WorldWideScience

Sample records for repeatable study designs

  1. Association between CAG repeat polymorphisms and the risk of prostate cancer: a meta-analysis by race, study design and the number of (CAG)n repeat polymorphisms.

    Science.gov (United States)

    Sun, Jun-Hyun; Lee, Sang-Ah

    2013-11-01

    Although a number of studies have been conducted on the association between prostate cancer and CAG repeat polymorphisms of the androgen receptor gene, this association remains elusive and controversial. In this meta-analysis, we aimed to evaluate the effects of (CAG)n repeat genetic polymorphisms on the incidence of prostate cancer, particularly as regards race, study design and the number of (CAG)n repeats. To collect articles published on the association between CAG repeats and prostate cancer, publications were identified from the National Center for Biotechnology Information (NCBI) database of epidemiological studies published up to October 2011; our identification of publications was not limited by a language barrier. The following search keywords were used: prostate cancer risk, CAG repeat polymorphism, androgen receptor gene and human. Stata version 10 was used for the meta-analysis and the publication bias was measured through the Begg's test and Egger's test. This meta-analysis included 47 studies with 13,346 cases and 15,172 control or non-cases and consisted of 31 reports based on Caucasians, ten on Asians, one on Hispanics and four on combined ethnic groups. The carriers of a shorter CAG repeat sequence had an increased risk of prostate cancer (OR 1.21, 95% CI 1.10-1.34 for all subjects; OR 1.21, 95% CI 1.10-1.34 for prospective studies; OR 1.32, 95% CI 1.15-1.51 for retrospective studies) regardless of the exact length of the CAG repeat, compared with carriers of a longer repeat sequence. In terms of race, the risk of carrying a shorter CAG repeat sequence was 1.10- and 1.83-fold higher than that of a longer repeat sequence in Caucasians and Asians, respectively. For the specific number of CAG repeat polymorphisms, carriers of repeats were observed to have a higher risk of prostate cancer (OR 1.16, 95% CI 1.04-1.29) compared with carriers with ≥ 22 CAG repeat polymorphisms, particularly for Asians (OR 2.06, 95% CI 1.00-4.24). This meta

  2. Case study: videogame distraction reduces behavioral distress in a preschool-aged child undergoing repeated burn dressing changes: a single-subject design

    National Research Council Canada - National Science Library

    Sil, Soumitri; Dahlquist, Lynnda M; Burns, Andrew J

    2013-01-01

    This single-subject design study evaluated the feasibility and efficacy of passive and interactive videogame distraction on behavioral distress for a preschool-aged child receiving repeated burn dressing changes...

  3. Repeated versus wide reading: A randomized control design study examining the impact of fluency interventions on underlying reading behavior.

    Science.gov (United States)

    Ardoin, Scott P; Binder, Katherine S; Foster, Tori E; Zawoyski, Andrea M

    2016-12-01

    Repeated readings (RR) has garnered much attention as an evidence based intervention designed to improve all components of reading fluency (rate, accuracy, prosody, and comprehension). Despite this attention, there is not an abundance of research comparing its effectiveness to other potential interventions. The current study presents the findings from a randomized control trial study involving the assignment of 168second grade students to a RR, wide reading (WR), or business as usual condition. Intervention students were provided with 9-10weeks of intervention with sessions occurring four times per week. Pre- and post-testing were conducted using Woodcock-Johnson III reading achievement measures (Woodcock, McGrew, & Mather, 2001, curriculum-based measurement (CBM) probes, measures of prosody, and measures of students' eye movements when reading. Changes in fluency were also monitored using weekly CBM progress monitoring procedures. Data were collected on the amount of time students spent reading and the number of words read by students during each intervention session. Results indicate substantial gains made by students across conditions, with some measures indicating greater gains by students in the two intervention conditions. Analyses do not indicate that RR was superior to WR. In addition to expanding the RR literature, this study greatly expands research evaluating changes in reading behaviors that occur with improvements in reading fluency. Implications regarding whether schools should provide more opportunities to repeatedly practice the same text (i.e., RR) or practice a wide range of text (i.e., WR) are provided. Copyright © 2016 Society for the Study of School Psychology. Published by Elsevier Ltd. All rights reserved.

  4. On balanced minimal repeated measurements designs

    Directory of Open Access Journals (Sweden)

    Shakeel Ahmad Mir

    2014-10-01

    Full Text Available Repeated Measurements designs are concerned with scientific experiments in which each experimental unit is assigned more than once to a treatment either different or identical. This class of designs has the property that the unbiased estimators for elementary contrasts among direct and residual effects are obtainable. Afsarinejad (1983 provided a method of constructing balanced Minimal Repeated Measurements designs p < t , when t is an odd or prime power, one or more than one treatment may occur more than once in some sequences and  designs so constructed no longer remain uniform in periods. In this paper an attempt has been made to provide a new method to overcome this drawback. Specifically, two cases have been considered                RM[t,n=t(t-t/(p-1,p], λ2=1 for balanced minimal repeated measurements designs and  RM[t,n=2t(t-t/(p-1,p], λ2=2 for balanced  repeated measurements designs. In addition , a method has been provided for constructing              extra-balanced minimal designs for special case RM[t,n=t2/(p-1,p], λ2=1.

  5. A new technique for repeated biopsies of the mammary gland in dairy cows allotted to Latin-square design studies.

    Science.gov (United States)

    de Lima, Luciano S; Martineau, Eric; De Marchi, Francilaine E; Palin, Marie-France; Dos Santos, Geraldo T; Petit, Hélène V

    2016-07-01

    The objective of this study was to develop a technique for carrying out repeated biopsies of the mammary gland of lactating dairy cows that provides enough material to monitor enzyme activities and gene expression in mammary secretory tissue. A total of 16 Holstein cows were subjected to 4 mammary biopsies each at 3-week intervals for a total of 64 biopsies. A 0.75-cm incision was made through the skin and subcutaneous tissue of the mammary gland and a trocar and cannula were inserted using a circular motion. The trocar was withdrawn and a syringe was plugged into the base of the cannula to create a vacuum for sampling mammary tissue. To reduce bleeding, hand pressure was put on the surgery site after biopsy and skin closure and ice was applied for at least 2 h after the biopsy using a cow bra. The entire procedure took an average of 25 min. Two attempts were usually enough to obtain 800 mg of tissue. Visual examination of milk samples 10 d after the biopsy indicated no trace of blood, except in samples from 2 cows. All wounds healed without infection and subcutaneous hematomas resorbed within 7 d. There was no incidence of mastitis throughout the lactation. This technique provides a new tool for biopsy of the mammary gland repeated at short intervals with the main effect being a decrease in milk production. Although secondary complications leading to illness or death are always a risk with any procedure, this biopsy technique was carried out without complications to the health of animals and with no incidence of mastitis during the lactation.

  6. Application of composite estimation in studies of animal population production with two-stage repeated sample designs.

    Science.gov (United States)

    Farver, T B; Holt, D; Lehenbauer, T; Greenley, W M

    1997-05-01

    This paper reports results from two example data sets of a two-stage sampling design where sampling (in panels) both farms and animals within selected farms increases the efficiency of parameter estimation from measurements recorded over time. With such a design, not only are farms replaced from time-to-time but also animals subsampled within retained farms are subject to replacement. Three general categories of parameters estimated for the population (the set of animals belonging to the universe of farms of interest) were (1) the total at each measurement occasion; (2) the difference between means or totals on successive measurement occasions; (3) the total over a sequence of successive measurement periods. Whereas several responses at the farm level were highly correlated over time (rho 1), the corresponding animal responses were less correlated over time (rho 2)-leading to only moderate gains in relative efficiency. Intraclass correlation values were too low in most cases to counteract the overall negative impact of rho 2. In general, sizeable gains in relative efficiency were observed for estimating change-confirming a previous result which showed this to be true provided that rho 1 was high (irrespective of rho 2).

  7. Artificial leucine rich repeats as new scaffolds for protein design.

    Science.gov (United States)

    Baabur-Cohen, Hemda; Dayalan, Subashini; Shumacher, Inbal; Cohen-Luria, Rivka; Ashkenasy, Gonen

    2011-04-15

    The leucine rich repeat (LRR) motif that participates in many biomolecular recognition events in cells was suggested as a general scaffold for producing artificial receptors. We describe here the design and first total chemical synthesis of small LRR proteins, and their structural analysis. When evaluating the tertiary structure as a function of different number of repeating units (1-3), we were able to find that the 3-repeats sequence, containing 90 amino acids, folds into the expected structure.

  8. Exploring the repeat protein universe through computational protein design.

    Science.gov (United States)

    Brunette, T J; Parmeggiani, Fabio; Huang, Po-Ssu; Bhabha, Gira; Ekiert, Damian C; Tsutakawa, Susan E; Hura, Greg L; Tainer, John A; Baker, David

    2015-12-24

    A central question in protein evolution is the extent to which naturally occurring proteins sample the space of folded structures accessible to the polypeptide chain. Repeat proteins composed of multiple tandem copies of a modular structure unit are widespread in nature and have critical roles in molecular recognition, signalling, and other essential biological processes. Naturally occurring repeat proteins have been re-engineered for molecular recognition and modular scaffolding applications. Here we use computational protein design to investigate the space of folded structures that can be generated by tandem repeating a simple helix-loop-helix-loop structural motif. Eighty-three designs with sequences unrelated to known repeat proteins were experimentally characterized. Of these, 53 are monomeric and stable at 95 °C, and 43 have solution X-ray scattering spectra consistent with the design models. Crystal structures of 15 designs spanning a broad range of curvatures are in close agreement with the design models with root mean square deviations ranging from 0.7 to 2.5 Å. Our results show that existing repeat proteins occupy only a small fraction of the possible repeat protein sequence and structure space and that it is possible to design novel repeat proteins with precisely specified geometries, opening up a wide array of new possibilities for biomolecular engineering.

  9. Design and analysis of communication protocols for quantum repeater networks

    Science.gov (United States)

    Jones, Cody; Kim, Danny; Rakher, Matthew T.; Kwiat, Paul G.; Ladd, Thaddeus D.

    2016-08-01

    We analyze how the performance of a quantum-repeater network depends on the protocol employed to distribute entanglement, and we find that the choice of repeater-to-repeater link protocol has a profound impact on entanglement-distribution rate as a function of hardware parameters. We develop numerical simulations of quantum networks using different protocols, where the repeater hardware is modeled in terms of key performance parameters, such as photon generation rate and collection efficiency. These parameters are motivated by recent experimental demonstrations in quantum dots, trapped ions, and nitrogen-vacancy centers in diamond. We find that a quantum-dot repeater with the newest protocol (‘MidpointSource’) delivers the highest entanglement-distribution rate for typical cases where there is low probability of establishing entanglement per transmission, and in some cases the rate is orders of magnitude higher than other schemes. Our simulation tools can be used to evaluate communication protocols as part of designing a large-scale quantum network.

  10. Status of a UAV SAR Designed for Repeat Pass Interferometry for Deformation Measurements

    Science.gov (United States)

    Hensley, Scott; Wheeler, Kevin; Hoffman, Jim; Miller, Tim; Lou, Yunling; Muellerschoen, Ron; Zebker, Howard; Madsen, Soren; Rosen, Paul

    2004-01-01

    Under the NASA ESTO sponsored Instrument Incubator Program we have designed a lightweight, reconfigurable polarimetric L-band SAR designed for repeat pass deformation measurements of rapidly deforming surfaces of geophysical interest such as volcanoes or earthquakes. This radar will be installed on an unmanned airborne vehicle (UAV) or a lightweight, high-altitude, and long endurance platform such as the Proteus. After a study of suitable available platforms we selected the Proteus for initial development and testing of the system. We want to control the repeat track capability of the aircraft to be within a 10 m tube to support the repeat deformation capability. We conducted tests with the Proteus using real-time GPS with sub-meter accuracy to see if pilots could fly the aircraft within the desired tube. Our results show that pilots are unable to fly the aircraft with the desired accuracy and therefore an augmented autopilot will be required to meet these objectives. Based on the Proteus flying altitude of 13.7 km (45,000 ft), we are designing a fully polarimetric L-band radar with 80 MHz bandwidth and 16 km range swath. This radar will have an active electronic beam steering antenna to achieve Doppler centroid stability that is necessary for repeat-pass interferometry (RPI). This paper will present are design criteria, current design and expected science applications.

  11. Successive failure, repeat entrepreneurship and no learning: A case study

    Directory of Open Access Journals (Sweden)

    Marius Pretorius

    2011-02-01

    Full Text Available Orientation: Current theories of repeat entrepreneurship provide little explanation for the effect of failure as a ‘trigger’ for creating successive ventures or learning from repeated failures. Research purpose: This study attempts to establish the role of previous failures on the ventures that follow them and to determine the process of learning from successive failures.Motivation for the study: Successive failures offer potentially valuable insights into the relationship between failures on the ventures that follow and the process of learning from failure.Research design, approach and method: The researchers investigated a single case study of one entrepreneur’s successive failures over 20 years.Main findings: Although the causes varied, all the failures had fundamental similarities. This suggested that the entrepreneur had not learnt from them. The previous failures did not trigger the subsequent ventures. Instead, they played a role in causing the failures. Learning from failure does not happen immediately but requires deliberate reflection. Deliberate reflection is a prerequisite for learning from failure as the entrepreneur repeated similar mistakes time after time until he reflected on each failure.Practical/managerial implications: It confirms that failure is a part of entrepreneurial endeavours. However, learning from it requires deliberate reflection. Failure does not ‘trigger’ the next venture and educators should note this.Contribution/value-add: Knowing the effect of failure on consecutive ventures may help us to understand the development of prototypes (mental frameworks and expand the theory about entrepreneurial prototype categories.

  12. Global Design Analysis for Highly Repeatable Solid-state Klystron Modulators

    CERN Document Server

    Anthony, Dal Gobbo

    2015-01-01

    This paper presents an analysis of the repeatability issue in the electrical-to-radio frequency conversion chains using pulsed klystrons. The focus is on the power electronics used in klystron modulators. Repeatability definition is presented and simulation results allow deriving important conclusions regarding the voltage repeatability harmonic content versus power electronics design directions. The trade-off between klystron modulator and low level RF controls is a key point for optimizing the global system repeatability performance.

  13. Analysis of repeated outcome measures from longitudinal studies

    Institute of Scientific and Technical Information of China (English)

    Yuanjia WANG; Naihua DUAN

    2011-01-01

    @@ In many clinical studies repeated measurements of an outcome are collected over time.For example,in an 8-week study of treatment for obsessive compulsive disorder,the severity of the disorder may be measured weekly using the Yale-Brown-Obsessive-Compulsive-Disorder-Scale (YBOCS).For each study participant who completes the study,there will be nine repeated measures of YBOCS (a baseline assessment plus eight assessments during the course of treatment).Such a study in which participants are followed and measured repeatedly over time is called a longitudinal study and the resulting data are called longitudinal data.

  14. Repeated loading of fine grained soils for pavement design

    OpenAIRE

    Loach, Simon C.

    1987-01-01

    The primary aim of this research was to investigate the behaviour of a clay subjected to a loading regime similar to that experienced by a road subgrade under traffic loading in Great Britain. The material used was Keuper Marl. The samples were anisotropically consolidated in a triaxial apparatus from a slurry which allowed careful control over the stress history and produced uniform samples. The samples were fully instrumented and the apparatus was capable of applying repeated axial and radi...

  15. CAD Method to Design Complex Dobby Weaves with Large Repeats

    Institute of Scientific and Technical Information of China (English)

    祝成炎

    2001-01-01

    The principle of a CAD method of converting the pre-designed figures in image form into complex dobby weaves with the appearances similar to the original figures is mainly introduced in this paper. A few designed weaves by the created CAD system are also given as examples of the practical application in the area of complex dobby weave designing.

  16. Rational design of alpha-helical tandem repeat proteins with closed architectures

    Science.gov (United States)

    Doyle, Lindsey; Hallinan, Jazmine; Bolduc, Jill; Parmeggiani, Fabio; Baker, David; Stoddard, Barry L.; Bradley, Philip

    2015-01-01

    Tandem repeat proteins, which are formed by repetition of modular units of protein sequence and structure, play important biological roles as macromolecular binding and scaffolding domains, enzymes, and building blocks for the assembly of fibrous materials1,2. The modular nature of repeat proteins enables the rapid construction and diversification of extended binding surfaces by duplication and recombination of simple building blocks3,4. The overall architecture of tandem repeat protein structures – which is dictated by the internal geometry and local packing of the repeat building blocks – is highly diverse, ranging from extended, super-helical folds that bind peptide, DNA, and RNA partners5–9, to closed and compact conformations with internal cavities suitable for small molecule binding and catalysis10. Here we report the development and validation of computational methods for de novo design of tandem repeat protein architectures driven purely by geometric criteria defining the inter-repeat geometry, without reference to the sequences and structures of existing repeat protein families. We have applied these methods to design a series of closed alpha-solenoid11 repeat structures (alpha-toroids) in which the inter-repeat packing geometry is constrained so as to juxtapose the N- and C-termini; several of these designed structures have been validated by X-ray crystallography. Unlike previous approaches to tandem repeat protein engineering12–20, our design procedure does not rely on template sequence or structural information taken from natural repeat proteins and hence can produce structures unlike those seen in nature. As an example, we have successfully designed and validated closed alpha-solenoid repeats with a left-handed helical architecture that – to our knowledge – is not yet present in the protein structure database21. PMID:26675735

  17. Rational design of α-helical tandem repeat proteins with closed architectures.

    Science.gov (United States)

    Doyle, Lindsey; Hallinan, Jazmine; Bolduc, Jill; Parmeggiani, Fabio; Baker, David; Stoddard, Barry L; Bradley, Philip

    2015-12-24

    Tandem repeat proteins, which are formed by repetition of modular units of protein sequence and structure, play important biological roles as macromolecular binding and scaffolding domains, enzymes, and building blocks for the assembly of fibrous materials. The modular nature of repeat proteins enables the rapid construction and diversification of extended binding surfaces by duplication and recombination of simple building blocks. The overall architecture of tandem repeat protein structures--which is dictated by the internal geometry and local packing of the repeat building blocks--is highly diverse, ranging from extended, super-helical folds that bind peptide, DNA, and RNA partners, to closed and compact conformations with internal cavities suitable for small molecule binding and catalysis. Here we report the development and validation of computational methods for de novo design of tandem repeat protein architectures driven purely by geometric criteria defining the inter-repeat geometry, without reference to the sequences and structures of existing repeat protein families. We have applied these methods to design a series of closed α-solenoid repeat structures (α-toroids) in which the inter-repeat packing geometry is constrained so as to juxtapose the amino (N) and carboxy (C) termini; several of these designed structures have been validated by X-ray crystallography. Unlike previous approaches to tandem repeat protein engineering, our design procedure does not rely on template sequence or structural information taken from natural repeat proteins and hence can produce structures unlike those seen in nature. As an example, we have successfully designed and validated closed α-solenoid repeats with a left-handed helical architecture that--to our knowledge--is not yet present in the protein structure database.

  18. Characterization of the peripheral blood transcriptome in a repeated measures design using a panel of healthy individuals

    DEFF Research Database (Denmark)

    De Boever, Patrick; Wens, Britt; Forcheh, Anyiawung Chiara

    2014-01-01

    A repeated measures microarray design with 22 healthy, non-smoking volunteers (aging 32. ±. 5. years) was set up to study transcriptome profiles in whole blood samples. The results indicate that repeatable data can be obtained with high within-subject correlation. Probes that could discriminate....... Our study suggests that the blood transcriptome of healthy individuals is reproducible over a time period of several months. © 2013 Elsevier Inc....

  19. Splashing Our Way to Playfulness! An Aquatic Playgroup for Young Children with Autism, A Repeated Measures Design

    Science.gov (United States)

    Fabrizi, Sarah E.

    2015-01-01

    This study investigated the effectiveness of an aquatic playgroup on the playfulness of children, ages 2 to 3 with autism spectrum disorder. Using a repeated measures design, we followed 10 children and their caregivers who participated in a 6-week aquatic playgroup in southwest Florida. Four dyads completed the entire 12-week study period. The…

  20. Splashing Our Way to Playfulness! An Aquatic Playgroup for Young Children with Autism, A Repeated Measures Design

    Science.gov (United States)

    Fabrizi, Sarah E.

    2015-01-01

    This study investigated the effectiveness of an aquatic playgroup on the playfulness of children, ages 2 to 3 with autism spectrum disorder. Using a repeated measures design, we followed 10 children and their caregivers who participated in a 6-week aquatic playgroup in southwest Florida. Four dyads completed the entire 12-week study period. The…

  1. Knowledge-based design of reagentless fluorescent biosensors from a designed ankyrin repeat protein.

    Science.gov (United States)

    Brient-Litzler, Elodie; Plückthun, Andreas; Bedouelle, Hugues

    2010-04-01

    Designed ankyrin repeat proteins (DARPins) can be selected from combinatorial libraries to bind any target antigen. They show high levels of recombinant expression, solubility and stability, and contain no cysteine residue. The possibility of obtaining, from any DARPin and at high yields, fluorescent conjugates which respond to the binding of the antigen by a variation of fluorescence, would have numerous applications in micro- and nano-analytical sciences. This possibility was explored with Off7, a DARPin directed against the maltose binding protein (MalE) from Escherichia coli, with known crystal structure of the complex. Eight residues of Off7, whose solvent accessible surface area varies on association with the antigen but which are not in direct contact with the antigen, were individually mutated into cysteine and then chemically coupled with a fluorophore. The conjugates were ranked according to their relative sensitivities. All of them showed an increase in their fluorescence intensity on antigen binding by >1.7-fold. The best conjugate retained the same affinity as the parental DARPin. Its signal increased linearly and specifically with the concentration of antigen, up to 15-fold in buffer and 3-fold in serum when fully saturated, the difference being mainly due to the absorption of light by serum. Its lower limit of detection was equal to 0.3 nM with a standard spectrofluorometer. Titrations with potassium iodide indicated that the fluorescence variation was due to a shielding of the fluorescent group from the solvent by the antigen. These results suggest rules for the design of reagentless fluorescent biosensors from any DARPin.

  2. Power analysis for multivariate and repeated measures designs: a flexible approach using the SPSS MANOVA procedure.

    Science.gov (United States)

    D'Amico, E J; Neilands, T B; Zambarano, R

    2001-11-01

    Although power analysis is an important component in the planning and implementation of research designs, it is often ignored. Computer programs for performing power analysis are available, but most have limitations, particularly for complex multivariate designs. An SPSS procedure is presented that can be used for calculating power for univariate, multivariate, and repeated measures models with and without time-varying and time-constant covariates. Three examples provide a framework for calculating power via this method: an ANCOVA, a MANOVA, and a repeated measures ANOVA with two or more groups. The benefits and limitations of this procedure are discussed.

  3. On the Analysis of a Repeated Measure Design in Genome-Wide Association Analysis

    Directory of Open Access Journals (Sweden)

    Young Lee

    2014-11-01

    Full Text Available Longitudinal data enables detecting the effect of aging/time, and as a repeated measures design is statistically more efficient compared to cross-sectional data if the correlations between repeated measurements are not large. In particular, when genotyping cost is more expensive than phenotyping cost, the collection of longitudinal data can be an efficient strategy for genetic association analysis. However, in spite of these advantages, genome-wide association studies (GWAS with longitudinal data have rarely been analyzed taking this into account. In this report, we calculate the required sample size to achieve 80% power at the genome-wide significance level for both longitudinal and cross-sectional data, and compare their statistical efficiency. Furthermore, we analyzed the GWAS of eight phenotypes with three observations on each individual in the Korean Association Resource (KARE. A linear mixed model allowing for the correlations between observations for each individual was applied to analyze the longitudinal data, and linear regression was used to analyze the first observation on each individual as cross-sectional data. We found 12 novel genome-wide significant disease susceptibility loci that were then confirmed in the Health Examination cohort, as well as some significant interactions between age/sex and SNPs.

  4. Status of a UAVSAR designed for repeat pass interferometry for deformation measurements

    Science.gov (United States)

    Hensley, Scott; Wheeler, Kevin; Sadowy, Greg; Miller, Tim; Shaffer, Scott; Muellerschoen, Ron; Jones, Cathleen; Zebker, Howard; Madsen, Soren; Paul, Rose

    2005-01-01

    NASA's Jet Propulsion Laboratory is currently implementing a reconfigurable polarimetric L-band synthetic aperture radar (SAR), specifically designed to acquire airborne repeat track interferometric (RTI) SAR data, also known as differential interferometric measurements. Differential interferometry can provide key deformation measurements, important for the scientific studies of Earthquakes and volcanoes. Using precision real-time GPS and a sensor controlled flight management system, the system will be able to fly predefined paths with great precision. The expected performance of the flight control system will constrain the flight path to be within a 10 m diameter tube about the desired flight track. The radar wilI be designed to operate on a UAV (Unpiloted Aria1 Vehicle) but will initially be demonstrated on a minimally piloted vehicle (MPV), such as the Proteus buitt by Scaled Composites or on a NASA Gulfstream III. The radar design is a fully polarimetric with an 80 MHz bandwidth (2 m range resolution) and 16 km range swath. The antenna is an electronically steered along track to assure that the actual antenna pointing can be controlled independent of the wind direction and speed. Other features supported by the antenna include an elevation monopulse option and a pulse-to-pulse resteering capability that will enable some novel modes of operation. The system will nominally operate at 45,000 ft (13800 m). The program began out as an Instrument Incubator Project (IIP) funded by NASA Earth Science and Technology Office (ESTO).

  5. Repeating tests: different roles in research studies and clinical medicine.

    Science.gov (United States)

    Monach, Paul A

    2012-10-01

    Researchers often decide whether to average multiple results in order to produce more precise data, and clinicians often decide whether to repeat a laboratory test in order to confirm its validity or to follow a trend. Some of the major sources of variation in laboratory tests (analytical imprecision, within-subject biological variation and between-subject variation) and the effects of averaging multiple results from the same sample or from the same person over time are discussed quantitatively in this article. This analysis leads to the surprising conclusion that the strategy of averaging multiple results is only necessary and effective in a limited range of research studies. In clinical practice, it may be important to repeat a test in order to eliminate the possibility of a rare type of error that has nothing to do analytical imprecision or within-subject variation, and for this reason, paradoxically, it may be most important to repeat tests with the highest sensitivity and/or specificity (i.e., ones that are critical for clinical decision-making).

  6. PET functional volume delineation: a robustness and repeatability study

    Energy Technology Data Exchange (ETDEWEB)

    Hatt, Mathieu [CHU Morvan, INSERM, U650, LaTIM, Brest (France); CHU MORVAN, LaTIM, INSERM U650, Brest (France); Cheze-le Rest, Catherine [CHU Morvan, INSERM, U650, LaTIM, Brest (France); CHU, Academic Department of Nuclear Medicine, Brest (France); Albarghach, Nidal; Pradier, Olivier [CHU Morvan, INSERM, U650, LaTIM, Brest (France); CHU, Institute of Oncology, Brest (France); Visvikis, Dimitris [CHU Morvan, INSERM, U650, LaTIM, Brest (France)

    2011-04-15

    Current state-of-the-art algorithms for functional uptake volume segmentation in PET imaging consist of threshold-based approaches, whose parameters often require specific optimization for a given scanner and associated reconstruction algorithms. Different advanced image segmentation approaches previously proposed and extensively validated, such as among others fuzzy C-means (FCM) clustering, or fuzzy locally adaptive bayesian (FLAB) algorithm have the potential to improve the robustness of functional uptake volume measurements. The objective of this study was to investigate robustness and repeatability with respect to various scanner models, reconstruction algorithms and acquisition conditions. Robustness was evaluated using a series of IEC phantom acquisitions carried out on different PET/CT scanners (Philips Gemini and Gemini Time-of-Flight, Siemens Biograph and GE Discovery LS) with their associated reconstruction algorithms (RAMLA, TF MLEM, OSEM). A range of acquisition parameters (contrast, duration) and reconstruction parameters (voxel size) were considered for each scanner model, and the repeatability of each method was evaluated on simulated and clinical tumours and compared to manual delineation. For all the scanner models, acquisition parameters and reconstruction algorithms considered, the FLAB algorithm demonstrated higher robustness in delineation of the spheres with low mean errors (10%) and variability (5%), with respect to threshold-based methodologies and FCM. The repeatability provided by all segmentation algorithms considered was very high with a negligible variability of <5% in comparison to that associated with manual delineation (5-35%). The use of advanced image segmentation algorithms may not only allow high accuracy as previously demonstrated, but also provide a robust and repeatable tool to aid physicians as an initial guess in determining functional volumes in PET. (orig.)

  7. On the repeated measures designs and sample sizes for randomized controlled trials.

    Science.gov (United States)

    Tango, Toshiro

    2016-04-01

    For the analysis of longitudinal or repeated measures data, generalized linear mixed-effects models provide a flexible and powerful tool to deal with heterogeneity among subject response profiles. However, the typical statistical design adopted in usual randomized controlled trials is an analysis of covariance type analysis using a pre-defined pair of "pre-post" data, in which pre-(baseline) data are used as a covariate for adjustment together with other covariates. Then, the major design issue is to calculate the sample size or the number of subjects allocated to each treatment group. In this paper, we propose a new repeated measures design and sample size calculations combined with generalized linear mixed-effects models that depend not only on the number of subjects but on the number of repeated measures before and after randomization per subject used for the analysis. The main advantages of the proposed design combined with the generalized linear mixed-effects models are (1) it can easily handle missing data by applying the likelihood-based ignorable analyses under the missing at random assumption and (2) it may lead to a reduction in sample size, compared with the simple pre-post design. The proposed designs and the sample size calculations are illustrated with real data arising from randomized controlled trials.

  8. Reactor pulse repeatability studies at the annular core research reactor

    Energy Technology Data Exchange (ETDEWEB)

    DePriest, K.R. [Applied Nuclear Technologies, Sandia National Laboratories, Mail Stop 1146, Post Office Box 5800, Albuquerque, NM 87185-1146 (United States); Trinh, T.Q. [Nuclear Facility Operations, Sandia National Laboratories, Mail Stop 0614, Post Office Box 5800, Albuquerque, NM 87185-1146 (United States); Luker, S. M. [Applied Nuclear Technologies, Sandia National Laboratories, Mail Stop 1146, Post Office Box 5800, Albuquerque, NM 87185-1146 (United States)

    2011-07-01

    The Annular Core Research Reactor (ACRR) at Sandia National Laboratories is a water-moderated pool-type reactor designed for testing many types of objects in the pulse and steady-state mode of operations. Personnel at Sandia began working to improve the repeatability of pulse operations for experimenters in the facility. The ACRR has a unique UO{sub 2}-BeO fuel that makes the task of producing repeatable pulses difficult with the current operating procedure. The ACRR produces a significant quantity of photoneutrons through the {sup 9}Be({gamma}, n){sup 8}Be reaction in the fuel elements. The photoneutrons are the result of the gammas produced during fission and in fission product decay, so their production is very much dependent on the reactor power history and changes throughout the day/week of experiments in the facility. Because the photoneutrons interfere with the delayed-critical measurements required for accurate pulse reactivity prediction, a new operating procedure was created. The photoneutron effects at delayed critical are minimized when using the modified procedure. In addition, the pulse element removal time is standardized for all pulse operations with the modified procedure, and this produces less variation in reactivity removal times. (authors)

  9. Repeat film analysis and its implications for quality assurance in dental radiology: An institutional case study

    Directory of Open Access Journals (Sweden)

    Shruthi Acharya

    2015-01-01

    Full Text Available Context: The goal of any radiologist is to produce the highest quality diagnostic radiographs, while keeping patient exposure as low as reasonably achievable (ALARA. Aims: The aim of this study was to describe the reasons for radiograph rejections through a repeat film analysis in an Indian dental school. Settings and Design: An observational study conducted in the Department of Oral Medicine and Radiology, Manipal College of Dental Sciences, Manipal. Materials and Methods: During a 6-month study period, a total of 9,495 intra-oral radiographs and 2339 extraoral radiographs taken in the Radiology Department were subjected to repeat film analysis. Statistical Analysis Used: SPSS Version 16. Descriptive analysis used. Results: The results showed that the repeat rates were 7.1% and 5.86% for intraoral and extraoral radiographs, respectively. Among the causes for errors reported, positioning error (38.7% was the most common, followed by improper angulations (26.1%, and improper film placement (11.2% for intra-oral radiographs. The study found that the maximum frequency of repeats among extraoral radiographs was for panoramic radiographs (49% followed by lateral cephalogram (33%, and paranasal sinus view (14%. It was also observed that repeat rate of intraoral radiographs was highest for internees (44.7%, and undergraduate students (28.2%. Conclusions: The study pointed to a need for more targeted interventions to achieve the goal of keeping patient exposure ALARA in a dental school setting.

  10. Design and Implementation of Simultaneous Shield And Repeater Insertion for On-chip Interconnects

    Directory of Open Access Journals (Sweden)

    M. Surendra Goud Mr. Y. Sreenivas Goud

    2012-02-01

    Full Text Available A Resource based optimization is a new approach for high performance integrated circuits. The method is applied to simultaneous shield and repeater insertion, resulting in minimum coupling noise under power, delay, and area constraints Repeater insertion is a well known design technique to reduce the delay required to propagate a signal along a line. Shielding inserts an additional line between a victim line and an aggressor line. Finally placing a shield beside and inserting repeaters along a victim line and are chosen to exemplify the resource based optimization process. In the active shielding architecture shield driving circuits as 4:1 multiplexer, full adder, multipliers are inserted. The power consumption of active shielding architecture is observed to be approximately 20% less compare to passive shielding architecture. The main aim of this is minimize the coupling noise under power, delay, and area constraints

  11. Designed armadillo repeat proteins as general peptide-binding scaffolds: consensus design and computational optimization of the hydrophobic core

    DEFF Research Database (Denmark)

    Parmeggiani, Fabio; Pellarin, Riccardo; Larsen, Anders Peter

    2007-01-01

    interactions with peptides or parts of proteins in extended conformation. The conserved binding mode of the peptide in extended form, observed for different targets, makes armadillo repeat proteins attractive candidates for the generation of modular peptide-binding scaffolds. Taking advantage of the large...... number of repeat sequences available, a consensus-based approach combined with a force field-based optimization of the hydrophobic core was used to derive soluble, highly expressed, stable, monomeric designed proteins with improved characteristics compared to natural armadillo proteins. These sequences...

  12. Studies of an expanded trinucleotide repeat in transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Bingham, P.; Wang, S.; Merry, D. [Univ. of Pennsylvania, Philadelphia, PA (United States)

    1994-09-01

    Spinal and bulbar muscular atrophy (SBMA) is a progressive motor neuron disease caused by expansion of a trinucleotide repeat in the androgen receptor gene (AR{sup exp}). AR{sup exp} repeats expand further or contract in approximately 25% of transmissions. Analogous {open_quotes}dynamic mutations{close_quotes} have been reported in other expanded trinucleotide repeat disorders. We have been developing a mouse model of this disease using a transgenic approach. Expression of the SBMA AR was documented in transgenic mice with an inducible promoter. No phenotypic effects of transgene expression were observed. We have extended our previous results on stability of the expanded trinucleotide repeat in transgenic mice in two lines carrying AR{sup exp}. Tail DNA was amplified by PCR using primers spanning the repeat on 60 AR{sup exp} transgenic mice from four different transgenic lines. Migration of the PCR product through an acrylamide gel showed no change of the 45 CAG repeat length in any progeny. Similarly, PCR products from 23 normal repeat transgenics showed no change from the repeat length of the original construct. Unlike the disease allele in humans, the expanded repeat AR cDNA in transgenic mice showed no change in repeat length with transmission. The relative stability of CAG repeats seen in the transgenic mice may indicate either differences in the fidelity of replicative enzymes, or differences in error identification and repair between mice and humans. Integration site or structural properties of the transgene itself might also play a role.

  13. The design and structural characterization of a synthetic pentatricopeptide repeat protein.

    Science.gov (United States)

    Gully, Benjamin S; Shah, Kunal R; Lee, Mihwa; Shearston, Kate; Smith, Nicole M; Sadowska, Agata; Blythe, Amanda J; Bernath-Levin, Kalia; Stanley, Will A; Small, Ian D; Bond, Charles S

    2015-02-01

    Proteins of the pentatricopeptide repeat (PPR) superfamily are characterized by tandem arrays of a degenerate 35-amino-acid α-hairpin motif. PPR proteins are typically single-stranded RNA-binding proteins with essential roles in organelle biogenesis, RNA editing and mRNA maturation. A modular, predictable code for sequence-specific binding of RNA by PPR proteins has recently been revealed, which opens the door to the de novo design of bespoke proteins with specific RNA targets, with widespread biotechnological potential. Here, the design and production of a synthetic PPR protein based on a consensus sequence and the determination of its crystal structure to 2.2 Å resolution are described. The crystal structure displays helical disorder, resulting in electron density representing an infinite superhelical PPR protein. A structural comparison with related tetratricopeptide repeat (TPR) proteins, and with native PPR proteins, reveals key roles for conserved residues in directing the structure and function of PPR proteins. The designed proteins have high solubility and thermal stability, and can form long tracts of PPR repeats. Thus, consensus-sequence synthetic PPR proteins could provide a suitable backbone for the design of bespoke RNA-binding proteins with the potential for high specificity.

  14. Design of a bioactive small molecule that targets r(AUUCU) repeats in spinocerebellar ataxia 10.

    Science.gov (United States)

    Yang, Wang-Yong; Gao, Rui; Southern, Mark; Sarkar, Partha S; Disney, Matthew D

    2016-06-01

    RNA is an important target for chemical probes of function and lead therapeutics; however, it is difficult to target with small molecules. One approach to tackle this problem is to identify compounds that target RNA structures and utilize them to multivalently target RNA. Here we show that small molecules can be identified to selectively bind RNA base pairs by probing a library of RNA-focused small molecules. A small molecule that selectively binds AU base pairs informed design of a dimeric compound (2AU-2) that targets the pathogenic RNA, expanded r(AUUCU) repeats, that causes spinocerebellar ataxia type 10 (SCA10) in patient-derived cells. Indeed, 2AU-2 (50 nM) ameliorates various aspects of SCA10 pathology including improvement of mitochondrial dysfunction, reduced activation of caspase 3, and reduction of nuclear foci. These studies provide a first-in-class chemical probe to study SCA10 RNA toxicity and potentially define broadly applicable compounds targeting RNA AU base pairs in cells.

  15. Cytogenetic studies in couples experiencing repeated pregnancy losses.

    Science.gov (United States)

    De Braekeleer, M; Dao, T N

    1990-07-01

    A computerized database generated from the literature on cytogenetic studies in couples experiencing repeated pregnancy losses has been set up at the University of Quebec at Chicoutimi. At the present time, it contains data on 22,199 couples (44,398 individuals). The statistical analyses showed a relationship between the distribution of the chromosome abnormalities and the number of abortions. An uneven distribution of the chromosomal structural rearrangements according to the sex of the carrier was found (P less than 0.05). Overall, 4.7% of the couples ascertained for two or more spontaneous abortions included one carrier. It also appeared that only translocations (both reciprocal and Robertsonian) and inversions were associated with a higher risk of pregnancy wastage. Therefore, genetic counselling should be offered to these couples and investigations performed on their extended families.

  16. Multiple-objective response-adaptive repeated measurement designs in clinical trials for binary responses.

    Science.gov (United States)

    Liang, Yuanyuan; Li, Yin; Wang, Jing; Carriere, Keumhee C

    2014-02-20

    A multiple-objective allocation strategy was recently proposed for constructing response-adaptive repeated measurement designs for continuous responses. We extend the allocation strategy to constructing response-adaptive repeated measurement designs for binary responses. The approach with binary responses is quite different from the continuous case, as the information matrix is a function of responses, and it involves nonlinear modeling. To deal with these problems, we first build the design on the basis of success probabilities. Then we illustrate how various models can accommodate carryover effects on the basis of logits of response profiles as well as any correlation structure. Through computer simulations, we find that the allocation strategy developed for continuous responses also works well for binary responses. As expected, design efficiency in terms of mean squared error drops sharply, as more emphasis is placed on increasing treatment benefit than estimation precision. However, we find that it can successfully allocate more patients to better treatment sequences without sacrificing much estimation precision.

  17. Study of simple sequence repeat (SSR) polymorphism for biotic ...

    African Journals Online (AJOL)

    home

    2013-10-02

    Oct 2, 2013 ... back cross breeding; SSRs, simple sequence repeats; PIC, polymorphism ..... PIC values were reported in barley wheat and rice (Gu et ... doubled-haploid rice population. Theor. ... Grover A, Aishwarya V, Sharma PC (2007).

  18. High-precision repeat-groundtrack orbit design and maintenance for Earth observation missions

    Science.gov (United States)

    He, Yanchao; Xu, Ming; Jia, Xianghua; Armellin, Roberto

    2017-02-01

    The focus of this paper is the design and station keeping of repeat-groundtrack orbits for Sun-synchronous satellites. A method to compute the semimajor axis of the orbit is presented together with a station-keeping strategy to compensate for the perturbation due to the atmospheric drag. The results show that the nodal period converges gradually with the increase of the order used in the zonal perturbations up to J_{15} . A differential correction algorithm is performed to obtain the nominal semimajor axis of the reference orbit from the inputs of the desired nodal period, eccentricity, inclination and argument of perigee. To keep the satellite in the proximity of the repeat-groundtrack condition, a practical orbit maintenance strategy is proposed in the presence of errors in the orbital measurements and control, as well as in the estimation of the semimajor axis decay rate. The performance of the maintenance strategy is assessed via the Monte Carlo simulation and the validation in a high fidelity model. Numerical simulations substantiate the validity of proposed mean-elements-based orbit maintenance strategy for repeat-groundtrack orbits.

  19. High-precision repeat-groundtrack orbit design and maintenance for Earth observation missions

    Science.gov (United States)

    He, Yanchao; Xu, Ming; Jia, Xianghua; Armellin, Roberto

    2017-06-01

    The focus of this paper is the design and station keeping of repeat-groundtrack orbits for Sun-synchronous satellites. A method to compute the semimajor axis of the orbit is presented together with a station-keeping strategy to compensate for the perturbation due to the atmospheric drag. The results show that the nodal period converges gradually with the increase of the order used in the zonal perturbations up to J_{15}. A differential correction algorithm is performed to obtain the nominal semimajor axis of the reference orbit from the inputs of the desired nodal period, eccentricity, inclination and argument of perigee. To keep the satellite in the proximity of the repeat-groundtrack condition, a practical orbit maintenance strategy is proposed in the presence of errors in the orbital measurements and control, as well as in the estimation of the semimajor axis decay rate. The performance of the maintenance strategy is assessed via the Monte Carlo simulation and the validation in a high fidelity model. Numerical simulations substantiate the validity of proposed mean-elements-based orbit maintenance strategy for repeat-groundtrack orbits.

  20. Comparison of Repeated Measurement Design and Mixed Models in Evaluation of the Entonox Effect on Labor Pain

    Directory of Open Access Journals (Sweden)

    Nasim Karimi

    2017-01-01

    Full Text Available Background & objectives: In many medical studies, the response variable is measured repeatedly over time to evaluate the treatment effect that is known as longitudinal study. The analysis method for this type of data is repeated measures ANOVA that uses only one correlation structure and the results are not valid with inappropriate correlation structure. To avoid this problem, a convenient alternative is mixed models. So, the aim of this study was to compare of mixed and repeated measurement models for examination of the Entonox effect on the labor pain. Methods: This experimental study was designed to compare the effect of Entonox and oxygen inhalation on pain relief between two groups. Data were analyzed using repeated measurement and mixed models with different correlation structures. Selection and comparison of proper correlation structures performed using Akaike information criterion, Bayesian information criterion and restricted log-likelihood. Data were analyzed using SPSS-22. Results: Results of our study showed that all variables containing analgesia methods, labor duration of the first and second stages, and time were significant in these tests. In mixed model, heterogeneous first-order autoregressive, first-order autoregressive, heterogeneous Toeplitz and unstructured correlation structures were recognized as the best structures. Also, all variables were significant in these structures. Unstructured variance covariance matrix was recognized as the worst structure and labor duration of the first and second stages was not significant in this structure. Conclusions: This study showed that the Entonox inhalation has a significant effect on pain relief in primiparous and it is confirmed by all of the models.

  1. Exposing Students to Repeat Photography: Increasing Cultural Understanding on a Short-Term Study Abroad

    Science.gov (United States)

    Lemmons, Kelly K.; Brannstrom, Christian; Hurd, Danielle

    2014-01-01

    Traditionally, repeat photography has been used to analyze land cover change. This paper describes how repeat photography may be used as a tool to enhance the short-term study abroad experience by facilitating cultural interaction and understanding. We present evidence from two cases and suggest a five-step repeat photography method for educators…

  2. Exposing Students to Repeat Photography: Increasing Cultural Understanding on a Short-Term Study Abroad

    Science.gov (United States)

    Lemmons, Kelly K.; Brannstrom, Christian; Hurd, Danielle

    2014-01-01

    Traditionally, repeat photography has been used to analyze land cover change. This paper describes how repeat photography may be used as a tool to enhance the short-term study abroad experience by facilitating cultural interaction and understanding. We present evidence from two cases and suggest a five-step repeat photography method for educators…

  3. A Prospective Study of Psychiatric Comorbidity and Recidivism Among Repeat DUI Offenders

    OpenAIRE

    Nelson, Sarah E.; Belkin, Katerina; LaPlante, Debi A.; Bosworth, Leslie; Shaffer, Howard J.

    2015-01-01

    Psychiatric comorbidity has emerged as a key element distinguishing DUI offenders from others, and, in some cases, distinguishing repeat offenders from first-time offenders. This paper utilizes a prospective design to determine whether the comorbid disorders identified among repeat DUI offenders can predict recidivism. Seven hundred forty-three repeat DUI offenders were recruited from a two-week inpatient treatment program at which they received a standardized mental health assessment and fol...

  4. Acute and repeated dose toxicity studies of different β-cyclodextrin-based nanosponge formulations.

    Science.gov (United States)

    Shende, Pravin; Kulkarni, Yogesh A; Gaud, R S; Deshmukh, Kiran; Cavalli, Roberta; Trotta, Francesco; Caldera, Fabrizio

    2015-05-01

    Nanosponges (NS) show promising results in different fields such as medicine, agriculture, water purification, fire engineering and so on. The present study was designed to evaluate toxicity of different NS formulations (namely, S1-S6) synthesized with different cross-linking agents such as carbonyl diimidazole, pyromellitic dianhydride and hexamethylene diisocynate; and preparation methods in experimental animals. Acute and repeated dose toxicity studies of formulations were carried out as per OECD guidelines 423 and 407, respectively. For acute toxicity study, formulations were administered to female rats at doses of 300 and 2000 mg/kg orally. The general behaviour of the rats was continuously monitored for 1 h after dosing, periodically during the first 24 h and daily thereafter for a total of 14 days. On day 14, animals were fasted overnight, weighed, and sacrificed. After sacrification, animals were subjected to necropsy. For repeated dose toxicity study, rats of either sex were orally administered with formulations at the dose of 300 mg/kg per day for a period of 28 days. The maximally tolerated dose of all formulations was found to be 2000 mg/kg. Repeated administration of formulations for 28 days did not show any significant changes in haematological and biochemical parameters in experimental animals. These results indicate that the formulations are safe, when tested in experimental animals.

  5. Single and repeated elective abortions in Japan: a psychosocial study.

    Science.gov (United States)

    Kitamura, T; Toda, M A; Shima, S; Sugawara, M

    1998-09-01

    Despite its social, legal and medical importance, termination of pregnancy (TOP) (induced abortion) has rarely been the focus of psychosocial research. Of a total of 1329 women who consecutively attended the antenatal clinic of a general hospital in Japan, 635 were expecting their first baby. Of these 635 women, 103 (16.2%) had experienced TOP once previously (first aborters), while 47 (7.4%) had experienced TOP two or more times (repeated aborters). Discriminant function analysis was performed using psychosocial variables found to be significantly associated with either first abortion or repeated abortion in bivariate analyses. This revealed that both first and repeated aborters could be predicted by smoking habits and an unwanted current pregnancy while the repeated aborters appear to differ from first aborters in having a longer pre-marital dating period, non-arranged marriages, smoking habits, early maternal loss experience or a low level of maternal care during childhood. These findings suggest that both the frequency of abortion and its repetition have psychosocial origins.

  6. Prolonged repeated acupuncture stimulation induces habituation effects in pain-related brain areas: an FMRI study.

    Science.gov (United States)

    Li, Chuanfu; Yang, Jun; Park, Kyungmo; Wu, Hongli; Hu, Sheng; Zhang, Wei; Bu, Junjie; Xu, Chunsheng; Qiu, Bensheng; Zhang, Xiaochu

    2014-01-01

    Most previous studies of brain responses to acupuncture were designed to investigate the acupuncture instant effect while the cumulative effect that should be more important in clinical practice has seldom been discussed. In this study, the neural basis of the acupuncture cumulative effect was analyzed. For this experiment, forty healthy volunteers were recruited, in which more than 40 minutes of repeated acupuncture stimulation was implemented at acupoint Zhusanli (ST36). Three runs of acupuncture fMRI datasets were acquired, with each run consisting of two blocks of acupuncture stimulation. Besides general linear model (GLM) analysis, the cumulative effects of acupuncture were analyzed with analysis of covariance (ANCOVA) to find the association between the brain response and the cumulative duration of acupuncture stimulation in each stimulation block. The experimental results showed that the brain response in the initial stage was the strongest although the brain response to acupuncture was time-variant. In particular, the brain areas that were activated in the first block and the brain areas that demonstrated cumulative effects in the course of repeated acupuncture stimulation overlapped in the pain-related areas, including the bilateral middle cingulate cortex, the bilateral paracentral lobule, the SII, and the right thalamus. Furthermore, the cumulative effects demonstrated bimodal characteristics, i.e. the brain response was positive at the beginning, and became negative at the end. It was suggested that the cumulative effect of repeated acupuncture stimulation was consistent with the characteristic of habituation effects. This finding may explain the neurophysiologic mechanism underlying acupuncture analgesia.

  7. Simulation for clinical repeated-dose pharmacokinetic trials applying a peak-and-trough sampling design to estimate oral clearance.

    Science.gov (United States)

    Ishida, Kazuya; Kayano, Yuichiro; Taguchi, Masato; Hashimoto, Yukiya

    2007-11-01

    We performed a simulation for the clinical pharmacokinetic study, in which blood was sampled at two time points corresponding to the peak concentration (C(peak)) and trough concentration (C(trough)) following repetitive oral drug administration to subjects. We estimated the approximate oral clearance (CL/F(approx)) as 2.D/(C(peak).tau+C(trough).tau), where D is the dose, and tau is the dosing interval. The CL/F(approx) value was accurate for drugs with a long-elimination half-life, and the estimation error of the CL/F value was slightly increased for drugs with a shorter elimination half-life. The accuracy of CL/F(approx) in each subject was not affected by the magnitude of the interindividual pharmacokinetic variability, but was significantly decreased by the larger measurement error of drug concentrations (or intraindividual pharmacokinetic variability). We further performed several computer simulations to mimic statistical hypothesis testing following the clinical repeated-dose pharmacokinetic trials. The statistical power to detect the difference of oral clearance between two groups was marginally dependent on the measurement error of drug concentration, but was highly dependent on the interindividual pharmacokinetic variability. These findings suggested that the peak-and-trough sampling design to estimate the CL/F(approx) value is useful for clinical repeated-dose pharmacokinetic trials, and that the study design and protocol should be evaluated carefully by computer simulation prior to a real clinical trial.

  8. A transcription blocker isolated from a designed repeat protein combinatorial library by in vivo functional screen.

    Science.gov (United States)

    Tikhonova, Elena B; Ethayathulla, Abdul S; Su, Yue; Hariharan, Parameswaran; Xie, Shicong; Guan, Lan

    2015-01-28

    A highly diverse DNA library coding for ankyrin seven-repeat proteins (ANK-N5C) was designed and constructed by a PCR-based combinatorial assembly strategy. A bacterial melibiose fermentation assay was adapted for in vivo functional screen. We isolated a transcription blocker that completely inhibits the melibiose-dependent expression of α-galactosidase (MelA) and melibiose permease (MelB) of Escherichia coli by specifically preventing activation of the melAB operon. High-resolution crystal structural determination reveals that the designed ANK-N5C protein has a typical ankyrin fold, and the specific transcription blocker, ANK-N5C-281, forms a domain-swapped dimer. Functional tests suggest that the activity of MelR, a DNA-binding transcription activator and a member of AraC family of transcription factors, is inhibited by ANK-N5C-281 protein. All ANK-N5C proteins are expected to have a concave binding area with negative surface potential, suggesting that the designed ANK-N5C library proteins may facilitate the discovery of binders recognizing structural motifs with positive surface potential, like in DNA-binding proteins. Overall, our results show that the established library is a useful tool for the discovery of novel bioactive reagents.

  9. Rational design of ligands targeting triplet repeating transcripts that cause RNA dominant disease: application to myotonic muscular dystrophy type 1 and spinocerebellar ataxia type 3.

    Science.gov (United States)

    Pushechnikov, Alexei; Lee, Melissa M; Childs-Disney, Jessica L; Sobczak, Krzysztof; French, Jonathan M; Thornton, Charles A; Disney, Matthew D

    2009-07-22

    Herein, we describe the design of high affinity ligands that bind expanded rCUG and rCAG repeat RNAs expressed in myotonic dystrophy type 1 (DM1) and spinocerebellar ataxia type 3. These ligands also inhibit, with nanomolar IC(50) values, the formation of RNA-protein complexes that are implicated in both disorders. The expanded rCUG and rCAG repeats form stable RNA hairpins with regularly repeating internal loops in the stem and have deleterious effects on cell function. The ligands that bind the repeats display a derivative of the bisbenzimidazole Hoechst 33258, which was identified by searching known RNA-ligand interactions for ligands that bind the internal loop displayed in these hairpins. A series of 13 modularly assembled ligands with defined valencies and distances between ligand modules was synthesized to target multiple motifs in these RNAs simultaneously. The most avid binder, a pentamer, binds the rCUG repeat hairpin with a K(d) of 13 nM. When compared to a series of related RNAs, the pentamer binds to rCUG repeats with 4.4- to >200-fold specificity. Furthermore, the affinity of binding to rCUG repeats shows incremental gains with increasing valency, while the background binding to genomic DNA is correspondingly reduced. Then, it was determined whether the modularly assembled ligands inhibit the recognition of RNA repeats by Muscleblind-like 1 (MBNL1) protein, the expanded-rCUG binding protein whose sequestration leads to splicing defects in DM1. Among several compounds with nanomolar IC(50) values, the most potent inhibitor is the pentamer, which also inhibits the formation of rCAG repeat-MBNL1 complexes. Comparison of the binding data for the designed synthetic ligands and MBNL1 to repeating RNAs shows that the synthetic ligand is 23-fold higher affinity and more specific to DM1 RNAs than MBNL1. Further studies show that the designed ligands are cell permeable to mouse myoblasts. Thus, cell permeable ligands that bind repetitive RNAs have been designed

  10. A novel AX+/BX- paradigm to assess fear learning and safety-signal processing with repeated-measure designs.

    Science.gov (United States)

    Kazama, Andy M; Schauder, Kimberly B; McKinnon, Michael; Bachevalier, Jocelyne; Davis, Michael

    2013-04-15

    One of the core symptoms of anxiety disorders, such as post-traumatic stress disorder, is the failure to overcome feelings of danger despite being in a safe environment. This deficit likely stems from an inability to fully process safety signals, which are cues in the environment that enable healthy individuals to over-ride fear in aversive situations. Studies examining safety signal learning in rodents, humans, and non-human primates currently rely on between-groups designs. Because repeated-measure designs reduce the number of subjects required, and facilitate a broader range of safety signal studies, the current project sought to develop a repeated-measures safety-signal learning paradigm in non-human primates. Twelve healthy rhesus macaques of both sexes received three rounds of auditory fear-potentiated startle training and testing using an AX+/BX- design with all visual cues. Cue AX was paired with an aversive blast of air, whereas the same X cue in compound with another B cue (BX) signaled the absence of an air blast. Hence, cue B served as a safety signal. Once animals consistently discriminated between the aversive (AX+) and safe (BX-) cues, measured by greater startle amplitude in the presence of AX vs. BX, they were tested for conditioned inhibition by eliciting startle in the presence of a novel ambiguous combined cue (AB). Similar to previous AX+/BX- studies, healthy animals rapidly learned to discriminate between the AX+ and BX- cues as well as demonstrate conditioned inhibition in the presence of the combined AB cue (i.e. lower startle amplitude in the presence of AB vs. AX). Additionally, animals performed consistently across three rounds of testing using three new cues each time. The results validate this novel method that will serve as a useful tool for better understanding the mechanisms for the regulation of fear and anxiety. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Crystal Structure of a Designed Tetratricopeptide Repeat Module in Complex with its Peptide Ligand

    Energy Technology Data Exchange (ETDEWEB)

    Cortajarena, A.; Wang, J; Regan, L

    2010-01-01

    Tetratricopeptide repeats (TPRs) are protein domains that mediate key protein-protein interactions in cells. Several TPR domains bind the C-termini of the chaperones heat shock protein (Hsp)90 and/or Hsp70, and exchange of such binding partners is key for the heat shock response. We have previously described the design of a TPR protein that binds tightly and specifically to the C-terminus of Hsp90, and in doing so, is able to inhibit chaperone function in vivo. Here we present the X-ray crystal structure of the designed TPR domain (CTPR390) in complex with its peptide ligand - the C-terminal residues of Hsp90 (peptide MEEVD). This structure reveals two interesting aspects of the TPR modules. First, a new packing arrangement of 3-TPR modules is observed. The TPR units stack against each other in an unusual fashion to form infinite superhelices in the crystal. Second, the structure provides insights into the molecular basis of TPR-ligand recognition.

  12. A Prospective Study of Psychiatric Comorbidity and Recidivism Among Repeat DUI Offenders.

    Science.gov (United States)

    Nelson, Sarah E; Belkin, Katerina; LaPlante, Debi A; Bosworth, Leslie; Shaffer, Howard J

    2015-04-13

    Psychiatric comorbidity has emerged as a key element distinguishing DUI offenders from others, and, in some cases, distinguishing repeat offenders from first-time offenders. This paper utilizes a prospective design to determine whether the comorbid disorders identified among repeat DUI offenders can predict recidivism. Seven hundred forty-three repeat DUI offenders were recruited from a two-week inpatient treatment program at which they received a standardized mental health assessment and followed across five years post-treatment to track DUI offense, motor vehicle-related offenses, and general criminal offenses. Psychiatric comorbidity, though it did not predict DUI recidivism specifically, predicted criminal re-offense more generally. In addition, there was a specific relationship between lifetime attention deficit disorder and repeated motor vehicle-related offenses. These findings suggest that for many repeat offenders, DUI is one outlet in a constellation of criminal behavior, and that psychiatric comorbidity increases vulnerability for criminal re-offense.

  13. Factors associated with repeated outbreak of anthrax in Bangladesh: qualitative and quantitative study

    Directory of Open Access Journals (Sweden)

    Jayedul Hassan

    2015-06-01

    Full Text Available Anthrax, caused by Bacillus anthracis is an acute, febrile disease of warm blooded animals including humans. Social norms and poverty in addition to climatic factors such as soil conditions, seasons of year, ambient temperature and rainfall influence the persistence of the B. anthracis and anthrax outbreaks. The present study was designed to reveal the factors influencing the repeated outbreak of anthrax in Bangladesh. Considering the previous outbreaks of anthrax, Sirajganj, Bogra, Kushtia, Tangail and Mymensingh districts of Bangladesh were selected for this study. To elucidate the factors, qualitative data relating to the animal management, knowledge and behavior of the people; and quantitative data relating to soil conditions, ambient temperature and rainfall were acquired, and analyzed critically. Based on the outbreak histories, a year was divided into two seasons, anthrax prone season (May-November and anthrax dry season (December-April. Anthrax spores could be isolated from 11.67% (n=14/120 of the soil samples collected from the study areas. The present study revealed that poor knowledge, lack of awareness, improper carcass disposal, inadequate vaccination, high Ca content and moisture in the soil along with high ambient temperature and rainfall during the anthrax prone season were the possible influencing factors of repeated outbreaks of anthrax in the study areas. Intensive propaganda to create public awareness of anthrax together with proper vaccination may reduce anthrax outbreaks in Bangladesh.

  14. Designed ankyrin repeat proteins: a new approach to mimic complex antigens for diagnostic purposes?

    Directory of Open Access Journals (Sweden)

    Stefanie Hausammann

    Full Text Available Inhibitory antibodies directed against coagulation factor VIII (FVIII can be found in patients with acquired and congenital hemophilia A. Such FVIII-inhibiting antibodies are routinely detected by the functional Bethesda Assay. However, this assay has a low sensitivity and shows a high inter-laboratory variability. Another method to detect antibodies recognizing FVIII is ELISA, but this test does not allow the distinction between inhibitory and non-inhibitory antibodies. Therefore, we aimed at replacing the intricate antigen FVIII by Designed Ankyrin Repeat Proteins (DARPins mimicking the epitopes of FVIII inhibitors. As a model we used the well-described inhibitory human monoclonal anti-FVIII antibody, Bo2C11, for the selection on DARPin libraries. Two DARPins were selected binding to the antigen-binding site of Bo2C11, which mimic thus a functional epitope on FVIII. These DARPins inhibited the binding of the antibody to its antigen and restored FVIII activity as determined in the Bethesda assay. Furthermore, the specific DARPins were able to recognize the target antibody in human plasma and could therefore be used to test for the presence of Bo2C11-like antibodies in a large set of hemophilia A patients. These data suggest, that our approach might be used to isolate epitopes from different sets of anti-FVIII antibodies in order to develop an ELISA-based screening assay allowing the distinction of inhibitory and non-inhibitory anti-FVIII antibodies according to their antibody signatures.

  15. Designing satisfaction studies

    DEFF Research Database (Denmark)

    Kristensen, Kai; Eskildsen, Jacob Kjær

    2007-01-01

    In the effect sampling method, presentation of researcher, the intro text, the order of questions in the questionnaire along with the number of categories in the rating scale is tested in relation to the design of satisfaction studies. Based on the analyses specific recommendations for designing...... satisfaction studies are given....

  16. Implementation of repeat HIV testing during pregnancy in Kenya: a qualitative study.

    Science.gov (United States)

    Rogers, Anna Joy; Weke, Elly; Kwena, Zachary; Bukusi, Elizabeth A; Oyaro, Patrick; Cohen, Craig R; Turan, Janet M

    2016-07-11

    Repeat HIV testing in late pregnancy has the potential to decrease rates of mother-to-child transmission of HIV by identifying mothers who seroconvert after having tested negative for HIV in early pregnancy. Despite being national policy in Kenya, the available data suggest that implementation rates are low. We conducted 20 in-depth semi-structured interviews with healthcare providers and managers to explore barriers and enablers to implementation of repeat HIV testing guidelines for pregnant women. Participants were from the Nyanza region of Kenya and were purposively selected to provide variation in socio-demographics and job characteristics. Interview transcripts were coded and analyzed in Dedoose software using a thematic analysis approach. Four themes were identified a priori using Ferlie and Shortell's Framework for Change and additional themes were allowed to emerge from the data. Participants identified barriers and enablers at the client, provider, facility, and health system levels. Key barriers at the client level from the perspective of providers included late initial presentation to antenatal care and low proportions of women completing the recommended four antenatal visits. Barriers to offering repeat HIV testing for providers included heavy workloads, time limitations, and failing to remember to check for retest eligibility. At the facility level, inconsistent volume of clients and lack of space required for confidential HIV retesting were cited as barriers. Finally, at the health system level, there were challenges relating to the HIV test kit supply chain and the design of nationally standardized antenatal patient registers. Enablers to improving the implementation of repeat HIV testing included client dissemination of the benefits of antenatal care through word-of-mouth, provider cooperation and task shifting, and it was suggested that use of an electronic health record system could provide automatic reminders for retest eligibility. This study

  17. The Scope of Design Studying

    Institute of Scientific and Technical Information of China (English)

    JIN Yin; Ren Wenying

    2007-01-01

    This article trys to discuss the scope of design studying in two fields.Firstly, design has three meanings: wide design, art design and industrial design.Secondly, design studying has five contents: cultural, philosophical, methodological, produced and marketable trends.

  18. Prolonged repeated acupuncture stimulation induces habituation effects in pain-related brain areas: an FMRI study.

    Directory of Open Access Journals (Sweden)

    Chuanfu Li

    Full Text Available Most previous studies of brain responses to acupuncture were designed to investigate the acupuncture instant effect while the cumulative effect that should be more important in clinical practice has seldom been discussed. In this study, the neural basis of the acupuncture cumulative effect was analyzed. For this experiment, forty healthy volunteers were recruited, in which more than 40 minutes of repeated acupuncture stimulation was implemented at acupoint Zhusanli (ST36. Three runs of acupuncture fMRI datasets were acquired, with each run consisting of two blocks of acupuncture stimulation. Besides general linear model (GLM analysis, the cumulative effects of acupuncture were analyzed with analysis of covariance (ANCOVA to find the association between the brain response and the cumulative duration of acupuncture stimulation in each stimulation block. The experimental results showed that the brain response in the initial stage was the strongest although the brain response to acupuncture was time-variant. In particular, the brain areas that were activated in the first block and the brain areas that demonstrated cumulative effects in the course of repeated acupuncture stimulation overlapped in the pain-related areas, including the bilateral middle cingulate cortex, the bilateral paracentral lobule, the SII, and the right thalamus. Furthermore, the cumulative effects demonstrated bimodal characteristics, i.e. the brain response was positive at the beginning, and became negative at the end. It was suggested that the cumulative effect of repeated acupuncture stimulation was consistent with the characteristic of habituation effects. This finding may explain the neurophysiologic mechanism underlying acupuncture analgesia.

  19. Analysing Repeat Visitation on Country Level with Passive Mobile Positioning Method: an Estonian Case Study

    Directory of Open Access Journals (Sweden)

    Andres Kuusik

    2013-01-01

    Full Text Available The purpose of this paper is to investigate the capabilities and limits of the passive mobile positioning (PMP method in studying loyalty of tourists on the macro level. The repeat visitors were identified using database of call activities of roaming phones in Estonia since 25.04.2005 till 31.01.2009. For this purpose was developed model which selected repeat visits on the basis of time interval. The findings of the study revealed that it is possible to observe the duration, density, seasonality and dynamics of repeat visitations. In addition the local destinations and events most loved by repeat visitors and the trajectory they are using could be also identified. Another important finding revealed that repeat visitors stay longer in destination than first time visitors. The results presented in this paper could be used by Estonian Ministry of Economic Affairs and Communications and by Enterprise Estonia developing the Estonian tourism policy

  20. A Correction for the Epsilon Approximate Test in Repeated Measures Designs with Two or More Independent Groups.

    Science.gov (United States)

    Lecoutre, Bruno

    1991-01-01

    The routine epsilon approximate test in repeated measures designs when the condition of circularity is unfulfilled uses an erroneous formula in the case of two or more groups. Because this may lead to underestimation of the deviation from circularity when the subject number is small, a correction is proposed. (Author/SLD)

  1. Design and data analysis 1 study design

    Directory of Open Access Journals (Sweden)

    Karthik Suresh

    2012-01-01

    Full Text Available This article is intended to give the reader guidance in evaluating different study designs used in medical research for better scientific quality, reliability and validity of their research. This article explains three main types of study designs with understanding examples. Care and caution with skills and experience needed to design suitable studies and appropriate design coupled with reliable sampling techniques and appropriate statistical analysis, supported by clear objectives with decent communication of the findings, are essential for good research.

  2. Development of the designed ankyrin repeat protein (DARPin) G3 for HER2 molecular imaging

    Energy Technology Data Exchange (ETDEWEB)

    Goldstein, Robert; Livanos, Maria; Bhavsar, Gaurav; Rashid, Mohammed; Miranda, Enrique; Tolner, Berend; Meyer, Tim; Chester, Kerry [UCL Cancer Institute, London (United Kingdom); Sosabowski, Jane; Leyton, Julius; Mather, Stephen [Queen Mary University of London, Centre for Molecular Oncology, Barts Cancer Institute, London (United Kingdom); Vigor, Kim [Clare Hall Laboratories, Biotherapeutics Development Unit, Cancer Research UK, South Mimms (United Kingdom); Nagy-Davidescu, Gabriela; Plueckthun, Andreas [Universitaet Zuerich, Biochemisches Institut, Zuerich (Switzerland); Yeung, Jenny [UCL Cancer Institute, London (United Kingdom); UCL Institute of Child Health, London (United Kingdom)

    2014-11-13

    Human epidermal growth factor receptor-2 (HER2) overexpression is a predictor of response to anti-HER2 therapy in breast and gastric cancer. Currently, HER2 status is assessed by tumour biopsy, but this may not be representative of the larger tumour mass or other metastatic sites, risking misclassification and selection of suboptimal therapy. The designed ankyrin repeat protein (DARPin) G3 binds HER2 with high affinity at an epitope that does not overlap with trastuzumab and is biologically inert. We hypothesized that radiolabelled DARPin G3 would be capable of selectively imaging HER2-positive tumours, and aimed to identify a suitable format for clinical application. G3 DARPins tagged with hexahistidine (His{sub 6}) or with histidine glutamate (HE){sub 3} and untagged G3 DARPins were manufactured using a GMP-compatible Pichia pastoris protocol and radiolabelled with {sup 125}I, or with {sup 111}In via DOTA linked to a C-terminal cysteine. BALB/c mice were injected with radiolabelled G3 and tissue biodistribution was evaluated by gamma counting. The lead construct ((HE){sub 3}-G3) was assessed in mice bearing HER2-positive human breast tumour (BT474) xenografts. For both isotopes, (HE){sub 3}-G3 had significantly lower liver uptake than His{sub 6}-G3 and untagged G3 counterparts in non-tumour-bearing mice, and there was no significantly different liver uptake between His{sub 6}-G3 and untagged G3. (HE){sub 3}-G3 was taken forward for evaluation in mice bearing HER2-positive tumour xenografts. The results demonstrated that radioactivity from {sup 111}In-(HE){sub 3}-G3 was better maintained in tumours and cleared faster from serum than radioactivity from {sup 125}I-(HE){sub 3}-G3, achieving superior tumour-to-blood ratios (343.7 ± 161.3 vs. 22.0 ± 11.3 at 24 h, respectively). On microSPECT/CT, {sup 111}In-labelled and {sup 125}I-labelled (HE){sub 3}-G3 could image HER2-positive tumours at 4 h after administration, but there was less normal tissue uptake of

  3. Design and analysis of effects of triplet repeat oligonucleotides in cell models for myotonic dystrophy

    NARCIS (Netherlands)

    Gonzalez-Barriga, A.; Mulders, S.A.M.; Giessen, J. van der; Hooijer, J.D.; Bijl, S.; Kessel, I.D.G. van; Beers, J. van; Deutekom, J.C. van; Fransen, J.A.M.; Wieringa, B.; Wansink, D.G.

    2013-01-01

    Myotonic dystrophy type 1 (DM1) is caused by DM protein kinase (DMPK) transcripts containing an expanded (CUG)n repeat. Antisense oligonucleotide (AON)-mediated suppression of these mutant RNAs is considered a promising therapeutic strategy for this severe disorder. Earlier, we identified a 2'-O-met

  4. Design and analysis of effects of triplet repeat oligonucleotides in cell models for myotonic dystrophy

    NARCIS (Netherlands)

    Gonzalez-Barriga, A.; Mulders, S.A.M.; Giessen, J. van der; Hooijer, J.D.; Bijl, S.; Kessel, I.D.G. van; Beers, J. van; Deutekom, J.C. van; Fransen, J.A.M.; Wieringa, B.; Wansink, D.G.

    2013-01-01

    Myotonic dystrophy type 1 (DM1) is caused by DM protein kinase (DMPK) transcripts containing an expanded (CUG)n repeat. Antisense oligonucleotide (AON)-mediated suppression of these mutant RNAs is considered a promising therapeutic strategy for this severe disorder. Earlier, we identified a 2'-O-met

  5. Repeated measures dose-finding design with time-trend detection in the presence of correlated toxicity data.

    Science.gov (United States)

    Yin, Jun; Paoletti, Xavier; Sargent, Daniel J; Mandrekar, Sumithra J

    2017-08-01

    Phase I trials are designed to determine the safety, tolerability, and recommended phase 2 dose of therapeutic agents for subsequent testing. The dose-finding paradigm has thus traditionally focused on identifying the maximum tolerable dose of an agent or combination therapy under the assumption that there is a non-decreasing relationship between dose-toxicity and dose-efficacy. The dose is typically determined based on the probability of severe toxicity observed during the first treatment cycle. A novel endpoint, the total toxicity profile, was previously developed to account for the multiple toxicity types and grades experienced in the first cycle. More recently, this was extended to a repeated measures design based on the total toxicity profile to account for longitudinal toxicities over multiple treatment cycles in the absence of within-patient correlation. In this work, we propose to extend the design in the presence of within-patient correlation. Furthermore, we provide a framework to detect a toxicity time trend (toxicity increasing, decreasing, or stable) over multiple treatment cycles. We utilize a linear mixed model in the Bayesian framework, with the addition of Bayesian risk functions for decision-making in dose assignment. The performance of this design was evaluated using simulation studies and real data from a phase I trial. We demonstrated that using available toxicity data from all cycles of treatment improves the accuracy of maximum tolerated dose identification and allows for the detection of a time trend. The performance is consistent regardless of the strength of the within-patient correlation. In addition, the use of a quasi-continuous total toxicity profile score significantly increased the power to detect time trends compared to when binary data only were used. The increased interest in molecularly targeted agents and immunotherapies in oncology necessitates innovative phase I study designs. Our proposed framework provides a tool to tackle

  6. Revisiting the TALE repeat.

    Science.gov (United States)

    Deng, Dong; Yan, Chuangye; Wu, Jianping; Pan, Xiaojing; Yan, Nieng

    2014-04-01

    Transcription activator-like (TAL) effectors specifically bind to double stranded (ds) DNA through a central domain of tandem repeats. Each TAL effector (TALE) repeat comprises 33-35 amino acids and recognizes one specific DNA base through a highly variable residue at a fixed position in the repeat. Structural studies have revealed the molecular basis of DNA recognition by TALE repeats. Examination of the overall structure reveals that the basic building block of TALE protein, namely a helical hairpin, is one-helix shifted from the previously defined TALE motif. Here we wish to suggest a structure-based re-demarcation of the TALE repeat which starts with the residues that bind to the DNA backbone phosphate and concludes with the base-recognition hyper-variable residue. This new numbering system is consistent with the α-solenoid superfamily to which TALE belongs, and reflects the structural integrity of TAL effectors. In addition, it confers integral number of TALE repeats that matches the number of bound DNA bases. We then present fifteen crystal structures of engineered dHax3 variants in complex with target DNA molecules, which elucidate the structural basis for the recognition of bases adenine (A) and guanine (G) by reported or uncharacterized TALE codes. Finally, we analyzed the sequence-structure correlation of the amino acid residues within a TALE repeat. The structural analyses reported here may advance the mechanistic understanding of TALE proteins and facilitate the design of TALEN with improved affinity and specificity.

  7. Computational study of the human dystrophin repeats: interaction properties and molecular dynamics.

    Science.gov (United States)

    Legrand, Baptiste; Giudice, Emmanuel; Nicolas, Aurélie; Delalande, Olivier; Le Rumeur, Elisabeth

    2011-01-01

    Dystrophin is a large protein involved in the rare genetic disease Duchenne muscular dystrophy (DMD). It functions as a mechanical linker between the cytoskeleton and the sarcolemma, and is able to resist shear stresses during muscle activity. In all, 75% of the dystrophin molecule consists of a large central rod domain made up of 24 repeat units that share high structural homology with spectrin-like repeats. However, in the absence of any high-resolution structure of these repeats, the molecular basis of dystrophin central domain's functions has not yet been deciphered. In this context, we have performed a computational study of the whole dystrophin central rod domain based on the rational homology modeling of successive and overlapping tandem repeats and the analysis of their surface properties. Each tandem repeat has very specific surface properties that make it unique. However, the repeats share enough electrostatic-surface similarities to be grouped into four separate clusters. Molecular dynamics simulations of four representative tandem repeats reveal specific flexibility or bending properties depending on the repeat sequence. We thus suggest that the dystrophin central rod domain is constituted of seven biologically relevant sub-domains. Our results provide evidence for the role of the dystrophin central rod domain as a scaffold platform with a wide range of surface features and biophysical properties allowing it to interact with its various known partners such as proteins and membrane lipids. This new integrative view is strongly supported by the previous experimental works that investigated the isolated domains and the observed heterogeneity of the severity of dystrophin related pathologies, especially Becker muscular dystrophy.

  8. Computational study of the human dystrophin repeats: interaction properties and molecular dynamics.

    Directory of Open Access Journals (Sweden)

    Baptiste Legrand

    Full Text Available Dystrophin is a large protein involved in the rare genetic disease Duchenne muscular dystrophy (DMD. It functions as a mechanical linker between the cytoskeleton and the sarcolemma, and is able to resist shear stresses during muscle activity. In all, 75% of the dystrophin molecule consists of a large central rod domain made up of 24 repeat units that share high structural homology with spectrin-like repeats. However, in the absence of any high-resolution structure of these repeats, the molecular basis of dystrophin central domain's functions has not yet been deciphered. In this context, we have performed a computational study of the whole dystrophin central rod domain based on the rational homology modeling of successive and overlapping tandem repeats and the analysis of their surface properties. Each tandem repeat has very specific surface properties that make it unique. However, the repeats share enough electrostatic-surface similarities to be grouped into four separate clusters. Molecular dynamics simulations of four representative tandem repeats reveal specific flexibility or bending properties depending on the repeat sequence. We thus suggest that the dystrophin central rod domain is constituted of seven biologically relevant sub-domains. Our results provide evidence for the role of the dystrophin central rod domain as a scaffold platform with a wide range of surface features and biophysical properties allowing it to interact with its various known partners such as proteins and membrane lipids. This new integrative view is strongly supported by the previous experimental works that investigated the isolated domains and the observed heterogeneity of the severity of dystrophin related pathologies, especially Becker muscular dystrophy.

  9. Repeat endocarditis: analysis of risk factors based on the International Collaboration on Endocarditis - Prospective Cohort Study.

    Science.gov (United States)

    Alagna, L; Park, L P; Nicholson, B P; Keiger, A J; Strahilevitz, J; Morris, A; Wray, D; Gordon, D; Delahaye, F; Edathodu, J; Miró, J M; Fernández-Hidalgo, N; Nacinovich, F M; Shahid, R; Woods, C W; Joyce, M J; Sexton, D J; Chu, V H

    2014-06-01

    Repeat episodes of infective endocarditis (IE) can occur in patients who survive an initial episode. We analysed risk factors and 1-year mortality of patients with repeat IE. We considered 1874 patients enrolled in the International Collaboration on Endocarditis - Prospective Cohort Study between January 2000 and December 2006 (ICE-PCS) who had definite native or prosthetic valve IE and 1-year follow-up. Multivariable analysis was used to determine risk factors for repeat IE and 1-year mortality. Of 1874 patients, 1783 (95.2%) had single-episode IE and 91 (4.8%) had repeat IE: 74/91 (81%) with new infection and 17/91 (19%) with presumed relapse. On bivariate analysis, repeat IE was associated with haemodialysis (p 0.002), HIV (p 0.009), injection drug use (IDU) (p < 0.001), Staphylococcus aureus IE (p 0.003), healthcare acquisition (p 0.006) and previous IE before ICE enrolment (p 0.001). On adjusted analysis, independent risk factors were haemodialysis (OR, 2.5; 95% CI, 1.2-5.3), IDU (OR, 2.9; 95% CI, 1.6-5.4), previous IE (OR, 2.8; 95% CI, 1.5-5.1) and living in the North American region (OR, 1.9; 95% CI, 1.1-3.4). Patients with repeat IE had higher 1-year mortality than those with single-episode IE (p 0.003). Repeat IE is associated with IDU, previous IE and haemodialysis. Clinicians should be aware of these risk factors in order to recognize patients who are at risk of repeat IE.

  10. The PICTURE study: diagnostic accuracy of multiparametric MRI in men requiring a repeat prostate biopsy.

    Science.gov (United States)

    Simmons, Lucy A M; Kanthabalan, Abi; Arya, Manit; Briggs, Tim; Barratt, Dean; Charman, Susan C; Freeman, Alex; Gelister, James; Hawkes, David; Hu, Yipeng; Jameson, Charles; McCartan, Neil; Moore, Caroline M; Punwani, Shonit; Ramachandran, Navin; van der Meulen, Jan; Emberton, Mark; Ahmed, Hashim U

    2017-04-25

    Transrectal prostate biopsy has limited diagnostic accuracy. Prostate Imaging Compared to Transperineal Ultrasound-guided biopsy for significant prostate cancer Risk Evaluation (PICTURE) was a paired-cohort confirmatory study designed to assess diagnostic accuracy of multiparametric magnetic resonance imaging (mpMRI) in men requiring a repeat biopsy. All underwent 3 T mpMRI and transperineal template prostate mapping biopsies (TTPM biopsies). Multiparametric MRI was reported using Likert scores and radiologists were blinded to initial biopsies. Men were blinded to mpMRI results. Clinically significant prostate cancer was defined as Gleason ⩾4+3 and/or cancer core length ⩾6 mm. Two hundred and forty-nine had both tests with mean (s.d.) age was 62 (7) years, median (IQR) PSA 6.8 ng ml (4.98-9.50), median (IQR) number of previous biopsies 1 (1-2) and mean (s.d.) gland size 37 ml (15.5). On TTPM biopsies, 103 (41%) had clinically significant prostate cancer. Two hundred and fourteen (86%) had a positive prostate mpMRI using Likert score ⩾3; sensitivity was 97.1% (95% confidence interval (CI): 92-99), specificity 21.9% (15.5-29.5), negative predictive value (NPV) 91.4% (76.9-98.1) and positive predictive value (PPV) 46.7% (35.2-47.8). One hundred and twenty-nine (51.8%) had a positive mpMRI using Likert score ⩾4; sensitivity was 80.6% (71.6-87.7), specificity 68.5% (60.3-75.9), NPV 83.3% (75.4-89.5) and PPV 64.3% (55.4-72.6). In men advised to have a repeat prostate biopsy, prostate mpMRI could be used to safely avoid a repeat biopsy with high sensitivity for clinically significant cancers. However, such a strategy can miss some significant cancers and overdiagnose insignificant cancers depending on the mpMRI score threshold used to define which men should be biopsied.

  11. Structural model for the interaction of a designed Ankyrin Repeat Protein with the human epidermal growth factor receptor 2.

    Directory of Open Access Journals (Sweden)

    V Chandana Epa

    Full Text Available Designed Ankyrin Repeat Proteins are a class of novel binding proteins that can be selected and evolved to bind to targets with high affinity and specificity. We are interested in the DARPin H10-2-G3, which has been evolved to bind with very high affinity to the human epidermal growth factor receptor 2 (HER2. HER2 is found to be over-expressed in 30% of breast cancers, and is the target for the FDA-approved therapeutic monoclonal antibodies trastuzumab and pertuzumab and small molecule tyrosine kinase inhibitors. Here, we use computational macromolecular docking, coupled with several interface metrics such as shape complementarity, interaction energy, and electrostatic complementarity, to model the structure of the complex between the DARPin H10-2-G3 and HER2. We analyzed the interface between the two proteins and then validated the structural model by showing that selected HER2 point mutations at the putative interface with H10-2-G3 reduce the affinity of binding up to 100-fold without affecting the binding of trastuzumab. Comparisons made with a subsequently solved X-ray crystal structure of the complex yielded a backbone atom root mean square deviation of 0.84-1.14 Ångstroms. The study presented here demonstrates the capability of the computational techniques of structural bioinformatics in generating useful structural models of protein-protein interactions.

  12. A study of allelic polymorphism of four short tandem repeats in the population of northwestern Russia

    Energy Technology Data Exchange (ETDEWEB)

    Aseev, M.V.; Skakun, V.N.; Baranov, V.S. [Ott Institute of Obstetrics and Gynecology, St. Petersburg (Russian Federation)

    1995-06-01

    Characteristics of the allelic polymorphisms of the trimeric AGC repeat of the androgen receptor gene (Xq11-12), exon 1 (AR); the tetrameric ATCT repeat of the von Willebrand factor gene (12p12), intron 40 (vWF); the AGAT repeat of the hypoxanthine phosphoribosyltransferase gene (Xq26) (HPRT); and the AGAT repeat of anonymous DNA sequences of the short arm of chromosome X (STRX1) were studied in 160 DNA samples from unrelated inhabitants of northwestern Russia using the method of polymerase chain reaction. Seventeen, ten, eight, and nine alleles were revealed electrophoretically for short tandem repeats of AR, vWF, HPRT, and STRX1, respectively. The heterozygosity indices for these repeats were 0.80, 0.70, 0.54, and 0.58, respectively. The values for AR and vWF correlated with those expected according to the Hardy-Weinberg equilibrium, whereas the values for HPRT and STRX1 differed significantly from those theoretically expected. The individualization potentials were 0.045, 0.135, 0.095, and 0.061 for the short tandem repeats of AR, vWF, HPRT, and STRX1, respectively. The distribution of genotypes for the set of these four loci in the population studied was determined. The possibilities of using the studied polymorphic marker systems in molecular diagnosis of the corresponding monogenic diseases - spinal and bulbar muscle atrophy (AR), Lesch-Nyhan disease (HPRT), and von Willebrand disease (vWF) - as well as in population human genetics, testing of personal identity, and molecular approaches to the estimation of mutagenic activity are discussed. 17 refs., 2 figs., 6 tabs.

  13. Narrative exposure therapy for posttraumatic stress disorder associated with repeated interpersonal trauma in patients with severe mental illness: a mixed methods design

    Science.gov (United States)

    Mauritz, Maria W.; Van Gaal, Betsie G. I.; Jongedijk, Ruud A.; Schoonhoven, Lisette; Nijhuis-van der Sanden, Maria W. G.; Goossens, Peter J. J.

    2016-01-01

    Background In the Netherlands, most patients with severe mental illness (SMI) receive flexible assertive community treatment (FACT) provided by multidisciplinary community mental health teams. SMI patients with comorbid posttraumatic stress disorder (PTSD) are sometimes offered evidence-based trauma-focused treatment like eye movement desensitization reprocessing or prolonged exposure. There is a large amount of evidence for the effectiveness of narrative exposure therapy (NET) within various vulnerable patient groups with repeated interpersonal trauma. Some FACT-teams provide NET for patients with comorbid PTSD, which is promising, but has not been specifically studied in SMI patients. Objectives The primary aim is to evaluate NET in SMI patients with comorbid PTSD associated with repeated interpersonal trauma to get insight into whether (1) PTSD and dissociative symptoms changes and (2) changes occur in the present SMI symptoms, care needs, quality of life, global functioning, and care consumption. The second aim is to gain insight into patients’ experiences with NET and to identify influencing factors on treatment results. Methods This study will have a mixed methods convergent design consisting of quantitative repeated measures and qualitative semi-structured in-depth interviews based on Grounded Theory. The study population will include adult SMI outpatients (n=25) with comorbid PTSD and receiving NET. The quantitative study parameters will be existence and severity of PTSD, dissociative, and SMI symptoms; care needs; quality of life; global functioning; and care consumption. In a longitudinal analysis, outcomes will be analyzed using mixed models to estimate the difference in means between baseline and repeated measurements. The qualitative study parameters will be experiences with NET and perceived factors for success or failure. Integration of quantitative and qualitative results will be focused on interpreting how qualitative results enhance the

  14. Anterior segment biometry: a study and review of resolution and repeatability data.

    Science.gov (United States)

    Reinstein, Dan Z; Gobbe, Marine; Archer, Timothy J

    2012-07-01

    To obtain comparable resolution and repeatability data for a selection of anterior segment imaging devices. A standard letter of request was sent in May 2008 to each device manufacturer requesting resolution and repeatability data for its device to be provided according to specific definitions and protocol; if this was not already published in the peer-reviewed domain, compliant raw data were required. Where applicable, repeatability data were reported for corneal vertex corneal thickness; epithelial and flap thickness; minimum corneal thickness; corneal, epithelial and flap thickness mapping for the central 6-mm diameter; minimum residual stromal thickness; angle-to-angle diameter; sulcus-to-sulcus diameter; and anterior chamber depth. To summarize published repeatability data, a complete review of the peer-reviewed literature waas performed. Nine of the 13 manufacturers contacted agreed to take part and provided the data requested: Pentacam HD (Oculus Optikgeräte GmbH), Galilei (Ziemer), Visante OCT (Carl Zeiss Meditec), SL-OCT (Haag-Streit), RTVue (Optovue), Artemis (ArcScan), Vumax (Sonomed), HiScan (Opticon), and Eye Cubed (Ellex/Innovative). Only one (Carl Zeiss Meditec) of 9 manufacturers was able to provide the data directly upon request, without performing a prospective study. Five of the 9 manufacturers were able to provide a complete set of repeatability data for all parameters measurable with their device; the remaining 4 manufacturers admitted that repeatability of some parameters was unknown. Both literature and manufacturers' data on file were lacking and required the study to be performed. This report provides an imperfect, but most comprehensive to date, resolution and repeatability data review of biometric devices intended for surgical planning. Copyright 2012, SLACK Incorporated.

  15. Receptionist input to quality and safety in repeat prescribing in UK general practice: ethnographic case study.

    Science.gov (United States)

    Swinglehurst, Deborah; Greenhalgh, Trisha; Russell, Jill; Myall, Michelle

    2011-11-03

    To describe, explore, and compare organisational routines for repeat prescribing in general practice to identify contributors and barriers to safety and quality. Ethnographic case study. Four urban UK general practices with diverse organisational characteristics using electronic patient records that supported semi-automation of repeat prescribing. 395 hours of ethnographic observation of staff (25 doctors, 16 nurses, 4 healthcare assistants, 6 managers, and 56 reception or administrative staff), and 28 documents and other artefacts relating to repeat prescribing locally and nationally. Potential threats to patient safety and characteristics of good practice. Observation of how doctors, receptionists, and other administrative staff contributed to, and collaborated on, the repeat prescribing routine. Analysis included mapping prescribing routines, building a rich description of organisational practices, and drawing these together through narrative synthesis. This was informed by a sociological model of how organisational routines shape and are shaped by information and communications technologies. Results Repeat prescribing was a complex, technology-supported social practice requiring collaboration between clinical and administrative staff, with important implications for patient safety. More than half of requests for repeat prescriptions were classed as "exceptions" by receptionists (most commonly because the drug, dose, or timing differed from what was on the electronic repeat list). They managed these exceptions by making situated judgments that enabled them (sometimes but not always) to bridge the gap between the idealised assumptions about tasks, roles, and interactions that were built into the electronic patient record and formal protocols, and the actual repeat prescribing routine as it played out in practice. This work was creative and demanded both explicit and tacit knowledge. Clinicians were often unaware of this input and it did not feature in policy

  16. Planned Repeat Cesarean Section at Term and Adverse Childhood Health Outcomes: A Record-Linkage Study.

    Directory of Open Access Journals (Sweden)

    Mairead Black

    2016-03-01

    Full Text Available Global cesarean section (CS rates range from 1% to 52%, with a previous CS being the commonest indication. Labour following a previous CS carries risk of scar rupture, with potential for offspring hypoxic brain injury, leading to high rates of repeat elective CS. However, the effect of delivery by CS on long-term outcomes in children is unclear. Increasing evidence suggests that in avoiding exposure to maternal bowel flora during labour or vaginal birth, offspring delivered by CS may be adversely affected in terms of energy uptake from the gut and immune development, increasing obesity and asthma risks, respectively. This study aimed to address the evidence gap on long-term childhood outcomes following repeat CS by comparing adverse childhood health outcomes after (1 planned repeat CS and (2 unscheduled repeat CS with those that follow vaginal birth after CS (VBAC.A data-linkage cohort study was performed. All second-born, term, singleton offspring delivered between 1 January 1993 and 31 December 2007 in Scotland, UK, to women with a history of CS (n = 40,145 were followed up until 31 January 2015. Outcomes assessed included obesity at age 5 y, hospitalisation with asthma, learning disability, cerebral palsy, and death. Cox regression and binary logistic regression were used as appropriate to compare outcomes following planned repeat CS (n = 17,919 and unscheduled repeat CS (n = 8,847 with those following VBAC (n = 13,379. Risk of hospitalisation with asthma was greater following both unscheduled repeat CS (3.7% versus 3.3%, adjusted hazard ratio [HR] 1.18, 95% CI 1.05-1.33 and planned repeat CS (3.6% versus 3.3%, adjusted HR 1.24, 95% CI 1.09-1.42 compared with VBAC. Learning disability and death were more common following unscheduled repeat CS compared with VBAC (3.7% versus 2.3%, adjusted odds ratio 1.64, 95% CI 1.17-2.29, and 0.5% versus 0.4%, adjusted HR 1.50, 95% CI 1.00-2.25, respectively. Risk of obesity at age 5 y and risk of cerebral

  17. Slurry reactor design studies

    Energy Technology Data Exchange (ETDEWEB)

    Fox, J.M.; Degen, B.D.; Cady, G.; Deslate, F.D.; Summers, R.L. (Bechtel Group, Inc., San Francisco, CA (USA)); Akgerman, A. (Texas A and M Univ., College Station, TX (USA)); Smith, J.M. (California Univ., Davis, CA (USA))

    1990-06-01

    The objective of these studies was to perform a realistic evaluation of the relative costs of tublar-fixed-bed and slurry reactors for methanol, mixed alcohols and Fischer-Tropsch syntheses under conditions where they would realistically be expected to operate. The slurry Fischer-Tropsch reactor was, therefore, operated at low H{sub 2}/CO ratio on gas directly from a Shell gasifier. The fixed-bed reactor was operated on 2.0 H{sub 2}/CO ratio gas after adjustment by shift and CO{sub 2} removal. Every attempt was made to give each reactor the benefit of its optimum design condition and correlations were developed to extend the models beyond the range of the experimental pilot plant data. For the methanol design, comparisons were made for a recycle plant with high methanol yield, this being the standard design condition. It is recognized that this is not necessarily the optimum application for the slurry reactor, which is being proposed for a once-through operation, coproducing methanol and power. Consideration is also given to the applicability of the slurry reactor to mixed alcohols, based on conditions provided by Lurgi for an Octamix{trademark} plant using their standard tubular-fixed reactor technology. 7 figs., 26 tabs.

  18. ProtRepeatsDB: a database of amino acid repeats in genomes

    Directory of Open Access Journals (Sweden)

    Chauhan Virander S

    2006-07-01

    Full Text Available Abstract Background Genome wide and cross species comparisons of amino acid repeats is an intriguing problem in biology mainly due to the highly polymorphic nature and diverse functions of amino acid repeats. Innate protein repeats constitute vital functional and structural regions in proteins. Repeats are of great consequence in evolution of proteins, as evident from analysis of repeats in different organisms. In the post genomic era, availability of protein sequences encoded in different genomes provides a unique opportunity to perform large scale comparative studies of amino acid repeats. ProtRepeatsDB http://bioinfo.icgeb.res.in/repeats/ is a relational database of perfect and mismatch repeats, access to which is designed as a resource and collection of tools for detection and cross species comparisons of different types of amino acid repeats. Description ProtRepeatsDB (v1.2 consists of perfect as well as mismatch amino acid repeats in the protein sequences of 141 organisms, the genomes of which are now available. The web interface of ProtRepeatsDB consists of different tools to perform repeat s; based on protein IDs, organism name, repeat sequences, and keywords as in FASTA headers, size, frequency, gene ontology (GO annotation IDs and regular expressions (REGEXP describing repeats. These tools also allow formulation of a variety of simple, complex and logical queries to facilitate mining and large-scale cross-species comparisons of amino acid repeats. In addition to this, the database also contains sequence analysis tools to determine repeats in user input sequences. Conclusion ProtRepeatsDB is a multi-organism database of different types of amino acid repeats present in proteins. It integrates useful tools to perform genome wide queries for rapid screening and identification of amino acid repeats and facilitates comparative and evolutionary studies of the repeats. The database is useful for identification of species or organism specific

  19. Seal design alternatives study

    Energy Technology Data Exchange (ETDEWEB)

    Van Sambeek, L.L. [RE/SPEC Inc., Rapid City, SD (US); Luo, D.D.; Lin, M.S.; Ostrowski, W.; Oyenuga, D. [Parsons Brinckerhoff Quade & Douglas, Inc., San Francisco, CA (US)

    1993-06-01

    This report presents the results from a study of various sealing alternatives for the WIPP sealing system. Overall, the sealing system has the purpose of reducing to the extent possible the potential for fluids (either gas or liquid) from entering or leaving the repository. The sealing system is divided into three subsystems: drift and panel seals within the repository horizon, shaft seals in each of the four shafts, and borehole seals. Alternatives to the baseline configuration for the WIPP seal system design included evaluating different geometries and schedules for seal component installations and the use of different materials for seal components. Order-of-magnitude costs for the various alternatives were prepared as part of the study. Firm recommendations are not presented, but the advantages and disadvantages of the alternatives are discussed. Technical information deficiencies are identified and studies are outlined which can provide required information.

  20. Design of a Dual-Band On-Body Antenna for a Wireless Body Area Network Repeater System

    Directory of Open Access Journals (Sweden)

    Kyeol Kwon

    2012-01-01

    Full Text Available A dual-band on-body antenna for a wireless body area network repeater system is proposed. The designed dual-band antenna has the maximum radiation directed toward the inside of the human body in the medical implantable communication service (MICS band in order to collect vital information from the human body and directed toward the outside in the industrial, scientific, and medical (ISM band to transmit that information to a monitoring system. In addition, the return loss property of the antenna is insensitive to human body effects by utilizing the epsilon negative zeroth-order resonance property.

  1. Longitudinal study of repeated sprint performance in youth soccer players of contrasting skeletal maturity status

    NARCIS (Netherlands)

    Valente-dos-Santos, Joao; Coelho-e-Silva, Manuel J.; Severino, Vitor; Duarte, Joao; Martins, Raul S.; Figueiredo, Antonio J.; Seabra, Andre T.; Philippaerts, Renaat M.; Cumming, Sean P.; Elferink-Gemser, Marije; Malina, Robert M.

    The purpose of the study was to evaluate the developmental changes in performance in a repeated-sprint ability (RSA) test in young soccer players of contrasting maturity status. A total of 83 regional level Portuguese youth soccer players, aged 11-13 years at baseline was assessed annually. Stature,

  2. Longitudinal study of repeated sprint performance in youth soccer players of contrasting maturity status

    NARCIS (Netherlands)

    V. Duarte; A. Seabra; A. Figueiredo; S. Cumming; R. Martins; R. Philippaerts; M. Coelho e Silva; J. Valente dos Santos; V. Severino; Marije Elferink-Gemser

    2012-01-01

    The purpose of the study was to evaluate the developmental changes in performance in a repeated-sprint ability (RSA) test in young soccer players of contrasting maturity status. A total of 83 regional level Portuguese youth soccer players, aged 11- 13 years at baseline was assessed annually.

  3. 40 CFR 799.9305 - TSCA Repeated dose 28-day oral toxicity study in rodents.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 31 2010-07-01 2010-07-01 true TSCA Repeated dose 28-day oral toxicity study in rodents. 799.9305 Section 799.9305 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... strains of young healthy adult animals should be employed. The females should be nulliparous and...

  4. Narrative exposure therapy for posttraumatic stress disorder associated with repeated interpersonal trauma in patients with severe mental illness: a mixed methods design

    Directory of Open Access Journals (Sweden)

    Maria W. Mauritz

    2016-09-01

    Full Text Available Background: In the Netherlands, most patients with severe mental illness (SMI receive flexible assertive community treatment (FACT provided by multidisciplinary community mental health teams. SMI patients with comorbid posttraumatic stress disorder (PTSD are sometimes offered evidence-based trauma-focused treatment like eye movement desensitization reprocessing or prolonged exposure. There is a large amount of evidence for the effectiveness of narrative exposure therapy (NET within various vulnerable patient groups with repeated interpersonal trauma. Some FACT-teams provide NET for patients with comorbid PTSD, which is promising, but has not been specifically studied in SMI patients. Objectives: The primary aim is to evaluate NET in SMI patients with comorbid PTSD associated with repeated interpersonal trauma to get insight into whether (1 PTSD and dissociative symptoms changes and (2 changes occur in the present SMI symptoms, care needs, quality of life, global functioning, and care consumption. The second aim is to gain insight into patients’ experiences with NET and to identify influencing factors on treatment results. Methods: This study will have a mixed methods convergent design consisting of quantitative repeated measures and qualitative semi-structured in-depth interviews based on Grounded Theory. The study population will include adult SMI outpatients (n=25 with comorbid PTSD and receiving NET. The quantitative study parameters will be existence and severity of PTSD, dissociative, and SMI symptoms; care needs; quality of life; global functioning; and care consumption. In a longitudinal analysis, outcomes will be analyzed using mixed models to estimate the difference in means between baseline and repeated measurements. The qualitative study parameters will be experiences with NET and perceived factors for success or failure. Integration of quantitative and qualitative results will be focused on interpreting how qualitative results

  5. BWID System Design Study

    Energy Technology Data Exchange (ETDEWEB)

    O' Brien, M.C.; Rudin, M.J.; Morrison, J.L.; Richardson, J.G.

    1991-01-01

    The mission of the Buried Waste Integrated Demonstration (BWID) System Design Study is to identify and evaluate technology process options for the cradle-to-grave remediation of Transuranic (TRU)-Contaminated Waste Pits and Trenches buried at the Idaho National Engineering Laboratory (INEL). Emphasis is placed upon evaluating system configuration options and associated functional and operational requirements for retrieving and treating the buried wastes. A Performance-Based Technology Selection Filter was developed to evaluate the identified remediation systems and their enabling technologies based upon system requirements and quantification of technical Comprehensive Environmental Response, Compensation, and Liability (CERCLA) balancing criteria. Remediation systems will also be evaluated with respect to regulatory and institutional acceptance and cost-effectiveness.

  6. BWID System Design Study

    Energy Technology Data Exchange (ETDEWEB)

    O`Brien, M.C.; Rudin, M.J.; Morrison, J.L.; Richardson, J.G.

    1991-12-31

    The mission of the Buried Waste Integrated Demonstration (BWID) System Design Study is to identify and evaluate technology process options for the cradle-to-grave remediation of Transuranic (TRU)-Contaminated Waste Pits and Trenches buried at the Idaho National Engineering Laboratory (INEL). Emphasis is placed upon evaluating system configuration options and associated functional and operational requirements for retrieving and treating the buried wastes. A Performance-Based Technology Selection Filter was developed to evaluate the identified remediation systems and their enabling technologies based upon system requirements and quantification of technical Comprehensive Environmental Response, Compensation, and Liability (CERCLA) balancing criteria. Remediation systems will also be evaluated with respect to regulatory and institutional acceptance and cost-effectiveness.

  7. Design of hybrid automatic repeat request (HARQ)for TDD-OFDM system

    Institute of Scientific and Technical Information of China (English)

    Wen Na; Zhang Ping

    2008-01-01

    Reliability-based hybrid automatic repeat request (HARQ) (RB-HARQ) is a recently developed form of incremental-redundancy ARQ.It achieves good performance whereas large retransmission request packets should be fed back.In this paper, in order to reduce the number of the fed back bits, we propose a HARQ scheme applied in time duplex division orthogonal frequency division multiplexing (TDDOFDM) system over the slow fading channel which is named channel-based HARQ (CB-HARQ).Because one bit which meets deep fading is always with small value of log likelihood ratio (LLR) during the process of decoding of LDPC code, the bits transmitted on the carrier with deep fading are retransmitted.At the receiver, the decoder will compute the locations of retransmission bits according to the channel fading values which are gotten by utilizing the feature of channel symmetry in TDD mode.So the indices of retransmission bits are avoided to be transmitted.Simulation results show that this method achieves better BER performance and requires much smaller request packets in feedback link.

  8. Thermionic Reactor Design Studies

    Energy Technology Data Exchange (ETDEWEB)

    Schock, Alfred

    1994-06-01

    During the 1960's and early 70's the author performed extensive design studies, analyses, and tests aimed at thermionic reactor concepts that differed significantly from those pursued by other investigators. Those studies, like most others under Atomic Energy Commission (AEC and DOE) and the National Aeronautics and Space Administration (NASA) sponsorship, were terminated in the early 1970's. Some of this work was previously published, but much of it was never made available in the open literature. U.S. interest in thermionic reactors resumed in the early 80's, and was greatly intensified by reports about Soviet ground and flight tests in the late 80's. This recent interest resulted in renewed U.S. thermionic reactor development programs, primarily under Department of Defense (DOD) and Department of Energy (DOE) sponsorship. Since most current investigators have not had an opportunity to study all of the author's previous work, a review of the highlights of that work may be of value to them. The present paper describes some of the author's conceptual designs and their rationale, and the special analytical techniques developed to analyze their performance. The basic designs, first published in 1963, are based on single-cell converters, either double-ended diodes extending over the full height of the reactor core or single-ended diodes extending over half the core height. In that respect they are similar to the thermionic fuel elements employed in the Topaz-2 reactor subsequently developed in the Soviet Union, copies of which were recently imported by the U.S. As in the Topaz-2 case, electrically heated steady-state performance tests of the converters are possible before fueling. Where the author's concepts differed from the later Topaz-2 design was in the relative location of the emitter and the collector. Placing the fueled emitter on the outside of the cylindrical diodes permits much higher axial conductances to reduce ohmic

  9. Optimal selection of individuals for repeated covariate measurements in follow-up studies.

    Science.gov (United States)

    Reinikainen, Jaakko; Karvanen, Juha; Tolonen, Hanna

    2016-12-01

    Repeated covariate measurements bring important information on the time-varying risk factors in long epidemiological follow-up studies. However, due to budget limitations, it may be possible to carry out the repeated measurements only for a subset of the cohort. We study cost-efficient alternatives for the simple random sampling in the selection of the individuals to be remeasured. The proposed selection criteria are based on forms of the D-optimality. The selection methods are compared with the simulation studies and illustrated with the data from the East-West study carried out in Finland from 1959 to 1999. The results indicate that cost savings can be achieved if the selection is focused on the individuals with high expected risk of the event and, on the other hand, on those with extreme covariate values in the previous measurements. © The Author(s) 2014.

  10. Brexpiprazole Alters Monoaminergic Systems following Repeated Administration: an in Vivo Electrophysiological Study

    OpenAIRE

    Oosterhof, Chris A.; Mansari, Mostafa El; Bundgaard, Christoffer; Blier, Pierre

    2015-01-01

    Background: Brexpiprazole was recently approved as adjunctive therapy for depression and treatment of schizophrenia in adults. To complement results from a previous study in which its acute effects were characterized, the present study assessed the effect of repeated brexpiprazole administration on monoaminergic systems. Methods: Brexpiprazole (1mg/kg, subcutaneous) or vehicle was administered once daily for 2 and 14 days. Single-unit electrophysiological recordings from noradrenaline neurons...

  11. Studies in Interior Design

    Science.gov (United States)

    Environ Planning Design, 1970

    1970-01-01

    Floor plans and photographs illustrate a description of the Samuel C. Williams Library at Stevens Institute of Technology, Hoboken, N.J. The unusual interior design allows students to take full advantage of the library's resources. (JW)

  12. Studies in Interior Design

    Science.gov (United States)

    Environ Planning Design, 1970

    1970-01-01

    Floor plans and photographs illustrate a description of the Samuel C. Williams Library at Stevens Institute of Technology, Hoboken, N.J. The unusual interior design allows students to take full advantage of the library's resources. (JW)

  13. Evaluation of statistical tools used in short-term repeated dose administration toxicity studies with rodents.

    Science.gov (United States)

    Kobayashi, Katsumi; Pillai, K Sadasivan; Sakuratani, Yuki; Abe, Takemaru; Kamata, Eiichi; Hayashi, Makoto

    2008-02-01

    In order to know the different statistical tools used to analyze the data obtained from twenty-eight-day repeated dose oral toxicity studies with rodents and the impact of these statistical tools on interpretation of data obtained from the studies, study reports of 122 numbers of twenty-eight-day repeated dose oral toxicity studies conducted in rats were examined. It was found that both complex and easy routes of decision trees were followed for the analysis of the quantitative data. These tools include Scheffe's test, non-parametric type Dunnett's and Scheffe's tests with very low power. Few studies used the non-parametric Dunnett type test and Mann-Whitney's U test. Though Chi-square and Fisher's tests are widely used for analysis of qualitative data, their sensitivity to detect a treatment-related effect is questionable. Mann-Whitney's U test has better sensitivity to analyze qualitative data than the chi-square and Fisher's tests. We propose Dunnett's test for analysis of quantitative data obtained from twenty-eight-day repeated dose oral toxicity tests and for qualitative data, Mann-Whitney's U test. For both tests, one-sided test with p=0.05 may be applied.

  14. Repeated vertebral augmentation for new vertebral compression fractures of postvertebral augmentation patients: a nationwide cohort study

    Directory of Open Access Journals (Sweden)

    Liang CL

    2015-03-01

    Full Text Available Cheng-Loong Liang,1 Hao-Kwan Wang,1 Fei-Kai Syu,2 Kuo-Wei Wang,1 Kang Lu,1 Po-Chou Liliang1 1Department of Neurosurgery, E-Da Hospital, I-Shou University, Kaohsiung City, Taiwan; 2Department of Pharmacy, China Medical University Hospital, Taichung City, Taiwan Purpose: Postvertebral augmentation vertebral compression fractures are common; repeated vertebral augmentation is usually performed for prompt pain relief. This study aimed to evaluate the incidence and risk factors of repeat vertebral augmentation.Methods: We performed a retrospective, nationwide, population-based longitudinal observation study, using the National Health Insurance Research Database (NHIRD of Taiwan. All patients who received vertebral augmentation for vertebral compression fractures were evaluated. The collected data included patient characteristics (demographics, comorbidities, and medication exposure and repeat vertebral augmentation. Kaplan–Meier and stratified Cox proportional hazard regressions were performed for analyses.Results: The overall incidence of repeat vertebral augmentation was 11.3% during the follow-up until 2010. Patients with the following characteristics were at greater risk for repeat vertebral augmentation: female sex (AOR=1.24; 95% confidence interval [CI]: 1.10–2.36, advanced age (AOR=1.60; 95% CI: 1.32–2.08, diabetes mellitus (AOR=4.31; 95% CI: 4.05–5.88, cerebrovascular disease (AOR=4.09; 95% CI: 3.44–5.76, dementia (AOR=1.97; 95% CI: 1.69–2.33, blindness or low vision (AOR=3.72; 95% CI: 2.32–3.95, hypertension (AOR=2.58; 95% CI: 2.35–3.47, and hyperlipidemia (AOR=2.09; 95% CI: 1.67–2.22. Patients taking calcium/ vitamin D (AOR=2.98; 95% CI: 1.83–3.93, bisphosphonates (AOR=2.11; 95% CI: 1.26–2.61, or calcitonin (AOR=4.59; 95% CI: 3.40–5.77 were less likely to undergo repeat vertebral augmentation; however, those taking steroids (AOR=7.28; 95% CI: 6.32–8.08, acetaminophen (AOR=3.54; 95% CI: 2.75–4.83, or nonsteroidal

  15. Repeat prenatal corticosteroid prior to preterm birth: a systematic review and individual participant data meta-analysis for the PRECISE study group (prenatal repeat corticosteroid international IPD study group: assessing the effects using the best level of evidence - study protocol

    Directory of Open Access Journals (Sweden)

    Crowther Caroline A

    2012-02-01

    Full Text Available Abstract Background The aim of this individual participant data (IPD meta-analysis is to assess whether the effects of repeat prenatal corticosteroid treatment given to women at risk of preterm birth to benefit their babies are modified in a clinically meaningful way by factors related to the women or the trial protocol. Methods/Design The Prenatal Repeat Corticosteroid International IPD Study Group: assessing the effects using the best level of Evidence (PRECISE Group will conduct an IPD meta-analysis. The PRECISE International Collaborative Group was formed in 2010 and data collection commenced in 2011. Eleven trials with up to 5,000 women and 6,000 infants are eligible for the PRECISE IPD meta-analysis. The primary study outcomes for the infants will be serious neonatal outcome (defined by the PRECISE International IPD Study Group as one of death (foetal, neonatal or infant; severe respiratory disease; severe intraventricular haemorrhage (grade 3 and 4; chronic lung disease; necrotising enterocolitis; serious retinopathy of prematurity; and cystic periventricular leukomalacia; use of respiratory support (defined as mechanical ventilation or continuous positive airways pressure or other respiratory support; and birth weight (Z-scores. For the children, the primary study outcomes will be death or any neurological disability (however defined by trialists at childhood follow up and may include developmental delay or intellectual impairment (developmental quotient or intelligence quotient more than one standard deviation below the mean, cerebral palsy (abnormality of tone with motor dysfunction, blindness (for example, corrected visual acuity worse than 6/60 in the better eye or deafness (for example, hearing loss requiring amplification or worse. For the women, the primary outcome will be maternal sepsis (defined as chorioamnionitis; pyrexia after trial entry requiring the use of antibiotics; puerperal sepsis; intrapartum fever requiring the use

  16. Design of Injection Mold for Repeater Panel%复读机面盖注塑模设计

    Institute of Scientific and Technical Information of China (English)

    蒋育华; 胡琪; 付鹏

    2012-01-01

    The structure characteristics of plastic part of repeater panel was analyzed. The design methods for combined molding parts and side core-pulling mechanism of the mold were expounded. The practical production proves that the actions of core-pulling and demoulding are steady and reliable, the pin-point gate can satisfy the appearance requirement of the plastic part, and the quality of the plastic part can meet the technical requirements.%分析了复读机面盖塑件的结构特点,阐述了该模具组合式成型零件及侧抽芯机构的设计方法.经生产实践证明:该模具的抽芯及脱模动作均平稳可靠,点浇口保证了塑件的外观要求,塑件质量可以满足技术要求.

  17. Architecture as Design Study.

    Science.gov (United States)

    Kauppinen, Heta

    1989-01-01

    Explores the use of analogies in architectural design, the importance of Gestalt theory and aesthetic cannons in understanding and being sensitive to architecture. Emphasizes the variation between public and professional appreciation of architecture. Notes that an understanding of architectural process enables students to improve the aesthetic…

  18. Chromosomal abnormalities in couples with repeated fetal loss: An Indian retrospective study

    Directory of Open Access Journals (Sweden)

    Frenny J Sheth

    2013-01-01

    Full Text Available Background: Recurrent pregnancy loss is a common occurrence and a matter of concern for couples planning the pregnancy. Chromosomal abnormalities, mainly balanced rearrangements, are common in couples with repeated miscarriages. Purpose: The purpose of this study is to evaluate the contribution of chromosomal anomalies causing repeated spontaneous miscarriages and provide detailed characterization of a few structurally altered chromosomes. Materials and Methods: A retrospective cytogenetic study was carried out on 4859 individuals having a history of recurrent miscarriages. The cases were analyzed using G-banding and fluorescence in situ hybridization wherever necessary. Results: Chromosomal rearrangements were found in 170 individuals (3.5%. Translocations were seen in 72 (42.35% cases. Of these, reciprocal translocations constituted 42 (24.70% cases while Robertsonian translocations were detected in 30 (17.64% cases. 7 (4.11% cases were mosaic, 8 (4.70% had small supernumerary marker chromosomes and 1 (0.6% had an interstitial microdeletion. Nearly, 78 (1.61% cases with heteromorphic variants were seen of which inversion of Y chromosome (57.70% and chromosome 9 pericentromeric variants (32.05% were predominantly involved. Conclusions: Chromosomal analysis is an important etiological investigation in couples with repeated miscarriages. Characterization of variants/marker chromosome enable calculation of a more precise recurrent risk in a subsequent pregnancy thereby facilitating genetic counseling and deciding further reproductive options.

  19. On the Applicability of Elastic Network Models for the Study of RNA CUG Trinucleotide Repeat Overexpansion.

    Directory of Open Access Journals (Sweden)

    Àlex L González

    Full Text Available Non-coding RNAs play a pivotal role in a number of diseases promoting an aberrant sequestration of nuclear RNA-binding proteins. In the particular case of myotonic dystrophy type 1 (DM1, a multisystemic autosomal dominant disease, the formation of large non-coding CUG repeats set up long-tract hairpins able to bind muscleblind-like proteins (MBNL, which trigger the deregulation of several splicing events such as cardiac troponin T (cTNT and insulin receptor's, among others. Evidence suggests that conformational changes in RNA are determinant for the recognition and binding of splicing proteins, molecular modeling simulations can attempt to shed light on the structural diversity of CUG repeats and to understand their pathogenic mechanisms. Molecular dynamics (MD are widely used to obtain accurate results at atomistic level, despite being very time consuming, and they contrast with fast but simplified coarse-grained methods such as Elastic Network Model (ENM. In this paper, we assess the application of ENM (traditionally applied on proteins for studying the conformational space of CUG repeats and compare it to conventional and accelerated MD conformational sampling. Overall, the results provided here reveal that ANM can provide useful insights into dynamic rCUG structures at a global level, and that their dynamics depend on both backbone and nucleobase fluctuations. On the other hand, ANM fail to describe local U-U dynamics of the rCUG system, which require more computationally expensive methods such as MD. Given that several limitations are inherent to both methods, we discuss here the usefulness of the current theoretical approaches for studying highly dynamic RNA systems such as CUG trinucleotide repeat overexpansions.

  20. Thermionic Reactor Design Studies

    Energy Technology Data Exchange (ETDEWEB)

    Schock, Alfred

    1994-08-01

    Paper presented at the 29th IECEC in Monterey, CA in August 1994. The present paper describes some of the author's conceptual designs and their rationale, and the special analytical techniques developed to analyze their (thermionic reactor) performance. The basic designs, first published in 1963, are based on single-cell converters, either double-ended diodes extending over the full height of the reactor core or single-ended diodes extending over half the core height. In that respect they are similar to the thermionic fuel elements employed in the Topaz-2 reactor subsequently developed in the Soviet Union, copies of which were recently imported by the U.S. As in the Topaz-2 case, electrically heated steady-state performance tests of the converters are possible before fueling.

  1. Does sequential embryo transfer improve pregnancy rate in patients with repeated implantation failure? A randomized control study

    Directory of Open Access Journals (Sweden)

    Wael A. Ismail Madkour

    2015-12-01

    Full Text Available Background: Repeated failure of in vitro fertilization treatment is frustrating to the patients and their clinicians. Various treatment plans and a change of protocol have been suggested for “low responders”; however, patients who fail treatment repeatedly inspite of good quality embryos pose a special therapeutic challenge. Additional challenge would be imposed on that particular group when the local IVF regulating low does not permit surplus embryo freezing. Objective: To examine whether sequential transfer of embryos on day 3 and on day 5 after ovum pick-up improves IVF/ET success rates in patients with repeated consecutive IVF failures (⩾ 3 trials compared to day 3 alone, with the background that local regulation prohibits embryo freezing. Study design: Randomized controlled study. Women scheduled for IVF/ET with repeated consecutive IVF failures (⩾ 3 trials were randomized to either sequential transfer of embryos on day 3 and on day 5 after ovum pick-up (Group I = 74 or conventional day 3 transfer (Group II = 73 as a control. The primary outcome measures were clinical pregnancy rate and implantation rate. The secondary outcome measures were ongoing pregnancy rate and early pregnancy loss. Results: Baseline and cycle characteristics were comparable in both groups. Clinical pregnancy rate (per embryo transfer was significantly higher in sequential ET group (37. 8% compared to that in day 3 group (21.9% (P value <0.05. Also, implantation rate (per embryos transferred was significantly higher in sequential ET group (17.1% compared to that in control group (10.5% (P value <0.01. Similarly, ongoing pregnancy (per embryo transfer was significantly higher in sequential ET group (33. 8% compared to that in day 3 group (19.2% (P value <0.05. Conclusions: Patients with repeated implantation failures, treatment with the sequential embryo transfer approach had significantly improved pregnancy outcomes compared to regular day 3 transfers

  2. Study of Optimal Perimetric Testing in Children (OPTIC: Feasibility, Reliability and Repeatability of Perimetry in Children.

    Directory of Open Access Journals (Sweden)

    Dipesh E Patel

    Full Text Available To investigate feasibility, reliability and repeatability of perimetry in children.A prospective, observational study recruiting 154 children aged 5-15 years, without an ophthalmic condition that affects the visual field (controls, identified consecutively between May 2012 and November 2013 from hospital eye clinics. Perimetry was undertaken in a single sitting, with standardised protocols, in a randomised order using the Humphrey static (SITA 24-2 FAST, Goldmann and Octopus kinetic perimeters. Data collected included test duration, subjective experience and test quality (incorporating examiner ratings on comprehension of instructions, fatigue, response to visual and auditory stimuli, concentration and co-operation to assess feasibility and reliability. Testing was repeated within 6 months to assess repeatability.Overall feasibility was very high (Goldmann=96.1%, Octopus=89% and Humphrey=100% completed the tests. Examiner rated reliability was 'good' in 125 (81.2% children for Goldmann, 100 (64.9% for Octopus and 98 (63.6% for Humphrey perimetry. Goldmann perimetry was the most reliable method in children under 9 years of age. Reliability improved with increasing age (multinomial logistic regression (Goldmann, Octopus and Humphrey, p<0.001. No significant differences were found for any of the three test strategies when examining initial and follow-up data outputs (Bland-Altman plots, n=43, suggesting good test repeatability, although the sample size may preclude detection of a small learning effect.Feasibility and reliability of formal perimetry in children improves with age. By the age of 9 years, all the strategies used here were highly feasible and reliable. Clinical assessment of the visual field is achievable in children as young as 5 years, and should be considered where visual field loss is suspected. Since Goldmann perimetry is the most effective strategy in children aged 5-8 years and this perimeter is no longer available, further

  3. A Statistical Approach Designed for Finding Mathematically Defined Repeats in Shotgun Data and Determining the Length Distribution of Clone—Inserts

    Institute of Scientific and Technical Information of China (English)

    LanZhong; KunlinZhang; XiangangHuang; PeixiangNi; YujunHan; KaiWang; JunWang; SonggangLi

    2003-01-01

    The large amount of repeats,especially high copy repeats,in the genomes of higher animals and plants makes whole genome assembly(WGA)quite difficult.In order to solve this problem,we tried to identify repeats and mask them prior to assembly even at the stage of genome survey.It is known that repeats of different copy number have different probabilities of appearance in shotgun data,so based on this principle,we constructed a statistical model and inferred criteria for mathematically defined repeats(MDRs)at different shotgun coverages.According to these criteria,we developed software MDRmasker to identify and mask MDRs in shotgun data.With repeats masked prior to assembly,the speed of as sembly was increased with lower error probability.In addition,clone-insert size affects the accuracy of repeat assembly and scaffold construction.We also designed length distribution of clone-inserts using our model.In our simulated genomes of human and rice,the length distribution of repeats in different,so their optimal length distributions of clone-inserts were not the same.Thus with optimal length distribution of clone-inserts,a given genome could be assembled better at lower coverage.

  4. A Statistical Approach Designed for Finding Mathematically De fined Repeats in Shotgun Data and Determining the Length Distri bution of Clone-Inserts

    Institute of Scientific and Technical Information of China (English)

    Lan Zhong; Kunlin Zhang; Xiangang Huang; Peixiang Ni; Yujun Han; Kai Wang; Jun Wang; Songgang Li

    2003-01-01

    The large amount of repeats, especially high copy repeats, in the genomes of higher animals and plants makes whole genome assembly (WGA) quite difficult. In order to solve this problem, we tried to identify repeats and mask them prior to assembly even at the stage of genome survey. It is known that repeats of different copy number have different probabilities of appearance in shotgun data, so based on this principle, we constructed a statistical model and inferred criteria for mathematically defined repeats (MDRs) at different shotgun coverages. According to these criteria, we developed software MDRmasker to identify and mask MDRs in shotgun data. With repeats masked prior to assembly, the speed of assembly was increased with lower error probability. In addition, clone-insert size affects the accuracy of repeat assembly and scaffold construction. We also designed length distribution of clone-inserts using our model. In our simulated genomes of human and rice, the length distribution of repeats is different, so their optimal length distributions of clone-inserts were not the same. Thus with optimal length distribution of clone-inserts, a given genome could be assembled better at lower coverage.

  5. Using Bayesian analysis in repeated preclinical in vivo studies for a more effective use of animals.

    Science.gov (United States)

    Walley, Rosalind; Sherington, John; Rastrick, Joe; Detrait, Eric; Hanon, Etienne; Watt, Gillian

    2016-05-01

    Whilst innovative Bayesian approaches are increasingly used in clinical studies, in the preclinical area Bayesian methods appear to be rarely used in the reporting of pharmacology data. This is particularly surprising in the context of regularly repeated in vivo studies where there is a considerable amount of data from historical control groups, which has potential value. This paper describes our experience with introducing Bayesian analysis for such studies using a Bayesian meta-analytic predictive approach. This leads naturally either to an informative prior for a control group as part of a full Bayesian analysis of the next study or using a predictive distribution to replace a control group entirely. We use quality control charts to illustrate study-to-study variation to the scientists and describe informative priors in terms of their approximate effective numbers of animals. We describe two case studies of animal models: the lipopolysaccharide-induced cytokine release model used in inflammation and the novel object recognition model used to screen cognitive enhancers, both of which show the advantage of a Bayesian approach over the standard frequentist analysis. We conclude that using Bayesian methods in stable repeated in vivo studies can result in a more effective use of animals, either by reducing the total number of animals used or by increasing the precision of key treatment differences. This will lead to clearer results and supports the "3Rs initiative" to Refine, Reduce and Replace animals in research. Copyright © 2016 John Wiley & Sons, Ltd.

  6. Designing verbal autopsy studies

    Directory of Open Access Journals (Sweden)

    Shibuya Kenji

    2010-06-01

    Full Text Available Abstract Background Verbal autopsy analyses are widely used for estimating cause-specific mortality rates (CSMR in the vast majority of the world without high-quality medical death registration. Verbal autopsies -- survey interviews with the caretakers of imminent decedents -- stand in for medical examinations or physical autopsies, which are infeasible or culturally prohibited. Methods and Findings We introduce methods, simulations, and interpretations that can improve the design of automated, data-derived estimates of CSMRs, building on a new approach by King and Lu (2008. Our results generate advice for choosing symptom questions and sample sizes that is easier to satisfy than existing practices. For example, most prior effort has been devoted to searching for symptoms with high sensitivity and specificity, which has rarely if ever succeeded with multiple causes of death. In contrast, our approach makes this search irrelevant because it can produce unbiased estimates even with symptoms that have very low sensitivity and specificity. In addition, the new method is optimized for survey questions caretakers can easily answer rather than questions physicians would ask themselves. We also offer an automated method of weeding out biased symptom questions and advice on how to choose the number of causes of death, symptom questions to ask, and observations to collect, among others. Conclusions With the advice offered here, researchers should be able to design verbal autopsy surveys and conduct analyses with greatly reduced statistical biases and research costs.

  7. WCDMA直放站回波对消方案设计%Design of Echo Cancellation System for WCDMA Repeater

    Institute of Scientific and Technical Information of China (English)

    华强; 夏哲雷; 朱怀环; 祝建英

    2013-01-01

    A design of echo cancellation for WCDMA repeater is proposed based on WCDMA standard in digital intermediate frequency technology under the FPGA + DSP platform. Firstly CAZAC codes which is not relevant with WCDMA signals are sent as the training sequence for channel initial estimation. Secondly, delay and amplitude are distributed to LMS adaptive filter as the initial value, then the echo cancellation realized by generating cancelling signals which is approach to echo signals. The results prove that the design has a good performance in echo cancellation by the united simulation using MATLAB and SIMULINK.%基于WCDMA标准提出了FPGA+DPS平台下实现在数字中频技术中抵消WCDMA直放站回波干扰信号的方案.首先发射与WCDMA信号不相关的伪随机序列CAZAC码作为训练序列进行信道初估计,然后将初估计得到的时延和幅度信息作为赋给LMS自适应滤波器的初值,生成逼近干扰信号的抵消信号,实现回波对消.使用MATLAB和SIMULINK联合仿真,证明该方法拥有良好的性能.

  8. The role of exposure history on HIV acquisition: insights from repeated low-dose challenge studies.

    Directory of Open Access Journals (Sweden)

    Roland R Regoes

    Full Text Available To assess the efficacy of HIV vaccine candidates or preventive treatment, many research groups have started to challenge monkeys repeatedly with low doses of the virus. Such challenge data provide a unique opportunity to assess the importance of exposure history for the acquisition of the infection. I developed stochastic models to analyze previously published challenge data. In the mathematical models, I allowed for variation of the animals' susceptibility to infection across challenge repeats, or across animals. In none of the studies I analyzed, I found evidence for an immunizing effect of non-infecting challenges, and in most studies, there is no evidence for variation in the susceptibilities to the challenges across animals. A notable exception was a challenge experiment by Letvin et al. Sci Translat Med (2011 conducted with the strain SIVsmE660. The challenge data of this experiment showed significant susceptibility variation from animal-to-animal, which is consistent with previously established genetic differences between the involved animals. For the studies which did not show significant immunizing effects and susceptibility differences, I conducted a power analysis and could thus exclude a very strong immunization effect for some of the studies. These findings validate the assumption that non-infecting challenges do not immunize an animal - an assumption that is central in the argument that repeated low-dose challenge experiments increase the statistical power of preclinical HIV vaccine trials. They are also relevant for our understanding of the role of exposure history for HIV acquisition and forecasting the epidemiological spread of HIV.

  9. Prolonged Repeated Acupuncture Stimulation Induces Habituation Effects in Pain-Related Brain Areas: An fMRI Study

    Science.gov (United States)

    Li, Chuanfu; Yang, Jun; Park, Kyungmo; Wu, Hongli; Hu, Sheng; Zhang, Wei; Bu, Junjie; Xu, Chunsheng; Qiu, Bensheng; Zhang, Xiaochu

    2014-01-01

    Most previous studies of brain responses to acupuncture were designed to investigate the acupuncture instant effect while the cumulative effect that should be more important in clinical practice has seldom been discussed. In this study, the neural basis of the acupuncture cumulative effect was analyzed. For this experiment, forty healthy volunteers were recruited, in which more than 40 minutes of repeated acupuncture stimulation was implemented at acupoint Zhusanli (ST36). Three runs of acupuncture fMRI datasets were acquired, with each run consisting of two blocks of acupuncture stimulation. Besides general linear model (GLM) analysis, the cumulative effects of acupuncture were analyzed with analysis of covariance (ANCOVA) to find the association between the brain response and the cumulative duration of acupuncture stimulation in each stimulation block. The experimental results showed that the brain response in the initial stage was the strongest although the brain response to acupuncture was time-variant. In particular, the brain areas that were activated in the first block and the brain areas that demonstrated cumulative effects in the course of repeated acupuncture stimulation overlapped in the pain-related areas, including the bilateral middle cingulate cortex, the bilateral paracentral lobule, the SII, and the right thalamus. Furthermore, the cumulative effects demonstrated bimodal characteristics, i.e. the brain response was positive at the beginning, and became negative at the end. It was suggested that the cumulative effect of repeated acupuncture stimulation was consistent with the characteristic of habituation effects. This finding may explain the neurophysiologic mechanism underlying acupuncture analgesia. PMID:24821143

  10. Study design in causal models

    OpenAIRE

    2012-01-01

    The causal assumptions, the study design and the data are the elements required for scientific inference in empirical research. The research is adequately communicated only if all of these elements and their relations are described precisely. Causal models with design describe the study design and the missing data mechanism together with the causal structure and allow the direct application of causal calculus in the estimation of the causal effects. The flow of the study is visualized by orde...

  11. No Improved Performance With Repeated-Sprint Training in Hypoxia Versus Normoxia: A Double-Blind and Crossover Study.

    Science.gov (United States)

    Montero, David; Lundby, Carsten

    2017-02-01

    Few recent studies indicate that short-term repeated-sprint (RS) training in hypoxia (RSH) improves RS performance compared with identical training under normoxic conditions (RSN) in endurance-trained subjects. To determine the effects of RSH against RSN on RS performance under normoxic and moderate hypoxic conditions, using a randomized, doubleblind, crossover experimental design. Fifteen endurance-trained male subjects (age 25 ± 4 y) performed 4 wk of RS training (3 sessions/wk) in normobaric hypoxia (RSH, FiO2 = 13.8%) and normoxia (RSN, FiO2 = 20.9%) in a crossover manner. Before and after completion of training, RS tests were performed on a cycle ergometer with no prior exercise (RSNE), after an incremental exercise test (RSIE), and after a time-trial test (RSTT) in normoxia and hypoxia. Peak power outputs at the incremental exercise test and time-trial performance were unaltered by RSH in normoxia and hypoxia. RS performance was generally enhanced by RSH, as well as RSN, but there were no additional effects of RSH over RSN on peak and mean sprint power output and the number of repeated sprints performed in the RSNE, RSIE, and RSTT trials under normoxic and hypoxic conditions. The present double-blind crossover study indicates that RSH does not improve RS performance compared with RSN in normoxic and hypoxic conditions in endurance-trained subjects. Therefore, caution should be exercised when proposing RSH as an advantageous method to improve exercise performance.

  12. Automated quality checks on repeat prescribing.

    OpenAIRE

    Rogers, Jeremy E; Wroe, Christopher J; Roberts, Angus; Swallow, Angela; Stables, David; Cantrill, Judith A; Rector, Alan L.

    2003-01-01

    BACKGROUND: Good clinical practice in primary care includes periodic review of repeat prescriptions. Markers of prescriptions that may need review have been described, but manually checking all repeat prescriptions against the markers would be impractical. AIM: To investigate the feasibility of computerising the application of repeat prescribing quality checks to electronic patient records in United Kingdom (UK) primary care. DESIGN OF STUDY: Software performance test against benchmark manual...

  13. Accuracy and repeatability of an inertial measurement unit system for field-based occupational studies.

    Science.gov (United States)

    Schall, Mark C; Fethke, Nathan B; Chen, Howard; Oyama, Sakiko; Douphrate, David I

    2016-04-01

    The accuracy and repeatability of an inertial measurement unit (IMU) system for directly measuring trunk angular displacement and upper arm elevation were evaluated over eight hours (i) in comparison to a gold standard, optical motion capture (OMC) system in a laboratory setting, and (ii) during a field-based assessment of dairy parlour work. Sample-to-sample root mean square differences between the IMU and OMC system ranged from 4.1° to 6.6° for the trunk and 7.2°-12.1° for the upper arm depending on the processing method. Estimates of mean angular displacement and angular displacement variation (difference between the 90th and 10th percentiles of angular displacement) were observed to change IMU system may serve as an acceptable instrument for directly measuring trunk and upper arm postures in field-based occupational exposure assessment studies with long sampling durations. Practitioner Summary: Few studies have evaluated inertial measurement unit (IMU) systems in the field or over long sampling durations. Results of this study indicate that the IMU system evaluated has reasonably good accuracy and repeatability for use in a field setting over a long sampling duration.

  14. Association study of the trinucleotide repeat polymorphism within SMARCA2 and schizophrenia

    Directory of Open Access Journals (Sweden)

    Danics Zoltan

    2006-06-01

    Full Text Available Abstract Background Brahma (BRM is a key component of the multisubunit SWI/SNF complex, a complex which uses the energy of ATP hydrolysis to remodel chromatin. BRM contains an N-terminal polyglutamine domain, encoded by a polymorphic trinucleotide (CAA/CAG repeat, the only known polymorphism in the coding region of the gene (SMARCA2. We have examined the association of this polymorphism with schizophrenia in a family-based and case/control study. SMARCA2 was chosen as a candidate gene because of its specific role in developmental pathways, its high expression level in the brain and some evidence of its association with schizophrenia spectrum disorder from genome-wide linkage analysis. Results Family-based analysis with 281 complete and incomplete triads showed that there is no significant preferential transmission of any of the alleles to the affected offspring. Also, in the case/control analysis, similar allele and genotype distributions were observed between affected cases (n = 289 and unaffected controls (n = 273 in each of three Caucasian populations studied: French Canadian, Tunisian and other Caucasians of European origin. Conclusion Results from our family-based and case-control association study suggest that there is no association between the trinucleotide repeat polymorphism within SMARCA2 and schizophrenia.

  15. Investigation of the toxicity of some organophosphorus pesticides in a repeated dose study in rats.

    Science.gov (United States)

    Baconi, Daniela Luiza; Bârcă, Maria; Manda, Gina; Ciobanu, Anne Marie; Bălălău, C

    2013-01-01

    The study aimed to the investigation of the toxicity of organophosphorus pesticides malathion (MLT) and diazinon (DZN) in Wistar rats in a repeated dose study for 35 days. MLT and DZN in corn oil vehicle were oral administered. Body and organs weights, plasma and brain cholinesterase activities, serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) activities, histopathological changes in liver and kidney, and some parameters of the immune function, such as leukocyte formula, spleen weight and cellularity, spleen lymphocytes proliferation in response to concanavalin A (Con A) were investigated; the potential oxidative stress (malondialdehyde in plasma and brain, and blood catalase activity) was also evaluated. No clinical toxicity signs attributed to pesticides were noted; no significant changes in the organ weights have been found. Body weight tends slightly to increase, predominantly in DZN treated rats. The results suggest that plasma cholinesterase is more susceptible than brain cholinesterase to the inhibitory effect of DZN and MLT. Other serum biochemical parameters showed no significant difference. DZN produced a marked increase of the number of spleen lymphocytes without a significant gain of the relative spleen weight. The both pesticides produced an increase of the number of mononuclear cells÷weight spleen. The splenic lymphocyte proliferation has not been influenced by MLT or DZN treatment. Histopathological observations identified some changes (vasodilatation, microvacuoles, and granular dystrophy) in the liver, with MLT, inducing macrovacuolar steatosis. The study indicates that repeated exposure, at subclinical doses, to organophosphorus MLT and DZN causes some biochemical, histopathological and immune alterations in rats.

  16. Potential Role of the Last Half Repeat in TAL Effectors Revealed by a Molecular Simulation Study

    Directory of Open Access Journals (Sweden)

    Hua Wan

    2016-01-01

    Full Text Available TAL effectors (TALEs contain a modular DNA-binding domain that is composed of tandem repeats. In all naturally occurring TALEs, the end of tandem repeats is invariantly a truncated half repeat. To investigate the potential role of the last half repeat in TALEs, we performed comparative molecular dynamics simulations for the crystal structure of DNA-bound TALE AvrBs3 lacking the last half repeat and its modeled structure having the last half repeat. The structural stability analysis indicates that the modeled system is more stable than the nonmodeled system. Based on the principle component analysis, it is found that the AvrBs3 increases its structural compactness in the presence of the last half repeat. The comparison of DNA groove parameters of the two systems implies that the last half repeat also causes the change of DNA major groove binding efficiency. The following calculation of hydrogen bond reveals that, by stabilizing the phosphate binding with DNA at the C-terminus, the last half repeat helps to adopt a compact conformation at the protein-DNA interface. It further mediates more contacts between TAL repeats and DNA nucleotide bases. Finally, we suggest that the last half repeat is required for the high-efficient recognition of DNA by TALE.

  17. Potential Role of the Last Half Repeat in TAL Effectors Revealed by a Molecular Simulation Study

    Science.gov (United States)

    Wan, Hua; Chang, Shan; Hu, Jian-ping; Tian, Xu-hong

    2016-01-01

    TAL effectors (TALEs) contain a modular DNA-binding domain that is composed of tandem repeats. In all naturally occurring TALEs, the end of tandem repeats is invariantly a truncated half repeat. To investigate the potential role of the last half repeat in TALEs, we performed comparative molecular dynamics simulations for the crystal structure of DNA-bound TALE AvrBs3 lacking the last half repeat and its modeled structure having the last half repeat. The structural stability analysis indicates that the modeled system is more stable than the nonmodeled system. Based on the principle component analysis, it is found that the AvrBs3 increases its structural compactness in the presence of the last half repeat. The comparison of DNA groove parameters of the two systems implies that the last half repeat also causes the change of DNA major groove binding efficiency. The following calculation of hydrogen bond reveals that, by stabilizing the phosphate binding with DNA at the C-terminus, the last half repeat helps to adopt a compact conformation at the protein-DNA interface. It further mediates more contacts between TAL repeats and DNA nucleotide bases. Finally, we suggest that the last half repeat is required for the high-efficient recognition of DNA by TALE. PMID:27803930

  18. Does repeated reading predict reading development over time? A study of children from Grade 3 to 4.

    Science.gov (United States)

    Gellert, Anna S

    2014-08-01

    The purpose of this study was to investigate whether immediate gains in reading fluency achieved during repeated reading of text can predict long-term reading development over and above traditional predictors of reading development. Eighty-one Grade 3 children read texts three times consecutively and were instructed either to read as quickly as possible (speed-focused repeated reading), or to retell the text afterwards (meaning-focused repeated reading). Measures of text reading fluency, sentence reading fluency, and text comprehension were administered to the children in Grades 3 and 4 to assess their reading development over time. The results indicate that children's immediate response to repeated reading can contribute to the prediction of their development of reading fluency over time. Even after controlling for individual differences in general cognitive ability, word reading fluency, rapid automatized naming, and vocabulary, the experimental measure with meaning-focused repeated reading remained a significant predictor.

  19. 5-Day repeated inhalation and 28-day post-exposure study of graphene.

    Science.gov (United States)

    Shin, Jae Hoon; Han, Sung Gu; Kim, Jin Kwon; Kim, Boo Wook; Hwang, Joo Hwan; Lee, Jong Seong; Lee, Ji Hyun; Baek, Jin Ee; Kim, Tae Gyu; Kim, Keun Soo; Lee, Heon Sang; Song, Nam Woong; Ahn, Kangho; Yu, Il Je

    2015-01-01

    Graphene has recently been attracting increasing attention due to its unique electronic and chemical properties and many potential applications in such fields as semiconductors, energy storage, flexible electronics, biosensors and medical imaging. However, the toxicity of graphene in the case of human exposure has not yet been clarified. Thus, a 5-day repeated inhalation toxicity study of graphene was conducted using a nose-only inhalation system for male Sprague-Dawley rats. A total of three groups (20 rats per group) were compared: (1) control (ambient air), (2) low concentration (0.68 ± 0.14 mg/m(3) graphene) and (3) high concentration (3.86 ± 0.94 mg/m(3) graphene). The rats were exposed to graphene for 6 h/day for 5 days, followed by recovery for 1, 3, 7 or 28 days. The bioaccumulation and macrophage ingestion of the graphene were evaluated in the rat lungs. The exposure to graphene did not change the body weights or organ weights of the rats after the 5-day exposure and during the recovery period. No statistically significant difference was observed in the levels of lactate dehydrogenase, protein and albumin between the exposed and control groups. However, graphene ingestion by alveolar macrophages was observed in the exposed groups. Therefore, these results suggest that the 5-day repeated exposure to graphene only had a minimal toxic effect at the concentrations and time points used in this study.

  20. Validation of a track repeating algorithm for intensity modulated proton therapy: clinical cases study

    Science.gov (United States)

    Yepes, Pablo P.; Eley, John G.; Liu, Amy; Mirkovic, Dragan; Randeniya, Sharmalee; Titt, Uwe; Mohan, Radhe

    2016-04-01

    Monte Carlo (MC) methods are acknowledged as the most accurate technique to calculate dose distributions. However, due its lengthy calculation times, they are difficult to utilize in the clinic or for large retrospective studies. Track-repeating algorithms, based on MC-generated particle track data in water, accelerate dose calculations substantially, while essentially preserving the accuracy of MC. In this study, we present the validation of an efficient dose calculation algorithm for intensity modulated proton therapy, the fast dose calculator (FDC), based on a track-repeating technique. We validated the FDC algorithm for 23 patients, which included 7 brain, 6 head-and-neck, 5 lung, 1 spine, 1 pelvis and 3 prostate cases. For validation, we compared FDC-generated dose distributions with those from a full-fledged Monte Carlo based on GEANT4 (G4). We compared dose-volume-histograms, 3D-gamma-indices and analyzed a series of dosimetric indices. More than 99% of the voxels in the voxelized phantoms describing the patients have a gamma-index smaller than unity for the 2%/2 mm criteria. In addition the difference relative to the prescribed dose between the dosimetric indices calculated with FDC and G4 is less than 1%. FDC reduces the calculation times from 5 ms per proton to around 5 μs.

  1. Repeat Colonoscopy within 6 Months after Initial Outpatient Colonoscopy in Ontario: A Population-Based Cross-Sectional Study

    Directory of Open Access Journals (Sweden)

    Lawrence Paszat

    2017-01-01

    Full Text Available Background. The goal of this study is to examine utilization of early repeat colonoscopy ≤ 6 months after an index procedure. Methods. We identified persons having repeat colonoscopy ≤ 6 months following outpatient colonoscopy without prior colonoscopy ≤ 5 years or prior diagnosis of colorectal cancer (CRC. We modeled repeat colonoscopy using a generalized estimating equation with an exchangeable correlation structure to account for clustering of patients by endoscopist. Results. The population included 334,663 persons, 7,892 (2.36% of whom had an early repeat colonoscopy within 6 months. Overall, endoscopist prior year colonoscopy volume was inversely related to repeat ≤ 6 months. Repeat colonoscopy ≤ 6 months varied by the clinical setting of the index colonoscopy (adjusted OR = 1.41 (95% CI 1.29–1.55 at nonhospital facilities compared to teaching or community hospitals. Among those who had polypectomy or biopsy, the adjusted OR for early repeat ≤ 6 months was elevated among those whose index colonoscopy was at a nonhospital facility (OR 1.44, 95% CI 1.30–1.60, compared to those at a teaching hospital or community hospital. Conclusions. Repeat colonoscopy ≤ 6 months after an index procedure is associated with the clinical setting of the index colonoscopy.

  2. Co-crystallization with conformation-specific designed ankyrin repeat proteins explains the conformational flexibility of BCL-W.

    Science.gov (United States)

    Schilling, Johannes; Schöppe, Jendrik; Sauer, Evelyn; Plückthun, Andreas

    2014-06-12

    BCL-W is a member of the BCL-2 family of anti-apoptotic proteins. A key event in the regulation of apoptosis is the heterodimerization between anti-apoptotic and pro-apoptotic family members, which involves a conserved surface-exposed groove on the anti-apoptotic proteins. Crystal structures of the ligand binding-competent conformation exist for all anti-apoptotic family members, with the exception of BCL-W, due to the flexibility of the BCL-W groove region. Existing structures had suggested major deviations of the BCL-W groove region from the otherwise structurally highly related remaining anti-apoptotic family members. To capture its ligand binding-competent conformation by counteracting the conformational flexibility of the BCL-W groove, we had selected high-affinity groove-binding designed ankyrin repeat proteins (DARPins) using ribosome display. We now determined two high-resolution crystal structures of human BCL-W in complex with different DARPins at resolutions 1.5 and 1.85Å, in which the structure of BCL-W is virtually identical, and BCL-W adopts a conformation extremely similar to the ligand-free conformation of its closest relative BCL-XL in both structures. However, distinct differences to all previous BCL-W structures are evident, notably in the ligand-binding region. We provide the first structural explanation for the conformational flexibility of the BCL-W groove region in comparison to other BCL-2 family members. Due to the importance of the anti-apoptotic BCL-2 family as drug targets, the presented crystal structure of ligand binding-competent BCL-W may serve as a valuable basis for structure-based drug design in the future and provides a missing piece for the structural characterization of this protein family.

  3. Expressed Sequence Tags Analysis and Design of Simple Sequence Repeats Markers from a Full-Length cDNA Library in Perilla frutescens (L.

    Directory of Open Access Journals (Sweden)

    Eun Soo Seong

    2015-01-01

    Full Text Available Perilla frutescens is valuable as a medicinal plant as well as a natural medicine and functional food. However, comparative genomics analyses of P. frutescens are limited due to a lack of gene annotations and characterization. A full-length cDNA library from P. frutescens leaves was constructed to identify functional gene clusters and probable EST-SSR markers via analysis of 1,056 expressed sequence tags. Unigene assembly was performed using basic local alignment search tool (BLAST homology searches and annotated Gene Ontology (GO. A total of 18 simple sequence repeats (SSRs were designed as primer pairs. This study is the first to report comparative genomics and EST-SSR markers from P. frutescens will help gene discovery and provide an important source for functional genomics and molecular genetic research in this interesting medicinal plant.

  4. Power and sample size for the S:T repeated measures design combined with a linear mixed-effects model allowing for missing data.

    Science.gov (United States)

    Tango, Toshiro

    2017-02-13

    Tango (Biostatistics 2016) proposed a new repeated measures design called the S:T repeated measures design, combined with generalized linear mixed-effects models and sample size calculations for a test of the average treatment effect that depend not only on the number of subjects but on the number of repeated measures before and after randomization per subject used for analysis. The main advantages of the proposed design combined with the generalized linear mixed-effects models are (1) it can easily handle missing data by applying the likelihood-based ignorable analyses under the missing at random assumption and (2) it may lead to a reduction in sample size compared with the simple pre-post design. In this article, we present formulas for calculating power and sample sizes for a test of the average treatment effect allowing for missing data within the framework of the S:T repeated measures design with a continuous response variable combined with a linear mixed-effects model. Examples are provided to illustrate the use of these formulas.

  5. Seroepidemiological studies indicate frequent and repeated exposure to Campylobacter spp. during childhood.

    Science.gov (United States)

    Ang, C W; Teunis, P F M; Herbrink, P; Keijser, J; Van Duynhoven, Y H T P; Visser, C E; Van Pelt, W

    2011-09-01

    The annual number of episodes of clinical gastroenteritis caused by Campylobacter spp. in The Netherlands is estimated to be 75 000, i.e. once per 200 person life-years. This number is based on extrapolation of culture results from population-based studies. The number of culture-confirmed cases of Campylobacter infection peaks in the first 3 years of life and again between the ages of 20 and 25 years. The seroepidemiology of Campylobacter describes the relationship between age and exposure to Campylobacter and reflects both symptomatic and asymptomatic infections. Using a validated ELISA system, antibodies to Campylobacter were measured in an age-stratified sample (n=456) of the PIENTER serum collection of the Dutch general population. The seroprevalence of Campylobacter IgG antibodies increased with age, reaching almost 100% at age 20 years. Antibody levels steadily increased with age until young adulthood, suggesting repeated exposure to Campylobacter. In conclusion, seroepidemiological data demonstrated repeated exposures to Campylobacter throughout life, most of which do not lead to clinical symptoms. From young adulthood, >95% of the population in The Netherlands had serological evidence for exposure to Campylobacter.

  6. Effects of repeated walking in a perturbing environment: a 4-day locomotor learning study.

    Science.gov (United States)

    Blanchette, Andreanne; Moffet, Helene; Roy, Jean-Sébastien; Bouyer, Laurent J

    2012-07-01

    Previous studies have shown that when subjects repeatedly walk in a perturbing environment, initial movement error becomes smaller, suggesting that retention of the adapted locomotor program occurred (learning). It has been proposed that the newly learned locomotor program may be stored separately from the baseline program. However, how locomotor performance evolves with repeated sessions of walking with the perturbation is not yet known. To address this question, 10 healthy subjects walked on a treadmill on 4 consecutive days. Each day, locomotor performance was measured using kinematics and surface electromyography (EMGs), before, during, and after exposure to a perturbation, produced by an elastic tubing that pulled the foot forward and up during swing, inducing a foot velocity error in the first strides. Initial movement error decreased significantly between days 1 and 2 and then remained stable. Associated changes in medial hamstring EMG activity stabilized only on day 3, however. Aftereffects were present after perturbation removal, suggesting that daily adaptation involved central command recalibration of the baseline program. Aftereffects gradually decreased across days but were still visible on day 4. Separation between the newly learned and baseline programs may take longer than suggested by the daily improvement in initial performance in the perturbing environment or may never be complete. These results therefore suggest that reaching optimal performance in a perturbing environment should not be used as the main indicator of a completed learning process, as central reorganization of the motor commands continues days after initial performance has stabilized.

  7. Study of four week repeated dose toxic test of Sweet Bee Venom in Beagle Dogs

    Directory of Open Access Journals (Sweden)

    Jae-Seuk Park

    2010-12-01

    Full Text Available Objectives: This study was performed to analyse four week repeated dose toxicity of Sweet Bee Venom(Sweet BV extracted from the bee venom in Beagle dogs. Methods: All experiments were conducted under the regulations of Good Laboratory Practice (GLP at Biotoxtech Company, a non-clinical study authorized institution. Male and female Beagle dogs of 5-6 months old were chosen for the pilot study of four week repeated dose toxicity of Sweet BV which was administered at the level of 0.56㎎/㎏ body weight which is eighty times higher than the clinical application dosage as the high dosage, followed by 0.28 and 0.14㎎/㎏ as midium and low dosage, respectively. Equal amount of excipient(normal saline to the Sweet BV experiment groups was administered as the control group every day for four weeks. Results: 1. No mortality was witnessed in all of the experiment groups. 2. All experiment groups were appealed pain sense in the treating time compared to the control group, and hyperemia and movement disorder were observed around the area of administration in all experiment groups, and higher occurrence in the higher dosage treatment. 3. For weight measurement, Neither male nor female groups showed significant changes. 4. In the urine analysis, CBC and biochemistry didn't show any significant changes in the experiment groups compared with control group. 5. For weight measurement of organs, experiment groups didn't show any significant changes compared with control group. 6. To verify abnormalities of organs and tissues, thigh muscle which treated with Sweet BV, cerebrum, liver, lung, kidney, and spinal cords were removed and conducted histologocal observation with H-E staining. In the histologocal observation of thigh muscle, cell infiltration, inflammatory, degeneration, necrosis of muscle fiber, and fibrosis were found in both thigh tissue. And the changes were depend on the dose of Sweet BV. But another organs were not detected in any abnormalities. 7

  8. Reducing impaired driving through the identification of Repeat Target Vehicles: A case study.

    Science.gov (United States)

    Stewart, James

    2012-02-01

    One of the most persistent groups of impaired drivers that are seemingly unaffected by social pressure, moral appeals, and the fear of arrest is that of the repeat impaired driver. This smaller group accounts for a disproportionate number of all impaired driving trips, often with high blood alcohol contents. New approaches are needed to identify and deal with the repeat impaired driver. We propose a method based on the discovery that almost 10% of all impaired driving calls for service involve repeat vehicles. Using the number of times a vehicle appears in our data, the average time to repeat, and the personality characteristics of the repeat impaired driver, we are able to create a comprehensive and predictive description of a Repeat Target Vehicle (RTV). Our method provides an opportunity to explore new and innovative crime reduction strategies that were never before possible. Copyright © 2011 Elsevier Ltd. All rights reserved.

  9. A study on ten short tandem repeat systems: African immigrant and Spanish population data.

    Science.gov (United States)

    Gamero, J J; Romero, J L; Gonzalez, J L; Arufe, M I; Cuesta, M I; Corte-Real, F; Carvalho, M; Anjos, M J; Vieira, D N; Vide, M C

    2000-06-05

    This work presents the results obtained from a genetic-population study for the D1S1656 system in the population of Southwest Spain (Huelva, Cádiz and Sevilla), Spaniards of Caucasian origin from North Africa (Ceuta), as well as in the black Central West African and Moroccan immigrant populations in Spain. The results of a study of the autochtonous population of the Canary Islands (n=138), and immigrant Central West African populations in Spain (n=132), obtained for nine short tandem repeat (STR) loci (D3S1358, VWA, FGA, D8S1179, D21S11, D18S51, D5S818, D13S317, D7S820), as well as the amelogenin locus, all contained in Profiler Plus (Perkin-Elmer) PCR amplification kits, are also presented. Except for the FGA and VWA data on immigrant Central West African populations in Spain, no deviations from the Hardy-Weinberg equilibrium were detected.

  10. Contributions by the CAG-repeat Polymorphism of the Androgen Receptor Gene and Circulating Androgens to Muscle Size. Odense Androgen Study - A Population-based Study of 20-29 Year-old Danish Men

    DEFF Research Database (Denmark)

    Nielsen, Torben Leo; Hagen, Claus; Wraae, Kristian

    2007-01-01

    Context: The number of CAG-repeats within the CAG-repeat polymorphism of the androgen receptor gene is inversely correlated with the transcriptional activity of the androgen receptor. Objective: To study the effect of the CAG-repeat number and circulating androgens on muscle size, to examine the ...... muscle size increased exponentially with decreasing androgen levels and was tripled at total testosterone levels...... the CAG-repeat number in relation to body fat mass and circulating androgens, and to identify the best hormonal marker of low muscle size amongst total testosterone, bioavailable testosterone, and dihydrotestosterone. Design, Setting, and Participants: Population-based study of 783 Danish men aged 20...... continuous outcomes (thigh and axial muscle area, lower extremity, upper extremity, and trunk lean body mass, and total body fat mass) and five binary outcomes of low muscle size defined as men with muscle size below the lower 10 percentile of each continuous outcome of muscle size. Results: The CAG...

  11. Bayesian latent variable models for hierarchical clustered count outcomes with repeated measures in microbiome studies.

    Science.gov (United States)

    Xu, Lizhen; Paterson, Andrew D; Xu, Wei

    2017-04-01

    Motivated by the multivariate nature of microbiome data with hierarchical taxonomic clusters, counts that are often skewed and zero inflated, and repeated measures, we propose a Bayesian latent variable methodology to jointly model multiple operational taxonomic units within a single taxonomic cluster. This novel method can incorporate both negative binomial and zero-inflated negative binomial responses, and can account for serial and familial correlations. We develop a Markov chain Monte Carlo algorithm that is built on a data augmentation scheme using Pólya-Gamma random variables. Hierarchical centering and parameter expansion techniques are also used to improve the convergence of the Markov chain. We evaluate the performance of our proposed method through extensive simulations. We also apply our method to a human microbiome study.

  12. [Repeat induced abortion: A multicenter study on medical abortions in France in 2014].

    Science.gov (United States)

    Opatowski, M; Bardy, F; David, P; Dunbavand, A; Saurel-Cubizolles, M-J

    2017-01-01

    To describe the social characteristics of women seeking a medical abortion, and the conditions of that abortion, according to whether they had one or more previous induced abortions. An observational study was carried out in 11 French units in 2013-2014, among women 18 years or older. A self-administered questionnaire on the abortion context and social situation was given to them, as well as a diary to record the pain level for each of five days following the mifepristone intake. The sample included 453 women. Among the respondents, 22% had had one previous abortion and 8% had had two or more. Women having had a previous voluntary abortion were more often isolated and in a poorer social situation than women having their first abortion. Better support for contraception after abortion could reduce the number of repeated abortions. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  13. A Review on the Study of "Repeating Earthquakes" by Cross-correlation of Seismic Waveforms~%A Review on the Study of "Repeating Earthquakes" by Cross-correlation of Seismic Waveforms~

    Institute of Scientific and Technical Information of China (English)

    Li Yutong; Jiang Changsheng

    2012-01-01

    "Repeating earthquakes", identified by cross-correlation of seismic waveforms, are found to be much more abundant in the nature than conventionally expected. In recent years, with the development of digital seismic networks, waveform cross correlation and "repeating earthquakes" have caused much attention to the measuring the variation of crustal medium properties and estimation of location accuracy and fault slip rate at depth or earthquake recurrence intervals. Moreover, as a useful tool, the "repeating earthquake" approach has also been used in the assessment of the accuracy of seismic phase picking, hypocenter location, fault structure and physics of earthquake sources, as well as the study of earthquake prediction. In this paper, we summarized the latest research and applications of "repeating earthquakes".

  14. Causal inference in longitudinal comparative effectiveness studies with repeated measures of a continuous intermediate variable.

    Science.gov (United States)

    Wang, Chen-Pin; Jo, Booil; Brown, C Hendricks

    2014-09-10

    We propose a principal stratification approach to assess causal effects in nonrandomized longitudinal comparative effectiveness studies with a binary endpoint outcome and repeated measures of a continuous intermediate variable. Our method is an extension of the principal stratification approach originally proposed for the longitudinal randomized study "Prevention of Suicide in Primary Care Elderly: Collaborative Trial" to assess the treatment effect on the continuous Hamilton depression score adjusting for the heterogeneity of repeatedly measured binary compliance status. Our motivation for this work comes from a comparison of the effect of two glucose-lowering medications on a clinical cohort of patients with type 2 diabetes. Here, we consider a causal inference problem assessing how well the two medications work relative to one another on two binary endpoint outcomes: cardiovascular disease-related hospitalization and all-cause mortality. Clinically, these glucose-lowering medications can have differential effects on the intermediate outcome, glucose level over time. Ultimately, we want to compare medication effects on the endpoint outcomes among individuals in the same glucose trajectory stratum while accounting for the heterogeneity in baseline covariates (i.e., to obtain 'principal effects' on the endpoint outcomes). The proposed method involves a three-step model estimation procedure. Step 1 identifies principal strata associated with the intermediate variable using hybrid growth mixture modeling analyses. Step 2 obtains the stratum membership using the pseudoclass technique and derives propensity scores for treatment assignment. Step 3 obtains the stratum-specific treatment effect on the endpoint outcome weighted by inverse propensity probabilities derived from Step 2.

  15. SU-E-J-263: Repeatability of SUV and Texture Parameters in Serial PET Studies

    Energy Technology Data Exchange (ETDEWEB)

    Schwartz, J; Humm, J; Nehmeh, S; Schoder, H [Memorial Sloan-Kettering Cancer Center, New York, NY (United States)

    2015-06-15

    Purpose: Standardized uptake values (SUV) are standard quantitative PET measures of FDG tumor uptake used,and are used as a tool to monitor response to therapy. Textural analysis is emerging as a new tool for assessing intratumoral heterogeneity which may allow better tissue characterization and improved prediction of response and survival rate.Understanding what variations may be expected in these parameters is key in order to make decisions based on how the change throughout the course of treatment. The aim of this study was to assess repeatability in SUV measures and texture parameters,and establish criteria that differentiate changes associated with treatment rather than statistical variability. Methods: Eighty patients,167 random lesions total,were scanned in a GE Discovery STE PET/CT Scanner. One field-of-view was chosen centered on the largest lesion observed in a clinical whole-body FDG PET.Immediately following,a gated 9 min scan was acquired in list mode,without changing the patient’s position between any scans. Data was replayed into 3 time bins,3 min each,in order to insure equivalent noise characteristics in each replicate.Data was reconstructed into 128×128×47 square matrices.One VOI was drawn over each lesion for each patient and used to segment all 3 replicates. The mean.max and peak SUV were calculated for each VOI and replicate. First-order textural features were also calculated (skewness and kurtosis). Repeatability was calculated as the average standard deviation over the mean for the 3 repeated measurements for each lesion. Results: The average percent error in the SUV max,peak and mean were 3.4%(0– 12.9%),1.9% (0–7.5%),2.8% (0–12.2%),respectively.For skewness and kurtosis they were 10.9% and 17.8%. Conclusion: We have shown that there is a large variation in %error in SUV measures across patients. SUVpeak is the least variable and kurtosis and skewness parameters are less reliable thatn SUVs.Higher order textures are be.

  16. Prognostic usefulness of repeated echocardiographic evaluation after acute myocardial infarction. TRACE Study Group. TRAndolapril Cardiac Evaluation

    DEFF Research Database (Denmark)

    Korup, E; Køber, L; Torp-Pedersen, C;

    1999-01-01

    The prognostic value of repeated echocardiographic measurement of left ventricular function after acute myocardial infarction was evaluated. We found that repeated measurements of wall motion index in survivors of acute myocardial infarction, with no reinfarction, provide important prognostic inf...... information about death and worsening of heart failure....

  17. Studies of the CAG repeat in the Machado-Joseph disease gene in Taiwan.

    Science.gov (United States)

    Hsieh, M; Tsai, H F; Lu, T M; Yang, C Y; Wu, H M; Li, S Y

    1997-08-01

    Machado-Joseph disease (MJD) is an autosomal dominant spinocerebellar degeneration characterized by cerebellar ataxia and pyramidal signs associated in varying degrees with a dystonic-rigid extrapyramidal syndrome or peripheral amyotrophy. Unstable CAG trinucleotide repeat expansion in the MJD gene on the long arm of chromosome 14 has been identified as the pathological mutation for MJD. While investigating the distribution of CAG repeat lengths of the MJD gene in Taiwan's population, we have identified 18 MJD-affected patients and 12 at-risk individuals in seven families. In addition, we have analyzed the range of CAG repeat lengths in 96 control individuals. The CAG repeat number ranged from 13 to 44 in the controls and 72-85 in the affected and at-risk individuals. Our results indicated that the CAG repeat number was inversely correlated with the age of onset. The differences in CAG repeat length between parent and child and between siblings are greater with paternal transmission than maternal transmission. Our data show a tendency towards the phenomenon of anticipation in the MJD families but do not support unidirectional expansion of CAG repeats during transmission. We also demonstrated that PCR amplification of the CAG repeats in the MJD gene from villous DNA was possible and might prove useful as a diagnostic tool for affected families in the future.

  18. A study on the trinucleotide repeat associated with Huntington`s disease in the Chinese

    Energy Technology Data Exchange (ETDEWEB)

    Bing-wen Soong; Jih-tsuu Wang [Neurological Institute, Taipei (Taiwan, Province of China)

    1994-09-01

    Analysis of the polymorphic (CAG)n repeat in the hungingtin gene in the chinese confirmed the presence of an expanded repeat on all Huntington`s disease chromosomes. Measurement of the specific CAG repeat sequence in 34 HD chromosomes from 15 unrelated families and 190 control chromosomes from the Chinese population showed a range from 9 to 29 repeats in normal subjects and 40 to 58 in affected subjects. The size distributions of normal and affected alleles did not overlap. A clear correlation bewteen early onset of symptoms and very high repeat number was seen, but the spread of the age-at-onset in the major repeat range producing characteristic HD it too wide to be of diagnostic value. There was also variability in the transmitted repeat size for both sexes in the HD size range. Maternal HD alleles showed a moderate instability with a preponderance of size decrease, while paternal HD alleles had a tendency to increase in repeat size on transmission, the degree of which appeared proportional to the initial size.

  19. Repeat colonoscopy after a colonoscopy with a negative result in Ontario: a population-based cohort study.

    Science.gov (United States)

    Hol, Lieke; Sutradhar, Rinku; Gu, Sumei; Baxter, Nancy N; Rabeneck, Linda; Tinmouth, Jill M; Paszat, Lawrence F

    2015-01-01

    Data suggest the overuse of repeat colonoscopies, especially in patients at low risk for colorectal cancer. Our objective was to evaluate the time to repeat colonoscopies in low-risk patients aged 50-79 years old and the associated patient- and endoscopist-related factors. All patients aged 50-79 years of age who underwent a complete outpatient colonoscopy with a negative result between 2000 and 2007 were identified from the Ontario Health Insurance Plan database. A colonoscopy performed within 5.5 years of follow-up after the index colonoscopy was considered an early repeat colonoscopy. Patient, endoscopist and endoscopy setting characteristics were recorded and their association with an early repeat colonoscopy was determined using an extended Cox proportional hazards regression model. The cohort consisted of 546 467 patients: 55.4% of the patients were female with a mean age of 61.1 years (95% confidence interval [CI] 61.1-61.2). The cumulative percentage of early repeat colonoscopy after 5.5 years was 33.7%. The rate decreased significantly between 2000 and 2007 (hazard ratio [HR] 0.35, 95% CI 0.34-0.36). General surgeons were associated with a higher risk of early repeat colonoscopy than gastroenterologists (HR 1.27, 95% CI 1.25-1.28). Endoscopists practising in a nonhospital setting were more likely to perform an early repeat colonoscopy (HR 1.26, 95% CI 1.22-1.30) than endoscopists at a hospital. This study showed that there was overuse of early repeat colonoscopy in more than 30% of patients who were at low risk for colorectal cancer. The risk decreased significantly between 2000 and 2007 but was still greater than 20% in 2007. Our findings can be used to develop targeted educational interventions among subgroups of endoscopists with a higher rate of early repeat colonoscopy.

  20. Strengths and limitations of using repeat-dose toxicity studies to predict effects on fertility.

    Science.gov (United States)

    Dent, M P

    2007-08-01

    The upcoming European chemicals legislation REACH (Registration, Evaluation, and Authorisation of Chemicals) will require the risk assessment of many thousands of chemicals. It is therefore necessary to develop intelligent testing strategies to ensure that chemicals of concern are identified whilst minimising the testing of chemicals using animals. Xenobiotics may perturb the reproductive cycle, and for this reason several reproductive studies are recommended under REACH. One of the endpoints assessed in this battery of tests is mating performance and fertility. Animal tests that address this endpoint use a relatively large number of animals and are also costly in terms of resource, time, and money. If it can be shown that data from non-reproductive studies such as in-vitro or repeat-dose toxicity tests are capable of generating reliable alerts for effects on fertility then some animal testing may be avoided. Available rat sub-chronic and fertility data for 44 chemicals that have been classified by the European Union as toxic to fertility were therefore analysed for concordance of effects. Because it was considered appropriate to read across data for some chemicals these data sets were considered relevant for 73 of the 102 chemicals currently classified as toxic to reproduction (fertility) under this system. For all but 5 of these chemicals it was considered that a well-performed sub-chronic toxicity study would have detected pathology in the male, and in some cases, the female reproductive tract. Three showed evidence of direct interaction with oestrogen or androgen receptors (linuron, nonylphenol, and fenarimol). The remaining chemicals (quinomethionate and azafenidin) act by modes of action that do not require direct interaction with steroid receptors. However, both these materials caused in-utero deaths in pre-natal developmental toxicity studies, and the relatively low NOAELs and the nature of the hazard identified in the sub-chronic tests provides an alert

  1. Non-target effects of repeated chlorothalonil application on soil nitrogen cycling: The key functional gene study.

    Science.gov (United States)

    Zhang, Manyun; Xu, Zhihong; Teng, Ying; Christie, Peter; Wang, Jun; Ren, Wenjie; Luo, Yongming; Li, Zhengao

    2016-02-01

    The widespread and increasing application of chlorothalonil (CTN) raises concerns about its non-target impacts, but little information is available on the effect of CTN on the key functional genes related to soil nitrogen (N) cycling, especially in the case of repeated applications. In the present study, a microcosm incubation was conducted to determine CTN residues and the impacts on the abundances of key functional genes related to N cycling after repeated CTN applications. The results demonstrated that repeated CTN applications at the recommended application rate and five times the recommended rate led to the accumulation of CTN residue in soil at concentrations of 5.59 and 78.79 mg kg(-1), respectively, by the end of incubation. Real time PCR (RT-PCR) revealed that repeated CTN applications had negative effects on the chiA and aprA gene abundances. There were significantly negative correlations between CTN residues and abundances of AOA and AOB genes. In addition, the abundances of key functional genes involved in soil denitrification were declined by repeated CTN applications with the sole exception of the nosZ gene. This study suggests that repeated CTN applications could lead to the accumulation of CTN residue and generate somewhat inconsistent and erratic effects on the abundances of key functional genes related to soil N cycling.

  2. Visual Design Principles: An Empirical Study of Design Lore

    Science.gov (United States)

    Kimball, Miles A.

    2013-01-01

    Many books, designers, and design educators talk about visual design principles such as balance, contrast, and alignment, but with little consistency. This study uses empirical methods to explore the lore surrounding design principles. The study took the form of two stages: a quantitative literature review to determine what design principles are…

  3. Visual Design Principles: An Empirical Study of Design Lore

    Science.gov (United States)

    Kimball, Miles A.

    2013-01-01

    Many books, designers, and design educators talk about visual design principles such as balance, contrast, and alignment, but with little consistency. This study uses empirical methods to explore the lore surrounding design principles. The study took the form of two stages: a quantitative literature review to determine what design principles are…

  4. Impact of repeated measures and sample selection on genome-wide association studies of fasting glucose

    Science.gov (United States)

    Rasmussen-Torvik, Laura J.; Alonso, Alvaro; Li, Man; Kao, Wen; Köttgen, Anna; Yan, Yuer; Couper, David; Boerwinkle, Eric; Bielinski, Suzette J.; Pankow, James S.

    2010-01-01

    Although GWAS have been performed in longitudinal studies, most used only a single trait measure. GWAS of fasting glucose have generally included only normoglycemic individuals. We examined the impact of both repeated measures and sample selection on GWAS in ARIC, a study which obtained four longitudinal measures of fasting glucose and included both individuals with and without prevalent diabetes. The sample included Caucasians and the Affymetrix 6.0 chip was used for genotyping. Sample sizes for GWAS analyses ranged from 8372 (first study visit) to 5782 (average fasting glucose). Candidate SNP analyses with SNPs identified through fasting glucose or diabetes GWAS were conducted in 9133 individuals, including 761 with prevalent diabetes. For a constant sample size, smaller p-values were obtained for the average measure of fasting glucose compared to values at any single visit, and two additional significant GWAS signals were detected. For four candidate SNPs (rs780094, rs10830963, rs7903146, and rs4607517), the strength of association between genotype and glucose was significantly (p-interaction fasting glucose candidate SNPs (rs780094, rs10830963, rs560887, rs4607517, rs13266634) the association with measured fasting glucose was more significant in the smaller sample without prevalent diabetes than in the larger combined sample of those with and without diabetes. This analysis demonstrates the potential utility of averaging trait values in GWAS studies and explores the advantage of using only individuals without prevalent diabetes in GWAS of fasting glucose. PMID:20839289

  5. Structural Studies of Metalloprotein Design

    Science.gov (United States)

    2007-11-02

    TITLE AND SUBTITLE Structural Studies of Metalloprotein Design 6. AUTHOR(S) David W. Christianson 5. FUNDING NUMBERS N00014-96-1-0288 7...0288 PRINCIPAL INVESTIGATOR: David W. Christiansen INSTITUTION: University of Pennsylvania GRANT TITLE: Structural Studies of Metalloprotein

  6. A nationwide, population-based, long-term follow-up study of repeated self-harm in Taiwan

    Directory of Open Access Journals (Sweden)

    Chung Chi-Hsiang

    2012-09-01

    Full Text Available Abstract Background Previous follow-up studies of repeated self-harm show that the cumulative risk of repeated self-harm within one year is 5.7%–15%, with females at greatest risk. However, relatively few studies have focused on the Far East. The objective of this study was to calculate the cumulative risk of repeated self-harm over different lengths of follow-up time (3 months, 6 months, and 1–8 years, to determine factors influencing repeated self-harm and to explore the interaction between gender and self-harm methods. Methods We used self-harm patient who hospitalized due to first-time self-harm between 2000 and 2007 from 1,230 hospitals in Taiwan. Hospitalization for repeated self-harm among members of this cohort was tracked after 3 months, 6 months, and 1–8 years. Tracking continued until December 31, 2008. We analyzed the cumulative risk and risk factors of repeated self-harm by using negative binomial regression. Results Of the 39,875 individual study samples, 3,388 individuals (8.50% were found to have repeatedly self-harmed. The cumulative risk of repeated self-harm within three months was 7.19% and within one year was 8%. Within 8 years, it was 8.70%. Females were more likely to repeatedly self-harm than males (RR = 1.21, 95% CI = 1.15–1.76. The main method of self-harm was solid or liquid substances (RR = 1.88, 95% CI = 1.23–2.04 or cutting or piercing (RR = 1.36, 95% CI = 1.02–1.82, and in patients with psychiatric disorders were more likely to self-harm (RR = 1.61, 95% CI = 1.48–1.75. Conclusions The key time for intervention for repeated self-harm is within three months. Appropriate prevention programs should be developed based on gender differences.

  7. Thermal stability of chicken brain {alpha}-spectrin repeat 17: a spectroscopic study

    Energy Technology Data Exchange (ETDEWEB)

    Brenner, Annette K. [University of Bergen, Department of Chemistry (Norway); Kieffer, Bruno [Ecole Superieure de Biotechnologie de Strasbourg, IGBMC Biomolecular NMR Group, CNRS UMR 7104 (France); Trave, Gilles [Ecole Superieure de Biotechnologie de Strasbourg, Equipe Oncoproteines, IREBS, UMR 7242 (France); Froystein, Nils Age [University of Bergen, Department of Chemistry (Norway); Raae, Arnt J., E-mail: arnt.raae@mbi.uib.no [University of Bergen, Department of Molecular Biology (Norway)

    2012-06-15

    Spectrin is a rod-like multi-modular protein that is mainly composed of triple-helical repeats. These repeats show very similar 3D-structures but variable conformational and thermodynamical stabilities, which may be of great importance for the flexibility and dynamic behaviour of spectrin in the cell. For instance, repeat 17 (R17) of the chicken brain spectrin {alpha}-chain is four times less stable than neighbouring repeat 16 (R16) in terms of Increment G. The structure of spectrin repeats has mainly been investigated by X-ray crystallography, but the structures of a few repeats, e.g. R16, have also been determined by NMR spectroscopy. Here, we undertook a detailed characterization of the neighbouring R17 by NMR spectroscopy. We assigned most backbone resonances and observed NOE restraints, relaxation values and coupling constants that all indicated that the fold of R17 is highly similar to that of R16, in agreement with previous X-ray analysis of a tandem repeat of the two domains. However, {sup 15}N heteronuclear NMR spectra measured at different temperatures revealed particular features of the R17 domain that might contribute to its lower stability. Conformational exchange appeared to alter the linker connecting R17 to R16 as well as the BC-loop in close proximity. In addition, heat-induced splitting was observed for backbone resonances of a few spatially related residues including V99 of helix C, which in R16 is replaced by the larger hydrophobic tryptophan residue that is relatively conserved among other spectrin repeats. These data support the view that the substitution of tryptophan by valine at this position may contribute to the lower stability of R17.

  8. Essays on diffusion and repeat sales of consumer durables : a study of the consumer electronics market

    OpenAIRE

    Kaya, Maria

    2008-01-01

    Although repeat purchases dominate overall sales of consumer durables, diffusion of innovations research has paid them far less attention than new product adoptions. A large survey of 8,077 households allowed a detailed investigation of the differences between households in terms of their repeat purchase behavior of durables. Asymmetric effects were investigated using competing hazard models and showed that consumer innovativeness has a strong impact on discretionary replacements. A modified ...

  9. CAG repeat polymorphisms in the androgen receptor and breast cancer risk in women: a meta-analysis of 17 studies.

    Science.gov (United States)

    Mao, Qixing; Qiu, Mantang; Dong, Gaochao; Xia, Wenjie; Zhang, Shuai; Xu, Youtao; Wang, Jie; Rong, Yin; Xu, Lin; Jiang, Feng

    2015-01-01

    The association between polymorphic CAG repeats in the androgen receptor gene in women and breast cancer susceptibility has been studied extensively. However, the conclusions regarding this relationship remain conflicting. The purpose of this meta-analysis was to identify whether androgen receptor CAG repeat lengths were related to breast cancer susceptibility. The MEDLINE, PubMed, and EMBASE databases were searched through to December 2014 to identify eligible studies. Data and study quality were rigorously assessed by two investigators according to the Newcastle-Ottawa Quality Assessment Scale. The publication bias was assessed by the Begg's test. Seventeen eligible studies were included in this meta-analysis. The overall analysis suggested no association between CAG polymorphisms and breast cancer risk (odds ratio [OR] 1.031, 95% confidence interval [CI] 0.855-1.245). However, in the subgroup analysis, we observed that long CAG repeats significantly increased the risk of breast cancer in the Caucasian population (OR 1.447, 95% CI 1.089-1.992). Additionally, the risk was significantly increased in Caucasian women carrying two alleles with CAG repeats ≥22 units compared with those with two shorter alleles (OR 1.315, 95% CI 1.014-1.707). These findings suggest that long CAG repeats increase the risk of breast cancer in Caucasian women. However, larger scale case-control studies are needed to validate our results.

  10. Intimate partner violence and repeat induced abortion in Italy: A cross sectional study.

    Science.gov (United States)

    Citernesi, Angela; Dubini, Valeria; Uglietti, Anna; Ricci, Elena; Cipriani, Sonia; Parazzini, Fabio

    2015-01-01

    To investigate the impact of intimate partner violence (IPV) on the risk of repeat induced abortion (RIA), we compared IPV history among women with and without previous induced abortion (IA). All consecutive women aged 18 years or more requiring IA in 12 Italian abortion clinics were eligible for inclusion in the study. They were asked to fill in an anonymous, self-developed questionnaire assessing sociodemographic data and their history of different types of violence and related risk factors. The analysis included 1030 women, 624 (60.6%) of whom reported a previous IA. Past or current IPV was reported by 19.3%: 7.0% reported sexual violence, 11.3% physical abuse and 12.1% psychological abuse. Past or current IPV was reported by 22.3% of women with RIA and 14.8% of those undergoing their first IA (adjusted odds ratio 1.57, 95% confidence interval 1.07-2.30; p = 0.02). When we considered sexual, psychological and physical abuse separately, we found that any kind of abuse was more frequent in women with RIA than in women with no previous IA. This study underlines the impact of IPV on the risk of RIA and suggests the need for screening for IPV among women requiring abortion, in order to identify women at risk of RIA and to improve their general and reproductive health.

  11. Repeated open application test with methyldibromo glutaronitrile, a multicentre study within the EECDRG.

    Science.gov (United States)

    Gruvberger, B; Andersen, K E; Brandão, F M; Bruynzeel, D P; Bruze, M; Frosch, P J; Goossens, A; Lahti, A; Maibach, H I; Menné, T; Orton, D; Seidenari, S

    2005-01-01

    Contact allergy to and allergic contact dermatitis from methyldibromo glutaronitrile (MDBGN) have frequently been reported. This study was initiated to help determine the optimal patch test preparation for MDBGN. In 51 patients with a doubtful or a positive patch test reaction to at least 1 of 4 test preparations with MDBGN in petrolatum at 1.0% w/w, 0.5%, 0.3% and 0.1%, a repeated open application test (ROAT) with moisturizers with and without MDBGN at 0.03% w/w was performed on the upper arms for 2 weeks. 18 of the 51 (35.3%) patients developed a positive ROAT. In all patients, there was a positive ROAT only to the moisturizer with MDBGN (P < 0.001). A statistically significant association was also found between the patch test reactivity (PTRL) and the outcome of the ROAT (P < 0.001). If only considering those with a PTRL above 0.3%, thus with negative or doubtful test reactions to 0.1% and 0.3%, there were still statistically significantly more patients with a positive ROAT to the moisturizer with MDBGN than to the moisturizer without MDBGN. The study demonstrates that patch testing with MDBGN at 0.3% and 0.1% will miss clinically relevant patch test reactions to MDBGN.

  12. Repeated exposure of acidic beverages on esthetic restorative materials: An in-vitro surface microhardness study.

    Science.gov (United States)

    Xavier, Arun M; Sunny, Steffy M; Rai, Kavita; Hegde, Amitha M

    2016-07-01

    A manifold increase in the consumption of aerated beverages has witnessed a twin increase in tooth wear and raised demand for esthetic restorative materials. This study aimed to evaluate the surface microhardness changes of esthetic restorative materials following treatment with aerated beverages in an in-vitro situation. The initial surface microhardness of the restorative materials GC Fuji II LC, GC Fuji IX, Nano Glass ionomer, Resin and Nano composite was recorded. These materials were studied under 3 groups that included those exposed to the acidic beverages daily, weekly once in a month and those that had no exposures at all. The final surface microhardness of the materials was recorded following experimentation and was subjected to statistical comparisons. The restorative materials were compared for their surface microhardness changes following respective treatments using the T-test and One-way ANOVA analysis. Inter-comparisons between the groups showed statistical significance (pmaterials revealed surface microhardness loss; the maximum reduction noticed with the Nano glass ionomer cement tested (pmaterials markedly reduced upon repeated exposures with acidic beverages; the product with phosphoric acid producing the maximum surface microhardness loss. Restorative materials, acidic beverages, surface microhardness, resin composites, glass ionomers.

  13. The Study on the Ferrokinetics and Acquired Immunity in Repeated Hookworm Infections

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Mun Ho; Lee, Pyl Ung [Seoul National University College of Medicine, Seoul (Korea, Republic of)

    1967-09-15

    In order to confirm whether acquired immunity or resistance can be developed by the repeated hookworm infections, the 150 mature actively moving filariform ancylostoma duodenale larvae obtained from the severe hookworm anemia patients were orally given to 8 healthy volunteers in three divided doses, 50 in each, at 5 day interval. Also the hematological changes as well as several ferrokinetics using {sup 59}Fe were done and were compared with 10 controls. The clinical symptoms and signs were checked every day for the first 3 weeks and then twice weekly until the end of the experiment. The appearance of the ova in the stool was examined by the formalin ether method and the ova was counted by the Stoll's method. The following laboratory tests were done:1) Red blood cell count, venous blood hematocrit (micromethod), hemoglobin count (cyanomethemoglobin method) were checked every 5 to 7 day interval. 2) Plasma iron concentration (Barkan's modified method) was determined every 2 to 3 week interval. 3) Radioisotope studies:a) Ferrokinetics: Huff et al and Bothwell's method were applied. Erythropoietic Index (% of normal)= ['Subject's turnover/100 ml whole bloodX100'] over ['Average normal turnover/100 ml whole blood'] b) Quantitative measurement of the gastrointestinal absorption of iron:Radioiron ({sup 59}Fe) balance method was applied. c) Determination of the plasma erythropoietin activity: Fried's method was applied. Following were the results: 1) The serum iron level was lower. The red cell volume was decreased, but with relative increase of plasma volume. 2) The plasma iron disappearance time was accelerated and the plasma iron turnover rate was decreased. The red cell iron turnover rate was markedly increased, while all of the red cell iron concentration, circulating red cell iron, plasma iron pool were decreased. The daily iron pool turnover and red cell renewal rate were increased. 3) The erythropoietic index

  14. Additional notes on clinical repeated-dose pharmacokinetic trials applying a peak-and-trough sampling design to estimate oral clearance.

    Science.gov (United States)

    Takaai, Mari; Kayano, Yuichiro; Shimizu, Takako; Taguchi, Masato; Hashimoto, Yukiya

    2008-01-01

    In the previous study, we performed a simulation of a clinical pharmacokinetic trial, in which blood was sampled at two time points corresponding to the peak concentration (C(peak)) and trough concentration (C(trough)) following repetitive oral administration at the dose, D, and dosing interval, tau. The approximate oral clearance (CL/F(approx)), estimated as 2 x D/(C(peak) x tau+C(trough) x tau), is accurate for drugs with an elimination half-life comparative to or longer than tau; however, it was suggested that we might not use CL/F(approx) for drugs with a considerably short elimination half-life relative to tau. In the present study, we evaluated the accuracy of the alternative oral clearance (CL/F(exp)) estimated by the simple monoexponential model. In contrast to CL/F(approx), CL/F(exp) was accurate for drugs with a short elimination half-life relative to tau. The present finding in conjunction with our previous study suggested that the peak-and-trough sampling design is promising for the clinical repeated-dose pharmacokinetic trial for drugs with not only slow but also rapid elimination from the body. We think that the accuracy and precision of the two analysis methods to estimate oral clearance (CL/F(approx) and CL/F(exp)) for a target drug should be evaluated carefully before and after a real clinical trial.

  15. Beverage Intake Assessment Questionnaire: Relative Validity and Repeatability in a Spanish Population with Metabolic Syndrome from the PREDIMED-PLUS Study

    Science.gov (United States)

    Ferreira-Pêgo, Cíntia; Nissensohn, Mariela; Kavouras, Stavros A.; Babio, Nancy; Serra-Majem, Lluís; Martín Águila, Adys; Mauromoustakos, Andy; Álvarez Pérez, Jacqueline; Salas-Salvadó, Jordi

    2016-01-01

    We assess the repeatability and relative validity of a Spanish beverage intake questionnaire for assessing water intake from beverages. The present analysis was performed within the framework of the PREDIMED-PLUS trial. The study participants were adults (aged 55–75) with a BMI ≥27 and <40 kg/m2, and at least three components of Metabolic Syndrome (MetS). A trained dietitian completed the questionnaire. Participants provided 24-h urine samples, and the volume and urine osmolality were recorded. The repeatability of the baseline measurement at 6 and 1 year was examined by paired Student’s t-test comparisons. A total of 160 participants were included in the analysis. The Bland–Altman analysis showed relatively good agreement between total daily fluid intake assessed using the fluid-specific questionnaire, and urine osmolality and 24-h volume with parameter estimates of −0.65 and 0.22, respectively (R2 = 0.20; p < 0.001). In the repeatability test, no significant differences were found between neither type of beverage nor total daily fluid intake at 6 months and 1-year assessment, compared to baseline. The proposed fluid-specific assessment questionnaire designed to assess the consumption of water and other beverages in Spanish adult individuals was found to be relatively valid with good repeatability. PMID:27483318

  16. Multimission Aircraft Design Study, Payload

    Science.gov (United States)

    2003-03-01

    iterated several times up to the level time allowed. 1.4 Scope It is necessary to recall that the backgrounds of the Systems Engineering Design Team...landing options are as wheels, skids, parachutes, airbags and none; that is, letting it fly forever or crash. Trade studies should be done in order to

  17. Structural Studies of a Four-MBT Repeat Protein MBTD1

    Energy Technology Data Exchange (ETDEWEB)

    Eryilmaz, Jitka; Pan, Patricia; Amaya, Maria F.; Allali-Hassani, Abdellah; Dong, Aiping; Adams-Cioaba, Melanie A.; MacKenzie, Farrell; Vedadi, Masoud; Min, Jinrong; (Toronto); (Toronto)

    2010-08-17

    The Polycomb group (PcG) of proteins is a family of important developmental regulators. The respective members function as large protein complexes involved in establishment and maintenance of transcriptional repression of developmental control genes. MBTD1, Malignant Brain Tumor domain-containing protein 1, is one such PcG protein. MBTD1 contains four MBT repeats. We have determined the crystal structure of MBTD1 (residues 130-566aa covering the 4 MBT repeats) at 2.5 {angstrom} resolution by X-ray crystallography. The crystal structure of MBTD1 reveals its similarity to another four-MBT-repeat protein L3MBTL2, which binds lower methylated lysine histones. Fluorescence polarization experiments confirmed that MBTD1 preferentially binds mono- and di-methyllysine histone peptides, like L3MBTL1 and L3MBTL2. All known MBT-peptide complex structures characterized to date do not exhibit strong histone peptide sequence selectivity, and use a 'cavity insertion recognition mode' to recognize the methylated lysine with the deeply buried methyl-lysine forming extensive interactions with the protein while the peptide residues flanking methyl-lysine forming very few contacts. Nevertheless, our mutagenesis data based on L3MBTL1 suggested that the histone peptides could not bind to MBT repeats in any orientation. The four MBT repeats in MBTD1 exhibits an asymmetric rhomboid architecture. Like other MBT repeat proteins characterized so far, MBTD1 binds mono- or dimethylated lysine histones through one of its four MBT repeats utilizing a semi-aromatic cage.

  18. Resistance repeatability study of ion-beam deposited vanadium oxide thin films

    Science.gov (United States)

    Alvarez, P.; Pearson, D. I. C.; Pochon, S.; Thomas, O.; Cooke, M.; Gunn, R.

    2016-09-01

    Ion Beam Sputter Deposition (IBSD) is a versatile technique particularly suited to applications requiring high quality, high performance layer materials as it allows independent and accurate control of the process parameters. Vanadium oxides, used for example in the fabrication of microbolometers, optical switches or optical storage, exhibit interesting properties such as a high Temperature Coefficient of Resistance (TCR), relatively low 1/f noise and a semiconductormetal phase transition close to room temperature. However, it is very challenging to control the stoichiometry of the deposited film as there are at least 25 different oxidation states of vanadium, few of which display the required electrical characteristics. In the present study, vanadium oxide thin layers were deposited by IBSD using an Oxford Ionfab300+ and analyzed with regard to their electrical properties. The impact of the system parameters on the resistance repeatability, wafer-to-wafer and batch-to-batch, was thoroughly investigated to provide the end user with a clear understanding of the factors affecting film resistivity while ensuring at the same time a steep variation of resistance with temperature, as notably required for uncooled bolometers. These parameters were balanced to also achieve a good deposition rate, throughput and uniformity over large device areas, compatible with the requirements of industrial applications.

  19. Comparative Genomic Hybridization Selection of Blastocysts for Repeated Implantation Failure Treatment: A Pilot Study

    Science.gov (United States)

    Greco, Ermanno; Bono, Sara; Ruberti, Alessandra; Lobascio, Anna Maria; Greco, Pierfrancesco; Biricik, Anil; Spizzichino, Letizia; Greco, Alessia; Tesarik, Jan; Minasi, Maria Giulia; Fiorentino, Francesco

    2014-01-01

    The aim of this study is to determine if the use of preimplantation genetic screening (PGS) by array comparative genomic hybridization (array CGH) and transfer of a single euploid blastocyst in patients with repeated implantation failure (RIF) can improve clinical results. Three patient groups are compared: 43 couples with RIF for whom embryos were selected by array CGH (group RIF-PGS), 33 couples with the same history for whom array CGH was not performed (group RIF NO PGS), and 45 good prognosis infertile couples with array CGH selected embryos (group NO RIF PGS). A single euploid blastocyst was transferred in groups RIF-PGS and NO RIF PGS. Array CGH was not performed in group RIF NO PGS in which 1-2 blastocysts were transferred. One monoembryonic sac with heartbeat was found in 28 patients of group RIF PGS and 31 patients of group NO RIF PGS showing similar clinical pregnancy and implantation rates (68.3% and 70.5%, resp.). In contrast, an embryonic sac with heartbeat was only detected in 7 (21.2%) patients of group RIF NO PGS. In conclusion, PGS by array CGH with single euploid blastocyst transfer appears to be a successful strategy for patients with multiple failed IVF attempts. PMID:24779011

  20. Repeated dose (14 days) rat intramuscular toxicology study of Her1 vaccine.

    Science.gov (United States)

    Mancebo, A; Casacó, A; Sánchez, B; González, B; Gómez, D; León, A; Bada, A M; Arteaga, M E; González, Y; González, C; Pupo, M; Fuentes, Dasha

    2012-12-01

    Our goal was to assess the toxicity of two strengths (200 and 400 μg) of HER1 cancer vaccine (Center of Molecular Immunology, Cuba), presented in two different formulations, in Sprague Dawley rats after repeated intramuscular administration (14 days). Four groups (5 animals/sex) were established: Control, Placebo (adjuvant), and two Treated groups receiving a dose representing ten times of human total dose (10×), 28.6 and 57.1 μg/kg. Clinical observations, body weight and rectal temperature were measured during the study. Clinical pathology analysis was performed, besides gross necropsy and histological examination of tissues on animals at the end of the assay. The assay ended with a 100% survival. Injection site damage, with the presence of cysts and granulomas, was observed in adjuvant and vaccine treated groups, with most severe cases predominating at higher strength. Administration of Placebo and Her1 vaccine induced increase in polymorphonuclear cells, with relative lymphopenia conditioned by primary neutrophilia. In summary, results suggest that Her1 immunization was capable of inducing an inflammatory effect at the injection site, leading to systemic alterations, more significant at higher strength (400 μg, 57.1 μg/kg), probably affected by the immunizations' schedule used. The vaccine was shown to be well tolerated without any obvious signs of systemic toxicity, with findings largely attributable to the adjuvant used.

  1. Study on the homocysteine metabolism of patients with unexplained repeated spontaneous abortion

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Objective:To study the metabolism abnormality of homocysteine(Hcy) in unexplained repeated spontaneous abortion(URSA).Methods:The level of Hcy in sera was measured with hyperpressure liquid chromatography(HPLC);Folic acid and vitamin B12 were detected by radioimmune assay;anticardiolipin antibody (ACA) was detected by ELISA.Results:(1)The level of serum Hcy in URSA group was significantly higher than that in control group,showing a statistical significant difference(P<0.01).The level of Hcy was correlated with ages,but not correlated with areas,numbers of miscarriage,gestation age,primary or secondary abortions.(2)The levels of folic acid and vitamin B12 in URSA group were significantly lower than those in control group.The levels of serum folic acid and vitamin B12 were not correlated with age,area,numbers of miscarriage and abortion periods.(3)ACA positive rate in URSA was significantly higher than that in control group.The level of Hcy in ACA(+) group was significantly higher than that in ACA(-) group among URSA patients.Conclusions:Hyperhomocysteinemia,low folic acid state,and ACA were all the independent risk factors for URSA.Lacking of folic acid and vitamin B12 is one of the important causes of hyperhomocysteinemia.ACA and hyperhomocysteinemia may have synergistic action in the occurrence of URSA.

  2. Identification and characterization of simple sequence repeats (SSRs) for population studies of Puccinia novopanici.

    Science.gov (United States)

    Orquera-Tornakian, Gabriela K; Garrido, Patricia; Kronmiller, Brent; Hunger, Robert; Tyler, Brett M; Garzon, Carla D; Marek, Stephen M

    2017-08-01

    Switchgrass (Panicum virgatum L.) can be severely affected by rust disease. Recently switchgrass rust caused by P. emaculata (now confirmed to be Puccinia novopanici) has received most of the attention by the research community because this pathogen is responsible for reducing the biomass production and biofuel feedstock quality of switchgrass. Microsatellite markers found in the literature were either not informative (no allele frequency) or showed few polymorphisms in the target populations, therefore additional markers are needed for future studies of the genetic variation and population structure of P. novopanici. This study reports the development and characterization of novel simple sequence repeat (SSR) markers from a Puccinia emaculata s.l. microsatellite-enriched library and expressed sequence tags (ESTs). Microsatellites were evaluated for polymorphisms on P. emaculata s.l. urediniospores collected in Iowa (IA), Mississippi (MS), Oklahoma (OK), South Dakota (SD) and Virginia (VA). Puccinia novopanici single spore whole genome amplifications were used as templates to validate the SSR reactions protocol and to assess a preliminary population genetics statistics of the pathogen. Eighteen microsatellite markers were polymorphic (average PIC=0.72) on individual urediniospores, with an average of 8.3 alleles per locus (range 3 to 17). Of the 49 SSRs loci initially identified in P. emaculata s.l., 18 were transferable to P. striiformis f. sp. tritici, 23 to P. triticina, 20 to P. sorghi and 31 to P. andropogonis. Thus, these markers could be useful for DNA fingerprinting and population structure analysis for population genetics, epidemiology and ecological studies of P. novopanici and potentially other related Puccinia species. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Repeat sleeve gastrectomy compared with primary sleeve gastrectomy: a single-center, matched case study.

    Science.gov (United States)

    Rebibo, Lionel; Fuks, David; Verhaeghe, Pierre; Deguines, Jean-Baptiste; Dhahri, Abdennaceur; Regimbeau, Jean-Marc

    2012-12-01

    Longitudinal sleeve gastrectomy (LSG) has been validated for the treatment of morbid obesity. However, treatment failures can appear several months after SG. Additional malabsorptive surgery is generally recommended in such cases. The objective of the present study was to evaluate the outcomes of repeat SG (re-SG) relative to first-line SG. This was a retrospective study included 15 patients underwent re-SG after failure of first-line SG (i.e. University Hospital, France; Public Practice). These patients were matched (for age, gender, body mass index and comorbidities) 1:2 with 30 patients having undergone first-line SG. The efficacy criteria comprised intra-operative data and postoperative data. The overall study population comprised 45 patients. The re-SG and first-line SG groups did not differ significantly in terms of median age (p = NS). The median BMI was similar in the two groups (43 kg/m(2) vs. 42.3 kg/m(2), p = NS). The two groups were similar in terms of the prevalence of comorbidities. The mean operating time was longer in the re-SG group (116 vs. 86 min; p ≤ 0.01). The postoperative complication rate was twice as high in the re-SG group (p = 0.31). Two patients in the re-SG group developed a gastric fistula (p = 0.25) and one of the latter died. At 12 months, the Excess Weight Loss was 66% (re-SG group) and 77% (first-line SG group) (p = 0.05). Re-SG is feasible but appears to be associated with a greater risk of complications. Nevertheless, re-SG can produce results (in terms of weight loss), equivalent to those obtained after first-line SG.

  4. Quantum repeated games revisited

    CERN Document Server

    Frackiewicz, Piotr

    2011-01-01

    We present a scheme for playing quantum repeated 2x2 games based on the Marinatto and Weber's approach to quantum games. As a potential application, we study twice repeated Prisoner's Dilemma game. We show that results not available in classical game can be obtained when the game is played in the quantum way. Before we present our idea, we comment on the previous scheme of playing quantum repeated games.

  5. Responsiveness of 5-HT2C receptors in repeatedly diazepam-injected rats: a behavioral and neurochemical study.

    Science.gov (United States)

    Khan, Asma; Haleem, Darakhshan J

    2008-01-01

    The role of 5-hydroxytryptamine (serotonin; 5-HT)2C receptors in anxiety and the anxiolytic effects of drugs is well documented. In view of the withdrawal anxiety associated with repeated diazepam intake, the present study concerns the efficacy of 5-HT2C receptors in rats treated with diazepam. Results show that diazepam injections at a dose of 2 mg/kg daily for two weeks increased weekly food intake and growth rate. Anxiolytic effects of the drug monitored in a light/dark activity box were not significant after single administration. One week and two weeks of administration elicited anxiolytic effects, which were smaller after two weeks of administration as compared to one week, suggesting the development of tolerance to the anxiolytic profile of diazepam. Moreover, three days' withdrawal from repeated administration elicited anxiogenic behavior in the light/dark activity box. The behavioral and neurochemical effects of 1-(m-chlorophenyl)piperazine (m-CPP) (3 mg/kg), a 5-HT2C agonist, were monitored following withdrawal (three days) from two weeks of diazepam administration. Results showed that hypophagic as well as anxiogenic-like effects of m-CPP were not different from repeated saline or repeated diazepam-injected animals. Administration of m-CPP increased 5-HT metabolism in repeated saline as well as repeated diazepam-injected animals. However, m-CPP-induced increases in 5-HT metabolism were greater in repeated diazepam-injected animals. Results are discussed in the context of the role of 5-HT2C receptors in the precipitation of withdrawal anxiety.

  6. FIRE - Flyby of Io with Repeat Encounters: A conceptual design for a New Frontiers mission to Io

    Science.gov (United States)

    Suer, Terry-Ann; Padovan, Sebastiano; Whitten, Jennifer L.; Potter, Ross W. K.; Shkolyar, Svetlana; Cable, Morgan; Walker, Catherine; Szalay, Jamey; Parker, Charles; Cumbers, John; Gentry, Diana; Harrison, Tanya; Naidu, Shantanu; Trammell, Harold J.; Reimuller, Jason; Budney, Charles J.; Lowes, Leslie L.

    2017-09-01

    A conceptual design is presented for a low complexity, heritage-based flyby mission to Io, Jupiter's innermost Galilean satellite and the most volcanically active body in the Solar System. The design addresses the 2011 Decadal Survey's recommendation for a New Frontiers class mission to Io and is based upon the result of the June 2012 NASA-JPL Planetary Science Summer School. A science payload is proposed to investigate the link between the structure of Io's interior, its volcanic activity, its surface composition, and its tectonics. A study of Io's atmospheric processes and Io's role in the Jovian magnetosphere is also planned. The instrument suite includes a visible/near-IR imager, a magnetic field and plasma suite, a dust analyzer, and a gimbaled high gain antenna to perform radio science. Payload activity and spacecraft operations would be powered by three Advanced Stirling Radioisotope Generators (ASRG). The primary mission includes 10 flybys with close-encounter altitudes as low as 100 km. The mission risks are mitigated by ensuring that relevant components are radiation tolerant and by using redundancy and flight-proven parts in the design. The spacecraft would be launched on an Atlas V rocket with a delta-v of 1.3 km/s. Three gravity assists (Venus, Earth, Earth) would be used to reach the Jupiter system in a 6-year cruise. The resulting concept demonstrates the rich scientific return of a flyby mission to Io.

  7. A Preliminary Study of the Effects of Repeated Massage on Hypothalamic–Pituitary–Adrenal and Immune Function in Healthy Individuals: A Study of Mechanisms of Action and Dosage

    Science.gov (United States)

    Schettler, Pamela; Bresee, Catherine

    2012-01-01

    Abstract Objectives This study gathers preliminary data about the biologic effects of repeated Swedish massage therapy compared to a light-touch control condition. Design The study design was a 5-week comparison of repeated Swedish massage and light touch on oxytocin (OT), arginine-vasopressin (AVP), adrenal corticotropin hormone (ACTH), cortisol (CORT), circulating phenotypic lymphocyte markers, and mitogen-stimulated cytokine function. Setting The setting was an outpatient research unit in an academic medical center. Participants The study subjects were medically and psychiatrically healthy young adults. Intervention The study comprised 45 minutes of Swedish massage or light touch, using highly specified and identical protocols, either weekly or twice weekly for 5 weeks. Outcome measures The outcome measures were mean differences between massage and light touch on OT, AVP, ACTH, CORT, lymphocyte markers, and cytokine levels. Results Compared to the touch control condition, weekly Swedish massage stimulated a sustained pattern of increased circulating phenotypic lymphocyte markers and decreased mitogen-stimulated cytokine production, similar to what was previously reported for a single massage session, while having minimal effect on hypothalamic–pituitary–adrenal function. Twice-weekly massage produced a different response pattern with increased OT levels, decreased AVP, and decreased CORT but little effect on circulating lymphocyte phenotypic markers and a slight increase in mitogen-stimulated interferon-γ, tumor necrosis factor-α, interleukin (IL)-1b and IL-2 levels, suggesting increased production of pro-inflammatory cytokines. Conclusions There are sustained cumulative biologic actions for the massage and touch interventions that persist for several days or a week, and these differ profoundly depending on the dosage (frequency) of sessions. Confirmatory studies in larger samples are needed. PMID:22775448

  8. Genetic structure of the Azores Islands: a study using 15 autosomal short tandem repeat loci.

    Science.gov (United States)

    Santos, Cristina; Alvarez, Luis; Aluja, Maria Pilar; Bruges-Armas, Jacome; Lima, Manuela

    2009-12-01

    The Azores archipelago (Portugal), located in the Atlantic Ocean, 1,500 km from the European mainland, is formed by nine islands of volcanic origin. The relative position of these islands allows the definition of three geographical groups: Eastern, Central and Western. Previous studies of the Azores using Short Tandem Repeats (STRs) have highlighted differences in the frequencies of several loci, when compared to Mainland Portugal or Madleira Island. Furthermore, linkage disequilibrium (LD), described for Azorean samples has been tentatively explained as reflecting the presence of genetic sub-structuring in the archipelago. To provide information concerning the genetic profile of the Azores Islands and to evaluate the presence of substructuring we have determined the allelic frequencies of 15 autosomal STR loci, using the AmpFlSTR Identifiler Kit, in representative samples from the Azorean Islands. Either considering the Azores as a whole, or analysing by island all the loci were in conformity with Hardy-Weinberg equilibrium. Average gene diversity ranged from 0.7669 in Corvo to 0.7972 in Terceira Island. Allelic independence between loci, tested for the global sample, detected significant LD (after correction for multiple tests) for pairs D21S11/D7S820 and D3S1358/D5S818. The exact test of population differentiation, combining the information of the 15 markers analysed, revealed significant differences between the three groups of islands, and between islands. Inter-island analysis reinforces the previous data that suggested the existence of sub-structuring in the Azores archipelago. Moreover, the data generated by this study can be used in a future forensic genetic database of the Azores after the appropriate enlacement of sample size by island, preventing, in that way, misinterpretations caused by population substructuring and small sample sizes.

  9. Diabetic Foot Prevention: Repeatability of the Loran Platform Plantar Pressure and Load Distribution Measurements in Nondiabetic Subjects during Bipedal Standing—A Pilot Study

    Directory of Open Access Journals (Sweden)

    Martha Zequera

    2011-01-01

    Full Text Available This study was designed to assess the repeatability of the Loran Platform and evaluate the variability of plantar pressure and postural balance, during barefoot standing in nondiabetic subjects, for future diabetic foot clinical evaluation. Measurements were taken for eight nondiabetic subjects (4 females, 4 males, aged 47±7.2 years who had no musculoskeletal symptoms. Five variables were measured with the platform in the barefoot standing position. Ten measurements were taken using two different techniques for feet and posture positioning, during three sessions, once a week. For most measurements, no significant effect over time was found with Student's t-test (P<.000125. The ANOVA test of statistical significance confirmed that measurement differences between subjects showed higher variations than measurements taken from the same subject (P<.001. The measurements taken by the Loran Platform system were found to be repeatable.

  10. A Design Approach for Collaboration Processes: A Multi-Method Design Science Study in Collaboration Engineering

    NARCIS (Netherlands)

    Kolfschoten, G.L.; De Vreede, G.J.

    2009-01-01

    Collaboration Engineering is an approach for the design and deployment of repeatable collaboration processes that can be executed by practitioners without the support of collaboration professionals such as facilitators. A critical challenge in Collaboration Engineering concerns how the design activi

  11. LONGITUDINAL STUDY OF REPEATED SPRINT PERFORMANCE IN YOUTH SOCCER PLAYERS OF CONTRASTING SKELETAL MATURITY STATUS

    Directory of Open Access Journals (Sweden)

    João Valente-dos-Santos

    2012-09-01

    Full Text Available The purpose of the study was to evaluate the developmental changes in performance in a repeated-sprint ability (RSA test in young soccer players of contrasting maturity status. A total of 83 regional level Portuguese youth soccer players, aged 11- 13 years at baseline was assessed annually. Stature, body mass, 7x34.2-m sprint protocol (25-s active recovery, 20-m multi-stage continuous shuttle endurance run and counter-movement jump (CMJ without the use of the arms were measured. Fat-free mass (FFM was determined by age and gender- specific formulas. Developmental changes in total sprint time across ages were predicted using multilevel modeling. Corresponding measurements were performed on an independent cross-sectional subsample of 52 youth soccer players 11-17 years to evaluate the predictive model. CA, CA2, maturational status (SA-CA, body size (mass and stature, FFM, aerobic endurance, lower limb explosive strength and annual volume training significantly improved the statistical fit of the RSA multilevel model. In 'late' maturing athletes, the best model for predicting change in RSA was expressed by the following equation: 86.54 - 2.87 x CA + 0.05 x CA2 - 0.25 x FFM + 0.15 x body mass + 0.05 x stature - 0.05 x aerobic endurance - 0.09 x lower limb explosive strength - 0.01 x annual volume training. The best fitting models for players who were 'on time' and 'early' maturing were identical to the best model for late maturing players, less 0.64 seconds and 1.74 seconds, respectively. Multilevel modeling provided performance curves that permitted the prediction of individual RSA performance across adolescent years in regional level soccer players

  12. A 13-week dermal repeat-dose neurotoxicity study of hydrodesulfurized kerosene in rats.

    Science.gov (United States)

    Breglia, Rudolph; Bui, Quang; Burnett, Donald; Koschier, Francis; Lapadula, Elizabeth; Podhasky, Paula; Schreiner, Ceinwen; White, Russell

    2014-01-01

    A 13-week dermal repeat-dose toxicity study was conducted with hydrodesulfurized (HDS) kerosene, a test material that also met the commercial specifications for aviation turbine fuel (jet A). The objectives were to assess the potential for target organ toxicity and neurotoxicity. The HDS kerosene was applied to the shaved backs of Sprague-Dawley CD rats, 12/sex/group, 6 h/d, 5 d/wk in doses of 0 (vehicle control), 165 mg/kg (20% HDS kerosene), 330 mg/kg (40% HDS kerosene), or 495 mg/kg (60% HDS kerosene). Additional rats (12/sex) from the control and the high-dose groups were held without treatment for 4 weeks to assess recovery. Standard parameters of toxicity were investigated during the in-life phase. At necropsy, organs were weighed and selected tissues were processed for microscopic evaluation. Neurobehavioral evaluations included tests of motor activity and functional observations that were conducted pretest, at intervals during the exposure period and after recovery. No test substance-related effects on mortality, clinical observations (except dermal irritation), body weight, or clinical chemistry values were observed. A dose-related increase in skin irritation, confirmed histologically as minimal, was evident at the dosing site. The only statistically significant change considered potentially treatment related was an increase in the neutrophil count in females at 13 weeks. No test article-related effects were observed in the neurobehavioral assessments or gross or microscopic findings in the peripheral or central nervous system tissues in any of the dose groups. Excluding skin irritation, the no observed adverse effect level value for all effects was considered 495 mg/kg/d.

  13. Population genetic study of 10 short tandem repeat loci from 600 domestic dogs in Korea

    Science.gov (United States)

    Moon, Seo Hyun; Jang, Yoon-Jeong

    2016-01-01

    Dogs have long shared close relationships with many humans. Due to the large number of dogs in human populations, they are often involved in crimes. Occasionally, canine biological evidence such as saliva, bloodstains and hairs can be found at crime scenes. Accordingly, canine DNA can be used as forensic evidence. The use of short tandem repeat (STR) loci from biological evidence is valuable for forensic investigations. In Korea, canine STR profiling-related crimes are being successfully analyzed, leading to diverse crimes such as animal cruelty, dog-attacks, murder, robbery, and missing and abandoned dogs being solved. However, the probability of random DNA profile matches cannot be analyzed because of a lack of canine STR data. Therefore, in this study, 10 STR loci were analyzed in 600 dogs in Korea (344 dogs belonging to 30 different purebreds and 256 crossbred dogs) to estimate canine forensic genetic parameters. Among purebred dogs, a separate statistical analysis was conducted for five major subgroups, 97 Maltese, 47 Poodles, 31 Shih Tzus, 32 Yorkshire Terriers, and 25 Pomeranians. Allele frequencies, expected (Hexp) and observed heterozygosity (Hobs), fixation index (F), probability of identity (P(ID)), probability of sibling identity (P(ID)sib) and probability of exclusion (PE) were then calculated. The Hexp values ranged from 0.901 (PEZ12) to 0.634 (FHC2079), while the P(ID)sib values were between 0.481 (FHC2079) and 0.304 (PEZ12) and the P(ID)sib was about 3.35 × 10−5 for the combination of all 10 loci. The results presented herein will strengthen the value of canine DNA to solving dog-related crimes. PMID:26645337

  14. Pilot study: Assessing repeatability of the EcoWalk platform resistive pressure sensors to measure plantar pressure during barefoot standing

    Science.gov (United States)

    Zequera, Martha; Perdomo, Oscar; Wilches, Carlos; Vizcaya, Pedro

    2013-06-01

    Plantar pressure provides useful information to assess the feet's condition. These systems have emerged as popular tools in clinical environment. These systems present errors and no compensation information is presented by the manufacturer, leading to uncertainty in the measurements. Ten healthy subjects, 5 females and 5 males, were recruited. Lateral load distribution, antero-posterior load distribution, average pressure, contact area, and force were recorded. The aims of this study were to assess repeatability of the EcoWalk system and identify the range of pressure values observed in the normal foot. The coefficient of repeatability was less than 4% for all parameters considered.

  15. Reduction and technical simplification of testing protocol for walking based on repeatability analyses: An Interreg IVa pilot study

    Directory of Open Access Journals (Sweden)

    Nejc Sarabon

    2010-12-01

    Full Text Available The aim of this study was to define the most appropriate gait measurement protocols to be used in our future studies in the Mobility in Ageing project. A group of young healthy volunteers took part in the study. Each subject carried out a 10-metre walking test at five different speeds (preferred, very slow, very fast, slow, and fast. Each walking speed was repeated three times, making a total of 15 trials which were carried out in a random order. Each trial was simultaneously analysed by three observers using three different technical approaches: a stop watch, photo cells and electronic kinematic dress. In analysing the repeatability of the trials, the results showed that of the five self-selected walking speeds, three of them (preferred, very fast, and very slow had a significantly higher repeatability of the average walking velocity, step length and cadence than the other two speeds. Additionally, the data showed that one of the three technical methods for gait assessment has better metric characteristics than the other two. In conclusion, based on repeatability, technical and organizational simplification, this study helped us to successfully define a simple and reliable walking test to be used in the main study of the project.

  16. Impact of land-use on carbon storage as dependent on soil texture: evidence from a desertified dryland using repeated paired sampling design.

    Science.gov (United States)

    Ye, Xuehua; Tang, Shuangli; Cornwell, William K; Gao, Shuqin; Huang, Zhenying; Dong, Ming; Cornelissen, Johannes H C

    2015-03-01

    Desertification resulting from land-use affects large dryland areas around the world, accompanied by carbon loss. However it has been difficult to interpret different land-use contributions to carbon pools owing to confounding factors related to climate, topography, soil texture and other original soil properties. To avoid such confounding effects, a unique systematic and extensive repeated design of paired sampling plots of different land-use types was adopted on Ordos Plateau, N China. The sampling enabled to quantify the effects of the predominant land-use types on carbon storage as dependent on soil texture, and to define the most promising land-use choices for carbon storage, both in grassland on sandy soil and in desert grassland on brown calcareous soil. The results showed that (1) desertification control should be an effective measure to improve the carbon sequestration in sandy grassland, and shrub planting should be better than grass planting; (2) development of man-made grassland should be a good choice to solve the contradictions of ecology and economy in desert grassland; (3) grassland on sandy soil is more vulnerable to soil degradation than desert grassland on brown calcareous soil. The results may be useful for the selection of land-use types, aiming at desertification prevention in drylands. Follow-up studies should directly investigate the role of soil texture on the carbon storage dynamic caused by land-use change. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Prospective study on determinants of repeat attendance and attendance patterns in breast cancer screening using the Theory of Planned Behaviour.

    NARCIS (Netherlands)

    Drossaert, Constance H.C.; Boer, Hendrik; Seydel, E.R.

    2003-01-01

    This prospective study, using the Theory of Planned Behaviour (TPB) as a theoretical framework, was carried out to identify the determinants of repeat attendance and attendance patterns in organised breast screening. A group of 2657 women filled out a baseline questionnaire, approximately 8 weeks

  18. Assessing the repeatability of terrestrial laser scanning for monitoring gully topography: A case study from Aratula, Queensland, Australia

    Science.gov (United States)

    Goodwin, Nicholas Robert; Armston, John; Stiller, Isaac; Muir, Jasmine

    2016-06-01

    Terrestrial laser scanning (TLS) technology is a powerful tool for quantifying gully morphology and monitoring change over time. This is due to the high sampling density, sub-centimetre positional accuracies (x, y, z), flexibility of survey configurations and ability to link multiple TLS scans together. However, to ensure correct interpretation of results, research is needed to test the repeatability of TLS derived products to quantify the accuracy and separate 'false' from 'true' geomorphic change. In this study, we use the RIEGL VZ400 scanner to test the repeatability of TLS datasets for mapping gully morphology. We then quantify change following a rainfall event of approximately 100 mm. Our study site, located in south-east Queensland, Australia was chosen to be challenging from a repeatability perspective with high topographic variability. The TLS data capture involved three sets of linked scans: one survey pre-rainfall, to be compared to two surveys post-rainfall acquired on consecutive days. Change is considered negligible in the two post-rainfall scans to test survey repeatability. To verify TLS accuracy, an independent dataset of gully extent and spot heights were acquired using traditional total station techniques. Results confirm that the TLS datasets can be registered multi-temporally at sub-centimetre levels of accuracy in three dimensions. Total station and TLS elevation samples showed strong agreement with a mean error and standard deviation (SD) of residuals equal to 0.052 and 0.047 m, respectively (n = 889). Significantly, our repeatability tests found that return type and pulse deviation influence the accuracy and repeatability of DEMs in gully environments. Analysis of consecutive day datasets showed that DEMs derived from first return data recorded 40% higher SD of residual error than DEMs using multiple return data. A significant empirical relationship between pulse deviation and the variance of residuals for repeat DEMs is also shown (r2 = 0

  19. Design Evolution Study - Aging Options

    Energy Technology Data Exchange (ETDEWEB)

    P. McDaniel

    2002-04-05

    The purpose of this study is to identify options and issues for aging commercial spent nuclear fuel received for disposal at the Yucca Mountain Mined Geologic Repository. Some early shipments of commercial spent nuclear fuel to the repository may be received with high-heat-output (younger) fuel assemblies that will need to be managed to meet thermal goals for emplacement. The capability to age as much as 40,000 metric tons of heavy metal of commercial spent nuclear he1 would provide more flexibility in the design to manage this younger fuel and to decouple waste receipt and waste emplacement. The following potential aging location options are evaluated: (1) Surface aging at four locations near the North Portal; (2) Subsurface aging in the permanent emplacement drifts; and (3) Subsurface aging in a new subsurface area. The following aging container options are evaluated: (1) Complete Waste Package; (2) Stainless Steel inner liner of the waste package; (3) Dual Purpose Canisters; (4) Multi-Purpose Canisters; and (5) New disposable canister for uncanistered commercial spent nuclear fuel. Each option is compared to a ''Base Case,'' which is the expected normal waste packaging process without aging. A Value Engineering approach is used to score each option against nine technical criteria and rank the options. Open issues with each of the options and suggested future actions are also presented. Costs for aging containers and aging locations are evaluated separately. Capital costs are developed for direct costs and distributable field costs. To the extent practical, unit costs are presented. Indirect costs, operating costs, and total system life cycle costs will be evaluated outside of this study. Three recommendations for aging commercial spent nuclear fuel--subsurface, surface, and combined surface and subsurface are presented for further review in the overall design re-evaluation effort. Options that were evaluated but not recommended are

  20. [Saarland Growth Study: sampling design].

    Science.gov (United States)

    Danker-Hopfe, H; Zabransky, S

    2000-01-01

    The use of reference data to evaluate the physical development of children and adolescents is part of the daily routine in the paediatric ambulance. The construction of such reference data is based on the collection of extensive reference data. There are different kinds of reference data: cross sectional references, which are based on data collected from a big representative cross-sectional sample of the population, longitudinal references, which are based on follow-up surveys of usually smaller samples of individuals from birth to maturity, and mixed longitudinal references, which are a combination of longitudinal and cross-sectional reference data. The advantages and disadvantages of the different methods of data collection and the resulting reference data are discussed. The Saarland Growth Study was conducted for several reasons: growth processes are subject to secular changes, there are no specific reference data for children and adolescents from this part of the country and the growth charts in use in the paediatric praxis are possibly not appropriate any more. Therefore, the Saarland Growth Study served two purposes a) to create actual regional reference data and b) to create a database for future studies on secular trends in growth processes of children and adolescents from Saarland. The present contribution focusses on general remarks on the sampling design of (cross-sectional) growth surveys and its inferences for the design of the present study.

  1. Progress study on the mechanism of CAG repeats dynamic mutation in polyQ disease

    Directory of Open Access Journals (Sweden)

    WANG Chun-rong

    2012-06-01

    Full Text Available Polyglutamine (polyQ disease is a group of neurodegenerative disorders caused by abnormal expansion of CAG repeats within coding regions of certain causative genes, which are translated into a series of abnormally expanded polyQ tracts causing cytotoxicity. So far, nine diseases caused by expanded polyQ tracts have been demonstrated including Huntington's disease (HD, spinobulbar muscular atrophy (SBMA, dentatorubral-pallidoluysian atrophy (DRPLA and several spinocerebellar ataxias subtypes (SCA. In human, long CAG repeats tend to expand during transmissions from parent to offspring, named as dynamic mutation, leading to an earlier age of disease onset and more severe symptoms in subsequent generations. The review presents some novel mechanisms based on dynamic mutation.

  2. AEROSOL PARTICLE COLLECTOR DESIGN STUDY

    Energy Technology Data Exchange (ETDEWEB)

    Lee, S; Richard Dimenna, R

    2007-09-27

    A computational evaluation of a particle collector design was performed to evaluate the behavior of aerosol particles in a fast flowing gas stream. The objective of the work was to improve the collection efficiency of the device while maintaining a minimum specified air throughput, nominal collector size, and minimal power requirements. The impact of a range of parameters was considered subject to constraints on gas flow rate, overall collector dimensions, and power limitations. Potential improvements were identified, some of which have already been implemented. Other more complex changes were identified and are described here for further consideration. In addition, fruitful areas for further study are proposed.

  3. PCR bias in amplification of androgen receptor alleles, a trinucleotide repeat marker used in clonality studies.

    OpenAIRE

    Mutter, G L; Boynton, K A

    1995-01-01

    Trinucleotide CAG repeats in the X-linked human androgen receptor gene (HUMARA) have proved a useful means of determining X chromosome haplotypes, and when combined with methylation analysis of nearby cytosine residues permits identification of non-random X inactivation in tumors of women. Co-amplification of two alleles in a heterozygote generates PCR products which differ in the number of CAG units, and thus their melting and secondary structure characteristics. We have shown that under opt...

  4. A genetic and structural study of genome rearrangements mediated by high copy repeat Ty1 elements.

    Directory of Open Access Journals (Sweden)

    Jason E Chan

    2011-05-01

    Full Text Available Ty elements are high copy number, dispersed repeated sequences in the Saccharomyces cerevisiae genome known to mediate gross chromosomal rearrangements (GCRs. Here we found that introduction of Ty912, a previously identified Ty1 element, onto the non-essential terminal region of the left arm of chromosome V led to a 380-fold increase in the rate of accumulating GCRs in a wild-type strain. A survey of 48 different mutations identified those that either increased or decreased the rate of Ty-mediated GCRs and demonstrated that suppression of Ty-mediated GCRs differs from that of both low copy repeat sequence- and single copy sequence-mediated GCRs. The majority of the Ty912-mediated GCRs observed were monocentric nonreciprocal translocations mediated by RAD52-dependent homologous recombination (HR between Ty912 and a Ty element on another chromosome arm. The remaining Ty912-mediated GCRs appeared to involve Ty912-mediated formation of unstable dicentric translocation chromosomes that were resolved by one or more Ty-mediated breakage-fusion-bridge cycles. Overall, the results demonstrate that the Ty912-mediated GCR assay is an excellent model for understanding mechanisms and pathways that suppress genome rearrangements mediated by high copy number repeat sequences, as well as the mechanisms by which such rearrangements occur.

  5. Study of the repeatability of histone genes in the ploidy series of wheat and Aegilops

    Energy Technology Data Exchange (ETDEWEB)

    Vakhitov, V.A.; Kulikov, A.M.

    1986-10-01

    The hDNA content and number of histone genes in the genomes of different wheat and Aegilops species have been determined by molecular hybridization of DNA with /sup 125/I-histone DNA of Drosophila (L-repeat) on nitrocellulose filters. It has been demonstrated that the proportion of hDNA in the total DNA of diploid and polyploid wheat species is (1.3-7.7) x 10/sup -3/% (57-850 genes), and in the ploidy series of Aegilops species (2.0-8.0) x 10/sup -3/% (89-780 genes). The repeatability of the histone genes generally increases at each ploidy level in the species with higher DNA content. At the same time, it has been demonstrated that the DNA content is not the only factor determining repeatability of the histone genes, as some diploid and allopolyploid species have similar number of these genes. It has been concluded that genetic mechanisms are involved in the regulation of the number of histone genes.

  6. Repeatability study of mechanomyography in submaximal isometric contractions using coefficient of variation and intraclass correlation coefficient.

    Science.gov (United States)

    Akataki, K; Mita, K; Itoh, Y

    1999-01-01

    The within-day and between-day repeatability of the mechanomyogram (MMG) was assessed using the coefficient of variation (CV) and the intraclass correlation coefficient (ICC) and was compared with that of the electromyogram (EMG). The MMG and EMG were recorded simultaneously during isometric elbow flexion trials at different submaximal levels of 10% to 90% MVC. The testing session consisting of 9 submaximal trials was repeated 8 times on the same day for estimation of the within-day variation. In order to examine the between-day variation, the same testing session was also performed 8 times over 3 weeks with a 2-day rest interval between each session. The CVs within-day and between-day in both the MMG and EMG did not demonstrate any significant differences relating to the magnitude of force exerted. The CVs combined over all the force levels were approximately 10% within the same day and 25% between days for both the MMG and EMG. These corresponded to the within-day ICC of approximately 0.95 and the between-day ICC of 0.80. The repeatability of the MMG during submaximal isometric contractions of biceps brachii muscles is considered to be similar to that of the more established EMG.

  7. Design and Co-design of Project-organized Studies

    DEFF Research Database (Denmark)

    Nielsen, Jørgen Lerche; Andreasen, Lars Birch

    2014-01-01

    The chapter contributes to discussions on design processes in relation to education, presenting different notions of design research and demonstrating how professors and students are involved together in designing innovative and constructive study processes that can help foster students' engageme......, self-awareness, mutual evaluation, reflection, and critical and creative thinking.......The chapter contributes to discussions on design processes in relation to education, presenting different notions of design research and demonstrating how professors and students are involved together in designing innovative and constructive study processes that can help foster students' engagement...

  8. A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene.

    Science.gov (United States)

    Leonova, J; Hanson, C

    1999-01-01

    This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.

  9. Recursive quantum repeater networks

    CERN Document Server

    Van Meter, Rodney; Horsman, Clare

    2011-01-01

    Internet-scale quantum repeater networks will be heterogeneous in physical technology, repeater functionality, and management. The classical control necessary to use the network will therefore face similar issues as Internet data transmission. Many scalability and management problems that arose during the development of the Internet might have been solved in a more uniform fashion, improving flexibility and reducing redundant engineering effort. Quantum repeater network development is currently at the stage where we risk similar duplication when separate systems are combined. We propose a unifying framework that can be used with all existing repeater designs. We introduce the notion of a Quantum Recursive Network Architecture, developed from the emerging classical concept of 'recursive networks', extending recursive mechanisms from a focus on data forwarding to a more general distributed computing request framework. Recursion abstracts independent transit networks as single relay nodes, unifies software layer...

  10. Deployment Repeatability

    Science.gov (United States)

    2016-04-01

    controlled to great precision, but in a Cubesat , there may be no attitude determination at all. Such a Cubesat might treat sun angle and tumbling rates as...could be sensitive to small differences in motor controller timing. In these cases, the analyst might choose to model the entire deployment path, with...knowledge of the material damage model or motor controller timing precision. On the other hand, if many repeated and environmentally representative

  11. Variability in prefrontal hemodynamic response during exposure to repeated self-selected music excerpts, a near-infrared spectroscopy study.

    Science.gov (United States)

    Moghimi, Saba; Schudlo, Larissa; Chau, Tom; Guerguerian, Anne-Marie

    2015-01-01

    Music-induced brain activity modulations in areas involved in emotion regulation may be useful in achieving therapeutic outcomes. Clinical applications of music may involve prolonged or repeated exposures to music. However, the variability of the observed brain activity patterns in repeated exposures to music is not well understood. We hypothesized that multiple exposures to the same music would elicit more consistent activity patterns than exposure to different music. In this study, the temporal and spatial variability of cerebral prefrontal hemodynamic response was investigated across multiple exposures to self-selected musical excerpts in 10 healthy adults. The hemodynamic changes were measured using prefrontal cortex near infrared spectroscopy and represented by instantaneous phase values. Based on spatial and temporal characteristics of these observed hemodynamic changes, we defined a consistency index to represent variability across these domains. The consistency index across repeated exposures to the same piece of music was compared to the consistency index corresponding to prefrontal activity from randomly matched non-identical musical excerpts. Consistency indexes were significantly different for identical versus non-identical musical excerpts when comparing a subset of repetitions. When all four exposures were compared, no significant difference was observed between the consistency indexes of randomly matched non-identical musical excerpts and the consistency index corresponding to repetitions of the same musical excerpts. This observation suggests the existence of only partial consistency between repeated exposures to the same musical excerpt, which may stem from the role of the prefrontal cortex in regulating other cognitive and emotional processes.

  12. Repeated hands-and-knees positioning during labour: a randomized pilot study.

    Science.gov (United States)

    Hodnett, Ellen D; Stremler, Robyn; Halpern, Stephen H; Weston, Julie; Windrim, Rory

    2013-01-01

    Background. Caesarean birth rates in North America continue to rise, in the absence of benefit for mothers and babies. One reason may be that hospitalized labouring women spend most of their labours in recumbent or semi-recumbent positions. Although hands-and-knees position has theoretical advantages, efforts to encourage its adoption in practice are severely hampered by the lack of compelling evidence that it is beneficial. Before a definitive, large scale trial, with spontaneous vaginal birth as the primary outcome, could be justified in terms of time, effort, and expense, several feasibility and acceptability questions had to be addressed. We aimed to enrol 60 women in a pilot study to assess feasibility and acceptability of the trial protocol, and to obtain estimates of treatment effects on method of birth and persistent back pain. Methods. We conducted a pilot study at two North American hospitals. In ten months of recruitment, 30 nulliparous women in labour at term were randomly allocated to either usual care (use of any position during labour except hands-and-knees) or to try hands-and-knees for 15 min every hour during labour. Data were collected about compliance, acceptability, persistent back pain, intrapartum interventions, and women's views of their experiences. Results. Although mean length of time from randomization to delivery was over 12 hours, only 9 of the 16 women allocated to repeated hands-and-knees used it more than twice. Two of the 14 in the usual care group used hands-and-knees once. Twenty-seven women had regional analgesia (15 in the hands-and-knees group and 12 in the usual care group). Eleven in the hands-and-knees group and 14 in the usual care group had spontaneous vaginal births. One woman (in the hands-and-knees group) had a vacuum extraction. Four women in the hands-and-knees group and none in the usual care group gave birth by caesarean section. Hourly back pain ratings were highly variable in both groups, covering the full range

  13. Repeated hands-and-knees positioning during labour: a randomized pilot study

    Directory of Open Access Journals (Sweden)

    Ellen D. Hodnett

    2013-02-01

    Full Text Available Background. Caesarean birth rates in North America continue to rise, in the absence of benefit for mothers and babies. One reason may be that hospitalized labouring women spend most of their labours in recumbent or semi-recumbent positions. Although hands-and-knees position has theoretical advantages, efforts to encourage its adoption in practice are severely hampered by the lack of compelling evidence that it is beneficial. Before a definitive, large scale trial, with spontaneous vaginal birth as the primary outcome, could be justified in terms of time, effort, and expense, several feasibility and acceptability questions had to be addressed. We aimed to enrol 60 women in a pilot study to assess feasibility and acceptability of the trial protocol, and to obtain estimates of treatment effects on method of birth and persistent back pain.Methods. We conducted a pilot study at two North American hospitals. In ten months of recruitment, 30 nulliparous women in labour at term were randomly allocated to either usual care (use of any position during labour except hands-and-knees or to try hands-and-knees for 15 min every hour during labour. Data were collected about compliance, acceptability, persistent back pain, intrapartum interventions, and women’s views of their experiences.Results. Although mean length of time from randomization to delivery was over 12 hours, only 9 of the 16 women allocated to repeated hands-and-knees used it more than twice. Two of the 14 in the usual care group used hands-and-knees once. Twenty-seven women had regional analgesia (15 in the hands-and-knees group and 12 in the usual care group. Eleven in the hands-and-knees group and 14 in the usual care group had spontaneous vaginal births. One woman (in the hands-and-knees group had a vacuum extraction. Four women in the hands-and-knees group and none in the usual care group gave birth by caesarean section. Hourly back pain ratings were highly variable in both groups

  14. HTS Insert Magnet Design Study

    CERN Document Server

    Devaux, M; Fleiter, J; Fazilleau, P; Lécrevisse, T; Pes, C; Rey, J-M; Rifflet, J-M; Sorbi, M; Stenvall, A; Tixador, P; Volpini, G

    2011-01-01

    Future accelerator magnets will need to reach higher field in the range of 20 T. This field level is very difficult to reach using only Low Temperature Superconductor materials whereas High Temperature Superconductors (HTS) provide interesting opportunities. High current densities and stress levels are needed to design such magnets. YBCO superconductor indeed carries large current densities under high magnetic field and provides good mechanical properties especially when produced using the IBAD approach. The HFM EUCARD program studies the design and the realization of an HTS insert of 6 T inside a Nb3Sn dipole of 13T at 4.2 K. In the2HTS insert, engineering current densities higher than 250 MA/m under 19 T are required to fulfill the specifications. The stress level is also very severe. YBCO IBAD tapes theoretically meet these challenges from presented measurements. The insert protection is also a critical because HTS materials show low quench propagation velocities and the coupling with the Nb3Sn magnet make...

  15. Corneal epithelial toxicity of antiglaucoma formulations: in vitro study of repeated applications

    Directory of Open Access Journals (Sweden)

    Meloni M

    2012-09-01

    Full Text Available Marisa Meloni,1 Giampiero Cattaneo,2 Barbara De Servi11VitroScreen In Vitro Research Laboratories, 2Thea Farma, Milan, ItalyBackground: By using a biologically relevant and sensitive three-dimensional model of human corneal epithelium and multiple endpoint analysis, assessment of the potential for eye irritation and long-term compatibility of four registered ophthalmological preparations, ie, Timolabak®, Timoptol®, Nyogel®, and Timogel®, was performed. This approach enables classification of the potential for irritation, discriminating between mildly irritant and non-irritant ocular substances.Methods: The exposure protocol included two time periods, ie, 24 hours (acute application and 72 hours (repeated applications twice daily. This approach allows assessment of not only the acute reaction but also possible recovery, as well as mimicking the potential cumulative effects associated with long-term application. Using benzalkonium chloride (BAK 0.01% as a positive control, the following parameters were quantified: cellular viability by MTT test, histological analysis by hematoxylin and eosin staining, passive release of interleukin-1a by enzyme-linked immunosorbent assay, and OCLN gene expression by quantitative real-time polymerase chain reaction.Results: Cell viability was reduced to under the 50% cutoff value after acute exposure (24 hours to BAK 0.01%, and after repeated application (72 hours of Timoptol and Nyogel. Histological analysis after acute exposure showed signs of superficial damage with all formulations, and severe changes after repeated applications of Timoptol, BAK 0.01%, and Nyogel. Timolabak and Timogel did not significantly alter the morphology of the human corneal epithelial cells after the different exposure times. Interleukin-1α release was greater than that for the negative control (>20 pg/mL and the positive control (BAK 0.01%, Nyogel, and Timoptol treatments and not different after treatment with Timolabak and

  16. CAG repeat polymorphisms in the androgen receptor and breast cancer risk in women: a meta-analysis of 17 studies

    Directory of Open Access Journals (Sweden)

    Mao Q

    2015-08-01

    Full Text Available Qixing Mao,1–3,* Mantang Qiu,1–3,* Gaochao Dong,3 Wenjie Xia,1–3 Shuai Zhang,1,3 Youtao Xu,1,3 Jie Wang,3 Yin Rong,1,3 Lin Xu,1,3 Feng Jiang1,3 1Department of Thoracic Surgery, Nanjing Medical University Affiliated Cancer Institute of Jiangsu Province, 2Fourth Clinical College of Nanjing Medical University, 3Jiangsu Key Laboratory of Molecular and Translational Cancer Research, Nanjing, People’s Republic of China *These authors contributed equally to this work Abstract: The association between polymorphic CAG repeats in the androgen receptor gene in women and breast cancer susceptibility has been studied extensively. However, the conclusions regarding this relationship remain conflicting. The purpose of this meta-analysis was to identify whether androgen receptor CAG repeat lengths were related to breast cancer susceptibility. The MEDLINE, PubMed, and EMBASE databases were searched through to December 2014 to identify eligible studies. Data and study quality were rigorously assessed by two investigators according to the Newcastle-Ottawa Quality Assessment Scale. The publication bias was assessed by the Begg’s test. Seventeen eligible studies were included in this meta-analysis. The overall analysis suggested no association between CAG polymorphisms and breast cancer risk (odds ratio [OR] 1.031, 95% confidence interval [CI] 0.855–1.245. However, in the subgroup analysis, we observed that long CAG repeats significantly increased the risk of breast cancer in the Caucasian population (OR 1.447, 95% CI 1.089–1.992. Additionally, the risk was significantly increased in Caucasian women carrying two alleles with CAG repeats ≥22 units compared with those with two shorter alleles (OR 1.315, 95% CI 1.014–1.707. These findings suggest that long CAG repeats increase the risk of breast cancer in Caucasian women. However, larger scale case-control studies are needed to validate our results. Keywords: androgen, CAG repeat polymorphism, women

  17. Design and analysis of post-fusion 6-helix bundle of heptad repeat regions from Newcastle disease virus F protein.

    Science.gov (United States)

    Zhu, Jieqing; Li, Pengyun; Wu, Tinghe; Gao, Feng; Ding, Yi; Zhang, Catherine W-H; Rao, Zihe; Gao, George F; Tien, Po

    2003-05-01

    Fusion of paramyxovirus to the cell involves receptor binding of the HN glycoprotein and a number of conformational changes of F glycoprotein. The F protein is expressed as a homotrimer on the virus surface. In the present model, there are at least three conformations of F protein, i.e. native form, pre-hairpin intermediate and the post-fusion state. In the post-fusion state, the two highly conserved heptad repeat (HR) regions of F protein form a stable 6-helix coiled-coil bundle. However, no crystal structure is known for this state for the Newcastle disease virus, although the crystal structure of the F protein native form has been solved recently. Here we deployed an Escherichia coli in vitro expression system to engineer this 6-helix bundle by fusion of either the two HR regions (HR1, linker and HR2) or linking the 6-helix [3 x (HR1, linker and HR2)] together as a single chain. Subsequently, both of them form a stable 6-helix bundle in vitro judging by gel filtration and chemical cross-linking and the proteins show salient features of an alpha-helix structure. Crystals diffracting X-rays have been obtained from both protein preparations and the structure determination is under way. This method could be used for crystallization of the post-fusion state HR structures of other viruses.

  18. Novel Compressor Blade Design Study

    Science.gov (United States)

    Srinivas, Abhay

    Jet engine efficiency goals are driving compressors to higher pressure ratios and engines to higher bypass ratios, each one driving to smaller cores. This is leading to larger tip gaps relative to the blade height. These larger relative tip clearances would negate some of the cycle improvements, and ways to mitigate this effect must be found. A novel split tip blade geometry has been created which helps improve the efficiency at large clearances while also improving operating range. Two identical blades are leaned in opposite directions starting at 85% span. They are cut at mid chord and the 2 halves then merged together so a split tip is created. The result is similar to the alula feathers on a soaring bird. The concept is that the split tip will energize the tip flow and increase range. For higher relative tip clearance, this will also improve efficiency. The 6th rotor of a highly loaded 10 stage machine was chosen as the baseline for this study. Three dimensional CFD simulations were performed using CD Adapco's Star-CCM+ at 5 clearances for the baseline and split tip geometry. The choking flow and stall margin of the split tip blade was higher than that of the baseline blade for all tip clearances. The pressure ratio of the novel blade was higher than that of the baseline blade near choke, but closer to stall it decreased. The sensitivity of peak efficiency to clearance was improved. At tight clearances of 0.62% of blade height, the maximum efficiency of the new design was less than the baseline blade, but as the tip clearance was increased above 2.5%, the maximum efficiency increased. Structural analysis was also performed to ascertain the feasibility of the design.

  19. Uncontrolled variables in frying studies: differences in repeatability between thermoxidation and frying experiments

    Directory of Open Access Journals (Sweden)

    Dobarganes, Carmen

    2007-09-01

    Full Text Available Palm oil, soybean oil and partially hydrogenated soybean oil were used to define the repeatability of oil degradation under thermoxidation in the absence of food and during the frying of potatoes. Total polar compounds and their constituent polymeric triglycerides, oxidized monomeric triglycerides and diglycerides were analyzed. The oils were thermoxidized under standard conditions in a Rancimat apparatus at 180 °C for 25 hours. Discontinuous frying experiments were carried out in triplicate in three apparently identical domestic fryers. Five batches of potatoes were fried per day in each fryer. Oils were heated at 180 °C in periods of 5 h per day during 5 consecutive days so that the total heating period was 25 h. Repeatability was high in the thermoxidation assays and rather low in the frying experiments. Significant differences between the oils were found in the thermoxidation experiments, while no significant differences were found in the frying assays due to large standard deviations. The participation of variables related to the fryer performance which are difficult to control, was deduced. Among them, differences in the heating/cooling cycles at high temperature might be important. The contribution of fryer performance to the decreased repeatability was confirmed in further frying experiments with palm oil. Results showed that repeatability for the same fryer was higher than that obtained when different fryers were considered.Se estudia la repetibilidad de los resultados obtenidos en el calentamiento de los aceites y grasas a temperatura elevada utilizando aceite de palma, aceite de soja y aceite de soja parcialmente hidrogenado. Partiendo de la repetibilidad de las determinaciones analíticas utilizadas para la evaluación de la degradación de los aceites y grasas a elevada temperatura, el análisis de compuestos polares y de su distribución en polímeros de triglicéridos, triglicéridos monómeros oxidados y diglicéridos, se

  20. Southampton mealtime assistance study: design and methods

    Directory of Open Access Journals (Sweden)

    Roberts Helen C

    2013-01-01

    Full Text Available Abstract Background Malnutrition is common in older people in hospital and is associated with adverse clinical outcomes including increased mortality, morbidity and length of stay. This has raised concerns about the nutrition and diet of hospital in-patients. A number of factors may contribute to low dietary intakes in hospital, including acute illness and cognitive impairment among in-patients. The extent to which other factors influence intake such as a lack of help at mealtimes, for patients who require assistance with eating, is uncertain. This study aims to evaluate the effectiveness of using trained volunteer mealtime assistants to help patients on an acute medical ward for older people at mealtimes. Methods/design The study design is quasi-experimental with a before (year one and after (year two comparison of patients on the intervention ward and parallel comparison with patients on a control ward in the same department. The intervention in the second year was the provision of trained volunteer mealtime assistance to patients in the intervention ward. There were three components of data collection that were repeated in both years on both wards. The first (primary outcome was patients’ dietary intake, collected as individual patient records and as ward-level balance data over 24 hour periods. The second was clinical outcome data assessed on admission and discharge from both wards, and 6 and 12 months after discharge. Finally qualitative data on the views and experience of patients, carers, staff and volunteers was collected through interviews and focus groups in both years to allow a mixed-method evaluation of the intervention. Discussion The study will describe the effect of provision of trained volunteer mealtime assistants on the dietary intake of older medical in-patients. The association between dietary intake and clinical outcomes including malnutrition risk, body composition, grip strength, length of hospital stay and mortality

  1. ACSA: Conference book: Design Studies

    NARCIS (Netherlands)

    Van Duin, L.

    1992-01-01

    In recent years, the Faculty of Architecture, Housing, Urban Design and Planning has been undergoing large changes in the training and research program mes. These changes followon from the signals received from professional practice, but above all from the desire of staff and students to design prog

  2. Use of short tandem repeat sequences to study Mycobacterium leprae in leprosy patients in Malawi and India.

    Directory of Open Access Journals (Sweden)

    Saroj K Young

    2008-04-01

    Full Text Available Inadequate understanding of the transmission of Mycobacterium leprae makes it difficult to predict the impact of leprosy control interventions. Genotypic tests that allow tracking of individual bacterial strains would strengthen epidemiological studies and contribute to our understanding of the disease.Genotyping assays based on variation in the copy number of short tandem repeat sequences were applied to biopsies collected in population-based epidemiological studies of leprosy in northern Malawi, and from members of multi-case households in Hyderabad, India. In the Malawi series, considerable genotypic variability was observed between patients, and also within patients, when isolates were collected at different times or from different tissues. Less within-patient variability was observed when isolates were collected from similar tissues at the same time. Less genotypic variability was noted amongst the closely related Indian patients than in the Malawi series.Lineages of M. leprae undergo changes in their pattern of short tandem repeat sequences over time. Genetic divergence is particularly likely between bacilli inhabiting different (e.g., skin and nerve tissues. Such variability makes short tandem repeat sequences unsuitable as a general tool for population-based strain typing of M. leprae, or for distinguishing relapse from reinfection. Careful use of these markers may provide insights into the development of disease within individuals and for tracking of short transmission chains.

  3. Does Repeated Ticking Maintain Tic Behavior? An Experimental Study of Eye Blinking in Healthy Individuals

    Directory of Open Access Journals (Sweden)

    Daniel J. V. Beetsma

    2013-01-01

    Full Text Available Tics in Tourette Syndrome (TS are often preceded by 'premonitory urges': annoying feelings or bodily sensations. We hypothesized that, by reducing annoyance of premonitory urges, tic behaviour may be reinforced. In a 2X2 experimental design in healthy participants, we studied the effects of premonitory urges (operationalized as air puffs on the eye and tic behaviour (deliberate eye blinking after a puff or a sound on changes in subjective evaluation of air puffs, and EMG responses on the m. orbicularis oculi. The experimental group with air puffs+ blinking experienced a decrease in subjective annoyance of the air puff, but habituation of the EMG response was blocked and length of EMG response increased. In the control groups (air puffs without instruction to blink, no air puffs, these effects were absent. When extrapolating to the situation in TS patients, these findings suggest that performance of tics is reinforced by reducing the subjective annoyance of premonitory urges, while simultaneously preventing habituation or even inducing sensitisation of the physiological motor response.

  4. Spa Goers' Repeated Visits for Health and Wellness and the Influential Factors: An Exploratory Study of the UK Spa Goers.

    Science.gov (United States)

    Choi, Myungsuk; Poade, Donna; Sohn, Minsung; Choi, Mankyu

    2016-01-01

    Dissemination of spa services across the globe and its market saturation drive demand for differentiated communication methods. This study aims to explore the influential factors on spa goers' repeated visits and their practical applications in the health and wellness spa industry. The identified factors were used as the measurement variables to examine the relation with spa goers' repeated visits. The proposed concept was tested by a mixed method combining a self-administered questionnaire and semistructured interview with 54 survey participants and 6 interviewees. It was meaningful to use a sample of the UK spa goers from the southwest region since global spa trends stem from the EU spas, and the United Kingdom is one of the market leaders. The data were analyzed using frequency, percentage, multiple logistic regression analysis, and coding process. The survey findings demonstrated that the most significant influential factor on the repeated spa visits is a memorable experience of which showed 13.7 times higher probability than the reference up-to-date facility. The details of memorable experiences were discovered throughout the interviews that include the rediscovery of self, feeling of connectedness, recharge for positive emotions, self-reward through escapism, and experience of noncommercialized local products and attractions. Therefore, using experiential marketing methods can be effective spa service marketing.

  5. The prodromal phase of leucine-rich repeat kinase 2-associated Parkinson disease: Clinical and imaging Studies.

    Science.gov (United States)

    Pont-Sunyer, Claustre; Tolosa, Eduardo; Caspell-Garcia, Chelsea; Coffey, Christopher; Alcalay, Roy N; Chan, Piu; Duda, John E; Facheris, Maurizio; Fernández-Santiago, Rubén; Marek, Kenneth; Lomeña, Francisco; Marras, Connie; Mondragon, Elisabet; Saunders-Pullman, Rachel; Waro, Bjorg

    2017-05-01

    Asymptomatic, nonmanifesting carriers of leucine-rich repeat kinase 2 mutations are at increased risk of developing PD. Clinical and neuroimaging features may be associated with gene carriage and/or may demarcate individuals at greater risk for phenoconversion to PD. To investigate clinical and dopamine transporter single-photon emission computed tomography imaging characteristics of leucine-rich repeat kinase 2 asymptomatic carriers. A total of 342 carriers' and 259 noncarriers' relatives of G2019S leucine-rich repeat kinase 2/PD patients and 39 carriers' and 31 noncarriers' relatives of R1441G leucine-rich repeat kinase 2/PD patients were evaluated. Motor and nonmotor symptoms were assessed using specific scales and questionnaires. Neuroimaging quantitative data were obtained in 81 carriers and compared with 41 noncarriers. G2019S carriers scored higher in motor scores and had lower radioligand uptake compared to noncarriers, but no differences in nonmotor symptoms scores were observed. R1441G carriers scored higher in motor scores, had lower radioligand uptake, and had higher scores in depression, dysautonomia, and Rapid Eye Movements Sleep Behavior Disorder Screening Questionnaire scores, but had better cognition scores than noncarriers. Among G2019S carriers, a group with "mild motor signs" was identified, and was significantly older, with worse olfaction and lower radioligand uptake. G2019S and R1441G carriers differ from their noncarriers' relatives in higher motor scores and slightly lower radioligand uptake. Nonmotor symptoms were mild, and different nonmotor profiles were observed in G2019S carriers compared to R1441G carriers. A group of G2019S carriers with known prodromal features was identified. Longitudinal studies are required to determine whether such individuals are at short-term risk of developing overt parkinsonism. © 2017 International Parkinson and Movement Disorder Society. © 2017 International Parkinson and Movement Disorder Society.

  6. Variability in prefrontal hemodynamic response during exposure to repeated self-selected music excerpts, a near-infrared spectroscopy study.

    Directory of Open Access Journals (Sweden)

    Saba Moghimi

    Full Text Available Music-induced brain activity modulations in areas involved in emotion regulation may be useful in achieving therapeutic outcomes. Clinical applications of music may involve prolonged or repeated exposures to music. However, the variability of the observed brain activity patterns in repeated exposures to music is not well understood. We hypothesized that multiple exposures to the same music would elicit more consistent activity patterns than exposure to different music. In this study, the temporal and spatial variability of cerebral prefrontal hemodynamic response was investigated across multiple exposures to self-selected musical excerpts in 10 healthy adults. The hemodynamic changes were measured using prefrontal cortex near infrared spectroscopy and represented by instantaneous phase values. Based on spatial and temporal characteristics of these observed hemodynamic changes, we defined a consistency index to represent variability across these domains. The consistency index across repeated exposures to the same piece of music was compared to the consistency index corresponding to prefrontal activity from randomly matched non-identical musical excerpts. Consistency indexes were significantly different for identical versus non-identical musical excerpts when comparing a subset of repetitions. When all four exposures were compared, no significant difference was observed between the consistency indexes of randomly matched non-identical musical excerpts and the consistency index corresponding to repetitions of the same musical excerpts. This observation suggests the existence of only partial consistency between repeated exposures to the same musical excerpt, which may stem from the role of the prefrontal cortex in regulating other cognitive and emotional processes.

  7. Improvement of LysM-mediated surface display of designed ankyrin repeat proteins (DARPins) in recombinant and nonrecombinant strains of Lactococcus lactis and Lactobacillus Species.

    Science.gov (United States)

    Zadravec, Petra; Štrukelj, Borut; Berlec, Aleš

    2015-03-01

    Safety and probiotic properties make lactic acid bacteria (LAB) attractive hosts for surface display of heterologous proteins. Protein display on nonrecombinant microorganisms is preferred for therapeutic and food applications due to regulatory requirements. We displayed two designed ankyrin repeat proteins (DARPins), each possessing affinity for the Fc region of human IgG, on the surface of Lactococcus lactis by fusing them to the Usp45 secretion signal and to the peptidoglycan-binding C terminus of AcmA, containing lysine motif (LysM) repeats. Growth medium containing a secreted fusion protein was used to test its heterologous binding to 10 strains of species of the genus Lactobacillus, using flow cytometry, whole-cell enzyme-linked immunosorbent assay (ELISA), and fluorescence microscopy. The fusion proteins bound to the surfaces of all lactobacilli; however, binding to the majority of bacteria was only 2- to 5-fold stronger than that of the control. Lactobacillus salivarius ATCC 11741 demonstrated exceptionally strong binding (32- to 55-fold higher than that of the control) and may therefore be an attractive host for nonrecombinant surface display. Genomic comparison of the species indicated the exopolysaccharides of Lb. salivarius as a possible reason for the difference. Additionally, a 15-fold concentration-dependent increase in nonrecombinant surface display on L. lactis was demonstrated by growing bacteria with sublethal concentrations of the antibiotics chloramphenicol and erythromycin. Nonrecombinant surface display on LAB, based on LysM repeats, was optimized by selecting Lactobacillus salivarius ATCC 11741 as the optimal host and by introducing antibiotics as additives for increasing surface display on L. lactis. Additionally, effective display of DARPins on the surfaces of nonrecombinant LAB has opened up several new therapeutic possibilities. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  8. PCR bias in amplification of androgen receptor alleles, a trinucleotide repeat marker used in clonality studies.

    Science.gov (United States)

    Mutter, G L; Boynton, K A

    1995-04-25

    Trinucleotide CAG repeats in the X-linked human androgen receptor gene (HUMARA) have proved a useful means of determining X chromosome haplotypes, and when combined with methylation analysis of nearby cytosine residues permits identification of non-random X inactivation in tumors of women. Co-amplification of two alleles in a heterozygote generates PCR products which differ in the number of CAG units, and thus their melting and secondary structure characteristics. We have shown that under optimal conditions amplification efficiency of two HUMARA alleles is near-equivalent, generating PCR products in a ratio proportional to that of the genomic template. In contrast, reduction of template quantity, damage of template by ultraviolet irradiation or addition of monovalent salts (sodium chloride, sodium acetate or ammonium acetate) produces highly variable imbalances of allelic PCR products, with a strong tendency to preferentially amplify lower molecular weight alleles. Variability and biasing was diminished by substitution of 7-deaza-2'-dGTP for dGTP during amplification, an intervention which reduces stability of intramolecular and intermolecular GC base pairing. We conclude that DNA which is scanty, damaged or salt contaminated may display amplification bias of GC-rich PCR targets, potentially confounding accurate interpretation or reproducibility of assays which require co-amplification of alleles.

  9. Analyzing repeated measures semi-continuous data, with application to an alcohol dependence study.

    Science.gov (United States)

    Liu, Lei; Strawderman, Robert L; Johnson, Bankole A; O'Quigley, John M

    2016-02-01

    Two-part random effects models (Olsen and Schafer,(1) Tooze et al.(2)) have been applied to repeated measures of semi-continuous data, characterized by a mixture of a substantial proportion of zero values and a skewed distribution of positive values. In the original formulation of this model, the natural logarithm of the positive values is assumed to follow a normal distribution with a constant variance parameter. In this article, we review and consider three extensions of this model, allowing the positive values to follow (a) a generalized gamma distribution, (b) a log-skew-normal distribution, and (c) a normal distribution after the Box-Cox transformation. We allow for the possibility of heteroscedasticity. Maximum likelihood estimation is shown to be conveniently implemented in SAS Proc NLMIXED. The performance of the methods is compared through applications to daily drinking records in a secondary data analysis from a randomized controlled trial of topiramate for alcohol dependence treatment. We find that all three models provide a significantly better fit than the log-normal model, and there exists strong evidence for heteroscedasticity. We also compare the three models by the likelihood ratio tests for non-nested hypotheses (Vuong(3)). The results suggest that the generalized gamma distribution provides the best fit, though no statistically significant differences are found in pairwise model comparisons.

  10. NMR studies on domain diffusion and alignment in modular GB1 repeats.

    Science.gov (United States)

    Walsh, Joseph D; Meier, Katlyn; Ishima, Rieko; Gronenborn, Angela M

    2010-10-20

    Modular proteins contain individual domains that are often connected by flexible, unstructured linkers. Using a model system based on the GB1 domain, we constructed tandem repeat proteins and investigated the rotational diffusion and long-range angular ordering behavior of individual domains by measuring NMR relaxation parameters and residual dipolar couplings. Although they display almost identical protein-solvent interfaces, each domain exhibits distinct rotational diffusion and alignment properties. The diffusion tensor anisotropy of the N-terminal domain (NTD) is D(‖)/D(⊥) = 1.5-1.6, similar to that of single-GB1 domains (D(‖)/D(⊥) = 1.6-1.7), whereas the value for the C-terminal domain (CTD) is D(‖)/D(⊥) = 2.0-2.2. In addition, the two domains have different rotational correlation times. These effects are observed for linkers of three to 24 residues, irrespective of linker length. The NTD and CTD also differ in their degree of magnetic alignment, even with a flexible linker of 18 residues, exhibiting D(a) values of 7.7 Hz and 9.7 Hz, respectively. Our results suggest that diffusion differences and long-range influences may persist in modular protein systems, even for systems that have highly flexible linkers and exhibit no domain-domain or domain-linker interactions.

  11. Design of Long Distance Repeater Module Based on LVDS%基于LVDS的远程中继模块设计

    Institute of Scientific and Technical Information of China (English)

    陈昱同; 罗贵隆

    2013-01-01

      针对LVDS数据传输在实际应用时可能出现的信号衰减问题,介绍了一种适用于各种逻辑控制的中继模块,该模块可对衰减后的信号进行有效恢复。讨论了中继模块的组成结构及关键技术,并且给出了中继模块的主要设计参数及降噪方法。%To the signal attenuation problem in practical application of LVDS data transmission ,a repeater module is introduced in this paper ,which is applicable to various kinds of logical control and can recover the signal after attenuating effectively .The components of repeater module and key technology are discussed ,and the main design parameters and noise reduction methods are given .

  12. Design Study: ELENA Bending Magnet Prototype

    CERN Document Server

    Schoerling, D

    2013-01-01

    The ELENA bending magnet prototype shall prove that the proposed design meets the requirements set by the ELENA beam dynamics. The following points will be discussed in detail: (i) production process of a magnetic yoke diluted with stainless steel plates, (ii) the stability and repeatability of the field homogeneity of such a yoke over the full working range, (iii) choice of soft magnetic steel, (iv) hysteresis effects, (v) mechanical deformations, (vi) thermal insulation to intercept heat load from baking for activation of NEG coating in the vacuum chamber, (vii) end shim design. In order to verify these points the following measurements will be performed: (i) Hall probe scanning, (ii) integrated field homogeneity measurement (DC), (iii) integrated field homogeneity measurement (AC).

  13. Dynamic combinatorial libraries of artificial repeat proteins.

    Science.gov (United States)

    Eisenberg, Margarita; Shumacher, Inbal; Cohen-Luria, Rivka; Ashkenasy, Gonen

    2013-06-15

    Repeat proteins are found in almost all cellular systems, where they are involved in diverse molecular recognition processes. Recent studies have suggested that de novo designed repeat proteins may serve as universal binders, and might potentially be used as practical alternative to antibodies. We describe here a novel chemical methodology for producing small libraries of repeat proteins, and screening in parallel the ligand binding of library members. The first stage of this research involved the total synthesis of a consensus-based three-repeat tetratricopeptide (TPR) protein (~14 kDa), via sequential attachment of the respective peptides. Despite the effectiveness of the synthesis and ligation steps, this method was found to be too demanding for the production of proteins containing variable number of repeats. Additionally, the analysis of binding of the individual proteins was time consuming. Therefore, we designed and prepared novel dynamic combinatorial libraries (DCLs), and show that their equilibration can facilitate the formation of TPR proteins containing up to eight repeating units. Interestingly, equilibration of the library building blocks in the presence of the biologically relevant ligands, Hsp90 and Hsp70, induced their oligomerization into forming more of the proteins with large recognition surfaces. We suggest that this work presents a novel simple and rapid tool for the simultaneous screening of protein mixtures with variable binding surfaces, and for identifying new binders for ligands of interest.

  14. Fixed-flexion knee radiography using a new positioning device produced highly repeatable measurements of joint space width: ELSA-Brasil Musculoskeletal Study (ELSA-Brasil MSK).

    Science.gov (United States)

    Telles, Rosa Weiss; Costa-Silva, Luciana; Machado, Luciana A C; Reis, Rodrigo Citton Padilha Dos; Barreto, Sandhi Maria

    To describe the performance of a non-fluoroscopic fixed-flexion PA radiographic protocol with a new positioning device, developed for the assessment of knee osteoarthritis (OA) in Brazilian Longitudinal Study of Adult Health Musculoskeletal Study (ELSA-Brasil MSK). A test-retest design including 19 adults (38 knee images) was conducted. Feasibility of the radiographic protocol was assessed by image quality parameters and presence of radioanatomic alignment according to intermargin distance (IMD) values. Repeatability was assessed for IMD and joint space width (JSW) measured at three different locations. Approximately 90% of knee images presented excellent quality. Frequencies of nearly perfect radioanatomic alignment (IMD ≤1mm) ranged from 29% to 50%, and satisfactory alignment was found in up to 71% and 76% of the images (IMD ≤1.5mm and ≤1.7mm, respectively). Repeatability analyses yielded the following results: IMD [SD of mean difference=1.08; coefficient of variation (%CV)=54.68%; intraclass correlation coefficient (ICC) (95%CI)=0.59 (0.34-0.77)]; JSW [SD of mean difference=0.34-0.61; %CV=4.48%-9.80%; ICC (95%CI)=0.74 (0.55-0.85)-0.94 (0.87-0.97)]. Adequately reproducible measurements of IMD and JSW were found in 68% and 87% of the images, respectively. Despite the difficulty in achieving consistent radioanatomic alignment between subsequent radiographs in terms of IMD, the protocol produced highly repeatable JSW measurements when these were taken at midpoint and 10mm from the medial extremity of the medial tibial plateau. Therefore, measurements of JSW at these locations can be considered adequate for the assessment of knee OA in ELSA-Brasil MSK. Copyright © 2016. Published by Elsevier Editora Ltda.

  15. Pulsed DEMO design assessment studies

    CERN Document Server

    Todd, T N

    2013-01-01

    Now that ITER is under construction, interest is increasing in the specification and design of the successor machine, a Demonstration Power Plant (DEMO), which in Europe is coordinated by the EFDA Power Plant Physics and Technology programme. This paper summarises the work carried out for EFDA in 2011-2012 on design issues pertinent to a pulsed version of DEMO, intended to be implemented with little or no extrapolation of technology available today. The work was carried out by the Euratom Fusion Associations CCFE, CEA, CRPP, ENEA and KIT, and in addition to a review of recent relevant literature addressed systems code analyses (pulse length vs. size), erosion of plasma facing components, thermomechanical fatigue in the blanket and first wall, a range of energy storage issues, and fatigue life improvements in Nb3Sn CICC superconductors.

  16. GSTM1 and APE1 genotypes affect arsenic-induced oxidative stress: a repeated measures study

    Directory of Open Access Journals (Sweden)

    Quamruzzaman Quazi

    2007-12-01

    Full Text Available Abstract Background Chronic arsenic exposure is associated with an increased risk of skin, bladder and lung cancers. Generation of oxidative stress may contribute to arsenic carcinogenesis. Methods To investigate the association between arsenic exposure and oxidative stress, urinary 8-hydroxy-2'-deoxyguanosine (8-OHdG was evaluated in a cohort of 97 women recruited from an arsenic-endemic region of Bangladesh in 2003. Arsenic exposure was measured in urine, toenails, and drinking water. Drinking water and urine samples were collected on three consecutive days. Susceptibility to oxidative stress was evaluated by genotyping relevant polymorphisms in glutathione-s transferase mu (GSTM1, human 8-oxoguanine glycosylase (hOGG1 and apurinic/apyrimidinic endonuclease (APE1 genes using the Taqman method. Data were analyzed using random effects Tobit regression to account for repeated measures and 8-OHdG values below the detection limit. Results A consistent negative effect for APE1 was observed across water, toenail and urinary arsenic models. APE1 148 glu/glu + asp/glu genotype was associated with a decrease in logged 8-OHdG of 0.40 (95%CI -0.73, -0.07 compared to APE1 148 asp/asp. An association between total urinary arsenic and 8-OHdG was observed among women with the GSTM1 null genotype but not in women with GSTM1 positive. Among women with GSTM1 null, a comparison of the second, third, and fourth quartiles of total urinary arsenic to the first quartile resulted in a 0.84 increase (95% CI 0.27, 1.42, a 0.98 increase (95% CI 033, 1.66 and a 0.85 increase (95% CI 0.27, 1.44 in logged 8-OHdG, respectively. No effects between 8-OHdG and toenail arsenic or drinking water arsenic were observed. Conclusion These results suggest the APE1 variant genotype decreases repair of 8-OHdG and that arsenic exposure is associated with oxidative stress in women who lack a functional GSTM1 detoxification enzyme.

  17. [A case-control study of factors associated with repeat teen pregnancy based on a sample from a university maternity hospital].

    Science.gov (United States)

    Silva, Andréa de Albuquerque Arruda; Coutinho, Isabela C; Katz, Leila; Souza, Alex Sandro Rolland

    2013-03-01

    Repeat teen pregnancy is a frequent issue and is considered an aggravating factor for increased maternal and fetal morbidity and social problems. The aim of the study was to identify factors associated with repeat teen pregnancy. A case-control study was conducted in 90 postpartum adolescents with more than one pregnancy (cases) and 90 adult women with a history of only one pregnancy during adolescence (controls). Statistical analysis used hierarchical logistic regression with 5% significance. Early sexual initiation (< 15 years), early age at first pregnancy (< 16 years), not raising the children themselves, and low family income (< one minimum wage) were associated with repeat teenage pregnancy, while partner change was inversely associated. Repeat teen pregnancy was mainly associated with reproductive and socioeconomic factors. Partner change appeared as a protective factor. Measures should be adopted during the postpartum period of teenage mothers in order to avoid repeat pregnancy.

  18. Efficacy of wearing compression garments during post-exercise period after two repeated bouts of strenuous exercise: a randomized crossover design in healthy, active males.

    Science.gov (United States)

    Goto, Kazushige; Mizuno, Sahiro; Mori, Ayaka

    2017-12-01

    The efficacy of wearing [a] compression garment (CG) between repeated bouts of exercise within a same day has not been fully understood. The present study determined the effect of wearing a CG after strenuous exercise sessions (consisting of sprint exercise, resistance exercise, drop jump) twice a day on exercise performance, muscle damage, and inflammatory responses. Eleven physically active males (age, 22.7 ± 0.9 years; height, 175.7 ± 6.7 cm; body mass, 73.6 ± 10.2 kg; BMI, 23.8 ± 2.7 kg/m(2)) performed two trials (a randomized crossover design), consisting of the trial with either wearing a whole-body CG during post-exercise period (CG trial) or the trial with wearing a normal garment without specific pressure (CON trial). Two exercise sessions were conducted in the morning (09:00-10:00, Ex1) and afternoon (14:00-15:00, Ex2). Immediately after completing 60 min of each exercise, the subjects in the CG trial changed into a whole-body CG. Time-course changes in exercise performance (bench press power, jump performances, repeated sprint ability), blood variables (lactate, glucose, myoglobin, creatine kinase, interleukin-6, leptin), and scores of subjective feeling (fatigue, muscle soreness) were compared between the CG and CON trials before Ex1 (8:40), immediately before Ex2 (14:00, 4 h after Ex1), 4 h after Ex2 (19:00), and 24 h after the onset of Ex1 (9:00). Two bouts of exercise significantly decreased performances of counter movement jump (main effect for time: P = 0.04, F = 3.75, partial η (2) = 0.27) and rebound jump (main effect for time: P = 0.00, F = 12.22, partial η (2) = 0.55), while no significant difference was observed between the two trials (interaction: P = 0.10, F = 1.96, partial η (2) = 0.16 for counter movement jump, P = 0.93, F = 0.01, partial η (2) = 0.001 for rebound jump). Repeated sprint ability (power output during 10 × 6 s maximal sprint, 30-s rest

  19. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Yan-Min Ma

    2014-06-01

    Full Text Available This study aimed to investigate the correlations among androgen receptor (AR CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and fifty-three healthy men (aged 22.8 ± 3.1 years were enrolled. The individuals were grouped as CAG short (CAG S if they harbored repeat length of ≤20 or as CAG long (CAG L if their CAG repeat length was >20. Body height/weight, penile length and other parameters were examined and recorded by the specified physicians; CAG repeat polymorphism was determined by the polymerase chain reaction (PCR method; and the serum levels of the sex hormones were detected by radioimmunoassay. Student's t-test or linear regression analysis was used to assess the associations among AR CAG repeat polymorphism, sex hormones and penile length. This investigation showed that the serum total testosterone (T level was positively associated with the AR CAG repeat length (P = 0.01; whereas, no significant correlation of T or AR CAG repeat polymorphism with the penile length was found (P = 0.593. Interestingly, an inverse association was observed between serum prolactin (PRL levels and penile length by linear regression analyses (β= −0.024, P = 0.039, 95% confidence interval (CI: −0.047, 0. Collectively, this study provides the first evidence that serum PRL, but not T or AR CAG repeat polymorphism, is correlated with penile length in the Han adult population from northwestern China.

  20. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China: a cross-sectional study.

    Science.gov (United States)

    Ma, Yan-Min; Wu, Kai-Jie; Ning, Liang; Zeng, Jin; Kou, Bo; Xie, Hong-Jun; Ma, Zhen-Kun; Wang, Xin-Yang; Gong, Yong-Guang; He, Da-Lin

    2014-01-01

    This study aimed to investigate the correlations among androgen receptor (AR) CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and fifty-three healthy men (aged 22.8 ± 3.1 years) were enrolled. The individuals were grouped as CAG short (CAG S ) if they harbored repeat length of ≤ 20 or as CAG long (CAG L ) if their CAG repeat length was >20. Body height/weight, penile length and other parameters were examined and recorded by the specified physicians; CAG repeat polymorphism was determined by the polymerase chain reaction (PCR) method; and the serum levels of the sex hormones were detected by radioimmunoassay. Student's t-test or linear regression analysis was used to assess the associations among AR CAG repeat polymorphism, sex hormones and penile length. This investigation showed that the serum total testosterone (T) level was positively associated with the AR CAG repeat length (P = 0.01); whereas, no significant correlation of T or AR CAG repeat polymorphism with the penile length was found (P = 0.593). Interestingly, an inverse association was observed between serum prolactin (PRL) levels and penile length by linear regression analyses (β= -0.024, P = 0.039, 95% confidence interval (CI): -0.047, 0). Collectively, this study provides the first evidence that serum PRL, but not T or AR CAG repeat polymorphism, is correlated with penile length in the Han adult population from northwestern China.

  1. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China:a cross-sectional study

    Institute of Scientific and Technical Information of China (English)

    YanMin Ma; DaLin He; KaiJie Wu; Liang Ning; Jin Zeng; Bo Kou; HongJun Xie; ZhenKun Ma; XinYang Wang; YongGuang Gong

    2014-01-01

    This study aimed to investigate the correlations among androgen receptor (AR) CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and iffty-three healthy men (aged 22.8 ± 3.1 years) were enrolled. The individuals were grouped as CAG short (CAGS) if they harbored repeat length of≤20 or as CAG long (CAGL) if their CAG repeat length was>20. Body height/weight, penile length and other parameters were examined and recorded by the speciifed physicians;CAG repeat polymorphism was determined by the polymerase chain reaction (PCR) method;and the serum levels of the sex hormones were detected by radioimmunoassay. Student’s t-test or linear regression analysis was used to assess the associations among AR CAG repeat polymorphism, sex hormones and penile length. This investigation showed that the serum total testosterone (T) level was positively associated with the AR CAG repeat length (P= 0.01); whereas, no signiifcant correlation of T or AR CAG repeat polymorphism with the penile length was found (P= 0.593). Interestingly, an inverse association was observed between serum prolactin (PRL) levels and penile length by linear regression analyses (b=-0.024, P= 0.039, 95%conifdence interval (CI):-0.047, 0). Collectively, this study provides the ifrst evidence that serum PRL, but not T or AR CAG repeat polymorphism, is correlated with penile length in the Han adult population from northwestern China.

  2. Design and Phenomenology of the FEBSTAT Study

    Science.gov (United States)

    Hesdorffer, Dale C; Shinnar, Shlomo; Lewis, Darrell V; Moshé, Solomon L; Nordli, Douglas R; Pellock, John M; MacFall, James; Shinnar, Ruth C; Masur, David; Frank, L Matthew; Epstein, Leon G; Litherland, Claire; Seinfeld, Syndi; Bello, Jacqueline A; Chan, Stephen; Bagiella, Emilia; Sun, Shumei

    2012-01-01

    Purpose Febrile status epilepticus (FSE) has been associated with hippocampal injury and subsequent hipppocampal sclerosis (HS) and temporal lobe epilepsy. The FEBSTAT study was designed to prospectively examine the association between prolonged febrile seizures and development of HS and associated temporal lobe epilepsy, one of the most controversial issues in epilepsy. We report on the baseline phenomenology of the final cohorts as well as detailed aims and methodology. Methods The “Consequences of Prolonged Febrile Seizures in Childhood” (FEBSTAT) study is a prospective, multicenter study. Enrolled are children, aged 1 month to 6 years, presenting with a febrile seizure lasting 30 minutes or more based upon ambulance, emergency department, and hospital records, and parental interview. At baseline, procedures included an MRI and EEG done within 72 hours of FSE, and a detailed history and neurological examination. Baseline development and behavior are assessed at one month. The baseline assessment is repeated, with age- appropriate developmental testing at one and five years after enrollment as well as at the development of epilepsy and one year after that. Telephone calls every three months document further seizures. Two other groups of children are included: a ‘control’ group consisting of children with a first febrile seizure ascertained at Columbia University and with almost identical baseline and one year follow-up examinations and a pilot cohort of FSE from Duke University. Key findings The FEBSTAT cohort consists of 199 children with a median age at baseline of 16.0 months (Interquartile range (IQR)=12.0–24.0) and a median duration of FSE of 70.0 minutes (IQR=47.0–110.0). Seizures were continuous in 57.3% and behaviorally intermittent (without recovery in between) in 31.2%; most were partial (4;2.0%) or secondary generalized (65.8%), and almost all (98.0%) culminated in a generalized tonic clonic seizure. Of the 199 children, 86.4% had normal

  3. Does a lack of design and repeatability compromise scientific criticism? A Response to Smith et al. (2009)

    Science.gov (United States)

    Wunder, Michael B.; Hobson, Keith A.; Kelly, Jeff; Marra, Peter P.; Wassenaar, Leonard I; Stricker, Craig A.; Doucett, Richard R.

    2009-01-01

    In a recent paper published in The Auk, Smith et al. (2009) raised serious concerns over an apparent lack of reproducibility in their study of stable hydrogen isotope values (δDf ) in raptor feathers. The authors based their concerns on results obtained from different laboratories to which they submitted original and blind “repeats” over a multiyear period. A regression of the original sample δD versus “repeat” measurements showed an increase in the magnitude of residuals with increasing δDf , especially for values greater than about −80‰ (Smith et al. 2009: fig. 2). Because of this, the authors “caution against the continued use of δDf for predicting geographic origin, and for addressing important conservation questions” (p. 41) and conclude that “it is counterproductive to move forward [with hydrogen isotopes in avian studies] without first establishing full confidence in the technique that underlies such insights and conservation recommendations” (p. 45). We disagree with these sentiments.

  4. The impact of the CAG repeat polymorphism of the androgen receptor gene on muscle and adipose tissues in 20-29-year-old Danish men: Odense Androgen Study

    DEFF Research Database (Denmark)

    Nielsen, Torben Leo; Hagen, Claus; Wraae, Kristian

    2010-01-01

    not correlate with any circulating androgen. Conclusions: The CAG repeat polymorphism affects body composition in young men: absolute musclethigh and absolute musclelower trunk increase as CAGn decreases. Expressed relatively, muscle areas and LBM increase, while SAT and FM decrease as CAGn decreases......Background: The number of CAG repeats (CAGn) within the CAG repeat polymorphism of the androgen receptor gene correlates inversely with the transactivation of the receptor. Objective: To examine the impact of CAGn on muscle, fat distribution, and circulating androgen levels. Design, settings...... and participants: Population-based, cross-sectional study of 783 Danish men aged 20–29 years. Methods: Genotyping was performed in 767 men. Areas of thigh and lower trunk muscle (musclethigh and musclelower trunk), subcutaneous adipose tissues (SATthigh and SATlower trunk), and deep adipose tissues (i...

  5. Selecting the appropriate study design for your research: Descriptive study designs

    OpenAIRE

    Aamir Omair

    2015-01-01

    This article describes the importance of selecting the appropriate epidemiological study design for a given study question. It provides an explanation to the different terms used in describing study designs with regards to observational versus interventional and descriptive versus analytical types of study designs. This article focuses on the description of the different types of descriptive study designs, that is, case report, case series, correlational, and cross-sectional study designs. Th...

  6. Study on Professional Process of Bra Design

    Institute of Scientific and Technical Information of China (English)

    李明菊; 徐朝晖

    2001-01-01

    The process of bra design in the underwear industry is studied. Several important aspects of the process were identified: sizing, fabric selection, pattern development and grading, the use of CAD system, fitting and wear trials. Although the design process relies heavily on the expertise and experience of designers, the modern technology such as CAD can facilitate and optimize the design process, and the fitting process on life models is essential for the underwear design. The differences between domestic underwear companies and foreign major ones mainly lie at the lack of dress form specially used for underwear design, lack of CAD/CAM or not making full use of them, and most of all, lack of the professional bra designers or even skillful pattern designers. The prospects and future model of bra design process were also elaborated in this paper.

  7. Optimization design of independent photovoltaic supply system for CDMA repeaters%CDMA直放站独立光伏供电系统的优化设计

    Institute of Scientific and Technical Information of China (English)

    陈正武; 苏成仁; 胡芳林; 梁盛德

    2011-01-01

    Solar photovoltaic was adopted to provide electricity to repeaters away from urban, which could not only save energy and protect environment, but also avoid the inconvenience to set electric wires from dozens of miles away and reduce the cost. With solar energy as an independent power supply system, the principle problem was to optimize the design of the system: the best installation angle of the solar panel, the appropriate power of the solar panel to fit a certain power appliance, the capacity of the battery according to the system design requirements, choosing the relevant charge-discharge controller, and etc.. In order to avoid configuration waste and guarantee the system work correctly according to the design requirements, a concise algorithm was introduced, which could reach the optimization design.%用太阳能光伏给远离市区的直放站提供电能,不但节约能源、清洁,而且便捷,不需要从数十里远的地方架设电线,有利于保护环境,减少投资.用太阳能光伏作为独立供电系统,首先要解决的是系统的最优设计问题:太阳电池板安装的最佳倾角;对-定功率的用电器配多大功率的太阳电池板;按照系统设计的工作要求如何配套电瓶的容量;选择相应的充电放电控制器等.既要使系统避免配置浪费,又要使系统能按设计要求保证工作.用简捷的运算方法达到了优化设计的结果.

  8. Drosophila melanogaster As a Model Organism to Study RNA Toxicity of Repeat Expansion-Associated Neurodegenerative and Neuromuscular Diseases

    Science.gov (United States)

    Koon, Alex C.; Chan, Ho Yin Edwin

    2017-01-01

    For nearly a century, the fruit fly, Drosophila melanogaster, has proven to be a valuable tool in our understanding of fundamental biological processes, and has empowered our discoveries, particularly in the field of neuroscience. In recent years, Drosophila has emerged as a model organism for human neurodegenerative and neuromuscular disorders. In this review, we highlight a number of recent studies that utilized the Drosophila model to study repeat-expansion associated diseases (READs), such as polyglutamine diseases, fragile X-associated tremor/ataxia syndrome (FXTAS), myotonic dystrophy type 1 (DM1) and type 2 (DM2), and C9ORF72-associated amyotrophic lateral sclerosis/frontotemporal dementia (C9-ALS/FTD). Discoveries regarding the possible mechanisms of RNA toxicity will be focused here. These studies demonstrate Drosophila as an excellent in vivo model system that can reveal novel mechanistic insights into human disorders, providing the foundation for translational research and therapeutic development. PMID:28377694

  9. Tectonomagnetic study in the seismoactive area of Narmada–Son lineament, central India: Preliminary results on repeat field observations

    Indian Academy of Sciences (India)

    S Y Waghmare; S D Pimprikar; P B Gawali; L Carlo; A G Patil

    2009-06-01

    Repeated measurements of the total geomagnetic field on the five profiles have revealed a picture of stress-induced tectonomagnetic effect in the form of secular variation of the total geomagnetic field in the tectonically and seismically active area of Jabalpur and adjoining areas of the Narmada-Son lineament (NSL),central India.For this experiment,a reference base station was established within the study area at Jabalpur.Using proton precession magnetometers with a sensitivity of 0.1 nT, simultaneous measurements of total geomagnetic field were made annually at the base and all field stations.Five cycles of repeated observations have been performed between 2003 and 2007.For data analysis,a difference method has been applied and the residuals have been calculated as secular variations of the total geomagnetic field with values ranging from ± 0.1nT to about > ± 14.6nT/yr over the different stations.The anomalies in secular variation of the total geomagnetic field may be related to anomalous accumulation of tectonic stresses and tensions on the deep fault zones and crustal blocks due to recent geodynamic processes and active geological inhomogeneities in the NSL.

  10. Multi-laboratory validation study of multilocus variable-number tandem repeat analysis (MLVA) for Salmonella enterica serovar Enteritidis, 2015

    Science.gov (United States)

    Peters, Tansy; Bertrand, Sophie; Björkman, Jonas T; Brandal, Lin T; Brown, Derek J; Erdõsi, Tímea; Heck, Max; Ibrahem, Salha; Johansson, Karin; Kornschober, Christian; Kotila, Saara M; Le Hello, Simon; Lienemann, Taru; Mattheus, Wesley; Nielsen, Eva Møller; Ragimbeau, Catherine; Rumore, Jillian; Sabol, Ashley; Torpdahl, Mia; Trees, Eija; Tuohy, Alma; de Pinna, Elizabeth

    2017-01-01

    Multilocus variable-number tandem repeat analysis (MLVA) is a rapid and reproducible typing method that is an important tool for investigation, as well as detection, of national and multinational outbreaks of a range of food-borne pathogens. Salmonella enterica serovar Enteritidis is the most common Salmonella serovar associated with human salmonellosis in the European Union/European Economic Area and North America. Fourteen laboratories from 13 countries in Europe and North America participated in a validation study for MLVA of S. Enteritidis targeting five loci. Following normalisation of fragment sizes using a set of reference strains, a blinded set of 24 strains with known allele sizes was analysed by each participant. The S. Enteritidis 5-loci MLVA protocol was shown to produce internationally comparable results as more than 90% of the participants reported less than 5% discrepant MLVA profiles. All 14 participating laboratories performed well, even those where experience with this typing method was limited. The raw fragment length data were consistent throughout, and the inter-laboratory validation helped to standardise the conversion of raw data to repeat numbers with at least two countries updating their internal procedures. However, differences in assigned MLVA profiles remain between well-established protocols and should be taken into account when exchanging data. PMID:28277220

  11. Effect of repeated sterilization cycles on the physical properties of scaling instruments: a scanning electron microscopy study.

    Science.gov (United States)

    Porto, Alessandra Nogueira; Borges, Álvaro Henrique; Semenoff-Segundo, Alex; Raslan, Suzane A; Pedro, Fábio Luis Miranda; Jorge, Antônio Olavo Cardoso; Bandeca, Matheus Coelho

    2015-05-01

    Repeated sterilizations cycles cause undesirable alterations in the material properties of the instruments, such as corrosion, alterations in the hardness of the metal and the loss of the cutting sharpness of the instrument. This research examined the effect of repeated dry heat sterilization and autoclaves cycles on carbon steel (CS) and stainless steel (SS) curettes during the scaling and root planning. A total of 77 Gracey curettes were used in this study. Of these, 35 were SS and 42 were CS curettes submitted in different process: Dry heat, autoclave, inhibition of corrosion and autoclave, scaling, root planning and dry heat, scaling, root planning, inhibition of corrosion and autoclave. The inhibition of corrosion used on the carbon curettes (prior to sterilization in the autoclave) was sodium nitrite at 2%. The curettes received 10 consecutive cycles of sterilization and after that the cutting edges were examined in the electronic microscope, at 60 and 100 magnification times. The images were evaluated by three independent examiners, who compared the photographs of each group with the control group. The surface corrosion products and a deterioration of the edges were observed and the results showed that the SS curettes suffered little alteration with sterilization, scaling, root planning whereas the CS curettes were visibly affected by sterilization in the autoclave, but when the inhibition of corrosion was used prior to the sterilization, the oxidation was considerably reduced.

  12. Repeated-Doses Toxicity Study of the Essential Oil of Hyptis martiusii Benth. (Lamiaceae in Swiss Mice

    Directory of Open Access Journals (Sweden)

    Germana Freire Rocha Caldas

    2013-01-01

    Full Text Available Hyptis martiusii Benth. (Lamiaceae is found in abundance in Northeastern Brazil where it is used in traditional medicine to treat gastric disorders. Since there are no studies reporting the toxicity and safety profile of this species, we investigated repeated-doses toxicity of the essential oil of Hyptis martiusii (EOHM. Swiss mice of both sexes were orally treated with EOHM (100 and 500 mg/kg for 30 days, and biochemical, hematological, and morphological parameters were determined. No toxicity signs or deaths were recorded during the treatment with EOHM. The body weight gain was not affected, but there was an occasional variation in water and food consumption among mice of both sexes treated with both doses. The hematological and biochemical profiles did not show significant differences except for a decrease in the MCV and an increase in albumin, but these variations are within the limits described for the species. The microscopic analysis showed changes in liver, kidneys, lungs, and spleen; however, these changes do not have clinical relevance since they varied among the groups, including the control group. The results indicate that the treatment of repeated-doses with the essential oil of Hyptis martiusii showed low toxicity in mice.

  13. Effectiveness of repeated photodynamic therapy in the elimination of intracanal Enterococcus faecalis biofilm: an in vitro study.

    Science.gov (United States)

    Prażmo, Ewa Joanna; Godlewska, Renata Alicja; Mielczarek, Agnieszka Beata

    2017-04-01

    The study aimed to investigate the effectiveness of photodynamic therapy in the elimination of intracanal Enterococcus faecalis biofilm and to analyse how a repeated light irradiation, replenishment of oxygen and photosensitiser affect the results of the photodynamic disinfecting protocol. After chemomechanical preparation, 46 single-rooted human teeth were infected with a clinical strain of E. faecalis and incubated for a week in microaerobic conditions. The experimental procedures included groups of single application of photodynamic therapy, two cycles of PDT, irrigation with 5.25% NaOCl solution and negative and positive control. The number of residing bacterial colonies in the root canals was determined based on the CFU/ml method. In the group of preparations irrigated with NaOCl, bacterial colonies were not observed. A single PDT eliminated 45% of the initial CFU/ml. Repeated PDT eradicated 95% of the intracanal bacterial biofilm. Photodynamic therapy has a high potential for the elimination of E. faecalis biofilm. There is a safe therapeutic window where photoinduced disinfection can be used as an adjuvant to conventional endodontic treatment, which remains the most effective.

  14. Broad and narrow personality traits as markers of one-time and repeated suicide attempts: A population-based study

    Directory of Open Access Journals (Sweden)

    Vitaro Frank

    2008-03-01

    Full Text Available Abstract Background Studying personality traits with the potential to differentiate between individuals engaging in suicide attempts of different degrees of severity could help us to understand the processes underlying the link of personality and nonfatal suicidal behaviours and to identify at-risk groups. One approach may be to examine whether narrow, i.e., lower-order personality traits may be more useful than their underlying, broad personality trait dimensions. Methods We investigated qualitative and quantitative differences in broad and narrow personality traits between one-time and repeated suicide attempters in a longitudinal, population-based sample of young French Canadian adults using two multivariate regression models. Results One broad (Compulsivity: OR = 2.0; 95% CI 1.2–3.5 and one narrow personality trait (anxiousness: OR = 1.1; 95% CI 1.01–1.1 differentiated between individuals with histories of repeated and one-time suicide attempts. Affective instability [(OR = 1.1; 95% CI 1.04–1.1] and anxiousness [(OR = .92; 95% CI .88–.95], on the other hand, differentiated between nonattempters and one-time suicide attempters. Conclusion Emotional and cognitive dysregulation and associated behavioural manifestations may be associated with suicide attempts of different severity. While findings associated with narrow traits may be easier to interpret and link to existing sociobiological theories, larger effect sizes associated with broad traits such as Compulsivity may be better suited to objectives with a more clinical focus.

  15. Spiral 2: preliminary design study

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-11-15

    The scientific council of GANIL asked to perform a comparative study on the production methods based on gamma induced fission and rapid-neutron induced fission concerning the nature and the intensity of the neutron-rich products. The production rate expected should be around 10{sup 13} fissions per second. The study should include the implantation and the costs of the concerned accelerators. The scientific committee recommended also to study the possibility to re-inject the radioactive beams of SPIRAL-II in the cyclotrons available at GANIL in order to give access to an energy range from 1.7 to 100 MeV/nucleon. For that purpose, some study groups have been formed to evaluate the possibility of such a project in the different components: physics case, target-ion sources, drivers, post-acceleration and general infrastructure. The organization of the project study is given at the end of this report. The following report presents an overview of the study. Particularly the total costs have been assessed according to 3 options for the driver: 38.0*10{sup 6} euros for a 40 MeV deuteron linac, 18.7*10{sup 6} euros for a 45 MeV electron linac, and 29.1*10{sup 6} euros for a 80 MeV deuteron cyclotron.

  16. Collective design in 3D printing: A large scale empirical study of designs, designers and evolution

    DEFF Research Database (Denmark)

    Özkil, Ali Gürcan

    2017-01-01

    This paper provides an empirical study of a collective design platform (Thingiverse); with the aim of understanding the phenomenon and investigating how designs concurrently evolve through the large and complex network of designers. The case study is based on the meta-data collected from 158 489 ...

  17. Interval Management Display Design Study

    Science.gov (United States)

    Baxley, Brian T.; Beyer, Timothy M.; Cooke, Stuart D.; Grant, Karlus A.

    2014-01-01

    In 2012, the Federal Aviation Administration (FAA) estimated that U.S. commercial air carriers moved 736.7 million passengers over 822.3 billion revenue-passenger miles. The FAA also forecasts, in that same report, an average annual increase in passenger traffic of 2.2 percent per year for the next 20 years, which approximates to one-and-a-half times the number of today's aircraft operations and passengers by the year 2033. If airspace capacity and throughput remain unchanged, then flight delays will increase, particularly at those airports already operating near or at capacity. Therefore it is critical to create new and improved technologies, communications, and procedures to be used by air traffic controllers and pilots. National Aeronautics and Space Administration (NASA), the FAA, and the aviation industry are working together to improve the efficiency of the National Airspace System and the cost to operate in it in several ways, one of which is through the creation of the Next Generation Air Transportation System (NextGen). NextGen is intended to provide airspace users with more precise information about traffic, routing, and weather, as well as improve the control mechanisms within the air traffic system. NASA's Air Traffic Management Technology Demonstration-1 (ATD-1) Project is designed to contribute to the goals of NextGen, and accomplishes this by integrating three NASA technologies to enable fuel-efficient arrival operations into high-density airports. The three NASA technologies and procedures combined in the ATD-1 concept are advanced arrival scheduling, controller decision support tools, and aircraft avionics to enable multiple time deconflicted and fuel efficient arrival streams in high-density terminal airspace.

  18. Prevention of eating disorders among minority youth: a matched-sample repeated measures study.

    Science.gov (United States)

    Cook-Cottone, Catherine; Jones, Lakaii A; Haugli, Sara

    2010-01-01

    The purpose of this study was to examine ethnic differences in primary prevention programs for eating disorders in young girls. In order to address the dearth of research in this area, this study examined the comparative response to an eating disorder prevention program on fifth-grade minority and White females. Pre- and post-test data were collected from 10 groups participating in the prevention program for a total of 50 girls. Minority participants and White participants were then matched based on Body Mass Index (BMI) and socioeconomic status in order to examine ethnic differences in group effectiveness. Findings indicated that minority and White participants were equally responsive to the prevention program.

  19. [The study of interaction between paralogous tandem repeats stellate and suppressor of stellate in the genome of Drosophila melanogaster].

    Science.gov (United States)

    Aravin, A A; Naumova, N M; Tulin, A V; Klenov, M S; Gvozdev, V A

    2000-04-01

    Testis-specific expression of tandemly repeated Stellate genes, located in eu- and heterochromatin regions of the X chromosome of Drosophila melanogaster, is suppressed by homologous Suppressor of Stellate repeats located on the Y chromosome. Using transgenic lines, we have demonstrated that three Su(Ste) copies failed to change the expression of the reporter construction carrying the bacterial beta-galactosidase gene under control of the Stellate gene regulatory sequence. Possible mechanisms of the Su(Ste) repeat suppressor activity are discussed.

  20. Discovery, Characterization, and Functional Study of a Novel MEF2D CAG Repeat in Duck (Anas platyrhynchos).

    Science.gov (United States)

    Wang, Yushi; Wang, Jiwen; Liu, Hehe; Zhang, Rongping; Zhang, Tao; Gan, Xiang; Huang, Huilan; Chen, Da; Li, Liang

    2016-08-01

    Myocyte enhancer transcription factor 2D (MEF2D) is an important transcription factor for promoting the growth and development of muscle. CAG repeats have been found in the coding sequence (CDS) of avian MEF2D; however, their functions remain unknown and require further investigation. Here, we examined the characteristics and functional role of MEF2D CAG repeat in duck. The full-length CDS of duck MEF2D was cloned for the first time, and a novel CAG repeat was identified and located in exon 9. Sequence analysis indicated that the protein domains of duck MEF2D are highly conserved relative to other vertebrates, whereas MEF2D CAG repeats with variable repeat numbers are specific to avian species. Furthermore, sequencing has revealed polymorphisms in MEF2D CAG repeat at both DNA and mRNA levels. Four MEF2D CAG repeat genotypes and 10 MEF2D cDNA variants with different CAG repeat numbers were detected in two duck populations. A t-test showed that the expanded CAG repeat generated significantly longer transcription products (p analysis demonstrated positive correlations between the expansion of the CAG repeat and five muscle-related traits. By using protein structure prediction, we suggested that the polymorphisms of the CAG repeat affect protein structures within protein domains. Taken together, these findings reveal that duck MEF2D CAG repeat is a potential functional element with polymorphisms and may cause differences in MEF2D function between duck and other vertebrate species.

  1. A statistical approach designed for finding mathematically defined repeats in shotgun data and determining the length distribution of clone-inserts

    DEFF Research Database (Denmark)

    Zhong, Lan; Zhang, Kunlin; Huang, Xiangang

    2003-01-01

    The large amount of repeats, especially high copy repeats, in the genomes of higher animals and plants makes whole genome assembly (WGA) quite difficult. In order to solve this problem, we tried to identify repeats and mask them prior to assembly even at the stage of genome survey. It is known...... that repeats of different copy number have different probabilities of appearance in shotgun data, so based on this principle, we constructed a statistical model and inferred criteria for mathematically defined repeats (MDRs) at different shotgun coverages. According to these criteria, we developed software......-inserts using our model. In our simulated genomes of human and rice, the length distribution of repeats is different, so their optimal length distributions of clone-inserts were not the same. Thus with optimal length distribution of clone-inserts, a given genome could be assembled better at lower coverage...

  2. The Effect of Image Quality, Repeated Study, and Assessment Method on Anatomy Learning

    Science.gov (United States)

    Fenesi, Barbara; Mackinnon, Chelsea; Cheng, Lucia; Kim, Joseph A.; Wainman, Bruce C.

    2017-01-01

    The use of two-dimensional (2D) images is consistently used to prepare anatomy students for handling real specimen. This study examined whether the quality of 2D images is a critical component in anatomy learning. The visual clarity and consistency of 2D anatomical images was systematically manipulated to produce low-quality and high-quality…

  3. Repeated open application test with methyldibromo glutaronitrile, a multicentre study within the EECDRG

    DEFF Research Database (Denmark)

    Gruvberger, B; Andersen, Klaus Ejner; Brandão, F M

    2005-01-01

    Contact allergy to and allergic contact dermatitis from methyldibromo glutaronitrile (MDBGN) have frequently been reported. This study was initiated to help determine the optimal patch test preparation for MDBGN. In 51 patients with a doubtful or a positive patch test reaction to at least 1 of 4 ...

  4. Mouth opening in patients irradiated for head and neck cancer : A prospective repeated measures study

    NARCIS (Netherlands)

    Kamstra, J. I.; Dijkstra, P. U.; van Leeuwen, M.; Roodenburg, J. L. N.; Langendijk, J. A.

    2015-01-01

    Objectives: Aims of this prospective cohort study were (1) to analyze the course of mouth opening up to 48 months post-radiotherapy (RT), (2) to assess risk factors predicting decrease in mouth opening, and (3) to develop a multivariable prediction model for change in mouth opening in a large sample

  5. Mouth opening in patients irradiated for head and neck cancer : A prospective repeated measures study

    NARCIS (Netherlands)

    Kamstra, J. I.; Dijkstra, P. U.; van Leeuwen, M.; Roodenburg, J. L. N.; Langendijk, J. A.

    Objectives: Aims of this prospective cohort study were (1) to analyze the course of mouth opening up to 48 months post-radiotherapy (RT), (2) to assess risk factors predicting decrease in mouth opening, and (3) to develop a multivariable prediction model for change in mouth opening in a large sample

  6. International Mycoplasma pneumoniae typing study: interpretation of M. pneumoniae multilocus variable-number tandem-repeat analysis

    Directory of Open Access Journals (Sweden)

    V.J. Chalker

    2015-09-01

    Full Text Available Typing of Mycoplasma pneumoniae by multiple-locus variable-number tandem repeat analysis (MLVA is increasingly in use. However, no specific internationally agreed guidance is available. Thirty M. pneumoniae DNA samples including serial dilutions of a type strain were sent to six international laboratories to perform MLVA and results were compared. Good correlation was observed, indicating that this methodology can be robustly performed in multiple sites. However, differences due to interpretation of fragment size, repeat sequence identification and repeat numbering led to inconsistency in the final profiles assigned by laboratories. We propose guidelines for interpreting M. pneumoniae MLVA typing and assigning the number of repeats.

  7. Power analysis for multivariate and repeated measurements designs via SPSS: correction and extension of D'Amico, Neilands, and Zambarano (2001).

    Science.gov (United States)

    Osborne, Jason W

    2006-05-01

    D'Amico, Neilands, and Zambarano (2001) published SPSS syntax to perform power analyses for three complex procedures: ANCOVA, MANOVA, and repeated measures ANOVA. Unfortunately, the published SPSS syntax for performing the repeated measures analysis needed some minor revision in order to perform the analysis correctly. This article presents the corrected syntax that will successfully perform the repeated measures analysis and provides some guidance on modifying the syntax to customize the analysis.

  8. TLEP design study forges ahead

    CERN Multimedia

    Alain Blondel & Mike Koratzinos

    2013-01-01

    As the Future Circular Collider (FCC) study is launched, one of its component parts, TLEP, enjoys a successful workshop at CERN. The FCC study looks at all options for a future circular collider with the emphasis on a hadron machine with TLEP as a possible intermediate step.   The poster of the sixth TLEP workshop that took place at CERN. Japanese artist Kazuya Akimoto kindly agreed to the use of one of his works as the basis for the poster’s backdrop. October 16 to 18 saw a three-day workshop on TLEP, the sixth in the series. The workshop took place at CERN and was well attended, informative and stimulating. To name just one of the influential people present, Herwig Schopper, ex-Director General of CERN and instrumental in the approval, construction and success of LEP, was among the participants. But what exactly is TLEP? The name was, somehow serendipitously, coined from future lepton collider option studies and stands for triple-LEP, a machine three times the size of LEP. But th...

  9. Repeated exposure of acidic beverages on esthetic restorative materials: an in-vitro surface microhardness study

    OpenAIRE

    Xavier, Arun M.; Sunny, Steffy M.; Rai, Kavita; Amitha M Hegde

    2016-01-01

    Background A manifold increase in the consumption of aerated beverages has witnessed a twin increase in tooth wear and raised demand for esthetic restorative materials. This study aimed to evaluate the surface microhardness changes of esthetic restorative materials following treatment with aerated beverages in an in-vitro situation. Material and Methods The initial surface microhardness of the restorative materials GC Fuji II LC, GC Fuji IX, Nano Glass ionomer, Resin and Nano composite was re...

  10. URINARY CREATINE AT REST AND AFTER REPEATED SPRINTS IN ATHLETES: A PILOT STUDY

    Directory of Open Access Journals (Sweden)

    I. Bezrati-Benayed

    2014-07-01

    Full Text Available Creatine plays a key role in muscle function and its evaluation is important in athletes. In this study, urinary creatine concentration was measured in order to highlight its possible significance in monitoring sprinters. The study included 51 sprinters and 25 age- and sex-matched untrained subjects as a control group. Body composition was measured and dietary intake estimated. Urine samples were collected before and after standardized physical exercise. Creatine was assessed by gas chromatography mass spectrometry. Basal urinary creatine (UC was significantly lower in sprinters than controls (34±30 vs. 74±3 μmol/mmol creatinine, p<0.05. UC was inversely correlated with body mass (r=-0.34, p<0.01 and lean mass (r=- 0.30, p<0.05, and positively correlated with fat mass (r=0.32, p<0.05. After acute exercise, urinary creatine significantly decreased in both athletes and controls. UC is low in sprinters at rest and further decreases after exercise, most likely due to a high uptake and use of creatine by muscles, as muscle mass and physical activity are supposed to be greater in athletes than untrained subjects. Further studies are needed to test the value of urinary creatine as a non-invasive marker of physical condition and as a parameter for managing Cr supplementation in athletes.

  11. Urinary creatine at rest and after repeated sprints in athletes: a pilot study.

    Science.gov (United States)

    Bezrati-Benayed, I; Nasrallah, F; Feki, M; Chamari, K; Omar, S; Alouane-Trabelsi, L; Ben Mansour, A; Kaabachi, N

    2014-03-01

    Creatine plays a key role in muscle function and its evaluation is important in athletes. In this study, urinary creatine concentration was measured in order to highlight its possible significance in monitoring sprinters. The study included 51 sprinters and 25 age- and sex-matched untrained subjects as a control group. Body composition was measured and dietary intake estimated. Urine samples were collected before and after standardized physical exercise. Creatine was assessed by gas chromatography mass spectrometry. Basal urinary creatine (UC) was significantly lower in sprinters than controls (34±30 vs. 74±3 µmol/mmol creatinine, p sprinters at rest and further decreases after exercise, most likely due to a high uptake and use of creatine by muscles, as muscle mass and physical activity are supposed to be greater in athletes than untrained subjects. Further studies are needed to test the value of urinary creatine as a non-invasive marker of physical condition and as a parameter for managing Cr supplementation in athletes.

  12. Principles of study design in environmental epidemiology.

    OpenAIRE

    Morgenstern, H.; Thomas, D

    1993-01-01

    This paper discusses the principles of study design and related methodologic issues in environmental epidemiology. Emphasis is given to studies aimed at evaluating causal hypotheses regarding exposures to suspected health hazards. Following background sections on the quantitative objectives and methods of population-based research, we present the major types of observational designs used in environmental epidemiology: first, the three basic designs involving the individual as the unit of anal...

  13. Mobile Variable Depth Sampling System Design Study

    Energy Technology Data Exchange (ETDEWEB)

    BOGER, R.M.

    2000-08-25

    A design study is presented for a mobile, variable depth sampling system (MVDSS) that will support the treatment and immobilization of Hanford LAW and HLW. The sampler can be deployed in a 4-inch tank riser and has a design that is based on requirements identified in the Level 2 Specification (latest revision). The waste feed sequence for the MVDSS is based on Phase 1, Case 3S6 waste feed sequence. Technical information is also presented that supports the design study.

  14. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China: a cross-sectional study

    OpenAIRE

    Yan-Min Ma; Kai-Jie Wu; Liang Ning; Jin Zeng; Bo Kou; Hong-Jun Xie; Zhen-Kun Ma; Xin-Yang Wang; Yong-Guang Gong; Da-Lin He

    2014-01-01

    This study aimed to investigate the correlations among androgen receptor (AR) CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and fifty-three healthy men (aged 22.8 ± 3.1 years) were enrolled. The individuals were grouped as CAG short (CAG S ) if they harbored repeat length of ≤20 or as CAG long (CAG L ) if their CAG repeat length was >20. Body height/weight, penile length and other parameters were examined and recorded by the specified ...

  15. Directionality switchable gain stabilized linear repeater

    Science.gov (United States)

    Ota, Takayuki; Ohmachi, Tadashi; Aida, Kazuo

    2004-10-01

    We propose a new approach to realize a bidirectional linear repeater suitable for future optical internet networks and fault location in repeater chain with OTDR. The proposed approach is the linear repeater of simple configuration whose directionality is rearranged dynamically by electrical control signal. The repeater is composed of a magneto-optical switch, a circulator, a dynamically gain stabilized unidirectional EDFA, and control circuits. The repeater directionality is rearranged as fast as 0.1ms by an electrical control pulse. It is experimentally confirmed that OTDR with the directionality switchable repeater is feasible for repeater chain. The detailed design and performance of the repeater are also discussed, including the multi-pass interference (MPI) which may arise in the proposed repeater, the effect of the MPI on SNR degradation of the repeater chain and the feed-forward EDFA gain control circuit.

  16. The haemotoxicity of azathioprine in repeat dose studies in the female CD-1 mouse.

    Science.gov (United States)

    Molyneux, Gemma; Gibson, Frances M; Chen, Christabelle M; Marway, Harpal K; McKeag, Sean; Mifsud, Charles V J; Pilling, Andrew M; Whayman, Matthew J; Turton, John A

    2008-04-01

    Azathioprine (AZA) is a cytotoxic immunosuppressive drug used in the prevention of rejection in organ transplants and the treatment of auto-immune diseases. However, AZA is haemotoxic causing significant bone marrow depression. The present studies were to characterize the haemotoxicity of AZA in the female CD-1 mouse. In Experiment 1, a dose-ranging study, with AZA gavaged daily for 10 days, clinical evidence of toxicity was evident at 125 mg/kg and above. Experiment 2 was a dose-response study with AZA gavaged daily for 10 days at 40-120 mg/kg. At day 1 after the final dose, AZA induced a dose-related pancytopaenia, reduced femoral marrow cellularity, increases in serum levels of the cytokine fms-like tyrosine kinase 3 ligand, reduction in granulocyte-monocyte colony-forming units and erythroid colonies, and increased bone marrow apoptosis. Histology demonstrated hepatocyte hypertrophy, thymic atrophy, reduced splenic extramedullary haemopoiesis, and reduced cellularity of sternal bone marrow. In Experiment 3, AZA was dosed for 10 days at 100 mg/kg with autopsies at 1, 3, 9, 22, 29, 43 and 57 days postdosing. At 1, 3 and 9 days, haematological parameters reflected changes in Experiment 2. At 22/29 days, many blood parameters were returning towards normal; at 43/57 days, most parameters compared with controls. However, there was some evidence of a persistent (i.e. residual/late-stage) mild reduction in RBC and erythroid progenitor cell counts at day 43/57. We conclude that the CD-1 mouse provides an acceptable model for the haemotoxicity of AZA in man.

  17. Women's risk of repeat abortions is strongly associated with alcohol consumption: a longitudinal analysis of a Russian national panel study, 1994-2009.

    Directory of Open Access Journals (Sweden)

    Katherine Keenan

    Full Text Available Abortion rates in Russia, particularly repeat abortions, are among the highest in the world, and abortion complications make a substantial contribution to the country's high maternal mortality rate. Russia also has a very high rate of hazardous alcohol use. However, the association between alcohol use and abortion in Russia remains unexplored. We investigated the longitudinal predictors of first and repeat abortion, focussing on women's alcohol use as a risk factor. Follow-up data from 2,623 women of reproductive age (16-44 years was extracted from 14 waves of the Russian Longitudinal Monitoring Survey (RLMS, a nationally representative panel study covering the period 1994-2009. We used discrete time hazard models to estimate the probability of having a first and repeat abortion by social, demographic and health characteristics at the preceding study wave. Having a first abortion was associated with demographic factors such as age and parity, whereas repeat abortions were associated with low education and alcohol use. After adjustment for demographic and socioeconomic factors, the risk of having a repeat abortion increased significantly as women's drinking frequency increased (P<0.001, and binge drinking women were significantly more likely to have a repeat abortion than non-drinkers (OR 2.28, 95% CI 1.62-3.20. This association was not accounted for by contraceptive use or a higher risk of pregnancy. Therefore the determinants of first and repeat abortion in Russia between 1994-2009 were different. Women who had repeat abortions were distinguished by their heavier and more frequent alcohol use. The mechanism for the association is not well understood but could be explained by unmeasured personality factors, such as risk taking, or social non-conformity increasing the risk of unplanned pregnancy. Heavy or frequent drinkers constitute a particularly high risk group for repeat abortion, who could be targeted in prevention efforts.

  18. Magnetic Resonance Spectroscopy in Patients with Insomnia: A Repeated Measurement Study.

    Science.gov (United States)

    Spiegelhalder, Kai; Regen, Wolfram; Nissen, Christoph; Feige, Bernd; Baglioni, Chiara; Riemann, Dieter; Hennig, Jürgen; Lange, Thomas

    2016-01-01

    Chronic insomnia is one of the most prevalent central nervous system disorders. It is characterized by increased arousal levels, however, the neurobiological causes and correlates of hyperarousal in insomnia remain to be further determined. In the current study, magnetic resonance spectroscopy was used in the morning and evening in a well-characterized sample of 20 primary insomnia patients (12 females; 8 males; 42.7 ± 13.4 years) and 20 healthy good sleepers (12 females; 8 males; 44.1 ± 10.6 years). The most important inhibitory and excitatory neurotransmitters of the central nervous system, γ-aminobutyric acid (GABA) and glutamate/glutamine (Glx), were assessed in the anterior cingulate cortex (ACC) and dorsolateral prefrontal cortex (DLPFC). The primary hypothesis, a diurnal effect on GABA levels in patients with insomnia, could not be confirmed. Moreover, the current results did not support previous findings of altered GABA levels in individuals with insomnia. Exploratory analyses, however, suggested that GABA levels in the ACC may be positively associated with habitual sleep duration, and, thus, reduced GABA levels may be a trait marker of objective sleep disturbances. Moreover, there was a significant GROUP x MEASUREMENT TIME interaction effect on Glx in the DLPFC with increasing Glx levels across the day in the patients but not in the control group. Therefore, Glx levels may reflect hyperarousal at bedtime in those with insomnia. Future confirmatory studies should include larger sample sizes to investigate brain metabolites in different subgroups of insomnia.

  19. Multi-Imagery Exploitation Configuration Design Study.

    Science.gov (United States)

    1982-11-01

    A124 88? MULTI-IMAGERY ENPLOITRTION CONFIGURATION DESIGN STUDY 1/2 (U) HARRIS CORP MEL8OURNE FL GOVERNMENT COMMUNICATION SYSTEMS DIV T E TIMOTHY ET...DESIGN STUDY 212 (U) HARRIS CORP MELBOURNE FL GOVERNMENT COMMUNICATION SYSTEMS DIV T E TIMOTHY ET AL. NOV 82 RRDC-TR-82-33 UNCLASSIFIED F31692-Si-C-8095 F

  20. On the design of satisfaction studies

    DEFF Research Database (Denmark)

    Kristensen, Kai; Eskildsen, Jacob Kjær

    2008-01-01

    In the effect sampling method, presentation of researcher, the intro text, the order of questions in the questionnaire along with the number of categories in the rating scale is tested in relation to the design of satisfaction studies. Based on the analyses specific recommendations for designing...... satisfaction studies are given....

  1. Global sensitivity analysis for repeated measures studies with informative drop-out: A semi-parametric approach.

    Science.gov (United States)

    Scharfstein, Daniel; McDermott, Aidan; Díaz, Iván; Carone, Marco; Lunardon, Nicola; Turkoz, Ibrahim

    2017-05-23

    In practice, both testable and untestable assumptions are generally required to draw inference about the mean outcome measured at the final scheduled visit in a repeated measures study with drop-out. Scharfstein et al. (2014) proposed a sensitivity analysis methodology to determine the robustness of conclusions within a class of untestable assumptions. In their approach, the untestable and testable assumptions were guaranteed to be compatible; their testable assumptions were based on a fully parametric model for the distribution of the observable data. While convenient, these parametric assumptions have proven especially restrictive in empirical research. Here, we relax their distributional assumptions and provide a more flexible, semi-parametric approach. We illustrate our proposal in the context of a randomized trial for evaluating a treatment of schizoaffective disorder. © 2017, The International Biometric Society.

  2. Design study for asteroidal exploitation

    Science.gov (United States)

    Adams, Carl; Blissit, Jim; Jarrett, Dave; Sanner, Rob; Yanagawa, Koji

    1985-08-01

    A systematic approach to asteroidal exploitation for the 1990 to 2010 time frame is presented as an initial step toward expanding the use of space beyond the space station by providing a source of lower cost materials. With only a limited amount of information known about the asteroids, reconnaissance and exploration phases to determine the exact locations and compositions of several earth-approaching asteroids are required. Earth-based telescopes are used to locate and study the asteroids, while unmanned probes will return samples of asteroidal material to earth for analysis. After these phases are completed, the retrieval of a 35,000 metric ton piece of the asteroid Anteros is undertaken. A cargo transporter uses magnetoplasmadynamic (MPD) arcjets outbound and a mass-driver using asteroidal material inbound. A crew ship uses ion engines. Low thrust trajectories are used for both spacecraft. A materials processing facility will manufacture propellant pellets and retrieve non-propellant materials for spacecraft use. The cost is 1/10th that to transport the same materials from earth to high earth orbit. The project will cost 25 percent less if done in conjunction with a lunar and Martian base.

  3. Zinc oxide nanoparticles: a 90-day repeated-dose dermal toxicity study in rats

    Directory of Open Access Journals (Sweden)

    Ryu HJ

    2014-12-01

    Full Text Available Hwa Jung Ryu,1,* Mu Yeb Seo,2,* Sung Kyu Jung,1 Eun Ho Maeng,2 Seung-Young Lee,2 Dong-Hyouk Jang,2 Taek-Jin Lee,2 Ki-Yeon Jo,2 Yu-Ri Kim,3 Kyu-Bong Cho,4 Meyoung-Kon Kim,3 Beom Jun Lee,5 Sang Wook Son1 1Department of Dermatology, Korea University College of Medicine, Seoul, 2Korea Testing and Research Institute, Gyunggido, 3Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul, 4Department of Clinical Laboratory Science, Shinheung College, Uijeongbu, 5College of Veterinary Medicine, Chungbuk National University, Cheongju, Republic of Korea *These authors contributed equally to this work and both should be considered first authors Abstract: Zinc oxide (ZnO works as a long-lasting, broad-spectrum physical sunblock, and can prevent skin cancer, sunburn, and photoaging. Nanosized ZnO particles are used often in sunscreens due to consumer preference over larger sizes, which appear opaque when dermally applied. Although the US Food and Drug Administration approved the use of nanoparticles (NPs in sunscreens in 1999, there are ongoing safety concerns. The aim of this study was to evaluate the subchronic toxicity of ZnO NPs after dermal application according to the Organization for Economic Cooperation and Development Test Guidelines 411 using Good Laboratory Practice. Sprague Dawley rats were randomly divided into eight (one control, one vehicle control, three experimental, and three recovery groups. Different concentrations of ZnO NPs were dermally applied to the rats in the experimental groups for 90 days. Clinical observations as well as weight and food consumption were measured and recorded daily. Hematology and biochemistry parameters were determined. Gross pathologic and histopathologic examinations were performed on selected tissues from all animals. Analyses of tissue were undertaken to determine target organ tissue distribution. There was no increased mortality in the experimental group. Although there

  4. The effect of image quality, repeated study, and assessment method on anatomy learning.

    Science.gov (United States)

    Fenesi, Barbara; Mackinnon, Chelsea; Cheng, Lucia; Kim, Joseph A; Wainman, Bruce C

    2017-06-01

    The use of two-dimensional (2D) images is consistently used to prepare anatomy students for handling real specimen. This study examined whether the quality of 2D images is a critical component in anatomy learning. The visual clarity and consistency of 2D anatomical images was systematically manipulated to produce low-quality and high-quality images of the human hand and human eye. On day 0, participants learned about each anatomical specimen from paper booklets using either low-quality or high-quality images, and then completed a comprehension test using either 2D images or three-dimensional (3D) cadaveric specimens. On day 1, participants relearned each booklet, and on day 2 participants completed a final comprehension test using either 2D images or 3D cadaveric specimens. The effect of image quality on learning varied according to anatomical content, with high-quality images having a greater effect on improving learning of hand anatomy than eye anatomy (high-quality vs. low-quality for hand anatomy P = 0.018; high-quality vs. low-quality for eye anatomy P = 0.247). Also, the benefit of high-quality images on hand anatomy learning was restricted to performance on short-answer (SA) questions immediately after learning (high-quality vs. low-quality on SA questions P = 0.018), but did not apply to performance on multiple-choice (MC) questions (high-quality vs. low-quality on MC questions P = 0.109) or after participants had an additional learning opportunity (24 hours later) with anatomy content (high vs. low on SA questions P = 0.643). This study underscores the limited impact of image quality on anatomy learning, and questions whether investment in enhancing image quality of learning aids significantly promotes knowledge development. Anat Sci Educ 10: 249-261. © 2016 American Association of Anatomists. © 2016 American Association of Anatomists.

  5. Statistical design and evaluation of biomarker studies.

    Science.gov (United States)

    Dobbin, Kevin K

    2014-01-01

    We review biostatistical aspects of biomarker studies, including design and analysis issues, covering the range of settings required for translational research-from early exploratory studies through clinical trials.

  6. Reported food intake and distribution of body fat: a repeated cross-sectional study

    Directory of Open Access Journals (Sweden)

    Stenlund Hans

    2006-12-01

    Full Text Available Abstract Background Body mass, as well as distribution of body fat, are predictors of both diabetes and cardiovascular disease. In Northern Sweden, despite a marked increase in average body mass, prevalence of diabetes was stagnant and myocardial infarctions decreased. A more favourable distribution of body fat is a possible contributing factor. This study investigates the relative importance of individual food items for time trends in waist circumference (WC and hip circumference (HC on a population level. Methods Independent cross-sectional surveys conducted in 1986, 1990, 1994 and 1999 in the two northernmost counties of Sweden with a common population of 250000. Randomly selected age stratified samples, altogether 2982 men and 3087 women aged 25–64 years. Questionnaires were completed and anthropometric measurements taken. For each food item, associations between frequency of consumption and waist and hip circumferences were estimated. Partial regression coefficients for every level of reported intake were multiplied with differences in proportion of the population reporting the corresponding levels of intake in 1986 and 1999. The sum of these product terms for every food item was the respective estimated impact on mean circumference. Results Time trends in reported food consumption associated with the more favourable gynoid distribution of adipose tissue were increased use of vegetable oil, pasta and 1.5% fat milk. Trends associated with abdominal obesity were increased consumption of beer in men and higher intake of hamburgers and French fried potatoes in women. Conclusion Food trends as markers of time trends in body fat distribution have been identified. The method is a complement to conventional approaches to establish associations between food intake and disease risk on a population level.

  7. Breath acidification in adolescent runners exposed to atmospheric pollution: A prospective, repeated measures observational study

    Directory of Open Access Journals (Sweden)

    Van Sickle David

    2008-03-01

    Full Text Available Abstract Background Vigorous outdoors exercise during an episode of air pollution might cause airway inflammation. The purpose of this study was to examine the effects of vigorous outdoor exercise during peak smog season on breath pH, a biomarker of airway inflammation, in adolescent athletes. Methods We measured breath pH both pre- and post-exercise on ten days during peak smog season in 16 high school athletes engaged in daily long-distance running in a downwind suburb of Atlanta. The association of post-exercise breath pH with ambient ozone and particulate matter concentrations was tested with linear regression. Results We collected 144 pre-exercise and 146 post-exercise breath samples from 16 runners (mean age 14.9 years, 56% male. Median pre-exercise breath pH was 7.58 (interquartile range: 6.90 to 7.86 and did not change significantly after exercise. We observed no significant association between ambient ozone or particulate matter and post-exercise breath pH. However both pre- and post-exercise breath pH were strikingly low in these athletes when compared to a control sample of 14 relatively sedentary healthy adults and to published values of breath pH in healthy subjects. Conclusion Although we did not observe an acute effect of air pollution exposure during exercise on breath pH, breath pH was surprisingly low in this sample of otherwise healthy long-distance runners. We speculate that repetitive vigorous exercise may induce airway acidification.

  8. Toxicity evaluation of zinc aluminium levodopa nanocomposite via oral route in repeated dose study

    Science.gov (United States)

    Kura, Aminu Umar; Cheah, Pike-See; Hussein, Mohd Zobir; Hassan, Zurina; Tengku Azmi, Tengku Ibrahim; Hussein, Nor Fuzina; Fakurazi, Sharida

    2014-05-01

    Nanotechnology, through nanomedicine, allowed drugs to be manipulated into nanoscale sizes for delivery to the different parts of the body, at the same time, retaining the valuable pharmacological properties of the drugs. However, efficient drug delivery and excellent release potential of these delivery systems may be hindered by possible untoward side effects. In this study, the sub-acute toxicity of oral zinc aluminium nanocomposite with and without levodopa was assessed using the Organization for Economic Co-operation and Development guidelines. No sign or symptom of toxicity was observed in orally treated rats with the nanocomposite at 5 and 500 mg/kg concentrations. Body weight gain, feeding, water intake, general survival and organosomatic index were not significantly different between control and treatment groups. Aspartate aminotransferase (AST) in 500 mg/kg levodopa nanocomposite (169 ± 30 U/L), 5 mg/kg levodopa nanocomposite (172 ± 49 U/L), and 500 mg/kg layered double hydroxides (LDH) nanocomposite (175 ± 25 U/L) were notably elevated compared to controls (143 ± 05 U/L); but the difference were not significant ( p > 0.05). However, the differences in aspartate aminotransferase/alanine aminotransferase (AST/ALT) ratio of 500 mg/kg levodopa nanocomposite (0.32 ± 0.12) and 500 mg/kg LDH nanocomposite (0.34 ± 0.12) were statistically significant ( p brain was found to be of similar morphology in both control and experimental groups. The kidneys of 500-mg/kg-treated rats with levodopa nanocomposite and LDH nanocomposite were found to have slight inflammatory changes, notably leukocyte infiltration around the glomeruli. The ultra-structure of the neurons from the substantia nigra of nanocomposite-exposed group was similar to those receiving only normal saline. The observed result has suggested possible liver and renal toxicity in orally administered levodopa intercalated nanocomposite; it is also dose-dependent that needs further assessment.

  9. Understanding how adherence goals promote adherence behaviours: a repeated measure observational study with HIV seropositive patients

    Directory of Open Access Journals (Sweden)

    Jones Gareth

    2012-08-01

    behaviours over and above the effects of the behaviour-specific thinking and ii the relationship between adherence to exercise and to medical treatment is stronger among those with more favourable views about the goal. Results from this study should identify the key contributing factors to inform subsequent adherence research and afford a more streamlined assessment matrix. The project also aims to inform patient care practices. UK Clinical Research Network registration number UKCRN 7842.

  10. Effects of Cold Water Immersion on Muscle Oxygenation During Repeated Bouts of Fatiguing Exercise: A Randomized Controlled Study.

    Science.gov (United States)

    Yeung, Simon S; Ting, Kin Hung; Hon, Maurice; Fung, Natalie Y; Choi, Manfi M; Cheng, Juno C; Yeung, Ella W

    2016-01-01

    Postexercise cold water immersion has been advocated to athletes as a means of accelerating recovery and improving performance. Given the effects of cold water immersion on blood flow, evaluating in vivo changes in tissue oxygenation during cold water immersion may help further our understanding of this recovery modality. This study aimed to investigate the effects of cold water immersion on muscle oxygenation and performance during repeated bouts of fatiguing exercise in a group of healthy young adults. Twenty healthy subjects performed 2 fatiguing bouts of maximal dynamic knee extension and flexion contractions both concentrically on an isokinetic dynamometer with a 10-min recovery period in between. Subjects were randomly assigned to either a cold water immersion (treatment) or passive recovery (control) group. Changes in muscle oxygenation were monitored continuously using near-infrared spectroscopy. Muscle performance was measured with isokinetic dynamometry during each fatiguing bout. Skin temperature, heart rate, blood pressure, and muscle soreness ratings were also assessed. Repeated measures ANOVA analysis was used to evaluate treatment effects. The treatment group had a significantly lower mean heart rate and lower skin temperature compared to the control group (P Cold water immersion attenuated a reduction in tissue oxygenation in the second fatiguing bout by 4% when compared with control. Muscle soreness was rated lower 1 day post-testing (P cold water immersion had no significant effect on muscle performance in subsequent exercise. As the results show that cold water immersion attenuated decreased tissue oxygenation in subsequent exercise performance, the metabolic response to exercise after cold water immersion is worthy of further exploration.

  11. High-Throughput Mycobacterial Interspersed Repetitive-Unit–Variable-Number Tandem-Repeat Genotyping for Mycobacterium tuberculosis Epidemiological Studies

    Science.gov (United States)

    Bidault, Floriane; Mosnier, Amandine; Bablishvili, Nino; Tukvadze, Nestani; Somphavong, Silaphet; Paboriboune, Phimpha; Ocheretina, Oksana; Pape, Jean William; Paranhos-Baccala, Glaucia; Berland, Jean-Luc

    2014-01-01

    The emergence of drug-resistant forms of tuberculosis (TB) represents a major public health concern. Understanding the transmission routes of the disease is a key factor for its control and for the implementation of efficient interventions. Mycobacterial interspersed repetitive-unit–variable-number tandem-repeat (MIRU-VNTR) marker typing is a well-described method for lineage identification and transmission tracking. However, the conventional manual genotyping technique is cumbersome and time-consuming and entails many risks for errors, thus hindering its implementation and dissemination. We describe here a new approach using the QIAxcel system, an automated high-throughput capillary electrophoresis system that also carries out allele calling. This automated method was assessed on 1,824 amplicons from 82 TB isolates and tested with sets of markers of 15 or 24 loci. Overall allele-calling concordance between the methods from 140 to 1,317 bp was 98.9%. DNA concentrations and repeatability and reproducibility performances showed no biases in allele calling. Furthermore, turnaround time using this automated system was reduced by 81% compared to the conventional manual agarose gel method. In sum, this new automated method facilitates MIRU-VNTR genotyping and provides reliable results. Therefore, it is well suited for field genotyping. The implementation of this method will help to achieve accurate and cost-effective epidemiological studies, especially in countries with a high prevalence of TB, where the high number of strains complicates the surveillance of circulating lineages and requires efficient interventions to be carried out in an urgent manner. PMID:25428144

  12. Fusion reactor blanket/shield design study

    Energy Technology Data Exchange (ETDEWEB)

    Smith, D.L.; Clemmer, R.G.; Harkness, S.D.

    1979-07-01

    A joint study of tokamak reactor first-wall/blanket/shield technology was conducted by Argonne National Laboratory (ANL) and McDonnell Douglas Astronautics Company (MDAC). The objectives of this program were the identification of key technological limitations for various tritium-breeding-blanket design concepts, establishment of a basis for assessment and comparison of the design features of each concept, and development of optimized blanket designs. The approach used involved a review of previously proposed blanket designs, analysis of critical technological problems and design features associated with each of the blanket concepts, and a detailed evaluation of the most tractable design concepts. Tritium-breeding-blanket concepts were evaluated according to the proposed coolant. The ANL effort concentrated on evaluation of lithium- and water-cooled blanket designs while the MDAC effort focused on helium- and molten salt-cooled designs. A joint effort was undertaken to provide a consistent set of materials property data used for analysis of all blanket concepts. Generalized nuclear analysis of the tritium breeding performance, an analysis of tritium breeding requirements, and a first-wall stress analysis were conducted as part of the study. The impact of coolant selection on the mechanical design of a tokamak reactor was evaluated. Reference blanket designs utilizing the four candidate coolants are presented.

  13. Mirror Advanced Reactor Study interim design report

    Energy Technology Data Exchange (ETDEWEB)

    1983-04-01

    The status of the design of a tenth-of-a-kind commercial tandem-mirror fusion reactor is described at the midpoint of a two-year study. When completed, the design is to serve as a strategic goal for the mirror fusion program. The main objectives of the Mirror Advanced Reactor Study (MARS) are: (1) to design an attractive tandem-mirror fusion reactor producing electricity and synfuels (in alternate versions), (2) to identify key development and technology needs, and (3) to exploit the potential of fusion for safety, low activation, and simple disposal of radioactive waste. In the first year we have emphasized physics and engineering of the central cell and physics of the end cell. Design optimization and trade studies are continuing, and we expect additional modifications in the end cells to further improve the performance of the final design.

  14. Cryostat design case studies, principles and engineering

    CERN Document Server

    2016-01-01

    This book enables the reader to learn the fundamental and applied aspects of practical cryostat design by examining previous design choices and resulting cryostat performance. Through a series of extended case studies the book presents an overview of existing cryostat design covering a wide range of cryostat types and applications, including the magnet cryostats that comprise the majority of the Large Hadron Collider at CERN, space-borne cryostats containing sensors operating below 1 K, and large cryogenic liquid storage vessels. It starts with an introductory section on the principles of cryostat design including practical data and equations. This section is followed by a series of case studies on existing cryostats, describing the specific requirements of the cryostat, the challenges involved and the design choices made along with the resulting performance of the cryostat. The cryostat examples used in the studies are chosen to cover a broad range of cryostat applications and the authors of each case are ...

  15. User Assemblages in Design: An Ethnographic Study

    OpenAIRE

    2010-01-01

    This thesis presents an ethnographic study of the role of users in user-centered design. It is written from the perspective of science and technology studies, in particular developments in actor-network theory, and draws on the notion of the assemblage from the work of Deleuze and Guattari. The data for this thesis derives from a six-month field study of the routine discourse and practices of user-centered designers working for a multinational microprocessor manufacturer. The central argument...

  16. Mixed sensitivity design: An aerospace case study

    NARCIS (Netherlands)

    Kwakernaak, Huibert; Camacho, E.F.; Basanez, L.; Puente, de la J.A.

    2002-01-01

    The mixed sensitivity design method for multivariable linear control systems proposed in the companion paper (Kwakernaak, 2001) is applied to the design of a stability augmentation system for the longitudinal motion of a fighter airplane previously studied by Safonov and Chiang (1988). Both $H_\\inft

  17. Huntington CAG repeat size does not modify onset age in familial Parkinson’s disease: The GenePD Study

    Science.gov (United States)

    McNicoll, Christopher F.; Latourelle, Jeanne C.; MacDonald, Marcy E.; Lew, Mark F.; Suchowersky, Oksana; Klein, Christine; Golbe, Lawrence I.; Mark, Margery H.; Growdon, John H.; Wooten, G. Frederick; Watts, Ray L.; Guttman, Mark; Racette, Brad A.; Perlmutter, Joel S.; Ahmed, Anwar; Shill, Holly A.; Singer, Carlos; Saint-Hilaire, Marie H.; Massood, Tiffany; Huskey, Karen W.; DeStefano, Anita L.; Gillis, Tammy; Mysore, Jayalakshmi; Goldwurm, Stefano; Pezzoli, Gianni; Baker, Kenneth B.; Itin, Ilia; Litvan, Irene; Nicholson, Garth; Corbett, Alastair; Nance, Martha; Drasby, Edward; Isaacson, Stuart; Burn, David J.; Chinnery, Patrick F.; Pramstaller, Peter P.; Al-hinti, Jomana; Moller, Anette T.; Ostergaard, Karen; Sherman, Scott J.; Roxburgh, Richard; Snow, Barry; Slevin, John T.; Cambi, Franca; Gusella, James F.; Myers, Richard H.

    2009-01-01

    The ATP/ADP ratio reflects mitochondrial function and has been reported to be influenced by the size of the Huntington disease gene (HD) repeat. Impaired mitochondrial function has long been implicated in the pathogenesis of Parkinson’s disease (PD) and therefore, we evaluated the relationship of the HD CAG repeat size to PD onset age in a large sample of familial PD cases. PD affected siblings (n=495) with known onset ages from 248 families, were genotyped for the HD CAG repeat. Genotyping failed in 11 cases leaving 484 for analysis, including 35 LRRK2 carriers. All cases had HD CAG repeats (range 15 to 34) below the clinical range for HD, although 5.2 percent of the sample (n=25) had repeats in the intermediate range (the intermediate range lower limit=27; upper limit=35 repeats), suggesting that the prevalence of intermediate allele carriers in the general population is significant. No relation between the HD CAG repeat size and the age at onset for PD was found in this sample of familial PD. PMID:18649400

  18. Nuclear-Powered GPS Spacecraft Design Study

    Energy Technology Data Exchange (ETDEWEB)

    Raab, Bernard

    1977-05-01

    This is the final report of a study to investigate the potential benefits of a nuclear (radioisotope) - powered satellite for advanced phases of the Global Positioning System (GPS) program. The critical parameters were: power to user; mean mission duration; orbital predictability; thermal control of on-board frequency standards; and vulnerability. The reference design approach is described, and input data are given for two power systems that are under development: an organic Rankine system and a Brayton cycle system. Reference design details are provided and structural design and analysis are discussed, as well as thermal design and analysis. A higher altitude version is also considered.

  19. Flight Path Recovery System (FPRS) design study

    Energy Technology Data Exchange (ETDEWEB)

    1978-09-01

    The study contained herein presents a design for a Flight Path Recovery System (FPPS) for use in the NURE Program which will be more accurate than systems presently used, provide position location data in digital form suitable for automatic data processing, and provide for flight path recovery in a more economic and operationally suitable manner. The design is based upon the use of presently available hardware and technoloy, and presents little, it any, development risk. In addition, a Flight Test Plan designed to test the FPRS design concept is presented.

  20. Repeat spinal anesthesia in cesarean section: A comparison between 10 mg and 12 mg doses of intrathecal hyperbaric (0.05%) bupivacaine repeated after failed spinal anesthesia: A prospective, parallel group study.

    Science.gov (United States)

    Bhar, Debasish; RoyBasunia, Sandip; Das, Anjan; Chhaule, Subinay; Mondal, Sudipta Kumar; Bisai, Subrata; Chattopadhyay, Surajit; Mandal, Subrata Kumar

    2016-01-01

    Spinal anesthesia for cesarean section is not a 100% successful technique. At times, despite straightforward insertion and drug administration, intrathecal anesthesia for cesarean section fails to obtain any sensory or motor block. Very few studies and literature are available regarding repeat administration of spinal anesthesia and its drug dosage, especially after first spinal failure in cesarean section lower segment cesarean section (LSCS) due to fear of the excessive spread of drug. The aim of our study is to compare the outcome between two different doses of 0.5% hyperbaric bupivacaine repeated intrathecally after failed spinal. After taking informed consent and Ethical Committee approval this prospective, randomized single-blinded study was conducted in 100 parturients of American Society of Anesthesiologists I-II who were posted for elective LSCS and had Bromage score 0 and no sensory block even at L4 dermatome after 10 min of first spinal anesthesia; were included in the study. Group A (n = 50) patients received 2.4 ml and Group B (n = 50) patients received 2 ml of 0.5% hyperbaric bupivacaine respectively for administering repeat spinal anesthesia. Heart rate (HR), systolic blood pressure (SBP), diastolic blood pressure (DBP), oxygen saturation, respiratory rate and electrocardiogram were monitored both intra- and post-operatively and complications were recorded. Incidence of high spinal, bradycardia, hypotension, respiratory complications, and nausea vomiting are significantly higher in Group A compared to Group B (P cesarean section with 10 mg of 0.5% hyperbaric bupivacaine provided after first spinal anesthesia, the level of sensory block is below L4 and motor power in Bromage scale is 0.

  1. Sequential design approaches for bioequivalence studies with crossover designs.

    Science.gov (United States)

    Potvin, Diane; DiLiberti, Charles E; Hauck, Walter W; Parr, Alan F; Schuirmann, Donald J; Smith, Robert A

    2008-01-01

    The planning of bioequivalence (BE) studies, as for any clinical trial, requires a priori specification of an effect size for the determination of power and an assumption about the variance. The specified effect size may be overly optimistic, leading to an underpowered study. The assumed variance can be either too small or too large, leading, respectively, to studies that are underpowered or overly large. There has been much work in the clinical trials field on various types of sequential designs that include sample size reestimation after the trial is started, but these have seen only little use in BE studies. The purpose of this work was to validate at least one such method for crossover design BE studies. Specifically, we considered sample size reestimation for a two-stage trial based on the variance estimated from the first stage. We identified two methods based on Pocock's method for group sequential trials that met our requirement for at most negligible increase in type I error rate.

  2. Research Design in Marital Adjustment Studies.

    Science.gov (United States)

    Croake, James W.; Lyon, Rebecca S.

    1978-01-01

    The numerous marital adjustment studies which exist in the literature are confounded by basic design problems. Marital stability should be the baseline for data. It is then possible to discuss "happiness,""success,""adjustment," and "satisfaction." (Author)

  3. Studying Design Engineers Use Of Information Systems

    DEFF Research Database (Denmark)

    Restrepo-Giraldo, John Dairo

    2006-01-01

    Studying information usage by design engineers involves considering technical, social, cognitive and volitional factors. This makes it challenging, especially for researchers without a cognitive psychology background. This paper presents a summary of key findings in researching information use...

  4. Risk factors for complications in donors at first and repeat whole blood donation: a cohort study with assessment of the impact on donor return.

    Science.gov (United States)

    Wiersum-Osselton, Johanna C; Marijt-van der Kreek, Tanneke; Brand, Anneke; Veldhuizen, Ingrid; van der Bom, Johanna G; de Kort, Wim

    2014-01-01

    First-time donation is among recognised risk factors for vasovagal reactions to blood donation and reactions are known to reduce donor return. We assessed associations between potential risk factors and vasovagal reactions and needle-related complications in first-time whole blood donation in comparison to repeat donation and analysed the impact of complications on donor return. We performed a cohort study on whole blood donations in The Netherlands from 1/1/2010 to 31/12/2010 using data extracted from the blood service information system. Donation data up to 31/12/2011 were used to ascertain donor return. In 2010 28,786 donors made first whole blood donations and there were 522,958 repeat donations. Vasovagal reactions occurred in 3.9% of first donations by males and 3.5% of first donations by females compared to in 0.2% and 0.6%, respectively, of repeat donations. Associations of vasovagal reactions with other factors including age, body weight, systolic and diastolic blood pressure were similar in first-time and repeat donors. Needle-related complications occurred in 0.2% of male and 0.5% of female first-time donations and in 0.1% and 0.3%, respectively, of repeat donations. Among first-time donors, the return rate within 1 year was 82% following an uncomplicated first donation, but 55% and 61% following vasovagal reactions and needle-related complications, respectively; the corresponding percentages among repeat donors were 86%, 58% and 82%. Among first-time donors, females suffered less than males from vasovagal reactions. Other risk factors had similar associations among first-time and repeat donors. Vasovagal reactions and needle-related complications in both first-time and repeat donors are followed by reduced donor return.

  5. Application of transrectal ultrasound-guided repeat needle biopsy in the diagnosis of prostate cancer in Chinese population: A retrospective study

    Directory of Open Access Journals (Sweden)

    Yi Wang

    2016-01-01

    Full Text Available Background: Transrectal ultrasound-guided repeat needle biopsy (TUGRNB is widely used for diagnosis of prostate cancer (PCa. However, significance of TUGRNB in Chinese population was rarely reported. A retrospective study was conducted to evaluate the significance of TUGRNB applied in prediction of PCa in Chinese population. Materials and Methods: A total of 960 from January 2009 to December 2012 were included. Repeat needle biopsy rate and PCa positive detection rate were evaluated. Relationship between prostate specific antigen (PSA levels and PCa positive rates was analyzed. Results: PCa positive detection rate after initial needle biopsy was 28.4%, which was lower than the rate of repeat needle biopsy (40%. The rate for immediate transurethral resection (TUR, surgery after initial needle biopsy, was 27.1%, however with a low PCa positive detection rate (0.66%. The repeat needle biopsy rate was lower compared with the initial biopsy rate (P 20 ng/ml, PCa positive rate was significantly higher than those with PSA < 20 ng/ml (P < 0.05. Conclusion: PCa positive detection rate following repeat needle biopsy in Chinese population was higher, although the repeated needle biopsy rate was still in a low level. TUGRNB should attract more attention in the diagnosis of PCa.

  6. Study of the ship design process model for collaborative design

    Science.gov (United States)

    He, Ze; Qiu, Chang-Hua; Wang, Neng-Jian

    2005-09-01

    The ship design process model is the basis for developing the ship collaborative design system under network environment. According to the characteristics of the ship design, a method for dividing the ship design process into, three layers is pat forward, that is project layer, design task layer and design activity layer, then the formalized definitions of the ship design process model, the decomposing principles of the ship design process and the architecture of the ship collaborative design (SDPM) system are presented. This method simplifies the activity network makes the optimization and adjustment of the design plan convenient and also makes the design process easier to control and change, at last the architecture of the ship collaborative design system is discussed.

  7. Study of the ship design process model for collaborative design

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    The ship design process model is the basis for developing the ship collaborative design system under network environment.According to the characteristics of the ship design, a method for dividing the ship design process into three layers is pat forward, that is project layer, design task layer and design activity layer, then the formalized definitions of the ship design process model, the decomposing principles of the ship design process and the architecture of the ship collaborative design (SDPM) system are presented. This method simplifies the activity network, makes the optimization and adjustment of the design plan convenient and also makes the design process easier to control and change, at last the architecture of the ship collaborative design system is discussed.

  8. Expansion of protein domain repeats.

    Directory of Open Access Journals (Sweden)

    Asa K Björklund

    2006-08-01

    Full Text Available Many proteins, especially in eukaryotes, contain tandem repeats of several domains from the same family. These repeats have a variety of binding properties and are involved in protein-protein interactions as well as binding to other ligands such as DNA and RNA. The rapid expansion of protein domain repeats is assumed to have evolved through internal tandem duplications. However, the exact mechanisms behind these tandem duplications are not well-understood. Here, we have studied the evolution, function, protein structure, gene structure, and phylogenetic distribution of domain repeats. For this purpose we have assigned Pfam-A domain families to 24 proteomes with more sensitive domain assignments in the repeat regions. These assignments confirmed previous findings that eukaryotes, and in particular vertebrates, contain a much higher fraction of proteins with repeats compared with prokaryotes. The internal sequence similarity in each protein revealed that the domain repeats are often expanded through duplications of several domains at a time, while the duplication of one domain is less common. Many of the repeats appear to have been duplicated in the middle of the repeat region. This is in strong contrast to the evolution of other proteins that mainly works through additions of single domains at either terminus. Further, we found that some domain families show distinct duplication patterns, e.g., nebulin domains have mainly been expanded with a unit of seven domains at a time, while duplications of other domain families involve varying numbers of domains. Finally, no common mechanism for the expansion of all repeats could be detected. We found that the duplication patterns show no dependence on the size of the domains. Further, repeat expansion in some families can possibly be explained by shuffling of exons. However, exon shuffling could not have created all repeats.

  9. Repeat induced abortion - a matter of individual behaviour or societal factors? A cross-sectional study among Swedish women.

    Science.gov (United States)

    Makenzius, Marlene; Tydén, Tanja; Darj, Elisabeth; Larsson, Margareta

    2011-10-01

    Almost 40% of all induced abortions in Sweden are repeat abortions; little is known about the risk factors. To investigate differences between women who had a first-time abortion and those with repeat abortion, and to identify factors associated with repeat abortion. A questionnaire was answered by 798 abortion-seeking women in Sweden during 2009. A regression model was used to assess risk factors for repeat abortions. In the age range 20-49 years, 41% of women had experienced at least one previous abortion. Risk factors for repeat abortion were parity (OR 2.57), lack of emotional support (OR 2.09), unemployment or sick leave (OR 1.65), tobacco use (OR 1.56), and low educational level (OR 1.5). Some women (n = 55) considered economic support and work opportunities could have enabled them to continue the pregnancy. Increased Sex and Relationship Education (SRE), easy access to high-quality contraception and counselling, were suggested (n = 86) as interventions for preventing unintended pregnancies. Even in a country with long established SRE and a public health policy to enhance sexual and reproductive health over a third of women requesting abortion have experienced one previously and the rate is maintained. Some specific factors are identified but, overall, a picture of vulnerability among women seeking repeat abortion stands out that needs to be considered in the prevention of unintended pregnancies.

  10. Orthogonal assembly of a designed ankyrin repeat protein-cytotoxin conjugate with a clickable serum albumin module for half-life extension.

    Science.gov (United States)

    Simon, Manuel; Frey, Raphael; Zangemeister-Wittke, Uwe; Plückthun, Andreas

    2013-11-20

    The generation of drug conjugates for safe and effective tumor targeting requires binding proteins tolerant to functionalization by rational engineering. Here, we show that Designed Ankyrin Repeat Proteins (DARPins), a novel class of binding proteins not derived from antibodies, can be used as building blocks for facile orthogonal assembly of bioconjugates for tumor targeting with tailored properties. DARPin Ec1, which targets the Epithelial Cell Adhesion Molecule (EpCAM), was genetically modified with a C-terminal cysteine for conjugation of the small molecule cytotoxin monomethylauristatin F (MMAF). In addition, it was N-terminally functionalized by metabolic introduction of the non-natural amino acid azidohomoalanine to enable linkage of site-specifically dibenzocyclooctyne-modified mouse serum albumin (MSA) for half-life extension using Cu(I)-free click chemistry. The conjugate MSA-Ec1-MMAF was assembled to obtain high yields of a pure and stable drug conjugate as confirmed by various analytical methods and in functional assays. The orthogonality of the assembly led to a defined reaction product and preserved the functional properties of all modules, including EpCAM-specific binding and internalization, FcRn binding mediated by MSA, and cytotoxic potency. Linkage of MMAF to the DARPin increased receptor-specific uptake of the drug while decreasing nonspecific uptake, and further coupling of the conjugate to MSA enhanced this effect. In mice, albumin conjugation increased the serum half-life from 11 min to 17.4 h, resulting in a more than 22-fold increase in the area-under-the-curve (AUC). Our data demonstrate the promise of the DARPin format for facile modular assembly of drug conjugates with improved pharmacokinetic performance for tumor targeting.

  11. Decision-to-Delivery Time Intervals in Emergency Caesarean Section Cases: Repeated cross-sectional study from Oman.

    Science.gov (United States)

    Tashfeen, Kaukab; Patel, Malini; Hamdi, Ilham M; Al-Busaidi, Ibrahim H A; Al-Yarubi, Mansour N

    2017-02-01

    In cases of fetal intolerance to labour, meeting the standard decision-to-delivery time interval (DDI) of ≤30 minutes is challenging. This study aimed to assess DDIs in emergency Caesarean section (CS) cases to identify factors causing DDI delays and the impact of a delayed DDI on perinatal outcomes. This repeated cross-sectional study included all emergency CS procedures performed due to acute fetal distress, antepartum haemorrhage or umbilical cord prolapse at the Nizwa Hospital, Nizwa, Oman. Three audit cycles of three months each were conducted between April 2011 and June 2013, including an initial retrospective cycle and two prospective cycles following the implementation of improvement strategies to address factors causing DDI delays. Poor perinatal outcomes were defined as Apgar scores of 60 minutes was significantly associated with poor neonatal outcomes in terms of increased SCBU admissions and low Apgar scores (P <0.001 each). Factors causing DDI delays included obtaining consent for the CS procedure, a lack of operating theatre availability and moving patients to the operating theatre. The identification of factors causing DDI delays may provide opportunities to improve perinatal outcomes.

  12. Decision-to-Delivery Time Intervals in Emergency Caesarean Section Cases; Repeated cross-sectional study from Oman

    Directory of Open Access Journals (Sweden)

    Kaukab Tashfeen

    2017-03-01

    Full Text Available Objectives: In cases of fetal intolerance to labour, meeting the standard decision-to-delivery time interval (DDI of ≤30 minutes is challenging. This study aimed to assess DDIs in emergency Caesarean section (CS cases to identify factors causing DDI delays and the impact of a delayed DDI on perinatal outcomes. Methods: This repeated cross-sectional study included all emergency CS procedures performed due to acute fetal distress, antepartum haemorrhage or umbilical cord prolapse at the Nizwa Hospital, Nizwa, Oman. Three audit cycles of three months each were conducted between April 2011 and June 2013, including an initial retrospective cycle and two prospective cycles following the implementation of improvement strategies to address factors causing DDI delays. Poor perinatal outcomes were defined as Apgar scores of 60 minutes was significantly associated with poor neonatal outcomes in terms of increased SCBU admissions and low Apgar scores (P <0.001 each. Factors causing DDI delays included obtaining consent for the CS procedure, a lack of operating theatre availability and moving patients to the operating theatre. Conclusion: The identification of factors causing DDI delays may provide opportunities to improve perinatal outcomes.

  13. First worldwide proficiency study on variable-number tandem-repeat typing of Mycobacterium tuberculosis complex strains.

    Science.gov (United States)

    de Beer, Jessica L; Kremer, Kristin; Ködmön, Csaba; Supply, Philip; van Soolingen, Dick

    2012-03-01

    Although variable-number tandem-repeat (VNTR) typing has gained recognition as the new standard for the DNA fingerprinting of Mycobacterium tuberculosis complex (MTBC) isolates, external quality control programs have not yet been developed. Therefore, we organized the first multicenter proficiency study on 24-locus VNTR typing. Sets of 30 DNAs of MTBC strains, including 10 duplicate DNA samples, were distributed among 37 participating laboratories in 30 different countries worldwide. Twenty-four laboratories used an in-house-adapted method with fragment sizing by gel electrophoresis or an automated DNA analyzer, nine laboratories used a commercially available kit, and four laboratories used other methods. The intra- and interlaboratory reproducibilities of VNTR typing varied from 0% to 100%, with averages of 72% and 60%, respectively. Twenty of the 37 laboratories failed to amplify particular VNTR loci; if these missing results were ignored, the number of laboratories with 100% interlaboratory reproducibility increased from 1 to 5. The average interlaboratory reproducibility of VNTR typing using a commercial kit was better (88%) than that of in-house-adapted methods using a DNA analyzer (70%) or gel electrophoresis (50%). Eleven laboratories using in-house-adapted manual typing or automated typing scored inter- and intralaboratory reproducibilities of 80% or higher, which suggests that these approaches can be used in a reliable way. In conclusion, this first multicenter study has documented the worldwide quality of VNTR typing of MTBC strains and highlights the importance of international quality control to improve genotyping in the future.

  14. Common interruptions in the repeating tripeptide sequence of non-fibrillar collagens: sequence analysis and structural studies on triple-helix peptide models.

    Science.gov (United States)

    Thiagarajan, Geetha; Li, Yingjie; Mohs, Angela; Strafaci, Christopher; Popiel, Magdalena; Baum, Jean; Brodsky, Barbara

    2008-02-22

    Interruptions in the repeating (Gly-X1-X2)(n) amino acid sequence pattern are found in the triple-helix domains of all non-fibrillar collagens, and perturbations to the triple-helix at such sites are likely to play a role in collagen higher-order structure and function. This study defines the sequence features and structural consequences of the most common interruption, where one residue is missing from the tripeptide pattern, Gly-X1-X2-Gly-AA(1)-Gly-X1-X2, designated G1G interruptions. Residues found within G1G interruptions are predominantly hydrophobic (70%), followed by a significant amount of charged residues (16%), and the Gly-X1-X2 triplets flanking the interruption are atypical. Studies on peptide models indicate the degree of destabilization is much greater when Pro is in the interruption, GP, than when hydrophobic residues (GF, GY) are present, and a rigid Gly-Pro-Hyp tripeptide adjacent to the interruption leads to greater destabilization than a flexible Gly-Ala-Ala sequence. Modeling based on NMR data indicates the Phe residue within a GF interruption is located on the outside of the triple helix. The G1G interruptions resemble a previously studied collagen interruption GPOGAAVMGPO, designated G4G-type, in that both are destabilizing, but allow continuation of rod-like triple helices and maintenance of the single residue stagger throughout the imperfection, with a loss of axial register of the superhelix on both sides. Both kinds of interruptions result in a highly localized perturbation in hydrogen bonding and dihedral angles, but the hydrophobic residue of a G4G interruption packs near the central axis of the superhelix, while the hydrophobic residue of a G1G interruption is located on the triple-helix surface. The different structural consequences of G1G and G4G interruptions in the repeating tripeptide sequence pattern suggest a physical basis for their differential susceptibility to matrix metalloproteinases in type X collagen.

  15. Nifty Nines and Repeating Decimals

    Science.gov (United States)

    Brown, Scott A.

    2016-01-01

    The traditional technique for converting repeating decimals to common fractions can be found in nearly every algebra textbook that has been published, as well as in many precalculus texts. However, students generally encounter repeating decimal numerals earlier than high school when they study rational numbers in prealgebra classes. Therefore, how…

  16. Nifty Nines and Repeating Decimals

    Science.gov (United States)

    Brown, Scott A.

    2016-01-01

    The traditional technique for converting repeating decimals to common fractions can be found in nearly every algebra textbook that has been published, as well as in many precalculus texts. However, students generally encounter repeating decimal numerals earlier than high school when they study rational numbers in prealgebra classes. Therefore, how…

  17. Repeat-until-success quantum repeaters

    Science.gov (United States)

    Bruschi, David Edward; Barlow, Thomas M.; Razavi, Mohsen; Beige, Almut

    2014-09-01

    We propose a repeat-until-success protocol to improve the performance of probabilistic quantum repeaters. Conventionally, these rely on passive static linear-optics elements and photodetectors to perform Bell-state measurements (BSMs) with a maximum success rate of 50%. This is a strong impediment for entanglement swapping between distant quantum memories. Every time a BSM fails, entanglement needs to be redistributed between the corresponding memories in the repeater link. The key ingredients of our scheme are repeatable BSMs. Under ideal conditions, these turn probabilistic quantum repeaters into deterministic ones. Under realistic conditions, our protocol too might fail. However, using additional threshold detectors now allows us to improve the entanglement generation rate by almost orders of magnitude, at a nominal distance of 1000 km, compared to schemes that rely on conventional BSMs. This improvement is sufficient to make the performance of our scheme comparable to the expected performance of some deterministic quantum repeaters.

  18. Using the American alligator and a repeated-measures design to place constraints on in vivo shoulder joint range of motion in dinosaurs and other fossil archosaurs.

    Science.gov (United States)

    Hutson, Joel D; Hutson, Kelda N

    2013-01-15

    Using the extant phylogenetic bracket of dinosaurs (crocodylians and birds), recent work has reported that elbow joint range of motion (ROM) studies of fossil dinosaur forearms may be providing conservative underestimates of fully fleshed in vivo ROM. As humeral ROM occupies a more central role in forelimb movements, the placement of quantitative constraints on shoulder joint ROM could improve fossil reconstructions. Here, we investigated whether soft tissues affect the more mobile shoulder joint in the same manner in which they affect elbow joint ROM in an extant archosaur. This test involved separately and repeatedly measuring humeral ROM in Alligator mississippiensis as soft tissues were dissected away in stages to bare bone. Our data show that the ROMs of humeral flexion and extension, as well as abduction and adduction, both show a statistically significant increase as flesh is removed, but then decrease when the bones must be physically articulated and moved until they separate from one another and/or visible joint surfaces. A similar ROM pattern is inferred for humeral pronation and supination. All final skeletonized ROMs were less than initial fully fleshed ROMs. These results are consistent with previously reported elbow joint ROM patterns from the extant phylogenetic bracket of dinosaurs. Thus, studies that avoid separation of complementary articular surfaces may be providing fossil shoulder joint ROMs that underestimate in vivo ROM in dinosaurs, as well as other fossil archosaurs.

  19. Repeated administration of D-amphetamine induces loss of [{sup 123}I]FP-CIT binding to striatal dopamine transporters in rat brain: a validation study

    Energy Technology Data Exchange (ETDEWEB)

    Booij, Jan [Department of Nuclear Medicine, Academic Medical Center, 1105 AZ Amsterdam (Netherlands)]. E-mail: j.booij@amc.uva.nl; Bruin, Kora de [Department of Nuclear Medicine, Academic Medical Center, 1105 AZ Amsterdam (Netherlands); Gunning, W. Boudewijn [Department of Neurology, Epilepsy Centre Kempenhaeghe, 5590 AB Heeze (Netherlands)

    2006-04-15

    In recent years, several PET and SPECT studies have shown loss of striatal dopamine transporter (DAT) binding in amphetamine (AMPH) users. However, the use of DAT SPECT tracers to detect AMPH-induced changes in DAT binding has not been validated. We therefore examined if repeated administration of D-AMPH or methamphetamine (METH) may induce loss of binding to striatal DATs in rats by using an experimental biodistribution study design and a SPECT tracer for the DAT ([{sup 123}I]FP-CIT). Methods: Groups of male rats (n=10 per group) were treated with D-AMPH (10 mg/kg body weight), METH (10 mg/kg body weight), or saline, twice a day for 5 consecutive days. Five days later, [{sup 123}I]FP-CIT was injected intravenously, and 2 h later, the rats were sacrificed and radioactivity was assayed. Results: In D-AMPH but not METH-treated rats, striatal [{sup 123}I]FP-CIT uptake was significantly lower (approximately 17%) than in the control group. Conclusion: These data show that [{sup 123}I]FP-CIT can be used to detect AMPH-induced changes in DAT binding and may validate the use of DAT radiotracers to study AMPH-induced changes in striatal DAT binding in vivo.

  20. Collaborative work on evaluation of ovarian toxicity. 2) Two- or four-week repeated dose studies and fertility study of mifepristone in female rats.

    Science.gov (United States)

    Tamura, Toru; Yokoi, Ryohei; Okuhara, Yuji; Harada, Chiho; Terashima, Yukari; Hayashi, Morimichi; Nagasawa, Tatsuya; Onozato, Tomoya; Kobayashi, Kazuo; Kuroda, Junji; Kusama, Hiroshi

    2009-01-01

    In order to assess ovarian pathological changes and their relationship to changes in female fertility parameters, mifepristone, a progesterone receptor antagonist, was selected as the test article and was administered orally to female rats at dose levels of 0, 0.8, 4, 20 and 100 mg/kg for 2 or 4 weeks in repeated dose-toxicity studies and in a female fertility study at dose levels of 0, 0.8, 4 and 20 mg/kg from > 2 weeks before copulation to postcoital day 7. In the repeated dose toxicity studies, persistent estrus was seen in the vaginal smears, and multiple cysts in the ovaries at necropsy, increases in luteinized cysts and hypertrophy of previously formed corpora lutea were observed in the histopathological examination of ovaries in rats receiving 20 mg/kg or more for 2 or 4 weeks. In female fertility studies, persistent vaginal cornification was also observed at 20 mg/kg and the precoital interval was significantly shortened. All of the animals were completely infertile when dosed with 20 mg/kg during the post-coital period. An increase in pre-implantation losses was observed in the animals treated with 20 mg/kg during the pre-coital phase, while treatment with 4 mg/kg mifepristone during the post-coital phase induced an increase in post-implantation losses. These results suggested that a 2-week administration period would be sufficient to detect the ovarian toxicity of mifepristone in repeated dose toxicity study and the pathological findings in the ovaries would reflect the alterations in female reproductive endpoints in the female fertility study.

  1. Improving the analysis of designed studies by combining statistical modelling with study design information

    NARCIS (Netherlands)

    Thissen, U.; Wopereis, S.; van Berg, S.A.A.; Bobeldijk, I.; Kleemann, R.; Kooistra, T.; van Dijk, K.W.; van Ommen, B.; Smilde, A.K.

    2009-01-01

    Background: In the fields of life sciences, so-called designed studies are used for studying complex biological systems. The data derived from these studies comply with a study design aimed at generating relevant information while diminishing unwanted variation (noise). Knowledge about the study

  2. Rhetorical Design Studies: The Art of Making Design Choices Explicit

    DEFF Research Database (Denmark)

    Halstrøm, Per L.

    2017-01-01

    Design has the potential to affect the situations we are in, the choices we make and the beliefs we live by. Being such an affective field, one might expect that canonized design thinking models and methods would be much concerned with how designers can discover arguments for their design choices...

  3. Interactive design computation: a case study on quantum design paradigm

    NARCIS (Netherlands)

    Feng, H.

    2013-01-01

    The ever-increasing complexity of design processes fosters novel design computation models to be employed in architectural research and design in order to facilitate accurate data processing and refined decision making. These computation models have enabled designers to work with complex geometry an

  4. The Effects of Repeated Exposure to Graphic Fear Appeals on Cigarette Packages: A Field Experiment

    NARCIS (Netherlands)

    Dijkstra, A.; Bos, C.

    2015-01-01

    Experimental studies on the effects of graphic fear appeals on cigarette packages typically expose smokers in a single session to a fear appeal, although in practice the exposure is always repeated. The present study applied an improved study design with repeated exposure to fear appeals on cigarett

  5. The Effects of Repeated Exposure to Graphic Fear Appeals on Cigarette Packages : A Field Experiment

    NARCIS (Netherlands)

    Dijkstra, Arie; Colin, Bos,

    2015-01-01

    Experimental studies on the effects of graphic fear appeals on cigarette packages typically expose smokers in a single session to a fear appeal, although in practice the exposure is always repeated. The present study applied an improved study design with repeated exposure to fear appeals on cigarett

  6. The Effects of Repeated Exposure to Graphic Fear Appeals on Cigarette Packages : A Field Experiment

    NARCIS (Netherlands)

    Dijkstra, Arie; Colin, Bos,

    2015-01-01

    Experimental studies on the effects of graphic fear appeals on cigarette packages typically expose smokers in a single session to a fear appeal, although in practice the exposure is always repeated. The present study applied an improved study design with repeated exposure to fear appeals on

  7. The Effects of Repeated Exposure to Graphic Fear Appeals on Cigarette Packages: A Field Experiment

    NARCIS (Netherlands)

    Dijkstra, A.; Bos, C.

    2015-01-01

    Experimental studies on the effects of graphic fear appeals on cigarette packages typically expose smokers in a single session to a fear appeal, although in practice the exposure is always repeated. The present study applied an improved study design with repeated exposure to fear appeals on

  8. Inter-Simple Sequence Repeat (ISSR Markers to Study Genetic Diversity Among Cotton Cultivars in Associated with Salt Tolerance

    Directory of Open Access Journals (Sweden)

    Ali Akbar ABDI

    2012-11-01

    Full Text Available Developing salt-tolerant crops is very important as a significant proportion of cultivated land is salt-affected. Screening and selection of salt tolerant genotypes of cotton using DNA molecular markers not only introduce tolerant cultivars useful for hybridization and breeding programs but also detect DNA regions involved in mechanism of salinity tolerance. To study this, 28 cotton cultivars, including 8 Iranian cotton varieties were grown in pots under greenhouse condition and three salt treatments were imposed with salt solutions (0, 70 and 140 mM NaCl. Eight agronomic traits including root length, root fresh weight, root dry weight, chlorophyll and fluorescence index, K+ and Na+ contents in shoot (above ground biomass, and K+/Na+ ratio were measured. Cluster analysis of cultivars based on measured agronomic traits, showed �Cindose� and �Ciacra� as the most tolerant cultivars, and �B-557� and �43347� as the most sensitive cultivars of salt damage. A total of 65 polymorphic DNA fragments were generated at 14 inter-simple sequence repeat (ISSR loci. Plants of 28 cultivars of cotton grouped into three clusters based on ISSR markers. Regression analysis of markers in relation with traits data showed that 23, 33 and 30 markers associated with the measured traits in three salt treatments respectively. These markers might help breeders in any marker assisted selection program in order to improving cotton cultivars against salt stress.

  9. Are diagnostic criteria for acute malnutrition affected by hydration status in hospitalized children? A repeated measures study

    Directory of Open Access Journals (Sweden)

    Fegan Gregory

    2011-09-01

    Full Text Available Abstract Introduction Dehydration and malnutrition commonly occur together among ill children in developing countries. Dehydration (change in total body water is known to alter weight. Although muscle tissue has high water content, it is not known whether mid-upper arm circumference (MUAC may be altered by changes in tissue hydration. We aimed to determine whether rehydration alters MUAC, MUAC Z score (MUACz, weight-for-length Z-score (WFLz and classification of nutritional status among hospitalised Kenyan children admitted with signs of dehydration. Study procedure We enrolled children aged from 3 months to 5 years admitted to a rural Kenyan district hospital with clinical signs compatible with dehydration, and without kwashiorkor. Anthropometric measurements were taken at admission and repeated after 48 hours of treatment, which included rehydration by WHO protocols. Changes in weight observed during this period were considered to be due to changes in hydration status. Results Among 325 children (median age 11 months the median weight gain (rehydration after 48 hours was 0.21 kg, (an increase of 2.9% of admission body weight. Each 1% change in weight was associated with a 0.40 mm (95% CI: 0.30 to 0.44 mm, p Conclusion MUAC is less affected by dehydration than WFLz and is therefore more suitable for nutritional assessment of ill children. However, both WFLz and MUAC misclassify SAM among dehydrated children. Nutritional status should be re-evaluated following rehydration, and management adjusted accordingly.

  10. A Study for the Characteristic Changes Under the Repeated Thermal Exposure in the Process of Repairing Aircraft Sandwich Structures

    Science.gov (United States)

    Kim, Yun Hae; Han, Joong Won; Kim, Don Won; Choi, Byung Keun; Murakami, R.

    Delamination can be observed in the sound areas during and/or after a couple times exposure to the elevated curing temperature due to the repeated repair condition. This study was conducted for checking the degree of degradation of properties of the cured parts and delamination between skin prepreg and honeycomb core. Specimens with glass honeycomb sandwich construction and glass/epoxy prepreg were prepared. The specimens were cured 1 to 5 times at 260°F in an autoclave and each additionally exposed 50, 100 and 150 hours in the 260°F oven. Each specimen was tested for tensile strength, compressive strength, flatwise tensile strength and interlaminar shear strength. To monitor the characteristics of the resin itself, the cured resin was tested using DMA and DSC. As a results, the decrease of Tg value were observed in the specific specimen which is exposed over 50 hrs at 260°F. This means the change or degradative of resin properties is also related to the decrease of flatwise tensile properties. Accordingly, minimal exposure on the curing temperature is recommended for parts in order to prevent the delation and maintain the better condition.

  11. Public perception of drinking water safety in South Africa 2002–2009: a repeated cross-sectional study

    Directory of Open Access Journals (Sweden)

    Wright Jim A

    2012-07-01

    Full Text Available Abstract Background In low and middle income countries, public perceptions of drinking water safety are relevant to promotion of household water treatment and to household choices over drinking water sources. However, most studies of this topic have been cross-sectional and not considered temporal variation in drinking water safety perceptions. The objective of this study is to explore trends in perceived drinking water safety in South Africa and its association with disease outbreaks, water supply and household characteristics. Methods This repeated cross-sectional study draws on General Household Surveys from 2002–2009, a series of annual nationally representative surveys of South African households, which include a question about perceived drinking water safety. Trends in responses to this question were examined from 2002–2009 in relation to reported cholera cases. The relationship between perceived drinking water safety and organoleptic qualities of drinking water, supply characteristics, and socio-economic and demographic household characteristics was explored in 2002 and 2008 using hierarchical stepwise logistic regression. Results The results suggest that perceived drinking water safety has remained relatively stable over time in South Africa, once the expansion of improved supplies is controlled for. A large cholera outbreak in 2000–02 had no apparent effect on public perception of drinking water safety in 2002. Perceived drinking water safety is primarily related to water taste, odour, and clarity rather than socio-economic or demographic characteristics. Conclusion This suggests that household perceptions of drinking water safety in South Africa follow similar patterns to those observed in studies in developed countries. The stability over time in public perception of drinking water safety is particularly surprising, given the large cholera outbreak that took place at the start of this period.

  12. Controlled air incinerator conceptual design study

    Energy Technology Data Exchange (ETDEWEB)

    1982-01-01

    This report presents a conceptual design study for a controlled air incinerator facility for incineration of low level combustible waste at Three Mile Island Unit 2 (TMI-2). The facility design is based on the use of a Helix Process Systems controlled air incinerator. Cost estimates and associated engineering, procurement, and construction schedules are also provided. The cost estimates and schedules are presented for two incinerator facility designs, one with provisions for waste ash solidification, the other with provisions for packaging the waste ash for transport to an undefined location.

  13. Engineering study for ISSTRS design concept

    Energy Technology Data Exchange (ETDEWEB)

    Hertzel, J.S.

    1997-01-31

    Los Alamos Technical Associates, Inc., is pleased to transmit the attached Conceptual Design Package for the Initial Single Shell Tank Retrieval System (ISSTRS), 90% Conceptual Design Review. The package includes the following: (1) ISSTRS Trade Studies: (a) Retrieval Facility Cooling Requirements; (b) Equipment Re-usability between Project W-320 and Tanks 241-C-103 and 241-C-1 05; (c) Sluice Line Options; and (d) Options for the Location of Tanks AX-103 and A-1 02 HVAC Equipment; (2) Drawings; (3) Risk Management Plan; (4) 0850 Interface Control Document; (5) Requirements Traceability Report; and (6) Project Design Specification.

  14. Sound in new media and design studies

    OpenAIRE

    Özcan, Oğuzhan; Tahiroğlu, Koray; Ikonen, Antti

    2014-01-01

    56 DesignIssues: Volume 30, Number 2 Spring 2014 © 2014 Massachusetts Institute of Technology Sound in New Media and Design Studies Koray Tahiro˘glu, O˘guzhan Özcan, Antti Ikonen Introduction The effect of new media on the computerization of cultural prac-tices has moved to a new level and has become more open, com-mon, and prevailing as we deal with new forms of artistic creation and design processes in supporting higher education. Massive changes have occurr...

  15. Distribution Network Design--literature study based

    OpenAIRE

    Li, Ang

    2012-01-01

    The focus of this research is companies' outbound distribution network design in supply chain management. Within the present competitive market, it is a fundamental importance for companies to achieve high level business performance with an effective supply chain. Outbound distribution network design as an important part in supply chain management, to a large extent decides whether companies can fulfill customers' requirement or not. Therefore, such a study is important for manufacturers and ...

  16. Conceptual study of advanced PWR core design

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Young Jin; Chang, Moon Hee; Kim, Keung Ku; Joo, Hyung Kuk; Kim, Young Il; Noh, Jae Man; Hwang, Dae Hyun; Kim, Taek Kyum; Yoo, Yon Jong

    1997-09-01

    The purpose of this project is for developing and verifying the core design concepts with enhanced safety and economy, and associated methodologies for core analyses. From the study of the sate-of-art of foreign advanced reactor cores, we developed core concepts such as soluble boron free, high convertible and enhanced safety core loaded semi-tight lattice hexagonal fuel assemblies. To analyze this hexagonal core, we have developed and verified some neutronic and T/H analysis methodologies. HELIOS code was adopted as the assembly code and HEXFEM code was developed for hexagonal core analysis. Based on experimental data in hexagonal lattices and the COBRA-IV-I code, we developed a thermal-hydraulic analysis code for hexagonal lattices. Using the core analysis code systems developed in this project, we designed a 600 MWe core and studied the feasibility of the core concepts. Two additional scopes were performed in this project : study on the operational strategies of soluble boron free core and conceptual design of large scale passive core. By using the axial BP zoning concept and suitable design of control rods, this project showed that it was possible to design a soluble boron free core in 600 MWe PWR. The results of large scale core design showed that passive concepts and daily load follow operation could be practiced. (author). 15 refs., 52 tabs., 101 figs.

  17. The effects of repeated administration of camphor-crataegus berry extract combination on blood pressure and on attentional performance - a randomized, placebo-controlled, double-blind study.

    Science.gov (United States)

    Erfurt, L; Schandry, R; Rubenbauer, S; Braun, U

    2014-09-25

    The present study investigated the effects of repeated administration of Korodin(®), a combination of camphor and crataegus berry extract, on blood pressure and attentional functioning. This study was conducted based on a randomized, placebo-controlled, double-blind design. 54 persons participated (33 female, 21 male) with a mean age of 24.3 years. Blood pressure and body mass index were in the normal range. Participants received 20 drops of either Korodin(®) or a placebo for four times with interjacent time intervals of about 10 min. Blood pressure was measured sphygmomanometrically before and after each administration. Attentional performance was quantified by using two paper-and-pencil tests, the d2 Test of Attention and Digit Symbol Test. Greater increases in blood pressure occurred after the four Korodin(®) administrations in comparison to the four placebo administrations. The performance in two parameters of d2 Test of Attention was consistently superior after the intake of Korodin(®). The excellent tolerability and safety of Korodin(®), even after a total consumption of 80 drops, was confirmed. Copyright © 2014 Elsevier GmbH. All rights reserved.

  18. Contributions by the CAG-repeat Polymorphism of the Androgen Receptor Gene and Circulating Androgens to Muscle Size. Odense Androgen Study - A Population-based Study of 20-29 Year-old Danish Men

    DEFF Research Database (Denmark)

    Nielsen, Torben Leo; Hagen, Claus; Wraae, Kristian;

    2007-01-01

    Context: The number of CAG-repeats within the CAG-repeat polymorphism of the androgen receptor gene is inversely correlated with the transcriptional activity of the androgen receptor. Objective: To study the effect of the CAG-repeat number and circulating androgens on muscle size, to examine......-repeat number correlated inversely with thigh and axial muscle area and with lower and upper extremity lean body mass. Except for upper extremity lean body mass, these findings remained significant in multivariate analyses controlling for circulating androgens, physical activity, smoking, alcohol intake...

  19. Repeated measurement sampling in genetic association analysis with genotyping errors.

    Science.gov (United States)

    Lai, Renzhen; Zhang, Hong; Yang, Yaning

    2007-02-01

    Genotype misclassification occurs frequently in human genetic association studies. When cases and controls are subject to the same misclassification model, Pearson's chi-square test has the correct type I error but may lose power. Most current methods adjusting for genotyping errors assume that the misclassification model is known a priori or can be assessed by a gold standard instrument. But in practical applications, the misclassification probabilities may not be completely known or the gold standard method can be too costly to be available. The repeated measurement design provides an alternative approach for identifying misclassification probabilities. With this design, a proportion of the subjects are measured repeatedly (five or more repeats) for the genotypes when the error model is completely unknown. We investigate the applications of the repeated measurement method in genetic association analysis. Cost-effectiveness study shows that if the phenotyping-to-genotyping cost ratio or the misclassification rates are relatively large, the repeat sampling can gain power over the regular case-control design. We also show that the power gain is not sensitive to the genetic model, genetic relative risk and the population high-risk allele frequency, all of which are typically important ingredients in association studies. An important implication of this result is that whatever the genetic factors are, the repeated measurement method can be applied if the genotyping errors must be accounted for or the phenotyping cost is high.

  20. Repeated Insulin-like Growth Factor 1 (IGF1 treatment in a patient with Rett Syndrome: a single case study

    Directory of Open Access Journals (Sweden)

    Giorgio ePini

    2014-06-01

    Full Text Available Rett syndrome (RTT is a devastating neurodevelopmental disorder that has no cure. Patients show regression of acquired skills, motor and speech impairment, cardio-respiratory distress, microcephaly and stereotyped hand movements. The majority of RTT patients display mutations in the gene that codes for the Methyl-CpG binding protein 2 (MeCP2, which is involved in the development of the central nervous system, especially synaptic and circuit maturation. Thus, agents that promote brain development and synaptic function are good candidates for ameliorating the symptoms of RTT. In particular, Insulin-like growth Factor 1 (IGF1 and its active peptide (1-3IGF1 cross the Blood Brain Barrier, and therefore are ideal treatments for RTT Indeed, both (1-3IGF1 and IGF1 treatment significantly ameliorates RTT symptoms in a mouse model of the disease In a previous study we established that IGF1 is safe and well tolerated on Rett patients. In this open label clinical case study, we assess the safety and tolerability of IGF1 administration in two cycles of the treatment. Before and after each cycle we monitored the clinical and blood parameters, autonomic function and social and cognitive abilities, and we found that IGF1 was well tolerated each time and did not induce any side effect, nor it interfered with the other treatments that the patient was undergoing. We noticed a moderate improvement in the cognitive, social and autonomic abilities of the patient after each cycle but the benefits were not retained between the two cycles, consistent with the preclinical observation that treatments for RTT should be administered through life. We find that repeated IGF1 treatment is safe and well tolerated in Rett patients but observed effects are not retained between cycles. These results have applications to other pathologies considering that IGF1 has been shown to be effective in other disorders of the autism spectrum.

  1. Repeated insulin-like growth factor 1 treatment in a patient with rett syndrome: a single case study.

    Science.gov (United States)

    Pini, Giorgio; Scusa, M Flora; Benincasa, Alberto; Bottiglioni, Ilaria; Congiu, Laura; Vadhatpour, Cyrus; Romanelli, Anna Maria; Gemo, Ilaria; Puccetti, Chetti; McNamara, Rachel; O'Leary, Seán; Corvin, Aiden; Gill, Michael; Tropea, Daniela

    2014-01-01

    Rett syndrome (RTT) is a devastating neurodevelopmental disorder that has no cure. Patients show regression of acquired skills, motor, and speech impairment, cardio-respiratory distress, microcephaly, and stereotyped hand movements. The majority of RTT patients display mutations in the gene that codes for the Methyl-CpG binding protein 2 (MeCP2), which is involved in the development of the central nervous system, especially synaptic and circuit maturation. Thus, agents that promote brain development and synaptic function are good candidates for ameliorating the symptoms of RTT. In particular, insulin-like growth factor 1 (IGF1) and its active peptide (1-3) IGF1 cross the Blood Brain Barrier, and therefore are ideal treatments for RTT Indeed, both (1-3) IGF1 and IGF1 treatment significantly ameliorates RTT symptoms in a mouse model of the disease In a previous study, we established that IGF1 is safe and well tolerated on Rett patients. In this open label clinical case study, we assess the safety and tolerability of IGF1 administration in two cycles of the treatment. Before and after each cycle, we monitored the clinical and blood parameters, autonomic function, and social and cognitive abilities, and we found that IGF1 was well tolerated each time and did not induce any side effect, nor it interfered with the other treatments that the patient was undergoing. We noticed a moderate improvement in the cognitive, social, and autonomic abilities of the patient after each cycle but the benefits were not retained between the two cycles, consistent with the pre-clinical observation that treatments for RTT should be administered through life. We find that repeated IGF1 treatment is safe and well tolerated in Rett patients but observed effects are not retained between cycles. These results have applications to other pathologies considering that IGF1 has been shown to be effective in other disorders of the autism spectrum.

  2. Experimental design of a waste glass study

    Energy Technology Data Exchange (ETDEWEB)

    Piepel, G.F.; Redgate, P.E.; Hrma, P.

    1995-04-01

    A Composition Variation Study (CVS) is being performed to support a future high-level waste glass plant at Hanford. A total of 147 glasses, covering a broad region of compositions melting at approximately 1150{degrees}C, were tested in five statistically designed experimental phases. This paper focuses on the goals, strategies, and techniques used in designing the five phases. The overall strategy was to investigate glass compositions on the boundary and interior of an experimental region defined by single- component, multiple-component, and property constraints. Statistical optimal experimental design techniques were used to cover various subregions of the experimental region in each phase. Empirical mixture models for glass properties (as functions of glass composition) from previous phases wee used in designing subsequent CVS phases.

  3. Intermediate CAG repeat expansion in the ATXN2 gene is a unique genetic risk factor for ALS--a systematic review and meta-analysis of observational studies.

    Directory of Open Access Journals (Sweden)

    Ming-Dong Wang

    Full Text Available Amyotrophic lateral sclerosis (ALS is a rare degenerative condition of the motor neurons. Over 10% of ALS cases are linked to monogenic mutations, with the remainder thought to be due to other risk factors, including environmental factors, genetic polymorphisms, and possibly gene-environmental interactions. We examined the association between ALS and an intermediate CAG repeat expansion in the ATXN2 gene using a meta-analytic approach. Observational studies were searched with relevant disease and gene terms from MEDLINE, EMBASE, and PsycINFO from January 2010 through to January 2014. All identified articles were screened using disease terms, gene terms, population information, and CAG repeat information according to PRISMA guidelines. The final list of 17 articles was further evaluated based on the study location, time period, and authors to exclude multiple usage of the same study populations: 13 relevant articles were retained for this study. The range 30-33 CAG repeats in the ATXN2 gene was most strongly associated with ALS. The meta-analysis revealed that the presence of an intermediate CAG repeat (30-33 in the ATXN2 gene was associated with an increased risk of ALS [odds ratio (OR = 4.44, 95%CI: 2.91-6.76] in Caucasian ALS patients. There was no significant difference in the association of this CAG intermediate repeat expansion in the ATXN2 gene between familial ALS cases (OR = 3.59, 1.58-8.17 and sporadic ALS cases (OR = 3.16, 1.88-5.32. These results indicate that the presence of intermediate CAG repeat expansion in the ATXN2 gene is a specific genetic risk factor for ALS, unlike monogenic mutations with an autosomal dominant transmission mode, which cause a more severe phenotype of ALS, with a higher prevalence in familial ALS.

  4. Intermediate CAG repeat expansion in the ATXN2 gene is a unique genetic risk factor for ALS--a systematic review and meta-analysis of observational studies.

    Science.gov (United States)

    Wang, Ming-Dong; Gomes, James; Cashman, Neil R; Little, Julian; Krewski, Daniel

    2014-01-01

    Amyotrophic lateral sclerosis (ALS) is a rare degenerative condition of the motor neurons. Over 10% of ALS cases are linked to monogenic mutations, with the remainder thought to be due to other risk factors, including environmental factors, genetic polymorphisms, and possibly gene-environmental interactions. We examined the association between ALS and an intermediate CAG repeat expansion in the ATXN2 gene using a meta-analytic approach. Observational studies were searched with relevant disease and gene terms from MEDLINE, EMBASE, and PsycINFO from January 2010 through to January 2014. All identified articles were screened using disease terms, gene terms, population information, and CAG repeat information according to PRISMA guidelines. The final list of 17 articles was further evaluated based on the study location, time period, and authors to exclude multiple usage of the same study populations: 13 relevant articles were retained for this study. The range 30-33 CAG repeats in the ATXN2 gene was most strongly associated with ALS. The meta-analysis revealed that the presence of an intermediate CAG repeat (30-33) in the ATXN2 gene was associated with an increased risk of ALS [odds ratio (OR) = 4.44, 95%CI: 2.91-6.76)] in Caucasian ALS patients. There was no significant difference in the association of this CAG intermediate repeat expansion in the ATXN2 gene between familial ALS cases (OR = 3.59, 1.58-8.17) and sporadic ALS cases (OR = 3.16, 1.88-5.32). These results indicate that the presence of intermediate CAG repeat expansion in the ATXN2 gene is a specific genetic risk factor for ALS, unlike monogenic mutations with an autosomal dominant transmission mode, which cause a more severe phenotype of ALS, with a higher prevalence in familial ALS.

  5. A review of the reporting and handling of missing data in cohort studies with repeated assessment of exposure measures

    Directory of Open Access Journals (Sweden)

    Karahalios Amalia

    2012-07-01

    Full Text Available Abstract Background Retaining participants in cohort studies with multiple follow-up waves is difficult. Commonly, researchers are faced with the problem of missing data, which may introduce biased results as well as a loss of statistical power and precision. The STROBE guidelines von Elm et al. (Lancet, 370:1453-1457, 2007; Vandenbroucke et al. (PLoS Med, 4:e297, 2007 and the guidelines proposed by Sterne et al. (BMJ, 338:b2393, 2009 recommend that cohort studies report on the amount of missing data, the reasons for non-participation and non-response, and the method used to handle missing data in the analyses. We have conducted a review of publications from cohort studies in order to document the reporting of missing data for exposure measures and to describe the statistical methods used to account for the missing data. Methods A systematic search of English language papers published from January 2000 to December 2009 was carried out in PubMed. Prospective cohort studies with a sample size greater than 1,000 that analysed data using repeated measures of exposure were included. Results Among the 82 papers meeting the inclusion criteria, only 35 (43% reported the amount of missing data according to the suggested guidelines. Sixty-eight papers (83% described how they dealt with missing data in the analysis. Most of the papers excluded participants with missing data and performed a complete-case analysis (n = 54, 66%. Other papers used more sophisticated methods including multiple imputation (n = 5 or fully Bayesian modeling (n = 1. Methods known to produce biased results were also used, for example, Last Observation Carried Forward (n = 7, the missing indicator method (n = 1, and mean value substitution (n = 3. For the remaining 14 papers, the method used to handle missing data in the analysis was not stated. Conclusions This review highlights the inconsistent reporting of missing data in cohort studies and the continuing

  6. A review of the reporting and handling of missing data in cohort studies with repeated assessment of exposure measures.

    Science.gov (United States)

    Karahalios, Amalia; Baglietto, Laura; Carlin, John B; English, Dallas R; Simpson, Julie A

    2012-07-11

    Retaining participants in cohort studies with multiple follow-up waves is difficult. Commonly, researchers are faced with the problem of missing data, which may introduce biased results as well as a loss of statistical power and precision. The STROBE guidelines von Elm et al. (Lancet, 370:1453-1457, 2007); Vandenbroucke et al. (PLoS Med, 4:e297, 2007) and the guidelines proposed by Sterne et al. (BMJ, 338:b2393, 2009) recommend that cohort studies report on the amount of missing data, the reasons for non-participation and non-response, and the method used to handle missing data in the analyses. We have conducted a review of publications from cohort studies in order to document the reporting of missing data for exposure measures and to describe the statistical methods used to account for the missing data. A systematic search of English language papers published from January 2000 to December 2009 was carried out in PubMed. Prospective cohort studies with a sample size greater than 1,000 that analysed data using repeated measures of exposure were included. Among the 82 papers meeting the inclusion criteria, only 35 (43%) reported the amount of missing data according to the suggested guidelines. Sixty-eight papers (83%) described how they dealt with missing data in the analysis. Most of the papers excluded participants with missing data and performed a complete-case analysis (n=54, 66%). Other papers used more sophisticated methods including multiple imputation (n=5) or fully Bayesian modeling (n=1). Methods known to produce biased results were also used, for example, Last Observation Carried Forward (n=7), the missing indicator method (n=1), and mean value substitution (n=3). For the remaining 14 papers, the method used to handle missing data in the analysis was not stated. This review highlights the inconsistent reporting of missing data in cohort studies and the continuing use of inappropriate methods to handle missing data in the analysis. Epidemiological journals

  7. Duct Leakage Repeatability Testing

    Energy Technology Data Exchange (ETDEWEB)

    Walker, Iain [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Sherman, Max [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2014-01-01

    Duct leakage often needs to be measured to demonstrate compliance with requirements or to determine energy or Indoor Air Quality (IAQ) impacts. Testing is often done using standards such as ASTM E1554 (ASTM 2013) or California Title 24 (California Energy Commission 2013 & 2013b), but there are several choices of methods available within the accepted standards. Determining which method to use or not use requires an evaluation of those methods in the context of the particular needs. Three factors that are important considerations are the cost of the measurement, the accuracy of the measurement and the repeatability of the measurement. The purpose of this report is to evaluate the repeatability of the three most significant measurement techniques using data from the literature and recently obtained field data. We will also briefly discuss the first two factors. The main question to be answered by this study is to determine if differences in the repeatability of these tests methods is sufficient to indicate that any of these methods is so poor that it should be excluded from consideration as an allowed procedure in codes and standards.

  8. PILER-CR: Fast and accurate identification of CRISPR repeats

    Directory of Open Access Journals (Sweden)

    Edgar Robert C

    2007-01-01

    Full Text Available Abstract Background Sequencing of prokaryotic genomes has recently revealed the presence of CRISPR elements: short, highly conserved repeats separated by unique sequences of similar length. The distinctive sequence signature of CRISPR repeats can be found using general-purpose repeat- or pattern-finding software tools. However, the output of such tools is not always ideal for studying these repeats, and significant effort is sometimes needed to build additional tools and perform manual analysis of the output. Results We present PILER-CR, a program specifically designed for the identification and analysis of CRISPR repeats. The program executes rapidly, completing a 5 Mb genome in around 5 seconds on a current desktop computer. We validate the algorithm by manual curation and by comparison with published surveys of these repeats, finding that PILER-CR has both high sensitivity and high specificity. We also present a catalogue of putative CRISPR repeats identified in a comprehensive analysis of 346 prokaryotic genomes. Conclusion PILER-CR is a useful tool for rapid identification and classification of CRISPR repeats. The software is donated to the public domain. Source code and a Linux binary are freely available at http://www.drive5.com/pilercr.

  9. Origin and fate of repeats in bacteria.

    Science.gov (United States)

    Achaz, G; Rocha, E P C; Netter, P; Coissac, E

    2002-07-01

    We investigated 53 complete bacterial chromosomes for intrachromosomal repeats. In previous studies on eukaryote chromosomes, we proposed a model for the dynamics of repeats based on the continuous genesis of tandem repeats, followed by an active process of high deletion rate, counteracted by rearrangement events that may prevent the repeats from being deleted. The present study of long repeats in the genomes of Bacteria and Archaea suggests that our model of interspersed repeats dynamics may apply to them. Thus the duplication process might be a consequence of very ancient mechanisms shared by all three domains. Moreover, we show that there is a strong negative correlation between nucleotide composition bias and the repeat density of genomes. We hypothesise that in highly biased genomes, non-duplicated small repeats arise more frequently by random effects and are used as primers for duplication mechanisms, leading to a higher density of large repeats.

  10. Twenty-eight-day repeated inhalation toxicity study of nano-sized lanthanum oxide in male sprague-dawley rats.

    Science.gov (United States)

    Shin, Seo-Ho; Lim, Cheol-Hong; Kim, Yong-Soon; Lee, Yong-Hoon; Kim, Sung-Hwan; Kim, Jong-Choon

    2017-04-01

    Although the use of lanthanum has increased in field of high-tech industry worldwide, potential adverse effects to human health and to the environment are largely unknown. The present study aimed to investigate the potential toxicity of nano-sized lanthanum oxide (La2 O3 ) following repeated inhalation exposure in male Sprague-Dawley rats. Male rats were exposed nose-only to nano-sized La2 O3 for 28 days (5 days/week) at doses of 0, 0.5, 2.5, and 10 mg/m(3) . In the experimental period, we evaluated treatment-related changes including clinical signs, body weight, hematology, serum biochemistry, necropsy findings, organ weight, and histopathology findings. We also analyzed lanthanum distribution in the major organs and in the blood, bronchoalveolar lavage fluids (BALF), and oxidative stress in lung tissues. Lanthanum level was highest in lung tissues and showed a dose-dependent relation. Alveolar proteinosis was observed in all treatment groups and was accompanied by an increase in lung weight; moreover, lung inflammation was observed in the 2.5 mg/m(3) and higher dose groups and was accompanied by an increase in white blood cells. In the BALF, total cell counts including macrophages and neutrophils, lactate dehydrogenase, albumin, nitric oxide, and tumor necrosis factor-alpha increased significantly in all treatment groups. Furthermore, these changes tended to deteriorate in the 10 mg/m(3) group at the end of the recovery period. In the present experimental conditions, we found that the lowest-observed-adverse-effect level of nano-sized La2 O3 was 0.5 mg/m(3) in male rats, and the target organ was the lung. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 1226-1240, 2017. © 2016 Wiley Periodicals, Inc.

  11. [C-11]raclopride-PET studies of the Huntington's disease rate of progression : Relevance of the trinucleotide repeat length

    NARCIS (Netherlands)

    Antonini, A; Leenders, KL; Eidelberg, D

    1998-01-01

    We used [C-11]raclopride and positron emission tomography (PET) to assess the relationship between striatal dopamine D2 receptor binding, trinucleotide repeat number (GAG), and subject age in 10 asymptomatic and 8 symptomatic carriers of the Huntington's disease (HD) mutation. In both preclinical an

  12. Pharmacokinetic evaluation of pamidronate after oral administration: a study on dose proportionality, absolute bioavailability, and effect of repeated administration

    DEFF Research Database (Denmark)

    Hyldstrup, Lars; Flesch, G; Hauffe, S A

    1993-01-01

    30 minutes at constant infusion rate. Repeated peroral doses (75 and 150 mg) were administered to 12 females (aged 51-70 years) for 10 consecutive days. Urinary excretion of pamidronate after peroral and i.v. administration was used for estimation of pamidronate absorption. Renal excretion...

  13. Primary and Repeat Cesarean Deliveries: A Population-based Study in the United States, 1979-2010.

    Science.gov (United States)

    Ananth, Cande V; Friedman, Alexander M; Keyes, Katherine M; Lavery, Jessica A; Hamilton, Ava; Wright, Jason D

    2017-07-01

    Despite the temporal increase in cesarean deliveries, the extent to which maternal age, period, and maternal birth cohorts may have contributed to these trends remains unknown. We performed an analysis of 123 million singleton deliveries in the United States (1979-2010). We estimated rate ratio (RR) with 95% confidence interval (CI) for primary and repeat cesarean deliveries. We examined changes in cesarean rates with weighted Poisson regression models across three time-scales: maternal age, year of delivery, and birth cohort (mother's birth year). The primary cesarean rate increased by 68% (95% confidence interval [CI]: 67%, 69%) between 1979 (11.0%) and 2010 (18.5%). Repeat cesarean deliveries increased by 178% (95% CI: 176, 179) from 5.2% in 1979 to 14.4% in 2010. Cesarean rates increased with advancing age. Compared with 1979, the RR for the period effect in primary and repeat cesarean deliveries increased up to 1990, fell to a nadir at 1993, and began to rise thereafter. A small birth cohort effect was evident, with women born before 1950 at increased risk of primary cesarean; no cohort effect was seen for repeat cesarean deliveries. Adjustment for maternal BMI had a small effect on these findings. Period effects in primary cesarean were explained by a combination of trends in obesity and chronic hypertension, as well as demographic shifts over time. Maternal age and period appear to have important contributions to the temporal increase in the cesarean rates, although the effect of parity on these associations remains undetermined.

  14. A Cross-Sectional Study on the Perceptions and Practices of Teenagers With Inflammatory Bowel Disease About Repeated Stool Sampling

    NARCIS (Netherlands)

    Heida, Anke; Dijkstra, Alie; Dantuma, Sietske K.; van Rheenen, Patrick F.

    2016-01-01

    Purpose: Repeated stool sampling to monitor disease activity is increasingly used in teenagers with inflammatory bowel disease (IBD). Knowledge about their perceptions and practices regarding collection of feces will increase the success rate of this monitoring strategy. Methods: We sent a survey to

  15. Deepening Kindergarteners' Science Vocabulary: A Design Study

    Science.gov (United States)

    Parsons, Allison Ward; Bryant, Camille Lawrence

    2016-01-01

    Early, effective instruction to introduce both science vocabulary and general academic language may help children build a strong conceptual and linguistic foundation for later instruction. In this study, a design research intervention was employed to expose children to a variety of interrelated science content words to increase both the breadth…

  16. Study designs for PDSA quality improvement research.

    Science.gov (United States)

    Speroff, Theodore; O'Connor, Gerald T

    2004-01-01

    The purpose of this article is to discuss strengths and weaknesses of quasi-experimental designs used in health care quality improvement research. The target groups for this article are investigators in plan-do-study-act (PDSA) quality improvement initiatives who wish to improve the rigor of their methodology and publish their work and reviewers who evaluate the quality of research proposals or published work. A primary purpose of PDSA quality improvement research is to establish a functional relationship between process changes in systems of health care and variation in outcomes. The time series design is the fundamental paradigm for demonstrating such functional relationships. The rigor of a PDSA quality improvement study design is strengthened using replication schemes and research methodology to address extraneous factors that weaken validity of observational studies. The design of PDSA quality improvement research should follow from the purpose and context of the project. Improving the rigor of the quality improvement literature will build a stronger foundation and more convincing justification for the study and practice of quality improvement in health care.

  17. Simulated Conversations With Virtual Humans to Improve Patient-Provider Communication and Reduce Unnecessary Prescriptions for Antibiotics: A Repeated Measure Pilot Study

    Science.gov (United States)

    2017-01-01

    Background Despite clear evidence that antibiotics do not cure viral infections, the problem of unnecessary prescribing of antibiotics in ambulatory care persists, and in some cases, prescribing patterns have increased. The overuse of antibiotics for treating viral infections has created numerous economic and clinical consequences including increased medical costs due to unnecessary hospitalizations, antibiotic resistance, disruption of gut bacteria, and obesity. Recent research has underscored the importance of collaborative patient-provider communication as a means to reduce the high rates of unnecessary prescriptions for antibiotics. However, most patients and providers do not feel prepared to engage in such challenging conversations. Objectives The aim of this pilot study was to assess the ability of a brief 15-min simulated role-play conversation with virtual humans to serve as a preliminary step to help health care providers and patients practice, and learn how to engage in effective conversations about antibiotics overuse. Methods A total of 69 participants (35 providers and 34 patients) completed the simulation once in one sitting. A pre-post repeated measures design was used to assess changes in patients’ and providers’ self-reported communication behaviors, activation, and preparedness, intention, and confidence to effectively communicate in the patient-provider encounter. Changes in patients’ knowledge and beliefs regarding antibiotic use were also evaluated. Results Patients experienced a short-term positive improvement in beliefs about appropriate antibiotic use for infection (F1,30=14.10, P=.001). Knowledge scores regarding the correct uses of antibiotics improved immediately postsimulation, but decreased at the 1-month follow-up (F1,30=31.16, P.10) Patients with lower levels of activation exhibited positive, short-term benefits in increased intent and confidence to discuss their needs and ask questions in the clinic visit, positive attitudes

  18. Repeated administration of D-amphetamine induces loss of [I-123]FP-CIT binding to striatal dopamine transporters in rat brain: a validation study

    NARCIS (Netherlands)

    J. Booij; K. de Bruin; W.B. Gunning

    2006-01-01

    In recent years, several PET and SPECT studies have shown loss of striatal dopamine transporter (DAT) binding in arnphetamine (AMPH) users. However, the use of DAT SPECT tracers to detect AMPH-induced changes in DAT binding has not been validated. We therefore examined if repeated administration of

  19. Prospective study on the determinants of repeat attendance and attendance patterns in breast cancer screening using the Theory of Planned Behaviour

    NARCIS (Netherlands)

    Drossaert, C.H.C.; Boer, H.; Seydel, E.R.

    2003-01-01

    This prospective study, using the Theory of Planned Behaviour (TPB) as a theoretical framework, was carried out to identify the determinants of repeat attendance and attendance patterns in organised breast screening. A group of 2657 women filled out a baseline questionnaire, approximately 8 weeks af

  20. Automatization and familiarity in repeated checking

    NARCIS (Netherlands)

    Dek, Eliane C P; van den Hout, Marcel A.; Giele, Catharina L.; Engelhard, Iris M.

    2014-01-01

    Repeated checking paradoxically increases memory uncertainty. This study investigated the underlying mechanism of this effect. We hypothesized that as a result of repeated checking, familiarity with stimuli increases, and automatization of the checking procedure occurs, which should result in decrea

  1. Thermodynamic Studies for Drug Design and Screening

    Science.gov (United States)

    Garbett, Nichola C.; Chaires, Jonathan B.

    2012-01-01

    Introduction A key part of drug design and development is the optimization of molecular interactions between an engineered drug candidate and its binding target. Thermodynamic characterization provides information about the balance of energetic forces driving binding interactions and is essential for understanding and optimizing molecular interactions. Areas covered This review discusses the information that can be obtained from thermodynamic measurements and how this can be applied to the drug development process. Current approaches for the measurement and optimization of thermodynamic parameters are presented, specifically higher throughput and calorimetric methods. Relevant literature for this review was identified in part by bibliographic searches for the period 2004 – 2011 using the Science Citation Index and PUBMED and the keywords listed below. Expert opinion The most effective drug design and development platform comes from an integrated process utilizing all available information from structural, thermodynamic and biological studies. Continuing evolution in our understanding of the energetic basis of molecular interactions and advances in thermodynamic methods for widespread application are essential to realize the goal of thermodynamically-driven drug design. Comprehensive thermodynamic evaluation is vital early in the drug development process to speed drug development towards an optimal energetic interaction profile while retaining good pharmacological properties. Practical thermodynamic approaches, such as enthalpic optimization, thermodynamic optimization plots and the enthalpic efficiency index, have now matured to provide proven utility in design process. Improved throughput in calorimetric methods remains essential for even greater integration of thermodynamics into drug design. PMID:22458502

  2. Reported frequency of physical activity in a large epidemiological study: relationship to specific activities and repeatability over time

    Directory of Open Access Journals (Sweden)

    Reeves Gillian K

    2011-06-01

    Full Text Available Abstract Background How overall physical activity relates to specific activities and how reported activity changes over time may influence interpretation of observed associations between physical activity and health. We examine the relationships between various physical activities self-reported at different times in a large cohort study of middle-aged UK women. Methods At recruitment, Million Women Study participants completed a baseline questionnaire including questions on frequency of strenuous and of any physical activity. About 3 years later 589,896 women also completed a follow-up questionnaire reporting the hours they spent on a range of specific activities. Time spent on each activity was used to estimate the associated excess metabolic equivalent hours (MET-hours and this value was compared across categories of physical activity reported at recruitment. Additionally, 18,655 women completed the baseline questionnaire twice, at intervals of up to 4 years; repeatability over time was assessed using the weighted kappa coefficient (κweighted and absolute percentage agreement. Results The average number of hours per week women reported doing specific activities was 14.0 for housework, 4.5 for walking, 3.0 for gardening, 0.2 for cycling, and 1.4 for all strenuous activity. Time spent and the estimated excess MET-hours associated with each activity increased with increasing frequency of any or strenuous physical activity reported at baseline (tests for trend, P weighted = 0.71 for questionnaires administered less than 6 months apart, and 52% (κweighted = 0.51 for questionnaires more than 2 years apart. Corresponding values for any physical activity were 57% (κweighted = 0.67 and 47% (κweighted = 0.58. Conclusions In this cohort, responses to simple questions on the frequency of any physical activity and of strenuous activity asked at baseline were associated with hours spent on specific activities and the associated estimated excess MET

  3. Collaborative work on evaluation of ovarian toxicity. 17) Two- or four-week repeated-dose studies and fertility study of sulpiride in female rats.

    Science.gov (United States)

    Ishii, Shun-ichiro; Ube, Masayuki; Okada, Miyoko; Adachi, Tamiko; Sugimoto, Jiro; Inoue, Yoshimi; Uno, Yoshifumi; Mutai, Mamoru

    2009-01-01

    To find the appropriate dosing period to detect ovarian toxicity, sulpiride, a D2 antagonist was orally dosed to female rats at dose levels of 1, 10, and 100 mg/kg/day daily for 2 or 4 weeks in repeated-dose toxicity studies. In addition, sulpiride at the same dose levels was given to female rats daily during the pre-mating period, mating period, and Days 0-7 of gestation to assess its effect on fertility. In ovarian histology in the 2-week study, increases in atretic follicle were seen at 1 mg/kg or more and increases in follicular cysts at 10 mg/kg or more. In the 4-week study, these findings were seen at 1 mg/kg or more, and a decrease in large follicles was seen at 10 mg/kg or more. Increased body weight gain was observed at 10 mg/kg or more in the 2- and 4-week studies. The females in these groups exhibited development of mammary alveolus by sulpiride-induced hyperprolactinemia. In the fertility study, sulpiride-treated females showing persistent diestrus resulted in successful mating, and almost all females got pregnant. However, increased implantation loss was observed at 10 mg/kg or more, which was considered to be caused by the adverse effect of sulpiride on oocyte development. From these results, sulpiride-induced ovarian toxicity was seen at 1 mg/kg or more in the 2- and 4-week repeated-dose toxicity studies, and the observed ovarian changes were considered to be related to adverse effects on female fertility.

  4. Advanced turbine systems: Studies and conceptual design

    Energy Technology Data Exchange (ETDEWEB)

    van der Linden, S.; Gnaedig, G.; Kreitmeier, F.

    1993-11-01

    The ABB selection for the Advanced Turbine System (ATS) includes advanced developments especially in the hot gas path of the combustion turbine and new state-of-the-art units such as the steam turbine and the HRSG. The increase in efficiency by more than 10% multiplicative compared to current designs will be based on: (1) Turbine Inlet Temperature Increase; (2) New Cooling Techniques for Stationary and Rotating Parts; and New Materials. Present, projected component improvements that will be introduced with the above mentioned issues will yield improved CCSC turbine performance, which will drive the ATS selected gas-fired reference CC power plant to 6 % LHV or better. The decrease in emission levels requires a careful optimization of the cycle design, where cooling air consumption has to be minimized. All interfaces of the individual systems in the complete CC Plant need careful checks, especially to avoid unnecessary margins in the individual designs. This study is an important step pointing out the feasibility of the ATS program with realistic goals set by DOE, which, however, will present challenges for Phase II time schedule of 18 months. With the approach outlined in this study and close cooperation with DOE, ATS program success can be achieved to deliver low emissions and low cost of electricity by the year 2002. The ABB conceptual design and step approach will lead to early component demonstration which will help accelerate the overall program objectives.

  5. Service Design, insights from nine case studies

    NARCIS (Netherlands)

    Enninga, Tanja; Manschot, M.M.; Gessel, C. van; Gijbels, J.; Lugt, Remko van der; Sleeswijk Visser, Sjoukje; Verhoeven, Fenne; Godfroij, Berit

    2013-01-01

    Service design is literally the design of services. Service designers improve existing services or design completely new ones. Nothing new so far. Services have been around for centuries, and every service was conceived and designed by someone. However, service design takes a different angle; a diff

  6. Investigating Repeater Effects on Chained Equipercentile Equating with Common Anchor Items

    Science.gov (United States)

    Kim, Sooyeon; Walker, Michael E.

    2012-01-01

    This study investigated the impact of repeat takers of a licensure test on the equating functions in the context of a nonequivalent groups with anchor test (NEAT) design. Examinees who had taken a new, to-be-equated form of the test were divided into three subgroups according to their previous testing experience: (a) repeaters who previously took…

  7. A Comparison of Two Reading Fluency Methods: Repeated Readings to a Fluency Criterion and Interval Sprinting

    Science.gov (United States)

    Kostewicz, Douglas E.; Kubina, Richard M., Jr.

    2010-01-01

    Teachers have used the method of repeated readings to build oral reading fluency in students with and without special needs. A new fluency building intervention called interval sprinting uses shorter timing intervals (i.e., sprints) across a passage. This study used an alternating treatment design to compare repeated readings and interval…

  8. Interim report on the tandem mirror hybrid design study

    Energy Technology Data Exchange (ETDEWEB)

    Moir, R.W. (ed.)

    1979-08-01

    The initial phase of a 2-year design study of a tandem mirror fusion reactor is presented. The following chapters are included: (1) mechanical design of the plant; (2) plasma physics; (3) blanket design; (4) magnet design; (5) injector design; (6) direct convertor design; (7) balance of plant design; (8) fission burner reactor; (9) environment and safety; and (10) economic analysis. (MOW)

  9. TU-AB-BRA-05: Repeatability of [F-18]-NaF PET Imaging Biomarkers for Bone Lesions: A Multicenter Study

    Energy Technology Data Exchange (ETDEWEB)

    Lin, C; Bradshaw, T; Perk, T; Harmon, S; Jeraj, R [University of Wisconsin - Madison, School of Medicine and Public Health, Madison, WI (United States); Liu, G

    2015-06-15

    Purpose: Quantifying the repeatability of imaging biomarkers is critical for assessing therapeutic response. While therapeutic efficacy has been traditionally quantified by SUV metrics, imaging texture features have shown potential for use as quantitative biomarkers. In this study we evaluated the repeatability of quantitative {sup 18}F-NaF PET-derived SUV metrics and texture features in bone lesions from patients in a multicenter study. Methods: Twenty-nine metastatic castrate-resistant prostate cancer patients received whole-body test-retest NaF PET/CT scans from one of three harmonized imaging centers. Bone lesions of volume greater than 1.5 cm{sup 3} were identified and automatically segmented using a SUV>15 threshold. From each lesion, 55 NaF PET-derived texture features (including first-order, co-occurrence, grey-level run-length, neighbor gray-level, and neighbor gray-tone difference matrix) were extracted. The test-retest repeatability of each SUV metric and texture feature was assessed with Bland-Altman analysis. Results: A total of 315 bone lesions were evaluated. Of the traditional SUV metrics, the repeatability coefficient (RC) was 12.6 SUV for SUVmax, 2.5 SUV for SUVmean, and 4.3 cm{sup 3} for volume. Their respective intralesion coefficients of variation (COVs) were 12%, 17%, and 6%. Of the texture features, COV was lowest for entropy (0.03%) and highest for kurtosis (105%). Lesion intraclass correlation coefficient (ICC) was lowest for maximum correlation coefficient (ICC=0.848), and highest for entropy (ICC=0.985). Across imaging centers, repeatability of texture features and SUV varied. For example, across imaging centers, COV for SUVmax ranged between 11–23%. Conclusion: Many NaF PET-derived SUV metrics and texture features for bone lesions demonstrated high repeatability, such as SUVmax, entropy, and volume. Several imaging texture features demonstrated poor repeatability, such as SUVtotal and SUVstd. These results can be used to establish

  10. Effects of repeatability measures on results of fMRI sICA: a study on simulated and real resting-state effects.

    Science.gov (United States)

    Remes, Jukka J; Starck, Tuomo; Nikkinen, Juha; Ollila, Esa; Beckmann, Christian F; Tervonen, Osmo; Kiviniemi, Vesa; Silven, Olli

    2011-05-15

    Spatial independent components analysis (sICA) has become a widely applied data-driven method for fMRI data, especially for resting-state studies. These sICA approaches are often based on iterative estimation algorithms and there are concerns about accuracy due to noise. Repeatability measures such as ICASSO, RAICAR and ARABICA have been introduced as remedies but information on their effects on estimates is limited. The contribution of this study was to provide more of such information and test if the repeatability analyses are necessary. We compared FastICA-based ordinary and repeatability approaches concerning mixing vector estimates. Comparisons included original FastICA, FSL4 Melodic FastICA and original and modified ICASSO. The effects of bootstrapping and convergence threshold were evaluated. The results show that there is only moderate improvement due to repeatability measures and only in the bootstrapping case. Bootstrapping attenuated power from time courses of resting-state network related ICs at frequencies higher than 0.1 Hz and made subsets of low frequency oscillations more emphasized IC-wise. The convergence threshold did not have a significant role concerning the accuracy of estimates. The performance results suggest that repeatability measures or strict converge criteria might not be needed in sICA analyses of fMRI data. Consequently, the results in existing sICA fMRI literature are probably valid in this sense. A decreased accuracy of original bootstrapping ICASSO was observed and corrected by using centrotype mixing estimates but the results warrant for thorough evaluations of data-driven methods in general. Also, given the fMRI-specific considerations, further development of sICA methods is strongly encouraged. Copyright © 2010 Elsevier Inc. All rights reserved.

  11. Mining of simple sequence repeats in the Genome of Gentianaceae

    Directory of Open Access Journals (Sweden)

    R Sathishkumar

    2011-01-01

    Full Text Available Simple sequence repeats (SSRs or short tandem repeats are short repeat motifs that show high level of length polymorphism due to insertion or deletion mutations of one or more repeat types. Here, we present the detection and abundance of microsatellites or SSRs in nucleotide sequences of Gentianaceae family. A total of 545 SSRs were mined in 4698 nucleotide sequences downloaded from the National Center for Biotechnology Information (NCBI. Among the SSR sequences, the frequency of repeat type was about 429 -mono repeats, 99 -di repeats, 15 -tri repeats, and 2 --hexa repeats. Mononucleotide repeats were found to be abundant repeat types, about 78%, followed by dinucleotide repeats (18.16% among the SSR sequences. An attempt was made to design primer pairs for 545 identified SSRs but these were found only for 169 sequences.

  12. Design and analysis of biomedical studies

    DEFF Research Database (Denmark)

    Hansen, Merete Kjær

    Biomedicine is a field that has great influence on the majority of mankind. The constant development has considerably changed our way of life during the last centuries. This has been achieved through the dedication of biomedical researchers along with the tremendous ressources that over time have...... been allocated this field. It is utterly important to utilize these ressources responsibly and efficiently by constantly striving to ensure high-quality biomedical studies. This involves the use of a sound statistical methodology regarding both the design and analysis of biomedical studies. The focus...... for biomedical studies are a recurring theme in this thesis. Data collected in some biomedical studies are positively skewed; hence methods relying on the normal distribution are not directly applicable. We investigated how data from one of these studies are suitably analyzed. We extracted 23 different summary...

  13. Quantitative methods for studying design protocols

    CERN Document Server

    Kan, Jeff WT

    2017-01-01

    This book is aimed at researchers and students who would like to engage in and deepen their understanding of design cognition research. The book presents new approaches for analyzing design thinking and proposes methods of measuring design processes. These methods seek to quantify design issues and design processes that are defined based on notions from the Function-Behavior-Structure (FBS) design ontology and from linkography. A linkograph is a network of linked design moves or segments. FBS ontology concepts have been used in both design theory and design thinking research and have yielded numerous results. Linkography is one of the most influential and elegant design cognition research methods. In this book Kan and Gero provide novel and state-of-the-art methods of analyzing design protocols that offer insights into design cognition by integrating segmentation with linkography by assigning FBS-based codes to design moves or segments and treating links as FBS transformation processes. They propose and test ...

  14. Design Study for Pulsed Proton Beam Generation

    Directory of Open Access Journals (Sweden)

    Han-Sung Kim

    2016-02-01

    Full Text Available Fast neutrons with a broad energy spectrum, with which it is possible to evaluate nuclear data for various research fields such as medical applications and the development of fusion reactors, can be generated by irradiating proton beams on target materials such as beryllium. To generate short-pulse proton beam, we adopted a deflector and slit system. In a simple deflector with slit system, most of the proton beam is blocked by the slit, especially when the beam pulse width is short. Therefore, the available beam current is very low, which results in low neutron flux. In this study, we proposed beam modulation using a buncher cavity to increase the available beam current. The ideal field pattern for the buncher cavity is sawtooth. To make the field pattern similar to a sawtooth waveform, a multiharmonic buncher was adopted. The design process for the multiharmonic buncher includes a beam dynamics calculation and three-dimensional electromagnetic simulation. In addition to the system design for pulsed proton generation, a test bench with a microwave ion source is under preparation to test the performance of the system. The design study results concerning the pulsed proton beam generation and the test bench preparation with some preliminary test results are presented in this paper.

  15. Multi-Band Feeds: A Design Study

    CERN Document Server

    Maan, Yogesh; Raja, Wasim; Mehta, Nikhil

    2012-01-01

    Broadband antenna feeds are of particular interest to existing and future radio telescopes for multi-frequency studies of astronomical sources. Although a 1:15 range in frequency is difficult to achieve, the well-known Eleven feed design offers a relatively uniform response over such a range, and reasonably well-matched responses in E & H planes. However, given the severe Radio Frequency Interference in several bands over such wide spectral range, one desires to selectively reject the corresponding bands. With this view, we have explored the possibilities of having a multi-band feed antenna spanning a wide frequency range, but which would have good response only in a number of pre-selected (relatively) RFI-free windows (for a particular telescope-site). The designs we have investigated use the basic configuration of pairs of dipoles as in the Eleven feed, but use simple wire dipoles instead of folded dipoles used in the latter. From our study of the two designs we have investigated, we find that the desig...

  16. A study of the evolution of inverted-topology repeats from LeuT-fold transporters using AlignMe.

    Science.gov (United States)

    Khafizov, Kamil; Staritzbichler, René; Stamm, Marcus; Forrest, Lucy R

    2010-12-21

    X-ray crystal structures have revealed that numerous secondary transporter proteins originally categorized into different sequence families share similar structures, namely, the LeuT fold. The core of this fold consists of two units of five transmembrane helices, whose conformations have been proposed to exchange to form the two alternate states required for transport. That these two units are related implies that LeuT-like transporters evolved from gene-duplication and fusion events. Thus, the origins of this structural repeat may be relevant to the evolution of transport function. However, the lack of significant sequence similarity requires sensitive sequence search methods for analyzing their evolution. To this end, we developed a software application called AlignMe, which can use various types of input information, such as residue hydrophobicity, to perform pairwise alignments of sequences and/or of hydropathy profiles of (membrane) proteins. We used AlignMe to analyze the evolutionary relationships between repeats of the LeuT fold. In addition, we identified proteins from the so-called DedA family that potentially share a common ancestor with these repeats. DedA domains have been implicated in, e.g., selenite uptake; they are found widely distributed across all kingdoms of life; two or more DedA domains are typically found per genome, and some may adopt dual topologies. These results suggest that DedA proteins existed in ancient organisms and may function as dimers, as required for a would-be ancestor of the LeuT fold. In conclusion, we provide novel insights into the evolution of this important structural motif and thus potentially into the alternating-access mechanism of transport itself.

  17. Repeat-pulse 13CO2 labeling of canola and field pea: implications for soil organic matter studies.

    Science.gov (United States)

    Sangster, Amy; Knight, Diane; Farrell, Richard; Bedard-Haughn, Angela

    2010-10-15

    Both the quantity and quality of plant residues can impact soil properties and processes. Isotopic tracers can be used to trace plant residue decomposition if the tracer is homogeneously distributed throughout the plant. Continuous labeling will homogeneously label plants but is not widely accessible because elaborate equipment is needed. In order to determine if the more accessible repeat-pulse labeling method could be used to trace plant residue decomposition, this labeling procedure was employed using (13)CO(2) to enrich field pea and canola plants in a controlled environment. Plants were exposed weekly to pulses of 33 atom% (13)CO(2) and grown to maturity. The distribution of the label throughout the plant parts (roots, stem, leaves, and pod) and biochemical fractions (ADF and ADL) was determined. The label was not homogeneously distributed throughout the plant; in particular, the pod fractions were less enriched than other fractions indicating the importance of continuing labeling well into plant maturity for pod-producing plants. The ADL fraction was also less enriched than the ADF fraction. Because of the heterogeneity of the label throughout the plant, caution should be applied when using the repeat-pulse method to trace the fate of (13)C-labeled residues in the soil. However, root contributions to below-ground C were successfully determined from the repeat-pulse labeled root material, as was (13)C enrichment of soil within the top 15 cm. Canola contributed more above- and below-ground residue C than field pea; however, canola was also higher in ADF and ADL fractions indicating a more recalcitrant residue.

  18. X-ray tubes study and design

    CERN Document Server

    Sardari, D

    1990-01-01

    This thesis contain both theoretical and experimental works. Theoretical aspect includes X-Ray tubes case study and design principles, in the introduced design process, anode-cathode distance, vacuum needed, filament size, anode face angle and shape and size of focusing electrodes can be found. A method for specification of tungsten lager thickness on anode is also introduced. Using computer simulation, electron trajectory between cathode-anode is obtained, This work is presented in the first International Conference on Control and Modeling, Tehran, 1990. Experimental work contains manufacturing more than 10 tubes and test each of them. One of these tubes can with stand up to 50 KV. Filament can be heated by passing a 2.1 A current. In these conditions anode current is 1.2 m A. Using this tube, some radiographs have been taken.

  19. Association between secondhand smoke exposure at home and cigarette gifting and sharing in Zhejiang, China: a repeat cross-sectional study.

    Science.gov (United States)

    Xu, Yue; Xu, ShuiYang; Wu, QingQing; Guo, YuJie

    2016-03-03

    The aims of the current study were to assess the prevalence of household cigarette gifting and sharing, and to evaluate the relationship between secondhand smoke (SHS) exposure, and cigarette gifting and sharing, in Zhejiang, China. A repeat cross-sectional design. 10 sites in 5 cities in Zhejiang, China. Two surveys were conducted with adults in Zhejiang, China, in 2010 (N=2112) and 2012 (N=2279), respectively. At both waves, the same questionnaire was used; respondents were asked questions on residence, number of family smokers, indoor smoking rules, household income and cigarette gifting and sharing. The findings revealed that more than half of respondents' families (54.50% in 2010, 52.79% in 2012) reported exposure to SHS. Many families (54.73% in 2010, 47.04% in 2012) shared cigarettes with others, and a minority (14.91% in 2010, 14.17% in 2012) reported their family giving cigarettes as a gift. There was a significant decrease in cigarette sharing from 2010 to 2012, irrespective of household with SHS exposure status; and the cigarette gifting was significantly decreased in household without SHS exposure. Compared to households without SHS exposure, the prevalence of cigarette gifting and sharing in households with SHS exposure was more obvious. Encouraging and promoting a smoke-free household environment is necessary to change public smoking customs in Zhejiang, China. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  20. Evaluation of a repeated dose liver micronucleus assay in rats treated with two genotoxic hepatocarcinogens, dimethylnitrosamine and 2-acetylaminofluorene: the possibility of integrating micronucleus tests with multiple tissues into a repeated dose general toxicity study.

    Science.gov (United States)

    Takashima, Rie; Takasawa, Hironao; Kawasako, Kazufumi; Ohyama, Wakako; Okada, Emiko; Narumi, Kazunori; Fujiishi, Yohei; Wako, Yumi; Yasunaga, Katsuaki; Hattori, Akiko; Kawabata, Masayoshi; Nakadate, Kiyoko; Nakagawa, Munehiro; Hamada, Shuichi

    2015-03-01

    As part of a collaborative study by the Collaborative Study Group for Micronucleus Test (CSGMT) of the Mammalian Mutagenicity Study Group (MMS) in the Japanese Environmental Mutagen Society (JEMS), the present study evaluated the effectiveness of the repeated dose liver micronucleus (RDLMN) assay. Two genotoxic hepatocarcinogens, dimethylnitrosamine (DMN) and 2-acetylaminofluorene (2-AAF), were administered orally to male rats (6 weeks old at the initial dosing) once daily for 14 and 28 days to evaluate the micronucleus (MN) inducibility in the liver. In addition, these chemicals were evaluated for MN inducibility in the bone marrow (BM) and gastrointestinal (GI) tract, i.e. glandular stomach and colon of the same animals used in the RDLMN assay. As a result, both chemicals produced positive results in the liver, although a weak positive response was given by 2-AAF. DMN gave negative results in the tissues other than the liver. 2-AAF produced positive responses in the BM and glandular stomach, and a prominent response was particularly observed in the glandular stomach, which is directly exposed to the test chemicals by gavage. The present results suggest that the RDLMN assay is a useful method for detecting genotoxic hepatocarcinogens, and that it is especially effective for evaluating test chemicals, such as DMN, undetectable by the BM and GI tract MN assay. Moreover, the results in this investigation indicate that the use of multiple tissues in the study integrating the MN tests is more effective than using a single tissue, for detection of the MN induction produced by chemical exposure to rats, and helps to determine the characteristics of the test chemicals.

  1. Design Study: Rocket Based MHD Generator

    Science.gov (United States)

    1997-01-01

    This report addresses the technical feasibility and design of a rocket based MHD generator using a sub-scale LOx/RP rocket motor. The design study was constrained by assuming the generator must function within the performance and structural limits of an existing magnet and by assuming realistic limits on (1) the axial electric field, (2) the Hall parameter, (3) current density, and (4) heat flux (given the criteria of heat sink operation). The major results of the work are summarized as follows: (1) A Faraday type of generator with rectangular cross section is designed to operate with a combustor pressure of 300 psi. Based on a magnetic field strength of 1.5 Tesla, the electrical power output from this generator is estimated to be 54.2 KW with potassium seed (weight fraction 3.74%) and 92 KW with cesium seed (weight fraction 9.66%). The former corresponds to a enthalpy extraction ratio of 2.36% while that for the latter is 4.16%; (2) A conceptual design of the Faraday MHD channel is proposed, based on a maximum operating time of 10 to 15 seconds. This concept utilizes a phenolic back wall for inserting the electrodes and inter-electrode insulators. Copper electrode and aluminum oxide insulator are suggested for this channel; and (3) A testing configuration for the sub-scale rocket based MHD system is proposed. An estimate of performance of an ideal rocket based MHD accelerator is performed. With a current density constraint of 5 Amps/cm(exp 2) and a conductivity of 30 Siemens/m, the push power density can be 250, 431, and 750 MW/m(sup 3) when the induced voltage uB have values of 5, 10, and 15 KV/m, respectively.

  2. Heart rate variability and DNA methylation levels are altered after short-term metal fume exposure among occupational welders: a repeated-measures panel study

    OpenAIRE

    2014-01-01

    Background: In occupational settings, boilermakers are exposed to high levels of metallic fine particulate matter (PM2.5) generated during the welding process. The effect of welding PM2.5 on heart rate variability (HRV) has been described, but the relationship between PM2.5, DNA methylation, and HRV is not known. Methods: In this repeated-measures panel study, we recorded resting HRV and measured DNA methylation levels in transposable elements Alu and long interspersed nuclear element-1 (LINE...

  3. Repeating Input-Based Tasks with Young Beginner Learners

    Science.gov (United States)

    Shintani, Natsuko

    2012-01-01

    The study reported in this article investigated task-repetition with young Japanese children. Fifteen children with no prior knowledge of English completed a communicative listening task that was designed to introduce new vocabulary. The same task was repeated nine times over five weeks. In line with Allwright's (1984) claim that "interaction…

  4. Modelling studies on neurodegenerative disease-causing triplet repeat sequences d(GGC/GCC)n and d(CAG/CTG)n

    Indian Academy of Sciences (India)

    Shibasish Chowdhury; Manju Bansal

    2001-12-01

    Model building and molecular mechanics studies have been carried out to examine the potential structures for d(GGC/GCC)5 and d(CAG/CTG)5 that might relate to their biological function and association with triplet repeat expansion diseases. Model building studies suggested that hairpin and quadruplex structures could be formed with these repeat sequences. Molecular mechanics studies have demonstrated that the hairpin and hairpin dimer structures of triplet repeat sequences formed by looping out of the two strands are as favourable as the corresponding B-DNA type hetero duplex structures. Further, at high salt condition, Greek key type quadruplex structures are energetically comparable with hairpin dimer and B-DNA type duplex structures. All tetrads in the quadruplex structures are well stacked and provide favourable stacking energy values. Interestingly, in the energy minimized hairpin dimer and Greek key type quadruplex structures, all the bases even in the non-G tetrads are cyclically hydrogen bonded, even though the A, C and T-tetrads were not hydrogen bonded in the starting structures.

  5. Variability and impact on design of bioequivalence studies.

    Science.gov (United States)

    Van Peer, Achiel

    2010-03-01

    In 2008, the European Agency for the Evaluation of Medicinal Products released a draft guidance on the investigation of bioequivalence for immediate release dosage forms with systemic action to replace the former guidance of a decade ago. Revisions of the regulatory guidance are based upon many questions over the past years and sometimes continuing scientific discussions on the use of the most suitable statistical analysis methods and study designs, particularly for drugs and drug products with high within-subject variability. Although high within-subject variability is usually associated with a coefficient of variation of 30% or more, new approaches are available in the literature to allow a gradual increase and a levelling off of the bioequivalence limits to some maximum wider values (e.g. 75-133%), dependent on the increase in the within-subject variability. The two-way, cross-over single dose study measuring parent drug is still the design of first choice. A partial replicate design with repeating the reference product and scaling the bioequivalence for the reference variability are proposed for drugs with high within-subject variability. In case of high variability, more regulatory authorities may accept a two-stage or group-sequential bioequivalence design using appropriately adjusted statistical analysis. This review also considers the mechanisms why drugs and drug products may exhibit large variability. The physiological complexity of the gastrointestinal tract and the interaction with the physicochemical properties of drug substances may contribute to the variation in plasma drug concentration-time profiles of drugs and drug products and to variability between and within subjects. A review of submitted bioequivalence studies at the Food and Drug Administration's Office of Generic Drugs over the period 2003-2005 indicated that extensive pre-systemic metabolism of the drug substance was the most important explanation for consistently high variability drugs

  6. Study on critical heat flux in narrow rectangular channel with repeated-rib roughness. 1. Experimental facility and preliminary experiments

    Energy Technology Data Exchange (ETDEWEB)

    Kinoshita, Hidetaka; Terada, Atsuhiko; Kaminaga, Masanori; Hino, Ryutaro [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    2001-10-01

    In the design of a spallation target system, the water cooling system, for example a proton beam window and a safety hull, is used with narrow channels, in order to remove high heat flux and prevent lowering of system performance by absorption of neutron. And in narrow channel, heat transfer enhancement using 2-D rib is considered for reduction the cost of cooling component and decrease inventory of water in the cooling system, that is, decrease of the amount of irradiated water. But few studies on CHF with rib have been carried out. Experimental and analytical studies with rib-roughened test section, in 10:1 ratio of pitch to height, are being carried out in order to clarify the CHF in rib-roughened channel. This paper presents the review of previous researches on heat transfer in channel with rib roughness, overview of the test facility and the preliminary experimental and analytical results. As a result, wall friction factors were about 3 times as large as that of smooth channel, and heat transfer coefficients are about 2 times as large as that of smooth channel. The obtained CHF was as same as previous mechanistic model by Sudo. (author)

  7. Study and Design of LED Lighting Systems

    Directory of Open Access Journals (Sweden)

    Li Cheng

    2013-06-01

    Full Text Available In this study, the optical characteristics, thermal characteristics, electrical characteristics of the LED device are studied. After analysis of the significance of the optical model, we establish the model of the LED light source using optical simulation software to analyze the impact of modeling four factors and law, based on ray tracing model intensity distribution with the manufacturers. On this basis, we expand the LED secondary optical design, namely, increasing of LDE method to the light level. After comparing different forms of non-imaging optical components, combined with the actual situation, the final choice is the system composed of rotating parabolic reflector with LDE. Besides, the reflected changing the relative position of the body and LDE space lead to the normal light intensity of the entire system appearing two peaks, but their causes are different. In addition, the method of combining theoretical analysis and computer simulations to study the distribution of LDE array illumination is utilized. Formula on the illumination distribution in the LDB array to a plane parallel thereto is deduced, which is verified by computer simulation and agrees well with it. A quantitative study of the factors affecting the road surface illuminance distribution is made on the basis of previous study, combined with the actual road lighting works. These factors are: LDE array form, the number of LED, spacing between LDE, LDE interval between the street lamps. The derived entire road illumination distribution formula and the corresponding curve gives a basic method for the analysis of such practical problems related outcomes for the LDE illumination optical system design and research basis.

  8. Schemes of Repeater Optimizing Distribution based on the MLC Application and CBLRD Simulation

    Directory of Open Access Journals (Sweden)

    Qian Qiuye

    2013-07-01

    Full Text Available The widely use of repeaters raises concern about their coordination among the public. Since repeaters may suffer interaction and limitation bearing capacity, designing a reasonable repeaters coordination method is of great significance. This study address the problem if repeater coordination in a circular flat area with minimal number of repeaters with seamless coverage theory, system simulation method. With 1,000 users, this study model the coverage, getting the minimal number of repeaters of different coverage radius based on extensive used regular hexagon coverage theory. A numerical example was given in this case. When the number of users increases to 10,000, this study simulate to get the signal density across the area according to the consideration of repeaters and the different distribution of users, which are divided into uniform distribution, linear distribution, normal distribution and lognormal distribution. Then, Multi-Layer Coverage (MLC and Coverage by Link Rate Density (CBLRD are created as the distribution scheme on the area where repeat service demand is large. Moreover, for solution on the distribution of the repeaters with barriers, distribution schemes are given considering the transmission of VHF spectrums and the distribution of users around the barrier. Additionally, Spring Comfortable Degree (SCD is used for evaluation of the results and the developing tends are given to improve the model. Due to the reasonable assumption, the solution of repeater distribution is of pivotal reference value based on the reasonable results.

  9. Changes in surgical team performance and safety climate attitudes following expansion of perioperative services: a repeated-measures study.

    Science.gov (United States)

    Gillespie, Brigid M; Harbeck, Emma; Kang, Evelyn; Steel, Catherine; Fairweather, Nicole; Chaboyer, Wendy

    2017-08-10

    Objective The aim of the present study was to describe process changes in surgical team performance and team members' attitudes to safety culture following hospital relocation and expansion of perioperative services.Methods The study was a naturalistic study using structured observations and surveys to assess non-technical skills (NTS; i.e. communication, teamwork, situational awareness, decision making and leadership) in surgery. This interrupted time series design used mixed-linear regression models to examine the effect of phase (before and after hospital relocation) on surgical teams' NTS and their processes that may affect performance. Differences in self-reported teamwork and safety climate attitudes were also examined.Results In all, 186 procedures (100 before and 81 after hospital relocation) were observed across teams working in general, paediatric, orthopaedic and thoracic surgeries. Interobserver agreement ranged from 86% to 95%. An effect of phase was found, indicating that there were significant improvements after relocation in the use of NTS by the teams observed (P=0.020; 95% confidence interval 1.9-4.7).Conclusions The improvements seen in surgical teams' NTS performance and safety culture attitudes may be related to the move to a new state-of-the-art perioperative department.What is known about the topic? Patient safety in surgery relies on optimal team performance, underpinned by effective NTS.What does this paper add? The NTS of surgical teams may be improved through ergonomic innovations that promote teams' shared mental models.What are the implications for practitioners? Effective multidisciplinary teamwork relies on a combination of NTS and ergonomic factors, which inherently contribute to team performance and safety climate attitudes.

  10. Rationale, design, and methodology for the optimizing outcomes in women with gestational diabetes mellitus and their infants study

    OpenAIRE

    Berry, Diane C.; Neal, Madeline; Hall, Emily G; Schwartz, Todd A; Verbiest, Sarah; Bonuck, Karen; Goodnight, William; Brody, Seth; Dorman, Karen F; Menard, Mary K; Stuebe, Alison M.

    2013-01-01

    Background Women who are diagnosed with gestational diabetes mellitus (GDM) are at increased risk for developing prediabetes and type 2 diabetes mellitus (T2DM). To date, there have been few interdisciplinary interventions that target predominantly ethnic minority low-income women diagnosed with GDM. This paper describes the rationale, design and methodology of a 2-year, randomized, controlled study being conducted in North Carolina. Methods/Design Using a two-group, repeated measures, experi...

  11. Rationale, design, and methodology for the optimizing outcomes in women with gestational diabetes mellitus and their infants study

    OpenAIRE

    Berry, Diane C.; Neal, Madeline; Hall, Emily G.; Schwartz, Todd A.; Verbiest, Sarah; Bonuck, Karen; Goodnight, William; Brody, Seth; Dorman, Karen F; Menard, Mary K; Stuebe, Alison M.

    2013-01-01

    Background Women who are diagnosed with gestational diabetes mellitus (GDM) are at increased risk for developing prediabetes and type 2 diabetes mellitus (T2DM). To date, there have been few interdisciplinary interventions that target predominantly ethnic minority low-income women diagnosed with GDM. This paper describes the rationale, design and methodology of a 2-year, randomized, controlled study being conducted in North Carolina. Methods/Design Using a two-group, repeated measures, experi...

  12. A comparative evaluation of tray spacer thickness and repeat pour on the accuracy of monophasic polyvinyl siloxane impression material: In vitro study

    Directory of Open Access Journals (Sweden)

    Sandeep Kumar

    2014-01-01

    Full Text Available Purpose: This study was aimed to determine the effect of various tray spacer thickness and subsequent repeated pours on the accuracy and dimensional stability of the impression made from monophasic polyvinyl siloxane material. Materials and Methods: Custom trays with different spacer thickness (2, 4 and 6 mm were used for making an impression of a master model simulating 3 unit fixed partial denture with monophasic polyvinyl siloxane material. These impressions were poured with die stone and repoured. Distance between the reference points were measured and subjected to statistical analysis. Result: Casts obtained from 1 st , 2 nd and 3 rd pour of the impression in 2, 4 and 6 mm spacer thickness tray have similar dimensional accuracy amongst each other and with the master model except in molar diameter and inter-abutment distances of cast obtained from 6 mm spacer thickness tray. Conclusion: The vertical distance of stone dies were decreased, whereas horizontal distance increased as the thickness of impression material is increased. There were statistically non-significant changes occurring among the repeated pours in 2, 4 and 6 mm spacer thickness. Clinical Implication: 2 and 4 mm spacer thickness are acceptable for making an impression for three unit fixed partial denture with monophasic polyvinyl siloxane material and it was not affected by two subsequent (1 st and 2 nd repeated pours.

  13. Vaginal birth after cesarean section (VBAC versus emergency repeat cesarean section at teaching hospitals in India: an ICMR task force study

    Directory of Open Access Journals (Sweden)

    B. S. Dhillon

    2014-06-01

    Results: A total of 155863 deliveries occurred during the study duration, there were 28.1% (n=43824 cesarean section and (10.1% (n=15664 were the number of previous cesarean section. In 84% (n=13151 had repeat cesarean delivery and 2513 (16% delivered vaginally. A trial of labor was planned in 4035 (25.8% women. The success rate of VBAC was 62.3% with 2513 women had successful vaginal delivery and 1522 (37.7% delivered by emergency repeat cesarean section. Major indication of emergency cesarean section was CPD (52.9%, foetal distress (25.8%, severe PIH/eclampsia (5.0%, previous 2 CS (0.7%, APH (1.4% and others (2.7%. In majority, surgical technique was conventional and in 3.7% the Misgav-Ladach technique was used. Scar dehiscence and surgical complications were observed in 5.4% and 4.0% of cases respectively. Blood transfusion was given in 7.0% and post-operative complications were seen in 6.8%. Perinatal and maternal mortality was 18.0/1000 and 257/100000 deliveries respectively. Conclusions: Safety in childbirth for women with prior cesarean is a major public health concern. Repeat caesarean section and planned vaginal birth after cesarean section are both associated with benefits and harms and correct management represents one of the most significant and challenging issues in obstetric practice. [Int J Reprod Contracept Obstet Gynecol 2014; 3(3.000: 592-597

  14. The effect of repeated immersion of gypsum cast in sodium hypochlorite and glutaraldehyde on its physical properties: An in vitro study

    Directory of Open Access Journals (Sweden)

    Rachuri Narendra Kumar

    2012-01-01

    Full Text Available Background: One method used to disinfect a dental cast is immersion in a disinfecting solution. Repeated immersion of a cast in disinfectant may affect its physical properties. Purpose: The purpose of this study was to evaluate the changes in dimensional accuracy and hardness of the dental casts as a result of repeated disinfection in 0.525% sodium hypochlorite and 2% glutaraldehyde solutions. Materials and Methods: Sixty specimens were made of type III dental stone. Twenty specimens were immersed in slurry, a supernatant solution of calcium sulfate in distilled water (control casts, 20 specimens in 0.525% sodium hypochlorite, and 20 specimens in 2% glutaraldehyde solutions for 30 min and air dried for 24 h. This process was repeated for 7 times for testing. Linear dimensional change and hardness were determined according to American National Standards Institute/American Dental Association (ANSI/ADA standards. The data were analyzed using two-way analysis of variance. Results: For specimens prepared with type III stones, treatment was by immersion in slurry (group I - control casts, and by immersion in 0.525% sodium hypochlorite (group II - test group 1 and in 2% glutaraldehyde solution (group III - test group 2. The specimens treated with sodium hypochlorite and glutaraldehyde showed more linear dimensional change compared to the specimens treated in slurry. However, the difference between test casts and control casts was significant. But the difference between the two test groups was not significant. Both the test groups showed decrease in hardness of the specimens compared to that specimens in control group. But the difference between two test groups was not significant in hardness.However,the values remained close to ANSI/ADA standards. Conclusion: The results demonstrated that repeated immersion of type III dental stone specimens in slurry with distilled water, 0.525% sodium hypochlorite and 2% glutaraldehyde, along with drying in air

  15. Personal semantics: Is it distinct from episodic and semantic memory? An electrophysiological study of memory for autobiographical facts and repeated events in honor of Shlomo Bentin.

    Science.gov (United States)

    Renoult, Louis; Tanguay, Annick; Beaudry, Myriam; Tavakoli, Paniz; Rabipour, Sheida; Campbell, Kenneth; Moscovitch, Morris; Levine, Brian; Davidson, Patrick S R

    2016-03-01

    Declarative memory is thought to consist of two independent systems: episodic and semantic. Episodic memory represents personal and contextually unique events, while semantic memory represents culturally-shared, acontextual factual knowledge. Personal semantics refers to aspects of declarative memory that appear to fall somewhere in between the extremes of episodic and semantic. Examples include autobiographical knowledge and memories of repeated personal events. These two aspects of personal semantics have been studied little and rarely compared to both semantic and episodic memory. We recorded the event-related potentials (ERPs) of 27 healthy participants while they verified the veracity of sentences probing four types of questions: general (i.e., semantic) facts, autobiographical facts, repeated events, and unique (i.e., episodic) events. Behavioral results showed equivalent reaction times in all 4 conditions. True sentences were verified faster than false sentences, except for unique events for which no significant difference was observed. Electrophysiological results showed that the N400 (which is classically associated with retrieval from semantic memory) was maximal for general facts and the LPC (which is classically associated with retrieval from episodic memory) was maximal for unique events. For both ERP components, the two personal semantic conditions (i.e., autobiographical facts and repeated events) systematically differed from semantic memory. In addition, N400 amplitudes also differentiated autobiographical facts from unique events. Autobiographical facts and repeated events did not differ significantly from each other but their corresponding scalp distributions differed from those associated with general facts. Our results suggest that the neural correlates of personal semantics can be distinguished from those of semantic and episodic memory, and may provide clues as to how unique events are transformed to semantic memory.

  16. Ambient particulate air pollution and circulating antioxidant enzymes: A repeated-measure study in healthy adults in Beijing, China.

    Science.gov (United States)

    Wu, Shaowei; Wang, Bin; Yang, Di; Wei, Hongying; Li, Hongyu; Pan, Lu; Huang, Jing; Wang, Xin; Qin, Yu; Zheng, Chanjuan; Shima, Masayuki; Deng, Furong; Guo, Xinbiao

    2016-01-01

    The association of systemic antioxidant activity with ambient air pollution has been unclear. A panel of 40 healthy college students underwent repeated blood collection for 12 occasions under three exposure scenarios before and after relocating from a suburban area to an urban area in Beijing, China in 2010-2011. We measured various air pollutants including fine particles (PM2.5) and determined circulating levels of antioxidant enzymes extracellular superoxide dismutase (EC-SOD) and glutathione peroxidase 1 (GPX1) in the laboratory. An interquartile range increase of 63.4 μg/m(3) at 3-d PM2.5 moving average was associated with a 6.3% (95% CI: 0.6, 12.4) increase in EC-SOD and a 5.5% (95% CI: 1.3, 9.8) increase in GPX1. Several PM2.5 chemical constituents, including negative ions (nitrate and chloride) and metals (e.g., iron and strontium), were consistently associated with increases in EC-SOD and GPX1. Our results support activation of circulating antioxidant enzymes following exposure to particulate air pollution. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. A Study on the Efficiency Improvement of Dye-Sensitized Solar Cell (DSSC) by Repeated Dye Coating.

    Science.gov (United States)

    Seo, Young Ho; Choi, Eun Chang; Hong, Byungyou

    2015-10-01

    Dye-sensitized solar cell (DSSC) is being extensively investigated as the next generation energy source. Despite of the attractive features like simple fabrication process and its economic efficiency, there are some problems such as low efficiency, long fabrication time and low long-term stability. Conventionally, the dye adsorption on TiO2 photo-electrode film needs long time in the solvent with low concentration of dye to get the high efficiency. In this work, the dye coating process was considerably shortened, albeit plenty of dye was used comparing with the conventional way. Our needs were met for the best result in our working environment and the relevant conditions to our work were obtained, which were the coating temperature of 70 °C, the dye concentration of 10 mM and the coating time of 3 min. And this coating process was successively repeated several times to maximize the dye adsorption and to improve the cell efficiency. Therefore, the efficiency increased by 13% in the proper condition.

  18. Reconfigurable multiport EPON repeater

    Science.gov (United States)

    Oishi, Masayuki; Inohara, Ryo; Agata, Akira; Horiuchi, Yukio

    2009-11-01

    An extended reach EPON repeater is one of the solutions to effectively expand FTTH service areas. In this paper, we propose a reconfigurable multi-port EPON repeater for effective accommodation of multiple ODNs with a single OLT line card. The proposed repeater, which has multi-ports in both OLT and ODN sides, consists of TRs, BTRs with the CDR function and a reconfigurable electrical matrix switch, can accommodate multiple ODNs to a single OLT line card by controlling the connection of the matrix switch. Although conventional EPON repeaters require full OLT line cards to accommodate subscribers from the initial installation stage, the proposed repeater can dramatically reduce the number of required line cards especially when the number of subscribers is less than a half of the maximum registerable users per OLT. Numerical calculation results show that the extended reach EPON system with the proposed EPON repeater can save 17.5% of the initial installation cost compared with a conventional repeater, and can be less expensive than conventional systems up to the maximum subscribers especially when the percentage of ODNs in lightly-populated areas is higher.

  19. A case study in value design

    Directory of Open Access Journals (Sweden)

    M. Sinclair

    2003-12-01

    Full Text Available The design of a special type of valve gave rise to a problem which lead the mechanical engineers who designed the valve to call in the help of the author. The final solution to the problem may not be mathematically sophisticated (in fact, it may seem trivial to some readers, but the steps through which the design team struggled and the final approach which resulted in a practically feasible solution may be of interest to other practitioners.

  20. Study on the humanization design of Television

    Institute of Scientific and Technical Information of China (English)

    郝凌飞

    2015-01-01

    Since 1924 the world’s first television was born, and now the TV has entered every household, become necessary for life products. The TV design in order to better meet people’s needs, the concept of humanity is essential to human design principles in this article as a starting point to explore the design of the TV how to better “people-oriented”.

  1. Design studies on indoor green furniture

    Institute of Scientific and Technical Information of China (English)

    徐菲

    2014-01-01

    Furniture is an important part in people's daily life, if green furniture can be achieved, for people to have a deeper understanding of green design. This paper analyzes the importance and problems of the current lifestyle of people, leads to green furniture, as well as focusing on aspects of green design furniture. Proposed should follow the “nature-based” green design basis, because it is the basis of the nature and duration requested.

  2. Studying the Creation of Design Artifacts

    DEFF Research Database (Denmark)

    Davis, Christopher J.; Hevner, Ala n R.; Weber, Barbara

    2016-01-01

    and information systems represents a highly interconnected locus in which both the generative processes of building design artifacts and articulating constructs used to evaluate their quality take place. We address this interconnectedness with an extended process-oriented research design enabling multi......-modal neurophysiological data analyses. We posit that our research will provide more comprehensive assessments of the efficacy of design processes and the evaluation of the qualities of the resulting design artifacts.......As software and information systems (IS) increase in functional sophistication, perceptions of IS quality are changing. Moving beyond issues of performance efficiency, essential qualities such as fitness for purpose, sustainability, and overall effectiveness become more complex. Creating software...

  3. TU-C-12A-05: Repeatability Study of Reduced Field-Of-View Diffusion-Weighted MRI On Human Thyroid Gland

    Energy Technology Data Exchange (ETDEWEB)

    Shukla-Dave, A; Lu, Y; Hatzoglou, V; Stambuk, H; Mazaheri, Y [Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Banerjee, S; Shankaranarayanan, A [GE Healthcare, Menlo Park, California (United States); Deasy, J [Memorial Sloan Kettering Cancer Center, New York, NY (United States)

    2014-06-15

    Purpose: To investigate the repeatability of reduced field-of-view diffusion-weighted imaging (rFOV DWI) in quantifying apparent diffusion coefficients (ADCs) for human thyroid glands in a clinical setting. Methods: Nine healthy human volunteers were enrolled and underwent 3T MRI exams. For each volunteer, 3 longitudinal exams (2 weeks apart) with 2 repetitive sessions within each exam, including rFOV and conventional full field-of-view (fFOV) DWI scans, were performed. In the acquired DWI images, a fixed-size region of interest (ROI; diameter=8mm) was placed on thyroid glands to calculate ADC. ADC was calculated using a monoexponential function with a noise correction scheme. The repeatability of ADC was assessed by using coefficient variation (CV) across sessions or exams, which was defined to be: r = 1-CV, 0 < r < 1, where CV=STD/m, STD is the standard deviation of ADC, and m is the average of ADC across sessions or exams. An experienced radiologist assessed and scored rFOV and fFOV DW images based on image characteristics (1, nondiagnostic; 2, poor; 3, satisfactory; 4, good; and 5, excellent).Analysis of variance (ANOVA) was performed to compare ADC values, CV of ADC, repeatability of ADC across sessions and exams, and radiologic scores between rFOV and fFOV DWI techniques. Results: There was no significant difference in ADC values across sessions and exams either in rFOV or fFOV DWI. The average CVs of both rFOV and fFOV DWI were less than 13%. The repeatability of ADC measurement between rFOV and fFOV DWI was not significantly different. The overall image quality was significantly higher with rFOV DWI than with fFOV DWI. Conclusion: This study suggested that ADCs from both rFOV and fFOV DWI were repeatable, but rFOV DWI had superior imaging quality for human thyroid glands in a clinical setting.

  4. Self-assembly of designed coiled coil peptides studied by small-angle X-ray scattering and analytical ultracentrifugation

    DEFF Research Database (Denmark)

    Malik, Leila; Nygaard, Jesper; Christensen, Niels Johan;

    2013-01-01

    α-Helical coiled coil structures, which are noncovalently associated heptad repeat peptide sequences, are ubiquitous in nature. Similar amphipathic repeat sequences have also been found in helix-containing proteins and have played a central role in de novo design of proteins. In addition......, they are promising tools for the construction of nanomaterials. Small-angle X-ray scattering (SAXS) has emerged as a new biophysical technique for elucidation of protein topology. Here, we describe a systematic study of the self-assembly of a small ensemble of coiled coil sequences using SAXS and analytical...

  5. Design study of the storage ring EUTERPE

    Science.gov (United States)

    Xi, Boling; Botman, J. I. M.; Timmermans, C. J.; Hagedoorn, H. L.

    1992-05-01

    At present the 400 MeV electron storage ring EUTERPE is being constructed at the Eindhoven University of Technology. It is a university project set up for studies of charged particle beam dynamics and applications of synchroton radiation, and for the education of students in these fields. The design of the ring is described in this paper. Considering the requirements of users in different fields, a lattice based on a so-called triple bend achromat structure with a high flexibility has been chosen. With this lattice, different optical options, including the HBSB (high brightness, small beam), the SBL (short bunch length) and the HLF (high light flux) modes can be realized. A small emittance of 7 nm rad and a short bunch length of the order of several mm can be achieved. In the first phase the synchrotron radiation in the UV and XUV region (the critical wavelength is 8.3 nm) will be provided from the regular dipole magnets. Later on, a 10 T wiggler magnet and other special inserters will be added, and other applications and beam dynamics studies will be feasible. Bending magnets are of the parallel faced C configuration. The effective aperture of the vacuum chamber is 2.3 cm (vertical) in the bending magnets and 4.7 cm elsewhere with a working vacuum condition of 10-9 Torr. Collective effects have been studied initially. First calculations indicate that a lifetime of several hours, influenced by the Touschek effect and residual gas scattering will be achievable for a 200 mA beam in the HLF mode for the standard rf parameters. A 70 MeV racetrack microtron will serve as injector for the ring.

  6. A Case Study in CAD Design Automation

    Science.gov (United States)

    Lowe, Andrew G.; Hartman, Nathan W.

    2011-01-01

    Computer-aided design (CAD) software and other product life-cycle management (PLM) tools have become ubiquitous in industry during the past 20 years. Over this time they have continuously evolved, becoming programs with enormous capabilities, but the companies that use them have not evolved their design practices at the same rate. Due to the…

  7. Low vision goggles: optical design studies

    Science.gov (United States)

    Levy, Ofer; Apter, Boris; Efron, Uzi

    2006-08-01

    Low Vision (LV) due to Age Related Macular Degeneration (AMD), Glaucoma or Retinitis Pigmentosa (RP) is a growing problem, which will affect more than 15 million people in the U.S alone in 2010. Low Vision Aid Goggles (LVG) have been under development at Ben-Gurion University and the Holon Institute of Technology. The device is based on a unique Image Transceiver Device (ITD), combining both functions of imaging and Display in a single chip. Using the ITD-based goggles, specifically designed for the visually impaired, our aim is to develop a head-mounted device that will allow the capture of the ambient scenery, perform the necessary image enhancement and processing, and re-direct it to the healthy part of the patient's retina. This design methodology will allow the Goggles to be mobile, multi-task and environmental-adaptive. In this paper we present the optical design considerations of the Goggles, including a preliminary performance analysis. Common vision deficiencies of LV patients are usually divided into two main categories: peripheral vision loss (PVL) and central vision loss (CVL), each requiring different Goggles design. A set of design principles had been defined for each category. Four main optical designs are presented and compared according to the design principles. Each of the designs is presented in two main optical configurations: See-through system and Video imaging system. The use of a full-color ITD-Based Goggles is also discussed.

  8. Effect of repeated intracoronary injection of bone marrow cells in patients with ischaemic heart failure the Danish stem cell study - congestive heart failure trial (DanCell-CHF)

    DEFF Research Database (Denmark)

    Diederichsen, A.C.; Møller, Jacob Eifer; Thayssen, P.;

    2008-01-01

    BACKGROUND: It has been suggested that myocardial regeneration may be achieved by a single intracoronary bone marrow derived stem cell infusion in selected patients with ischaemic heart disease. The effect is uncertain in patients with chronic ischaemic heart failure and it is not known whether...... repeated infusions would have additional positive effects. AIMS: To assess whether two treatments of intracoronary infusion of bone marrow stem cells, administered 4 months apart, could improve left ventricular (LV) systolic function in patients with chronic ischaemic heart failure. METHODS: The study......, NYHA class improved (pstem cell treatment in patients with chronic ischaemic heart failure Udgivelsesdato: 2008/7...

  9. Hysteresis of magnetostructural transitions: Repeatable and non-repeatable processes

    Energy Technology Data Exchange (ETDEWEB)

    Provenzano, Virgil [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States); Della Torre, Edward; Bennett, Lawrence H. [Department of Electrical and Computer Engineering, The George Washington University, Washington, DC 20052 (United States); ElBidweihy, Hatem, E-mail: Hatem@gwmail.gwu.edu [Department of Electrical and Computer Engineering, The George Washington University, Washington, DC 20052 (United States)

    2014-02-15

    The Gd{sub 5}Ge{sub 2}Si{sub 2} alloy and the off-stoichiometric Ni{sub 50}Mn{sub 35}In{sub 15} Heusler alloy belong to a special class of metallic materials that exhibit first-order magnetostructural transitions near room temperature. The magnetic properties of this class of materials have been extensively studied due to their interesting magnetic behavior and their potential for a number of technological applications such as refrigerants for near-room-temperature magnetic refrigeration. The thermally driven first-order transitions in these materials can be field-induced in the reverse order by applying a strong enough field. The field-induced transitions are typically accompanied by the presence of large magnetic hysteresis, the characteristics of which are a complicated function of temperature, field, and magneto-thermal history. In this study we show that the virgin curve, the major loop, and sequentially measured MH loops are the results of both repeatable and non-repeatable processes, in which the starting magnetostructural state, prior to the cycling of field, plays a major role. Using the Gd{sub 5}Ge{sub 2}Si{sub 2} and Ni{sub 50}Mn{sub 35}In{sub 15} alloys, as model materials, we show that a starting single phase state results in fully repeatable processes and large magnetic hysteresis, whereas a mixed phase starting state results in non-repeatable processes and smaller hysteresis.

  10. The CAG repeat polymorphism of androgen receptor gene and prostate cancer: a meta-analysis.

    Science.gov (United States)

    Gu, Mingliang; Dong, Xiaoqun; Zhang, Xuezhi; Niu, Wenquan

    2012-03-01

    The association between the polymorphic CAG repeat in androgen receptor gene (AR) and prostate cancer susceptibility has been studied extensively. However, the results are contradictory. The purpose of our meta-analysis was to investigate whether CAG repeat related to prostate cancer risk and had genetic heterogeneity across different geographic regions and study designs. Random-effects model was performed irrespective of between-study heterogeneity. Data and study quality were assessed in duplicate. Publication bias was assessed by the fail-safe number and Egger's test. There were 16 (patients/controls: 2972/3792), 19 (3835/4908) and 12 (3372/2631) study groups for comparisons of ≥ 20, 22 and 23 repeats of CAG sequence, respectively. Compared with CAG repeat repeats had 21% (95% CI: 0.61-1.02; P = 0.076), 5% (95% CI: 0.81-1.11; P = 0.508) and 5% (95% CI: 0.76-1.20; P = 0.681) decreased risk of prostate cancer. After classifying studies by geographic areas, carriers of ≥ 20 repeats had 11% decreased risk in populations from USA, 53% from Europe, and 20% from Asia (P > 0.05), whereas comparison of ≥ 23 repeats with others generated a significant prediction in European populations (OR = 1.17; P = 0.039). Stratification by study designs revealed no material changes in risk estimation. Meta-regression analysis found no significant sources of between-study heterogeneity for age, study design and geographic region for all comparisons. There was no identified publication bias. Taken together, our results demonstrated that AR CAG repeat polymorphism with ≥ 20 repeats might confer a protective effect among the prostate cancer patients with 45 years older but not all the prostate cancer patients.

  11. Study on Case-Based Fixture Design

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Fixture is an important manufacturing activity. A fixture design system based on case-based reasoning (CBR) is proposed in this paper. A new method of case representation on the basis of fixture function is presented, where the case representation is constituted of workpiece knowledge, processing feature knowledge, and fixture feature knowledge. Running the prototype system shows that the knowledge representation method, using cases, is a better way to transform and explain the design knowledge.

  12. Case study: error rates and paperwork design.

    Science.gov (United States)

    Drury, C G

    1998-01-01

    A job instruction document, or workcard, for civil aircraft maintenance produced a number of paperwork errors when used operationally. The design of the workcard was compared to the guidelines of Patel et al [1994, Applied Ergonomics, 25 (5), 286-293]. All of the errors occurred in work instructions which did not meet these guidelines, demonstrating that the design of documentation does affect operational performance.

  13. The Study of Tactical Missile's Airframe Digital Optimization Design

    Institute of Scientific and Technical Information of China (English)

    LUO Zhiqing; QIAN Airong; LI Xuefeng; GAO Lin; LEI Jian

    2006-01-01

    Digital design and optimal are very important in modern design. The traditional design methods and procedure are not fit for the modern missile weapons research and development. Digital design methods and optimal ideas were employed to deal with this problem. The disadvantages of the traditional missile's airframe design procedure and the advantages of the digital design methods were discussed. A new concept of design process reengineering (DPR) was put forward. An integrated missile airframe digital design platform and the digital design procedure, which integrated the optimization ideas and methods, were developed. Case study showed that the design platform and the design procedure could improve the efficiency and quality of missile's airframe design, and get the more reasonable and optimal results.

  14. Improving Oral Reading Fluency through Response Opportunities: A Comparison of Phrase Drill Error Correction with Repeated Readings

    Science.gov (United States)

    Begeny, John C.; Daly, Edward J., III; Valleley, Rachel J.

    2006-01-01

    The purpose of this study was to compare two oral reading fluency treatments (repeated readings and phrase drill error correction) which differ in the way they prompt student responding. Repeated readings (RR) and phrase drill (PD) error correction were alternated with a baseline and a reward condition within an alternating treatments design with…

  15. The role of feedback and differences between good and poor decoders in a repeated word reading paradigm in first grade

    NARCIS (Netherlands)

    Gorp, K. van; Segers, P.C.J.; Verhoeven, L.T.W.

    2017-01-01

    The direct, retention, and transfer effects of repeated word and pseudoword reading were studied in a pretest, training, posttest, retention design. First graders (48 good readers, 47 poor readers) read 25 CVC words and 25 CVC pseudowords in ten repeated word reading sessions, preceded and followed

  16. Initial DEMO tokamak design configuration studies

    Energy Technology Data Exchange (ETDEWEB)

    Bachmann, Christian, E-mail: christian.bachmann@efda.org [EFDA, Boltzmannstraße 2, 85748 Garching (Germany); Aiello, G. [CEA-Saclay, DEN, DM2S, SEMT, F-91191 Gif-Sur-Yvette (France); Albanese, R.; Ambrosino, R. [ENEA/CREATE, Universita di Napoli Federico II, Naples (Italy); Arbeiter, F. [Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany); Aubert, J. [CEA-Saclay, DEN, DM2S, SEMT, F-91191 Gif-Sur-Yvette (France); Boccaccini, L.; Carloni, D. [Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany); Federici, G. [EFDA, Boltzmannstraße 2, 85748 Garching (Germany); Fischer, U. [Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany); Kovari, M. [CCFE, Culham Science Centre, Abingdon, Oxon OX14 3DB (United Kingdom); Li Puma, A. [CEA-Saclay, DEN, DM2S, SEMT, F-91191 Gif-Sur-Yvette (France); Loving, A. [CCFE, Culham Science Centre, Abingdon, Oxon OX14 3DB (United Kingdom); Maione, I. [Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany); Mattei, M. [ENEA/CREATE, Universita di Napoli Federico II, Naples (Italy); Mazzone, G. [ENEA C.R. Frascati, via E. Fermi 45, 00044 Frascati, Roma (Italy); Meszaros, B. [EFDA, Boltzmannstraße 2, 85748 Garching (Germany); Palermo, I. [Centro de Investigaciones Energéticas, Medioambientales y Tecnológicas (CIEMAT), Madrid (Spain); Pereslavtsev, P. [Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany); Riccardo, V. [CCFE, Culham Science Centre, Abingdon, Oxon OX14 3DB (United Kingdom); and others

    2015-10-15

    Highlights: • A definition of main DEMO requirements. • A description of the DEMO tokamak design configuration. • A description of issues yet to be solved. - Abstract: To prepare the DEMO conceptual design phase a number of physics and engineering assessments were carried out in recent years in the frame of EFDA concluding in an initial design configuration of a DEMO tokamak. This paper gives an insight into the identified engineering requirements and constraints and describes their impact on the selection of the technologies and design principles of the main tokamak components. The EU DEMO program aims at making best use of the technologies developed for ITER (e.g., magnets, vessel, cryostat, and to some degree also the divertor). However, other systems in particular the breeding blanket require design solutions and advanced technologies that will only partially be tested in ITER. The main differences from ITER include the requirement to breed, to extract, to process and to recycle the tritium needed for plasma operation, the two orders of magnitude larger lifetime neutron fluence, the consequent radiation dose levels, which limit remote maintenance options, and the requirement to use low-activation steel for in-vessel components that also must operate at high temperature for efficient energy conversion.

  17. Epidemiological study air disaster in Amsterdam (ESADA: study design

    Directory of Open Access Journals (Sweden)

    Bramsen Inge

    2005-05-01

    Full Text Available Abstract Background In 1992, a cargo aircraft crashed into apartment buildings in Amsterdam, killing 43 victims and destroying 266 apartments. In the aftermath there were speculations about the cause of the crash, potential exposures to hazardous materials due to the disaster and the health consequences. Starting in 2000, the Epidemiological Study Air Disaster in Amsterdam (ESADA aimed to assess the long-term health effects of occupational exposure to this disaster on professional assistance workers. Methods/Design Epidemiological study among all the exposed professional fire-fighters and police officers who performed disaster-related task(s, and hangar workers who sorted the wreckage of the aircraft, as well as reference groups of their non-exposed colleagues who did not perform any disaster-related tasks. The study took place, on average, 8.5 years after the disaster. Questionnaires were used to assess details on occupational exposure to the disaster. Health measures comprised laboratory assessments in urine, blood and saliva, as well as self-reported current health measures, including health-related quality of life, and various physical and psychological symptoms. Discussion In this paper we describe and discuss the design of the ESADA. The ESADA will provide additional scientific knowledge on the long-term health effects of technological disasters on professional workers.

  18. Status of the Neutrino Factory accelerator design studies

    CERN Document Server

    Prior, Gersende

    2013-01-01

    This document is a review of the present status of the Neutrino Factory design study, after the publication of the Interim Design Report and before the publication of the Reference Design Report. The different components of the accelerator as well as their current design stage and future tasks are described here.

  19. Design Studies with DEMIRCI for SPP RFQ

    CERN Document Server

    Yasatekin, B; Alacakir, A; Unel, G

    2014-01-01

    To design a Radio Frequency Quadrupole (RFQ) is a onerous job which requires a good understanding of all the main parameters and the relevant calculations. Up to the present there are only a few software packages performing this task in a reliable way. These legacy software, though proven in time, could benefit from the modern software development tools like Object Oriented (OO) programming. In this note, a new RFQ design software, DEMIRCI is introduced. It is written entirely from scratch using C++ and based on CERN's OO ROOT library. It has a friendly graphical user interface and also a command line interface for batch calculations. It can also interact by file exchange with similar software in the field. After presenting the generic properties of DEMIRCI, its compatibility with similar software packages is discussed based on the results from the reference design parameters of SPP (SNRTC Project Prometheus), a demonstration accelerator at Ankara, Turkey.

  20. Conceptual design studies for a CEPC detector

    Science.gov (United States)

    Chekanov, S. V.; Demarteau, M.

    2016-11-01

    The physics potential of the Circular Electron Positron Collider (CEPC) can be significantly strengthened by two detectors with complementary designs. A promising detector approach based on the Silicon Detector (SiD) designed for the International Linear Collider (ILC) is presented. Several simplifications of this detector for the lower energies expected at the CEPC are proposed. A number of cost optimizations of this detector are illustrated using full detector simulations. We show that the proposed changes will enable one to reach the physics goals at the CEPC.

  1. Conceptual Design Studies for a CEPC Detector

    CERN Document Server

    Chekanov, S V

    2016-01-01

    The physics potential of the Circular Electron Positron Collider (CEPC) can be significantly strengthened by two detectors with complementary designs. A promising detector approach based on the Silicon Detector (SiD) designed for the International Linear Collider (ILC) is presented. Several simplifications of this detector for the lower energies expected at the CEPC are proposed. A number of cost optimizations of this detector are illustrated using full detector simulations. We show that the proposed changes will enable to reach the physics goals at the CEPC.

  2. Strengthening concept learning by repeated testing.

    Science.gov (United States)

    Wiklund-Hörnqvist, Carola; Jonsson, Bert; Nyberg, Lars

    2014-02-01

    The aim of this study was to examine whether repeated testing with feedback benefits learning compared to rereading of introductory psychology key-concepts in an educational context. The testing effect was examined immediately after practice, after 18 days, and at a five-week delay in a sample of undergraduate students (n = 83). The results revealed that repeated testing with feedback significantly enhanced learning compared to rereading at all delays, demonstrating that repeated retrieval enhances retention compared to repeated encoding in the short- and the long-term. In addition, the effect of repeated testing was beneficial for students irrespectively of working memory capacity. It is argued that teaching methods involving repeated retrieval are important to consider by the educational system.

  3. Feasibility study of an Integrated Program for Aerospace vehicle Design (IPAD). Volume 4: IPAD system design

    Science.gov (United States)

    Goldfarb, W.; Carpenter, L. C.; Redhed, D. D.; Hansen, S. D.; Anderson, L. O.; Kawaguchi, A. S.

    1973-01-01

    The computing system design of IPAD is described and the requirements which form the basis for the system design are discussed. The system is presented in terms of a functional design description and technical design specifications. The functional design specifications give the detailed description of the system design using top-down structured programming methodology. Human behavioral characteristics, which specify the system design at the user interface, security considerations, and standards for system design, implementation, and maintenance are also part of the technical design specifications. Detailed specifications of the two most common computing system types in use by the major aerospace companies which could support the IPAD system design are presented. The report of a study to investigate migration of IPAD software between the two candidate 3rd generation host computing systems and from these systems to a 4th generation system is included.

  4. THE RELIABILITY STUDY OF MINE DESIGN

    Institute of Scientific and Technical Information of China (English)

    彭世济; 张达贤; 习永峰; 卢明银; 孙洪泉

    1991-01-01

    The method of reliability analysis of mineral reserve estimation, mining construction, mining technological system and surface mine investment in mine design is discussed in this paper. On the basis of this method, the questions, such as "whether the planned production and predicted economic effectiveness could be obtained", can be answered, and corresponding measures can be taken.

  5. Rationale and Design of the 'MITOCARE' Study

    DEFF Research Database (Denmark)

    Clemmensen, Peter

    2012-01-01

    Treatment of acute ST-elevation myocardial infarction (STEMI) by reperfusion using percutaneous coronary intervention (PCI) or thrombolysis has provided clinical benefits; however, it also induces considerable cell death. This process is called reperfusion injury. The continuing high rates of mor...... understanding of the complex pathophysiology underlying myocardial injury after STEMI. The present paper describes the rationale, design and the methods of the trial....

  6. Tokamak blanket design study, final report

    Energy Technology Data Exchange (ETDEWEB)

    1980-08-01

    A cylindrical module concept was developed, analyzed, and incorporated in a tokamak blanket system that includes piping systems, vacuum boundary sealing, and support structures. The design is based on the use of state-of-the-art structural materials (20% cold-worked type 316 stainless steel), lithium as the breeding material, and pressurized helium as the coolant. The module design consists of nested concentric cylinders (with an outer diameter of 10 cm) and features direct wall cooling by helium flowing between the outer (first-wall) cylinder and the inner (lithium-containing) cylinder. Each cylinder can withstand full coolant pressure, thus enhancing reliability. Results show that stainless steel is a viable material for a first wall subjected to a neutron wall loading of 4 MW/m/sup 2/ and a particle heat flux of 1 MW/m/sup 2/. Lifetime analysis shows that the first-wall design meets the goal of operating at 20-min cycles with 95% duty for 100,000 cycles. To reduce system complexity, a larger 20-cm-diam module also was analyzed for incorporation in the blanket assembly. Reliability assessment indicates that it may be possible to double the module in size from 10 to 20 cm in diameter. With a modest increase in coolant pumping power, a blanket assembly comprising 20-cm-diam modules can still achieve 100,000 operating cycles - equivalent to a 3.6-year design lifetime - with only one or two helium coolant leaks into the plasma.

  7. Research designs for experimental single-case studies

    Directory of Open Access Journals (Sweden)

    Ralf Spieß

    2012-09-01

    Full Text Available This overview describes the most important designs for single case experimental studies, which are ABAB-design, multiple baseline design, alternating treatments design and changing criterion design. The logic of experimental control in single case studies is explained and it is described, how these different designs are able to provide internal validity and enable causal interpretations of intervention outcome. An important precondition of valid interpretation is objective and reliable data assessment. Data evaluation by visual inspection is explained and several methods of statistical data analysis are discussed. To establish generability across persons, situations, and settings, the importance of replication studies is highlighted.

  8. The Pentapeptide Repeat Proteins

    Energy Technology Data Exchange (ETDEWEB)

    Vetting,M.; Hegde, S.; Fajardo, J.; Fiser, A.; Roderick, S.; Takiff, H.; Blanchard, J.

    2006-01-01

    The Pentapeptide Repeat Protein (PRP) family has over 500 members in the prokaryotic and eukaryotic kingdoms. These proteins are composed of, or contain domains composed of, tandemly repeated amino acid sequences with a consensus sequence of [S, T,A, V][D, N][L, F]-[S, T,R][G]. The biochemical function of the vast majority of PRP family members is unknown. The three-dimensional structure of the first member of the PRP family was determined for the fluoroquinolone resistance protein (MfpA) from Mycobacterium tuberculosis. The structure revealed that the pentapeptide repeats encode the folding of a novel right-handed quadrilateral {beta}-helix. MfpA binds to DNA gyrase and inhibits its activity. The rod-shaped, dimeric protein exhibits remarkable size, shape and electrostatic similarity to DNA.

  9. Can a Repeated Sprint Ability Test Help Clear a Previously Injured Soccer Player for Fully Functional Return to Activity? A Pilot Study.

    Science.gov (United States)

    Padulo, Johnny; Attene, Giuseppe; Ardigò, Luca P; Bragazzi, Nicola L; Maffulli, Nicola; Zagatto, Alessandro M; Dello Iacono, Antonio

    2017-07-01

    To investigate the effects of fatigue induced by a repeated sprint ability (RSA) test on the neuromuscular responses of soccer players with a recent history of lower limb injuries (CH) and a matched control group in good fitness condition (GH). This was a case-control study. Nine CH and 9 GH. Allocation to CH or GH. Each player was assessed for blood lactate concentration and jumping performance [squat jump (SJ) and countermovement jump (CMJ)] before/after RSA. Post-RSA rate of perceived exertion (RPE) was obtained. Receiver operating characteristic analysis was performed to calculate RSA sensitivity and specificity in distinguishing between CH and GH. Intraclass correlation coefficient was used to assess reliability. No baseline differences were found for any variable. ΔSJ before/after RSA was -14 ± 2% and -5 ± 2% in CH and GH, respectively (P Repeated sprint ability is a simple, low-cost field test potentially able to assist in clinical decision making for return to sport.

  10. Null alleles at the Huntington disease locus: implications for diagnostics and CAG repeat instability.

    Science.gov (United States)

    Williams, L C; Hegde, M R; Nagappan, R; Faull, R L; Giles, J; Winship, I; Snow, K; Love, D R

    2000-01-01

    PCR amplification of the CAG repeat in exon 1 of the IT15 gene is routinely undertaken to confirm a clinical diagnosis of Huntington disease (HD) and to provide predictive testing for at-risk relatives of affected individuals. Our studies have detected null alleles on the chromosome carrying the expanded repeat in three of 91 apparently unrelated HD families. Sequence analysis of these alleles has revealed the same mutation event, leading to the juxtaposition of uninterrupted CAG and CCG repeats. These data suggest that a mutation-prone region exists in the IT15 gene bounded by the CAG and CCG repeats and that caution should be exercised in designing primers that anneal to the region bounded by these repeats. Two of the HD families segregated null alleles with expanded uninterrupted CAG repeats at the lower end of the zone of reduced penetrance. The expanded repeats are meiotically unstable in these families, although this instability is within a small range of repeat lengths. The haplotypes of the disease-causing chromosomes in these two families differ, only one of which is similar to that reported previously as being specific for new HD mutations. Finally, no apparent mitotic instability of the uninterrupted CAG repeat was observed in the brain of one of the HD individuals.

  11. Detection of dispersed short tandem repeats using reversible jump Markov chain Monte Carlo.

    Science.gov (United States)

    Liang, Tong; Fan, Xiaodan; Li, Qiwei; Li, Shuo-Yen R

    2012-10-01

    Tandem repeats occur frequently in biological sequences. They are important for studying genome evolution and human disease. A number of methods have been designed to detect a single tandem repeat in a sliding window. In this article, we focus on the case that an unknown number of tandem repeat segments of the same pattern are dispersively distributed in a sequence. We construct a probabilistic generative model for the tandem repeats, where the sequence pattern is represented by a motif matrix. A Bayesian approach is adopted to compute this model. Markov chain Monte Carlo (MCMC) algorithms are used to explore the posterior distribution as an effort to infer both the motif matrix of tandem repeats and the location of repeat segments. Reversible jump Markov chain Monte Carlo (RJMCMC) algorithms are used to address the transdimensional model selection problem raised by the variable number of repeat segments. Experiments on both synthetic data and real data show that this new approach is powerful in detecting dispersed short tandem repeats. As far as we know, it is the first work to adopt RJMCMC algorithms in the detection of tandem repeats.

  12. Repeating the Past

    Science.gov (United States)

    Moore, John W.

    1998-05-01

    As part of the celebration of the Journal 's 75th year, we are scanning each Journal issue from 25, 50, and 74 years ago. Many of the ideas and practices described are so similar to present-day "innovations" that George Santayana's adage (1) "Those who cannot remember the past are condemned to repeat it" comes to mind. But perhaps "condemned" is too strong - sometimes it may be valuable to repeat something that was done long ago. One example comes from the earliest days of the Division of Chemical Education and of the Journal.

  13. Crossover versus parallel designs: dose-escalation design comparisons for first-in-human studies.

    Science.gov (United States)

    Yan, Zhiwu; Hosmane, Balakrishna; Locke, Charles

    2013-01-01

    We study the statistical efficiency for rising-dose designs in the context of first-in-human studies. Specifically, we identify a class of crossover designs that are appealing in terms of both subject safety and statistical efficiency and, for a three-period, two-panel design in such a class, we compare its A-efficiency relative to the corresponding parallel designs and optimal/efficient crossover designs, respectively, under various plausible models. In the meantime, we also evaluate the impact of inclusion of baseline measurements as a covariate in the statistical analysis, for both crossover and parallel studies.

  14. Phylogenetic study and molecular identification of 31 Dendrobium species using inter-simple sequence repeat (ISSR) markers

    National Research Council Canada - National Science Library

    Wang, H.-Z; Feng, S.-G; Lu, J.-J; Shi, N.-N; Liu, J.-J

    2009-01-01

    The genetic diversity of the genus Dendrobium is not well known and the phylogenetic relationship of Dendrobium species are mainly determined by studies of the comparative vegetative anatomy and plant systematics...

  15. Study of the design of CSNS MEBT

    Institute of Scientific and Technical Information of China (English)

    OUYANG Hua-Fu; LIU Hua-Chang; FU Shi-Nian

    2009-01-01

    The design of CSNS MEBT has two objectives: (1) to match the beam both in the transversal direction and the longitudinal direction from RFQ into DTL; (2) to further chop the beam into the required time structure asked by RCS. It is very difficult and critical to control well the emittance growth and in the meantime to match and chop the beam. Firstly, the optical design is done and optimized, and the multi-particle simulations show that the maximum emittance growth is successfully controlled within 14%. Secondly, based on the different beam envelopes obtained by TRACE-3D and PARMELA, the least deflecting angle of the chopper is determined by TRACE-3D. At last, the field of steering magnet is determined through simulations.

  16. User Design: A Case Study on Corporate Change

    Science.gov (United States)

    Pastore, Raymond S.; Carr-Chellman, Alison A.; Lohmann, Neal

    2011-01-01

    The purpose of this study was to examine the effects of implementing user design strategies within the corporate culture. Using a case study design approach, this article explores the change process within a "Fortune" 100 company in which users were given significant decision-making powers. The main focus is on the unique nature of user design in…

  17. A 12-month randomized crossover study on the effects of Lanreotide Autogel and Octreotide long-acting repeatable on GH and IGF-l in patients with acromegaly

    DEFF Research Database (Denmark)

    Andries, Magdalene; Glintborg, Dorte; Kvistborg, Annette

    2007-01-01

    of acromegaly in a randomized study design. Material and methods Twelve acromegalic patients were included and 10 patients completed treatment with LAN or OCT for 6 months and were then switched to the opposite treatment modality for 6 months without a washout period in a randomized crossover design. GH and IGF...

  18. Study of Screen Design Principles for Visualizing Medical Records.

    Science.gov (United States)

    Fujita, Kenichiro; Takemura, Tadamasa; Kuroda, Tomohiro

    2015-01-01

    To improve UX of EMR/EHR, the screen design principles for the visualization are required. Through the study of common attributes of medical records, we present four principles and show three screen designs by applying them.

  19. Second time around: Corticospinal responses following repeated sports-related concussions within the same season. A transcranial magnetic stimulation study

    Directory of Open Access Journals (Sweden)

    Alan J Pearce

    2014-01-01

    Conclusions: This multiple-case study has demonstrated that concussion result in increased intracortical inhibition and reduction in cognitive and motor performance. Further, TMS, in conjunction with tests of cognitive and motor performance, can be useful as a prognostic technique in assessing recovery from acute concussion injury.

  20. Reduction of smoking in Dutch adolescents over the past decade and its health gains : a repeated cross-sectional study

    NARCIS (Netherlands)

    Gielkens-Sijstermans, Cindy M.; Mommers, Monique A.; Hoogenveen, Rudolf T.; Feenstra, Talitha L.; de Vreede, Jacqueline; Bovens, Fons M.; van Schayck, Onno C.

    Background: Smoking is the main preventable lifestyle-related risk factor threatening human health. In this study, time trends in smoking behaviour between 1996 and 2005 among adolescents enrolled in secondary school were assessed. Methods: In 1996, 2001 and 2005, a survey was conducted in the

  1. A repeated-measures study of recreational water exposure, non-point source pollution, and risk of illness

    Science.gov (United States)

    Discharge of stormwater runoff onto beaches is a major cause of beach closings and advisories in the United States. Prospective studies of recreational water quality and health have often been limited to two time points (baseline and follow-up). Little is known about the risk of ...

  2. All-optical repeater.

    Science.gov (United States)

    Silberberg, Y

    1986-06-01

    An all-optical device containing saturable gain, saturable loss, and unsaturable loss is shown to transform weak, distorted optical pulses into uniform standard-shape pulses. The proposed device performs thresholding, amplification, and pulse shaping as required from an optical repeater. It is shown that such a device could be realized by existing semiconductor technology.

  3. Bidirectional Manchester repeater

    Science.gov (United States)

    Ferguson, J.

    1980-01-01

    Bidirectional Manchester repeater is inserted at periodic intervals along single bidirectional twisted pair transmission line to detect, amplify, and transmit bidirectional Manchester 11 code signals. Requiring only 18 TTL 7400 series IC's, some line receivers and drivers, and handful of passive components, circuit is simple and relatively inexpensive to build.

  4. Techniques for Conducting Effective Concept Design and Design-to-Cost Trade Studies

    Science.gov (United States)

    Di Pietro, David A.

    2015-01-01

    Concept design plays a central role in project success as its product effectively locks the majority of system life cycle cost. Such extraordinary leverage presents a business case for conducting concept design in a credible fashion, particularly for first-of-a-kind systems that advance the state of the art and that have high design uncertainty. A key challenge, however, is to know when credible design convergence has been achieved in such systems. Using a space system example, this paper characterizes the level of convergence needed for concept design in the context of technical and programmatic resource margins available in preliminary design and highlights the importance of design and cost evaluation learning curves in determining credible convergence. It also provides techniques for selecting trade study cases that promote objective concept evaluation, help reveal unknowns, and expedite convergence within the trade space and conveys general practices for conducting effective concept design-to-cost studies.

  5. Analytical study of recoil systems and their design

    Directory of Open Access Journals (Sweden)

    J. P. Sirpal

    1960-07-01

    Full Text Available A critical study of the various design parameters usually employed in the typical existing designs and it has been found that the order of magnitudes of some of these parameters are fairly different from those theoretically suggested. An explanation of this difference is also offered. A few additional parameters that are necessary for a preliminary design have also been studied. Based on this some considerations regarding a new design have been suggested.

  6. The necessity of repeated assessment of imaging studies contained in medical records in medico-legal opinions

    Directory of Open Access Journals (Sweden)

    Aleksandra Borowska-Solonynko

    2014-12-01

    Full Text Available The paper presents two case reports of living victims, in which imaging studies of the chest conducted at a medical facility were an essential part of the medico-legal opinion. The first case was that of a young male hospitalized due to CT evidence of bilateral rib fractions, who claimed to have been assaulted by police officers. The other case was that of a six week old baby hospitalized due to chest X-ray evidence of right hand side rib fractions. The chest X-ray was performed due to one bruise found on the baby’s forehead and two small bruises on the back, which gave rise to suspicions of child abuse. In both cases, expert witnesses in radiology definitively excluded the presence of any fractures. These cases indicate that a new assessment of imaging studies contained in medical records is needed. Expert opinions based solely on the description of imaging studies may result in grave consequences.

  7. Repeated dose 28-days oral toxicity study of Carica papaya L. leaf extract in Sprague Dawley rats.

    Science.gov (United States)

    Afzan, Adlin; Abdullah, Noor Rain; Halim, Siti Zaleha; Rashid, Badrul Amini; Semail, Raja Hazlini Raja; Abdullah, Noordini; Jantan, Ibrahim; Muhammad, Hussin; Ismail, Zakiah

    2012-04-10

    Carica papaya L. leaves have been used in ethnomedicine for the treatment of fevers and cancers. Despite its benefits, very few studies on their potential toxicity have been described. The aim of the present study was to characterize the chemical composition of the leaf extract from 'Sekaki' C. papaya cultivar by UPLC-TripleTOF-ESI-MS and to investigate the sub-acute oral toxicity in Sprague Dawley rats at doses of 0.01, 0.14 and 2 g/kg by examining the general behavior, clinical signs, hematological parameters, serum biochemistry and histopathology changes. A total of twelve compounds consisting of one piperidine alkaloid, two organic acids, six malic acid derivatives, and four flavonol glycosides were characterized or tentatively identified in the C. papaya leaf extract. In the sub-acute study, the C. papaya extract did not cause mortality nor were treatment-related changes in body weight, food intake, water level, and hematological parameters observed between treatment and control groups. Some biochemical parameters such as the total protein, HDL-cholesterol, AST, ALT and ALP were elevated in a non-dose dependent manner. Histopathological examination of all organs including liver did not reveal morphological alteration. Other parameters showed non-significant differences between treatment and control groups. The present results suggest that C. papaya leaf extract at a dose up to fourteen times the levels employed in practical use in traditional medicine in Malaysia could be considered safe as a medicinal agent.

  8. Reusable Reentry Satellite (RRS) system design study

    Science.gov (United States)

    1991-01-01

    The Reusable Reentry Satellite (RRS) is intended to provide investigators in several biological disciplines with a relatively inexpensive method to access space for up to 60 days with eventual recovery on Earth. The RRS will permit totally intact, relatively soft, recovery of the vehicle, system refurbishment, and reflight with new and varied payloads. The RRS is to be capable of three reflights per year over a 10-year program lifetime. The RRS vehicle will have a large and readily accessible volume near the vehicle center of gravity for the Payload Module (PM) containing the experiment hardware. The vehicle is configured to permit the experimenter late access to the PM prior to launch and rapid access following recovery. The RRS will operate in one of two modes: (1) as a free-flying spacecraft in orbit, and will be allowed to drift in attitude to provide an acceleration environment of less than 10(exp -5) g. the acceleration environment during orbital trim maneuvers will be less than 10(exp -3) g; and (2) as an artificial gravity system which spins at controlled rates to provide an artificial gravity of up to 1.5 Earth g. The RRS system will be designed to be rugged, easily maintained, and economically refurbishable for the next flight. Some systems may be designed to be replaced rather than refurbished, if cost effective and capable of meeting the specified turnaround time. The minimum time between recovery and reflight will be approximately 60 days. The PMs will be designed to be relatively autonomous, with experiments that require few commands and limited telemetry. Mass data storage will be accommodated in the PM. The hardware development and implementation phase is currently expected to start in 1991 with a first launch in late 1993.

  9. Statistical design study of lunar ceramic

    Science.gov (United States)

    Effinger, Mike; Tucker, Dennis

    1994-01-01

    Fabrication of a lunar ceramic was conducted according to a statistically designed experiment. The method of cold pressing was used since the consumption of electrical energy is kept to a minimum (a priority in the lunar environment). This traditional fabrication technique also provides an initial data source on which further investigations can be based. Results obtained from using two percent binder, a cold pressing pressure of 276 MPa, and 24 hours sintering time yielded the greatest compressive strength of 247 MPa. Analysis of each variable's influence on the compressive strength is also presented.

  10. Generosity pays in the presence of direct reciprocity: a comprehensive study of 2 × 2 repeated games.

    Directory of Open Access Journals (Sweden)

    Luis A Martinez-Vaquero

    Full Text Available By applying a technique previously developed to study ecosystem assembly [Capitán et al., Phys. Rev. Lett. 103, 168101 (2009] we study the evolutionary stable strategies of iterated 2 × 2 games. We focus on memory-one strategies, whose probability to play a given action depends on the actions of both players in the previous time step. We find the asymptotically stable populations resulting from all possible invasions of any known stable population. The results of this invasion process are interpreted as transitions between different populations that occur with a certain probability. Thus the whole process can be described as a Markov chain whose states are the different stable populations. With this approach we are able to study the whole space of symmetric 2 × 2 games, characterizing the most probable results of evolution for the different classes of games. Our analysis includes quasi-stationary mixed equilibria that are relevant as very long-lived metastable states and is compared to the predictions of a fixation probability analysis. We confirm earlier results on the success of the Pavlov strategy in a wide range of parameters for the iterated Prisoner's Dilemma, but find that as the temptation to defect grows there are many other possible successful strategies. Other regions of the diagram reflect the equilibria structure of the underlying one-shot game, albeit often some non-expected strategies arise as well. We thus provide a thorough analysis of iterated 2 × 2 games from which we are able to extract some general conclusions. Our most relevant finding is that a great deal of the payoff parameter range can still be understood by focusing on win-stay, lose-shift strategies, and that very ambitious ones, aspiring to obtaining always a high payoff, are never evolutionary stable.

  11. Feedback from an image of finger and an actual finger produce similar prismatic after-effect: a repeated measures study

    DEFF Research Database (Denmark)

    Wilms, Inge Linda; Assentoft, Emilie

    2014-01-01

    by seeing their fingertip. In the second condition subjects saw an image of a fingertip. The results indicate that the two conditions are significantly different. The study is an important step in understanding what actually makes a difference in training when trying to convert paper-and-pencil training...... if it is the format rather than the indirectness of the feedback creating this difference. 27 healthy subjects were subjected to a single session of Prism Adaptation Training under two different feedback conditions. In the first feedback condition, subjects were exposed to visual feedback on pointing precision...

  12. Long-term facial improvement after repeated BoNT-A injections and mirror biofeedback exercises for chronic facial synkinesis: a case-series study.

    Science.gov (United States)

    Mandrini, Silvia; Comelli, Mario; Dall'angelo, Anna; Togni, Rossella; Cecini, Miriam; Pavese, Chiara; Dalla Toffola, Elena

    2016-12-01

    Only few studies have considered the effects of the combined treatment with onabotulinumtoxinA (BoNT-A) injections and biofeedback (BFB) rehabilitation in the recovery of postparetic facial synkinesis (PPFS). To explore the presence of a persistent improvement in facial function out of the pharmacological effect of BoNT-A in subjects with established PPFS, after repeated sessions of BoNT-A injections combined with an educational facial training program using mirror biofeedback (BFB) exercises. Secondary objective was to investigate the trend of the presumed persistent improvement. Case-series study. Outpatient Clinic of Physical Medicine and Rehabilitation Unit. Twenty-seven patients (22 females; mean age 45±16 years) affected by an established peripheral facial palsy, treated with a minimum of three BoNT-A injections in association with mirror BFB rehabilitation. The interval between consecutive BoNT-A injections was at least five months. At baseline and before every BoNT-A injection+mirror BFB session (when the effect of the previous BoNT-A injection had vanished), patients were assessed with the Italian version of Sunnybrook Facial Grading System (SB). The statistical analysis considered SB composite and partial scores before each treatment session compared to the baseline scores. A significant improvement of the SB composite and partial scores was observed until the fourth session. Considering the "Symmetry of Voluntary Movement" partial score, the main improvement was observed in the muscles of the lower part of the face. In a chronic stage of postparetic facial synkinesis, patients may benefit from a combined therapy with repeated BoNT-A injections and an educational facial training program with mirror BFB exercises, gaining an improvement of the facial function up to the fourth session. This improvement reflects the acquired ability to use facial muscle correctly. It doesn't involve the injected muscles but those trained with mirror biofeedback exercises

  13. Liquid Acquisition Device Design Sensitivity Study

    Science.gov (United States)

    VanDyke, M. K.; Hastings, L. J.

    2012-01-01

    In-space propulsion often necessitates the use of a capillary liquid acquisition device (LAD) to assure that gas-free liquid propellant is available to support engine restarts in microgravity. If a capillary screen-channel device is chosen, then the designer must determine the appropriate combination screen mesh and channel geometry. A screen mesh selection which results in the smallest LAD width when compared to any other screen candidate (for a constant length) is desirable; however, no best screen exists for all LAD design requirements. Flow rate, percent fill, and acceleration are the most influential drivers for determining screen widths. Increased flow rates and reduced percent fills increase the through-the-screen flow pressure losses, which drive the LAD to increased widths regardless of screen choice. Similarly, increased acceleration levels and corresponding liquid head pressures drive the screen mesh selection toward a higher bubble point (liquid retention capability). After ruling out some screens on the basis of acceleration requirements alone, candidates can be identified by examining screens with small flow-loss-to-bubble point ratios for a given condition (i.e., comparing screens at certain flow rates and fill levels). Within the same flow rate and fill level, the screen constants inertia resistance coefficient, void fraction, screen pore or opening diameter, and bubble point can become the driving forces in identifying the smaller flow-loss-to-bubble point ratios.

  14. Innovative Offshore Wind Plant Design Study

    Energy Technology Data Exchange (ETDEWEB)

    Hurley, William L. [Glosten Associates, Inc., Seattle, WA (United States); Nordstrom, Charles J. [Glosten Associates, Inc., Seattle, WA (United States); Morrison, Brent J. [Glosten Associates, Inc., Seattle, WA (United States)

    2013-12-18

    Technological advancements in the Glosten PelaStar floating wind turbine system have led to projected cost of energy (COE) reductions from today’s best-in-class offshore wind systems. The PelaStar system is projected to deliver a COE that is 35% lower than that delivered by the current offshore wind plants. Several technology developments have been achieved that directly target significant cost of energy reductions. These include: Application of state-of-the-art steel construction materials and methods, including fatigue-resistant welding techniques and technologies, to reduce hull steel weight; Advancements in synthetic fiber tendon design for the mooring system, which are made possible by laboratory analysis of full-scale sub-rope specimens; Investigations into selected anchor technologies to improve anchor installation methods; Refinement of the installation method, specifically through development of the PelaStar Support Barge design. Together, these technology developments drive down the capital cost and operating cost of offshore wind plants and enable access to superb wind resources in deep water locations. These technology developments also reduce the uncertainty of the PelaStar system costs, which increases confidence in the projected COE reductions.

  15. Repeated dose studies with pure Epigallocatechin-3-gallate demonstrated dose and route dependant hepatotoxicity with associated dyslipidemia

    Directory of Open Access Journals (Sweden)

    Balaji Ramachandran

    2016-01-01

    Full Text Available EGCG (Epigallocatechin-3-gallate is the major active principle catechin found in green tea. Skepticism regarding the safety of consuming EGCG is gaining attention, despite the fact that it is widely being touted for its potential health benefits, including anti-cancer properties. The lack of scientific data on safe dose levels of pure EGCG is of concern, while EGCG has been commonly studied as a component of GTE (Green tea extract and not as a single active constituent. This study has been carried out to estimate the maximum tolerated non-toxic dose of pure EGCG and to identify the treatment related risk factors. In a fourteen day consecutive treatment, two different administration modalities were compared, offering an improved [i.p (intraperitoneal] and limited [p.o (oral] bioavailability. A trend of dose and route dependant hepatotoxicity was observed particularly with i.p treatment and EGCG increased serum lipid profile in parallel to hepatotoxicity. Fourteen day tolerable dose of EGCG was established as 21.1 mg/kg for i.p and 67.8 mg/kg for p.o. We also observed that, EGCG induced effects by both treatment routes are reversible, subsequent to an observation period for further fourteen days after cessation of treatment. It was demonstrated that the severity of EGCG induced toxicity appears to be a function of dose, route of administration and period of treatment.

  16. Repeated head trauma is associated with smaller thalamic volumes and slower processing speed: the Professional Fighters' Brain Health Study.

    Science.gov (United States)

    Bernick, Charles; Banks, Sarah J; Shin, Wanyong; Obuchowski, Nancy; Butler, Sam; Noback, Michael; Phillips, Michael; Lowe, Mark; Jones, Stephen; Modic, Michael

    2015-08-01

    Cumulative head trauma may alter brain structure and function. We explored the relationship between exposure variables, cognition and MRI brain structural measures in a cohort of professional combatants. 224 fighters (131 mixed martial arts fighters and 93 boxers) participating in the Professional Fighters Brain Health Study, a longitudinal cohort study of licensed professional combatants, were recruited, as were 22 controls. Each participant underwent computerised cognitive testing and volumetric brain MRI. Fighting history including years of fighting and fights per year was obtained from self-report and published records. Statistical analyses of the baseline evaluations were applied cross-sectionally to determine the relationship between fight exposure variables and volumes of the hippocampus, amygdala, thalamus, caudate, putamen. Moreover, the relationship between exposure and brain volumes with cognitive function was assessed. Increasing exposure to repetitive head trauma measured by number of professional fights, years of fighting, or a Fight Exposure Score (FES) was associated with lower brain volumes, particularly the thalamus and caudate. In addition, speed of processing decreased with decreased thalamic volumes and with increasing fight exposure. Higher scores on a FES used to reflect exposure to repetitive head trauma were associated with greater likelihood of having cognitive impairment. Greater exposure to repetitive head trauma is associated with lower brain volumes and lower processing speed in active professional fighters. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  17. A foundational observation method for studying design situations

    DEFF Research Database (Denmark)

    Cash, Philip; Hicks, Ben; Culley, Steve

    2015-01-01

    Observational studies of designers play an important role in engineering design research, yet there is currently no accepted standard approach for comparing, combining, or contrasting studies. Consequentially, reuse, reanalysis, replication, and aggregation of data are limited and the potential...... impact of individual studies is severely constrained. This paper begins to address this issue by introducing and developing a foundational method for observational design research to improve replicability, reuse, and overall comparability of empirical studies. A three-step foundational method is proposed...

  18. Violence towards health care workers in a Public Health Care Facility in Italy: a repeated cross-sectional study

    Directory of Open Access Journals (Sweden)

    Magnavita Nicola

    2012-05-01

    Full Text Available Abstract Background Violence at work is one of the major concerns in health care activities. The aim of this study was to identify the prevalence of physical and non-physical violence in a general health care facility in Italy and to assess the relationship between violence and psychosocial factors, thereby providing a basis for appropriate intervention. Methods All health care workers from a public health care facility were invited to complete a questionnaire containing questions on workplace violence. Three questionnaire-based cross-sectional surveys were conducted. The response rate was 75 % in 2005, 71 % in 2007, and 94 % in 2009. The 2009 questionnaire contained the VIF (Violent Incident Form for reporting violent incidents, the DCS (demand/control/support model for job strain, the Colquitt 20 item questionnaire for perceived organizational justice, and the GHQ-12 General Health Questionnaire for the assessment of mental health. Results One out of ten workers reported physical assault, and one out of three exposure to non-physical violence in the workplace in the previous year. Nurses and physicians were the most exposed occupational categories, whereas the psychiatric and emergency departments were the services at greatest risk of violence. Workers exposed to non-physical violence were subject to high job strain, low support, low perceived organizational justice, and high psychological distress. Conclusion Our study shows that health care workers in an Italian local health care facility are exposed to violence. Workplace violence was associated with high demand and psychological disorders, while job control, social support and organizational justice were protective factors.

  19. Fatigue In U12 Soccer-7 Players During Repeated One-Day Tournament Games - A Pilot Study.

    Science.gov (United States)

    Sanchez-Sanchez, Javier; Sanchez, Mario; Hernandez, Daniel; Ramirez-Campillo, Rodrigo; Martínez, Cristian; Nakamura, Fabio Y

    2017-07-12

    The aim of this study was to describe and compare the distances and displacement speeds of U12 Soccer-7 athletes during four tournament Soccer-7 games (TG) played in less than 24-h (experimental condition) with those recorded during two league Soccer-7 games (LG) with 24-h of rest prior to the match (control condition). Ten participants (age = 10.3 ± 0.5 years) were recruited for the study. Main data analyzed during games included distance completed relative to match duration (Drel), maximal velocity and distance completed at different running speeds (including acceleration, deceleration, standing, walking, jogging, medium-intensity running, high-intensity running and sprinting). For data collection during games, athletes wore a GPS unit. Different (p0.05) and during the two LG between 84.2 ± 10.9 m/min and 87.5 ± 9.9 m/min (P>0.05). Moreover, similar Drel was recorded during TG and LG (86.8 m/min and 85.9 m/min, respectively). Compared to LG, during TG maximal velocity was lower (23.0 km/h and 21.3 km/h, respectively; Pgame of the tournament, in the preceding games the distance covered at low speeds (3.1-8.0 km/h) was lower (37.7% and 32.4%, respectively; Pgames with less than 24-h of inter-day rest negatively affects displacement speeds distribution (but not overall relative distances) in U12 Soccer-7 athletes. These results may help to better plan training and competition schedules to youth players.

  20. Effects of ambient air pollution on functional status in patients with chronic congestive heart failure: a repeated-measures study

    Directory of Open Access Journals (Sweden)

    Phillips Russell S

    2007-09-01

    Full Text Available Abstract Background Studies using administrative data report a positive association between ambient air pollution and the risk of hospitalization for congestive heart failure (HF. Circulating levels of B-type natriuretic peptide (BNP are directly associated with cardiac hemodynamics and symptom severity in patients with HF and, therefore, serves as a marker of functional status. We tested the hypothesis that BNP levels would be positively associated with short-term changes in ambient pollution levels among 28 patients with chronic stable HF and impaired systolic function. Methods BNP was measured in whole blood at 0, 6, and 12 weeks. We used linear mixed models to evaluate the association between fine particulate matter (PM2.5, carbon monoxide, sulfur dioxide, nitrogen dioxide, ozone, and black carbon and log(BNP. Lags of 0 to 3 days were considered in separate models. We calculated the intraclass correlation coefficient and within-subject coefficient of variation as measures of reproducibility. Results We found no association between any pollutant and measures of BNP at any lag. For example, a 10 μg/m3 increase in PM2.5 was associated with a 0.8% (95% CI: -16.4, 21.5; p = 0.94 increase in BNP on the same day. The within-subject coefficient of variation was 45% on the natural scale and 9% on the log scale. Conclusion These results suggest that serial BNP measurements are unlikely to be useful in a longitudinal study of air pollution-related acute health effects. The magnitude of expected ambient air pollution health effects appears small in relation to the considerable within-person variability in BNP levels in this population.

  1. Characterization of regional left ventricular function in nonhuman primates using magnetic resonance imaging biomarkers: a test-retest repeatability and inter-subject variability study.

    Directory of Open Access Journals (Sweden)

    Smita Sampath

    Full Text Available Pre-clinical animal models are important to study the fundamental biological and functional mechanisms involved in the longitudinal evolution of heart failure (HF. Particularly, large animal models, like nonhuman primates (NHPs, that possess greater physiological, biochemical, and phylogenetic similarity to humans are gaining interest. To assess the translatability of these models into human diseases, imaging biomarkers play a significant role in non-invasive phenotyping, prediction of downstream remodeling, and evaluation of novel experimental therapeutics. This paper sheds insight into NHP cardiac function through the quantification of magnetic resonance (MR imaging biomarkers that comprehensively characterize the spatiotemporal dynamics of left ventricular (LV systolic pumping and LV diastolic relaxation. MR tagging and phase contrast (PC imaging were used to quantify NHP cardiac strain and flow. Temporal inter-relationships between rotational mechanics, myocardial strain and LV chamber flow are presented, and functional biomarkers are evaluated through test-retest repeatability and inter subject variability analyses. The temporal trends observed in strain and flow was similar to published data in humans. Our results indicate a dominant dimension based pumping during early systole, followed by a torsion dominant pumping action during late systole. Early diastole is characterized by close to 65% of untwist, the remainder of which likely contributes to efficient filling during atrial kick. Our data reveal that moderate to good intra-subject repeatability was observed for peak strain, strain-rates, E/circumferential strain-rate (CSR ratio, E/longitudinal strain-rate (LSR ratio, and deceleration time. The inter-subject variability was high for strain dyssynchrony, diastolic strain-rates, peak torsion and peak untwist rate. We have successfully characterized cardiac function in NHPs using MR imaging. Peak strain, average systolic strain

  2. Between two roles - Experiences of newly trained nurse practitioners in surgical care in Sweden: A qualitative study using repeated interviews.

    Science.gov (United States)

    Jangland, Eva; Yngman Uhlin, Pia; Arakelian, Erebouni

    2016-11-01

    The position of Nurse Practitioner is a new role in Nordic countries. The transition from a registered nurse to the Nurse Practitioner role has been reported to be a personal challenge. This study, guided by the Nordic theoretical model for use in the education of advanced practice nurses, represents a unique opportunity to describe this transition for newly graduated Nurse Practitioners in an interprofessional surgical care team in Sweden. The aim was to explore how the first Nurse Practitioners in surgical care experienced the transition into a new role and what competences they used in the team. Eight new Nurse Practitioners with parallel work in clinical practice were interviewed twice around the time of their graduation. The qualitative analyses show that the participants integrated several central competences, but the focus in this early stage in their new role was on direct clinical praxis, consultation, cooperation, case management, and coaching. Transition from the role of clinical nurse specialist to nurse practitioner was a challenging process in which the positive response from patients was a driving force for the new Nurse Practitioners. The participants felt prepared for and determined to solve the challenging situations they approached working in the interprofessional team.

  3. (1)H NMR-based metabolomics study on repeat dose toxicity of fine particulate matter in rats after intratracheal instillation.

    Science.gov (United States)

    Zhang, Yannan; Hu, Hejing; Shi, Yanfeng; Yang, Xiaozhe; Cao, Lige; Wu, Jing; Asweto, Collins Otieno; Feng, Lin; Duan, Junchao; Sun, Zhiwei

    2017-07-01

    Systemic metabolic effects and toxicity mechanisms of ambient fine particulate matter (PM2.5) remain uncertain. In order to investigate the mechanisms in PM2.5 toxicity, we explored the endogenous metabolic changes and possible influenced metabolic pathways in rats after intratracheal instillation of PM2.5 by using a (1)H nuclear magnetic resonance (NMR)-based metabolomics approach. Liver and kidney histopathology examinations were also performed. Chemical characterization demonstrated that PM2.5 was a complex mixture of elements. Histopathology showed cellular edema in liver and glomerulus atrophy of the PM2.5 treated rats. We systematically analyzed the metabolites changes of serum and urine in rats using (1)H NMR techniques in combination with multivariate statistical analysis. Significantly reduced levels of lactate, alanine, dimethylglycine, creatine, glycine and histidine in serum, together with increased levels of citrate, arginine, hippurate, allantoin and decreased levels of allthreonine, lactate, alanine, acetate, succinate, trimethylamine, formate in urine were observed of PM2.5 treated rats. The mainly affected metabolic pathways by PM2.5 were glycine, serine and threonine metabolism, glyoxylate and dicarboxylate metabolism, citrate cycle (TCA cycle), nitrogen metabolism and methane metabolism. Our study provided important information on assessing the toxicity of PM2.5 and demonstrated that metabolomics approach can be employed as a tool to understand the toxicity mechanism of complicated environmental pollutants. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Spacecraft (Mobile Satellite) configuration design study

    Science.gov (United States)

    1985-01-01

    The relative costs to procure and operate a two-satellite mobile satellite system designed to operate either in the UHF band of the L Band, and with several antenna diameter options in each frequency band was investigated. As configured, the size of the spacecraft is limited to the current RCA Series 4000 Geosynchronous Communications Spacecraft bus, which spans the range from 4000 to 5800 pounds in the transfer orbit. The Series 4000 bus forms the basis around which the Mobile Satellite transponder and associated antennas were appended. Although the resultant configuration has little outward resemblance to the present Series 4000 microwave communications spacecraft, the structure, attitude control, thermal, power, and command and control subsystems of the Series 4000 spacecraft are all adapted to support the Mobile Satellite mission.

  5. Socioeconomic inequalities in smoking in The Netherlands before and during the Global Financial Crisis: a repeated cross-sectional study.

    Science.gov (United States)

    Benson, Fiona E; Kuipers, Mirte A G; Nierkens, Vera; Bruggink, Jan-Willem; Stronks, Karien; Kunst, Anton E

    2015-05-06

    The Global Financial Crisis (GFC) increased levels of financial strain, especially in those of low socioeconomic status (SES). Financial strain can affect smoking behaviour. This study examines socioeconomic inequalities in current smoking and smoking cessation in The Netherlands before and during the Global Financial Crisis (GFC). Participants were 66,960 Dutch adults (≥ 18 years) who took part in the annual national Health Survey (2004-2011). Period was dichotomised: 'pre-' and 'during-GFC'. SES measures used were income, education and neighbourhood deprivation. Outcomes were current smoking rates (smokers/total population) and smoking cessation ratios (former smokers/ever smokers). Multilevel logistic regression models controlled for individual characteristics and tested for interaction between period and SES. In both periods, high SES respondents (in all indicators) had lower current smoking levels and higher cessation ratios than those of middle or low SES. Inequalities in current smoking increased significantly in poorly educated adults of 45-64 years of age (Odds Ratio (OR) low educational level compared with high: 2.00[1.79-2.23] compared to pre-GFC 1.67[1.50-1.86], p for interaction = 0.02). Smoking cessation inequalities by income in 18-30 year olds increased with borderline significance during the GFC (OR low income compared to high income: 0.73[0.58-0.91]) compared to pre-GFC (OR: 0.98[0.80-1.20]), p for interaction = 0.051). Overall, socioeconomic inequalities in current smoking and smoking cessation were unchanged during the GFC. However, current smoking inequalities by education, and smoking cessation inequalities by income, increased in specific age groups. Increased financial strain caused by the crisis may disproportionately affect smoking behaviour in some disadvantaged groups.

  6. Burden of hospital admission and repeat angiography in angina pectoris patients with and without coronary artery disease: a registry-based cohort study.

    Directory of Open Access Journals (Sweden)

    Lasse Jespersen

    Full Text Available AIMS: To evaluate risk of hospitalization due to cardiovascular disease (CVD and repeat coronary angiography (CAG in stable angina pectoris (SAP with no obstructive coronary artery disease (CAD versus obstructive CAD, and asymptomatic reference individuals. METHODS AND RESULTS: We followed 11,223 patients with no prior CVD having a first-time CAG in 1998-2009 due to SAP symptoms and 5,695 asymptomatic reference individuals from the Copenhagen City Heart Study through registry linkage for 7.8 years (median. In recurrent event survival analysis, patients with SAP had 3-4-fold higher risk of hospitalization for CVD irrespective of CAG findings and cardiovascular comorbidity. Multivariable adjusted hazard ratios(95%CI for patients with angiographically normal coronary arteries was 3.0(2.5-3.5, for angiographically diffuse non-obstructive CAD 3.9(3.3-4.6 and for 1-3-vessel disease 3.6-4.1(range(all P<0.001. Mean accumulated hospitalization time was 3.5(3.0-4.0(days/10 years follow-up in reference individuals and 4.5(3.8-5.2/7.0(5.4-8.6/6.7(5.2-8.1/6.1(5.2-7.4/8.6(6.6-10.7 in patients with angiographically normal coronary arteries/angiographically diffuse non-obstructive CAD/1-, 2-, and 3-vessel disease, respectively (all P<0.05, age-adjusted. SAP symptoms predicted repeat CAG with multivariable adjusted hazard ratios for patients with angiographically normal coronary arteries being 2.3(1.9-2.9, for angiographically diffuse non-obstructive CAD 5.5(4.4-6.8 and for obstructive CAD 6.6-9.4(range(all P<0.001. CONCLUSIONS: Patients with SAP symptoms and angiographically normal coronary arteries or angiographically diffuse non-obstructive CAD suffer from considerably greater CVD burdens in terms of hospitalization for CVD and repeat CAG compared with asymptomatic reference individuals even after adjustment for cardiac risk factors and exclusion of cardiovascular comorbidity as cause. Contrary to common perception, excluding obstructive CAD by CAG in such

  7. Facilitating the Development and Evaluation of a Citizen Science Web Site: A Case Study of Repeat Photography and Climate Change in Southwest Alaska's National Parks

    Science.gov (United States)

    Mullen, Karina C.; Newman, Gregory; Thompson, Jessica L.

    2013-01-01

    Interviews with national park visitors across the country revealed that climate change education through place-based, hands-on learning using repeat photographs and technology is appealing to park visitors. This manuscript provides a summary of the development of a repeat photography citizen science Web site for national parks in Southwest Alaska.…

  8. Facilitating the Development and Evaluation of a Citizen Science Web Site: A Case Study of Repeat Photography and Climate Change in Southwest Alaska's National Parks

    Science.gov (United States)

    Mullen, Karina C.; Newman, Gregory; Thompson, Jessica L.

    2013-01-01

    Interviews with national park visitors across the country revealed that climate change education through place-based, hands-on learning using repeat photographs and technology is appealing to park visitors. This manuscript provides a summary of the development of a repeat photography citizen science Web site for national parks in Southwest Alaska.…

  9. Study of Contemporary Jewelry Design Emotional Expression Skills

    Directory of Open Access Journals (Sweden)

    Bai-hui Gong

    2017-02-01

    Full Text Available With the development of the society, people gradually realize the importance of design, design also has played a more and more important role in the life.More and more people are willing to choose the design work with unique emotions.Designers gives the new concept of life into the jewelry through the material, color, craft technique, etc. Jewelry as emotional carrier, can better deliver humanistic ideas behind the design in silence.This paper studies the emotional expression skills of contemporary jewelry design.

  10. Similarities and Differences of the Soleus and Gastrocnemius H-reflexes during Varied Body Postures, Foot Positions, and Muscle Function: Multifactor Designs for Repeated Measures

    Directory of Open Access Journals (Sweden)

    Sabbahi Mohamed A

    2011-06-01

    Full Text Available Abstract Background Although the soleus (Sol, medial gastrocnemius (MG, and lateral gastrocnemius (LG muscles differ in function, composition, and innervations, it is a common practice is to investigate them as single H-reflex recording. The purpose of this study was to compare H-reflex recordings between these three sections of the triceps surae muscle group of healthy participants while lying and standing during three different ankle positions. Methods The Sol, MG and LG muscles' H-reflexes were recorded from ten participants during prone lying and standing with the ankle in neutral, maximum dorsiflexion, and maximum plantarflexion positions. Four traces were averaged for each combination of conditions. Three-way ANOVAs (posture X ankle position X muscle with planned comparisons were used for statistical comparisons. Results Although the H-reflex in the three muscle sections differed in latency and amplitude, its dependency on posture and ankle position was similar. The H-reflex amplitudes and maximum H-reflex to M-response (H/M ratios were significantly 1 lower during standing compared to lying with the ankle in neutral, 2 greater during standing with the ankle in plantarflexion compared to neutral, and 3 less with the ankle in dorsiflexion compared to neutral during lying and standing for all muscles (p ≤ .05. Conclusion Varying demands are required for muscles activated during distinctly different postures and ankle movement tasks.

  11. Green Diesel from Hydrotreated Vegetable Oil Process Design Study

    NARCIS (Netherlands)

    Hilbers, T.J.; Sprakel, L.M.J.; Enk, van den L.B.J.; Zaalberg, B.; Berg, van den H.; Ham, van der A.G.J.

    2015-01-01

    A systematic approach was applied to study the process of hydrotreating vegetable oils. During the three phases of conceptual, detailed, and final design, unit operations were designed and sized. Modeling of the process was performed with UniSim Design®. Producing green diesel and jet fuel from vege

  12. Embracing Wicked Problems: The Turn to Design in Composition Studies

    Science.gov (United States)

    Marback, Richard

    2009-01-01

    Recent appeal to the concept of design in composition studies benefits teaching writing in digital media. Yet the concept of design has not been developed enough to fully benefit composition instruction. This article develops an understanding of design as a matter of resolving wicked problems and makes a case for the advantages of this…

  13. Green Diesel from Hydrotreated Vegetable Oil Process Design Study

    NARCIS (Netherlands)

    Hilbers, T.J.; Sprakel, Lisette Maria Johanna; van den Enk, L.B.J.; Zaalberg, B.; van den Berg, Henderikus; van der Ham, Aloysius G.J.

    2015-01-01

    A systematic approach was applied to study the process of hydrotreating vegetable oils. During the three phases of conceptual, detailed, and final design, unit operations were designed and sized. Modeling of the process was performed with UniSim Design®. Producing green diesel and jet fuel from

  14. Design tradeoff studies and sensitivity analysis. Appendix B

    Energy Technology Data Exchange (ETDEWEB)

    1979-05-25

    The results of the design trade-off studies and the sensitivity analysis of Phase I of the Near Term Hybrid Vehicle (NTHV) Program are presented. The effects of variations in the design of the vehicle body, propulsion systems, and other components on vehicle power, weight, cost, and fuel economy and an optimized hybrid vehicle design are discussed. (LCL)

  15. Tokamak Fusion Core Experiment: design studies based on superconducting and hybrid toroidal field coils. Design overview

    Energy Technology Data Exchange (ETDEWEB)

    Flanagan, C.A. (ed.)

    1984-10-01

    This document is a design overview that describes the scoping studies and preconceptual design effort performed in FY 1983 on the Tokamak Fusion Core Experiment (TFCX) class of device. These studies focussed on devices with all-superconducting toroidal field (TF) coils and on devices with superconducting TF coils supplemented with copper TF coil inserts located in the bore of the TF coils in the shield region. Each class of device is designed to satisfy the mission of ignition and long pulse equilibrium burn. Typical design parameters are: major radius = 3.75 m, minor radius = 1.0 m, field on axis = 4.5 T, plasma current = 7.0 MA. These designs relay on lower hybrid (LHRH) current rampup and heating to ignition using ion cyclotron range of frequency (ICRF). A pumped limiter has been assumed for impurity control. The present document is a design overview; a more detailed design description is contained in a companion document.

  16. The Annular Microwave Dryer Design and Study on Honeysuckle

    Directory of Open Access Journals (Sweden)

    Geng Yuefeng

    2014-03-01

    Full Text Available In order to dry fresh honeysuckle, microwave drying process were studied on fresh honeysuckle; and microwave drying apparatus on fresh honeysuckle is designed according to the drying process. The designed microwave dryer contains microwave generator, microwave dryer, dehumidifying systems, control system, transmission systems, microwave leakage inhibited mechanism and other components. The drying experiment is carried by the designed dryer, from the setting-to-work test, the design was success.

  17. Study of the Synchronous Reluctance Motor Design

    Directory of Open Access Journals (Sweden)

    Dirba J.

    2016-08-01

    Full Text Available The paper focuses on studying the external-rotor synchronous reluctance motor. The analysis is performed to estimate the influence of the number of stator slots and non-magnetic areas in the rotor (i.e., flux barriers on the electromagnetic torque and torque ripple of the studied motor. It is concluded that the increase in the number of stator slots Z = 6 to Z = 18 causes an approximately twofold decrease in the ripple factor, but torque increases by 5 %. Electromagnetic torque will be increased approximately by 24 %, if non-magnetic flux barriers are created in the rotor of the studied synchronous reluctance motor.

  18. Optimal adaptive sequential designs for crossover bioequivalence studies.

    Science.gov (United States)

    Xu, Jialin; Audet, Charles; DiLiberti, Charles E; Hauck, Walter W; Montague, Timothy H; Parr, Alan F; Potvin, Diane; Schuirmann, Donald J

    2016-01-01

    In prior works, this group demonstrated the feasibility of valid adaptive sequential designs for crossover bioequivalence studies. In this paper, we extend the prior work to optimize adaptive sequential designs over a range of geometric mean test/reference ratios (GMRs) of 70-143% within each of two ranges of intra-subject coefficient of variation (10-30% and 30-55%). These designs also introduce a futility decision for stopping the study after the first stage if there is sufficiently low likelihood of meeting bioequivalence criteria if the second stage were completed, as well as an upper limit on total study size. The optimized designs exhibited substantially improved performance characteristics over our previous adaptive sequential designs. Even though the optimized designs avoided undue inflation of type I error and maintained power at ≥ 80%, their average sample sizes were similar to or less than those of conventional single stage designs.

  19. Design Study Methodology: Reflections from the Trenches and the Stacks.

    Science.gov (United States)

    Sedlmair, M; Meyer, M; Munzner, T

    2012-12-01

    Design studies are an increasingly popular form of problem-driven visualization research, yet there is little guidance available about how to do them effectively. In this paper we reflect on our combined experience of conducting twenty-one design studies, as well as reading and reviewing many more, and on an extensive literature review of other field work methods and methodologies. Based on this foundation we provide definitions, propose a methodological framework, and provide practical guidance for conducting design studies. We define a design study as a project in which visualization researchers analyze a specific real-world problem faced by domain experts, design a visualization system that supports solving this problem, validate the design, and reflect about lessons learned in order to refine visualization design guidelines. We characterize two axes - a task clarity axis from fuzzy to crisp and an information location axis from the domain expert's head to the computer - and use these axes to reason about design study contributions, their suitability, and uniqueness from other approaches. The proposed methodological framework consists of 9 stages: learn, winnow, cast, discover, design, implement, deploy, reflect, and write. For each stage we provide practical guidance and outline potential pitfalls. We also conducted an extensive literature survey of related methodological approaches that involve a significant amount of qualitative field work, and compare design study methodology to that of ethnography, grounded theory, and action research.

  20. Childhood experiences and repeated suicidal behavior

    DEFF Research Database (Denmark)

    Krarup, Gertrud; Nielsen, Bent; Rask, P

    1991-01-01

    The aim of this study was to elucidate the influence of various events in childhood on suicidal behavior in adult age. For this purpose, 99 patients admitted to the Department of Psychiatry of Odense University Hospital after making a suicide attempt were followed for 5 years, to register repeated...... suicidal behavior. The results showed that three fourths of the patients attempted suicide more than once (62% nonfatal and 14% fatal outcome). The sex distribution was about the same among the first-evers as among the repeaters. Most repeaters were younger people in their twenties and thirties......, and the first-evers on average were past the age of 40. Somewhat unexpectedly, significantly more repeaters than first-evers had grown up with both their parents. However, the results also showed that significantly more repeaters than first-evers had had an unhappy childhood. This indicates...

  1. A Study of Fuel and Reactor Design for Platinum Nanoparticle Catalyzed Microreactors

    Directory of Open Access Journals (Sweden)

    Dylan McNally

    2015-01-01

    Full Text Available Typical microcombustion-based power devices entail the use of catalyst to sustain combustion in less than millimeter scale channels. This work explores the use of several other candidate fuels for ~8 nm diameter Pt particle catalyzed combustion within 800 μm channel width cordierite substrates. The results demonstrate while commercial hydrocarbon fuels such as methane, propane, butane, and ethanol can be used to sustain catalytic combustion, room temperature ignition was only observed using methanol-air mixtures. Fuels, other than methanol, required preheating at temperatures >200°C, yet repeated catalytic cycling similar to methanol-air mixtures was demonstrated. Subsequently, a new reactor design was investigated to couple with thermoelectric generators. The modified reactor design enabled ignition of methanol-air mixtures at room temperature with the ability to achieve repeat catalytic cycles. Preliminary performance studies achieved a maximum temperature difference ΔT of 55°C with a flow rate of 800 mL/min. While the temperature difference indicates a respectable potential for power generation, reduced exhaust temperature and improved thermal management could significantly enhance the eventual device performance.

  2. The study design and methodology for the ARCHER study - adolescent rural cohort study of hormones, health, education, environments and relationships

    Directory of Open Access Journals (Sweden)

    Steinbeck Katharine

    2012-09-01

    Full Text Available Abstract Background Adolescence is characterized by marked psychosocial, behavioural and biological changes and represents a critical life transition through which adult health and well-being are established. Substantial research confirms the role of psycho-social and environmental influences on this transition, but objective research examining the role of puberty hormones, testosterone in males and oestradiol in females (as biomarkers of puberty on adolescent events is lacking. Neither has the tempo of puberty, the time from onset to completion of puberty within an individual been studied, nor the interaction between age of onset and tempo. This study has been designed to provide evidence on the relationship between reproductive hormones and the tempo of their rise to adult levels, and adolescent behaviour, health and wellbeing. Methods/Design The ARCHER study is a multidisciplinary, prospective, longitudinal cohort study in 400 adolescents to be conducted in two centres in regional Australia in the State of New South Wales. The overall aim is to determine how changes over time in puberty hormones independently affect the study endpoints which describe universal and risk behaviours, mental health and physical status in adolescents. Recruitment will commence in school grades 5, 6 and 7 (10–12 years of age. Data collection includes participant and parent questionnaires, anthropometry, blood and urine collection and geocoding. Data analysis will include testing the reliability and validity of the chosen measures of puberty for subsequent statistical modeling to assess the impact over time of tempo and onset of puberty (and their interaction and mean-level repeated measures analyses to explore for significant upward and downward shifts on target outcomes as a function of main effects. Discussion The strengths of this study include enrollment starting in the earliest stages of puberty, the use of frequent urine samples in addition to annual

  3. [Comparative analysis of internal repeating segments in proteins of species from the three kingdoms of life].

    Science.gov (United States)

    Chen, Hao; Zhu, Sheng; Chen, Liang-Biao

    2005-03-01

    In 1970's, Ohno proposed that primordial proteins might evolve from periodic amplification of oligopeptides. Internal repeating segments in proteins may play important roles in functional evolution of proteins. In this study,a new method was designed to extract internal repeating segments from proteomes of 8 modern species belong to eukaryota, bacteria and archaea, respectively. The repeating patterns and the frequencies within proteomes of each kingdom were analyzed by matrix plot. Simple repeat segments were found in eukaryotic proteins with high frequencies,but were much lower in bacteria and none in archaea. Further analysis showed that, the biased usage of amino acids in the internal repeating segments was positively related to the frequencies of individual amino acids in the proteome of a given species. The correlation coefficient was up to 0.95 in prokaryota, with the eukaryota to be lower. The high frequency of simple repeat sequences in eukaryotic proteomes, as well as the disparate relationships of amino acid compositions between the internal repeating segments and their haboring eukaryotic proteomes imply that the fast evolution of simple repeat sequences could be one force that generates the high complexity of eukarytic proteomes.

  4. Study design and patient recruitment for the Japan Polyp Study

    Directory of Open Access Journals (Sweden)

    Sano Y

    2014-05-01

    , Japan Background: The Japan Polyp Study (JPS Workgroup was established in 2000 to evaluate colonoscopic follow-up surveillance strategies. The JPS was a multicenter randomized controlled trial designed to evaluate follow-up surveillance strategies in patients who had undergone two complete colonoscopies for control of colorectal cancer, with removal of all detected polyps. The aim of the present analysis was to assess the patient recruitment and whether the clinical characteristics were adequate for enrollment at the participating centers. Materials and methods: Among referrals for colonoscopy at the eleven participating centers, all patients who were 40–69 years old, without a family or personal history of familial polyposis, Lynch syndrome, inflammatory bowel disease, or a personal history of polypectomy with unknown histology, and had no invasive colorectal cancer or colectomy, were considered for inclusion from February 2003. Results: Among 4,752 referrals, a total of 3,926 patients with a mean age of 57.3 (range 40–69 years, including 2,440 (62% males, were included in the JPS. The participation rate was 83%. Among them, a total of 2,757 patients who had undergone two complete colonoscopies with removal of all detected polyps were eligible, giving an eligibility rate of 70% (2,757 of 3,926. Among the eligible patients, 2,166 were assigned to randomized groups, and 591 patients to a nonrandomized group. The last steps of data lock, analysis, and complete histopathological assessment based on a pathology review are ongoing. Conclusion: Eligible patients recruited for the JPS were successfully assigned on the basis of the expected sample-size calculation. Keywords: colonoscopy, follow-up surveillance strategies, Japan Polyp Study (JPS, study design, multicenter randomized controlled trial

  5. Research study on IPS digital controller design

    Science.gov (United States)

    Kuo, B. C.; Folkerts, C.

    1976-01-01

    The performance is investigated of the simplified continuous-data model of the Instrument Pointing System (IPS). Although the ultimate objective is to study the digital model of the system, knowledge on the performance of the continuous-data model is important in the sense that the characteristics of the digital system should approach those of the continuous-data system as the sampling period approaches zero.

  6. A warehouse design decision model: case study

    OpenAIRE

    Geraldes, Carla A. S. (Ed.); Carvalho, Maria do Sameiro; Pereira, Guilherme

    2008-01-01

    Today’s competitive and volatile market requires flexibility, quality and efficiency from the logistics operations. In this context, warehouses are an important link of the logistic chain and warehouse management plays an important role over customer's service. Throughout this work we analyze a mathematical model aiming to support warehouse management decisions. A case study is used for that purpose and the model jointly identifies product allocation to the functional areas in the warehouse, ...

  7. Design studies for the Double Chooz trigger

    Energy Technology Data Exchange (ETDEWEB)

    Cucoanes, Andi Sebastian

    2009-07-24

    The main characteristic of the neutrino mixing effect is assumed to be the coupling between the flavor and the mass eigenstates. Three mixing angles ({theta}{sub 12}, {theta}{sub 23}, {theta}{sub 13}) are describing the magnitude of this effect. Still unknown, {theta}{sub 13} is considered very small, based on the measurement done by the CHOOZ experiment. A leading experiment will be Double Chooz, placed in the Ardennes region, on the same site as used by CHOOZ. The Double Chooz goal is the exploration of {proportional_to}80% from the currently allowed {theta}{sub 13} region, by searching the disappearance of reactor antineutrinos. Double Chooz will use two similar detectors, located at different distances from the reactor cores: a near one at {proportional_to}150 m where no oscillations are expected and a far one at 1.05 km distance, close to the first minimum of the survival probability function. The measurement foresees a precise comparison of neutrino rates and spectra between both detectors. The detection mechanism is based on the inverse {beta}-decay. The Double Chooz detectors have been designed to minimize the rate of random background. In a simplified view, two optically separated regions are considered. The target, filled with Gd-doped liquid scintillator, is the main antineutrino interaction volume. Surrounding the target, the inner veto region aims to tag the cosmogenic muon background which hits the detector. Both regions are viewed by photomultipliers. The Double Chooz trigger system has to be highly efficient for antineutrino events as well as for several types of background. The trigger analyzes discriminated signals from the central region and the inner veto photomultipliers. The trigger logic is fully programmable and can combine the input signals. The trigger conditions are based on the total energy released in event and on the PMT groups multiplicity. For redundancy, two independent trigger boards will be used for the central region, each of

  8. EBTS:DESIGN AND EXPERIMENTAL STUDY.

    Energy Technology Data Exchange (ETDEWEB)

    PIKIN,A.; ALESSI,J.; BEEBE,E.; KPONOU,A.; PRELEC,K.; KUZNETSOV,G.; TIUNOV,M.

    2000-11-06

    Experimental study of the BNL Electron Beam Test Stand (EBTS), which is a prototype of the Relativistic Heavy Ion Collider (RHIC) Electron Beam Ion Source (EBIS), is currently underway. The basic physics and engineering aspects of a high current EBIS implemented in EBTS are outlined and construction of its main systems is presented. Efficient transmission of a 10 A electron beam through the ion trap has been achieved. Experimental results on generation of multiply charged ions with both continuous gas and external ion injection confirm stable operation of the ion trap.

  9. Design of Orion Soil Impact Study using the Modern Design of Experiments

    Science.gov (United States)

    DeLoach, Richard

    2010-01-01

    Two conventional One Factor At a Time (OFAT) test matrices under consideration for an Orion Landing System subscale soil impact study are reviewed. Certain weaknesses in the designs, systemic to OFAT experiment designs generally, are identified. An alternative test matrix is proposed that is based in the Modern Design of Experiments (MDOE), which achieves certain synergies by combining the original two test matrices into one. The attendant resource savings are quantified and the impact on uncertainty is discussed.

  10. Long-term disability and prognosis in dentatorubral-pallidoluysian atrophy: a correlation with CAG repeat length.

    Science.gov (United States)

    Hasegawa, Arika; Ikeuchi, Takeshi; Koike, Ryoko; Matsubara, Nae; Tsuchiya, Miyuki; Nozaki, Hiroaki; Homma, Atsushi; Idezuka, Jiro; Nishizawa, Masatoyo; Onodera, Osamu

    2010-08-15

    Dentatorubral-pallidoluysian atrophy (DRPLA) is a rare autosomal dominant neurodegenerative disorder caused by CAG repeat expansion. Previous studies demonstrated that the onset of DRPLA is closely associated with CAG repeat length. However, the natural history of DRPLA has not yet been evaluated. We here retrospectively investigated the factors that determine the disease milestones and prognosis in 183 Japanese patients genetically diagnosed with DRPLA. We determined the age at onset, age at which each of the subsequent clinical manifestations appeared, age at becoming wheelchair-bound, and age at death. Kaplan-Meier analysis revealed that the patients with CAG repeats larger than the median length of 65 repeats developed each of the clinical features of DRPLA at a younger age than those with repeats. The patients became wheelchair-bound at a median age of 33 years (n = 61; range, 3-77 years) and died at a median age of 49 years (n = 23; range, 18-80 years). The ages at becoming wheelchair-bound and at death strongly correlated with the expanded CAG repeat length. Moreover, the patients with >or=65 CAG repeats showed a more severe long-term disability and a poorer prognosis. In contrast, the rate of progression after the onset did not correlate with CAG repeat length. The CAG repeat length may have a considerable effect on not only the disease onset but also the disease milestones and prognosis in DRPLA patients. These effects of CAG repeat length may be relevant in designing future clinical therapeutic trials.

  11. Estimation of acute oral toxicity using the No Observed Adverse Effect Level (NOAEL) from the 28 day repeated dose toxicity studies in rats.

    Science.gov (United States)

    Bulgheroni, Anna; Kinsner-Ovaskainen, Agnieszka; Hoffmann, Sebastian; Hartung, Thomas; Prieto, Pilar

    2009-02-01

    Acute systemic toxicity is one of the areas of particular concern due to the 2009 deadline set by the 7th Amendment of the Cosmetics Directive (76/768/EEC), which introduces a testing and marketing ban of cosmetic products with ingredients tested on animals. The scientific community is putting considerable effort into developing and validating non-animal alternatives in this area. However, it is unlikely that validated and regulatory accepted alternative methods and/or strategies will be available in March 2009. Following the initiatives undertaken in the pharmaceutical industry to waive the acute oral toxicity testing before going to clinical studies by using information from other in vivo studies, we proposed an approach to identify non-toxic compounds (LD50>2000mg/kg) using information from 28 days repeated dose toxicity studies. Taking into account the high prevalence of non-toxic substances (87%) in the New Chemicals Database, it was possible to set a NOAEL threshold of 200mg/kg that allowed the correct identification of 63% of non-toxic compounds, while testing of cosmetic ingredients.

  12. Influence of coefficient of variation in determining significant difference of quantitative values obtained from 28-day repeated-dose toxicity studies in rats.

    Science.gov (United States)

    Kobayashi, Katsumi; Sakuratani, Yuki; Abe, Takemaru; Yamazaki, Kazuko; Nishikawa, Satoshi; Yamada, Jun; Hirose, Akihiko; Kamata, Eiichi; Hayashi, Makoto

    2011-01-01

    In order to understand the influence of coefficient of variation (CV) in determining significant difference of quantitative values of 28-day repeated-dose toxicity studies, we examined 59 parameters of 153 studies conducted in accordance with Chemical Substance Control Law in 12 test facilities. Sex difference was observed in 12 parameters and 10 parameters showed large CV in females. The minimum CV was 0.74% for sodium. CV of electrolytes was comparatively small, whereas enzymes had large CV. Large differences in CV were observed for major parameters among 7-8 test facilities. The changes in CV were grossly classified into 11. Our study revealed that a statistical significant difference is usually detected if there is a difference of 7% in mean values between the groups and the groups have a CV of about 7%. A parameter with a CV as high as 30% may be significantly different, if the difference of the mean between the groups is 30%. It would be ideal to use median value to assess the treatment-related effect, rather than mean, when the CV is very high. We recommend using CV of the body weight as a standard to judge the adverse effect level.

  13. Communicating Qualitative Research Study Designs to Research Ethics Review Boards

    Science.gov (United States)

    Ells, Carolyn

    2011-01-01

    Researchers using qualitative methodologies appear to be particularly prone to having their study designs called into question by research ethics or funding agency review committees. In this paper, the author considers the issue of communicating qualitative research study designs in the context of institutional research ethics review and offers…

  14. Interior Design Supports Art Education: A Case Study

    Science.gov (United States)

    Clemons, Stephanie A.

    2006-01-01

    Interior design, as a field of study, is a rapidly growing area of interest--particularly for teenagers in the United States. Part of this interest stems from the proliferation of design-related reality shows available through television media. Some art educators and curriculum specialists in the nation perceive the study of interior spaces as a…

  15. ASIPP remotely operated vehicle design (ROV) and feasibility study

    Science.gov (United States)

    Zhang, Tao; Zhang, Xuanchen; Wang, Lei; Pan, Hongtao; Zheng, Lei; Cheng, Yong; Wu, Jing

    2017-06-01

    The ROV is an important device for studying the underwater world. Thus, the ASIPP ROV is designed to meet this demand by ASIPP RH team. Through adding the wireless vision module, the performance of the robot is promoted in motion control, image collecting and so on. The rationality of the design and the effectiveness of the controller are validated by simulation and experimental study.

  16. 23 CFR 650.117 - Content of design studies.

    Science.gov (United States)

    2010-04-01

    ... 23 Highways 1 2010-04-01 2010-04-01 false Content of design studies. 650.117 Section 650.117 Highways FEDERAL HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION ENGINEERING AND TRAFFIC OPERATIONS...) Studies by highway agencies shall contain: (1) The hydrologic and hydraulic data and design...

  17. Interior Design Supports Art Education: A Case Study

    Science.gov (United States)

    Clemons, Stephanie A.

    2006-01-01

    Interior design, as a field of study, is a rapidly growing area of interest--particularly for teenagers in the United States. Part of this interest stems from the proliferation of design-related reality shows available through television media. Some art educators and curriculum specialists in the nation perceive the study of interior spaces as a…

  18. 300 GeV Up-dated design study

    CERN Multimedia

    1967-01-01

    The 'Report on the Design Study of a 300 GeV Proton Synchrotron' (document CERN/ 563) was issued in November 1964. An Addendum (document CERN/702) to this Design Study was issued on 30 May as one of the up-to-date set of documents and relevant costs presented to the June Council Meeting.

  19. Evidence of cormorant-induced mortality, disparate migration strategies and repeatable circadian rhythm in the endangered North Sea houting (Coregonus oxyrinchus): A telemetry study mapping the postspawning migration

    DEFF Research Database (Denmark)

    Jensen, Lasse Fast; Rognon, Paul C.B.; Aarestrup, Kim

    2017-01-01

    , possibly indicating constrained navigation through the lakes. The migration into the Wadden Sea correlated with temperature indicating osmoregulatory constraints of sea entry. Unlike most salmonid species, migration occurred both day and night. Moreover, fish exhibited repeatable individual differences...

  20. Transitioning from Marketing-Oriented Design to User-Oriented Design: A Case Study

    Science.gov (United States)

    Laster, Shari; Stitz, Tammy; Bove, Frank J.; Wise, Casey

    2011-01-01

    The transition to a new architecture and design for an academic library Web site does not always proceed smoothly. In this case study, a library at a large research university hired an outside Web development contractor to create a new architecture and design for the university's Web site using dotCMS, an open-source content management system. The…

  1. Design Fixation and Cooperative Learning in Elementary Engineering Design Project: A Case Study

    Science.gov (United States)

    Luo, Yi

    2015-01-01

    This paper presents a case study examining 3rd, 4th and 5th graders' design fixation and cooperative learning in an engineering design project. A mixed methods instrument, the Cooperative Learning Observation Protocol (CLOP), was adapted to record frequency and class observation on cooperative learning engagement through detailed field notes.…

  2. Quality by design study of the direct analysis in real time mass spectrometry response.

    Science.gov (United States)

    Wang, Lu; Chen, Teng; Zeng, Shanshan; Qu, Haibin

    2014-02-01

    A mass spectrometry method has been developed using the Quality by Design (QbD) principle. Direct analysis in real time mass spectrometry (DART-MS) was adopted to analyze a pharmaceutical preparation. A fishbone diagram for DART-MS and the Plackett-Burman design were utilized to evaluate the impact of a number of factors on the method performance. Multivariate regression and Pareto ranking analysis indicated that the temperature, determined distance, and sampler speed were statistically significant (P design combined with response surface analysis was then employed to study the relationships between these three factors and the quality of the DART-MS analysis. The analytical design space of DART-MS was thus constructed and its robustness was validated. In this presented approach, method performance was mathematically described as a composite desirability function of the critical quality attributes (CQAs). Two terms of method validation, including analytical repeatability and method robustness, were carried out at an operating work point. Finally, the validated method was successfully applied to the pharmaceutical quality assurance in different manufacturing batches. These results revealed that the QbD concept was practical in DART-MS method development. Meanwhile, the determined quality was controlled by the analytical design space. This presented strategy provided a tutorial to the development of a robust QbD-compliant mass spectrometry method for industrial quality control.

  3. Quality by Design Study of the Direct Analysis in Real Time Mass Spectrometry Response

    Science.gov (United States)

    Wang, Lu; Chen, Teng; Zeng, Shanshan; Qu, Haibin

    2013-12-01

    A mass spectrometry method has been developed using the Quality by Design (QbD) principle. Direct analysis in real time mass spectrometry (DART-MS) was adopted to analyze a pharmaceutical preparation. A fishbone diagram for DART-MS and the Plackett-Burman design were utilized to evaluate the impact of a number of factors on the method performance. Multivariate regression and Pareto ranking analysis indicated that the temperature, determined distance, and sampler speed were statistically significant (P < 0.05). Furthermore, the Box-Behnken design combined with response surface analysis was then employed to study the relationships between these three factors and the quality of the DART-MS analysis. The analytical design space of DART-MS was thus constructed and its robustness was validated. In this presented approach, method performance was mathematically described as a composite desirability function of the critical quality attributes (CQAs). Two terms of method validation, including analytical repeatability and method robustness, were carried out at an operating work point. Finally, the validated method was successfully applied to the pharmaceutical quality assurance in different manufacturing batches. These results revealed that the QbD concept was practical in DART-MS method development. Meanwhile, the determined quality was controlled by the analytical design space. This presented strategy provided a tutorial to the development of a robust QbD-compliant mass spectrometry method for industrial quality control.

  4. Research designs and making causal inferences from health care studies.

    Science.gov (United States)

    Flannelly, Kevin J; Jankowski, Katherine R B

    2014-01-01

    This article summarizes the major types of research designs used in healthcare research, including experimental, quasi-experimental, and observational studies. Observational studies are divided into survey studies (descriptive and correlational studies), case-studies and analytic studies, the last of which are commonly used in epidemiology: case-control, retrospective cohort, and prospective cohort studies. Similarities and differences among the research designs are described and the relative strength of evidence they provide is discussed. Emphasis is placed on five criteria for drawing causal inferences that are derived from the writings of the philosopher John Stuart Mill, especially his methods or canons. The application of the criteria to experimentation is explained. Particular attention is given to the degree to which different designs meet the five criteria for making causal inferences. Examples of specific studies that have used various designs in chaplaincy research are provided.

  5. Beyond the castle:public space co-design, a case study and guidelines for designers

    OpenAIRE

    Cruickshank, Leon; Coupe, Gemma; Hennesy, Dee

    2013-01-01

    In this paper we describe a high profile project to reimagine a large green space in the heart of the city of Lancaster in the UK. This co-design project involved professional designers but also 2500 people with 700 of these making an active co-design contribution. This project forms the basis of a discussion of how we used a series of events to help participants reach their full creative co-design potential moving from doing to creating levels of creativity. From this case study we go on to ...

  6. Repeatability of Cryogenic Multilayer Insulation

    Science.gov (United States)

    Johnson, W. L.; Vanderlaan, M.; Wood, J. J.; Rhys, N. O.; Guo, W.; Van Sciver, S.; Chato, D. J.

    2017-01-01

    Due to the variety of requirements across aerospace platforms, and one off projects, the repeatability of cryogenic multilayer insulation has never been fully established. The objective of this test program is to provide a more basic understanding of the thermal performance repeatability of MLI systems that are applicable to large scale tanks. There are several different types of repeatability that can be accounted for: these include repeatability between multiple identical blankets, repeatability of installation of the same blanket, and repeatability of a test apparatus. The focus of the work in this report is on the first two types of repeatability. Statistically, repeatability can mean many different things. In simplest form, it refers to the range of performance that a population exhibits and the average of the population. However, as more and more identical components are made (i.e. the population of concern grows), the simple range morphs into a standard deviation from an average performance. Initial repeatability testing on MLI blankets has been completed at Florida State University. Repeatability of five GRC provided coupons with 25 layers was shown to be +/- 8.4 whereas repeatability of repeatedly installing a single coupon was shown to be +/- 8.0. A second group of 10 coupons have been fabricated by Yetispace and tested by Florida State University, through the first 4 tests, the repeatability has been shown to be +/- 16. Based on detailed statistical analysis, the data has been shown to be statistically significant.

  7. Parametric design study of tandem mirror fusion reactors

    Energy Technology Data Exchange (ETDEWEB)

    Carlson, G.A.

    1977-05-27

    The parametric design study of the tandem mirror reactor (TMR) is described. The results of this study illustrate the variation of reactor characteristics with changes in the independent design parameters, reveal the set of design parameters which minimizes the cost of the reactor, and show the sensitivity of the optimized design to physics and technological uncertainties. The total direct capital cost of an optimized 1000 MWe TMR is estimated to be $1300/kWe. The direct capital cost of a 2000 MWe plant is less than $1000/kWe.

  8. Determination of the ideal sampling technique to reduce repeated procedures:a comparative study including 393 fine-needle aspirations for thyroid nodules.

    Science.gov (United States)

    Uzunkaya, Fatih; Özden, Ahmet

    2017-02-27

    Fine-needle aspiration biopsy is an established method for the evaluation of thyroid nodules, but it has not been standardized worldwide yet. Adequacy of the aspirations is affected by several factors. The aim of this study is to determine the main factors affecting the adequacy and to suggest a procedural technique expected to reduce repeated procedures. A total of 393 aspiration procedures performed using either 22-gauge or 27-gauge needles were included in the study. The samplings were classified as inadequate or adequate according to the cytopathological reports, and results were compared. The rate of adequate samplings was higher in the 27-gauge group and the difference was statistically significant. Neither the size of nodules nor the number of slides used for smearing affected the adequacy. There was not a statistically significant relation between the needle size and the nodule size or the number of slides in terms of adequacy. Needle size is an important factor that affects the adequacy of samplings. The nodule size and the number of slides do not affect the adequacy. However, bloody and thicker smears are difficult for pathologists to evaluate and result in inadequacy.

  9. Diurnal variations of plasma homocysteine, total antioxidant status, and biological markers of muscle injury during repeated sprint: effect on performance and muscle fatigue--a pilot study.

    Science.gov (United States)

    Hammouda, Omar; Chtourou, Hamdi; Chahed, Henda; Ferchichi, Salyma; Kallel, Choumous; Miled, Abdelhedi; Chamari, Karim; Souissi, Nizar

    2011-12-01

    The aim of this study was (i) to evaluate whether homocysteine (Hcy), total antioxidant status (TAS), and biological markers of muscle injury would be affected by time of day (TOD) in football players and (ii) to establish a relationship between diurnal variation of these biomarkers and the daytime rhythm of power and muscle fatigue during repeated sprint ability (RSA) exercise. In counterbalanced order, 12 football (soccer) players performed an RSA test (5 x[6 s of maximal cycling sprint + 24 s of rest]) on two different occasions: 07:00-08:30 h and 17:00-18:30 h. Fasting blood samples were collected from a forearm vein before and 3-5 min after each RSA test. Core temperature, rating of perceived exertion, and performances (i.e., Sprint 1, Sprint 2, and power decrease) during the RSA test were significantly higher at 17:00 than 07:00 h (p RSA test. However, biomarkers of antioxidant status' resting levels (i.e., total antioxidant status, uric acid, and total bilirubin) were higher in the morning. This TOD effect was suppressed after exercise for TAS and uric acid. In conclusion, the present study confirms diurnal variation of Hcy, selected biological markers of cellular damage, and antioxidant status in young football players. Also, the higher performances and muscle fatigue showed in the evening during RSA exercise might be due to higher levels of biological markers of muscle injury and lower antioxidant status at this TOD.

  10. Repeatability of clades as a criterion of reliability: a case study for molecular phylogeny of Acanthomorpha (Teleostei) with larger number of taxa.

    Science.gov (United States)

    Chen, Wei-Jen; Bonillo, Céline; Lecointre, Guillaume

    2003-02-01

    Although much progress has been made recently in teleostean phylogeny, relationships among the main lineages of the higher teleosts (Acanthomorpha), containing more than 60% of all fish species, remain poorly defined. This study represents the most extensive taxonomic sampling effort to date to collect new molecular characters for phylogenetic analysis of acanthomorph fishes. We compiled and analyzed three independent data sets, including: (i) mitochondrial ribosomal fragments from 12S and 16s (814bp for 97 taxa); (ii) nuclear ribosomal 28S sequences (847bp for 74 taxa); and (iii) a nuclear protein-coding gene, rhodopsin (759bp for 86 taxa). Detailed analyses were conducted on each data set separately and the principle of taxonomic congruence without consensus trees was used to assess confidence in the results as follows. Repeatability of clades from separate analyses was considered the primary criterion to establish reliability, rather than bootstrap proportions from a single combined (total evidence) data matrix. The new and reliable clades emerging from this study of the acanthomorph radiation were: Gadiformes (cods) with Zeioids (dories); Beloniformes (needlefishes) with Atheriniformes (silversides); blenioids (blennies) with Gobiesocoidei (clingfishes); Channoidei (snakeheads) with Anabantoidei (climbing gouramies); Mastacembeloidei (spiny eels) with Synbranchioidei (swamp-eels); the last two pairs of taxa grouping together, Syngnathoidei (aulostomids, macroramphosids) with Dactylopteridae (flying gurnards); Scombroidei (mackerels) plus Stromatoidei plus Chiasmodontidae; Ammodytidae (sand lances) with Cheimarrhichthyidae (torrentfish); Zoarcoidei (eelpouts) with Cottoidei; Percidae (perches) with Notothenioidei (Antarctic fishes); and a clade grouping Carangidae (jacks), Echeneidae (remoras), Sphyraenidae (barracudas), Menidae (moonfish), Polynemidae (threadfins), Centropomidae (snooks), and Pleuronectiformes (flatfishes).

  11. 26-week repeated oral dose toxicity study of UP446, a combination of defined extracts of Scutellaria baicalensis and Acacia catechu, in beagle dogs.

    Science.gov (United States)

    Yimam, Mesfin; Lee, Young Chul; Jia, Qi

    2016-07-01

    The needs for relatively safe botanical alternatives to relieve symptoms associated to arthritis have continued to grow in parallel with the ageing population. UP446, a standardized bioflavonoid composition from the roots of Scutellaria baicalensis and the heartwoods of Acacia catechu, has been used as over the counter joint care dietary supplements and a prescription medical food. Significant safety data have been documented in rodents and human for this composition. Here we evaluated the potential adverse effects of orally administered UP446 in beagle dogs following a 26-week repeated oral dose toxicity study. UP446 at doses of 250, 500 and 1000 mg/kg/day were administered orally to beagle dogs for 26 weeks. A 4-week recovery group from the high dose (1000 mg/kg) and vehicle treated groups were included. No morbidity or mortality was observed for the duration of the study. No significant differences between groups in body weights, food consumption, ophthalmological examinations, electrocardiograms, urinalysis, hematology, clinical chemistry, organ weights, gross pathology and histopathology were documented. Emesis, loose feces and diarrhea were noted in both genders at the 1000 mg/kg treatment groups. These clinical signs were considered to be reversible as they were not evident in the recovery period. In conclusion, the no-observed-adverse-effect-level (NOAEL) of UP446 was considered to be 500 mg/kg/day both in male and female beagle dogs.

  12. Combination of the clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 technique with the piggybac transposon system for mouse in utero electroporation to study cortical development.

    Science.gov (United States)

    Cheng, Man; Jin, Xubin; Mu, Lili; Wang, Fangyu; Li, Wei; Zhong, Xiaoling; Liu, Xuan; Shen, Wenchen; Liu, Ying; Zhou, Yan

    2016-09-01

    In utero electroporation (IUE) is commonly used to study cortical development of cerebrum by downregulating or overexpressing genes of interest in neural progenitor cells (NPCs) of small mammals. However, exogenous plasmids are lost or diluted over time. Furthermore, gene knockdown based on short-hairpin RNAs may exert nonspecific effects that lead to aberrant neuronal migration. Genomic engineering by the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) system has great research and therapeutic potentials. Here we integrate the CRISPR/Cas9 components into the piggyBac (PB) transposon system (the CRISPR/Cas9-PB toolkit) for cortical IUEs. The mouse Sry-related HMG box-2 (Sox2) gene was selected as the target for its application. Most transduced cortical NPCs were depleted of SOX2 protein as early as 3 days post-IUE, whereas expressions of SOX1 and PAX6 remained intact. Furthermore, both the WT Cas9 and the D10A nickase mutant Cas9n showed comparable knockout efficiency. Transduced cortical cells were purified with fluorescence-activated cell sorting, and effective gene editing at the Sox2 loci was confirmed. Thus, application of the CRISPR/Cas9-PB toolkit in IUE is a promising strategy to study gene functions in cortical NPCs and their progeny. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  13. Design Fixation and Cooperative Learning in Elementary Engineering Design Project: A Case Study

    Directory of Open Access Journals (Sweden)

    Yi Luo

    2015-09-01

    Full Text Available This paper presents a case study examining 3rd, 4th and 5th graders’ design fixation and cooperative learning in an engineering design project. A mixed methods instrument, the Cooperative Learning Observation Protocol (CLOP, was adapted to record frequency and class observation on cooperative learning engagement through detailed field notes. Students’ design journals and reflections were also analyzed for an inductive qualitative analysis. The findings indicate three major themes of design fixation: 1 fixation on common features of things; 2 fixation on popular teenage culture; 3 fixation on the first design idea. In the cooperative learning process of elementary engineering design project, although pupils had demonstrated some abilities to solve concrete problems in a logical fashion, the participants encountered a number of obstacles in the group. Dominance, social loafing, and other problems occurring in the group process might have offset certain benefits of cooperative learning. Implications of the findings are also discussed.

  14. Efficacy and efficiency: self-designed versus instructor-designed study tools.

    Science.gov (United States)

    Stern, E B; Hassanein, R S

    1992-03-01

    During the course of their education, occupational therapy students learn to administer complex structured assessments. For easier administration of these assessments, students design note cards, which then replace cumbersome test manuals during administration. This study considered whether students could learn test administration with equal efficiency and efficacy if given test administration note cards rather than having to design their own. The results showed that the subjects using instructor-designed cards earned written test and practical examination scores similar to those of the subjects using self-designed cards. The subjects using instructor-designed cards spent significantly less (p = .003) total time in study than did the subjects using self-designed cards. The difference in time between the two groups was attributable to the time spent designing note cards. Therefore, distribution of instructor-designed note cards appears to offer equally effective and significantly more efficient learning when compared with that produced when students design their own cards. The differences in efficacy and efficiency were similar for students of different learning styles (as classified by Witkin's field-dependence/field-independence continuum) [corrected].

  15. Pentatricopeptide repeat proteins in plants.

    Science.gov (United States)

    Barkan, Alice; Small, Ian

    2014-01-01

    Pentatricopeptide repeat (PPR) proteins constitute one of the largest protein families in land plants, with more than 400 members in most species. Over the past decade, much has been learned about the molecular functions of these proteins, where they act in the cell, and what physiological roles they play during plant growth and development. A typical PPR protein is targeted to mitochondria or chloroplasts, binds one or several organellar transcripts, and influences their expression by altering RNA sequence, turnover, processing, or translation. Their combined action has profound effects on organelle biogenesis and function and, consequently, on photosynthesis, respiration, plant development, and environmental responses. Recent breakthroughs in understanding how PPR proteins recognize RNA sequences through modular base-specific contacts will help match proteins to potential binding sites and provide a pathway toward designing synthetic RNA-binding proteins aimed at desired targets.

  16. Engineering Design Tools for Shape Memory Alloy Actuators: CASMART Collaborative Best Practices and Case Studies

    Science.gov (United States)

    Wheeler, Robert W.; Benafan, Othmane; Gao, Xiujie; Calkins, Frederick T; Ghanbari, Zahra; Hommer, Garrison; Lagoudas, Dimitris; Petersen, Andrew; Pless, Jennifer M.; Stebner, Aaron P.; Turner, Travis L.

    2016-01-01

    The primary goal of the Consortium for the Advancement of Shape Memory Alloy Research and Technology (CASMART) is to enable the design of revolutionary applications based on shape memory alloy (SMA) technology. In order to help realize this goal and reduce the development time and required experience for the fabrication of SMA actuation systems, several modeling tools have been developed for common actuator types and are discussed herein along with case studies, which highlight the capabilities and limitations of these tools. Due to their ability to sustain high stresses and recover large deformations, SMAs have many potential applications as reliable, lightweight, solid-state actuators. Their advantage over classical actuators can also be further improved when the actuator geometry is modified to fit the specific application. In this paper, three common actuator designs are studied: wires, which are lightweight, low-profile, and easily implemented; springs, which offer actuation strokes upwards of 200 at reduced mechanical loads; and torque tubes, which can provide large actuation forces in small volumes and develop a repeatable zero-load actuation response (known as the two-way shape memory effect). The modeling frameworks, which have been implemented in the design tools, are developed for each of these frequently used SMA actuator types. In order to demonstrate the versatility and flexibility of the presented design tools, as well as validate their modeling framework, several design challenges were completed. These case studies include the design and development of an active hinge for the deployment of a solar array or foldable space structure, an adaptive solar array deployment and positioning system, a passive air temperature controller for regulation flow temperatures inside of a jet engine, and a redesign of the Corvette active hatch, which allows for pressure equalization of the car interior. For each of the presented case studies, a prototype or proof

  17. Practical use of the repeating patterns in mask writing

    Science.gov (United States)

    Shoji, Masahiro; Inoue, Tadao; Yamabe, Masaki

    2010-03-01

    In May 2006, the Mask Design, Drawing, and Inspection Technology Research Department (Mask D2I) at the Association of Super-Advanced Electronics Technologies (ASET) launched a 4-year program for reducing mask manufacturing cost and TAT by concurrent optimization of MDP, mask writing, and mask inspection. As one of the tasks being pursued at the Mask Design Data Technology Research Laboratory, we have evaluated the effect of reducing the drawing shot counts by utilizing the repeating patterns, and showed positive impact on mask making by using CP drawing. During the past four years, we have developed a software to extract repeating patterns from fractured OPCed mask data which can be used to minimize the shot counts. In this evaluation, we have used an actual device production data obtained from the member companies of MaskD2I. To the extraction software we added new functions for extracting common repeating patterns from a set of multiple masks, and studied how this step can reduce the counts in comparison to the shot counts required during the conventional mask writing techniques. We have also developed software that uses the extraction result of repeating patterns and prepares drawing-data for the MCC/CP drawing system, which has been developed at the Mask Writing Equipment Technology Research Laboratory. With this software, we have simulated EB proximity effect on CP writing and examined how it affect the shot count reduction where CP shots with large CD errors are to be divided into VSB shots. In this paper, we will report the evaluation result of the practical application of repeating patterns in mask writing with this software.

  18. Repeater For A Digital-Communication Bus

    Science.gov (United States)

    Torres-Guzman, Esteban; Olson, Stephen; Heaps, Tim

    1993-01-01

    Digital repeater circuit designed to extend range of communication on MIL-STD-1553 bus beyond original maximum allowable length of 300 ft. Circuit provides two-way communication, one way at time, and conforms to specifications of MIL-STD-1553. Crosstalk and instability eliminated.

  19. Advanced wind turbine design studies: Advanced conceptual study. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Hughes, P; Sherwin, R [Atlantic Orient Corp., Norwich, VT (United States)

    1994-08-01

    In conjunction with the US Department of Energy and the National Renewable Energy Laboratory`s Advanced Wind Turbine Program, the Atlantic Orient Corporation developed preliminary designs for the next generation of wind turbines. These 50 kW and 350 kW turbines are based upon the concept of simplicity. By adhering to a design philosophy that emphasizes simplicity, we project that these turbines will produce energy at extremely competitive rates which will unlock the potential of wind energy domestically and internationally. The program consisted of three distinct phases. First, we evaluated the operational history of the Enertech 44 series wind turbines. As a result of this evaluation, we developed, in the second phase, a preliminary design for a new 50 kW turbine for the near-term market. In the third phase, we took a clean-sheet-of-paper approach to designing a 350 kW turbine focused on the mid-1990s utility market that incorporated past experience and advanced technology.

  20. Design, recruitment, and retention of African-American smokers in a pharmacokinetic study

    Directory of Open Access Journals (Sweden)

    Mayo Matthew S

    2010-01-01

    Full Text Available Abstract Background African-Americans remain underrepresented in clinical research despite experiencing a higher burden of disease compared to all other ethnic groups in the United States. The purpose of this article is to describe the study design and discuss strategies used to recruit and retain African-American smokers in a pharmacokinetic study. Methods The parent study was designed to evaluate the differences in the steady-state concentrations of bupropion and its three principal metabolites between African-American menthol and non-menthol cigarette smokers. Study participation consisted of four visits at a General Clinical Research Center (GCRC over six weeks. After meeting telephone eligibility requirements, phone-eligible participants underwent additional screening during the first two GCRC visits. The last two visits (pharmacokinetic study phase required repeated blood draws using an intravenous catheter over the course of 12 hours. Results Five hundred and fifteen African-American smokers completed telephone screening; 187 were phone-eligible and 92 were scheduled for the first GCRC visit. Of the 81 who attended the first visit, 48 individuals were enrolled in the pharmacokinetic study, and a total of 40 individuals completed the study (83% retention rate. Conclusions Although recruitment of African-American smokers into a non-treatment, pharmacokinetic study poses challenges, retention is feasible. The results provide valuable information for investigators embarking on non-treatment laboratory-based studies among minority populations.