Cardoso; Bandeca, Matheus Coelho

    2015-05-01

    Repeated sterilizations cycles cause undesirable alterations in the material properties of the instruments, such as corrosion, alterations in the hardness of the metal and the loss of the cutting sharpness of the instrument. This research examined the effect of repeated dry heat sterilization and autoclaves cycles on carbon steel (CS) and stainless steel (SS) curettes during the scaling and root planning. A total of 77 Gracey curettes were used in this study. Of these, 35 were SS and 42 were CS curettes submitted in different process: Dry heat, autoclave, inhibition of corrosion and autoclave, scaling, root planning and dry heat, scaling, root planning, inhibition of corrosion and autoclave. The inhibition of corrosion used on the carbon curettes (prior to sterilization in the autoclave) was sodium nitrite at 2%. The curettes received 10 consecutive cycles of sterilization and after that the cutting edges were examined in the electronic microscope, at 60 and 100 magnification times. The images were evaluated by three independent examiners, who compared the photographs of each group with the control group. The surface corrosion products and a deterioration of the edges were observed and the results showed that the SS curettes suffered little alteration with sterilization, scaling, root planning whereas the CS curettes were visibly affected by sterilization in the autoclave, but when the inhibition of corrosion was used prior to the sterilization, the oxidation was considerably reduced.

  15. Repeated-Doses Toxicity Study of the Essential Oil of Hyptis martiusii Benth. (Lamiaceae in Swiss Mice

    Directory of Open Access Journals (Sweden)

    Germana Freire Rocha Caldas

    2013-01-01

    Full Text Available Hyptis martiusii Benth. (Lamiaceae is found in abundance in Northeastern Brazil where it is used in traditional medicine to treat gastric disorders. Since there are no studies reporting the toxicity and safety profile of this species, we investigated repeated-doses toxicity of the essential oil of Hyptis martiusii (EOHM. Swiss mice of both sexes were orally treated with EOHM (100 and 500 mg/kg for 30 days, and biochemical, hematological, and morphological parameters were determined. No toxicity signs or deaths were recorded during the treatment with EOHM. The body weight gain was not affected, but there was an occasional variation in water and food consumption among mice of both sexes treated with both doses. The hematological and biochemical profiles did not show significant differences except for a decrease in the MCV and an increase in albumin, but these variations are within the limits described for the species. The microscopic analysis showed changes in liver, kidneys, lungs, and spleen; however, these changes do not have clinical relevance since they varied among the groups, including the control group. The results indicate that the treatment of repeated-doses with the essential oil of Hyptis martiusii showed low toxicity in mice.

  16. Effectiveness of repeated photodynamic therapy in the elimination of intracanal Enterococcus faecalis biofilm: an in vitro study.

    Science.gov (United States)

    Prażmo, Ewa Joanna; Godlewska, Renata Alicja; Mielczarek, Agnieszka Beata

    2017-04-01

    The study aimed to investigate the effectiveness of photodynamic therapy in the elimination of intracanal Enterococcus faecalis biofilm and to analyse how a repeated light irradiation, replenishment of oxygen and photosensitiser affect the results of the photodynamic disinfecting protocol. After chemomechanical preparation, 46 single-rooted human teeth were infected with a clinical strain of E. faecalis and incubated for a week in microaerobic conditions. The experimental procedures included groups of single application of photodynamic therapy, two cycles of PDT, irrigation with 5.25% NaOCl solution and negative and positive control. The number of residing bacterial colonies in the root canals was determined based on the CFU/ml method. In the group of preparations irrigated with NaOCl, bacterial colonies were not observed. A single PDT eliminated 45% of the initial CFU/ml. Repeated PDT eradicated 95% of the intracanal bacterial biofilm. Photodynamic therapy has a high potential for the elimination of E. faecalis biofilm. There is a safe therapeutic window where photoinduced disinfection can be used as an adjuvant to conventional endodontic treatment, which remains the most effective.

  17. Broad and narrow personality traits as markers of one-time and repeated suicide attempts: A population-based study

    Directory of Open Access Journals (Sweden)

    Vitaro Frank

    2008-03-01

    Full Text Available Abstract Background Studying personality traits with the potential to differentiate between individuals engaging in suicide attempts of different degrees of severity could help us to understand the processes underlying the link of personality and nonfatal suicidal behaviours and to identify at-risk groups. One approach may be to examine whether narrow, i.e., lower-order personality traits may be more useful than their underlying, broad personality trait dimensions. Methods We investigated qualitative and quantitative differences in broad and narrow personality traits between one-time and repeated suicide attempters in a longitudinal, population-based sample of young French Canadian adults using two multivariate regression models. Results One broad (Compulsivity: OR = 2.0; 95% CI 1.2–3.5 and one narrow personality trait (anxiousness: OR = 1.1; 95% CI 1.01–1.1 differentiated between individuals with histories of repeated and one-time suicide attempts. Affective instability [(OR = 1.1; 95% CI 1.04–1.1] and anxiousness [(OR = .92; 95% CI .88–.95], on the other hand, differentiated between nonattempters and one-time suicide attempters. Conclusion Emotional and cognitive dysregulation and associated behavioural manifestations may be associated with suicide attempts of different severity. While findings associated with narrow traits may be easier to interpret and link to existing sociobiological theories, larger effect sizes associated with broad traits such as Compulsivity may be better suited to objectives with a more clinical focus.

  18. Cumulative family risks across income levels predict deterioration of children's general health during childhood and adolescence.

    Science.gov (United States)

    Lin, Yi-Ching; Seo, Dong-Chul

    2017-01-01

    Family is considered an important agent in the health development of children. This process is significant but quite complex because the prevalence of potential risk factors in the family can hinder children's health. This study examined if multiple family risks might have cumulative effect on children and youth's health across various levels of household income. The data in this study were drawn from the 2011-2012 U.S. National Survey of Children's Health (N = 79,601). A cumulative family risk (CFR) index was developed, which included such constructs as single-parenthood, unstable employment, large family, parenting stress, poor maternal education, poor maternal general health and poor maternal mental health. Multiple logistic regression analyses showed that CFR level was significantly related to children and youth's poor health outcome (p families than on those from poor families. Overall there was a consistent pattern of trend in the point estimate as well as confidence limits as levels of affluence and numbers of family risk increased although some of the confidence intervals overlapped. Living in disadvantaged families might serve as a protective factor against CFRs possibly through repeated exposure to hardships and subsequent formation of resilience among some of the disadvantaged children.

  19. Latino Mothers' Cumulative Food Insecurity Exposure and Child Body Composition.

    Science.gov (United States)

    Hernandez, Daphne C

    2016-01-01

    To document whether an intergenerational transmission of food insecurity is occurring by assessing low-income foreign-born Latino mothers' experiences with food insecurity as none, once (either childhood or adulthood) or twice (during both childhood and adulthood). Also the association between maternal cumulative food insecurity and children's body composition was examined. Maternal self-reported surveys on retrospective measures of food insecurity during childhood, current measures of food insecurity, and demographics were collected from Houston-area community centers (N = 96). Children's body mass index (BMI) and waist circumference (WC) were directly assessed. Covariate-adjusted logistic regression models analyzed the association between cumulative food insecurity experiences and children's body composition. Fifty-eight percent of mothers experienced food insecurity both as a child and as an adult and 31% of the mothers experienced food insecurity either as a child or adult. Maternal cumulative exposure to food insecurity was unrelated to BMI but was negatively related to elevated WC. Although an intergenerational transmission of food insecurity does exist, maternal cumulative exposure to food insecurity does not impact children's body composition negatively in the short term. Studying the long-term effects of cumulative food insecurity exposure can provide information for the development and timing of obesity interventions.

  20. Case study: videogame distraction reduces behavioral distress in a preschool-aged child undergoing repeated burn dressing changes: a single-subject design

    National Research Council Canada - National Science Library

    Sil, Soumitri; Dahlquist, Lynnda M; Burns, Andrew J

    2013-01-01

    This single-subject design study evaluated the feasibility and efficacy of passive and interactive videogame distraction on behavioral distress for a preschool-aged child receiving repeated burn dressing changes...

  1. Prevention of eating disorders among minority youth: a matched-sample repeated measures study.

    Science.gov (United States)

    Cook-Cottone, Catherine; Jones, Lakaii A; Haugli, Sara

    2010-01-01

    The purpose of this study was to examine ethnic differences in primary prevention programs for eating disorders in young girls. In order to address the dearth of research in this area, this study examined the comparative response to an eating disorder prevention program on fifth-grade minority and White females. Pre- and post-test data were collected from 10 groups participating in the prevention program for a total of 50 girls. Minority participants and White participants were then matched based on Body Mass Index (BMI) and socioeconomic status in order to examine ethnic differences in group effectiveness. Findings indicated that minority and White participants were equally responsive to the prevention program.

  2. [The study of interaction between paralogous tandem repeats stellate and suppressor of stellate in the genome of Drosophila melanogaster].

    Science.gov (United States)

    Aravin, A A; Naumova, N M; Tulin, A V; Klenov, M S; Gvozdev, V A

    2000-04-01

    Testis-specific expression of tandemly repeated Stellate genes, located in eu- and heterochromatin regions of the X chromosome of Drosophila melanogaster, is suppressed by homologous Suppressor of Stellate repeats located on the Y chromosome. Using transgenic lines, we have demonstrated that three Su(Ste) copies failed to change the expression of the reporter construction carrying the bacterial beta-galactosidase gene under control of the Stellate gene regulatory sequence. Possible mechanisms of the Su(Ste) repeat suppressor activity are discussed.

  3. Discovery, Characterization, and Functional Study of a Novel MEF2D CAG Repeat in Duck (Anas platyrhynchos).

    Science.gov (United States)

    Wang, Yushi; Wang, Jiwen; Liu, Hehe; Zhang, Rongping; Zhang, Tao; Gan, Xiang; Huang, Huilan; Chen, Da; Li, Liang

    2016-08-01

    Myocyte enhancer transcription factor 2D (MEF2D) is an important transcription factor for promoting the growth and development of muscle. CAG repeats have been found in the coding sequence (CDS) of avian MEF2D; however, their functions remain unknown and require further investigation. Here, we examined the characteristics and functional role of MEF2D CAG repeat in duck. The full-length CDS of duck MEF2D was cloned for the first time, and a novel CAG repeat was identified and located in exon 9. Sequence analysis indicated that the protein domains of duck MEF2D are highly conserved relative to other vertebrates, whereas MEF2D CAG repeats with variable repeat numbers are specific to avian species. Furthermore, sequencing has revealed polymorphisms in MEF2D CAG repeat at both DNA and mRNA levels. Four MEF2D CAG repeat genotypes and 10 MEF2D cDNA variants with different CAG repeat numbers were detected in two duck populations. A t-test showed that the expanded CAG repeat generated significantly longer transcription products (p analysis demonstrated positive correlations between the expansion of the CAG repeat and five muscle-related traits. By using protein structure prediction, we suggested that the polymorphisms of the CAG repeat affect protein structures within protein domains. Taken together, these findings reveal that duck MEF2D CAG repeat is a potential functional element with polymorphisms and may cause differences in MEF2D function between duck and other vertebrate species.

  4. Repeated versus wide reading: A randomized control design study examining the impact of fluency interventions on underlying reading behavior.

    Science.gov (United States)

    Ardoin, Scott P; Binder, Katherine S; Foster, Tori E; Zawoyski, Andrea M

    2016-12-01

    Repeated readings (RR) has garnered much attention as an evidence based intervention designed to improve all components of reading fluency (rate, accuracy, prosody, and comprehension). Despite this attention, there is not an abundance of research comparing its effectiveness to other potential interventions. The current study presents the findings from a randomized control trial study involving the assignment of 168second grade students to a RR, wide reading (WR), or business as usual condition. Intervention students were provided with 9-10weeks of intervention with sessions occurring four times per week. Pre- and post-testing were conducted using Woodcock-Johnson III reading achievement measures (Woodcock, McGrew, & Mather, 2001, curriculum-based measurement (CBM) probes, measures of prosody, and measures of students' eye movements when reading. Changes in fluency were also monitored using weekly CBM progress monitoring procedures. Data were collected on the amount of time students spent reading and the number of words read by students during each intervention session. Results indicate substantial gains made by students across conditions, with some measures indicating greater gains by students in the two intervention conditions. Analyses do not indicate that RR was superior to WR. In addition to expanding the RR literature, this study greatly expands research evaluating changes in reading behaviors that occur with improvements in reading fluency. Implications regarding whether schools should provide more opportunities to repeatedly practice the same text (i.e., RR) or practice a wide range of text (i.e., WR) are provided. Copyright © 2016 Society for the Study of School Psychology. Published by Elsevier Ltd. All rights reserved.

  5. The Effect of Image Quality, Repeated Study, and Assessment Method on Anatomy Learning

    Science.gov (United States)

    Fenesi, Barbara; Mackinnon, Chelsea; Cheng, Lucia; Kim, Joseph A.; Wainman, Bruce C.

    2017-01-01

    The use of two-dimensional (2D) images is consistently used to prepare anatomy students for handling real specimen. This study examined whether the quality of 2D images is a critical component in anatomy learning. The visual clarity and consistency of 2D anatomical images was systematically manipulated to produce low-quality and high-quality…

  6. Repeated open application test with methyldibromo glutaronitrile, a multicentre study within the EECDRG

    DEFF Research Database (Denmark)

    Gruvberger, B; Andersen, Klaus Ejner; Brandão, F M

    2005-01-01

    Contact allergy to and allergic contact dermatitis from methyldibromo glutaronitrile (MDBGN) have frequently been reported. This study was initiated to help determine the optimal patch test preparation for MDBGN. In 51 patients with a doubtful or a positive patch test reaction to at least 1 of 4 ...

  7. Mouth opening in patients irradiated for head and neck cancer : A prospective repeated measures study

    NARCIS (Netherlands)

    Kamstra, J. I.; Dijkstra, P. U.; van Leeuwen, M.; Roodenburg, J. L. N.; Langendijk, J. A.

    2015-01-01

    Objectives: Aims of this prospective cohort study were (1) to analyze the course of mouth opening up to 48 months post-radiotherapy (RT), (2) to assess risk factors predicting decrease in mouth opening, and (3) to develop a multivariable prediction model for change in mouth opening in a large sample

  8. Mouth opening in patients irradiated for head and neck cancer : A prospective repeated measures study

    NARCIS (Netherlands)

    Kamstra, J. I.; Dijkstra, P. U.; van Leeuwen, M.; Roodenburg, J. L. N.; Langendijk, J. A.

    Objectives: Aims of this prospective cohort study were (1) to analyze the course of mouth opening up to 48 months post-radiotherapy (RT), (2) to assess risk factors predicting decrease in mouth opening, and (3) to develop a multivariable prediction model for change in mouth opening in a large sample

  9. International Mycoplasma pneumoniae typing study: interpretation of M. pneumoniae multilocus variable-number tandem-repeat analysis

    Directory of Open Access Journals (Sweden)

    V.J. Chalker

    2015-09-01

    Full Text Available Typing of Mycoplasma pneumoniae by multiple-locus variable-number tandem repeat analysis (MLVA is increasingly in use. However, no specific internationally agreed guidance is available. Thirty M. pneumoniae DNA samples including serial dilutions of a type strain were sent to six international laboratories to perform MLVA and results were compared. Good correlation was observed, indicating that this methodology can be robustly performed in multiple sites. However, differences due to interpretation of fragment size, repeat sequence identification and repeat numbering led to inconsistency in the final profiles assigned by laboratories. We propose guidelines for interpreting M. pneumoniae MLVA typing and assigning the number of repeats.

  10. Nonlinear cumulative damage model for multiaxial fatigue

    Institute of Scientific and Technical Information of China (English)

    SHANG De-guang; SUN Guo-qin; DENG Jing; YAN Chu-liang

    2006-01-01

    On the basis of the continuum fatigue damage theory,a nonlinear uniaxial fatigue cumulative damage model is first proposed.In order to describe multiaxial fatigue damage characteristics,a nonlinear multiaxial fatigue cumulative damage model is developed based on the critical plane approach,The proposed model can consider the multiaxial fatigue limit,mean hydrostatic pressure and the unseparated characteristic for the damage variables and loading parameters.The recurrence formula of fatigue damage model was derived under multilevel loading,which is used to predict multiaxial fatigue life.The results showed that the proposed nonlinear multiaxial fatigue cumulative damage model is better than Miner's rule.

  11. Cumulative pion production via successive collisions in nuclear medium

    CERN Document Server

    Motornenko, A

    2016-01-01

    Production of pions in proton-nucleus (p+A) reactions outside of a kinematical boundary of proton-nucleon collisions, the so-called cumulative effect, is studied. The kinematical restrictions on pions emitted in backward direction in the target rest frame are analyzed. It is shown that cumulative pion production requires a presence of massive baryonic resonances that are produced during successive collisions of projectile with nuclear nucleons. After each successive collision the mass of created resonance may increase and, simultaneously, its longitudinal velocity decreases. Simulations within Ultra relativistic Quantum Molecular Dynamics model reveals that successive collisions of baryonic resonances with nuclear nucleons plays the dominant role in cumulative pion production in p+A reactions.

  12. Baltic Sea biodiversity status vs. cumulative human pressures

    DEFF Research Database (Denmark)

    Andersen, Jesper H.; Halpern, Benjamin S.; Korpinen, Samuli

    2015-01-01

    Abstract Many studies have tried to explain spatial and temporal variations in biodiversity status of marine areas from a single-issue perspective, such as fishing pressure or coastal pollution, yet most continental seas experience a wide range of human pressures. Cumulative impact assessments have...... been developed to capture the consequences of multiple stressors for biodiversity, but the ability of these assessments to accurately predict biodiversity status has never been tested or ground-truthed. This relationship has similarly been assumed for the Baltic Sea, especially in areas with impaired...... status, but has also never been documented. Here we provide a first tentative indication that cumulative human impacts relate to ecosystem condition, i.e. biodiversity status, in the Baltic Sea. Thus, cumulative impact assessments offer a promising tool for informed marine spatial planning, designation...

  13. Repeated exposure of acidic beverages on esthetic restorative materials: an in-vitro surface microhardness study

    OpenAIRE

    Xavier, Arun M.; Sunny, Steffy M.; Rai, Kavita; Amitha M Hegde

    2016-01-01

    Background A manifold increase in the consumption of aerated beverages has witnessed a twin increase in tooth wear and raised demand for esthetic restorative materials. This study aimed to evaluate the surface microhardness changes of esthetic restorative materials following treatment with aerated beverages in an in-vitro situation. Material and Methods The initial surface microhardness of the restorative materials GC Fuji II LC, GC Fuji IX, Nano Glass ionomer, Resin and Nano composite was re...

  14. URINARY CREATINE AT REST AND AFTER REPEATED SPRINTS IN ATHLETES: A PILOT STUDY

    Directory of Open Access Journals (Sweden)

    I. Bezrati-Benayed

    2014-07-01

    Full Text Available Creatine plays a key role in muscle function and its evaluation is important in athletes. In this study, urinary creatine concentration was measured in order to highlight its possible significance in monitoring sprinters. The study included 51 sprinters and 25 age- and sex-matched untrained subjects as a control group. Body composition was measured and dietary intake estimated. Urine samples were collected before and after standardized physical exercise. Creatine was assessed by gas chromatography mass spectrometry. Basal urinary creatine (UC was significantly lower in sprinters than controls (34±30 vs. 74±3 μmol/mmol creatinine, p<0.05. UC was inversely correlated with body mass (r=-0.34, p<0.01 and lean mass (r=- 0.30, p<0.05, and positively correlated with fat mass (r=0.32, p<0.05. After acute exercise, urinary creatine significantly decreased in both athletes and controls. UC is low in sprinters at rest and further decreases after exercise, most likely due to a high uptake and use of creatine by muscles, as muscle mass and physical activity are supposed to be greater in athletes than untrained subjects. Further studies are needed to test the value of urinary creatine as a non-invasive marker of physical condition and as a parameter for managing Cr supplementation in athletes.

  15. Urinary creatine at rest and after repeated sprints in athletes: a pilot study.

    Science.gov (United States)

    Bezrati-Benayed, I; Nasrallah, F; Feki, M; Chamari, K; Omar, S; Alouane-Trabelsi, L; Ben Mansour, A; Kaabachi, N

    2014-03-01

    Creatine plays a key role in muscle function and its evaluation is important in athletes. In this study, urinary creatine concentration was measured in order to highlight its possible significance in monitoring sprinters. The study included 51 sprinters and 25 age- and sex-matched untrained subjects as a control group. Body composition was measured and dietary intake estimated. Urine samples were collected before and after standardized physical exercise. Creatine was assessed by gas chromatography mass spectrometry. Basal urinary creatine (UC) was significantly lower in sprinters than controls (34±30 vs. 74±3 µmol/mmol creatinine, p sprinters at rest and further decreases after exercise, most likely due to a high uptake and use of creatine by muscles, as muscle mass and physical activity are supposed to be greater in athletes than untrained subjects. Further studies are needed to test the value of urinary creatine as a non-invasive marker of physical condition and as a parameter for managing Cr supplementation in athletes.

  16. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China: a cross-sectional study

    OpenAIRE

    Yan-Min Ma; Kai-Jie Wu; Liang Ning; Jin Zeng; Bo Kou; Hong-Jun Xie; Zhen-Kun Ma; Xin-Yang Wang; Yong-Guang Gong; Da-Lin He

    2014-01-01

    This study aimed to investigate the correlations among androgen receptor (AR) CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and fifty-three healthy men (aged 22.8 ± 3.1 years) were enrolled. The individuals were grouped as CAG short (CAG S ) if they harbored repeat length of ≤20 or as CAG long (CAG L ) if their CAG repeat length was >20. Body height/weight, penile length and other parameters were examined and recorded by the specified ...

  17. Tools and Techniques - Statistical. Estimating cumulative incidences in the presence of right-censoring and competing risks : an introduction with illustrations from the COACH study

    NARCIS (Netherlands)

    Postmus, Douwe; Demissei, Biniyam G; Hillege, Hans L

    2016-01-01

    In cardiovascular studies, it is common to assess the association between the risk of experiencing an event, such as death or hospitalisation, and one or more exposure variables, such as different treatment regimens when the study under consideration is an intervention study. A frequently applied

  18. The haemotoxicity of azathioprine in repeat dose studies in the female CD-1 mouse.

    Science.gov (United States)

    Molyneux, Gemma; Gibson, Frances M; Chen, Christabelle M; Marway, Harpal K; McKeag, Sean; Mifsud, Charles V J; Pilling, Andrew M; Whayman, Matthew J; Turton, John A

    2008-04-01

    Azathioprine (AZA) is a cytotoxic immunosuppressive drug used in the prevention of rejection in organ transplants and the treatment of auto-immune diseases. However, AZA is haemotoxic causing significant bone marrow depression. The present studies were to characterize the haemotoxicity of AZA in the female CD-1 mouse. In Experiment 1, a dose-ranging study, with AZA gavaged daily for 10 days, clinical evidence of toxicity was evident at 125 mg/kg and above. Experiment 2 was a dose-response study with AZA gavaged daily for 10 days at 40-120 mg/kg. At day 1 after the final dose, AZA induced a dose-related pancytopaenia, reduced femoral marrow cellularity, increases in serum levels of the cytokine fms-like tyrosine kinase 3 ligand, reduction in granulocyte-monocyte colony-forming units and erythroid colonies, and increased bone marrow apoptosis. Histology demonstrated hepatocyte hypertrophy, thymic atrophy, reduced splenic extramedullary haemopoiesis, and reduced cellularity of sternal bone marrow. In Experiment 3, AZA was dosed for 10 days at 100 mg/kg with autopsies at 1, 3, 9, 22, 29, 43 and 57 days postdosing. At 1, 3 and 9 days, haematological parameters reflected changes in Experiment 2. At 22/29 days, many blood parameters were returning towards normal; at 43/57 days, most parameters compared with controls. However, there was some evidence of a persistent (i.e. residual/late-stage) mild reduction in RBC and erythroid progenitor cell counts at day 43/57. We conclude that the CD-1 mouse provides an acceptable model for the haemotoxicity of AZA in man.

  19. Women's risk of repeat abortions is strongly associated with alcohol consumption: a longitudinal analysis of a Russian national panel study, 1994-2009.

    Directory of Open Access Journals (Sweden)

    Katherine Keenan

    Full Text Available Abortion rates in Russia, particularly repeat abortions, are among the highest in the world, and abortion complications make a substantial contribution to the country's high maternal mortality rate. Russia also has a very high rate of hazardous alcohol use. However, the association between alcohol use and abortion in Russia remains unexplored. We investigated the longitudinal predictors of first and repeat abortion, focussing on women's alcohol use as a risk factor. Follow-up data from 2,623 women of reproductive age (16-44 years was extracted from 14 waves of the Russian Longitudinal Monitoring Survey (RLMS, a nationally representative panel study covering the period 1994-2009. We used discrete time hazard models to estimate the probability of having a first and repeat abortion by social, demographic and health characteristics at the preceding study wave. Having a first abortion was associated with demographic factors such as age and parity, whereas repeat abortions were associated with low education and alcohol use. After adjustment for demographic and socioeconomic factors, the risk of having a repeat abortion increased significantly as women's drinking frequency increased (P<0.001, and binge drinking women were significantly more likely to have a repeat abortion than non-drinkers (OR 2.28, 95% CI 1.62-3.20. This association was not accounted for by contraceptive use or a higher risk of pregnancy. Therefore the determinants of first and repeat abortion in Russia between 1994-2009 were different. Women who had repeat abortions were distinguished by their heavier and more frequent alcohol use. The mechanism for the association is not well understood but could be explained by unmeasured personality factors, such as risk taking, or social non-conformity increasing the risk of unplanned pregnancy. Heavy or frequent drinkers constitute a particularly high risk group for repeat abortion, who could be targeted in prevention efforts.

  20. Magnetic Resonance Spectroscopy in Patients with Insomnia: A Repeated Measurement Study.

    Science.gov (United States)

    Spiegelhalder, Kai; Regen, Wolfram; Nissen, Christoph; Feige, Bernd; Baglioni, Chiara; Riemann, Dieter; Hennig, Jürgen; Lange, Thomas

    2016-01-01

    Chronic insomnia is one of the most prevalent central nervous system disorders. It is characterized by increased arousal levels, however, the neurobiological causes and correlates of hyperarousal in insomnia remain to be further determined. In the current study, magnetic resonance spectroscopy was used in the morning and evening in a well-characterized sample of 20 primary insomnia patients (12 females; 8 males; 42.7 ± 13.4 years) and 20 healthy good sleepers (12 females; 8 males; 44.1 ± 10.6 years). The most important inhibitory and excitatory neurotransmitters of the central nervous system, γ-aminobutyric acid (GABA) and glutamate/glutamine (Glx), were assessed in the anterior cingulate cortex (ACC) and dorsolateral prefrontal cortex (DLPFC). The primary hypothesis, a diurnal effect on GABA levels in patients with insomnia, could not be confirmed. Moreover, the current results did not support previous findings of altered GABA levels in individuals with insomnia. Exploratory analyses, however, suggested that GABA levels in the ACC may be positively associated with habitual sleep duration, and, thus, reduced GABA levels may be a trait marker of objective sleep disturbances. Moreover, there was a significant GROUP x MEASUREMENT TIME interaction effect on Glx in the DLPFC with increasing Glx levels across the day in the patients but not in the control group. Therefore, Glx levels may reflect hyperarousal at bedtime in those with insomnia. Future confirmatory studies should include larger sample sizes to investigate brain metabolites in different subgroups of insomnia.

  1. Global sensitivity analysis for repeated measures studies with informative drop-out: A semi-parametric approach.

    Science.gov (United States)

    Scharfstein, Daniel; McDermott, Aidan; Díaz, Iván; Carone, Marco; Lunardon, Nicola; Turkoz, Ibrahim

    2017-05-23

    In practice, both testable and untestable assumptions are generally required to draw inference about the mean outcome measured at the final scheduled visit in a repeated measures study with drop-out. Scharfstein et al. (2014) proposed a sensitivity analysis methodology to determine the robustness of conclusions within a class of untestable assumptions. In their approach, the untestable and testable assumptions were guaranteed to be compatible; their testable assumptions were based on a fully parametric model for the distribution of the observable data. While convenient, these parametric assumptions have proven especially restrictive in empirical research. Here, we relax their distributional assumptions and provide a more flexible, semi-parametric approach. We illustrate our proposal in the context of a randomized trial for evaluating a treatment of schizoaffective disorder. © 2017, The International Biometric Society.

  2. Zinc oxide nanoparticles: a 90-day repeated-dose dermal toxicity study in rats

    Directory of Open Access Journals (Sweden)

    Ryu HJ

    2014-12-01

    Full Text Available Hwa Jung Ryu,1,* Mu Yeb Seo,2,* Sung Kyu Jung,1 Eun Ho Maeng,2 Seung-Young Lee,2 Dong-Hyouk Jang,2 Taek-Jin Lee,2 Ki-Yeon Jo,2 Yu-Ri Kim,3 Kyu-Bong Cho,4 Meyoung-Kon Kim,3 Beom Jun Lee,5 Sang Wook Son1 1Department of Dermatology, Korea University College of Medicine, Seoul, 2Korea Testing and Research Institute, Gyunggido, 3Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul, 4Department of Clinical Laboratory Science, Shinheung College, Uijeongbu, 5College of Veterinary Medicine, Chungbuk National University, Cheongju, Republic of Korea *These authors contributed equally to this work and both should be considered first authors Abstract: Zinc oxide (ZnO works as a long-lasting, broad-spectrum physical sunblock, and can prevent skin cancer, sunburn, and photoaging. Nanosized ZnO particles are used often in sunscreens due to consumer preference over larger sizes, which appear opaque when dermally applied. Although the US Food and Drug Administration approved the use of nanoparticles (NPs in sunscreens in 1999, there are ongoing safety concerns. The aim of this study was to evaluate the subchronic toxicity of ZnO NPs after dermal application according to the Organization for Economic Cooperation and Development Test Guidelines 411 using Good Laboratory Practice. Sprague Dawley rats were randomly divided into eight (one control, one vehicle control, three experimental, and three recovery groups. Different concentrations of ZnO NPs were dermally applied to the rats in the experimental groups for 90 days. Clinical observations as well as weight and food consumption were measured and recorded daily. Hematology and biochemistry parameters were determined. Gross pathologic and histopathologic examinations were performed on selected tissues from all animals. Analyses of tissue were undertaken to determine target organ tissue distribution. There was no increased mortality in the experimental group. Although there

  3. The effect of image quality, repeated study, and assessment method on anatomy learning.

    Science.gov (United States)

    Fenesi, Barbara; Mackinnon, Chelsea; Cheng, Lucia; Kim, Joseph A; Wainman, Bruce C

    2017-06-01

    The use of two-dimensional (2D) images is consistently used to prepare anatomy students for handling real specimen. This study examined whether the quality of 2D images is a critical component in anatomy learning. The visual clarity and consistency of 2D anatomical images was systematically manipulated to produce low-quality and high-quality images of the human hand and human eye. On day 0, participants learned about each anatomical specimen from paper booklets using either low-quality or high-quality images, and then completed a comprehension test using either 2D images or three-dimensional (3D) cadaveric specimens. On day 1, participants relearned each booklet, and on day 2 participants completed a final comprehension test using either 2D images or 3D cadaveric specimens. The effect of image quality on learning varied according to anatomical content, with high-quality images having a greater effect on improving learning of hand anatomy than eye anatomy (high-quality vs. low-quality for hand anatomy P = 0.018; high-quality vs. low-quality for eye anatomy P = 0.247). Also, the benefit of high-quality images on hand anatomy learning was restricted to performance on short-answer (SA) questions immediately after learning (high-quality vs. low-quality on SA questions P = 0.018), but did not apply to performance on multiple-choice (MC) questions (high-quality vs. low-quality on MC questions P = 0.109) or after participants had an additional learning opportunity (24 hours later) with anatomy content (high vs. low on SA questions P = 0.643). This study underscores the limited impact of image quality on anatomy learning, and questions whether investment in enhancing image quality of learning aids significantly promotes knowledge development. Anat Sci Educ 10: 249-261. © 2016 American Association of Anatomists. © 2016 American Association of Anatomists.

  4. Does Repeated Ticking Maintain Tic Behavior? An Experimental Study of Eye Blinking in Healthy Individuals

    Directory of Open Access Journals (Sweden)

    Daniel J. V. Beetsma

    2013-01-01

    Full Text Available Tics in Tourette Syndrome (TS are often preceded by 'premonitory urges': annoying feelings or bodily sensations. We hypothesized that, by reducing annoyance of premonitory urges, tic behaviour may be reinforced. In a 2X2 experimental design in healthy participants, we studied the effects of premonitory urges (operationalized as air puffs on the eye and tic behaviour (deliberate eye blinking after a puff or a sound on changes in subjective evaluation of air puffs, and EMG responses on the m. orbicularis oculi. The experimental group with air puffs+ blinking experienced a decrease in subjective annoyance of the air puff, but habituation of the EMG response was blocked and length of EMG response increased. In the control groups (air puffs without instruction to blink, no air puffs, these effects were absent. When extrapolating to the situation in TS patients, these findings suggest that performance of tics is reinforced by reducing the subjective annoyance of premonitory urges, while simultaneously preventing habituation or even inducing sensitisation of the physiological motor response.

  5. Cumulative cultural learning: Development and diversity.

    Science.gov (United States)

    Legare, Cristine H

    2017-07-24

    The complexity and variability of human culture is unmatched by any other species. Humans live in culturally constructed niches filled with artifacts, skills, beliefs, and practices that have been inherited, accumulated, and modified over generations. A causal account of the complexity of human culture must explain its distinguishing characteristics: It is cumulative and highly variable within and across populations. I propose that the psychological adaptations supporting cumulative cultural transmission are universal but are sufficiently flexible to support the acquisition of highly variable behavioral repertoires. This paper describes variation in the transmission practices (teaching) and acquisition strategies (imitation) that support cumulative cultural learning in childhood. Examining flexibility and variation in caregiver socialization and children's learning extends our understanding of evolution in living systems by providing insight into the psychological foundations of cumulative cultural transmission-the cornerstone of human cultural diversity.

  6. Cumulative sessions of repetitive transcranial magnetic stimulation (rTMS) build up facilitation to subsequent TMS-mediated behavioural disruptions.

    Science.gov (United States)

    Valero-Cabré, Antoni; Pascual-Leone, Alvaro; Rushmore, Richard J

    2008-02-01

    A single session of repetitive transcranial magnetic stimulation (rTMS) can induce behavioural effects that outlast the duration of the stimulation train itself (off-line effects). Series of rTMS sessions on consecutive days are being used for therapeutic applications in a variety of disorders and are assumed to lead to the build-up of cumulative effects. However, no studies have carefully assessed this notion. In the present study we applied 30 daily sessions of 1 Hz rTMS (continuous train of 20 min) to repeatedly modulate activity in the posterior parietal cortex and associated neural systems in two intact cats. We assessed the effect on visuospatial orientation before and after each stimulation session. Cumulative sessions of rTMS progressively induced visuospatial neglect-like 'after-effects' of greater magnitude (from 5-10% to 40-50% error levels) and increasing spatial extent (from 90-75 degrees to 45-30 degrees eccentricity locations), affecting the visual hemifield contralateral to the stimulated hemisphere. Nonetheless, 60 min after each TMS session, visual detection-localization abilities repeatedly returned to baseline levels. Furthermore, no lasting behavioural effect could be demonstrated at any time across the study, when subjects were tested 1 or 24 h post-rTMS. We conclude that the past history of periodically cumulative rTMS sessions builds up a lasting 'memory', resulting in increased facilitation to subsequent TMS-induced disruptions. Such a phenomenon allows a behavioural effect of progressively higher magnitude, but equal duration, in response to individual TMS interventions.

  7. Reported food intake and distribution of body fat: a repeated cross-sectional study

    Directory of Open Access Journals (Sweden)

    Stenlund Hans

    2006-12-01

    Full Text Available Abstract Background Body mass, as well as distribution of body fat, are predictors of both diabetes and cardiovascular disease. In Northern Sweden, despite a marked increase in average body mass, prevalence of diabetes was stagnant and myocardial infarctions decreased. A more favourable distribution of body fat is a possible contributing factor. This study investigates the relative importance of individual food items for time trends in waist circumference (WC and hip circumference (HC on a population level. Methods Independent cross-sectional surveys conducted in 1986, 1990, 1994 and 1999 in the two northernmost counties of Sweden with a common population of 250000. Randomly selected age stratified samples, altogether 2982 men and 3087 women aged 25–64 years. Questionnaires were completed and anthropometric measurements taken. For each food item, associations between frequency of consumption and waist and hip circumferences were estimated. Partial regression coefficients for every level of reported intake were multiplied with differences in proportion of the population reporting the corresponding levels of intake in 1986 and 1999. The sum of these product terms for every food item was the respective estimated impact on mean circumference. Results Time trends in reported food consumption associated with the more favourable gynoid distribution of adipose tissue were increased use of vegetable oil, pasta and 1.5% fat milk. Trends associated with abdominal obesity were increased consumption of beer in men and higher intake of hamburgers and French fried potatoes in women. Conclusion Food trends as markers of time trends in body fat distribution have been identified. The method is a complement to conventional approaches to establish associations between food intake and disease risk on a population level.

  8. Breath acidification in adolescent runners exposed to atmospheric pollution: A prospective, repeated measures observational study

    Directory of Open Access Journals (Sweden)

    Van Sickle David

    2008-03-01

    Full Text Available Abstract Background Vigorous outdoors exercise during an episode of air pollution might cause airway inflammation. The purpose of this study was to examine the effects of vigorous outdoor exercise during peak smog season on breath pH, a biomarker of airway inflammation, in adolescent athletes. Methods We measured breath pH both pre- and post-exercise on ten days during peak smog season in 16 high school athletes engaged in daily long-distance running in a downwind suburb of Atlanta. The association of post-exercise breath pH with ambient ozone and particulate matter concentrations was tested with linear regression. Results We collected 144 pre-exercise and 146 post-exercise breath samples from 16 runners (mean age 14.9 years, 56% male. Median pre-exercise breath pH was 7.58 (interquartile range: 6.90 to 7.86 and did not change significantly after exercise. We observed no significant association between ambient ozone or particulate matter and post-exercise breath pH. However both pre- and post-exercise breath pH were strikingly low in these athletes when compared to a control sample of 14 relatively sedentary healthy adults and to published values of breath pH in healthy subjects. Conclusion Although we did not observe an acute effect of air pollution exposure during exercise on breath pH, breath pH was surprisingly low in this sample of otherwise healthy long-distance runners. We speculate that repetitive vigorous exercise may induce airway acidification.

  9. Toxicity evaluation of zinc aluminium levodopa nanocomposite via oral route in repeated dose study

    Science.gov (United States)

    Kura, Aminu Umar; Cheah, Pike-See; Hussein, Mohd Zobir; Hassan, Zurina; Tengku Azmi, Tengku Ibrahim; Hussein, Nor Fuzina; Fakurazi, Sharida

    2014-05-01

    Nanotechnology, through nanomedicine, allowed drugs to be manipulated into nanoscale sizes for delivery to the different parts of the body, at the same time, retaining the valuable pharmacological properties of the drugs. However, efficient drug delivery and excellent release potential of these delivery systems may be hindered by possible untoward side effects. In this study, the sub-acute toxicity of oral zinc aluminium nanocomposite with and without levodopa was assessed using the Organization for Economic Co-operation and Development guidelines. No sign or symptom of toxicity was observed in orally treated rats with the nanocomposite at 5 and 500 mg/kg concentrations. Body weight gain, feeding, water intake, general survival and organosomatic index were not significantly different between control and treatment groups. Aspartate aminotransferase (AST) in 500 mg/kg levodopa nanocomposite (169 ± 30 U/L), 5 mg/kg levodopa nanocomposite (172 ± 49 U/L), and 500 mg/kg layered double hydroxides (LDH) nanocomposite (175 ± 25 U/L) were notably elevated compared to controls (143 ± 05 U/L); but the difference were not significant ( p > 0.05). However, the differences in aspartate aminotransferase/alanine aminotransferase (AST/ALT) ratio of 500 mg/kg levodopa nanocomposite (0.32 ± 0.12) and 500 mg/kg LDH nanocomposite (0.34 ± 0.12) were statistically significant ( p brain was found to be of similar morphology in both control and experimental groups. The kidneys of 500-mg/kg-treated rats with levodopa nanocomposite and LDH nanocomposite were found to have slight inflammatory changes, notably leukocyte infiltration around the glomeruli. The ultra-structure of the neurons from the substantia nigra of nanocomposite-exposed group was similar to those receiving only normal saline. The observed result has suggested possible liver and renal toxicity in orally administered levodopa intercalated nanocomposite; it is also dose-dependent that needs further assessment.

  10. Safety of Repeated Yttrium-90 Radioembolization

    Energy Technology Data Exchange (ETDEWEB)

    Lam, Marnix G. E. H.; Louie, John D. [Stanford University School of Medicine, Division of Interventional Radiology (United States); Iagaru, Andrei H.; Goris, Michael L. [Stanford University School of Medicine, Division of Nuclear Medicine (United States); Sze, Daniel Y., E-mail: dansze@stanford.edu [Stanford University School of Medicine, Division of Interventional Radiology (United States)

    2013-10-15

    Purpose: Repeated radioembolization (RE) treatments carry theoretically higher risk of radiation-induced hepatic injury because of the liver's cumulative memory of previous exposure. We performed a retrospective safety analysis on patients who underwent repeated RE. Methods: From 2004 to 2011, a total of 247 patients were treated by RE. Eight patients (5 men, 3 women, age range 51-71 years) underwent repeated treatment of a targeted territory, all with resin microspheres (SIR-Spheres; Sirtex, Lane Cove, Australia). Adverse events were graded during a standardized follow-up. In addition, the correlation between the occurrence of RE-induced liver disease (REILD) and multiple variables was investigated in univariate and multivariate analyses in all 247 patients who received RE. Results: Two patients died shortly after the second treatment (at 84 and 107 days) with signs and symptoms of REILD. Both patients underwent whole liver treatment twice (cumulative doses 3.08 and 2.66 GBq). The other 6 patients demonstrated only minor toxicities after receiving cumulative doses ranging from 2.41 to 3.88 GBq. All patients experienced objective tumor responses. In the whole population, multifactorial analysis identified three risk factors associated with REILD: repeated RE (p = 0.036), baseline serum total bilirubin (p = 0.048), and baseline serum aspartate aminotransferase (p = 0.043). Repeated RE proved to be the only independent risk factor for REILD in multivariate analysis (odds ratio 9.6; p = 0.002). Additionally, the administered activity per target volume (in GBq/L) was found to be an independent risk factor for REILD, but only in whole liver treatments (p = 0.033). Conclusion: The risk of REILD appears to be elevated for repeated RE. Objective tumor responses were observed, but establishment of safety limits will require improvement in dosimetric measurement and prediction.

  11. Understanding how adherence goals promote adherence behaviours: a repeated measure observational study with HIV seropositive patients

    Directory of Open Access Journals (Sweden)

    Jones Gareth

    2012-08-01

    behaviours over and above the effects of the behaviour-specific thinking and ii the relationship between adherence to exercise and to medical treatment is stronger among those with more favourable views about the goal. Results from this study should identify the key contributing factors to inform subsequent adherence research and afford a more streamlined assessment matrix. The project also aims to inform patient care practices. UK Clinical Research Network registration number UKCRN 7842.

  12. Calculating Cumulative Binomial-Distribution Probabilities

    Science.gov (United States)

    Scheuer, Ernest M.; Bowerman, Paul N.

    1989-01-01

    Cumulative-binomial computer program, CUMBIN, one of set of three programs, calculates cumulative binomial probability distributions for arbitrary inputs. CUMBIN, NEWTONP (NPO-17556), and CROSSER (NPO-17557), used independently of one another. Reliabilities and availabilities of k-out-of-n systems analyzed. Used by statisticians and users of statistical procedures, test planners, designers, and numerical analysts. Used for calculations of reliability and availability. Program written in C.

  13. Cumulative cultural evolution: the role of teaching.

    Science.gov (United States)

    Castro, Laureano; Toro, Miguel A

    2014-04-21

    In humans, cultural transmission occurs usually by cumulative inheritance, generating complex adaptive behavioral features. Cumulative culture requires key psychological processes (fundamentally imitation and teaching) that are absent or impoverished in non-human primates. In this paper we analyze the role that teaching has played in human cumulative cultural evolution. We assume that a system of cumulative culture generates increasingly adaptive behaviors, that are also more complex and difficult to imitate. Our thesis is that, as cultural traits become more complex, cumulative cultural transmission requires teaching to ensure accurate transmission from one generation to the next. In an increasingly complex cultural environment, we consider that individuals commit errors in imitation. We develop a model of cumulative cultural evolution in a changing environment and show that these errors hamper the process of cultural accumulation. We also show that a system of teaching between parents and offspring that increases the fidelity of imitation unblocks the accumulation and becomes adaptive whenever the gain in fitness compensates the cost of teaching.

  14. Human cumulative culture: a comparative perspective.

    Science.gov (United States)

    Dean, Lewis G; Vale, Gill L; Laland, Kevin N; Flynn, Emma; Kendal, Rachel L

    2014-05-01

    Many animals exhibit social learning and behavioural traditions, but human culture exhibits unparalleled complexity and diversity, and is unambiguously cumulative in character. These similarities and differences have spawned a debate over whether animal traditions and human culture are reliant on homologous or analogous psychological processes. Human cumulative culture combines high-fidelity transmission of cultural knowledge with beneficial modifications to generate a 'ratcheting' in technological complexity, leading to the development of traits far more complex than one individual could invent alone. Claims have been made for cumulative culture in several species of animals, including chimpanzees, orangutans and New Caledonian crows, but these remain contentious. Whilst initial work on the topic of cumulative culture was largely theoretical, employing mathematical methods developed by population biologists, in recent years researchers from a wide range of disciplines, including psychology, biology, economics, biological anthropology, linguistics and archaeology, have turned their attention to the experimental investigation of cumulative culture. We review this literature, highlighting advances made in understanding the underlying processes of cumulative culture and emphasising areas of agreement and disagreement amongst investigators in separate fields.

  15. Sci—Thur AM: YIS - 11: Estimation of Bladder-Wall Cumulative Dose in Multi-Fraction Image-Based Gynaecological Brachytherapy Using Deformable Point Set Registration

    Energy Technology Data Exchange (ETDEWEB)

    Zakariaee, R [Physics Department, University of British Columbia, Vancouver, BC (Canada); Brown, C J; Hamarneh, G [School of Computing Science, Simon Fraser University, Burnaby, BC (Canada); Parsons, C A; Spadinger, I [British Columbia Cancer Agency, Vancouver, BC (Canada)

    2014-08-15

    Dosimetric parameters based on dose-volume histograms (DVH) of contoured structures are routinely used to evaluate dose delivered to target structures and organs at risk. However, the DVH provides no information on the spatial distribution of the dose in situations of repeated fractions with changes in organ shape or size. The aim of this research was to develop methods to more accurately determine geometrically localized, cumulative dose to the bladder wall in intracavitary brachytherapy for cervical cancer. The CT scans and treatment plans of 20 cervical cancer patients were used. Each patient was treated with five high-dose-rate (HDR) brachytherapy fractions of 600cGy prescribed dose. The bladder inner and outer surfaces were delineated using MIM Maestro software (MIM Software Inc.) and were imported into MATLAB (MathWorks) as 3-dimensional point clouds constituting the “bladder wall”. A point-set registration toolbox for MATLAB, Coherent Point Drift (CPD), was used to non-rigidly transform the bladder-wall points from four of the fractions to the coordinate system of the remaining (reference) fraction, which was chosen to be the emptiest bladder for each patient. The doses were accumulated on the reference fraction and new cumulative dosimetric parameters were calculated. The LENT-SOMA toxicity scores of these patients were studied against the cumulative dose parameters. Based on this study, there was no significant correlation between the toxicity scores and the determined cumulative dose parameters.

  16. A new technique for repeated biopsies of the mammary gland in dairy cows allotted to Latin-square design studies.

    Science.gov (United States)

    de Lima, Luciano S; Martineau, Eric; De Marchi, Francilaine E; Palin, Marie-France; Dos Santos, Geraldo T; Petit, Hélène V

    2016-07-01

    The objective of this study was to develop a technique for carrying out repeated biopsies of the mammary gland of lactating dairy cows that provides enough material to monitor enzyme activities and gene expression in mammary secretory tissue. A total of 16 Holstein cows were subjected to 4 mammary biopsies each at 3-week intervals for a total of 64 biopsies. A 0.75-cm incision was made through the skin and subcutaneous tissue of the mammary gland and a trocar and cannula were inserted using a circular motion. The trocar was withdrawn and a syringe was plugged into the base of the cannula to create a vacuum for sampling mammary tissue. To reduce bleeding, hand pressure was put on the surgery site after biopsy and skin closure and ice was applied for at least 2 h after the biopsy using a cow bra. The entire procedure took an average of 25 min. Two attempts were usually enough to obtain 800 mg of tissue. Visual examination of milk samples 10 d after the biopsy indicated no trace of blood, except in samples from 2 cows. All wounds healed without infection and subcutaneous hematomas resorbed within 7 d. There was no incidence of mastitis throughout the lactation. This technique provides a new tool for biopsy of the mammary gland repeated at short intervals with the main effect being a decrease in milk production. Although secondary complications leading to illness or death are always a risk with any procedure, this biopsy technique was carried out without complications to the health of animals and with no incidence of mastitis during the lactation.

  17. Effects of Cold Water Immersion on Muscle Oxygenation During Repeated Bouts of Fatiguing Exercise: A Randomized Controlled Study.

    Science.gov (United States)

    Yeung, Simon S; Ting, Kin Hung; Hon, Maurice; Fung, Natalie Y; Choi, Manfi M; Cheng, Juno C; Yeung, Ella W

    2016-01-01

    Postexercise cold water immersion has been advocated to athletes as a means of accelerating recovery and improving performance. Given the effects of cold water immersion on blood flow, evaluating in vivo changes in tissue oxygenation during cold water immersion may help further our understanding of this recovery modality. This study aimed to investigate the effects of cold water immersion on muscle oxygenation and performance during repeated bouts of fatiguing exercise in a group of healthy young adults. Twenty healthy subjects performed 2 fatiguing bouts of maximal dynamic knee extension and flexion contractions both concentrically on an isokinetic dynamometer with a 10-min recovery period in between. Subjects were randomly assigned to either a cold water immersion (treatment) or passive recovery (control) group. Changes in muscle oxygenation were monitored continuously using near-infrared spectroscopy. Muscle performance was measured with isokinetic dynamometry during each fatiguing bout. Skin temperature, heart rate, blood pressure, and muscle soreness ratings were also assessed. Repeated measures ANOVA analysis was used to evaluate treatment effects. The treatment group had a significantly lower mean heart rate and lower skin temperature compared to the control group (P Cold water immersion attenuated a reduction in tissue oxygenation in the second fatiguing bout by 4% when compared with control. Muscle soreness was rated lower 1 day post-testing (P cold water immersion had no significant effect on muscle performance in subsequent exercise. As the results show that cold water immersion attenuated decreased tissue oxygenation in subsequent exercise performance, the metabolic response to exercise after cold water immersion is worthy of further exploration.

  18. High-Throughput Mycobacterial Interspersed Repetitive-Unit–Variable-Number Tandem-Repeat Genotyping for Mycobacterium tuberculosis Epidemiological Studies

    Science.gov (United States)

    Bidault, Floriane; Mosnier, Amandine; Bablishvili, Nino; Tukvadze, Nestani; Somphavong, Silaphet; Paboriboune, Phimpha; Ocheretina, Oksana; Pape, Jean William; Paranhos-Baccala, Glaucia; Berland, Jean-Luc

    2014-01-01

    The emergence of drug-resistant forms of tuberculosis (TB) represents a major public health concern. Understanding the transmission routes of the disease is a key factor for its control and for the implementation of efficient interventions. Mycobacterial interspersed repetitive-unit–variable-number tandem-repeat (MIRU-VNTR) marker typing is a well-described method for lineage identification and transmission tracking. However, the conventional manual genotyping technique is cumbersome and time-consuming and entails many risks for errors, thus hindering its implementation and dissemination. We describe here a new approach using the QIAxcel system, an automated high-throughput capillary electrophoresis system that also carries out allele calling. This automated method was assessed on 1,824 amplicons from 82 TB isolates and tested with sets of markers of 15 or 24 loci. Overall allele-calling concordance between the methods from 140 to 1,317 bp was 98.9%. DNA concentrations and repeatability and reproducibility performances showed no biases in allele calling. Furthermore, turnaround time using this automated system was reduced by 81% compared to the conventional manual agarose gel method. In sum, this new automated method facilitates MIRU-VNTR genotyping and provides reliable results. Therefore, it is well suited for field genotyping. The implementation of this method will help to achieve accurate and cost-effective epidemiological studies, especially in countries with a high prevalence of TB, where the high number of strains complicates the surveillance of circulating lineages and requires efficient interventions to be carried out in an urgent manner. PMID:25428144

  19. Existence of Solutions of a Riccati Differential System from a General Cumulant Control Problem

    Directory of Open Access Journals (Sweden)

    Stanley R. Liberty

    2011-01-01

    Full Text Available We study a system of infinitely many Riccati equations that arise from a cumulant control problem, which is a generalization of regulator problems, risk-sensitive controls, minimal cost variance controls, and k-cumulant controls. We obtain estimates for the existence intervals of solutions of the system. In particular, new existence conditions are derived for solutions on the horizon of the cumulant control problem.

  20. Re: Could Testosterone Replacement Therapy in Hypogonadal Men Ameliorate Anemia, a Cardiovascular Risk Factor? An Observational, 54-week Cumulative Registry Study

    Directory of Open Access Journals (Sweden)

    Emre Bakırcıoğlu

    2016-09-01

    Full Text Available Testosterone deficiency syndrome may associate with erectile dysfunction, increased abdominal fat and reduced muscle mass. Low serum testosterone is also related with anemia, metabolic syndrome and cardiovascular disease. In this study, the authors investigated if testosterone undecanoate (TU reduces anemia and the risk of cardiovascular disease in patients with hypogonadism A total of 58 participants with a total testosterone level of less than 2.35 ng/ml received an injection of 1.000 mg TU 6 times; at initial visit, 6, 18, 30, 42 and 54 weeks. They observed that total testosterone and free testosterone levels were restored by TU. Hemoglobin and hematocrit levels significantly increased while anemia and total cholesterol levels significantly reduced. Although there are some limitations of this study e.g. it is not a randomized controlled and a long-term study, TU treatment in hypogonadal men decreased the prevalence of anemia, improved lipid profiles and lowered the risk of cardiovascular disease.

  1. Cumulative Incidence of Cancer After Solid Organ Transplantation

    Science.gov (United States)

    Hall, Erin C.; Pfeiffer, Ruth M.; Segev, Dorry L.; Engels, Eric A.

    2014-01-01

    BACKGROUND Solid organ transplantation recipients have elevated cancer incidence. Estimates of absolute cancer risk after transplantation can inform prevention and screening. METHODS The Transplant Cancer Match Study links the US transplantation registry with 14 state/regional cancer registries. The authors used nonparametric competing risk methods to estimate the cumulative incidence of cancer after transplantation for 2 periods (1987–1999 and 2000–2008). For recipients from 2000 to 2008, the 5-year cumulative incidence, stratified by organ, sex, and age at transplantation, was estimated for 6 preventable or screen-detectable cancers. For comparison, the 5-year cumulative incidence was calculated for the same cancers in the general population at representative ages using Surveillance, Epidemiology, and End Results data. RESULTS Among 164,156 recipients, 8520 incident cancers were identified. The absolute cancer risk was slightly higher for recipients during the period from 2000 to 2008 than during the period from 1987 to 1999 (5-year cumulative incidence: 4.4% vs 4.2%; P =.006); this difference arose from the decreasing risk of competing events (5-year cumulative incidence of death, graft failure, or retransplantation: 26.6% vs 31.9%; P 50 years; range, 0.36%–2.22%). For recipients aged >50 years, the 5-year cumulative incidence was higher for colorectal cancer (range, 0.33%–1.94%) than for the general population at the recommended screening age (aged 50 years: range, 0.25%–0.33%). For recipients aged >50 years, the 5-year cumulative incidence was high for lung cancer among thoracic organ recipients (range, 1.16%–3.87%) and for kidney cancer among kidney recipients (range, 0.53%–0.84%). The 5-year cumulative incidence for prostate cancer and breast cancer was similar or lower in transplantation recipients than at the recommended ages of screening in the general population. CONCLUSIONS Subgroups of transplantation recipients have a high absolute risk

  2. Prediction of adaptation difficulties by country of origin, cumulate psychosocial stressors and attitude toward integrating: A Swedish study of first-generation immigrants from Somalia, Vietnam and China

    OpenAIRE

    Johnsson, Ewa; Zolkowska, Krystyna; McNeil, Thomas F

    2015-01-01

    Background: Different types of accumulated stress have been found to have negative consequences for immigrants’ capacity to adapt to the new environment. It remains unclear which factors have the greatest influence. Aims: The study investigated whether immigrants’ experience of great difficulty in adapting to a new country could best be explained by (1) country of origin, (2) exposure to accumulated stressors before arrival or (3) after arrival in the new country and/or (4) reserved attitude ...

  3. Huntington CAG repeat size does not modify onset age in familial Parkinson’s disease: The GenePD Study

    Science.gov (United States)

    McNicoll, Christopher F.; Latourelle, Jeanne C.; MacDonald, Marcy E.; Lew, Mark F.; Suchowersky, Oksana; Klein, Christine; Golbe, Lawrence I.; Mark, Margery H.; Growdon, John H.; Wooten, G. Frederick; Watts, Ray L.; Guttman, Mark; Racette, Brad A.; Perlmutter, Joel S.; Ahmed, Anwar; Shill, Holly A.; Singer, Carlos; Saint-Hilaire, Marie H.; Massood, Tiffany; Huskey, Karen W.; DeStefano, Anita L.; Gillis, Tammy; Mysore, Jayalakshmi; Goldwurm, Stefano; Pezzoli, Gianni; Baker, Kenneth B.; Itin, Ilia; Litvan, Irene; Nicholson, Garth; Corbett, Alastair; Nance, Martha; Drasby, Edward; Isaacson, Stuart; Burn, David J.; Chinnery, Patrick F.; Pramstaller, Peter P.; Al-hinti, Jomana; Moller, Anette T.; Ostergaard, Karen; Sherman, Scott J.; Roxburgh, Richard; Snow, Barry; Slevin, John T.; Cambi, Franca; Gusella, James F.; Myers, Richard H.

    2009-01-01

    The ATP/ADP ratio reflects mitochondrial function and has been reported to be influenced by the size of the Huntington disease gene (HD) repeat. Impaired mitochondrial function has long been implicated in the pathogenesis of Parkinson’s disease (PD) and therefore, we evaluated the relationship of the HD CAG repeat size to PD onset age in a large sample of familial PD cases. PD affected siblings (n=495) with known onset ages from 248 families, were genotyped for the HD CAG repeat. Genotyping failed in 11 cases leaving 484 for analysis, including 35 LRRK2 carriers. All cases had HD CAG repeats (range 15 to 34) below the clinical range for HD, although 5.2 percent of the sample (n=25) had repeats in the intermediate range (the intermediate range lower limit=27; upper limit=35 repeats), suggesting that the prevalence of intermediate allele carriers in the general population is significant. No relation between the HD CAG repeat size and the age at onset for PD was found in this sample of familial PD. PMID:18649400

  4. Continuously Cumulating Meta-Analysis and Replicability.

    Science.gov (United States)

    Braver, Sanford L; Thoemmes, Felix J; Rosenthal, Robert

    2014-05-01

    The current crisis in scientific psychology about whether our findings are irreproducible was presaged years ago by Tversky and Kahneman (1971), who noted that even sophisticated researchers believe in the fallacious Law of Small Numbers-erroneous intuitions about how imprecisely sample data reflect population phenomena. Combined with the low power of most current work, this often leads to the use of misleading criteria about whether an effect has replicated. Rosenthal (1990) suggested more appropriate criteria, here labeled the continuously cumulating meta-analytic (CCMA) approach. For example, a CCMA analysis on a replication attempt that does not reach significance might nonetheless provide more, not less, evidence that the effect is real. Alternatively, measures of heterogeneity might show that two studies that differ in whether they are significant might have only trivially different effect sizes. We present a nontechnical introduction to the CCMA framework (referencing relevant software), and then explain how it can be used to address aspects of replicability or more generally to assess quantitative evidence from numerous studies. We then present some examples and simulation results using the CCMA approach that show how the combination of evidence can yield improved results over the consideration of single studies.

  5. Repeat spinal anesthesia in cesarean section: A comparison between 10 mg and 12 mg doses of intrathecal hyperbaric (0.05%) bupivacaine repeated after failed spinal anesthesia: A prospective, parallel group study.

    Science.gov (United States)

    Bhar, Debasish; RoyBasunia, Sandip; Das, Anjan; Chhaule, Subinay; Mondal, Sudipta Kumar; Bisai, Subrata; Chattopadhyay, Surajit; Mandal, Subrata Kumar

    2016-01-01

    Spinal anesthesia for cesarean section is not a 100% successful technique. At times, despite straightforward insertion and drug administration, intrathecal anesthesia for cesarean section fails to obtain any sensory or motor block. Very few studies and literature are available regarding repeat administration of spinal anesthesia and its drug dosage, especially after first spinal failure in cesarean section lower segment cesarean section (LSCS) due to fear of the excessive spread of drug. The aim of our study is to compare the outcome between two different doses of 0.5% hyperbaric bupivacaine repeated intrathecally after failed spinal. After taking informed consent and Ethical Committee approval this prospective, randomized single-blinded study was conducted in 100 parturients of American Society of Anesthesiologists I-II who were posted for elective LSCS and had Bromage score 0 and no sensory block even at L4 dermatome after 10 min of first spinal anesthesia; were included in the study. Group A (n = 50) patients received 2.4 ml and Group B (n = 50) patients received 2 ml of 0.5% hyperbaric bupivacaine respectively for administering repeat spinal anesthesia. Heart rate (HR), systolic blood pressure (SBP), diastolic blood pressure (DBP), oxygen saturation, respiratory rate and electrocardiogram were monitored both intra- and post-operatively and complications were recorded. Incidence of high spinal, bradycardia, hypotension, respiratory complications, and nausea vomiting are significantly higher in Group A compared to Group B (P cesarean section with 10 mg of 0.5% hyperbaric bupivacaine provided after first spinal anesthesia, the level of sensory block is below L4 and motor power in Bromage scale is 0.

  6. Repeat workers' compensation claims: risk factors, costs and work disability

    Directory of Open Access Journals (Sweden)

    Collie Alex

    2011-06-01

    Full Text Available Abstract Background The objective of our study was to describe factors associated with repeat workers' compensation claims and to compare the work disability arising in workers with single and multiple compensation claims. Methods All initial injury claims lodged by persons of working age during a five year period (1996 to 2000 and any repeat claims were extracted from workers' compensation administrative data in the state of Victoria, Australia. Groups of workers with single and multiple claims were identified. Descriptive analysis of claims by affliction, bodily location, industry segment, occupation, employer and workplace was undertaken. Survival analysis determined the impact of these variables on the time between the claims. The economic impact and duration of work incapacity associated with initial and repeat claims was compared between groups. Results 37% of persons with an initial claim lodged a second claim. This group contained a significantly greater proportion of males, were younger and more likely to be employed in manual occupations and high-risk industries than those with single claims. 78% of repeat claims were for a second injury. Duration between the claims was shortest when the working conditions had not changed. The initial claims of repeat claimants resulted in significantly (p lower costs and work disability than the repeat claims. Conclusions A substantial proportion of injured workers experience a second occupational injury or disease. These workers pose a greater economic burden than those with single claims, and also experience a substantially greater cumulative period of work disability. There is potential to reduce the social, health and economic burden of workplace injury by enacting prevention programs targeted at these workers.

  7. Cumulative psychosocial stress, coping resources, and preterm birth.

    Science.gov (United States)

    McDonald, Sheila W; Kingston, Dawn; Bayrampour, Hamideh; Dolan, Siobhan M; Tough, Suzanne C

    2014-12-01

    Preterm birth constitutes a significant international public health issue, with implications for child and family well-being. High levels of psychosocial stress and negative affect before and during pregnancy are contributing factors to shortened gestation and preterm birth. We developed a cumulative psychosocial stress variable and examined its association with early delivery controlling for known preterm birth risk factors and confounding environmental variables. We further examined this association among subgroups of women with different levels of coping resources. Utilizing the All Our Babies (AOB) study, an ongoing prospective pregnancy cohort study in Alberta, Canada (n = 3,021), multinomial logistic regression was adopted to examine the independent effect of cumulative psychosocial stress and preterm birth subgroups compared to term births. Stratified analyses according to categories of perceived social support and optimism were undertaken to examine differential effects among subgroups of women. Cumulative psychosocial stress was a statistically significant risk factor for late preterm birth (OR = 1.73; 95 % CI = 1.07, 2.81), but not for early preterm birth (OR = 2.44; 95 % CI = 0.95, 6.32), controlling for income, history of preterm birth, pregnancy complications, reproductive history, and smoking in pregnancy. Stratified analyses showed that cumulative psychosocial stress was a significant risk factor for preterm birth at psychosocial stress on the risk for early delivery.

  8. Risk factors for complications in donors at first and repeat whole blood donation: a cohort study with assessment of the impact on donor return.

    Science.gov (United States)

    Wiersum-Osselton, Johanna C; Marijt-van der Kreek, Tanneke; Brand, Anneke; Veldhuizen, Ingrid; van der Bom, Johanna G; de Kort, Wim

    2014-01-01

    First-time donation is among recognised risk factors for vasovagal reactions to blood donation and reactions are known to reduce donor return. We assessed associations between potential risk factors and vasovagal reactions and needle-related complications in first-time whole blood donation in comparison to repeat donation and analysed the impact of complications on donor return. We performed a cohort study on whole blood donations in The Netherlands from 1/1/2010 to 31/12/2010 using data extracted from the blood service information system. Donation data up to 31/12/2011 were used to ascertain donor return. In 2010 28,786 donors made first whole blood donations and there were 522,958 repeat donations. Vasovagal reactions occurred in 3.9% of first donations by males and 3.5% of first donations by females compared to in 0.2% and 0.6%, respectively, of repeat donations. Associations of vasovagal reactions with other factors including age, body weight, systolic and diastolic blood pressure were similar in first-time and repeat donors. Needle-related complications occurred in 0.2% of male and 0.5% of female first-time donations and in 0.1% and 0.3%, respectively, of repeat donations. Among first-time donors, the return rate within 1 year was 82% following an uncomplicated first donation, but 55% and 61% following vasovagal reactions and needle-related complications, respectively; the corresponding percentages among repeat donors were 86%, 58% and 82%. Among first-time donors, females suffered less than males from vasovagal reactions. Other risk factors had similar associations among first-time and repeat donors. Vasovagal reactions and needle-related complications in both first-time and repeat donors are followed by reduced donor return.

  9. The electronic diagnosis of caries in pits and fissures: site-specific stable conductance readings or cumulative resistance readings?

    Science.gov (United States)

    Ricketts, D N; Kidd, E A; Wilson, R F

    1997-01-01

    A prototype electronic caries meter (ECM II; LODE, Groningen. The Netherlands) was designed to deliver a conductance reading when the reading had remained stable for 3 consecutive seconds. The aim of this study was to determine whether this type of stable conductance reading was optimal for caries diagnosis. The ECM II was connected to a graphic recorder which enabled the continuous resistance to be recorded. The graphic recording was calibrated using a standard, variable resistance box. Stable conductance readings were taken for 76 sites on 32 extracted teeth with no visible sign of cavitation at an airflow of 7.5 l/min. Simultaneous graphic recording of resistance was continued for 10 s and cumulative resistance measurements were calculated by adding the resistance values at 1-second intervals. Histological validation of caries status was carried out on macroradiographs of sections cut to include sample sites. The histological picture was compared with the stable conductance reading and the cumulative resistance value for each site. Sensitivity and specificity values were calculated by randomly choosing stable conductance and cumulative resistance values to differentiate sound and carious sites. The results were presented as a series of receiver operating characteristics (ROC) curves and the optimum sensitivity and specificity values determined. 33% of sites had enamel caries and 32% had enamel and dentine caries. Results showed that both stable conductance readings and cumulative resistance measurements gave high and comparable sensitivity and specificity values for the diagnosis of dentine caries (sens. 92%, spec. 87% and sens. 88%, spec. 81%, respectively). However, when intra-examiner reproducibility was checked, stable conductance readings were more repeatable and achieved in shorter clinical time. In conclusion, stable conductance readings appear to be the most suitable for occlusal caries diagnosis.

  10. Application of transrectal ultrasound-guided repeat needle biopsy in the diagnosis of prostate cancer in Chinese population: A retrospective study

    Directory of Open Access Journals (Sweden)

    Yi Wang

    2016-01-01

    Full Text Available Background: Transrectal ultrasound-guided repeat needle biopsy (TUGRNB is widely used for diagnosis of prostate cancer (PCa. However, significance of TUGRNB in Chinese population was rarely reported. A retrospective study was conducted to evaluate the significance of TUGRNB applied in prediction of PCa in Chinese population. Materials and Methods: A total of 960 from January 2009 to December 2012 were included. Repeat needle biopsy rate and PCa positive detection rate were evaluated. Relationship between prostate specific antigen (PSA levels and PCa positive rates was analyzed. Results: PCa positive detection rate after initial needle biopsy was 28.4%, which was lower than the rate of repeat needle biopsy (40%. The rate for immediate transurethral resection (TUR, surgery after initial needle biopsy, was 27.1%, however with a low PCa positive detection rate (0.66%. The repeat needle biopsy rate was lower compared with the initial biopsy rate (P 20 ng/ml, PCa positive rate was significantly higher than those with PSA < 20 ng/ml (P < 0.05. Conclusion: PCa positive detection rate following repeat needle biopsy in Chinese population was higher, although the repeated needle biopsy rate was still in a low level. TUGRNB should attract more attention in the diagnosis of PCa.

  11. Expansion of protein domain repeats.

    Directory of Open Access Journals (Sweden)

    Asa K Björklund

    2006-08-01

    Full Text Available Many proteins, especially in eukaryotes, contain tandem repeats of several domains from the same family. These repeats have a variety of binding properties and are involved in protein-protein interactions as well as binding to other ligands such as DNA and RNA. The rapid expansion of protein domain repeats is assumed to have evolved through internal tandem duplications. However, the exact mechanisms behind these tandem duplications are not well-understood. Here, we have studied the evolution, function, protein structure, gene structure, and phylogenetic distribution of domain repeats. For this purpose we have assigned Pfam-A domain families to 24 proteomes with more sensitive domain assignments in the repeat regions. These assignments confirmed previous findings that eukaryotes, and in particular vertebrates, contain a much higher fraction of proteins with repeats compared with prokaryotes. The internal sequence similarity in each protein revealed that the domain repeats are often expanded through duplications of several domains at a time, while the duplication of one domain is less common. Many of the repeats appear to have been duplicated in the middle of the repeat region. This is in strong contrast to the evolution of other proteins that mainly works through additions of single domains at either terminus. Further, we found that some domain families show distinct duplication patterns, e.g., nebulin domains have mainly been expanded with a unit of seven domains at a time, while duplications of other domain families involve varying numbers of domains. Finally, no common mechanism for the expansion of all repeats could be detected. We found that the duplication patterns show no dependence on the size of the domains. Further, repeat expansion in some families can possibly be explained by shuffling of exons. However, exon shuffling could not have created all repeats.

  12. Predicting Cumulative Incidence Probability by Direct Binomial Regression

    DEFF Research Database (Denmark)

    Scheike, Thomas H.; Zhang, Mei-Jie

    Binomial modelling; cumulative incidence probability; cause-specific hazards; subdistribution hazard......Binomial modelling; cumulative incidence probability; cause-specific hazards; subdistribution hazard...

  13. Repeat induced abortion - a matter of individual behaviour or societal factors? A cross-sectional study among Swedish women.

    Science.gov (United States)

    Makenzius, Marlene; Tydén, Tanja; Darj, Elisabeth; Larsson, Margareta

    2011-10-01

    Almost 40% of all induced abortions in Sweden are repeat abortions; little is known about the risk factors. To investigate differences between women who had a first-time abortion and those with repeat abortion, and to identify factors associated with repeat abortion. A questionnaire was answered by 798 abortion-seeking women in Sweden during 2009. A regression model was used to assess risk factors for repeat abortions. In the age range 20-49 years, 41% of women had experienced at least one previous abortion. Risk factors for repeat abortion were parity (OR 2.57), lack of emotional support (OR 2.09), unemployment or sick leave (OR 1.65), tobacco use (OR 1.56), and low educational level (OR 1.5). Some women (n = 55) considered economic support and work opportunities could have enabled them to continue the pregnancy. Increased Sex and Relationship Education (SRE), easy access to high-quality contraception and counselling, were suggested (n = 86) as interventions for preventing unintended pregnancies. Even in a country with long established SRE and a public health policy to enhance sexual and reproductive health over a third of women requesting abortion have experienced one previously and the rate is maintained. Some specific factors are identified but, overall, a picture of vulnerability among women seeking repeat abortion stands out that needs to be considered in the prevention of unintended pregnancies.

  14. Decision-to-Delivery Time Intervals in Emergency Caesarean Section Cases: Repeated cross-sectional study from Oman.

    Science.gov (United States)

    Tashfeen, Kaukab; Patel, Malini; Hamdi, Ilham M; Al-Busaidi, Ibrahim H A; Al-Yarubi, Mansour N

    2017-02-01

    In cases of fetal intolerance to labour, meeting the standard decision-to-delivery time interval (DDI) of ≤30 minutes is challenging. This study aimed to assess DDIs in emergency Caesarean section (CS) cases to identify factors causing DDI delays and the impact of a delayed DDI on perinatal outcomes. This repeated cross-sectional study included all emergency CS procedures performed due to acute fetal distress, antepartum haemorrhage or umbilical cord prolapse at the Nizwa Hospital, Nizwa, Oman. Three audit cycles of three months each were conducted between April 2011 and June 2013, including an initial retrospective cycle and two prospective cycles following the implementation of improvement strategies to address factors causing DDI delays. Poor perinatal outcomes were defined as Apgar scores of 60 minutes was significantly associated with poor neonatal outcomes in terms of increased SCBU admissions and low Apgar scores (P <0.001 each). Factors causing DDI delays included obtaining consent for the CS procedure, a lack of operating theatre availability and moving patients to the operating theatre. The identification of factors causing DDI delays may provide opportunities to improve perinatal outcomes.

  15. Decision-to-Delivery Time Intervals in Emergency Caesarean Section Cases; Repeated cross-sectional study from Oman

    Directory of Open Access Journals (Sweden)

    Kaukab Tashfeen

    2017-03-01

    Full Text Available Objectives: In cases of fetal intolerance to labour, meeting the standard decision-to-delivery time interval (DDI of ≤30 minutes is challenging. This study aimed to assess DDIs in emergency Caesarean section (CS cases to identify factors causing DDI delays and the impact of a delayed DDI on perinatal outcomes. Methods: This repeated cross-sectional study included all emergency CS procedures performed due to acute fetal distress, antepartum haemorrhage or umbilical cord prolapse at the Nizwa Hospital, Nizwa, Oman. Three audit cycles of three months each were conducted between April 2011 and June 2013, including an initial retrospective cycle and two prospective cycles following the implementation of improvement strategies to address factors causing DDI delays. Poor perinatal outcomes were defined as Apgar scores of 60 minutes was significantly associated with poor neonatal outcomes in terms of increased SCBU admissions and low Apgar scores (P <0.001 each. Factors causing DDI delays included obtaining consent for the CS procedure, a lack of operating theatre availability and moving patients to the operating theatre. Conclusion: The identification of factors causing DDI delays may provide opportunities to improve perinatal outcomes.

  16. First worldwide proficiency study on variable-number tandem-repeat typing of Mycobacterium tuberculosis complex strains.

    Science.gov (United States)

    de Beer, Jessica L; Kremer, Kristin; Ködmön, Csaba; Supply, Philip; van Soolingen, Dick

    2012-03-01

    Although variable-number tandem-repeat (VNTR) typing has gained recognition as the new standard for the DNA fingerprinting of Mycobacterium tuberculosis complex (MTBC) isolates, external quality control programs have not yet been developed. Therefore, we organized the first multicenter proficiency study on 24-locus VNTR typing. Sets of 30 DNAs of MTBC strains, including 10 duplicate DNA samples, were distributed among 37 participating laboratories in 30 different countries worldwide. Twenty-four laboratories used an in-house-adapted method with fragment sizing by gel electrophoresis or an automated DNA analyzer, nine laboratories used a commercially available kit, and four laboratories used other methods. The intra- and interlaboratory reproducibilities of VNTR typing varied from 0% to 100%, with averages of 72% and 60%, respectively. Twenty of the 37 laboratories failed to amplify particular VNTR loci; if these missing results were ignored, the number of laboratories with 100% interlaboratory reproducibility increased from 1 to 5. The average interlaboratory reproducibility of VNTR typing using a commercial kit was better (88%) than that of in-house-adapted methods using a DNA analyzer (70%) or gel electrophoresis (50%). Eleven laboratories using in-house-adapted manual typing or automated typing scored inter- and intralaboratory reproducibilities of 80% or higher, which suggests that these approaches can be used in a reliable way. In conclusion, this first multicenter study has documented the worldwide quality of VNTR typing of MTBC strains and highlights the importance of international quality control to improve genotyping in the future.

  17. Nifty Nines and Repeating Decimals

    Science.gov (United States)

    Brown, Scott A.

    2016-01-01

    The traditional technique for converting repeating decimals to common fractions can be found in nearly every algebra textbook that has been published, as well as in many precalculus texts. However, students generally encounter repeating decimal numerals earlier than high school when they study rational numbers in prealgebra classes. Therefore, how…

  18. Nifty Nines and Repeating Decimals

    Science.gov (United States)

    Brown, Scott A.

    2016-01-01

    The traditional technique for converting repeating decimals to common fractions can be found in nearly every algebra textbook that has been published, as well as in many precalculus texts. However, students generally encounter repeating decimal numerals earlier than high school when they study rational numbers in prealgebra classes. Therefore, how…

  19. The effects of cumulative practice on mathematics problem solving.

    Science.gov (United States)

    Mayfield, Kristin H; Chase, Philip N

    2002-01-01

    This study compared three different methods of teaching five basic algebra rules to college students. All methods used the same procedures to teach the rules and included four 50-question review sessions interspersed among the training of the individual rules. The differences among methods involved the kinds of practice provided during the four review sessions. Participants who received cumulative practice answered 50 questions covering a mix of the rules learned prior to each review session. Participants who received a simple review answered 50 questions on one previously trained rule. Participants who received extra practice answered 50 extra questions on the rule they had just learned. Tests administered after each review included new questions for applying each rule (application items) and problems that required novel combinations of the rules (problem-solving items). On the final test, the cumulative group outscored the other groups on application and problem-solving items. In addition, the cumulative group solved the problem-solving items significantly faster than the other groups. These results suggest that cumulative practice of component skills is an effective method of training problem solving.

  20. Repeat-until-success quantum repeaters

    Science.gov (United States)

    Bruschi, David Edward; Barlow, Thomas M.; Razavi, Mohsen; Beige, Almut

    2014-09-01

    We propose a repeat-until-success protocol to improve the performance of probabilistic quantum repeaters. Conventionally, these rely on passive static linear-optics elements and photodetectors to perform Bell-state measurements (BSMs) with a maximum success rate of 50%. This is a strong impediment for entanglement swapping between distant quantum memories. Every time a BSM fails, entanglement needs to be redistributed between the corresponding memories in the repeater link. The key ingredients of our scheme are repeatable BSMs. Under ideal conditions, these turn probabilistic quantum repeaters into deterministic ones. Under realistic conditions, our protocol too might fail. However, using additional threshold detectors now allows us to improve the entanglement generation rate by almost orders of magnitude, at a nominal distance of 1000 km, compared to schemes that rely on conventional BSMs. This improvement is sufficient to make the performance of our scheme comparable to the expected performance of some deterministic quantum repeaters.

  1. Collaborative work on evaluation of ovarian toxicity. 2) Two- or four-week repeated dose studies and fertility study of mifepristone in female rats.

    Science.gov (United States)

    Tamura, Toru; Yokoi, Ryohei; Okuhara, Yuji; Harada, Chiho; Terashima, Yukari; Hayashi, Morimichi; Nagasawa, Tatsuya; Onozato, Tomoya; Kobayashi, Kazuo; Kuroda, Junji; Kusama, Hiroshi

    2009-01-01

    In order to assess ovarian pathological changes and their relationship to changes in female fertility parameters, mifepristone, a progesterone receptor antagonist, was selected as the test article and was administered orally to female rats at dose levels of 0, 0.8, 4, 20 and 100 mg/kg for 2 or 4 weeks in repeated dose-toxicity studies and in a female fertility study at dose levels of 0, 0.8, 4 and 20 mg/kg from > 2 weeks before copulation to postcoital day 7. In the repeated dose toxicity studies, persistent estrus was seen in the vaginal smears, and multiple cysts in the ovaries at necropsy, increases in luteinized cysts and hypertrophy of previously formed corpora lutea were observed in the histopathological examination of ovaries in rats receiving 20 mg/kg or more for 2 or 4 weeks. In female fertility studies, persistent vaginal cornification was also observed at 20 mg/kg and the precoital interval was significantly shortened. All of the animals were completely infertile when dosed with 20 mg/kg during the post-coital period. An increase in pre-implantation losses was observed in the animals treated with 20 mg/kg during the pre-coital phase, while treatment with 4 mg/kg mifepristone during the post-coital phase induced an increase in post-implantation losses. These results suggested that a 2-week administration period would be sufficient to detect the ovarian toxicity of mifepristone in repeated dose toxicity study and the pathological findings in the ovaries would reflect the alterations in female reproductive endpoints in the female fertility study.

  2. Cumulative Culture and Future Thinking: Is Mental Time Travel a Prerequisite to Cumulative Cultural Evolution?

    Science.gov (United States)

    Vale, G. L.; Flynn, E. G.; Kendal, R. L.

    2012-01-01

    Cumulative culture denotes the, arguably, human capacity to build on the cultural behaviors of one's predecessors, allowing increases in cultural complexity to occur such that many of our cultural artifacts, products and technologies have progressed beyond what a single individual could invent alone. This process of cumulative cultural evolution…

  3. Inter-Simple Sequence Repeat (ISSR Markers to Study Genetic Diversity Among Cotton Cultivars in Associated with Salt Tolerance

    Directory of Open Access Journals (Sweden)

    Ali Akbar ABDI

    2012-11-01

    Full Text Available Developing salt-tolerant crops is very important as a significant proportion of cultivated land is salt-affected. Screening and selection of salt tolerant genotypes of cotton using DNA molecular markers not only introduce tolerant cultivars useful for hybridization and breeding programs but also detect DNA regions involved in mechanism of salinity tolerance. To study this, 28 cotton cultivars, including 8 Iranian cotton varieties were grown in pots under greenhouse condition and three salt treatments were imposed with salt solutions (0, 70 and 140 mM NaCl. Eight agronomic traits including root length, root fresh weight, root dry weight, chlorophyll and fluorescence index, K+ and Na+ contents in shoot (above ground biomass, and K+/Na+ ratio were measured. Cluster analysis of cultivars based on measured agronomic traits, showed �Cindose� and �Ciacra� as the most tolerant cultivars, and �B-557� and �43347� as the most sensitive cultivars of salt damage. A total of 65 polymorphic DNA fragments were generated at 14 inter-simple sequence repeat (ISSR loci. Plants of 28 cultivars of cotton grouped into three clusters based on ISSR markers. Regression analysis of markers in relation with traits data showed that 23, 33 and 30 markers associated with the measured traits in three salt treatments respectively. These markers might help breeders in any marker assisted selection program in order to improving cotton cultivars against salt stress.

  4. Are diagnostic criteria for acute malnutrition affected by hydration status in hospitalized children? A repeated measures study

    Directory of Open Access Journals (Sweden)

    Fegan Gregory

    2011-09-01

    Full Text Available Abstract Introduction Dehydration and malnutrition commonly occur together among ill children in developing countries. Dehydration (change in total body water is known to alter weight. Although muscle tissue has high water content, it is not known whether mid-upper arm circumference (MUAC may be altered by changes in tissue hydration. We aimed to determine whether rehydration alters MUAC, MUAC Z score (MUACz, weight-for-length Z-score (WFLz and classification of nutritional status among hospitalised Kenyan children admitted with signs of dehydration. Study procedure We enrolled children aged from 3 months to 5 years admitted to a rural Kenyan district hospital with clinical signs compatible with dehydration, and without kwashiorkor. Anthropometric measurements were taken at admission and repeated after 48 hours of treatment, which included rehydration by WHO protocols. Changes in weight observed during this period were considered to be due to changes in hydration status. Results Among 325 children (median age 11 months the median weight gain (rehydration after 48 hours was 0.21 kg, (an increase of 2.9% of admission body weight. Each 1% change in weight was associated with a 0.40 mm (95% CI: 0.30 to 0.44 mm, p Conclusion MUAC is less affected by dehydration than WFLz and is therefore more suitable for nutritional assessment of ill children. However, both WFLz and MUAC misclassify SAM among dehydrated children. Nutritional status should be re-evaluated following rehydration, and management adjusted accordingly.

  5. A Study for the Characteristic Changes Under the Repeated Thermal Exposure in the Process of Repairing Aircraft Sandwich Structures

    Science.gov (United States)

    Kim, Yun Hae; Han, Joong Won; Kim, Don Won; Choi, Byung Keun; Murakami, R.

    Delamination can be observed in the sound areas during and/or after a couple times exposure to the elevated curing temperature due to the repeated repair condition. This study was conducted for checking the degree of degradation of properties of the cured parts and delamination between skin prepreg and honeycomb core. Specimens with glass honeycomb sandwich construction and glass/epoxy prepreg were prepared. The specimens were cured 1 to 5 times at 260°F in an autoclave and each additionally exposed 50, 100 and 150 hours in the 260°F oven. Each specimen was tested for tensile strength, compressive strength, flatwise tensile strength and interlaminar shear strength. To monitor the characteristics of the resin itself, the cured resin was tested using DMA and DSC. As a results, the decrease of Tg value were observed in the specific specimen which is exposed over 50 hrs at 260°F. This means the change or degradative of resin properties is also related to the decrease of flatwise tensile properties. Accordingly, minimal exposure on the curing temperature is recommended for parts in order to prevent the delation and maintain the better condition.

  6. Public perception of drinking water safety in South Africa 2002–2009: a repeated cross-sectional study

    Directory of Open Access Journals (Sweden)

    Wright Jim A

    2012-07-01

    Full Text Available Abstract Background In low and middle income countries, public perceptions of drinking water safety are relevant to promotion of household water treatment and to household choices over drinking water sources. However, most studies of this topic have been cross-sectional and not considered temporal variation in drinking water safety perceptions. The objective of this study is to explore trends in perceived drinking water safety in South Africa and its association with disease outbreaks, water supply and household characteristics. Methods This repeated cross-sectional study draws on General Household Surveys from 2002–2009, a series of annual nationally representative surveys of South African households, which include a question about perceived drinking water safety. Trends in responses to this question were examined from 2002–2009 in relation to reported cholera cases. The relationship between perceived drinking water safety and organoleptic qualities of drinking water, supply characteristics, and socio-economic and demographic household characteristics was explored in 2002 and 2008 using hierarchical stepwise logistic regression. Results The results suggest that perceived drinking water safety has remained relatively stable over time in South Africa, once the expansion of improved supplies is controlled for. A large cholera outbreak in 2000–02 had no apparent effect on public perception of drinking water safety in 2002. Perceived drinking water safety is primarily related to water taste, odour, and clarity rather than socio-economic or demographic characteristics. Conclusion This suggests that household perceptions of drinking water safety in South Africa follow similar patterns to those observed in studies in developed countries. The stability over time in public perception of drinking water safety is particularly surprising, given the large cholera outbreak that took place at the start of this period.

  7. Radiologic imaging in cystic fibrosis: cumulative effective dose and changing trends over 2 decades.

    LENUS (Irish Health Repository)

    O'Connell, Oisin J

    2012-06-01

    With the increasing life expectancy for patients with cystic fibrosis (CF), and a known predisposition to certain cancers, cumulative radiation exposure from radiologic imaging is of increasing significance. This study explores the estimated cumulative effective radiation dose over a 17-year period from radiologic procedures and changing trends of imaging modalities over this period.

  8. Aging and Cumulative Inequality: How Does Inequality Get Under the Skin?

    Science.gov (United States)

    Ferraro, Kenneth F.; Shippee, Tetyana Pylypiv

    2009-01-01

    Purpose: This article draws from cumulative disadvantage and life course theories to develop a new theory for the social scientific study of aging. Design and Methods: Five axioms of "cumulative inequality (CI) theory" are articulated to identify how life course trajectories are influenced by early and accumulated inequalities but can be modified…

  9. Contributions by the CAG-repeat Polymorphism of the Androgen Receptor Gene and Circulating Androgens to Muscle Size. Odense Androgen Study - A Population-based Study of 20-29 Year-old Danish Men

    DEFF Research Database (Denmark)

    Nielsen, Torben Leo; Hagen, Claus; Wraae, Kristian;

    2007-01-01

    Context: The number of CAG-repeats within the CAG-repeat polymorphism of the androgen receptor gene is inversely correlated with the transcriptional activity of the androgen receptor. Objective: To study the effect of the CAG-repeat number and circulating androgens on muscle size, to examine......-repeat number correlated inversely with thigh and axial muscle area and with lower and upper extremity lean body mass. Except for upper extremity lean body mass, these findings remained significant in multivariate analyses controlling for circulating androgens, physical activity, smoking, alcohol intake...

  10. Cumulative Effect of Depression on Dementia Risk

    Directory of Open Access Journals (Sweden)

    J. Olazarán

    2013-01-01

    Full Text Available Objective. To analyze a potential cumulative effect of life-time depression on dementia and Alzheimer’s disease (AD, with control of vascular factors (VFs. Methods. This study was a subanalysis of the Neurological Disorders in Central Spain (NEDICES study. Past and present depression, VFs, dementia status, and dementia due to AD were documented at study inception. Dementia status was also documented after three years. Four groups were created according to baseline data: never depression (nD, past depression (pD, present depression (prD, and present and past depression (prpD. Logistic regression was used. Results. Data of 1,807 subjects were investigated at baseline (mean age 74.3, 59.3% women, and 1,376 (81.6% subjects were evaluated after three years. The prevalence of dementia at baseline was 6.7%, and dementia incidence was 6.3%. An effect of depression was observed on dementia prevalence (OR [CI 95%] 1.84 [1.01–3.35] for prD and 2.73 [1.08–6.87] for prpD, and on dementia due to AD (OR 1.98 [0.98–3.99] for prD and OR 3.98 [1.48–10.71] for prpD (fully adjusted models, nD as reference. Depression did not influence dementia incidence. Conclusions. Present depression and, particularly, present and past depression are associated with dementia at old age. Multiple mechanisms, including toxic effect of depression on hippocampal neurons, plausibly explain these associations.

  11. Repeated Insulin-like Growth Factor 1 (IGF1 treatment in a patient with Rett Syndrome: a single case study

    Directory of Open Access Journals (Sweden)

    Giorgio ePini

    2014-06-01

    Full Text Available Rett syndrome (RTT is a devastating neurodevelopmental disorder that has no cure. Patients show regression of acquired skills, motor and speech impairment, cardio-respiratory distress, microcephaly and stereotyped hand movements. The majority of RTT patients display mutations in the gene that codes for the Methyl-CpG binding protein 2 (MeCP2, which is involved in the development of the central nervous system, especially synaptic and circuit maturation. Thus, agents that promote brain development and synaptic function are good candidates for ameliorating the symptoms of RTT. In particular, Insulin-like growth Factor 1 (IGF1 and its active peptide (1-3IGF1 cross the Blood Brain Barrier, and therefore are ideal treatments for RTT Indeed, both (1-3IGF1 and IGF1 treatment significantly ameliorates RTT symptoms in a mouse model of the disease In a previous study we established that IGF1 is safe and well tolerated on Rett patients. In this open label clinical case study, we assess the safety and tolerability of IGF1 administration in two cycles of the treatment. Before and after each cycle we monitored the clinical and blood parameters, autonomic function and social and cognitive abilities, and we found that IGF1 was well tolerated each time and did not induce any side effect, nor it interfered with the other treatments that the patient was undergoing. We noticed a moderate improvement in the cognitive, social and autonomic abilities of the patient after each cycle but the benefits were not retained between the two cycles, consistent with the preclinical observation that treatments for RTT should be administered through life. We find that repeated IGF1 treatment is safe and well tolerated in Rett patients but observed effects are not retained between cycles. These results have applications to other pathologies considering that IGF1 has been shown to be effective in other disorders of the autism spectrum.

  12. Repeated insulin-like growth factor 1 treatment in a patient with rett syndrome: a single case study.

    Science.gov (United States)

    Pini, Giorgio; Scusa, M Flora; Benincasa, Alberto; Bottiglioni, Ilaria; Congiu, Laura; Vadhatpour, Cyrus; Romanelli, Anna Maria; Gemo, Ilaria; Puccetti, Chetti; McNamara, Rachel; O'Leary, Seán; Corvin, Aiden; Gill, Michael; Tropea, Daniela

    2014-01-01

    Rett syndrome (RTT) is a devastating neurodevelopmental disorder that has no cure. Patients show regression of acquired skills, motor, and speech impairment, cardio-respiratory distress, microcephaly, and stereotyped hand movements. The majority of RTT patients display mutations in the gene that codes for the Methyl-CpG binding protein 2 (MeCP2), which is involved in the development of the central nervous system, especially synaptic and circuit maturation. Thus, agents that promote brain development and synaptic function are good candidates for ameliorating the symptoms of RTT. In particular, insulin-like growth factor 1 (IGF1) and its active peptide (1-3) IGF1 cross the Blood Brain Barrier, and therefore are ideal treatments for RTT Indeed, both (1-3) IGF1 and IGF1 treatment significantly ameliorates RTT symptoms in a mouse model of the disease In a previous study, we established that IGF1 is safe and well tolerated on Rett patients. In this open label clinical case study, we assess the safety and tolerability of IGF1 administration in two cycles of the treatment. Before and after each cycle, we monitored the clinical and blood parameters, autonomic function, and social and cognitive abilities, and we found that IGF1 was well tolerated each time and did not induce any side effect, nor it interfered with the other treatments that the patient was undergoing. We noticed a moderate improvement in the cognitive, social, and autonomic abilities of the patient after each cycle but the benefits were not retained between the two cycles, consistent with the pre-clinical observation that treatments for RTT should be administered through life. We find that repeated IGF1 treatment is safe and well tolerated in Rett patients but observed effects are not retained between cycles. These results have applications to other pathologies considering that IGF1 has been shown to be effective in other disorders of the autism spectrum.

  13. Intermediate CAG repeat expansion in the ATXN2 gene is a unique genetic risk factor for ALS--a systematic review and meta-analysis of observational studies.

    Directory of Open Access Journals (Sweden)

    Ming-Dong Wang

    Full Text Available Amyotrophic lateral sclerosis (ALS is a rare degenerative condition of the motor neurons. Over 10% of ALS cases are linked to monogenic mutations, with the remainder thought to be due to other risk factors, including environmental factors, genetic polymorphisms, and possibly gene-environmental interactions. We examined the association between ALS and an intermediate CAG repeat expansion in the ATXN2 gene using a meta-analytic approach. Observational studies were searched with relevant disease and gene terms from MEDLINE, EMBASE, and PsycINFO from January 2010 through to January 2014. All identified articles were screened using disease terms, gene terms, population information, and CAG repeat information according to PRISMA guidelines. The final list of 17 articles was further evaluated based on the study location, time period, and authors to exclude multiple usage of the same study populations: 13 relevant articles were retained for this study. The range 30-33 CAG repeats in the ATXN2 gene was most strongly associated with ALS. The meta-analysis revealed that the presence of an intermediate CAG repeat (30-33 in the ATXN2 gene was associated with an increased risk of ALS [odds ratio (OR = 4.44, 95%CI: 2.91-6.76] in Caucasian ALS patients. There was no significant difference in the association of this CAG intermediate repeat expansion in the ATXN2 gene between familial ALS cases (OR = 3.59, 1.58-8.17 and sporadic ALS cases (OR = 3.16, 1.88-5.32. These results indicate that the presence of intermediate CAG repeat expansion in the ATXN2 gene is a specific genetic risk factor for ALS, unlike monogenic mutations with an autosomal dominant transmission mode, which cause a more severe phenotype of ALS, with a higher prevalence in familial ALS.

  14. Intermediate CAG repeat expansion in the ATXN2 gene is a unique genetic risk factor for ALS--a systematic review and meta-analysis of observational studies.

    Science.gov (United States)

    Wang, Ming-Dong; Gomes, James; Cashman, Neil R; Little, Julian; Krewski, Daniel

    2014-01-01

    Amyotrophic lateral sclerosis (ALS) is a rare degenerative condition of the motor neurons. Over 10% of ALS cases are linked to monogenic mutations, with the remainder thought to be due to other risk factors, including environmental factors, genetic polymorphisms, and possibly gene-environmental interactions. We examined the association between ALS and an intermediate CAG repeat expansion in the ATXN2 gene using a meta-analytic approach. Observational studies were searched with relevant disease and gene terms from MEDLINE, EMBASE, and PsycINFO from January 2010 through to January 2014. All identified articles were screened using disease terms, gene terms, population information, and CAG repeat information according to PRISMA guidelines. The final list of 17 articles was further evaluated based on the study location, time period, and authors to exclude multiple usage of the same study populations: 13 relevant articles were retained for this study. The range 30-33 CAG repeats in the ATXN2 gene was most strongly associated with ALS. The meta-analysis revealed that the presence of an intermediate CAG repeat (30-33) in the ATXN2 gene was associated with an increased risk of ALS [odds ratio (OR) = 4.44, 95%CI: 2.91-6.76)] in Caucasian ALS patients. There was no significant difference in the association of this CAG intermediate repeat expansion in the ATXN2 gene between familial ALS cases (OR = 3.59, 1.58-8.17) and sporadic ALS cases (OR = 3.16, 1.88-5.32). These results indicate that the presence of intermediate CAG repeat expansion in the ATXN2 gene is a specific genetic risk factor for ALS, unlike monogenic mutations with an autosomal dominant transmission mode, which cause a more severe phenotype of ALS, with a higher prevalence in familial ALS.

  15. Is cumulated pyrethroid exposure associated with prediabetes?

    DEFF Research Database (Denmark)

    Hansen, Martin Rune; Jørs, Erik; Lander, Flemming;

    2014-01-01

    , cumulative exposure) was assessed from questionnaire data. Participants were asked about symptoms of diabetes. Blood samples were analyzed for glycosylated hemoglobin (HbA1c), a measure of glucose regulation. No association was found between pyrethroid exposure and diabetes symptoms. The prevalence...

  16. Cumulative Disadvantage among the Highly Ambitious.

    Science.gov (United States)

    McClelland, Katherine

    1990-01-01

    Using a social reproduction theory framework, analyzes the process by which high school seniors aspiring to high-level positions are sorted out after graduation. Analyzes early educational attainments and changes in occupational expectations. Shows a process of cumulative disadvantage in which White males are more likely to achieve their goals.…

  17. Pavlovian conditioning and cumulative reinforcement rate.

    Science.gov (United States)

    Harris, Justin A; Patterson, Angela E; Gharaei, Saba

    2015-04-01

    In 5 experiments using delay conditioning of magazine approach with rats, reinforcement rate was varied either by manipulating the mean interval between onset of the conditioned stimulus (CS) and unconditioned stimulus (US) or by manipulating the proportion of CS presentations that ended with the US (trial-based reinforcement rate). Both manipulations influenced the acquisition of responding. In each experiment, a specific comparison was made between 2 CSs that differed in their mean CS-US interval and in their trial-based reinforcement rate, such that the cumulative reinforcement rate-the cumulative duration of the CS between reinforcements-was the same for the 2 CSs. For example, a CS reinforced on 100% of trials with a mean CS-US interval of 60 s was compared with a CS reinforced on 33% of trials and a mean duration of 20 s. Across the 5 experiments, conditioning was virtually identical for the 2 CSs with matched cumulative reinforcement rate. This was true as long as the timing of the US was unpredictable and, thus, response rates were uniform across the length of the CS. We conclude that the effects of CS-US interval and of trial-based reinforcement rate are reducible entirely to their common effect on cumulative reinforcement rate. We discuss the implications of this for rate-based, trial-based, and real-time associative models of conditioning.

  18. An Axiomatization of Cumulative Prospect Theory

    NARCIS (Netherlands)

    Wakker, P.P.; Tversky, A.

    1993-01-01

    This paper presents a method for axiomatizing a variety of models for decision making under uncertainty, including Expected Utility and Cumulative Prospect Theory. This method identifies, for each model, the situations that permit consistent inferences about the ordering of value differences. Exampl

  19. Cumulative Disadvantage among the Highly Ambitious.

    Science.gov (United States)

    McClelland, Katherine

    1990-01-01

    Using a social reproduction theory framework, analyzes the process by which high school seniors aspiring to high-level positions are sorted out after graduation. Analyzes early educational attainments and changes in occupational expectations. Shows a process of cumulative disadvantage in which White males are more likely to achieve their goals.…

  20. A review of the reporting and handling of missing data in cohort studies with repeated assessment of exposure measures

    Directory of Open Access Journals (Sweden)

    Karahalios Amalia

    2012-07-01

    Full Text Available Abstract Background Retaining participants in cohort studies with multiple follow-up waves is difficult. Commonly, researchers are faced with the problem of missing data, which may introduce biased results as well as a loss of statistical power and precision. The STROBE guidelines von Elm et al. (Lancet, 370:1453-1457, 2007; Vandenbroucke et al. (PLoS Med, 4:e297, 2007 and the guidelines proposed by Sterne et al. (BMJ, 338:b2393, 2009 recommend that cohort studies report on the amount of missing data, the reasons for non-participation and non-response, and the method used to handle missing data in the analyses. We have conducted a review of publications from cohort studies in order to document the reporting of missing data for exposure measures and to describe the statistical methods used to account for the missing data. Methods A systematic search of English language papers published from January 2000 to December 2009 was carried out in PubMed. Prospective cohort studies with a sample size greater than 1,000 that analysed data using repeated measures of exposure were included. Results Among the 82 papers meeting the inclusion criteria, only 35 (43% reported the amount of missing data according to the suggested guidelines. Sixty-eight papers (83% described how they dealt with missing data in the analysis. Most of the papers excluded participants with missing data and performed a complete-case analysis (n = 54, 66%. Other papers used more sophisticated methods including multiple imputation (n = 5 or fully Bayesian modeling (n = 1. Methods known to produce biased results were also used, for example, Last Observation Carried Forward (n = 7, the missing indicator method (n = 1, and mean value substitution (n = 3. For the remaining 14 papers, the method used to handle missing data in the analysis was not stated. Conclusions This review highlights the inconsistent reporting of missing data in cohort studies and the continuing

  1. A review of the reporting and handling of missing data in cohort studies with repeated assessment of exposure measures.

    Science.gov (United States)

    Karahalios, Amalia; Baglietto, Laura; Carlin, John B; English, Dallas R; Simpson, Julie A

    2012-07-11

    Retaining participants in cohort studies with multiple follow-up waves is difficult. Commonly, researchers are faced with the problem of missing data, which may introduce biased results as well as a loss of statistical power and precision. The STROBE guidelines von Elm et al. (Lancet, 370:1453-1457, 2007); Vandenbroucke et al. (PLoS Med, 4:e297, 2007) and the guidelines proposed by Sterne et al. (BMJ, 338:b2393, 2009) recommend that cohort studies report on the amount of missing data, the reasons for non-participation and non-response, and the method used to handle missing data in the analyses. We have conducted a review of publications from cohort studies in order to document the reporting of missing data for exposure measures and to describe the statistical methods used to account for the missing data. A systematic search of English language papers published from January 2000 to December 2009 was carried out in PubMed. Prospective cohort studies with a sample size greater than 1,000 that analysed data using repeated measures of exposure were included. Among the 82 papers meeting the inclusion criteria, only 35 (43%) reported the amount of missing data according to the suggested guidelines. Sixty-eight papers (83%) described how they dealt with missing data in the analysis. Most of the papers excluded participants with missing data and performed a complete-case analysis (n=54, 66%). Other papers used more sophisticated methods including multiple imputation (n=5) or fully Bayesian modeling (n=1). Methods known to produce biased results were also used, for example, Last Observation Carried Forward (n=7), the missing indicator method (n=1), and mean value substitution (n=3). For the remaining 14 papers, the method used to handle missing data in the analysis was not stated. This review highlights the inconsistent reporting of missing data in cohort studies and the continuing use of inappropriate methods to handle missing data in the analysis. Epidemiological journals

  2. Duct Leakage Repeatability Testing

    Energy Technology Data Exchange (ETDEWEB)

    Walker, Iain [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Sherman, Max [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2014-01-01

    Duct leakage often needs to be measured to demonstrate compliance with requirements or to determine energy or Indoor Air Quality (IAQ) impacts. Testing is often done using standards such as ASTM E1554 (ASTM 2013) or California Title 24 (California Energy Commission 2013 & 2013b), but there are several choices of methods available within the accepted standards. Determining which method to use or not use requires an evaluation of those methods in the context of the particular needs. Three factors that are important considerations are the cost of the measurement, the accuracy of the measurement and the repeatability of the measurement. The purpose of this report is to evaluate the repeatability of the three most significant measurement techniques using data from the literature and recently obtained field data. We will also briefly discuss the first two factors. The main question to be answered by this study is to determine if differences in the repeatability of these tests methods is sufficient to indicate that any of these methods is so poor that it should be excluded from consideration as an allowed procedure in codes and standards.

  3. Selection of body sway parameters according to their sensitivity and repeatability

    Directory of Open Access Journals (Sweden)

    Nejc Sarabon

    2010-03-01

    Full Text Available For the precise evaluation of body balance, static type of tests performed on a force plate are the most commonly used ones. In these tests, body sway characteristics are analyzed based on the model of inverted pendulum and looking at the center of pressure (COP movement in time. Human body engages different strategies to compensate for balance perturbations. For this reason, there is a need to identify parameters which are sensitive to specific balance changes and which enable us to identify balance sub-components. The aim of our study was to investigate intra-visit repeatability and sensibility of the 40 different body sway parameters. Twenty-nine subjects participated in the study. They performed three different balancing tasks of different levels of difficulty, three repetitions each. The hip-width parallel stance and the single leg stance, both with open eyes, were used as ways to compare different balance intensities due to biomechanical changes. Additionally, deprivation of vision was used in the third balance task to study sensitivity to sensory system changes. As shown by intraclass correlation coefficient (ICC, repeatability of cumulative parameters such as COP, maximal amplitude and frequency showed excellent repeatability (ICC>0,85. Other parameters describing sub-dynamics through single repetition proved to have unsatisfying repeatability. Parameters most sensitive to increased intensity of balancing tasks were common COP, COP in medio-lateral and in antero-posterior direction, and maximal amplitues in the same directions. Frequency of oscilations has proved to be sensitive only to deprivation of vision. As shown in our study, cumulative parameters describing the path which the center of pressure makes proved to be the most repeatable and sensitive to detect different increases of balancing tasks enabling future use in balance studies and in clinical practice.

  4. Origin and fate of repeats in bacteria.

    Science.gov (United States)

    Achaz, G; Rocha, E P C; Netter, P; Coissac, E

    2002-07-01

    We investigated 53 complete bacterial chromosomes for intrachromosomal repeats. In previous studies on eukaryote chromosomes, we proposed a model for the dynamics of repeats based on the continuous genesis of tandem repeats, followed by an active process of high deletion rate, counteracted by rearrangement events that may prevent the repeats from being deleted. The present study of long repeats in the genomes of Bacteria and Archaea suggests that our model of interspersed repeats dynamics may apply to them. Thus the duplication process might be a consequence of very ancient mechanisms shared by all three domains. Moreover, we show that there is a strong negative correlation between nucleotide composition bias and the repeat density of genomes. We hypothesise that in highly biased genomes, non-duplicated small repeats arise more frequently by random effects and are used as primers for duplication mechanisms, leading to a higher density of large repeats.

  5. ProtRepeatsDB: a database of amino acid repeats in genomes

    Directory of Open Access Journals (Sweden)

    Chauhan Virander S

    2006-07-01

    Full Text Available Abstract Background Genome wide and cross species comparisons of amino acid repeats is an intriguing problem in biology mainly due to the highly polymorphic nature and diverse functions of amino acid repeats. Innate protein repeats constitute vital functional and structural regions in proteins. Repeats are of great consequence in evolution of proteins, as evident from analysis of repeats in different organisms. In the post genomic era, availability of protein sequences encoded in different genomes provides a unique opportunity to perform large scale comparative studies of amino acid repeats. ProtRepeatsDB http://bioinfo.icgeb.res.in/repeats/ is a relational database of perfect and mismatch repeats, access to which is designed as a resource and collection of tools for detection and cross species comparisons of different types of amino acid repeats. Description ProtRepeatsDB (v1.2 consists of perfect as well as mismatch amino acid repeats in the protein sequences of 141 organisms, the genomes of which are now available. The web interface of ProtRepeatsDB consists of different tools to perform repeat s; based on protein IDs, organism name, repeat sequences, and keywords as in FASTA headers, size, frequency, gene ontology (GO annotation IDs and regular expressions (REGEXP describing repeats. These tools also allow formulation of a variety of simple, complex and logical queries to facilitate mining and large-scale cross-species comparisons of amino acid repeats. In addition to this, the database also contains sequence analysis tools to determine repeats in user input sequences. Conclusion ProtRepeatsDB is a multi-organism database of different types of amino acid repeats present in proteins. It integrates useful tools to perform genome wide queries for rapid screening and identification of amino acid repeats and facilitates comparative and evolutionary studies of the repeats. The database is useful for identification of species or organism specific

  6. Twenty-eight-day repeated inhalation toxicity study of nano-sized lanthanum oxide in male sprague-dawley rats.

    Science.gov (United States)

    Shin, Seo-Ho; Lim, Cheol-Hong; Kim, Yong-Soon; Lee, Yong-Hoon; Kim, Sung-Hwan; Kim, Jong-Choon

    2017-04-01

    Although the use of lanthanum has increased in field of high-tech industry worldwide, potential adverse effects to human health and to the environment are largely unknown. The present study aimed to investigate the potential toxicity of nano-sized lanthanum oxide (La2 O3 ) following repeated inhalation exposure in male Sprague-Dawley rats. Male rats were exposed nose-only to nano-sized La2 O3 for 28 days (5 days/week) at doses of 0, 0.5, 2.5, and 10 mg/m(3) . In the experimental period, we evaluated treatment-related changes including clinical signs, body weight, hematology, serum biochemistry, necropsy findings, organ weight, and histopathology findings. We also analyzed lanthanum distribution in the major organs and in the blood, bronchoalveolar lavage fluids (BALF), and oxidative stress in lung tissues. Lanthanum level was highest in lung tissues and showed a dose-dependent relation. Alveolar proteinosis was observed in all treatment groups and was accompanied by an increase in lung weight; moreover, lung inflammation was observed in the 2.5 mg/m(3) and higher dose groups and was accompanied by an increase in white blood cells. In the BALF, total cell counts including macrophages and neutrophils, lactate dehydrogenase, albumin, nitric oxide, and tumor necrosis factor-alpha increased significantly in all treatment groups. Furthermore, these changes tended to deteriorate in the 10 mg/m(3) group at the end of the recovery period. In the present experimental conditions, we found that the lowest-observed-adverse-effect level of nano-sized La2 O3 was 0.5 mg/m(3) in male rats, and the target organ was the lung. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 1226-1240, 2017. © 2016 Wiley Periodicals, Inc.

  7. [C-11]raclopride-PET studies of the Huntington's disease rate of progression : Relevance of the trinucleotide repeat length

    NARCIS (Netherlands)

    Antonini, A; Leenders, KL; Eidelberg, D

    1998-01-01

    We used [C-11]raclopride and positron emission tomography (PET) to assess the relationship between striatal dopamine D2 receptor binding, trinucleotide repeat number (GAG), and subject age in 10 asymptomatic and 8 symptomatic carriers of the Huntington's disease (HD) mutation. In both preclinical an

  8. Pharmacokinetic evaluation of pamidronate after oral administration: a study on dose proportionality, absolute bioavailability, and effect of repeated administration

    DEFF Research Database (Denmark)

    Hyldstrup, Lars; Flesch, G; Hauffe, S A

    1993-01-01

    30 minutes at constant infusion rate. Repeated peroral doses (75 and 150 mg) were administered to 12 females (aged 51-70 years) for 10 consecutive days. Urinary excretion of pamidronate after peroral and i.v. administration was used for estimation of pamidronate absorption. Renal excretion...

  9. Primary and Repeat Cesarean Deliveries: A Population-based Study in the United States, 1979-2010.

    Science.gov (United States)

    Ananth, Cande V; Friedman, Alexander M; Keyes, Katherine M; Lavery, Jessica A; Hamilton, Ava; Wright, Jason D

    2017-07-01

    Despite the temporal increase in cesarean deliveries, the extent to which maternal age, period, and maternal birth cohorts may have contributed to these trends remains unknown. We performed an analysis of 123 million singleton deliveries in the United States (1979-2010). We estimated rate ratio (RR) with 95% confidence interval (CI) for primary and repeat cesarean deliveries. We examined changes in cesarean rates with weighted Poisson regression models across three time-scales: maternal age, year of delivery, and birth cohort (mother's birth year). The primary cesarean rate increased by 68% (95% confidence interval [CI]: 67%, 69%) between 1979 (11.0%) and 2010 (18.5%). Repeat cesarean deliveries increased by 178% (95% CI: 176, 179) from 5.2% in 1979 to 14.4% in 2010. Cesarean rates increased with advancing age. Compared with 1979, the RR for the period effect in primary and repeat cesarean deliveries increased up to 1990, fell to a nadir at 1993, and began to rise thereafter. A small birth cohort effect was evident, with women born before 1950 at increased risk of primary cesarean; no cohort effect was seen for repeat cesarean deliveries. Adjustment for maternal BMI had a small effect on these findings. Period effects in primary cesarean were explained by a combination of trends in obesity and chronic hypertension, as well as demographic shifts over time. Maternal age and period appear to have important contributions to the temporal increase in the cesarean rates, although the effect of parity on these associations remains undetermined.

  10. A Cross-Sectional Study on the Perceptions and Practices of Teenagers With Inflammatory Bowel Disease About Repeated Stool Sampling

    NARCIS (Netherlands)

    Heida, Anke; Dijkstra, Alie; Dantuma, Sietske K.; van Rheenen, Patrick F.

    2016-01-01

    Purpose: Repeated stool sampling to monitor disease activity is increasingly used in teenagers with inflammatory bowel disease (IBD). Knowledge about their perceptions and practices regarding collection of feces will increase the success rate of this monitoring strategy. Methods: We sent a survey to

  11. Repeat Gamma Knife Radiosurgery for Trigeminal Neuralgia

    Energy Technology Data Exchange (ETDEWEB)

    Aubuchon, Adam C., E-mail: acaubuchon@gmail.com [Department of Radiation Oncology, Wake Forest University School of Medicine, Winston-Salem, NC (United States); Chan, Michael D. [Department of Radiation Oncology, Wake Forest University School of Medicine, Winston-Salem, NC (United States); Lovato, James F. [Department of Public Health Sciences, Wake Forest University School of Medicine, Winston-Salem, NC (United States); Balamucki, Christopher J. [Department of Radiation Oncology, University of Florida, Gainesville, FL (United States); Ellis, Thomas L.; Tatter, Stephen B. [Department of Neurosurgery, Wake Forest University School of Medicine, Winston-Salem, NC (United States); McMullen, Kevin P.; Munley, Michael T.; Deguzman, Allan F.; Ekstrand, Kenneth E.; Bourland, J. Daniel; Shaw, Edward G. [Department of Radiation Oncology, Wake Forest University School of Medicine, Winston-Salem, NC (United States)

    2011-11-15

    Purpose: Repeat gamma knife stereotactic radiosurgery (GKRS) for recurrent or persistent trigeminal neuralgia induces an additional response but at the expense of an increased incidence of facial numbness. The present series summarized the results of a repeat treatment series at Wake Forest University Baptist Medical Center, including a multivariate analysis of the data to identify the prognostic factors for treatment success and toxicity. Methods and Materials: Between January 1999 and December 2007, 37 patients underwent a second GKRS application because of treatment failure after a first GKRS treatment. The mean initial dose in the series was 87.3 Gy (range, 80-90). The mean retreatment dose was 84.4 Gy (range, 60-90). The dosimetric variables recorded included the dorsal root entry zone dose, pons surface dose, and dose to the distal nerve. Results: Of the 37 patients, 81% achieved a >50% pain relief response to repeat GKRS, and 57% experienced some form of trigeminal dysfunction after repeat GKRS. Two patients (5%) experienced clinically significant toxicity: one with bothersome numbness and one with corneal dryness requiring tarsorraphy. A dorsal root entry zone dose at repeat treatment of >26.6 Gy predicted for treatment success (61% vs. 32%, p = .0716). A cumulative dorsal root entry zone dose of >84.3 Gy (72% vs. 44%, p = .091) and a cumulative pons surface dose of >108.5 Gy (78% vs. 44%, p = .018) predicted for post-GKRS numbness. The presence of any post-GKRS numbness predicted for a >50% decrease in pain intensity (100% vs. 60%, p = .0015). Conclusion: Repeat GKRS is a viable treatment option for recurrent trigeminal neuralgia, although the patient assumes a greater risk of nerve dysfunction to achieve maximal pain relief.

  12. Cumulants of heat transfer across nonlinear quantum systems

    Science.gov (United States)

    Li, Huanan; Agarwalla, Bijay Kumar; Li, Baowen; Wang, Jian-Sheng

    2013-12-01

    We consider thermal conduction across a general nonlinear phononic junction. Based on two-time observation protocol and the nonequilibrium Green's function method, heat transfer in steady-state regimes is studied, and practical formulas for the calculation of the cumulant generating function are obtained. As an application, the general formalism is used to study anharmonic effects on fluctuation of steady-state heat transfer across a single-site junction with a quartic nonlinear on-site pinning potential. An explicit nonlinear modification to the cumulant generating function exact up to the first order is given, in which the Gallavotti-Cohen fluctuation symmetry is found still valid. Numerically a self-consistent procedure is introduced, which works well for strong nonlinearity.

  13. Repeated administration of D-amphetamine induces loss of [I-123]FP-CIT binding to striatal dopamine transporters in rat brain: a validation study

    NARCIS (Netherlands)

    J. Booij; K. de Bruin; W.B. Gunning

    2006-01-01

    In recent years, several PET and SPECT studies have shown loss of striatal dopamine transporter (DAT) binding in arnphetamine (AMPH) users. However, the use of DAT SPECT tracers to detect AMPH-induced changes in DAT binding has not been validated. We therefore examined if repeated administration of

  14. Prospective study on the determinants of repeat attendance and attendance patterns in breast cancer screening using the Theory of Planned Behaviour

    NARCIS (Netherlands)

    Drossaert, C.H.C.; Boer, H.; Seydel, E.R.

    2003-01-01

    This prospective study, using the Theory of Planned Behaviour (TPB) as a theoretical framework, was carried out to identify the determinants of repeat attendance and attendance patterns in organised breast screening. A group of 2657 women filled out a baseline questionnaire, approximately 8 weeks af

  15. Cumulative risk hypothesis: Predicting and preventing child maltreatment recidivism.

    Science.gov (United States)

    Solomon, David; Åsberg, Kia; Peer, Samuel; Prince, Gwendolyn

    2016-08-01

    Although Child Protective Services (CPS) and other child welfare agencies aim to prevent further maltreatment in cases of child abuse and neglect, recidivism is common. Having a better understanding of recidivism predictors could aid in preventing additional instances of maltreatment. A previous study identified two CPS interventions that predicted recidivism: psychotherapy for the parent, which was related to a reduced risk of recidivism, and temporary removal of the child from the parent's custody, which was related to an increased recidivism risk. However, counter to expectations, this previous study did not identify any other specific risk factors related to maltreatment recidivism. For the current study, it was hypothesized that (a) cumulative risk (i.e., the total number of risk factors) would significantly predict maltreatment recidivism above and beyond intervention variables in a sample of CPS case files and that (b) therapy for the parent would be related to a reduced likelihood of recidivism. Because it was believed that the relation between temporary removal of a child from the parent's custody and maltreatment recidivism is explained by cumulative risk, the study also hypothesized that that the relation between temporary removal of the child from the parent's custody and recidivism would be mediated by cumulative risk. After performing a hierarchical logistic regression analysis, the first two hypotheses were supported, and an additional predictor, psychotherapy for the child, also was related to reduced chances of recidivism. However, Hypothesis 3 was not supported, as risk did not significantly mediate the relation between temporary removal and recidivism.

  16. Automatization and familiarity in repeated checking

    NARCIS (Netherlands)

    Dek, Eliane C P; van den Hout, Marcel A.; Giele, Catharina L.; Engelhard, Iris M.

    2014-01-01

    Repeated checking paradoxically increases memory uncertainty. This study investigated the underlying mechanism of this effect. We hypothesized that as a result of repeated checking, familiarity with stimuli increases, and automatization of the checking procedure occurs, which should result in decrea

  17. Reported frequency of physical activity in a large epidemiological study: relationship to specific activities and repeatability over time

    Directory of Open Access Journals (Sweden)

    Reeves Gillian K

    2011-06-01

    Full Text Available Abstract Background How overall physical activity relates to specific activities and how reported activity changes over time may influence interpretation of observed associations between physical activity and health. We examine the relationships between various physical activities self-reported at different times in a large cohort study of middle-aged UK women. Methods At recruitment, Million Women Study participants completed a baseline questionnaire including questions on frequency of strenuous and of any physical activity. About 3 years later 589,896 women also completed a follow-up questionnaire reporting the hours they spent on a range of specific activities. Time spent on each activity was used to estimate the associated excess metabolic equivalent hours (MET-hours and this value was compared across categories of physical activity reported at recruitment. Additionally, 18,655 women completed the baseline questionnaire twice, at intervals of up to 4 years; repeatability over time was assessed using the weighted kappa coefficient (κweighted and absolute percentage agreement. Results The average number of hours per week women reported doing specific activities was 14.0 for housework, 4.5 for walking, 3.0 for gardening, 0.2 for cycling, and 1.4 for all strenuous activity. Time spent and the estimated excess MET-hours associated with each activity increased with increasing frequency of any or strenuous physical activity reported at baseline (tests for trend, P weighted = 0.71 for questionnaires administered less than 6 months apart, and 52% (κweighted = 0.51 for questionnaires more than 2 years apart. Corresponding values for any physical activity were 57% (κweighted = 0.67 and 47% (κweighted = 0.58. Conclusions In this cohort, responses to simple questions on the frequency of any physical activity and of strenuous activity asked at baseline were associated with hours spent on specific activities and the associated estimated excess MET

  18. Collaborative work on evaluation of ovarian toxicity. 17) Two- or four-week repeated-dose studies and fertility study of sulpiride in female rats.

    Science.gov (United States)

    Ishii, Shun-ichiro; Ube, Masayuki; Okada, Miyoko; Adachi, Tamiko; Sugimoto, Jiro; Inoue, Yoshimi; Uno, Yoshifumi; Mutai, Mamoru

    2009-01-01

    To find the appropriate dosing period to detect ovarian toxicity, sulpiride, a D2 antagonist was orally dosed to female rats at dose levels of 1, 10, and 100 mg/kg/day daily for 2 or 4 weeks in repeated-dose toxicity studies. In addition, sulpiride at the same dose levels was given to female rats daily during the pre-mating period, mating period, and Days 0-7 of gestation to assess its effect on fertility. In ovarian histology in the 2-week study, increases in atretic follicle were seen at 1 mg/kg or more and increases in follicular cysts at 10 mg/kg or more. In the 4-week study, these findings were seen at 1 mg/kg or more, and a decrease in large follicles was seen at 10 mg/kg or more. Increased body weight gain was observed at 10 mg/kg or more in the 2- and 4-week studies. The females in these groups exhibited development of mammary alveolus by sulpiride-induced hyperprolactinemia. In the fertility study, sulpiride-treated females showing persistent diestrus resulted in successful mating, and almost all females got pregnant. However, increased implantation loss was observed at 10 mg/kg or more, which was considered to be caused by the adverse effect of sulpiride on oocyte development. From these results, sulpiride-induced ovarian toxicity was seen at 1 mg/kg or more in the 2- and 4-week repeated-dose toxicity studies, and the observed ovarian changes were considered to be related to adverse effects on female fertility.

  19. Experience of cumulative effects assessment in the UK

    Directory of Open Access Journals (Sweden)

    Piper Jake

    2004-01-01

    Full Text Available Cumulative effects assessment (CEA is a development of environmental impact assessment which attempts to take into account the wider picture of what impacts may affect the environment as a result of either multiple or linear projects, or development plans. CEA is seen as a further valuable tool in promoting sustainable development. The broader canvas upon which the assessment is made leads to a suite of issues such as complexity in methods and assessment of significance, the desirability of co-operation between developers and other parties, new ways of addressing mitigation and monitoring. After outlining the legislative position and the process of CEA, this paper looks at three cases studies in the UK where cumulative assessment has been carried out - the cases concern wind farms, major infrastructure and off-shore developments.

  20. Complexity and demographic explanations of cumulative culture.

    Directory of Open Access Journals (Sweden)

    Adrien Querbes

    Full Text Available Formal models have linked prehistoric and historical instances of technological change (e.g., the Upper Paleolithic transition, cultural loss in Holocene Tasmania, scientific progress since the late nineteenth century to demographic change. According to these models, cumulation of technological complexity is inhibited by decreasing--while favoured by increasing--population levels. Here we show that these findings are contingent on how complexity is defined: demography plays a much more limited role in sustaining cumulative culture in case formal models deploy Herbert Simon's definition of complexity rather than the particular definitions of complexity hitherto assumed. Given that currently available empirical evidence doesn't afford discriminating proper from improper definitions of complexity, our robustness analyses put into question the force of recent demographic explanations of particular episodes of cultural change.

  1. Avoiding Program-Induced Cumulative Overload (PICO).

    Science.gov (United States)

    Orr, Robin; Knapik, Joseph J; Pope, Rodney

    2016-01-01

    This article defines the concept of program-induced cumulative overload (PICO), provides examples, and advises ways to mitigate the adverse effects. PICO is the excessive cumulative physical workload that can be imparted to military personnel by a military training program with an embedded physical training component. PICO can be acute (accumulating within a single day) or chronic (accumulating across the entirety of the program) and results in adverse outcomes for affected personnel, including detrimental fatigue, performance degradation, injuries, or illness. Strategies to mitigate PICO include focusing administration and logistic practices during the development and ongoing management of a trainee program and implementing known musculoskeletal injury prevention strategies. More training is not always better, and trainers need to consider the total amount of physical activity that military personnel experience across both operational training and physical training if PICO is to be mitigated.

  2. Sharing a quota on cumulative carbon emissions

    Science.gov (United States)

    Raupach, Michael R.; Davis, Steven J.; Peters, Glen P.; Andrew, Robbie M.; Canadell, Josep G.; Ciais, Philippe; Friedlingstein, Pierre; Jotzo, Frank; van Vuuren, Detlef P.; Le Quéré, Corinne

    2014-10-01

    Any limit on future global warming is associated with a quota on cumulative global CO2 emissions. We translate this global carbon quota to regional and national scales, on a spectrum of sharing principles that extends from continuation of the present distribution of emissions to an equal per-capita distribution of cumulative emissions. A blend of these endpoints emerges as the most viable option. For a carbon quota consistent with a 2 °C warming limit (relative to pre-industrial levels), the necessary long-term mitigation rates are very challenging (typically over 5% per year), both because of strong limits on future emissions from the global carbon quota and also the likely short-term persistence in emissions growth in many regions.

  3. Cumulative carbon emissions and the Green Paradox

    OpenAIRE

    Ploeg, Frederick Van der

    2013-01-01

    The green paradox states that a gradually more ambitious climate policy such as a renewables subsidy or an anticipated carbon tax induces fossil fuel owners to extract more rapidly and accelerate global warming. However, if extraction becomes more costly as reserves are depleted, such policies also shorten the fossil fuel era, induce more fossil fuel to be left in the earth, and thus curb cumulative carbon emissions. These consequences are relevant, as global warming depends primarily on cumu...

  4. Statistical Methods for Estimating the Cumulative Risk of Screening Mammography Outcomes

    NARCIS (Netherlands)

    Hubbard, R.A.; Ripping, T.M.; Chubak, J.; Broeders, M.J.; Miglioretti, D.L.

    2016-01-01

    BACKGROUND: This study illustrates alternative statistical methods for estimating cumulative risk of screening mammography outcomes in longitudinal studies. METHODS: Data from the US Breast Cancer Surveillance Consortium (BCSC) and the Nijmegen Breast Cancer Screening Program in the Netherlands were

  5. Expansive Soil Crack Depth under Cumulative Damage

    Directory of Open Access Journals (Sweden)

    Bei-xiao Shi

    2014-01-01

    Full Text Available The crack developing depth is a key problem to slope stability of the expansive soil and its project governance and the crack appears under the roles of dry-wet cycle and gradually develops. It is believed from the analysis that, because of its own cohesion, the expansive soil will have a certain amount of deformation under pulling stress but without cracks. The soil body will crack only when the deformation exceeds the ultimate tensile strain that causes cracks. And it is also believed that, due to the combined effect of various environmental factors, particularly changes of the internal water content, the inherent basic physical properties of expansive soil are weakened, and irreversible cumulative damages are eventually formed, resulting in the development of expansive soil cracks in depth. Starting from the perspective of volumetric strain that is caused by water loss, considering the influences of water loss rate and dry-wet cycle on crack developing depth, the crack developing depth calculation model which considers the water loss rate and the cumulative damages is established. Both the proposal of water loss rate and the application of cumulative damage theory to the expansive soil crack development problems try to avoid difficulties in matrix suction measurement, which will surely play a good role in promoting and improving the research of unsaturated expansive soil.

  6. EPA Workshop on Epigenetics and Cumulative Risk ...

    Science.gov (United States)

    Agenda Download the Workshop Agenda (PDF) The workshop included presentations and discussions by scientific experts pertaining to three topics (i.e., epigenetic changes associated with diverse stressors, key science considerations in understanding epigenetic changes, and practical application of epigenetic tools to address cumulative risks from environmental stressors), to address several questions under each topic, and included an opportunity for attendees to participate in break-out groups, provide comments and ask questions. Workshop Goals The workshop seeks to examine the opportunity for use of aggregate epigenetic change as an indicator in cumulative risk assessment for populations exposed to multiple stressors that affect epigenetic status. Epigenetic changes are specific molecular changes around DNA that alter expression of genes. Epigenetic changes include DNA methylation, formation of histone adducts, and changes in micro RNAs. Research today indicates that epigenetic changes are involved in many chronic diseases (cancer, cardiovascular disease, obesity, diabetes, mental health disorders, and asthma). Research has also linked a wide range of stressors including pollution and social factors with occurrence of epigenetic alterations. Epigenetic changes have the potential to reflect impacts of risk factors across multiple stages of life. Only recently receiving attention is the nexus between the factors of cumulative exposure to environmental

  7. Seasonal climate change patterns due to cumulative CO2 emissions

    Science.gov (United States)

    Partanen, Antti-Ilari; Leduc, Martin; Damon Matthews, H.

    2017-07-01

    Cumulative CO2 emissions are near linearly related to both global and regional changes in annual-mean surface temperature. These relationships are known as the transient climate response to cumulative CO2 emissions (TCRE) and the regional TCRE (RTCRE), and have been shown to remain approximately constant over a wide range of cumulative emissions. Here, we assessed how well this relationship holds for seasonal patterns of temperature change, as well as for annual-mean and seasonal precipitation patterns. We analyzed an idealized scenario with CO2 concentration growing at an annual rate of 1% using data from 12 Earth system models from the Coupled Model Intercomparison Project Phase 5 (CMIP5). Seasonal RTCRE values for temperature varied considerably, with the highest seasonal variation evident in the Arctic, where RTCRE was about 5.5 °C per Tt C for boreal winter and about 2.0 °C per Tt C for boreal summer. Also the precipitation response in the Arctic during boreal winter was stronger than during other seasons. We found that emission-normalized seasonal patterns of temperature change were relatively robust with respect to time, though they were sub-linear with respect to emissions particularly near the Arctic. Moreover, RTCRE patterns for precipitation could not be quantified robustly due to the large internal variability of precipitation. Our results suggest that cumulative CO2 emissions are a useful metric to predict regional and seasonal changes in precipitation and temperature. This extension of the TCRE framework to seasonal and regional climate change is helpful for communicating the link between emissions and climate change to policy-makers and the general public, and is well-suited for impact studies that could make use of estimated regional-scale climate changes that are consistent with the carbon budgets associated with global temperature targets.

  8. Finite-volume cumulant expansion in QCD-colorless plasma

    Energy Technology Data Exchange (ETDEWEB)

    Ladrem, M. [Taibah University, Physics Department, Faculty of Science, Al-Madinah, Al-Munawwarah (Saudi Arabia); Physics Department, Algiers (Algeria); ENS-Vieux Kouba (Bachir El-Ibrahimi), Laboratoire de Physique et de Mathematiques Appliquees (LPMA), Algiers (Algeria); Ahmed, M.A.A. [Taibah University, Physics Department, Faculty of Science, Al-Madinah, Al-Munawwarah (Saudi Arabia); ENS-Vieux Kouba (Bachir El-Ibrahimi), Laboratoire de Physique et de Mathematiques Appliquees (LPMA), Algiers (Algeria); Taiz University in Turba, Physics Department, Taiz (Yemen); Alfull, Z.Z. [Taibah University, Physics Department, Faculty of Science, Al-Madinah, Al-Munawwarah (Saudi Arabia); Cherif, S. [ENS-Vieux Kouba (Bachir El-Ibrahimi), Laboratoire de Physique et de Mathematiques Appliquees (LPMA), Algiers (Algeria); Ghardaia University, Sciences and Technologies Department, Ghardaia (Algeria)

    2015-09-15

    Due to the finite-size effects, the localization of the phase transition in finite systems and the determination of its order, become an extremely difficult task, even in the simplest known cases. In order to identify and locate the finite-volume transition point T{sub 0}(V) of the QCD deconfinement phase transition to a colorless QGP, we have developed a new approach using the finite-size cumulant expansion of the order parameter and the L{sub mn}-method. The first six cumulants C{sub 1,2,3,4,5,6} with the corresponding under-normalized ratios (skewness Σ, kurtosis κ, pentosis Π{sub ±}, and hexosis H{sub 1,2,3}) and three unnormalized combinations of them, (O = σ{sup 2}κΣ{sup -1},U = σ{sup -2}Σ{sup -1},N = σ{sup 2}κ) are calculated and studied as functions of (T, V). A new approach, unifying in a clear and consistent way the definitions of cumulant ratios, is proposed.Anumerical FSS analysis of the obtained results has allowed us to locate accurately the finite-volume transition point. The extracted transition temperature value T{sub 0}(V) agrees with that expected T{sub 0}{sup N}(V) from the order parameter and the thermal susceptibility χ{sub T} (T, V), according to the standard procedure of localization to within about 2%. In addition to this, a very good correlation factor is obtained proving the validity of our cumulants method. The agreement of our results with those obtained by means of other models is remarkable. (orig.)

  9. Beverage Intake Assessment Questionnaire: Relative Validity and Repeatability in a Spanish Population with Metabolic Syndrome from the PREDIMED-PLUS Study

    Science.gov (United States)

    Ferreira-Pêgo, Cíntia; Nissensohn, Mariela; Kavouras, Stavros A.; Babio, Nancy; Serra-Majem, Lluís; Martín Águila, Adys; Mauromoustakos, Andy; Álvarez Pérez, Jacqueline; Salas-Salvadó, Jordi

    2016-01-01

    We assess the repeatability and relative validity of a Spanish beverage intake questionnaire for assessing water intake from beverages. The present analysis was performed within the framework of the PREDIMED-PLUS trial. The study participants were adults (aged 55–75) with a BMI ≥27 and <40 kg/m2, and at least three components of Metabolic Syndrome (MetS). A trained dietitian completed the questionnaire. Participants provided 24-h urine samples, and the volume and urine osmolality were recorded. The repeatability of the baseline measurement at 6 and 1 year was examined by paired Student’s t-test comparisons. A total of 160 participants were included in the analysis. The Bland–Altman analysis showed relatively good agreement between total daily fluid intake assessed using the fluid-specific questionnaire, and urine osmolality and 24-h volume with parameter estimates of −0.65 and 0.22, respectively (R2 = 0.20; p < 0.001). In the repeatability test, no significant differences were found between neither type of beverage nor total daily fluid intake at 6 months and 1-year assessment, compared to baseline. The proposed fluid-specific assessment questionnaire designed to assess the consumption of water and other beverages in Spanish adult individuals was found to be relatively valid with good repeatability. PMID:27483318

  10. Finite Volume Cumulant Expansion in QCD-Colorless Plasma

    CERN Document Server

    Ladrem, M; Al-Full, Z; Cherif, S

    2015-01-01

    Due to the finite size effects, the localisation of the phase transition in finite systems and the determination of its order, become an extremely difficult task, even in the simplest known cases. In order to identify and locate the finite volume transition point $T_{0}(V)$ of the QCD deconfinement phase transition to a Colorless QGP, we have developed a new approach using the finite size cumulant expansion of the order parameter and the $L_{mn}$-method. The first six cumulants $C_{1,2,3,4,5,6}$ with the corresponding under-normalized ratios(skewness $\\Sigma$, kurtosis $\\kappa$ ,pentosis $\\Pi_{\\pm}$ and hexosis $\\mathcal{H}_{1,2,3}$) and three unnormalized combinations of them ($\\mathcal{O}={\\mathcal{\\sigma }^{2} \\mathcal{\\kappa } }{\\mathbf{\\Sigma }^{-1} }$, $\\mathcal{U} ={\\mathcal{\\sigma }^{-2} \\mathbf{\\Sigma }^{-1} }$, $\\mathcal{N} = \\mathcal{\\sigma }^{2} \\mathcal{\\kappa }$) are calculated and studied as functions of $(T,V)$. A new approach, unifying in a clear and consistent way the definitions of cumulant...

  11. TU-AB-BRA-05: Repeatability of [F-18]-NaF PET Imaging Biomarkers for Bone Lesions: A Multicenter Study

    Energy Technology Data Exchange (ETDEWEB)

    Lin, C; Bradshaw, T; Perk, T; Harmon, S; Jeraj, R [University of Wisconsin - Madison, School of Medicine and Public Health, Madison, WI (United States); Liu, G

    2015-06-15

    Purpose: Quantifying the repeatability of imaging biomarkers is critical for assessing therapeutic response. While therapeutic efficacy has been traditionally quantified by SUV metrics, imaging texture features have shown potential for use as quantitative biomarkers. In this study we evaluated the repeatability of quantitative {sup 18}F-NaF PET-derived SUV metrics and texture features in bone lesions from patients in a multicenter study. Methods: Twenty-nine metastatic castrate-resistant prostate cancer patients received whole-body test-retest NaF PET/CT scans from one of three harmonized imaging centers. Bone lesions of volume greater than 1.5 cm{sup 3} were identified and automatically segmented using a SUV>15 threshold. From each lesion, 55 NaF PET-derived texture features (including first-order, co-occurrence, grey-level run-length, neighbor gray-level, and neighbor gray-tone difference matrix) were extracted. The test-retest repeatability of each SUV metric and texture feature was assessed with Bland-Altman analysis. Results: A total of 315 bone lesions were evaluated. Of the traditional SUV metrics, the repeatability coefficient (RC) was 12.6 SUV for SUVmax, 2.5 SUV for SUVmean, and 4.3 cm{sup 3} for volume. Their respective intralesion coefficients of variation (COVs) were 12%, 17%, and 6%. Of the texture features, COV was lowest for entropy (0.03%) and highest for kurtosis (105%). Lesion intraclass correlation coefficient (ICC) was lowest for maximum correlation coefficient (ICC=0.848), and highest for entropy (ICC=0.985). Across imaging centers, repeatability of texture features and SUV varied. For example, across imaging centers, COV for SUVmax ranged between 11–23%. Conclusion: Many NaF PET-derived SUV metrics and texture features for bone lesions demonstrated high repeatability, such as SUVmax, entropy, and volume. Several imaging texture features demonstrated poor repeatability, such as SUVtotal and SUVstd. These results can be used to establish

  12. Effects of repeatability measures on results of fMRI sICA: a study on simulated and real resting-state effects.

    Science.gov (United States)

    Remes, Jukka J; Starck, Tuomo; Nikkinen, Juha; Ollila, Esa; Beckmann, Christian F; Tervonen, Osmo; Kiviniemi, Vesa; Silven, Olli

    2011-05-15

    Spatial independent components analysis (sICA) has become a widely applied data-driven method for fMRI data, especially for resting-state studies. These sICA approaches are often based on iterative estimation algorithms and there are concerns about accuracy due to noise. Repeatability measures such as ICASSO, RAICAR and ARABICA have been introduced as remedies but information on their effects on estimates is limited. The contribution of this study was to provide more of such information and test if the repeatability analyses are necessary. We compared FastICA-based ordinary and repeatability approaches concerning mixing vector estimates. Comparisons included original FastICA, FSL4 Melodic FastICA and original and modified ICASSO. The effects of bootstrapping and convergence threshold were evaluated. The results show that there is only moderate improvement due to repeatability measures and only in the bootstrapping case. Bootstrapping attenuated power from time courses of resting-state network related ICs at frequencies higher than 0.1 Hz and made subsets of low frequency oscillations more emphasized IC-wise. The convergence threshold did not have a significant role concerning the accuracy of estimates. The performance results suggest that repeatability measures or strict converge criteria might not be needed in sICA analyses of fMRI data. Consequently, the results in existing sICA fMRI literature are probably valid in this sense. A decreased accuracy of original bootstrapping ICASSO was observed and corrected by using centrotype mixing estimates but the results warrant for thorough evaluations of data-driven methods in general. Also, given the fMRI-specific considerations, further development of sICA methods is strongly encouraged. Copyright © 2010 Elsevier Inc. All rights reserved.

  13. Analysis of tandem repeats in the genome of Chinese shrimp Fenneropenaeus chinensis

    Institute of Scientific and Technical Information of China (English)

    KONG Jie; GAO Huan

    2005-01-01

    Through random sequencing, we found a total of 884000 base-pairs (bp) of random genomic sequences in the genome of Chinese shrimp (Fenneropenaeus chinensis). Using bio-soft Tandem Repeat Finder (TRF) software, 2159 tandem repeats were found, in which there were 1714 microsatellites and 445 minisatellites, accounting for 79.4% and 20.6% of repeat sequences, respectively. The cumulative length of repeat sequences was found to be 116685 bp, accounting for 13.2% of the total DNA sequence; the cumulative length of microsatellites occupied 9.78% of the total DNA sequence, and that of minisatellites occupied 3.42%. In decreasing order, the 20 most abundant repeat sequence classes were as follows: AT (557), AC (471), AG (274), AAT (92), A (56), AAG (28), ATC (27), ATAG (27), AGG (18), ACT (15), C (11), AAC (11), ACAT (11), CAGA (10), AGAA (9), AGGG (7), CAAA (7), CGCA (6), ATAA (6), AGAGAA (6). Dinucleotide repeats, not only in the aspect of the number, but also in cumulative length, were the preponderant repeat type. There were few classes and low copy numbers of repeat units of the pentanucleotide repeat type, which included only three classes: AGAGA, GAGGC and AAAGA. The classes and copy numbers of heptanucleotide, eleven-nucleotide and thirteen-nucleotide primer-number-composed repeats were distinctly less than that of repeat types beside them.

  14. A study of the evolution of inverted-topology repeats from LeuT-fold transporters using AlignMe.

    Science.gov (United States)

    Khafizov, Kamil; Staritzbichler, René; Stamm, Marcus; Forrest, Lucy R

    2010-12-21

    X-ray crystal structures have revealed that numerous secondary transporter proteins originally categorized into different sequence families share similar structures, namely, the LeuT fold. The core of this fold consists of two units of five transmembrane helices, whose conformations have been proposed to exchange to form the two alternate states required for transport. That these two units are related implies that LeuT-like transporters evolved from gene-duplication and fusion events. Thus, the origins of this structural repeat may be relevant to the evolution of transport function. However, the lack of significant sequence similarity requires sensitive sequence search methods for analyzing their evolution. To this end, we developed a software application called AlignMe, which can use various types of input information, such as residue hydrophobicity, to perform pairwise alignments of sequences and/or of hydropathy profiles of (membrane) proteins. We used AlignMe to analyze the evolutionary relationships between repeats of the LeuT fold. In addition, we identified proteins from the so-called DedA family that potentially share a common ancestor with these repeats. DedA domains have been implicated in, e.g., selenite uptake; they are found widely distributed across all kingdoms of life; two or more DedA domains are typically found per genome, and some may adopt dual topologies. These results suggest that DedA proteins existed in ancient organisms and may function as dimers, as required for a would-be ancestor of the LeuT fold. In conclusion, we provide novel insights into the evolution of this important structural motif and thus potentially into the alternating-access mechanism of transport itself.

  15. Repeat-pulse 13CO2 labeling of canola and field pea: implications for soil organic matter studies.

    Science.gov (United States)

    Sangster, Amy; Knight, Diane; Farrell, Richard; Bedard-Haughn, Angela

    2010-10-15

    Both the quantity and quality of plant residues can impact soil properties and processes. Isotopic tracers can be used to trace plant residue decomposition if the tracer is homogeneously distributed throughout the plant. Continuous labeling will homogeneously label plants but is not widely accessible because elaborate equipment is needed. In order to determine if the more accessible repeat-pulse labeling method could be used to trace plant residue decomposition, this labeling procedure was employed using (13)CO(2) to enrich field pea and canola plants in a controlled environment. Plants were exposed weekly to pulses of 33 atom% (13)CO(2) and grown to maturity. The distribution of the label throughout the plant parts (roots, stem, leaves, and pod) and biochemical fractions (ADF and ADL) was determined. The label was not homogeneously distributed throughout the plant; in particular, the pod fractions were less enriched than other fractions indicating the importance of continuing labeling well into plant maturity for pod-producing plants. The ADL fraction was also less enriched than the ADF fraction. Because of the heterogeneity of the label throughout the plant, caution should be applied when using the repeat-pulse method to trace the fate of (13)C-labeled residues in the soil. However, root contributions to below-ground C were successfully determined from the repeat-pulse labeled root material, as was (13)C enrichment of soil within the top 15 cm. Canola contributed more above- and below-ground residue C than field pea; however, canola was also higher in ADF and ADL fractions indicating a more recalcitrant residue.

  16. Evaluation of a repeated dose liver micronucleus assay in rats treated with two genotoxic hepatocarcinogens, dimethylnitrosamine and 2-acetylaminofluorene: the possibility of integrating micronucleus tests with multiple tissues into a repeated dose general toxicity study.

    Science.gov (United States)

    Takashima, Rie; Takasawa, Hironao; Kawasako, Kazufumi; Ohyama, Wakako; Okada, Emiko; Narumi, Kazunori; Fujiishi, Yohei; Wako, Yumi; Yasunaga, Katsuaki; Hattori, Akiko; Kawabata, Masayoshi; Nakadate, Kiyoko; Nakagawa, Munehiro; Hamada, Shuichi

    2015-03-01

    As part of a collaborative study by the Collaborative Study Group for Micronucleus Test (CSGMT) of the Mammalian Mutagenicity Study Group (MMS) in the Japanese Environmental Mutagen Society (JEMS), the present study evaluated the effectiveness of the repeated dose liver micronucleus (RDLMN) assay. Two genotoxic hepatocarcinogens, dimethylnitrosamine (DMN) and 2-acetylaminofluorene (2-AAF), were administered orally to male rats (6 weeks old at the initial dosing) once daily for 14 and 28 days to evaluate the micronucleus (MN) inducibility in the liver. In addition, these chemicals were evaluated for MN inducibility in the bone marrow (BM) and gastrointestinal (GI) tract, i.e. glandular stomach and colon of the same animals used in the RDLMN assay. As a result, both chemicals produced positive results in the liver, although a weak positive response was given by 2-AAF. DMN gave negative results in the tissues other than the liver. 2-AAF produced positive responses in the BM and glandular stomach, and a prominent response was particularly observed in the glandular stomach, which is directly exposed to the test chemicals by gavage. The present results suggest that the RDLMN assay is a useful method for detecting genotoxic hepatocarcinogens, and that it is especially effective for evaluating test chemicals, such as DMN, undetectable by the BM and GI tract MN assay. Moreover, the results in this investigation indicate that the use of multiple tissues in the study integrating the MN tests is more effective than using a single tissue, for detection of the MN induction produced by chemical exposure to rats, and helps to determine the characteristics of the test chemicals.

  17. Cumulative risks of foster care placement for Danish children

    National Research Council Canada - National Science Library

    Fallesen, Peter; Emanuel, Natalia; Wildeman, Christopher

    2014-01-01

    Although recent research suggests that the cumulative risk of foster care placement is far higher for American children than originally suspected, little is known about the cumulative risk of foster...

  18. Recursive Numerical Evaluation of the Cumulative Bivariate Normal Distribution

    CERN Document Server

    Meyer, Christian

    2010-01-01

    We propose an algorithm for evaluation of the cumulative bivariate normal distribution, building upon Marsaglia's ideas for evaluation of the cumulative univariate normal distribution. The algorithm is mathematically transparent, delivers competitive performance and can easily be extended to arbitrary precision.

  19. Climate mitigation: sustainable preferences and cumulative carbon

    Science.gov (United States)

    Buckle, Simon

    2010-05-01

    We develop a stylized AK growth model with both climate damages to ecosystem goods and services and sustainable preferences that allow trade-offs between present discounted utility and long-run climate damages. The simplicity of the model permits analytical solutions. Concern for the long-term provides a strong driver for mitigation action. One plausible specification of sustainable preferences leads to the result that, for a range of initial parameter values, an optimizing agent would choose a level of cumulative carbon dioxide (CO2) emissions independent of initial production capital endowment and CO2 levels. There is no technological change so, for economies with sufficiently high initial capital and CO2 endowments, optimal mitigation will lead to disinvestment. For lower values of initial capital and/or CO2 levels, positive investment can be optimal, but still within the same overall level of cumulative emissions. One striking aspect of the model is the complexity of possible outcomes, in addition to these optimal solutions. We also identify a resource constrained region and several regions where climate damages exceed resources available for consumption. Other specifications of sustainable preferences are discussed, as is the case of a hard constraint on long-run damages. Scientists are currently highlighting the potential importance of the cumulative carbon emissions concept as a robust yet flexible target for climate policymakers. This paper shows that it also has an ethical interpretation: it embodies an implicit trade off in global welfare between present discounted welfare and long-term climate damages. We hope that further development of the ideas presented here might contribute to the research and policy debate on the critical areas of intra- and intergenerational welfare.

  20. Elaboration of a concept for the cumulative environmental exposure assessment of biocides

    Energy Technology Data Exchange (ETDEWEB)

    Gross, Rita; Bunke, Dirk; Moch, Katja [Oeko-Institut e.V. - Institut fuer Angewandte Oekologie e.V., Freiburg im Breisgau (Germany); Gartiser, Stefan [Hydrotox GmbH, Freiburg im Breisgau (Germany)

    2011-12-15

    Article 10(1) of the EU Biocidal Products Directive 98/8/EC (BPD) requires that for the inclusion of an active substance in Annex I, Annex IA or IB, cumulation effects from the use of biocidal products containing the same active substance shall be taken into account, where relevant. The study proves the feasibility of a technical realisation of Article 10(1) of the BPD and elaborates a first concept for the cumulative environmental exposure assessment of biocides. Existing requirements concerning cumulative assessments in other regulatory frameworks have been evaluated and their applicability for biocides has been examined. Technical terms and definitions used in this context were documented with the aim to harmonise terminology with other frameworks and to set up a precise definition within the BPD. Furthermore, application conditions of biocidal products have been analysed to find out for which cumulative exposure assessments may be relevant. Different parameters were identified which might serve as indicators for the relevance of cumulative exposure assessments. These indicators were then integrated in a flow chart by means of which the relevance of cumulative exposure assessments can be checked. Finally, proposals for the technical performance of cumulative exposure assessments within the Review Programme have been elaborated with the aim to bring the results of the project into the upcoming development and harmonization processes on EU level. (orig.)

  1. Long and Short Term Cumulative Structural Priming Effects

    OpenAIRE

    Kaschak, Michael P.; Kutta, Timothy J.; Coyle, Jacqueline M.

    2012-01-01

    We present six experiments that examine cumulative structural priming effects (i.e., structural priming effects that accumulate across many utterances). Of particular interest is whether (1) cumulative priming effects transfer across language production tasks and (2) the transfer of cumulative priming effects across tasks persists over the course of a week. Our data suggest that cumulative structural priming effects do transfer across language production tasks (e.g., from written stem complet...

  2. Preserved cumulative semantic interference despite amnesia

    Directory of Open Access Journals (Sweden)

    Gary Michael Oppenheim

    2015-05-01

    As predicted by Oppenheim et al’s (2010 implicit incremental learning account, WRP’s BCN RTs demonstrated strong (and significant repetition priming and semantic blocking effects (Figure 1. Similar to typical results from neurally intact undergraduates, WRP took longer to name pictures presented in semantically homogeneous blocks than in heterogeneous blocks, an effect that increased with each cycle. This result challenges accounts that ascribe cumulative semantic interference in this task to explicit memory mechanisms, instead suggesting that the effect has the sort of implicit learning bases that are typically spared in hippocampal amnesia.

  3. Cumulant matching for independent source extraction.

    Science.gov (United States)

    Phlypo, Ronald; Zarzoso, Vicente; Comon, Pierre; Lemahieu, Ignace

    2008-01-01

    In this work we show how one can make use of priors on signal statistics under the form of cumulant guesses to extract an independent source from an observed mixture. The advantage of using statistical priors on the signal lies in the fact that no specific knowledge is needed about its temporal behavior, neither about its spatial distribution. We show that these statistics can be obtained either by reasoning on the theoretical values of a supposed waveform, either by using a subset of the observations from which we know that their statistics are merely hindered by interferences. Results on an electro-cardiographic recording confirm the above assumptions.

  4. Heart rate variability and DNA methylation levels are altered after short-term metal fume exposure among occupational welders: a repeated-measures panel study

    OpenAIRE

    2014-01-01

    Background: In occupational settings, boilermakers are exposed to high levels of metallic fine particulate matter (PM2.5) generated during the welding process. The effect of welding PM2.5 on heart rate variability (HRV) has been described, but the relationship between PM2.5, DNA methylation, and HRV is not known. Methods: In this repeated-measures panel study, we recorded resting HRV and measured DNA methylation levels in transposable elements Alu and long interspersed nuclear element-1 (LINE...

  5. Modelling studies on neurodegenerative disease-causing triplet repeat sequences d(GGC/GCC)n and d(CAG/CTG)n

    Indian Academy of Sciences (India)

    Shibasish Chowdhury; Manju Bansal

    2001-12-01

    Model building and molecular mechanics studies have been carried out to examine the potential structures for d(GGC/GCC)5 and d(CAG/CTG)5 that might relate to their biological function and association with triplet repeat expansion diseases. Model building studies suggested that hairpin and quadruplex structures could be formed with these repeat sequences. Molecular mechanics studies have demonstrated that the hairpin and hairpin dimer structures of triplet repeat sequences formed by looping out of the two strands are as favourable as the corresponding B-DNA type hetero duplex structures. Further, at high salt condition, Greek key type quadruplex structures are energetically comparable with hairpin dimer and B-DNA type duplex structures. All tetrads in the quadruplex structures are well stacked and provide favourable stacking energy values. Interestingly, in the energy minimized hairpin dimer and Greek key type quadruplex structures, all the bases even in the non-G tetrads are cyclically hydrogen bonded, even though the A, C and T-tetrads were not hydrogen bonded in the starting structures.

  6. A Missing Link in the Evolution of the Cumulative Recorder

    Science.gov (United States)

    Asano, Toshio; Lattal, Kennon A.

    2012-01-01

    A recently recovered cumulative recorder provides a missing link in the evolution of the cumulative recorder from a modified kymograph to a reliably operating, scientifically and commercially successful instrument. The recorder, the only physical evidence of such an early precommercial cumulative recorder yet found, was sent to Keio University in…

  7. Original and cumulative prospect theory: a discussion of empirical differences

    NARCIS (Netherlands)

    P.P. Wakker; H. Fennema

    1997-01-01

    This note discusses differences between prospect theory and cumulative prospect theory. It shows that cumulative prospect theory is not merely a formal correction of some theoretical problems in prospect theory, but it also gives different predictions. Experiments are described that favor cumulative

  8. Contributions by the CAG-repeat Polymorphism of the Androgen Receptor Gene and Circulating Androgens to Muscle Size. Odense Androgen Study - A Population-based Study of 20-29 Year-old Danish Men

    DEFF Research Database (Denmark)

    Nielsen, Torben Leo; Hagen, Claus; Wraae, Kristian

    2007-01-01

    Context: The number of CAG-repeats within the CAG-repeat polymorphism of the androgen receptor gene is inversely correlated with the transcriptional activity of the androgen receptor. Objective: To study the effect of the CAG-repeat number and circulating androgens on muscle size, to examine the ...... muscle size increased exponentially with decreasing androgen levels and was tripled at total testosterone levels...... the CAG-repeat number in relation to body fat mass and circulating androgens, and to identify the best hormonal marker of low muscle size amongst total testosterone, bioavailable testosterone, and dihydrotestosterone. Design, Setting, and Participants: Population-based study of 783 Danish men aged 20...... continuous outcomes (thigh and axial muscle area, lower extremity, upper extremity, and trunk lean body mass, and total body fat mass) and five binary outcomes of low muscle size defined as men with muscle size below the lower 10 percentile of each continuous outcome of muscle size. Results: The CAG...

  9. Greater neurobehavioral deficits occur in adult mice after repeated, as compared to single, mild traumatic brain injury (mTBI).

    Science.gov (United States)

    Nichols, Jessica N; Deshane, Alok S; Niedzielko, Tracy L; Smith, Cory D; Floyd, Candace L

    2016-02-01

    Mild traumatic brain injury (mTBI) accounts for the majority of all brain injuries and affected individuals typically experience some extent of cognitive and/or neuropsychiatric deficits. Given that repeated mTBIs often result in worsened prognosis, the cumulative effect of repeated mTBIs is an area of clinical concern and on-going pre-clinical research. Animal models are critical in elucidating the underlying mechanisms of single and repeated mTBI-associated deficits, but the neurobehavioral sequelae produced by these models have not been well characterized. Thus, we sought to evaluate the behavioral changes incurred after single and repeated mTBIs in mice utilizing a modified impact-acceleration model. Mice in the mTBI group received 1 impact while the repeated mTBI group received 3 impacts with an inter-injury interval of 24h. Classic behavior evaluations included the Morris water maze (MWM) to assess learning and memory, elevated plus maze (EPM) for anxiety, and forced swim test (FST) for depression/helplessness. Additionally, species-typical behaviors were evaluated with the marble-burying and nestlet shredding tests to determine motivation and apathy. Non-invasive vibration platforms were used to examine sleep patterns post-mTBI. We found that the repeated mTBI mice demonstrated deficits in MWM testing and poorer performance on species-typical behaviors. While neither single nor repeated mTBI affected behavior in the EPM or FST, sleep disturbances were observed after both single and repeated mTBI. Here, we conclude that behavioral alterations shown after repeated mTBI resemble several of the deficits or disturbances reported by patients, thus demonstrating the relevance of this murine model to study repeated mTBIs.

  10. The Carvedilol Prospective Randomized Cumulative Survival (COPERNICUS) trial.

    Science.gov (United States)

    Eichhorn, Eric J; Bristow, Michael R

    2001-01-01

    Previous trials (Metoprolol CR/XL Randomised Intervention Trial in Congestive Heart Failure [MERIT-HF], Cardiac Insufficiency Bisoprolol Study [CIBIS] II) have demonstrated a mortality benefit of beta-adrenergic blockade in patients with mild to moderate heart failure. The recent Carvedilol Prospective Randomized Cumulative Survival (COPERNICUS) trial has extended these results to a more advanced patient population. This trial did not, however, include patients who could not reach compensation, patients with far advanced heart failure symptoms, or a significant number of black patients. Future studies of beta-blockade may focus on these patients or patients with asymptomatic left ventricular dysfunction.

  11. The Carvedilol Prospective Randomized Cumulative Survival (COPERNICUS trial

    Directory of Open Access Journals (Sweden)

    Bristow Michael R

    2001-02-01

    Full Text Available Abstract Previous trials (Metoprolol CR/XL Randomised Intervention Trial in Congestive Heart Failure [MERIT-HF], Cardiac Insufficiency Bisoprolol Study [CIBIS] II have demonstrated a mortality benefit of β-adrenergic blockade in patients with mild to moderate heart failure. The recent Carvedilol Prospective Randomized Cumulative Survival (COPERNICUS trial has extended these results to a more advanced patient population. This trial did not, however, include patients who could not reach compensation, patients with far advanced heart failure symptoms, or a significant number of black patients. Future studies of β-blockade may focus on these patients or patients with asymptomatic left ventricular dysfunction.

  12. Oil spill characterization in the hybrid polarity SAR domain using log-cumulants

    Science.gov (United States)

    Espeseth, Martine M.; Skrunes, Stine; Brekke, Camilla; Salberg, Arnt-Børre; Jones, Cathleen E.; Holt, Benjamin

    2016-10-01

    Log-cumulants have proven to be an interesting tool for evaluating the statistical properties of potential oil spills in polarimetric Synthetic Aperture Radar (SAR) data within the common horizontal (H) and vertical (V) polarization basis. The use of first, second, and third order sample log-cumulants has shown potential for evaluating the texture and the statistical distributions, as well as discriminating oil from look-alikes. Log-cumulants are cumulants derived in the log-domain and can be applied to both single-polarization and multipolarization SAR data. This study is the first to investigate the differences between hybrid-polarity (HP) and full-polarimetric (FP) modes based on the sample log-cumulants of various oil slicks and open water from nine Uninhabited Aerial Vehicle Synthetic Aperture Radar (UAVSAR) scenes acquired off the coast of Norway in 2015. The sample log-cumulants calculated from the HP intensities show similar statistical behavior to the FP ones, resulting in a similar interpretation of the sample log-cumulants from HP and FP. Approximately eight hours after release the sample log-cumulants representing emulsion slicks have become more similar to the open water compared to plant oil. We find that the sample log-cumulants of the various oil slicks and open water varies between the scenes and also between the slicks and open water. This might be due to changes in ocean and wind condition, the initial slick properties, and/or the difference in the weathering process of the oil slicks.

  13. Ground-Truthing Validation to Assess the Effect of Facility Locational Error on Cumulative Impacts Screening Tools

    OpenAIRE

    Sadd, J. L.; Hall, E. S.; Pastor, M.; Morello-Frosch, R. A.; D. Lowe-Liang; Hayes, J.; Swanson, C

    2015-01-01

    Researchers and government regulators have developed numerous tools to screen areas and populations for cumulative impacts and vulnerability to environmental hazards and risk. These tools all rely on secondary data maintained by government agencies as part of the regulatory and permitting process. Stakeholders interested in cumulative impacts screening results have consistently questioned the accuracy and completeness of some of these datasets. In this study, three cumulative impacts screenin...

  14. Diabetic Foot Prevention: Repeatability of the Loran Platform Plantar Pressure and Load Distribution Measurements in Nondiabetic Subjects during Bipedal Standing—A Pilot Study

    Directory of Open Access Journals (Sweden)

    Martha Zequera

    2011-01-01

    Full Text Available This study was designed to assess the repeatability of the Loran Platform and evaluate the variability of plantar pressure and postural balance, during barefoot standing in nondiabetic subjects, for future diabetic foot clinical evaluation. Measurements were taken for eight nondiabetic subjects (4 females, 4 males, aged 47±7.2 years who had no musculoskeletal symptoms. Five variables were measured with the platform in the barefoot standing position. Ten measurements were taken using two different techniques for feet and posture positioning, during three sessions, once a week. For most measurements, no significant effect over time was found with Student's t-test (P<.000125. The ANOVA test of statistical significance confirmed that measurement differences between subjects showed higher variations than measurements taken from the same subject (P<.001. The measurements taken by the Loran Platform system were found to be repeatable.

  15. Cumulative environmental management and the oil sands

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2005-07-01

    In response to concerns regarding the cumulative environmental impacts of oil sands development within the Athabasca oil sands deposit, the government of Alberta established a Regional Sustainable Development Strategy (RSDS) to balance development with environmental protection. The environmental issues identified through the RSDS were addressed by the Cumulative Environmental Management Association (CEMA). CEMA's boundary is the Wood Buffalo region of northeastern Alberta. It identifies existing and future environmental effects in the region and proposes recommendations to regulatory bodies for reducing environmental impacts associated with oil sands development. This presentation outlined some of the 55 stakeholder representatives of CEMA, including Alberta government departments associated with resource development, oil sand developers within the region, and Aboriginal communities and First Nations. These stakeholders provide input on sector priorities and agree on environmental thresholds. Established working groups also address technical and scientific research issues identified in the RSDS such as sustainable ecosystems; surface waters; trace metals and air contaminants; nitrogen oxides and sulphur dioxides; and land reclamation. To date, CEMA has submitted more than 50 reports and has made 4 major environmental recommendations for trace metal management, ecosystem management tools, a framework for acid deposition management, and a landscape design checklist. tabs., figs.

  16. Innovativeness, population size and cumulative cultural evolution.

    Science.gov (United States)

    Kobayashi, Yutaka; Aoki, Kenichi

    2012-08-01

    Henrich [Henrich, J., 2004. Demography and cultural evolution: how adaptive cultural processes can produce maladaptive losses-the Tasmanian case. Am. Antiquity 69, 197-214] proposed a model designed to show that larger population size facilitates cumulative cultural evolution toward higher skill levels. In this model, each newborn attempts to imitate the most highly skilled individual of the parental generation by directly-biased social learning, but the skill level he/she acquires deviates probabilistically from that of the exemplar (cultural parent). The probability that the skill level of the imitator exceeds that of the exemplar can be regarded as the innovation rate. After reformulating Henrich's model rigorously, we introduce an overlapping-generations analog based on the Moran model and derive an approximate formula for the expected change per generation of the highest skill level in the population. For large population size, our overlapping-generations model predicts a much larger effect of population size than Henrich's discrete-generations model. We then investigate by way of Monte Carlo simulations the case where each newborn chooses as his/her exemplar the most highly skilled individual from among a limited number of acquaintances. When the number of acquaintances is small relative to the population size, we find that a change in the innovation rate contributes more than a proportional change in population size to the cumulative cultural evolution of skill level.

  17. A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene.

    Science.gov (United States)

    Leonova, J; Hanson, C

    1999-01-01

    This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.

  18. Cumulative teen birth rates among girls in foster care at age 17: an analysis of linked birth and child protection records from California.

    Science.gov (United States)

    Putnam-Hornstein, Emily; King, Bryn

    2014-04-01

    This study used linked foster care and birth records to provide a longitudinal, population-level examination of the incidence of first and repeat births among girls who were in foster care at age 17. Girls in a foster care placement in California at the age of 17 between 2003 and 2007 were identified from statewide child protection records. These records were probabilistically matched to vital birth records spanning the period from 2001 to 2010. Linked data were used to estimate the cumulative percentage of girls who had given birth before age 20. Birth rates and unadjusted risk ratios were generated to characterize foster care experiences correlated with heightened teen birth rates. Between 2003 and 2007 in California, there were 20,222 girls in foster care at age 17. Overall, 11.4% had a first birth before age 18. The cumulative percentage who gave birth before age 20 was 28.1%. Among girls who had a first birth before age 18, 41.2% had a repeat teen birth. Significant variations by race/ethnicity and placement-related characteristics emerged. Expanded data and rigorous research are needed to evaluate prevention efforts and ensure parenting teens are provided with the needed services and supports.

  19. Evaluating Cumulative Ecosystem Response to Restoration Projects in the Columbia River Estuary, Annual Report 2007

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, Gary E.; Diefenderfer, Heida L.; Borde, Amy B.; Dawley, Earl M.; Ebberts, Blaine D.; Putman, Douglas A.; Roegner, G. C.; Russell, Micah; Skalski, John R.; Thom, Ronald M.; Vavrinec, John

    2008-10-01

    The goal of this multi-year study (2004-2010) is to develop a methodology to evaluate the cumulative effects of multiple habitat restoration projects intended to benefit ecosystems supporting juvenile salmonids in the lower Columbia River and estuary. Literature review in 2004 revealed no existing methods for such an evaluation and suggested that cumulative effects could be additive or synergistic. Field research in 2005, 2006, and 2007 involved intensive, comparative studies paired by habitat type (tidal swamp vs. marsh), trajectory (restoration vs. reference site), and restoration action (tide gate vs. culvert vs. dike breach). The field work established two kinds of monitoring indicators for eventual cumulative effects analysis: core and higher-order indicators. Management implications of limitations and applications of site-specific effectiveness monitoring and cumulative effects analysis were identified.

  20. The seemingly quixotic pursuit of a cumulative psychological science: introduction to the special issue.

    Science.gov (United States)

    Curran, Patrick J

    2009-06-01

    The goal of any empirical science is to pursue the construction of a cumulative base of knowledge upon which the future of the science may be built. However, there is mixed evidence that the science of psychology can accurately be characterized by such a cumulative progression. Indeed, some argue that the development of a truly cumulative psychological science is not possible with the current paradigms of hypothesis testing in single-study designs. The author explores this controversy as a framework to introduce the 6 articles that make up this special issue on the integration of data and empirical findings across multiple studies. The author proposes that the methods and techniques described in this set of articles can significantly propel researchers forward in their ongoing quest to build a cumulative psychological science. (PsycINFO Database Record (c) 2009 APA, all rights reserved).

  1. A validation of a posture matching approach for the determination of 3D cumulative back loads.

    Science.gov (United States)

    Sutherland, Chad A; Albert, Wayne J; Wrigley, Allan T; Callaghan, Jack P

    2008-03-01

    The purpose of this project was to investigate the amount of error in calculating cumulative lumbar spine kinetics using a posture matching approach (3DMatch) compared to a 3D coordinate electromagnetic tracking approach (FASTRAK). Six subjects were required to perform five repeats each of two symmetrical and two asymmetrical lifts while being simultaneously recorded from 4 camera views at viewing angles of 0 degrees , 45 degrees , 60 degrees and 90 degrees to the sagittal plane while wearing eight FASTRAK sensors to define an 8 segment rigid link model (RLM) of the head, arms, and trunk. Four hundred and eighty lifts (6 subjects x20 lifts x4 camera views) were analyzed using the 3DMatch posture-matching program to calculate the following cumulative loads at the L4/L5 joint: compression, anterior shear, posterior shear, reaction shear and extension moment. The errors in cumulative load calculation were determined as the difference between the values calculated for the same lifts using a 3D RLM that used electromagnetic motion tracking sensors (FASTRAK) positioned at the segment center of masses as model inputs. No significant difference (pposture matching by trained users can provide reasonable 3D data to calculate cumulative low back loads with a biomechanical model.

  2. A comparative evaluation of tray spacer thickness and repeat pour on the accuracy of monophasic polyvinyl siloxane impression material: In vitro study

    Directory of Open Access Journals (Sweden)

    Sandeep Kumar

    2014-01-01

    Full Text Available Purpose: This study was aimed to determine the effect of various tray spacer thickness and subsequent repeated pours on the accuracy and dimensional stability of the impression made from monophasic polyvinyl siloxane material. Materials and Methods: Custom trays with different spacer thickness (2, 4 and 6 mm were used for making an impression of a master model simulating 3 unit fixed partial denture with monophasic polyvinyl siloxane material. These impressions were poured with die stone and repoured. Distance between the reference points were measured and subjected to statistical analysis. Result: Casts obtained from 1 st , 2 nd and 3 rd pour of the impression in 2, 4 and 6 mm spacer thickness tray have similar dimensional accuracy amongst each other and with the master model except in molar diameter and inter-abutment distances of cast obtained from 6 mm spacer thickness tray. Conclusion: The vertical distance of stone dies were decreased, whereas horizontal distance increased as the thickness of impression material is increased. There were statistically non-significant changes occurring among the repeated pours in 2, 4 and 6 mm spacer thickness. Clinical Implication: 2 and 4 mm spacer thickness are acceptable for making an impression for three unit fixed partial denture with monophasic polyvinyl siloxane material and it was not affected by two subsequent (1 st and 2 nd repeated pours.

  3. Vaginal birth after cesarean section (VBAC versus emergency repeat cesarean section at teaching hospitals in India: an ICMR task force study

    Directory of Open Access Journals (Sweden)

    B. S. Dhillon

    2014-06-01

    Results: A total of 155863 deliveries occurred during the study duration, there were 28.1% (n=43824 cesarean section and (10.1% (n=15664 were the number of previous cesarean section. In 84% (n=13151 had repeat cesarean delivery and 2513 (16% delivered vaginally. A trial of labor was planned in 4035 (25.8% women. The success rate of VBAC was 62.3% with 2513 women had successful vaginal delivery and 1522 (37.7% delivered by emergency repeat cesarean section. Major indication of emergency cesarean section was CPD (52.9%, foetal distress (25.8%, severe PIH/eclampsia (5.0%, previous 2 CS (0.7%, APH (1.4% and others (2.7%. In majority, surgical technique was conventional and in 3.7% the Misgav-Ladach technique was used. Scar dehiscence and surgical complications were observed in 5.4% and 4.0% of cases respectively. Blood transfusion was given in 7.0% and post-operative complications were seen in 6.8%. Perinatal and maternal mortality was 18.0/1000 and 257/100000 deliveries respectively. Conclusions: Safety in childbirth for women with prior cesarean is a major public health concern. Repeat caesarean section and planned vaginal birth after cesarean section are both associated with benefits and harms and correct management represents one of the most significant and challenging issues in obstetric practice. [Int J Reprod Contracept Obstet Gynecol 2014; 3(3.000: 592-597

  4. The effect of repeated immersion of gypsum cast in sodium hypochlorite and glutaraldehyde on its physical properties: An in vitro study

    Directory of Open Access Journals (Sweden)

    Rachuri Narendra Kumar

    2012-01-01

    Full Text Available Background: One method used to disinfect a dental cast is immersion in a disinfecting solution. Repeated immersion of a cast in disinfectant may affect its physical properties. Purpose: The purpose of this study was to evaluate the changes in dimensional accuracy and hardness of the dental casts as a result of repeated disinfection in 0.525% sodium hypochlorite and 2% glutaraldehyde solutions. Materials and Methods: Sixty specimens were made of type III dental stone. Twenty specimens were immersed in slurry, a supernatant solution of calcium sulfate in distilled water (control casts, 20 specimens in 0.525% sodium hypochlorite, and 20 specimens in 2% glutaraldehyde solutions for 30 min and air dried for 24 h. This process was repeated for 7 times for testing. Linear dimensional change and hardness were determined according to American National Standards Institute/American Dental Association (ANSI/ADA standards. The data were analyzed using two-way analysis of variance. Results: For specimens prepared with type III stones, treatment was by immersion in slurry (group I - control casts, and by immersion in 0.525% sodium hypochlorite (group II - test group 1 and in 2% glutaraldehyde solution (group III - test group 2. The specimens treated with sodium hypochlorite and glutaraldehyde showed more linear dimensional change compared to the specimens treated in slurry. However, the difference between test casts and control casts was significant. But the difference between the two test groups was not significant. Both the test groups showed decrease in hardness of the specimens compared to that specimens in control group. But the difference between two test groups was not significant in hardness.However,the values remained close to ANSI/ADA standards. Conclusion: The results demonstrated that repeated immersion of type III dental stone specimens in slurry with distilled water, 0.525% sodium hypochlorite and 2% glutaraldehyde, along with drying in air

  5. Personal semantics: Is it distinct from episodic and semantic memory? An electrophysiological study of memory for autobiographical facts and repeated events in honor of Shlomo Bentin.

    Science.gov (United States)

    Renoult, Louis; Tanguay, Annick; Beaudry, Myriam; Tavakoli, Paniz; Rabipour, Sheida; Campbell, Kenneth; Moscovitch, Morris; Levine, Brian; Davidson, Patrick S R

    2016-03-01

    Declarative memory is thought to consist of two independent systems: episodic and semantic. Episodic memory represents personal and contextually unique events, while semantic memory represents culturally-shared, acontextual factual knowledge. Personal semantics refers to aspects of declarative memory that appear to fall somewhere in between the extremes of episodic and semantic. Examples include autobiographical knowledge and memories of repeated personal events. These two aspects of personal semantics have been studied little and rarely compared to both semantic and episodic memory. We recorded the event-related potentials (ERPs) of 27 healthy participants while they verified the veracity of sentences probing four types of questions: general (i.e., semantic) facts, autobiographical facts, repeated events, and unique (i.e., episodic) events. Behavioral results showed equivalent reaction times in all 4 conditions. True sentences were verified faster than false sentences, except for unique events for which no significant difference was observed. Electrophysiological results showed that the N400 (which is classically associated with retrieval from semantic memory) was maximal for general facts and the LPC (which is classically associated with retrieval from episodic memory) was maximal for unique events. For both ERP components, the two personal semantic conditions (i.e., autobiographical facts and repeated events) systematically differed from semantic memory. In addition, N400 amplitudes also differentiated autobiographical facts from unique events. Autobiographical facts and repeated events did not differ significantly from each other but their corresponding scalp distributions differed from those associated with general facts. Our results suggest that the neural correlates of personal semantics can be distinguished from those of semantic and episodic memory, and may provide clues as to how unique events are transformed to semantic memory.

  6. Serum cardiac troponin T after repeated endurance exercise events.

    Science.gov (United States)

    Bonetti, A; Tirelli, F; Albertini, R; Monica, C; Monica, M; Tredici, G

    1996-05-01

    Recently Dr. Rowe made a hypothesis according to which small areas of myocardial necrosis can be caused by microvascular spasm, related to high catecholamine concentrations and other mechanisms, following extraordinary unremitting endurance exercises or due to the cumulative effect of several endurance events. It was this last suggestion which prompted us to investigate 25 top cyclists, taking part in the 77th Giro d'Italia. Blood samples were obtained the day before the start of the competition and once a week thereafter until the end. We measured myoglobin, lactic dehydrogenase, total creatine kinase, creatine kinase isoenzyme MB and serum cardiac troponin T (Tn-T), a highly sensitive and specific method for the detection of myocardial injury. While at measuring time points which followed we found a significant increase in the serum indicators of muscle damage, compared with their values at the beginning of the race, creatine kinase isoenzyme MB did not rise significantly and cardiac Tn-T was found in the serum of only 5 athletes, repeatedly in some cases, but always below the cut off values considered as indicating myocardial ischemia. On the basis of the behaviour of creatine kinase isoenzyme MB and, above all, of cardiac Tn-T, we can conclude that heavy endurance exercises, repeated daily for 22 days, as was the case in our study, do not seem able to produce, in top athletes, permanent heart damage by means of acute myocardial injury.

  7. A semi-parametric censoring bias model for estimating the cumulative risk of a false-positive screening test under dependent censoring

    OpenAIRE

    Hubbard, Rebecca A.; Miglioretti, Diana L.

    2013-01-01

    False-positive test results are among the most common harms of screening tests and may lead to more invasive and expensive diagnostic testing procedures. Estimating the cumulative risk of a false-positive screening test result after repeat screening rounds is therefore important for evaluating potential screening regimens. Existing estimators of the cumulative false-positive risk are limited by strong assumptions about censoring mechanisms and parametric assumptions about variation in risk ac...

  8. Eye lens radiation exposure and repeated head CT scans: A problem to keep in mind

    Energy Technology Data Exchange (ETDEWEB)

    Michel, Morgane; Jacob, Sophie [Institute for Radiological Protection and Nuclear Safety, IRSN/DRPH/SRBE/Laboratoire d' Epidemiologie, BP 17, 92 262 Fontenay-aux-Roses (France); Roger, Gilles [Otolaryngology Department, Trousseau Hospital, Paris (France); Pelosse, Beatrice [Ophthalmology Department, Trousseau Hospital, Paris (France); Laurier, Dominique [Institute for Radiological Protection and Nuclear Safety, IRSN/DRPH/SRBE/Laboratoire d' Epidemiologie, BP 17, 92 262 Fontenay-aux-Roses (France); Le Pointe, Hubert Ducou [Radiology Department, Trousseau Hospital, Paris (France); Bernier, Marie-Odile, E-mail: marie-odile.bernier@irsn.fr [Institute for Radiological Protection and Nuclear Safety, IRSN/DRPH/SRBE/Laboratoire d' Epidemiologie, BP 17, 92 262 Fontenay-aux-Roses (France)

    2012-08-15

    Objectives: The deterministic character of radiation-induced cataract is being called into question, raising the possibility of a risk in patients, especially children, exposed to ionizing radiation in case of repeated head CT-scans. This study aims to estimate the eye lens doses of a pediatric population exposed to repeated head CTs and to assess the feasibility of an epidemiological study. Methods: Children treated for a cholesteatoma, who had had at least one CT-scan of the middle ear before their tenth birthday, were included. Radiation exposure has been assessed from medical records and telephone interviews. Results: Out of the 39 subjects contacted, 32 accepted to participate. A total of 76 CT-scans were retrieved from medical records. At the time of the interview (mean age: 16 years), the mean number of CT per child was 3. Cumulative mean effective and eye lens doses were 1.7 mSv and 168 mGy, respectively. Conclusion: A relatively high lens radiation dose was observed in children exposed to repeated CT-scans. Due to that exposure and despite the difficulties met when trying to reach patients' families, a large scale epidemiological study should be performed in order to assess the risk of radiation-induced cataracts associated with repeated head CT.

  9. Ambient particulate air pollution and circulating antioxidant enzymes: A repeated-measure study in healthy adults in Beijing, China.

    Science.gov (United States)

    Wu, Shaowei; Wang, Bin; Yang, Di; Wei, Hongying; Li, Hongyu; Pan, Lu; Huang, Jing; Wang, Xin; Qin, Yu; Zheng, Chanjuan; Shima, Masayuki; Deng, Furong; Guo, Xinbiao

    2016-01-01

    The association of systemic antioxidant activity with ambient air pollution has been unclear. A panel of 40 healthy college students underwent repeated blood collection for 12 occasions under three exposure scenarios before and after relocating from a suburban area to an urban area in Beijing, China in 2010-2011. We measured various air pollutants including fine particles (PM2.5) and determined circulating levels of antioxidant enzymes extracellular superoxide dismutase (EC-SOD) and glutathione peroxidase 1 (GPX1) in the laboratory. An interquartile range increase of 63.4 μg/m(3) at 3-d PM2.5 moving average was associated with a 6.3% (95% CI: 0.6, 12.4) increase in EC-SOD and a 5.5% (95% CI: 1.3, 9.8) increase in GPX1. Several PM2.5 chemical constituents, including negative ions (nitrate and chloride) and metals (e.g., iron and strontium), were consistently associated with increases in EC-SOD and GPX1. Our results support activation of circulating antioxidant enzymes following exposure to particulate air pollution. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. A Study on the Efficiency Improvement of Dye-Sensitized Solar Cell (DSSC) by Repeated Dye Coating.

    Science.gov (United States)

    Seo, Young Ho; Choi, Eun Chang; Hong, Byungyou

    2015-10-01

    Dye-sensitized solar cell (DSSC) is being extensively investigated as the next generation energy source. Despite of the attractive features like simple fabrication process and its economic efficiency, there are some problems such as low efficiency, long fabrication time and low long-term stability. Conventionally, the dye adsorption on TiO2 photo-electrode film needs long time in the solvent with low concentration of dye to get the high efficiency. In this work, the dye coating process was considerably shortened, albeit plenty of dye was used comparing with the conventional way. Our needs were met for the best result in our working environment and the relevant conditions to our work were obtained, which were the coating temperature of 70 °C, the dye concentration of 10 mM and the coating time of 3 min. And this coating process was successively repeated several times to maximize the dye adsorption and to improve the cell efficiency. Therefore, the efficiency increased by 13% in the proper condition.

  11. Deliberative Democracy, Institution Building, and the Pragmatics of Cumulative Effects Assessment

    Directory of Open Access Journals (Sweden)

    John R. Parkins

    2011-09-01

    Full Text Available Cumulative effects assessment is a process of scientific analysis, social choice, and public policy development, yet the linkages among these domains are often less than transparent. Limits to scientific and technical assessment, issues of power and control of information, and episodic forms of civic engagement represent serious challenges to meaningful understanding of cumulative effects assessment and land-use planning. In articulating these challenges, I draw on case studies from Ontario's Lands for Life and Alberta's Land-use Framework to illustrate current limitations to cumulative effects assessment on public lands in Canada. As a partial remedy for these limitations, insights into a pragmatic approach to impact assessment, in contrast to decisionistic and technocratic approaches, offer a way forward through a more robust integration of scientific information, civic engagement, and public policy development. I also identify a need for longer-standing institutions that are dedicated to regional planning and cumulative effects assessment in Canada.

  12. Ion cumulation by conical cathode electrolysis.

    CERN Document Server

    Grishin, V G

    2002-01-01

    Results of solid-state sodium stearate electrolysis with conical and cylindrical cathodes is presented here. Both electric measurement and conical samples destruction can be explained if a stress developing inside the conical sample is much bigger than in the cylindrical case and there is its unlimited amplification along cone slopes. OTHER KEYWORDS: ion, current, solid, symmetry, cumulation, polarization, depolarization, ionic conductor,superionic conductor, ice, crystal, strain, V-center, V-centre, doped crystal, interstitial impurity, intrinsic color center, high pressure technology, Bridgman, anvil, experiment, crowdion, dielectric, proton, layer, defect, lattice, dynamics, electromigration, mobility, muon catalysis, concentration, doping, dopant, conductivity, pycnonuclear reaction, permittivity, dielectric constant, point defects, interstitials, polarizability, imperfection, defect centers, glass, epitaxy, sodium hydroxide, metallic substrate, crystallization, point, tip, susceptibility, ferroelectric, ...

  13. Reconfigurable multiport EPON repeater

    Science.gov (United States)

    Oishi, Masayuki; Inohara, Ryo; Agata, Akira; Horiuchi, Yukio

    2009-11-01

    An extended reach EPON repeater is one of the solutions to effectively expand FTTH service areas. In this paper, we propose a reconfigurable multi-port EPON repeater for effective accommodation of multiple ODNs with a single OLT line card. The proposed repeater, which has multi-ports in both OLT and ODN sides, consists of TRs, BTRs with the CDR function and a reconfigurable electrical matrix switch, can accommodate multiple ODNs to a single OLT line card by controlling the connection of the matrix switch. Although conventional EPON repeaters require full OLT line cards to accommodate subscribers from the initial installation stage, the proposed repeater can dramatically reduce the number of required line cards especially when the number of subscribers is less than a half of the maximum registerable users per OLT. Numerical calculation results show that the extended reach EPON system with the proposed EPON repeater can save 17.5% of the initial installation cost compared with a conventional repeater, and can be less expensive than conventional systems up to the maximum subscribers especially when the percentage of ODNs in lightly-populated areas is higher.

  14. TU-C-12A-05: Repeatability Study of Reduced Field-Of-View Diffusion-Weighted MRI On Human Thyroid Gland

    Energy Technology Data Exchange (ETDEWEB)

    Shukla-Dave, A; Lu, Y; Hatzoglou, V; Stambuk, H; Mazaheri, Y [Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Banerjee, S; Shankaranarayanan, A [GE Healthcare, Menlo Park, California (United States); Deasy, J [Memorial Sloan Kettering Cancer Center, New York, NY (United States)

    2014-06-15

    Purpose: To investigate the repeatability of reduced field-of-view diffusion-weighted imaging (rFOV DWI) in quantifying apparent diffusion coefficients (ADCs) for human thyroid glands in a clinical setting. Methods: Nine healthy human volunteers were enrolled and underwent 3T MRI exams. For each volunteer, 3 longitudinal exams (2 weeks apart) with 2 repetitive sessions within each exam, including rFOV and conventional full field-of-view (fFOV) DWI scans, were performed. In the acquired DWI images, a fixed-size region of interest (ROI; diameter=8mm) was placed on thyroid glands to calculate ADC. ADC was calculated using a monoexponential function with a noise correction scheme. The repeatability of ADC was assessed by using coefficient variation (CV) across sessions or exams, which was defined to be: r = 1-CV, 0 < r < 1, where CV=STD/m, STD is the standard deviation of ADC, and m is the average of ADC across sessions or exams. An experienced radiologist assessed and scored rFOV and fFOV DW images based on image characteristics (1, nondiagnostic; 2, poor; 3, satisfactory; 4, good; and 5, excellent).Analysis of variance (ANOVA) was performed to compare ADC values, CV of ADC, repeatability of ADC across sessions and exams, and radiologic scores between rFOV and fFOV DWI techniques. Results: There was no significant difference in ADC values across sessions and exams either in rFOV or fFOV DWI. The average CVs of both rFOV and fFOV DWI were less than 13%. The repeatability of ADC measurement between rFOV and fFOV DWI was not significantly different. The overall image quality was significantly higher with rFOV DWI than with fFOV DWI. Conclusion: This study suggested that ADCs from both rFOV and fFOV DWI were repeatable, but rFOV DWI had superior imaging quality for human thyroid glands in a clinical setting.

  15. Cumulative human threats on fish biodiversity components in Tunisian waters

    Directory of Open Access Journals (Sweden)

    F. BEN RAIS LASRAM

    2015-02-01

    Full Text Available Human activities are increasingly impacting biodiversity. To improve conservation planning measures in an ecosystem-based management context, we need to explore how the effects of these activities interact with different biodiversity components. In this study, we used a semi-quantitative method to assess the cumulative impacts of human activities on three biodiversity components (species richness, phylogenetic diversity, and functional diversity in Tunisia’s exclusive economic zone. For each of the nine activities considered, we developed an understanding of their effects from local studies and the expert opinion of stakeholders with country-specific experience. We mapped the cumulative effects and the three biodiversity components and then assessed the degree to which these elements overlapped using an overlap index. This is the first time such an assessment has been made for Tunisia’s marine ecosystems and our assessment highlight the inappropriateness of current conservation measures. The results of this study have specific application for the prioritization of future management actions.

  16. Cumulative human threats on fish biodiversity components in Tunisian waters

    Directory of Open Access Journals (Sweden)

    F. BEN RAIS LASRAM

    2014-06-01

    Full Text Available Human activities are increasingly impacting biodiversity. To improve conservation planning measures in an ecosystem-based management context, we need to explore how the effects of these activities interact with different biodiversity components. In this study, we used a semi-quantitative method to assess the cumulative impacts of human activities on three biodiversity components (species richness, phylogenetic diversity, and functional diversity in Tunisia’s exclusive economic zone. For each of the nine activities considered, we developed an understanding of their effects from local studies and the expert opinion of stakeholders with country-specific experience. We mapped the cumulative effects and the three biodiversity components and then assessed the degree to which these elements overlapped using an overlap index. This is the first time such an assessment has been made for Tunisia’s marine ecosystems and our assessment highlight the inappropriateness of current conservation measures. The results of this study have specific application for the prioritization of future management actions.

  17. Cumulative Incidence of Cancer among People with AIDS in the United States

    Science.gov (United States)

    Simard, Edgar P.; Pfeiffer, Ruth M.; Engels, Eric A.

    2010-01-01

    BACKGROUND As people with acquired immunodeficiency syndrome (AIDS) live longer due to highly active antiretroviral therapy (HAART, widely available since 1996), the overall burden of cancer may increase. METHODS A population-based record linkage study identified cancers in 472,378 people with AIDS (1980–2006). Using non-parametric competing risk methods, we estimated cumulative incidence of cancer across 3 calendar periods (AIDS onset in 1980–1989, 1990–1995, and 1996–2006). RESULTS Measured at 5-years after AIDS onset, cumulative incidence of AIDS-defining cancer (ADC) declined sharply across AIDS calendar periods (from 18% in 1980–1989, to 11% in 1990–1995, to 4.2% in 1996–2006 [i.e., HAART era]). Cumulative incidence of Kaposi sarcoma declined from 14.3% during 1980–1989 to 6.7% during 1990–1995 to 1.8% during 1996–2006. Non-Hodgkin lymphoma (NHL) cumulative incidence declined from 3.8% during 1990–1995 to 2.2% during 1996–2006; during the HAART era, NHL was the commonest (53%) ADC. Cumulative incidence of non-AIDS-defining cancer (NADC) increased from 1.1% to 1.5% with no change thereafter (1.0%, 1996–2006), in part due to declines in competing mortality. However, cumulative incidence increased steadily over time for specific NADCs (anal cancer, Hodgkin lymphoma, and liver cancer). Lung cancer cumulative incidence increased from 0.14% during 1980–1989 to 0.32% during 1990–1995, with no change thereafter. CONCLUSIONS We noted dramatically declining cumulative incidence of 2 major ADCs (Kaposi sarcoma and NHL) and increases in some NADCs (specifically cancers of the anus, liver, and lung, and Hodgkin lymphoma). As HIV/AIDS is increasingly managed as a chronic disease, greater attention should be focused on cancer screening and prevention. PMID:20960504

  18. Recursive quantum repeater networks

    CERN Document Server

    Van Meter, Rodney; Horsman, Clare

    2011-01-01

    Internet-scale quantum repeater networks will be heterogeneous in physical technology, repeater functionality, and management. The classical control necessary to use the network will therefore face similar issues as Internet data transmission. Many scalability and management problems that arose during the development of the Internet might have been solved in a more uniform fashion, improving flexibility and reducing redundant engineering effort. Quantum repeater network development is currently at the stage where we risk similar duplication when separate systems are combined. We propose a unifying framework that can be used with all existing repeater designs. We introduce the notion of a Quantum Recursive Network Architecture, developed from the emerging classical concept of 'recursive networks', extending recursive mechanisms from a focus on data forwarding to a more general distributed computing request framework. Recursion abstracts independent transit networks as single relay nodes, unifies software layer...

  19. The seven-year cumulative survival rate of Osstem implants

    Science.gov (United States)

    Kim, Young-Kyun; Kim, Bum-Su; Yun, Pil-Young; Mun, Sang-Un; Yi, Yang-Jin; Jeong, Kyung-In

    2014-01-01

    Objectives This study was performed to analyze the cumulative survival rate of Osstem implants (Osstem Implant Co., Ltd.) over a seven-year period. Materials and Methods A total of 105 patients who had 467 Osstem implants that were placed at the Section of Dentistry, Seoul National University Bundang Hospital (Seongnam, Korea) from June 2003 through December 2005 were analyzed. The life table method and a cross-tubulation analysis, log rank test were used to evaluate the survival curve and the influence that the prognostic factors. The prognostic factors, i.e., age and gender of patients, diameter and length, type of implants, bone graft history and loading time were determined with a Cox proportional hazard model based on logistic regression analysis. Results The seven-year cumulative survival rate of Osstem implants was 95.37%. The Cox proportional hazard model revealed that the following factors had a significant influence on survival rate; increased diameter, reduced prosthetic loading period and performance of bone grafting. Conclusion The osstem implants showed satisfactory results over the seven-year study period. PMID:24868503

  20. Cumulative Effects Assessment: Linking Social, Ecological, and Governance Dimensions

    Directory of Open Access Journals (Sweden)

    Marian Weber

    2012-06-01

    Full Text Available Setting social, economic, and ecological objectives is ultimately a process of social choice informed by science. In this special feature we provide a multidisciplinary framework for the use of cumulative effects assessment in land use planning. Forest ecosystems are facing considerable challenges driven by population growth and increasing demands for resources. In a suite of case studies that span the boreal forest of Western Canada to the interior Atlantic forest of Paraguay we show how transparent and defensible methods for scenario analysis can be applied in data-limited regions and how social dimensions of land use change can be incorporated in these methods, particularly in aboriginal communities that have lived in these ecosystems for generations. The case studies explore how scenario analysis can be used to evaluate various land use options and highlight specific challenges with identifying social and ecological responses, determining thresholds and targets for land use, and integrating local and traditional knowledge in land use planning. Given that land use planning is ultimately a value-laden and often politically charged process we also provide some perspective on various collective and expert-based processes for identifying cumulative impacts and thresholds. The need for good science to inform and be informed by culturally appropriate democratic processes calls for well-planned and multifaceted approaches both to achieve an informed understanding of both residents and governments of the interactive and additive changes caused by development, and to design action agendas to influence such change at the ecological and social level.

  1. Effect of repeated intracoronary injection of bone marrow cells in patients with ischaemic heart failure the Danish stem cell study - congestive heart failure trial (DanCell-CHF)

    DEFF Research Database (Denmark)

    Diederichsen, A.C.; Møller, Jacob Eifer; Thayssen, P.;

    2008-01-01

    BACKGROUND: It has been suggested that myocardial regeneration may be achieved by a single intracoronary bone marrow derived stem cell infusion in selected patients with ischaemic heart disease. The effect is uncertain in patients with chronic ischaemic heart failure and it is not known whether...... repeated infusions would have additional positive effects. AIMS: To assess whether two treatments of intracoronary infusion of bone marrow stem cells, administered 4 months apart, could improve left ventricular (LV) systolic function in patients with chronic ischaemic heart failure. METHODS: The study......, NYHA class improved (pstem cell treatment in patients with chronic ischaemic heart failure Udgivelsesdato: 2008/7...

  2. Assessing the cumulative impact of disturbance on canopy structure and chemistry in Appalachian forests

    Science.gov (United States)

    Deel, Lindsay N.

    Eastern forests experience a range of disturbance events over time, from stand-replacing disturbances, such as clear cuts, to ephemeral disturbances, such as insect outbreaks. By understanding the cumulative impact of disturbances on canopy structure and chemistry, we can gain insight into management strategies, assess a variety of ecosystem services, and even contribute to a larger body of knowledge on global climate change. I transformed a series of Landsat images spanning approximately 25 years into cumulative disturbance maps covering Green Ridge State Forest and Savage River State Forest in western Maryland. Intensive field surveys collected during the summer of 2009 provided measurements of canopy N and estimates of canopy cover, understory cover, and leaf cover. I used AVIRIS imagery flown concurrently with field data collection to map canopy nitrogen across both forests. Through this project, I tested the impact of cumulative disturbance on forest canopy cover and canopy nitrogen. I found that increased values of cumulative disturbance had a measurable negative impact on forest canopy structure and canopy nitrogen. Moreover, by testing varying methods of summing cumulative disturbance, I found that past disturbances diminish over time in importance, yet still influence the current canopy structure and canopy N of a forest. Thus, my study suggests that Landsat time series data can be synthesized into cumulative metrics incorporating multiple disturbance types, which help explain important disturbance-mediated changes in ecosystem functions.

  3. Airway refractoriness to inhaled mannitol after repeated challenge.

    Science.gov (United States)

    Suh, Dong In; Lee, Ju Kyung; Kim, Jin-Tack; Koh, Young Yull

    2011-10-01

    Exercise and inhaled mannitol are thought to cause bronchoconstriction through a similar mechanism in asthma. The response to exercise becomes refractory with repeated challenges. This study aimed to investigate whether repeated challenge with mannitol induces refractoriness, as with exercise. Forty-one children with asthma underwent two consecutive dose-response mannitol challenges (Phase 1); the second challenge proceeded after recovery (FEV(1) : 95% or more of baseline value) from the first. The response to mannitol was expressed as a provocative dose causing a 15% fall in FEV(1) (PD(15) ) and the response-dose ratio (RDR) (% fall in FEV(1) /cumulative dose). In 18 subjects who were deemed to have mannitol refractoriness in Phase 1, a mannitol challenge was performed before and after a methacholine challenge (Phase 2). In Phase 1, the time taken for the FEV(1) to recover after the first mannitol challenge ranged from 20 to 100 min with a median of 50 min. In the 23 subjects with a measurable mannitol PD(15) in both challenges, the geometric mean (95%CI) PD(15) in the second challenge (163 mg [114-232]) was significantly higher than that in the first challenge (66 mg [50-88], P value of 0.083%/mg (0.055-0.125) in the first challenge to 0.029%/mg (0.017-0.048) in the second challenge (P challenge with methacholine or mannitol did not significantly alter subsequent bronchoconstriction to the opposite challenge. Repeated challenge with mannitol resulted in less bronchoconstriction when compared with the initial challenge. This refractoriness seems not to be attributable to functional loss of responsiveness or non-specific effect of prior bronchoconstriction.

  4. Hysteresis of magnetostructural transitions: Repeatable and non-repeatable processes

    Energy Technology Data Exchange (ETDEWEB)

    Provenzano, Virgil [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States); Della Torre, Edward; Bennett, Lawrence H. [Department of Electrical and Computer Engineering, The George Washington University, Washington, DC 20052 (United States); ElBidweihy, Hatem, E-mail: Hatem@gwmail.gwu.edu [Department of Electrical and Computer Engineering, The George Washington University, Washington, DC 20052 (United States)

    2014-02-15

    The Gd{sub 5}Ge{sub 2}Si{sub 2} alloy and the off-stoichiometric Ni{sub 50}Mn{sub 35}In{sub 15} Heusler alloy belong to a special class of metallic materials that exhibit first-order magnetostructural transitions near room temperature. The magnetic properties of this class of materials have been extensively studied due to their interesting magnetic behavior and their potential for a number of technological applications such as refrigerants for near-room-temperature magnetic refrigeration. The thermally driven first-order transitions in these materials can be field-induced in the reverse order by applying a strong enough field. The field-induced transitions are typically accompanied by the presence of large magnetic hysteresis, the characteristics of which are a complicated function of temperature, field, and magneto-thermal history. In this study we show that the virgin curve, the major loop, and sequentially measured MH loops are the results of both repeatable and non-repeatable processes, in which the starting magnetostructural state, prior to the cycling of field, plays a major role. Using the Gd{sub 5}Ge{sub 2}Si{sub 2} and Ni{sub 50}Mn{sub 35}In{sub 15} alloys, as model materials, we show that a starting single phase state results in fully repeatable processes and large magnetic hysteresis, whereas a mixed phase starting state results in non-repeatable processes and smaller hysteresis.

  5. Fixed-flexion knee radiography using a new positioning device produced highly repeatable measurements of joint space width: ELSA-Brasil Musculoskeletal Study (ELSA-Brasil MSK).

    Science.gov (United States)

    Telles, Rosa Weiss; Costa-Silva, Luciana; Machado, Luciana A C; Reis, Rodrigo Citton Padilha Dos; Barreto, Sandhi Maria

    To describe the performance of a non-fluoroscopic fixed-flexion PA radiographic protocol with a new positioning device, developed for the assessment of knee osteoarthritis (OA) in Brazilian Longitudinal Study of Adult Health Musculoskeletal Study (ELSA-Brasil MSK). A test-retest design including 19 adults (38 knee images) was conducted. Feasibility of the radiographic protocol was assessed by image quality parameters and presence of radioanatomic alignment according to intermargin distance (IMD) values. Repeatability was assessed for IMD and joint space width (JSW) measured at three different locations. Approximately 90% of knee images presented excellent quality. Frequencies of nearly perfect radioanatomic alignment (IMD ≤1mm) ranged from 29% to 50%, and satisfactory alignment was found in up to 71% and 76% of the images (IMD ≤1.5mm and ≤1.7mm, respectively). Repeatability analyses yielded the following results: IMD [SD of mean difference=1.08; coefficient of variation (%CV)=54.68%; intraclass correlation coefficient (ICC) (95%CI)=0.59 (0.34-0.77)]; JSW [SD of mean difference=0.34-0.61; %CV=4.48%-9.80%; ICC (95%CI)=0.74 (0.55-0.85)-0.94 (0.87-0.97)]. Adequately reproducible measurements of IMD and JSW were found in 68% and 87% of the images, respectively. Despite the difficulty in achieving consistent radioanatomic alignment between subsequent radiographs in terms of IMD, the protocol produced highly repeatable JSW measurements when these were taken at midpoint and 10mm from the medial extremity of the medial tibial plateau. Therefore, measurements of JSW at these locations can be considered adequate for the assessment of knee OA in ELSA-Brasil MSK. Copyright © 2016. Published by Elsevier Editora Ltda.

  6. Long and Short Term Cumulative Structural Priming Effects.

    Science.gov (United States)

    Kaschak, Michael P; Kutta, Timothy J; Coyle, Jacqueline M

    We present six experiments that examine cumulative structural priming effects (i.e., structural priming effects that accumulate across many utterances). Of particular interest is whether (1) cumulative priming effects transfer across language production tasks and (2) the transfer of cumulative priming effects across tasks persists over the course of a week. Our data suggest that cumulative structural priming effects do transfer across language production tasks (e.g., from written stem completion to picture description, and from picture description to written stem completion), but only when both tasks are presented in the same experimental session. When cumulative priming effects are established in one task, and the second (changed) task is not presented until a week later, the cumulative priming effects are not observed.

  7. Why Veterinary Medical Educators Should Embrace Cumulative Final Exams.

    Science.gov (United States)

    Royal, Kenneth D

    2017-01-03

    The topic of cumulative final examinations often elicits polarizing opinions from veterinary medical educators. While some faculty prefer cumulative finals, there are many who perceive these types of examinations as problematic. Specifically, faculty often cite cumulative examinations are more likely to cause students' greater stress, which may in turn result in negative student evaluations of teaching. Cumulative finals also restrict the number of items one may present to students on most recent material. While these cited disadvantages may have some merit, the advantages of cumulative examinations far exceed the disadvantages. The purpose of this article is to discuss the advantages of cumulative examinations with respect to learning evidence, grade/score validity, fairness issues, and implications for academic policy.

  8. Cumulative hierarchies and computability over universes of sets

    Directory of Open Access Journals (Sweden)

    Domenico Cantone

    2008-05-01

    Full Text Available Various metamathematical investigations, beginning with Fraenkel’s historical proof of the independence of the axiom of choice, called for suitable definitions of hierarchical universes of sets. This led to the discovery of such important cumulative structures as the one singled out by von Neumann (generally taken as the universe of all sets and Godel’s universe of the so-called constructibles. Variants of those are exploited occasionally in studies concerning the foundations of analysis (according to Abraham Robinson’s approach, or concerning non-well-founded sets. We hence offer a systematic presentation of these many structures, partly motivated by their relevance and pervasiveness in mathematics. As we report, numerous properties of hierarchy-related notions such as rank, have been verified with the assistance of the ÆtnaNova proof-checker.Through SETL and Maple implementations of procedures which effectively handle the Ackermann’s hereditarily finite sets, we illustrate a particularly significant case among those in which the entities which form a universe of sets can be algorithmically constructed and manipulated; hereby, the fruitful bearing on pure mathematics of cumulative set hierarchies ramifies into the realms of theoretical computer science and algorithmics.

  9. Analysis of experimental data on correlations between cumulative particles

    Energy Technology Data Exchange (ETDEWEB)

    Vlasov, A.V.; Doroshkevich, E.A.; Leksin, G.A. [Institute of Theoretical and Experimental Physics, Moscow (Russian Federation)] [and others

    1995-04-01

    Experimental data on correlations between cumulative particles are analyzed. A space-time and energy-transfer pattern of hadron-nucleus interaction based on both correlation data and data on the inclusive spectra of cumulative particles is considered. A new variable that is convenient for describing the production of cumulative particles is proposed using the concept of symmetry between the one-particle and multiparticle distributions. 32 refs., 9 figs., 1 tab.

  10. Comparison of reproductive outcome, including the pattern of loss, between couples with chromosomal abnormalities and those with unexplained repeated miscarriages.

    Science.gov (United States)

    Flynn, Helen; Yan, Junhao; Saravelos, Sotirios H; Li, Tin-Chiu

    2014-01-01

    Chromosomal abnormalities are an important cause of repeated miscarriage. Several studies have discussed the association between chromosomal abnormalities and repeated miscarriage. This study attempts to describe the pattern of miscarriage in this group of women and the eventual pregnancy outcome of couples with chromosomal abnormalities compared with couples with unexplained repeated pregnancy loss. This was a retrospective study involving 795 couples with repeated miscarriages. Out of 795 couples, 28 (3.52%) were found to have a chromosomal abnormality (carrier group). Over half (65.5%) of the chromosomal abnormalities were balanced reciprocal translocations. After referral, this carrier group had a total of 159 pregnancies, leading to 36 live births (22.6%) among 18 couples. The after referral miscarriage rate in the chromosomal anomaly group (55.6%) was significantly (P chromosomal anomaly, the miscarriages were more likely to occur between 6 and 12 weeks' gestation. The encouraging cumulative live birth rate of 64.3% for couples with chromosomal anomaly and repeated miscarriage suggests that further attempts at natural conception are a viable option. © 2013 The Authors. Journal of Obstetrics and Gynaecology Research © 2013 Japan Society of Obstetrics and Gynecology.

  11. Automated quality checks on repeat prescribing.

    OpenAIRE

    Rogers, Jeremy E; Wroe, Christopher J; Roberts, Angus; Swallow, Angela; Stables, David; Cantrill, Judith A; Rector, Alan L.

    2003-01-01

    BACKGROUND: Good clinical practice in primary care includes periodic review of repeat prescriptions. Markers of prescriptions that may need review have been described, but manually checking all repeat prescriptions against the markers would be impractical. AIM: To investigate the feasibility of computerising the application of repeat prescribing quality checks to electronic patient records in United Kingdom (UK) primary care. DESIGN OF STUDY: Software performance test against benchmark manual...

  12. Strengthening concept learning by repeated testing.

    Science.gov (United States)

    Wiklund-Hörnqvist, Carola; Jonsson, Bert; Nyberg, Lars

    2014-02-01

    The aim of this study was to examine whether repeated testing with feedback benefits learning compared to rereading of introductory psychology key-concepts in an educational context. The testing effect was examined immediately after practice, after 18 days, and at a five-week delay in a sample of undergraduate students (n = 83). The results revealed that repeated testing with feedback significantly enhanced learning compared to rereading at all delays, demonstrating that repeated retrieval enhances retention compared to repeated encoding in the short- and the long-term. In addition, the effect of repeated testing was beneficial for students irrespectively of working memory capacity. It is argued that teaching methods involving repeated retrieval are important to consider by the educational system.

  13. Barrier function and natural moisturizing factor levels after cumulative exposure to a fruit-derived organic acid and a detergent: different outcomes in atopic and healthy skin and relevance for occupational contact dermatitis in the food industry.

    Science.gov (United States)

    Angelova-Fischer, Irena; Hoek, Anne-Karin; Dapic, Irena; Jakasa, Ivone; Kezic, Sanja; Fischer, Tobias W; Zillikens, Detlef

    2015-12-01

    Fruit-derived organic compounds and detergents are relevant exposure factors for occupational contact dermatitis in the food industry. Although individuals with atopic dermatitis (AD) are at risk for development of occupational contact dermatitis, there have been no controlled studies on the effects of repeated exposure to multiple irritants, relevant for the food industry, in atopic skin. The aim of the study was to investigate the outcomes of repeated exposure to a fruit-derived organic acid and a detergent in AD compared to healthy volunteers. The volunteers were exposed to 2.0% acetic acid (AcA) and/or 0.5% sodium lauryl sulfate (SLS) in controlled tandem repeated irritation test. The outcomes were assessed by measurements of erythema, transepidermal water loss (TEWL) and natural moisturizing factor (NMF) levels. In the AD volunteers, repeated AcA exposure led to barrier disruption and significant TEWL increase; no significant differences after the same exposure in the healthy controls were found. Repeated exposure to SLS and the irritant tandems enhanced the reactions and resulted in a significantly higher increase in TEWL in the AD compared to the control group. Cumulative irritant exposure reduced the NMF levels in both groups. Differences in the severity of irritant-induced barrier impairment in atopic individuals contribute to the risk for occupational contact dermatitis in result of multiple exposures to food-derived irritants and detergents. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. The Pentapeptide Repeat Proteins

    Energy Technology Data Exchange (ETDEWEB)

    Vetting,M.; Hegde, S.; Fajardo, J.; Fiser, A.; Roderick, S.; Takiff, H.; Blanchard, J.

    2006-01-01

    The Pentapeptide Repeat Protein (PRP) family has over 500 members in the prokaryotic and eukaryotic kingdoms. These proteins are composed of, or contain domains composed of, tandemly repeated amino acid sequences with a consensus sequence of [S, T,A, V][D, N][L, F]-[S, T,R][G]. The biochemical function of the vast majority of PRP family members is unknown. The three-dimensional structure of the first member of the PRP family was determined for the fluoroquinolone resistance protein (MfpA) from Mycobacterium tuberculosis. The structure revealed that the pentapeptide repeats encode the folding of a novel right-handed quadrilateral {beta}-helix. MfpA binds to DNA gyrase and inhibits its activity. The rod-shaped, dimeric protein exhibits remarkable size, shape and electrostatic similarity to DNA.

  15. Can a Repeated Sprint Ability Test Help Clear a Previously Injured Soccer Player for Fully Functional Return to Activity? A Pilot Study.

    Science.gov (United States)

    Padulo, Johnny; Attene, Giuseppe; Ardigò, Luca P; Bragazzi, Nicola L; Maffulli, Nicola; Zagatto, Alessandro M; Dello Iacono, Antonio

    2017-07-01

    To investigate the effects of fatigue induced by a repeated sprint ability (RSA) test on the neuromuscular responses of soccer players with a recent history of lower limb injuries (CH) and a matched control group in good fitness condition (GH). This was a case-control study. Nine CH and 9 GH. Allocation to CH or GH. Each player was assessed for blood lactate concentration and jumping performance [squat jump (SJ) and countermovement jump (CMJ)] before/after RSA. Post-RSA rate of perceived exertion (RPE) was obtained. Receiver operating characteristic analysis was performed to calculate RSA sensitivity and specificity in distinguishing between CH and GH. Intraclass correlation coefficient was used to assess reliability. No baseline differences were found for any variable. ΔSJ before/after RSA was -14 ± 2% and -5 ± 2% in CH and GH, respectively (P Repeated sprint ability is a simple, low-cost field test potentially able to assist in clinical decision making for return to sport.

  16. Evaluating Cumulative Ecosystem Response to Restoration Projects in the Lower Columbia River and Estuary, 2009

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, Gary E.; Diefenderfer, Heida L.; Borde, Amy B.; Bryson, Amanda J.; Cameron, April; Coleman, Andre M.; Corbett, C.; Dawley, Earl M.; Ebberts, Blaine D.; Kauffman, Ronald; Roegner, G. Curtis; Russell, Micah T.; Silva, April; Skalski, John R.; Thom, Ronald M.; Vavrinec, John; Woodruff, Dana L.; Zimmerman, Shon A.

    2010-10-26

    This is the sixth annual report of a seven-year project (2004 through 2010) to evaluate the cumulative effects of habitat restoration actions in the lower Columbia River and estuary (LCRE). The project, called the Cumulative Effects Study, is being conducted for the U.S. Army Corps of Engineers Portland District (USACE) by the Marine Sciences Laboratory of the Pacific Northwest National Laboratory (PNNL), the Pt. Adams Biological Field Station of the National Marine Fisheries Service (NMFS), the Columbia River Estuary Study Taskforce (CREST), and the University of Washington. The goal of the Cumulative Effects Study is to develop a methodology to evaluate the cumulative effects of multiple habitat restoration projects intended to benefit ecosystems supporting juvenile salmonids in the 235-km-long LCRE. Literature review in 2004 revealed no existing methods for such an evaluation and suggested that cumulative effects could be additive or synergistic. From 2005 through 2009, annual field research involved intensive, comparative studies paired by habitat type (tidal swamp versus marsh), trajectory (restoration versus reference site), and restoration action (tidegate replacement vs. culvert replacement vs. dike breach).

  17. Repeating the Past

    Science.gov (United States)

    Moore, John W.

    1998-05-01

    As part of the celebration of the Journal 's 75th year, we are scanning each Journal issue from 25, 50, and 74 years ago. Many of the ideas and practices described are so similar to present-day "innovations" that George Santayana's adage (1) "Those who cannot remember the past are condemned to repeat it" comes to mind. But perhaps "condemned" is too strong - sometimes it may be valuable to repeat something that was done long ago. One example comes from the earliest days of the Division of Chemical Education and of the Journal.

  18. Cumulative social disadvantage and child health.

    Science.gov (United States)

    Bauman, Laurie J; Silver, Ellen J; Stein, Ruth E K

    2006-04-01

    Disparities in child health are a major public health concern. However, it is unclear whether these are predominantly the result of low income, race, or other social risk factors that may contribute to their health disadvantage. Although others have examined the effects of the accumulation of risk factors, this methodology has not been applied to child health. We tested 4 social risk factors (poverty, minority race/ethnicity, low parental education, and not living with both biological parents) to assess whether they have cumulative effects on child health and examined whether access to health care reduced health disparities. We analyzed data on 57,553 children low parental education, and single-parent household) were consistently associated with child health. These were summed, generating the Social Disadvantage Index (range: 0-3). A total of 43.6% of children had no social disadvantages, 30.8% had 1, 15.6% had 2, and 10.0% had all 3. Compared with those with no social disadvantages, the odds ratios (ORs) of being in "good, fair, or poor health" (versus "excellent or very good") were 1.95 for 1 risk, 3.22 for 2 risks, and 4.06 for 3 risks. ORs of having a chronic condition increased from 1.25 (1 risk) to 1.60 (2 risks) to 2.11 (3 risks). ORs for activity limitation were 1.51 (1 risk) to 2.14 (2 risks) and 2.88 (3 risks). Controlling for health insurance did not affect these findings. The accumulation of social disadvantage among children was strongly associated with poorer child health and having insurance did not reduce the observed health disparities.

  19. Modelling the evolution and diversity of cumulative culture

    Science.gov (United States)

    Enquist, Magnus; Ghirlanda, Stefano; Eriksson, Kimmo

    2011-01-01

    Previous work on mathematical models of cultural evolution has mainly focused on the diffusion of simple cultural elements. However, a characteristic feature of human cultural evolution is the seemingly limitless appearance of new and increasingly complex cultural elements. Here, we develop a general modelling framework to study such cumulative processes, in which we assume that the appearance and disappearance of cultural elements are stochastic events that depend on the current state of culture. Five scenarios are explored: evolution of independent cultural elements, stepwise modification of elements, differentiation or combination of elements and systems of cultural elements. As one application of our framework, we study the evolution of cultural diversity (in time as well as between groups). PMID:21199845

  20. Modelling the evolution and diversity of cumulative culture.

    Science.gov (United States)

    Enquist, Magnus; Ghirlanda, Stefano; Eriksson, Kimmo

    2011-02-12

    Previous work on mathematical models of cultural evolution has mainly focused on the diffusion of simple cultural elements. However, a characteristic feature of human cultural evolution is the seemingly limitless appearance of new and increasingly complex cultural elements. Here, we develop a general modelling framework to study such cumulative processes, in which we assume that the appearance and disappearance of cultural elements are stochastic events that depend on the current state of culture. Five scenarios are explored: evolution of independent cultural elements, stepwise modification of elements, differentiation or combination of elements and systems of cultural elements. As one application of our framework, we study the evolution of cultural diversity (in time as well as between groups).

  1. Phylogenetic study and molecular identification of 31 Dendrobium species using inter-simple sequence repeat (ISSR) markers

    National Research Council Canada - National Science Library

    Wang, H.-Z; Feng, S.-G; Lu, J.-J; Shi, N.-N; Liu, J.-J

    2009-01-01

    The genetic diversity of the genus Dendrobium is not well known and the phylogenetic relationship of Dendrobium species are mainly determined by studies of the comparative vegetative anatomy and plant systematics...

  2. The U.S. Forest Service's analysis of cumulative effects to wildlife: A study of legal standards, current practice, and ongoing challenges on a National Forest

    Energy Technology Data Exchange (ETDEWEB)

    Schultz, Courtney A., E-mail: courtney.schultz@colostate.edu

    2012-01-15

    Cumulative effects analysis (CEA) allows natural resource managers to understand the status of resources in historical context, learn from past management actions, and adapt future activities accordingly. U.S. federal agencies are required to complete CEA as part of environmental impact assessment under the National Environmental Policy Act (NEPA). Past research on CEA as part of NEPA has identified significant deficiencies in CEA practice, suggested methodologies for handling difficult aspects of CEA, and analyzed the rise in litigation over CEA in U.S. courts. This article provides a review of the literature and legal standards related to CEA as it is done under NEPA and then examines current practice on a U.S. National Forest, utilizing qualitative methods in order to provide a detailed understanding of current approaches to CEA. Research objectives were to understand current practice, investigate ongoing challenges, and identify impediments to improvement. Methods included a systematic review of a set of NEPA documents and semi-structured interviews with practitioners, scientists, and members of the public. Findings indicate that the primary challenges associated with CEA include: issues of both geographic and temporal scale of analysis, confusion over the purpose of the requirement, the lack of monitoring data, and problems coordinating and disseminating data. Improved monitoring strategies and programmatic analyses could support improved CEA practice.

  3. Cumulative Effects of Human Activities on Marine Mammal Populations

    Science.gov (United States)

    2015-09-30

    1 DISTRIBUTION STATEMENT A. Approved for public release; distribution is unlimited. Cumulative Effects of Human Activities on Marine Mammal ...marine mammals . OBJECTIVES The National Academies of Sciences, Engineering, and Medicine has convened a volunteer committee that will...Review the present scientific understanding of cumulative effects of anthropogenic stressors on marine mammals with a focus on anthropogenic sound

  4. Second time around: Corticospinal responses following repeated sports-related concussions within the same season. A transcranial magnetic stimulation study

    Directory of Open Access Journals (Sweden)

    Alan J Pearce

    2014-01-01

    Conclusions: This multiple-case study has demonstrated that concussion result in increased intracortical inhibition and reduction in cognitive and motor performance. Further, TMS, in conjunction with tests of cognitive and motor performance, can be useful as a prognostic technique in assessing recovery from acute concussion injury.

  5. Reduction of smoking in Dutch adolescents over the past decade and its health gains : a repeated cross-sectional study

    NARCIS (Netherlands)

    Gielkens-Sijstermans, Cindy M.; Mommers, Monique A.; Hoogenveen, Rudolf T.; Feenstra, Talitha L.; de Vreede, Jacqueline; Bovens, Fons M.; van Schayck, Onno C.

    Background: Smoking is the main preventable lifestyle-related risk factor threatening human health. In this study, time trends in smoking behaviour between 1996 and 2005 among adolescents enrolled in secondary school were assessed. Methods: In 1996, 2001 and 2005, a survey was conducted in the

  6. A repeated-measures study of recreational water exposure, non-point source pollution, and risk of illness

    Science.gov (United States)

    Discharge of stormwater runoff onto beaches is a major cause of beach closings and advisories in the United States. Prospective studies of recreational water quality and health have often been limited to two time points (baseline and follow-up). Little is known about the risk of ...

  7. All-optical repeater.

    Science.gov (United States)

    Silberberg, Y

    1986-06-01

    An all-optical device containing saturable gain, saturable loss, and unsaturable loss is shown to transform weak, distorted optical pulses into uniform standard-shape pulses. The proposed device performs thresholding, amplification, and pulse shaping as required from an optical repeater. It is shown that such a device could be realized by existing semiconductor technology.

  8. Bidirectional Manchester repeater

    Science.gov (United States)

    Ferguson, J.

    1980-01-01

    Bidirectional Manchester repeater is inserted at periodic intervals along single bidirectional twisted pair transmission line to detect, amplify, and transmit bidirectional Manchester 11 code signals. Requiring only 18 TTL 7400 series IC's, some line receivers and drivers, and handful of passive components, circuit is simple and relatively inexpensive to build.

  9. Lattice QCD results on cumulant ratios at freeze-out

    CERN Document Server

    Karsch, Frithjof

    2016-01-01

    Ratios of cumulants of net proton-number fluctuations measured by the STAR Collaboration show strong deviations from a skellam distribution, which should describe thermal properties of cumulant ratios, if proton-number fluctuations are generated in equilibrium and a hadron resonance gas (HRG) model would provide a suitable description of thermodynamics at the freeze-out temperature. We present some results on sixth order cumulants entering the calculation of the QCD equation of state at non-zero values of the baryon chemical potential (mu_B) and discuss limitations on the applicability of HRG thermodynamics deduced from a comparison between QCD and HRG model calculations of cumulants of conserved charge fluctuations. We show that basic features of the $\\mu_B$-dependence of skewness and kurtosis ratios of net proton-number fluctuations measured by the STAR Collaboration resemble those expected from a O(mu_B^2) QCD calculation of the corresponding net baryon-number cumulant ratios.

  10. The necessity of repeated assessment of imaging studies contained in medical records in medico-legal opinions

    Directory of Open Access Journals (Sweden)

    Aleksandra Borowska-Solonynko

    2014-12-01

    Full Text Available The paper presents two case reports of living victims, in which imaging studies of the chest conducted at a medical facility were an essential part of the medico-legal opinion. The first case was that of a young male hospitalized due to CT evidence of bilateral rib fractions, who claimed to have been assaulted by police officers. The other case was that of a six week old baby hospitalized due to chest X-ray evidence of right hand side rib fractions. The chest X-ray was performed due to one bruise found on the baby’s forehead and two small bruises on the back, which gave rise to suspicions of child abuse. In both cases, expert witnesses in radiology definitively excluded the presence of any fractures. These cases indicate that a new assessment of imaging studies contained in medical records is needed. Expert opinions based solely on the description of imaging studies may result in grave consequences.

  11. Repeated dose 28-days oral toxicity study of Carica papaya L. leaf extract in Sprague Dawley rats.

    Science.gov (United States)

    Afzan, Adlin; Abdullah, Noor Rain; Halim, Siti Zaleha; Rashid, Badrul Amini; Semail, Raja Hazlini Raja; Abdullah, Noordini; Jantan, Ibrahim; Muhammad, Hussin; Ismail, Zakiah

    2012-04-10

    Carica papaya L. leaves have been used in ethnomedicine for the treatment of fevers and cancers. Despite its benefits, very few studies on their potential toxicity have been described. The aim of the present study was to characterize the chemical composition of the leaf extract from 'Sekaki' C. papaya cultivar by UPLC-TripleTOF-ESI-MS and to investigate the sub-acute oral toxicity in Sprague Dawley rats at doses of 0.01, 0.14 and 2 g/kg by examining the general behavior, clinical signs, hematological parameters, serum biochemistry and histopathology changes. A total of twelve compounds consisting of one piperidine alkaloid, two organic acids, six malic acid derivatives, and four flavonol glycosides were characterized or tentatively identified in the C. papaya leaf extract. In the sub-acute study, the C. papaya extract did not cause mortality nor were treatment-related changes in body weight, food intake, water level, and hematological parameters observed between treatment and control groups. Some biochemical parameters such as the total protein, HDL-cholesterol, AST, ALT and ALP were elevated in a non-dose dependent manner. Histopathological examination of all organs including liver did not reveal morphological alteration. Other parameters showed non-significant differences between treatment and control groups. The present results suggest that C. papaya leaf extract at a dose up to fourteen times the levels employed in practical use in traditional medicine in Malaysia could be considered safe as a medicinal agent.

  12. Mathematical modeling of detonation initiation via flow cumulation effects

    Science.gov (United States)

    Semenov, I.; Utkin, P.; Akhmedyanov, I.

    2016-07-01

    The paper concerns two problems connected with the idea of gaseous detonation initiation via flow cumulation effects and convergence of relatively weak shock waves (SW). The first one is the three-dimensional (3D) numerical investigation of shock-to-detonation transition (SDT) in methane-air mixture in a tube with parabolic contraction followed by the tube section of narrow diameter and conical expansion. The second problem is the numerical study of the start-up of the model small-scale hydrogen electrochemical pulse detonation engine with the use of electrical discharge generating the toroidal SW. The investigation is performed by means of numerical simulation with the use of modern high-performance computing systems.

  13. Cumulative Laws,Team Assembling Mechanisms Determining Network Structure

    Institute of Scientific and Technical Information of China (English)

    WU Bin; LIU Qi; YE Qi

    2008-01-01

    A number of researching works have shed light on the field of complex networks recently.We investigate a wide range of real-world networks and find several interesting phenomena.Firstly,almost all of these networks evolve by overlapping new small graphs on former networks.Secondly,not only the degree sequence of the mature network follows a power-law distribution,but also the distribution of the cumulative occurrence times during the growing process are revealed to have a heavy tail.Existing network evolving models do not provide interpretation to these phenomena.We suggest a model based on the team assembling mechanism,which is extracted from the growing processes of real-world networks and requires simple parameters,and produces networks exhibiting these properties observed in the present study and in previous works.

  14. The cumulative effect of risk compensation on infection preventive measures.

    Science.gov (United States)

    Maxin, Daniel; Sega, Laurentiu; Eaton, Lisa

    2016-12-01

    We study several epidemic models (with and without gender structure) that incorporate risk compensation behavior in response to a lower chance of acquiring the infection as a result of preventive measures that are only partially effective. We show that the cumulative risk compensation that occurs between a high risk susceptible and infectious individual may play an important role in whether the implementation of these measures is successful in lowering the epidemic reproductive number. In addition, we show that certain levels of risk compensation may cancel the benefit of the low infection risk practiced by diagnosed infectious individuals when the goal is a reduction of the epidemic reproductive number. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. EXPERIMENTAL VALIDATION OF CUMULATIVE SURFACE LOCATION ERROR FOR TURNING PROCESSES

    Directory of Open Access Journals (Sweden)

    Adam K. Kiss

    2016-02-01

    Full Text Available The aim of this study is to create a mechanical model which is suitable to investigate the surface quality in turning processes, based on the Cumulative Surface Location Error (CSLE, which describes the series of the consecutive Surface Location Errors (SLE in roughing operations. In the established model, the investigated CSLE depends on the currently and the previously resulted SLE by means of the variation of the width of cut. The phenomenon of the system can be described as an implicit discrete map. The stationary Surface Location Error and its bifurcations were analysed and flip-type bifurcation was observed for CSLE. Experimental verification of the theoretical results was carried out.

  16. Cumulative Incidence Association Models for Bivariate Competing Risks Data.

    Science.gov (United States)

    Cheng, Yu; Fine, Jason P

    2012-03-01

    Association models, like frailty and copula models, are frequently used to analyze clustered survival data and evaluate within-cluster associations. The assumption of noninformative censoring is commonly applied to these models, though it may not be true in many situations. In this paper, we consider bivariate competing risk data and focus on association models specified for the bivariate cumulative incidence function (CIF), a nonparametrically identifiable quantity. Copula models are proposed which relate the bivariate CIF to its corresponding univariate CIFs, similarly to independently right censored data, and accommodate frailty models for the bivariate CIF. Two estimating equations are developed to estimate the association parameter, permitting the univariate CIFs to be estimated either parametrically or nonparametrically. Goodness-of-fit tests are presented for formally evaluating the parametric models. Both estimators perform well with moderate sample sizes in simulation studies. The practical use of the methodology is illustrated in an analysis of dementia associations.

  17. Generosity pays in the presence of direct reciprocity: a comprehensive study of 2 × 2 repeated games.

    Directory of Open Access Journals (Sweden)

    Luis A Martinez-Vaquero

    Full Text Available By applying a technique previously developed to study ecosystem assembly [Capitán et al., Phys. Rev. Lett. 103, 168101 (2009] we study the evolutionary stable strategies of iterated 2 × 2 games. We focus on memory-one strategies, whose probability to play a given action depends on the actions of both players in the previous time step. We find the asymptotically stable populations resulting from all possible invasions of any known stable population. The results of this invasion process are interpreted as transitions between different populations that occur with a certain probability. Thus the whole process can be described as a Markov chain whose states are the different stable populations. With this approach we are able to study the whole space of symmetric 2 × 2 games, characterizing the most probable results of evolution for the different classes of games. Our analysis includes quasi-stationary mixed equilibria that are relevant as very long-lived metastable states and is compared to the predictions of a fixation probability analysis. We confirm earlier results on the success of the Pavlov strategy in a wide range of parameters for the iterated Prisoner's Dilemma, but find that as the temptation to defect grows there are many other possible successful strategies. Other regions of the diagram reflect the equilibria structure of the underlying one-shot game, albeit often some non-expected strategies arise as well. We thus provide a thorough analysis of iterated 2 × 2 games from which we are able to extract some general conclusions. Our most relevant finding is that a great deal of the payoff parameter range can still be understood by focusing on win-stay, lose-shift strategies, and that very ambitious ones, aspiring to obtaining always a high payoff, are never evolutionary stable.

  18. Changes in surgical team performance and safety climate attitudes following expansion of perioperative services: a repeated-measures study.

    Science.gov (United States)

    Gillespie, Brigid M; Harbeck, Emma; Kang, Evelyn; Steel, Catherine; Fairweather, Nicole; Chaboyer, Wendy

    2017-08-10

    Objective The aim of the present study was to describe process changes in surgical team performance and team members' attitudes to safety culture following hospital relocation and expansion of perioperative services.Methods The study was a naturalistic study using structured observations and surveys to assess non-technical skills (NTS; i.e. communication, teamwork, situational awareness, decision making and leadership) in surgery. This interrupted time series design used mixed-linear regression models to examine the effect of phase (before and after hospital relocation) on surgical teams' NTS and their processes that may affect performance. Differences in self-reported teamwork and safety climate attitudes were also examined.Results In all, 186 procedures (100 before and 81 after hospital relocation) were observed across teams working in general, paediatric, orthopaedic and thoracic surgeries. Interobserver agreement ranged from 86% to 95%. An effect of phase was found, indicating that there were significant improvements after relocation in the use of NTS by the teams observed (P=0.020; 95% confidence interval 1.9-4.7).Conclusions The improvements seen in surgical teams' NTS performance and safety culture attitudes may be related to the move to a new state-of-the-art perioperative department.What is known about the topic? Patient safety in surgery relies on optimal team performance, underpinned by effective NTS.What does this paper add? The NTS of surgical teams may be improved through ergonomic innovations that promote teams' shared mental models.What are the implications for practitioners? Effective multidisciplinary teamwork relies on a combination of NTS and ergonomic factors, which inherently contribute to team performance and safety climate attitudes.

  19. Feedback from an image of finger and an actual finger produce similar prismatic after-effect: a repeated measures study

    DEFF Research Database (Denmark)

    Wilms, Inge Linda; Assentoft, Emilie

    2014-01-01

    by seeing their fingertip. In the second condition subjects saw an image of a fingertip. The results indicate that the two conditions are significantly different. The study is an important step in understanding what actually makes a difference in training when trying to convert paper-and-pencil training...... if it is the format rather than the indirectness of the feedback creating this difference. 27 healthy subjects were subjected to a single session of Prism Adaptation Training under two different feedback conditions. In the first feedback condition, subjects were exposed to visual feedback on pointing precision...

  20. Long-term facial improvement after repeated BoNT-A injections and mirror biofeedback exercises for chronic facial synkinesis: a case-series study.

    Science.gov (United States)

    Mandrini, Silvia; Comelli, Mario; Dall'angelo, Anna; Togni, Rossella; Cecini, Miriam; Pavese, Chiara; Dalla Toffola, Elena

    2016-12-01

    Only few studies have considered the effects of the combined treatment with onabotulinumtoxinA (BoNT-A) injections and biofeedback (BFB) rehabilitation in the recovery of postparetic facial synkinesis (PPFS). To explore the presence of a persistent improvement in facial function out of the pharmacological effect of BoNT-A in subjects with established PPFS, after repeated sessions of BoNT-A injections combined with an educational facial training program using mirror biofeedback (BFB) exercises. Secondary objective was to investigate the trend of the presumed persistent improvement. Case-series study. Outpatient Clinic of Physical Medicine and Rehabilitation Unit. Twenty-seven patients (22 females; mean age 45±16 years) affected by an established peripheral facial palsy, treated with a minimum of three BoNT-A injections in association with mirror BFB rehabilitation. The interval between consecutive BoNT-A injections was at least five months. At baseline and before every BoNT-A injection+mirror BFB session (when the effect of the previous BoNT-A injection had vanished), patients were assessed with the Italian version of Sunnybrook Facial Grading System (SB). The statistical analysis considered SB composite and partial scores before each treatment session compared to the baseline scores. A significant improvement of the SB composite and partial scores was observed until the fourth session. Considering the "Symmetry of Voluntary Movement" partial score, the main improvement was observed in the muscles of the lower part of the face. In a chronic stage of postparetic facial synkinesis, patients may benefit from a combined therapy with repeated BoNT-A injections and an educational facial training program with mirror BFB exercises, gaining an improvement of the facial function up to the fourth session. This improvement reflects the acquired ability to use facial muscle correctly. It doesn't involve the injected muscles but those trained with mirror biofeedback exercises

  1. Repeated dose studies with pure Epigallocatechin-3-gallate demonstrated dose and route dependant hepatotoxicity with associated dyslipidemia

    Directory of Open Access Journals (Sweden)

    Balaji Ramachandran

    2016-01-01

    Full Text Available EGCG (Epigallocatechin-3-gallate is the major active principle catechin found in green tea. Skepticism regarding the safety of consuming EGCG is gaining attention, despite the fact that it is widely being touted for its potential health benefits, including anti-cancer properties. The lack of scientific data on safe dose levels of pure EGCG is of concern, while EGCG has been commonly studied as a component of GTE (Green tea extract and not as a single active constituent. This study has been carried out to estimate the maximum tolerated non-toxic dose of pure EGCG and to identify the treatment related risk factors. In a fourteen day consecutive treatment, two different administration modalities were compared, offering an improved [i.p (intraperitoneal] and limited [p.o (oral] bioavailability. A trend of dose and route dependant hepatotoxicity was observed particularly with i.p treatment and EGCG increased serum lipid profile in parallel to hepatotoxicity. Fourteen day tolerable dose of EGCG was established as 21.1 mg/kg for i.p and 67.8 mg/kg for p.o. We also observed that, EGCG induced effects by both treatment routes are reversible, subsequent to an observation period for further fourteen days after cessation of treatment. It was demonstrated that the severity of EGCG induced toxicity appears to be a function of dose, route of administration and period of treatment.

  2. Study on critical heat flux in narrow rectangular channel with repeated-rib roughness. 1. Experimental facility and preliminary experiments

    Energy Technology Data Exchange (ETDEWEB)

    Kinoshita, Hidetaka; Terada, Atsuhiko; Kaminaga, Masanori; Hino, Ryutaro [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    2001-10-01

    In the design of a spallation target system, the water cooling system, for example a proton beam window and a safety hull, is used with narrow channels, in order to remove high heat flux and prevent lowering of system performance by absorption of neutron. And in narrow channel, heat transfer enhancement using 2-D rib is considered for reduction the cost of cooling component and decrease inventory of water in the cooling system, that is, decrease of the amount of irradiated water. But few studies on CHF with rib have been carried out. Experimental and analytical studies with rib-roughened test section, in 10:1 ratio of pitch to height, are being carried out in order to clarify the CHF in rib-roughened channel. This paper presents the review of previous researches on heat transfer in channel with rib roughness, overview of the test facility and the preliminary experimental and analytical results. As a result, wall friction factors were about 3 times as large as that of smooth channel, and heat transfer coefficients are about 2 times as large as that of smooth channel. The obtained CHF was as same as previous mechanistic model by Sudo. (author)

  3. Violence towards health care workers in a Public Health Care Facility in Italy: a repeated cross-sectional study

    Directory of Open Access Journals (Sweden)

    Magnavita Nicola

    2012-05-01

    Full Text Available Abstract Background Violence at work is one of the major concerns in health care activities. The aim of this study was to identify the prevalence of physical and non-physical violence in a general health care facility in Italy and to assess the relationship between violence and psychosocial factors, thereby providing a basis for appropriate intervention. Methods All health care workers from a public health care facility were invited to complete a questionnaire containing questions on workplace violence. Three questionnaire-based cross-sectional surveys were conducted. The response rate was 75 % in 2005, 71 % in 2007, and 94 % in 2009. The 2009 questionnaire contained the VIF (Violent Incident Form for reporting violent incidents, the DCS (demand/control/support model for job strain, the Colquitt 20 item questionnaire for perceived organizational justice, and the GHQ-12 General Health Questionnaire for the assessment of mental health. Results One out of ten workers reported physical assault, and one out of three exposure to non-physical violence in the workplace in the previous year. Nurses and physicians were the most exposed occupational categories, whereas the psychiatric and emergency departments were the services at greatest risk of violence. Workers exposed to non-physical violence were subject to high job strain, low support, low perceived organizational justice, and high psychological distress. Conclusion Our study shows that health care workers in an Italian local health care facility are exposed to violence. Workplace violence was associated with high demand and psychological disorders, while job control, social support and organizational justice were protective factors.

  4. Fatigue In U12 Soccer-7 Players During Repeated One-Day Tournament Games - A Pilot Study.

    Science.gov (United States)

    Sanchez-Sanchez, Javier; Sanchez, Mario; Hernandez, Daniel; Ramirez-Campillo, Rodrigo; Martínez, Cristian; Nakamura, Fabio Y

    2017-07-12

    The aim of this study was to describe and compare the distances and displacement speeds of U12 Soccer-7 athletes during four tournament Soccer-7 games (TG) played in less than 24-h (experimental condition) with those recorded during two league Soccer-7 games (LG) with 24-h of rest prior to the match (control condition). Ten participants (age = 10.3 ± 0.5 years) were recruited for the study. Main data analyzed during games included distance completed relative to match duration (Drel), maximal velocity and distance completed at different running speeds (including acceleration, deceleration, standing, walking, jogging, medium-intensity running, high-intensity running and sprinting). For data collection during games, athletes wore a GPS unit. Different (p0.05) and during the two LG between 84.2 ± 10.9 m/min and 87.5 ± 9.9 m/min (P>0.05). Moreover, similar Drel was recorded during TG and LG (86.8 m/min and 85.9 m/min, respectively). Compared to LG, during TG maximal velocity was lower (23.0 km/h and 21.3 km/h, respectively; Pgame of the tournament, in the preceding games the distance covered at low speeds (3.1-8.0 km/h) was lower (37.7% and 32.4%, respectively; Pgames with less than 24-h of inter-day rest negatively affects displacement speeds distribution (but not overall relative distances) in U12 Soccer-7 athletes. These results may help to better plan training and competition schedules to youth players.

  5. Effects of ambient air pollution on functional status in patients with chronic congestive heart failure: a repeated-measures study

    Directory of Open Access Journals (Sweden)

    Phillips Russell S

    2007-09-01

    Full Text Available Abstract Background Studies using administrative data report a positive association between ambient air pollution and the risk of hospitalization for congestive heart failure (HF. Circulating levels of B-type natriuretic peptide (BNP are directly associated with cardiac hemodynamics and symptom severity in patients with HF and, therefore, serves as a marker of functional status. We tested the hypothesis that BNP levels would be positively associated with short-term changes in ambient pollution levels among 28 patients with chronic stable HF and impaired systolic function. Methods BNP was measured in whole blood at 0, 6, and 12 weeks. We used linear mixed models to evaluate the association between fine particulate matter (PM2.5, carbon monoxide, sulfur dioxide, nitrogen dioxide, ozone, and black carbon and log(BNP. Lags of 0 to 3 days were considered in separate models. We calculated the intraclass correlation coefficient and within-subject coefficient of variation as measures of reproducibility. Results We found no association between any pollutant and measures of BNP at any lag. For example, a 10 μg/m3 increase in PM2.5 was associated with a 0.8% (95% CI: -16.4, 21.5; p = 0.94 increase in BNP on the same day. The within-subject coefficient of variation was 45% on the natural scale and 9% on the log scale. Conclusion These results suggest that serial BNP measurements are unlikely to be useful in a longitudinal study of air pollution-related acute health effects. The magnitude of expected ambient air pollution health effects appears small in relation to the considerable within-person variability in BNP levels in this population.

  6. A bivariate optimal replacement policy with cumulative repair cost limit under cumulative damage model

    Indian Academy of Sciences (India)

    MIN-T SAI LAI; SHIH-CHIH CHEN

    2016-05-01

    In this paper, a bivariate replacement policy (n, T) for a cumulative shock damage process is presented that included the concept of cumulative repair cost limit. The arrival shocks can be divided into two kinds of shocks. Each type-I shock causes a random amount of damage and these damages are additive. When the total damage exceeds a failure level, the system goes into serious failure. Type-II shock causes the system into minor failure and such a failure can be corrected by minimal repair. When a minor failure occurs, the repaircost will be evaluated and minimal repair is executed if the accumulated repair cost is less than a predetermined limit L. The system is replaced at scheduled time T, at n-th minor failure, or at serious failure. The long-term expected cost per unit time is derived using the expected costs as the optimality criterion. The minimum-cost policy is derived, and existence and uniqueness of the optimal n* and T* are proved. This bivariate optimal replacement policy (n, T) is showed to be better than the optimal T* and the optimal n* policy.

  7. Study on cumulative effect of acupuncture on Fenglong (ST 40) to hemodynamics of PCA%丰隆对大脑后动脉血液动力学的针刺累积效应

    Institute of Scientific and Technical Information of China (English)

    程为平; 袁彬; 郑艺

    2011-01-01

    目的 探讨针刺左侧丰隆穴对双侧大脑后动脉(PCA)血液动力学是否存在针刺累积效应.方法 针刺16名健康志愿者左侧丰隆穴,采用经颅多谱勒超声仪(TCD)分别在针刺前10 min、进针得气时、留针15 min后、出针时、出针10 min后检测两侧大脑后动脉收缩期最大血流速度(Vs)、舒张期最大血流速度(Vd)、平均血流速度(Vm)、搏动指数(PI)及阻抗指数(RI),并进行统计学分析.结果 左侧出针10 min后TCD的Vs、Vd、Vm参数[分别为(84.56±19.72) cm/s、(39.75±10.15) cm/s、(56.13±14.73) cm/s],均较进针前10 min下降(P<0.05),其余各值与进针前10 min比较变化不明显(P>0.05).结论 针刺左侧丰隆穴能降低出针10 min后同侧得PCA的Vs、Vd、Vm,因而认为具有针刺累积效应,提示针刺该穴时应注意留针时间.%Objective To discuss the cumulative effect of acupuncture on left ST40 to hemodynamic of PCA.Methods Sixteen healthy young people were randomly chosen to be acupunctured on left ST40 and parameters of TCD such as Vs,Vd,Vm,PI and RI were managed to be recorded sequentially at the 5 points below to make out an statistical analysis:10 min before acupuncture; the time of inserting the needles; 15 min after retaining the needles; the time when taking the needles out; 10 min after the acupunture.Results The parameters of TCD Vs,Vd,Vm 10min after withdrawing the needle [Were ( 84.56± 19.72) cm/s、( 39.75 ±10.15 ) cm/s、(56.13 ± 14.73 ) cm/s each] all showed a decline compared with the parameters 10min before acupuncture(P<0.05),while other parameters turned out to be almost the same (P>0.05).Conclusion Acupuncture on left ST40 has cumulative effect on Vs,Vd and Vm,which suggest us the needle retention time should be noted.

  8. Characterization of regional left ventricular function in nonhuman primates using magnetic resonance imaging biomarkers: a test-retest repeatability and inter-subject variability study.

    Directory of Open Access Journals (Sweden)

    Smita Sampath

    Full Text Available Pre-clinical animal models are important to study the fundamental biological and functional mechanisms involved in the longitudinal evolution of heart failure (HF. Particularly, large animal models, like nonhuman primates (NHPs, that possess greater physiological, biochemical, and phylogenetic similarity to humans are gaining interest. To assess the translatability of these models into human diseases, imaging biomarkers play a significant role in non-invasive phenotyping, prediction of downstream remodeling, and evaluation of novel experimental therapeutics. This paper sheds insight into NHP cardiac function through the quantification of magnetic resonance (MR imaging biomarkers that comprehensively characterize the spatiotemporal dynamics of left ventricular (LV systolic pumping and LV diastolic relaxation. MR tagging and phase contrast (PC imaging were used to quantify NHP cardiac strain and flow. Temporal inter-relationships between rotational mechanics, myocardial strain and LV chamber flow are presented, and functional biomarkers are evaluated through test-retest repeatability and inter subject variability analyses. The temporal trends observed in strain and flow was similar to published data in humans. Our results indicate a dominant dimension based pumping during early systole, followed by a torsion dominant pumping action during late systole. Early diastole is characterized by close to 65% of untwist, the remainder of which likely contributes to efficient filling during atrial kick. Our data reveal that moderate to good intra-subject repeatability was observed for peak strain, strain-rates, E/circumferential strain-rate (CSR ratio, E/longitudinal strain-rate (LSR ratio, and deceleration time. The inter-subject variability was high for strain dyssynchrony, diastolic strain-rates, peak torsion and peak untwist rate. We have successfully characterized cardiac function in NHPs using MR imaging. Peak strain, average systolic strain

  9. Longhi Games, Internal Reservoirs, and Cumulate Porosity

    Science.gov (United States)

    Morse, S. A.

    2009-05-01

    Fe in plagioclase at an early age, T-rollers (or not) on the Di-Trid boundary in Fo-Di-Sil, the mantle solidus, origins of anorthosites, esoteric uses of Schreinemakers rules and many more topics are all fresh and pleasant memories of John Longhi's prolific and creative work. The Fram-Longhi experimental effect of pressure on plagioclase partitioning with liquid in mafic rocks became essential to an understanding of multiphase Rayleigh fractionation of plagioclase in big layered intrusions. Only by using the pressure effect could I find a good equation through the data for the Kiglapait intrusion, and that result among others required the existence with probability 1.0 of an internal reservoir (Morse, JPet 2008). Knowledge of cumulate porosity is a crucial key to the understanding of layered igneous rocks. We seek both the initial (inverse packing fraction) and residual porosity to find the time and process path from sedimentation to solidification. In the Kiglapait Lower Zone we have a robust estimate of mean residual porosity from the modes of the excluded phases augite, oxides, sulfide, and apatite. To this we apply the maximum variance of plagioclase composition (the An range) to find an algorithm that extends through the Upper Zone and to other intrusions. Of great importance is that all these measurements were made in grain mounts concentrated from typically about 200 g of core or hand specimen, hence the represented sample volume is thousands of times greater than for a thin section. The resulting distribution and scatter of the An range is novel and remarkable. It is V-shaped in the logarithmic representation of stratigraphic height, running from about 20 mole % at both ends (base to top of the Layered Series) to near-zero at 99 PCS. The intercept of the porosity-An range relation gives An range = 3.5 % at zero residual porosity. Petrographic analysis reveals that for PCS less than 95 and greater than 99.9, the An range is intrinsic, i.e. pre-cumulus, for

  10. Between two roles - Experiences of newly trained nurse practitioners in surgical care in Sweden: A qualitative study using repeated interviews.

    Science.gov (United States)

    Jangland, Eva; Yngman Uhlin, Pia; Arakelian, Erebouni

    2016-11-01

    The position of Nurse Practitioner is a new role in Nordic countries. The transition from a registered nurse to the Nurse Practitioner role has been reported to be a personal challenge. This study, guided by the Nordic theoretical model for use in the education of advanced practice nurses, represents a unique opportunity to describe this transition for newly graduated Nurse Practitioners in an interprofessional surgical care team in Sweden. The aim was to explore how the first Nurse Practitioners in surgical care experienced the transition into a new role and what competences they used in the team. Eight new Nurse Practitioners with parallel work in clinical practice were interviewed twice around the time of their graduation. The qualitative analyses show that the participants integrated several central competences, but the focus in this early stage in their new role was on direct clinical praxis, consultation, cooperation, case management, and coaching. Transition from the role of clinical nurse specialist to nurse practitioner was a challenging process in which the positive response from patients was a driving force for the new Nurse Practitioners. The participants felt prepared for and determined to solve the challenging situations they approached working in the interprofessional team.

  11. (1)H NMR-based metabolomics study on repeat dose toxicity of fine particulate matter in rats after intratracheal instillation.

    Science.gov (United States)

    Zhang, Yannan; Hu, Hejing; Shi, Yanfeng; Yang, Xiaozhe; Cao, Lige; Wu, Jing; Asweto, Collins Otieno; Feng, Lin; Duan, Junchao; Sun, Zhiwei

    2017-07-01

    Systemic metabolic effects and toxicity mechanisms of ambient fine particulate matter (PM2.5) remain uncertain. In order to investigate the mechanisms in PM2.5 toxicity, we explored the endogenous metabolic changes and possible influenced metabolic pathways in rats after intratracheal instillation of PM2.5 by using a (1)H nuclear magnetic resonance (NMR)-based metabolomics approach. Liver and kidney histopathology examinations were also performed. Chemical characterization demonstrated that PM2.5 was a complex mixture of elements. Histopathology showed cellular edema in liver and glomerulus atrophy of the PM2.5 treated rats. We systematically analyzed the metabolites changes of serum and urine in rats using (1)H NMR techniques in combination with multivariate statistical analysis. Significantly reduced levels of lactate, alanine, dimethylglycine, creatine, glycine and histidine in serum, together with increased levels of citrate, arginine, hippurate, allantoin and decreased levels of allthreonine, lactate, alanine, acetate, succinate, trimethylamine, formate in urine were observed of PM2.5 treated rats. The mainly affected metabolic pathways by PM2.5 were glycine, serine and threonine metabolism, glyoxylate and dicarboxylate metabolism, citrate cycle (TCA cycle), nitrogen metabolism and methane metabolism. Our study provided important information on assessing the toxicity of PM2.5 and demonstrated that metabolomics approach can be employed as a tool to understand the toxicity mechanism of complicated environmental pollutants. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. The impact of cumulative family risks on various levels of food insecurity.

    Science.gov (United States)

    Hernandez, Daphne C

    2015-03-01

    The study uses the Fragile Families and Child Well-being Study (N=2025) to examine the relationship between four cumulative family risk indices and refined measures of food hardship: marginal food security, low food security, and very low food security. Regression analyses indicate that cumulative family risk indices are useful in differentiating various levels of food insecurity. Specifically, the maternal poor health and risky health behaviors index is pertinent for distinguishing (1) food insecure from marginal food secure households and (2) very low food secure from low food secure households. In addition, the financial strain index is pertinent for differentiating between marginal food secure families from food secure families among non-poor households. Connecting food assistance programs with established social services may decrease the negative impact that cumulative family-level risk factors have on families' varying levels of food insecurity.

  13. Kindling fires: examining the potential for cumulative learning in a Journalism curriculum

    KAUST Repository

    Kilpert, Leigh

    2013-01-01

    This study investigated context-dependency of learning as an indicator for students\\' potential to continue learning after graduation. We used Maton\\'s theoretical concepts of \\'cumulative\\' and \\'segmented\\' learning, and \\'semantic gravity\\', to look for context-independent learning in students\\' assessments in a Journalism curriculum. We postulated whether the curriculum constrained or enabled cumulative learning. Students\\' responses to assessments were coded by their degree of context-dependency, or semantic gravity. We found that, firstly, students are overly successful in producing context-dependent answers but struggle to deliver context-independent responses. Secondly, students were not effective when they used higher level knowledge principles without the foundation of lower level ones. Lastly, the marking criteria were encouraging markers to reward context-dependent answers over context-independent ones. This study has implications for educators interested in curriculum design that enables cumulative learning in discipline specific contexts. © 2013 Copyright Taylor and Francis Group, LLC.

  14. Socioeconomic inequalities in smoking in The Netherlands before and during the Global Financial Crisis: a repeated cross-sectional study.

    Science.gov (United States)

    Benson, Fiona E; Kuipers, Mirte A G; Nierkens, Vera; Bruggink, Jan-Willem; Stronks, Karien; Kunst, Anton E

    2015-05-06

    The Global Financial Crisis (GFC) increased levels of financial strain, especially in those of low socioeconomic status (SES). Financial strain can affect smoking behaviour. This study examines socioeconomic inequalities in current smoking and smoking cessation in The Netherlands before and during the Global Financial Crisis (GFC). Participants were 66,960 Dutch adults (≥ 18 years) who took part in the annual national Health Survey (2004-2011). Period was dichotomised: 'pre-' and 'during-GFC'. SES measures used were income, education and neighbourhood deprivation. Outcomes were current smoking rates (smokers/total population) and smoking cessation ratios (former smokers/ever smokers). Multilevel logistic regression models controlled for individual characteristics and tested for interaction between period and SES. In both periods, high SES respondents (in all indicators) had lower current smoking levels and higher cessation ratios than those of middle or low SES. Inequalities in current smoking increased significantly in poorly educated adults of 45-64 years of age (Odds Ratio (OR) low educational level compared with high: 2.00[1.79-2.23] compared to pre-GFC 1.67[1.50-1.86], p for interaction = 0.02). Smoking cessation inequalities by income in 18-30 year olds increased with borderline significance during the GFC (OR low income compared to high income: 0.73[0.58-0.91]) compared to pre-GFC (OR: 0.98[0.80-1.20]), p for interaction = 0.051). Overall, socioeconomic inequalities in current smoking and smoking cessation were unchanged during the GFC. However, current smoking inequalities by education, and smoking cessation inequalities by income, increased in specific age groups. Increased financial strain caused by the crisis may disproportionately affect smoking behaviour in some disadvantaged groups.

  15. Burden of hospital admission and repeat angiography in angina pectoris patients with and without coronary artery disease: a registry-based cohort study.

    Directory of Open Access Journals (Sweden)

    Lasse Jespersen

    Full Text Available AIMS: To evaluate risk of hospitalization due to cardiovascular disease (CVD and repeat coronary angiography (CAG in stable angina pectoris (SAP with no obstructive coronary artery disease (CAD versus obstructive CAD, and asymptomatic reference individuals. METHODS AND RESULTS: We followed 11,223 patients with no prior CVD having a first-time CAG in 1998-2009 due to SAP symptoms and 5,695 asymptomatic reference individuals from the Copenhagen City Heart Study through registry linkage for 7.8 years (median. In recurrent event survival analysis, patients with SAP had 3-4-fold higher risk of hospitalization for CVD irrespective of CAG findings and cardiovascular comorbidity. Multivariable adjusted hazard ratios(95%CI for patients with angiographically normal coronary arteries was 3.0(2.5-3.5, for angiographically diffuse non-obstructive CAD 3.9(3.3-4.6 and for 1-3-vessel disease 3.6-4.1(range(all P<0.001. Mean accumulated hospitalization time was 3.5(3.0-4.0(days/10 years follow-up in reference individuals and 4.5(3.8-5.2/7.0(5.4-8.6/6.7(5.2-8.1/6.1(5.2-7.4/8.6(6.6-10.7 in patients with angiographically normal coronary arteries/angiographically diffuse non-obstructive CAD/1-, 2-, and 3-vessel disease, respectively (all P<0.05, age-adjusted. SAP symptoms predicted repeat CAG with multivariable adjusted hazard ratios for patients with angiographically normal coronary arteries being 2.3(1.9-2.9, for angiographically diffuse non-obstructive CAD 5.5(4.4-6.8 and for obstructive CAD 6.6-9.4(range(all P<0.001. CONCLUSIONS: Patients with SAP symptoms and angiographically normal coronary arteries or angiographically diffuse non-obstructive CAD suffer from considerably greater CVD burdens in terms of hospitalization for CVD and repeat CAG compared with asymptomatic reference individuals even after adjustment for cardiac risk factors and exclusion of cardiovascular comorbidity as cause. Contrary to common perception, excluding obstructive CAD by CAG in such

  16. Facilitating the Development and Evaluation of a Citizen Science Web Site: A Case Study of Repeat Photography and Climate Change in Southwest Alaska's National Parks

    Science.gov (United States)

    Mullen, Karina C.; Newman, Gregory; Thompson, Jessica L.

    2013-01-01

    Interviews with national park visitors across the country revealed that climate change education through place-based, hands-on learning using repeat photographs and technology is appealing to park visitors. This manuscript provides a summary of the development of a repeat photography citizen science Web site for national parks in Southwest Alaska.…

  17. Facilitating the Development and Evaluation of a Citizen Science Web Site: A Case Study of Repeat Photography and Climate Change in Southwest Alaska's National Parks

    Science.gov (United States)

    Mullen, Karina C.; Newman, Gregory; Thompson, Jessica L.

    2013-01-01

    Interviews with national park visitors across the country revealed that climate change education through place-based, hands-on learning using repeat photographs and technology is appealing to park visitors. This manuscript provides a summary of the development of a repeat photography citizen science Web site for national parks in Southwest Alaska.…

  18. The effects of increased constant incubation temperature and cumulative acute heat shock exposures on morphology and survival of Lake Whitefish (Coregonus clupeaformis) embryos.

    Science.gov (United States)

    Lee, Abigail H; Eme, John; Mueller, Casey A; Manzon, Richard G; Somers, Christopher M; Boreham, Douglas R; Wilson, Joanna Y

    2016-04-01

    Increasing incubation temperatures, caused by global climate change or thermal effluent from industrial processes, may influence embryonic development of fish. This study investigates the cumulative effects of increased incubation temperature and repeated heat shocks on developing Lake Whitefish (Coregonus clupeaformis) embryos. We studied the effects of three constant incubation temperatures (2°C, 5°C or 8°C water) and weekly, 1-h heat shocks (+3°C) on hatching time, survival and morphology of embryos, as these endpoints may be particularly susceptible to temperature changes. The constant temperatures represent the predicted magnitude of elevated water temperatures from climate change and industrial thermal plumes. Time to the pre-hatch stage decreased as constant incubation temperature increased (148d at 2°C, 92d at 5°C, 50d at 8°C), but weekly heat shocks did not affect time to hatch. Mean survival rates and embryo morphometrics were compared at specific developmental time-points (blastopore, eyed, fin flutter and pre-hatch) across all treatments. Constant incubation temperatures or +3°C heat-shock exposures did not significantly alter cumulative survival percentage (~50% cumulative survival to pre-hatch stage). Constant warm incubation temperatures did result in differences in morphology in pre-hatch stage embryos. 8°C and 5°C embryos were significantly smaller and had larger yolks than 2°C embryos, but heat-shocked embryos did not differ from their respective constant temperature treatment groups. Elevated incubation temperatures may adversely alter Lake Whitefish embryo size at hatch, but weekly 1-h heat shocks did not affect size or survival at hatch. These results suggest that intermittent bouts of warm water effluent (e.g., variable industrial emissions) are less likely to negatively affect Lake Whitefish embryonic development than warmer constant incubation temperatures that may occur due to climate change.

  19. A method proposal for cumulative environmental impact assessment based on the landscape vulnerability evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Pavlickova, Katarina; Vyskupova, Monika, E-mail: vyskupova@fns.uniba.sk

    2015-01-15

    Cumulative environmental impact assessment deals with the occasional use in practical application of environmental impact assessment process. The main reasons are the difficulty of cumulative impact identification caused by lack of data, inability to measure the intensity and spatial effect of all types of impacts and the uncertainty of their future evolution. This work presents a method proposal to predict cumulative impacts on the basis of landscape vulnerability evaluation. For this purpose, qualitative assessment of landscape ecological stability is conducted and major vulnerability indicators of environmental and socio-economic receptors are specified and valuated. Potential cumulative impacts and the overall impact significance are predicted quantitatively in modified Argonne multiple matrixes while considering the vulnerability of affected landscape receptors and the significance of impacts identified individually. The method was employed in the concrete environmental impact assessment process conducted in Slovakia. The results obtained in this case study reflect that this methodology is simple to apply, valid for all types of impacts and projects, inexpensive and not time-consuming. The objectivity of the partial methods used in this procedure is improved by quantitative landscape ecological stability evaluation, assignment of weights to vulnerability indicators based on the detailed characteristics of affected factors, and grading impact significance. - Highlights: • This paper suggests a method proposal for cumulative impact prediction. • The method includes landscape vulnerability evaluation. • The vulnerability of affected receptors is determined by their sensitivity. • This method can increase the objectivity of impact prediction in the EIA process.

  20. Alcohol intake and colorectal cancer: a comparison of approaches for including repeated measures of alcohol consumption

    DEFF Research Database (Denmark)

    Thygesen, Lau Caspar; Wu, Kana; Grønbaek, Morten

    2008-01-01

    BACKGROUND: In numerous studies, alcohol intake has been found to be positively associated with colorectal cancer risk. However, the majority of studies included only one exposure measurement, which may bias the results if long-term intake is relevant.METHODS: We compared different approaches...... for including repeated measures of alcohol intake among 47,432 US men enrolled in the Health Professionals Follow-up Study. Questionnaires including questions on alcohol intake had been completed in 1986, 1990, 1994, and 1998. The outcome was incident colorectal cancer during follow-up from 1986 to 2002.RESULTS......: During follow-up, 868 members of the cohort experienced colorectal cancer. Baseline, updated, and cumulative average alcohol intakes were positively associated with colorectal cancer, with only minor differences among the approaches. These results support moderately increased risk for intake >30 g...

  1. Cumulative stress and autonomic dysregulation in a community sample.

    Science.gov (United States)

    Lampert, Rachel; Tuit, Keri; Hong, Kwang-Ik; Donovan, Theresa; Lee, Forrester; Sinha, Rajita

    2016-05-01

    Whether cumulative stress, including both chronic stress and adverse life events, is associated with decreased heart rate variability (HRV), a non-invasive measure of autonomic status which predicts poor cardiovascular outcomes, is unknown. Healthy community dwelling volunteers (N = 157, mean age 29 years) participated in the Cumulative Stress/Adversity Interview (CAI), a 140-item event interview measuring cumulative adversity including major life events, life trauma, recent life events and chronic stressors, and underwent 24-h ambulatory ECG monitoring. HRV was analyzed in the frequency domain and standard deviation of NN intervals (SDNN) calculated. Initial simple regression analyses revealed that total cumulative stress score, chronic stressors and cumulative adverse life events (CALE) were all inversely associated with ultra low-frequency (ULF), very low-frequency (VLF) and low-frequency (LF) power and SDNN (all p stress and chronic stress each was significantly associated with SDNN and ULF even after the highly significant contributions of age and sex, with no other covariates accounting for additional appreciable variance. For VLF and LF, both total cumulative stress and chronic stress significantly contributed to the variance alone but were not longer significant after adjusting for race and health behaviors. In summary, total cumulative stress, and its components of adverse life events and chronic stress were associated with decreased cardiac autonomic function as measured by HRV. Findings suggest one potential mechanism by which stress may exert adverse effects on mortality in healthy individuals. Primary preventive strategies including stress management may prove beneficial.

  2. Repeated lifestyle interventions lead to progressive weight loss

    DEFF Research Database (Denmark)

    Dandanell, Sune; Ritz, Christian; Verdich, Elisabeth

    2017-01-01

    AIMS: This study aimed to investigate whether repeated lifestyle interventions lead to progressive weight loss or to weight cycling. METHODS: A retrospective review chart study with follow-up on 2120 participants (mean±SD age 36±15 years; body weight 116±28 kg; fat 43±6%). All had participated...... lost to follow-up after one to four interventions, respectively. The cumulated weight loss at follow-up increased with the number of interventions from one to four: 12.2±0.1, 15.9±0.7, 16.1±1.2 and 18.5±2.0 kg ( ploss of fat and fat free mass after one to four...... interventions in a selected and motivated group can be an efficient method for weight loss maintenance with only limited body weight cycling in the interim periods. However, the relationship between loss of fat and fat free mass might change in an unfavourable direction....

  3. [Genetic variability and phylogenetic analysis of 39 short tandem repeat loci in Beijing Han population].

    Science.gov (United States)

    Xiuyan, Ruan; Weini, Wang; Yaran, Yang; Bingbing, Xie; Jing, Chen; Yacheng, Liu; Jiangwei, Yan

    2015-07-01

    In this study, we studied the genetic polymorphisms of short tandem repeat (STR) loci from 13 CODIS and 26 non-CODIS system in Beijing Han population for the first time, and established a database of 39 STR loci whose forensic parameters were further evaluated. Our results demonstrated no significant deviation from the Hardy-Weinberg equilibrium of 39 STR loci and no pairwise linkage disequilibrium between them. The power of discriminations, expected heterozygosity, polymorphic information content, and power of exclusion of 39 STR loci ranged from 0.7740-0.9818, 0.6000-0.9350, 0.5317-0.9047 and 0.2909-0.8673. The cumulated discrimination power and cumulative probability of exclusion were 0.999999999999999999999999999999999999999964971 and 0.999999999973878, respectively. Moreover, the genetic distance was calculated based on allele frequency an