
Sample records for repeat-polymerase chain reaction

  1. HF Chain Reaction Laser (United States)


    reaction can develop uni2ormly in a subsonic flow with snall teemperatiu-e rise over a distance much longer than the time for mixing, thus tendiný to isolate...upper level population, moreover, the observed effects of H2, Tabla 3, appear to be predicted reasonably well by the model. In the calcula- tions 112

  2. Polymerization as a Model Chain Reaction (United States)

    Morton, Maurice


    Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

  3. The chain re-action

    CERN Multimedia


    On 18 March, beam commissioning started in the first ‘link’ of the accelerator chain – LINAC 2. This marks the start of what will be the longest period of beam operations in CERN’s history, with the accelerator complex remaining operational throughout the winter to supply the LHC. The Bulletin finds out what is being done to make sure the whole chain is ready for this historic run.

  4. Bordetella pertussis diagnosed by polymerase chain reaction

    DEFF Research Database (Denmark)

    Birkebaek, N H; Heron, I; Skjødt, K


    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity of...

  5. Determining Annealing Temperatures for Polymerase Chain Reaction (United States)

    Porta, Angela R.; Enners, Edward


    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  6. Polymerase Chain Reaction for Educational Settings. (United States)

    Garrison, Stephen J.; dePamphillis, Claude


    Suggests the incorporation of the Polymerase Chain Reaction (PCR) technique into high school and college biology laboratories. Discusses the following sections: (1) current PCR applications; (2) PCR technique; (3) Manual and Machine PCR; (4) Manual PCR Preparations and Procedure; (5) Materials, Supplies, and Recipes; (6) Primer Selection; and (7)…

  7. The polymerase chain reaction (PCR): general methods. (United States)

    Waters, Daniel L E; Shapter, Frances M


    The polymerase chain reaction (PCR) converts very low quantities of DNA into very high quantities and is the foundation of many specialized techniques of molecular biology. PCR utilizes components of the cellular machinery of mitotic cell division in vitro which respond predictably to user inputs. This chapter introduces the principles of PCR and discusses practical considerations from target sequence definition through to optimization and application.

  8. Polymerase chain reaction assay for avian polyomavirus.


    Phalen, D.N.; Wilson, V G; Graham, D L


    A polymerase chain reaction assay was developed for detection of budgerigar fledgling disease virus (BFDV). The assay used a single set of primers complementary to sequences located in the putative coding region for the BFDV VP1 gene. The observed amplification product had the expected size of 550 bp and was confirmed to derive from BFDV DNA by its restriction digestion pattern. This assay was specific for BFDV and highly sensitive, being able to detect as few as 20 copies of the virus. By us...

  9. Transformational leadership: a cascading chain reaction. (United States)

    Murphy, Lorraine


    Historical influences still permeate contemporary nursing practise. These are mirrored in organizational philosophies, transactional and autocratic leadership styles and disempowered staff. Whilst there is disparity amongst the theorists' definitions of leadership, there is consensus pertaining to the attributes necessary to realize effective leadership. Transformational leadership is heralded as new criterion for nurse managers, and can be achieved through training, education and professional development in key leadership competencies. To achieve a chain reaction, charismatic transformational leaders espouse intellectual stimulation and individual consideration to empower staff and enhance patient care. Nurse managers that develop and foster transformational leadership can surmount oppressive traditions and confidently navigate a complex and rapidly changing health care environment.

  10. Polymerase chain reaction with nearby primers. (United States)

    Garafutdinov, Ravil R; Galimova, Aizilya A; Sakhabutdinova, Assol R


    DNA analysis of biological specimens containing degraded nucleic acids such as mortal remains, archaeological artefacts, forensic samples etc. has gained more attention in recent years. DNA extracted from these samples is often inapplicable for conventional polymerase chain reaction (PCR), so for its amplification the nearby primers are commonly used. Here we report the data that clarify the features of PCR with nearby and abutting primers. We have shown that the proximity of primers leads to significant reduction of the reaction time and ensures the successful performance of DNA amplification even in the presence of PCR inhibitors. The PCR with abutting primers is usually characterized by the absence of nonspecific amplification products that causes extreme sensitivity with limit of detection on single copy level. The feasibility of PCR with abutting primers was demonstrated on species identification of 100 years old rotten wood. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Bordetella pertussis diagnosed by polymerase chain reaction

    DEFF Research Database (Denmark)

    Birkebaek, N H; Heron, I; Skjødt, K


    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...... in 25 patients in whose nasopharyngeal secretions BP had been demonstrated after 4-7 days of culture. The detection limit of PCR in aqueous solution was 1-2 BP bacteria per reaction tube. PCR was 100% specific for BP, showing no response with other Bordetella species or other bacteria known to colonize...... of PCR for the diagnosis of BP, we used known concentrations of BP, Bordetella parapertussis and Bordetella bronchiseptica in aqueous solutions. PCR was furthermore carried out on species of bacteria that might be isolated from the nasopharynx. The applicability of PCR to patient specimens was tested...

  12. Polymerase chain reaction assay for avian polyomavirus. (United States)

    Phalen, D N; Wilson, V G; Graham, D L


    A polymerase chain reaction assay was developed for detection of budgerigar fledgling disease virus (BFDV). The assay used a single set of primers complementary to sequences located in the putative coding region for the BFDV VP1 gene. The observed amplification product had the expected size of 550 bp and was confirmed to derive from BFDV DNA by its restriction digestion pattern. This assay was specific for BFDV and highly sensitive, being able to detect as few as 20 copies of the virus. By using the polymerase chain reaction, BFDV was detected in adult, nestling, and embryo budgerigar (Melopsitticus undulatus) tissue DNAs and in sera from adult and nestling budgerigars. These results suggest the possibility of persistent infections in adult birds and lend further support to previously described evidence of possible in ovo transmission. BFDV was also detected in chicken embryo fibroblast cell cultures and chicken eggs inoculated with the virus. A 550-bp product with identical restriction enzyme sites was amplified from a suspected polyomavirus isolated from a peach-faced lovebird (Agapornis pesonata) and from tissue DNA from a Hahn's macaw (Ara nobilis) and a sun conure (Aratinga solstitialis) with histological lesions suggestive of polyomavirus infection. These fragments also hybridized with a BFDV-derived probe, proving that they were derived from a polyomavirus very similar, if not identical, to BFDV.

  13. Polymerase Chain Reaction on a Viral Nanoparticle. (United States)

    Carr-Smith, James; Pacheco-Gómez, Raúl; Little, Haydn A; Hicks, Matthew R; Sandhu, Sandeep; Steinke, Nadja; Smith, David J; Rodger, Alison; Goodchild, Sarah A; Lukaszewski, Roman A; Tucker, James H R; Dafforn, Timothy R


    The field of synthetic biology includes studies that aim to develop new materials and devices from biomolecules. In recent years, much work has been carried out using a range of biomolecular chassis including α-helical coiled coils, β-sheet amyloids and even viral particles. In this work, we show how hybrid bionanoparticles can be produced from a viral M13 bacteriophage scaffold through conjugation with DNA primers that can template a polymerase chain reaction (PCR). This unprecedented example of a PCR on a virus particle has been studied by flow aligned linear dichroism spectroscopy, which gives information on the structure of the product as well as a new protototype methodology for DNA detection. We propose that this demonstration of PCR on the surface of a bionanoparticle is a useful addition to ways in which hybrid assemblies may be constructed using synthetic biology.

  14. [Polymerase chain reaction and its application]. (United States)

    Sárosi, I; Gerald, E; Girish, V N


    The polymerase chain reaction (PCR) is one of the most important new methods in molecular biology. It is widely used in genetic and anthropologic basic research, in oncology and virology, in all those fields, where molecular biologic methods can give answers to the questions raised. The procedure enables one to multiply with extreme precision targeted pieces of amounts as little as one target molecule of DNA or RNA by five to six logs, making them easy to be handled and examined by routine molecular biological methods. The method is presented through one possible application field, that is of great importance in the study of hepatocarcinogenesis. Sensitivity of PCR in detection of hepatitis B virus DNA is greater by four logs than animal inoculation, the last most sensitive method known.

  15. Actinobaculum suis Detection Using Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cristina Román Amigo


    Full Text Available Actinobaculum suis is an important agent related to urinary infection in swine females. Due to its fastidious growth characteristics, the isolation of this anaerobic bacterium is difficult, thus impairing the estimation of its prevalence. The purpose of this study was to develop and test a polymerase chain reaction (PCR for the detection and identification of A. suis and then compare these results with traditional isolation methods. Bacterial isolation and PCR were performed on one hundred and ninety-two urine samples from sows and forty-five preputial swabs from boars. The results indicate that this PCR was specific for A. suis, presenting a detection limit between 1.0×101 CFU/mL and 1.0×102 CFU/mL. A. suis frequencies, as measured by PCR, were 8.9% (17/192 in sow urine samples and 82.2% (37/45 in preputial swabs. Assessed using conventional culturing techniques, none of the urine samples were positive for A. suis; however, A. suis was detected in 31.1% (14/45 of the swabs. This PCR technique was shown to be an efficient method for the detection of A. suis in urine and preputial swabs.

  16. Long chain branching on linear polypropylene by solid state reactions

    NARCIS (Netherlands)

    Borsig, E.; Gotsis, A. D.; Picchioni, F.


    A method was developed for the long chain branching (LCB) of isotactic polypropylene (iPP) via modification in the solid state. PP long chains have been linked as branches to the original linear iPP chains using solid state reactions in the presence of a free radical initiator and a multifunctional

  17. The polymerase chain reaction: current and future clinical applications.


    Lynch, J R; Brown, J. M.


    The polymerase chain reaction has undergone rapid improvement since its initial development, such that the technique currently permits rapid, accurate, predictive tests to be made in the field of prenatal diagnosis and has greatly aided forensic medicine. It is anticipated that the polymerase chain reaction will also facilitate advances in other fields, in particular preimplantation diagnosis, virology, bacteriology, and cancer therapy.

  18. A Practical Polymerase Chain Reaction Laboratory for Introductory Biology Classes. (United States)

    Bowlus, R. David; Grether, Susan C.


    Presents a polymerase chain reaction (PCR) laboratory exercise that can be performed by introductory biology students in 1 45- to 55-minute class period. Includes a general description of the polymerase chain reaction, materials needed, procedure, and details of interest to teachers. (JRH)

  19. Chain-reaction crash on a highway in high visibility (United States)

    Nagatani, Takashi


    We study the chain-reaction crash (multiple-vehicle collision) in high-visibility condition on a highway. In the traffic situation, drivers control their vehicles by both gear-changing and braking. Drivers change the gears according to the headway and brake according to taillights of the forward vehicle. We investigate whether or not the first collision induces the chain-reaction crash numerically. It is shown that dynamic transitions occur from no collisions, through a single collision, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We compare the multiple-vehicle collisions in high-visibility with that in low-visibility. We derive the transition points and the region maps for the chain-reaction crash in high visibility.

  20. an overview on the application of polymerase chain reaction (pcr)

    African Journals Online (AJOL)


    Bayero Journal of Pure and Applied Sciences, 2(1): 109 - 114 ... Keywords: Polymerase chain reaction, Diagnosis, Bacteria, Infections .... A brain abscess is a localized pyogenic bacterial ... as encephalitis and skin rash. ... Streptococcus.

  1. A noncontact temperature measurement method in polymerase chain reaction reactors (United States)

    Sochivko, D. G.; Varlamov, D. A.; Fedorov, A. A.; Kurochkin, V. E.


    A new noncontact method for measuring temperatures of liquids, which is based on the fluorescent probes, is proposed. The method is intended for measuring temperatures of reaction media in reactors of devices for polymerase chain reactions in real time and can be used for determining dynamic temperature parameters.

  2. Multi-template polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Elena Kalle


    Full Text Available PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.

  3. The Ripple Effect: Citation Chain Reactions of a Nobel Prize

    DEFF Research Database (Denmark)

    Faber Frandsen, Tove; Nicolaisen, Jeppe


    This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his s...

  4. Determination of gender in cetaceans by the polymerase chain reaction

    NARCIS (Netherlands)

    Palsboll, PJ; Vader, A; Bakke, P; El-Gewely, MR


    We determined the gender of a variety of cet can species, including both ondotocetes and mysticetes, using the polymerase chain reaction for amplification of the sex chromosome specific regions ZFY/ZFX and SRY. This quick and simple method requires extremely small amounts of tissue, and therefore al

  5. Problem-Solving Test: Real-Time Polymerase Chain Reaction (United States)

    Szeberenyi, Jozsef


    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  6. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)



    Feb 5, 2014 ... polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional ... If one can see or know where microbes in soil live, what roles in soil .... extraction buffer allowed both soil DNA and total soil RNA ... genomic DNA contamination in the RNA sample is trouble-.

  7. Robust regression methods for real-time polymerase chain reaction

    NARCIS (Netherlands)

    Trypsteen, Wim; De Neve, Jan; Bosman, Kobus; Nijhuis, Monique; Thas, Olivier; Vandekerckhove, Linos; De Spiegelaere, Ward


    Current real-time polymerase chain reaction (PCR) data analysis methods implement linear least squares regression methods for primer efficiency estimation based on standard curve dilution series. This method is sensitive to outliers that distort the outcome and are often ignored or removed by the en

  8. [The contamination under polymerase chain reaction studies: problems and solutions]. (United States)

    Titov, V N; Ameliushkina, V A; Rozhkova, T A


    The study was carried out to determine risk factors of false positive and false negative results under polymerase chain reaction-analysis of clinical material. The samples with high viral load can be the source of false positive results. The contamination with nucleic acids can occur at any section of polymerase chain reaction analysis. The study data permitted to establish that the most sensitive stage is isolation and purification of nucleic acids especially under manual mode of operation. The detection of positive signal in most samples of one setting indicates total contamination. The cases when only several samples are polluted are special challenge. The presence of sample with high concentration of viral nucleic acid and several samples with low concentration in one setting means necessity of repeated analysis beginning with stage of isolation of nucleic acid. The analysis of curves of accumulation of products of amplification, their forms and positioning on chart is the obligatory stage of polymerase chain reaction study in real time regimen. These actions permit to exclude the readouts of false negative testing results to departments. The study conclusions are equipotent for polymerase chain reaction testing of any nucleic acid targets.

  9. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna


    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

  10. Robust regression methods for real-time polymerase chain reaction

    NARCIS (Netherlands)

    Trypsteen, Wim; De Neve, Jan; Bosman, Kobus; Nijhuis, Monique; Thas, Olivier; Vandekerckhove, Linos; De Spiegelaere, Ward


    Current real-time polymerase chain reaction (PCR) data analysis methods implement linear least squares regression methods for primer efficiency estimation based on standard curve dilution series. This method is sensitive to outliers that distort the outcome and are often ignored or removed by the

  11. Robust regression methods for real-time polymerase chain reaction

    NARCIS (Netherlands)

    Trypsteen, Wim; De Neve, Jan; Bosman, Kobus; Nijhuis, Monique|info:eu-repo/dai/nl/176957529; Thas, Olivier; Vandekerckhove, Linos; De Spiegelaere, Ward


    Current real-time polymerase chain reaction (PCR) data analysis methods implement linear least squares regression methods for primer efficiency estimation based on standard curve dilution series. This method is sensitive to outliers that distort the outcome and are often ignored or removed by the en

  12. Mathematics analysis of polymerase chain reaction kinetic curves. (United States)

    Sochivko, D G; Fedorov, A A; Varlamov, D A; Kurochkin, V E; Petrov, R V


    The paper reviews different approaches to the mathematical analysis of polymerase chain reaction (PCR) kinetic curves. The basic principles of PCR mathematical analysis are presented. Approximation of PCR kinetic curves and PCR efficiency curves by various functions is described. Several PCR models based on chemical kinetics equations are suggested. Decision criteria for an optimal function to describe PCR efficiency are proposed.

  13. Detection of Neisseria Gonorrhoeae from Urine with Ligase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    曹经江; 郑和义; 胡维


    Objective: To evaluate the value of ligase chain reaction(LCR) in the diagnosis of diplococcus gonorrhoeae in urine.Methods: LCR detection of the urine for Neisseria gonorrhoeae and bacteria culture of discharge was per-formed simultaneously to 276 patients with urethritis or cervicitis seeking treatment in sex transmitted dis-eases (STDs) outpatient clinic. For specimens with discordant results, polymerase chain reaction was conducted. The purpose was to detect the respective sensitivity and specificity of bacteria culture and LCR. Results: 24 of 276(8.7%) patients had positive LCR results and 21 of 276(7.6%) were positive for culture.5 specimens had discordant results from LCR and bacteria culture. The sensitivity and specificity of LCR in the diagnosis of gonorrhoeae were 92.3% and 100% respectively. Conclusion: This study showed that LCR had a higher sensitivity and specificity for the diagnosis of gonorrhoeae from urine.

  14. Soluble Polyimides Bearing Long-Chain Alkyl Groups on Their Side Chain via Polymer Reaction

    Directory of Open Access Journals (Sweden)

    Yusuke Tsuda


    Full Text Available Novel soluble polyimides having long-chain alkyl groups on their side chain were synthesized via polymer reaction with the polyimides having phenolic OH groups and 3,4,5-tris(dodecyloxybenzoic acid (12GA using N,N′-dicyclohexylcarbodiimide (DCC as a dehydration reagent. The polyimides having phenolic OH groups were synthesized from the tetracarboxylic dianhydrides such as 5-(2,5-dioxotetrahydrofuryl-3-methyl-3-cyclohexene-1,2-dicarboxylic anhydride (cyclohexene-DA, 4,4′-hexafluoroisopropylidendi(phthalic anhydride (6FDA, and 3,3′,4,4′-diphenylsulfone tetracarboxylic dianhydride (DSDA and aromatic diamines such as 4,4′-diamino-3,3′-dihydroxybiphenyl (HAB. The polymer reactions were carried out in NMP and the progresses of polymer reactions were quantitatively monitored by 1H NMR measurements (conversion; 12.2–98.7%. The obtained polyimides bearing long-chain alkyl groups have enough molecular weights, good film-forming ability, good solubility for various organic solvents, and enough thermal stability. The water contact angles of the polyimide films were investigated, and it is noted that the introduction of long-chain alkyl groups increases the hydrophobicity of polyimide surface. These polyimides are expected to be applicable as the functional materials for microelectronics such as the alignment layers of LCDs.

  15. Soluble Polyimides Bearing Long-Chain Alkyl Groups on Their Side Chain via Polymer Reaction



    Novel soluble polyimides having long-chain alkyl groups on their side chain were synthesized via polymer reaction with the polyimides having phenolic OH groups and 3,4,5-tris(dodecyloxy)benzoic acid (12GA) using N,N′-dicyclohexylcarbodiimide (DCC) as a dehydration reagent. The polyimides having phenolic OH groups were synthesized from the tetracarboxylic dianhydrides such as 5-(2,5-dioxotetrahydrofuryl)-3-methyl-3-cyclohexene-1,2-dicarboxylic anhydride (cyclohexene-DA), 4,4′-hexafluoroisoprop...

  16. Implosion chain reaction mitigation in underwater assemblies of photomultiplier tubes

    Energy Technology Data Exchange (ETDEWEB)

    Ling, Jiajie, E-mail: [Brookhaven National Laboratory, Upton, NY 11973 (United States); Bishai, Mary; Diwan, Milind; Dolph, Jeffrey; Kettell, Steve; Sexton, Kenneth; Sharma, Rahul; Simos, Nikolaos; Stewart, James [Brookhaven National Laboratory, Upton, NY 11973 (United States); Tanaka, Hidekazu [Brookhaven National Laboratory, Upton, NY 11973 (United States); Kamioka Observatory, Institute for Cosmic Ray Research, The University of Tokyo, 456 Higashi-Mozumi, Kamioka, Hida, Gifu 506-1205 (Japan); Viren, Brett [Brookhaven National Laboratory, Upton, NY 11973 (United States); Arnold, Douglas; Tabor, Philip; Turner, Stephen [Naval Undersea Warfare Center, Newport, RI 02841 (United States); Benson, Terry; Wahl, Daniel; Wendt, Christopher [University of Wisconsin-Madison, WI 53706 (United States); Hahn, Alan; Kaducak, Marc; Mantsch, Paul [Fermi National Accelerator Laboratory, Batavia, IL 60510 (United States); and others


    Since the accident with a cascade failure of photomultiplier tubes (PMTs) in the Super-Kamiokande experiment in 2001, the mechanical performance of large format semi-hemispherical PMTs has become a critical issue for large water Cherenkov detectors. The subject of this study is the survival of an assembled array of PMTs under significant hydrostatic pressure and subjected to shock waves caused by the failure of a single PMT. This paper details the results of the second stage of a R and D program focused on the design and testing of different PMT assemblies to mitigate the risk of a “chain-reaction” of PMT failures. The initial results show that our PMT assembly design can effectively reduce the magnitude of the shock wave. With the testing results in this paper and the hydrodynamic simulation calculation, we can further improve the design of PMT deployment to mitigate the risk of chain reactions caused by implosion induced shock waves.


    Directory of Open Access Journals (Sweden)

    Zoran Budimlija


    Full Text Available Biological traces can be found in various forms. The basic question to deal withduring the biological traces' analysis is the one about their origin, that is, the questionof identity of the person to whom such samples belong. Up to now the most precisemethod of the DNA is the PCR of Polymerase Chain Reaction.The generalassumptions about applying the method for the purpose of human identification aredescribed, namely, the one that is used in the Institute for Forensic Medicine in NoviSad.

  18. Automated polymerase chain reaction in capillary tubes with hot air. (United States)

    Wittwer, C T; Fillmore, G C; Hillyard, D R


    We describe a simple, compact, inexpensive thermal cycler that can be used for the polymerase chain reaction. Based on heat transfer with air to samples in sealed capillary tubes, the apparatus resembles a recirculating hair dryer. The temperature is regulated via thermocouple input to a programmable set-point process controller that provides proportional output to a solid state relay controlling a heating coil. For efficient cooling after the denaturation step, the controller activates a solenoid that opens a door to vent hot air and allows cool air to enter. Temperature-time profiles and amplification results approximate those obtained using water baths and microfuge tubes.

  19. HLA-B27 Determination by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    D. C. Kilpatrick


    Full Text Available A method for determining the presence or absence of HLA-827 by selective amplification of a region in the third exon of the HLA-B27 gene common to B*270 I to B*2705 inclusive, was evaluated. This polymerase chain reaction/sequence specific primer (PCR-SSP method gave perfect correlation with serological typing on 40 individuals of previously determined HLA type and on 50 further clinical samples elaluated blind. It was concluded that HLA-B27 determination by PCR-SSP is simple, reliable. cost-effectile and convient for laboratory staff.

  20. HLA-B27 Determination by Polymerase Chain Reaction


    Kilpatrick, D C


    A method for determining the presence or absence of HLA-827 by selective amplification of a region in the third exon of the HLA-B27 gene common to B*270 I to B*2705 inclusive, was evaluated. This polymerase chain reaction/sequence specific primer (PCR-SSP) method gave perfect correlation with serological typing on 40 individuals of previously determined HLA type and on 50 further clinical samples elaluated blind. It was concluded that HLA-B27 determination by PCR-SSP is simple, reliable. cost...

  1. Detection of Trypanosoma cruzi by Polymerase Chain Reaction. (United States)

    Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz


    American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.

  2. Automated microdroplet platform for sample manipulation and polymerase chain reaction. (United States)

    Chabert, Max; Dorfman, Kevin D; de Cremoux, Patricia; Roeraade, Johan; Viovy, Jean-Louis


    We present a fully automated system performing continuous sampling, reagent mixing, and polymerase chain reaction (PCR) in microdroplets transported in immiscible oil. Sample preparation and analysis are totally automated, using an original injection method from a modified 96-well plate layered with three superimposed liquid layers and in-capillary laser-induced fluorescence endpoint detection. The process is continuous, allowing sample droplets to be carried uninterruptedly into the reaction zone while new drops are aspirated from the sample plate. Reproducible amplification, negligible cross-contamination, and detection of low sample concentrations were demonstrated on numerous consecutive sample drops. The system, which opens the route to strong reagents and labor savings in high-throughput applications, was validated on the clinically relevant quantification of progesterone receptor gene expression in human breast cancer cell lines.


    Institute of Scientific and Technical Information of China (English)

    郭增柱; 王正仪; 安亦军; 祝宏


    Polymerase chain reaction (PCR) has been applied in diagnosing amebic liver infection by detecting pathogenic Entamoeba histolytica DNA in liver aspirates. Oligonucleotide primers found to he specific for the gene encoding the 30 kDa molecule of this pathogenic ameba were used in the test. Liver aspirates obtained from 23 patients with amebic liver abscess substantiated by typical clinical rnanifastation or with very high titres of anti-E histtolytica antibodies by ELISA were found to he positive by PCR. Fourteen controlsamples (3 cases of bacterial liver abscess, I of liver cancer and 10 of other abscess) were all found to be negative to this reaction. The results suggested PCR to he a specific and sensitive tool for diagnosing amebic liver abscess infections.

  4. Toxoplasma polymerase chain reaction on experimental blood samples. (United States)

    Joss, A W; Chatterton, J M; Evans, R; Ho-Yen, D O


    A two-stage polymerase chain reaction (PCR) assay employing oligonucleotide primers from the B1 gene of Toxoplasma gondii was developed and assessed for sensitivity and specificity. It was able to detect T. gondii DNA from as little as one parasite/sample in mock-infected rat or mouse leucocyte preparations. Parasitaemia was also identified in animals at five stages between 16 and 66 h after infection with the virulent RH strain, and at 12 stages between 2 and 38 days after infection with the cyst-forming Beverley strain. In the latter case, PCR was more sensitive than animal culture. No cross-reactions were observed in samples containing various opportunist pathogens which may also be found in the blood of immunocompromised patients.

  5. Taylor dispersion in polymerase chain reaction in a microchannel (United States)

    Lee, Jinkee; Kulla, Elejdis; Chauhan, Anuj; Tripathi, Anubhav


    Polymerase chain reaction (PCR) is commonly used for a wide range of DNA applications such as disease detection, genetic fingerprinting, and paternity testing. The importance of PCR has led to an increased interest in performing PCR in a microfluidic platform with a high throughput while using very small DNA quantities. In this paper we solve convection-diffusion equations for the DNA and deoxynucleoside triphosphate (dNTP) under conditions suitable for PCR operation in a microchip. These include pressure driven flow accompanied by temporal temperature changes that lead to an amplification reaction, which is modeled as a first order reaction. The convection-diffusion-reaction equations are solved by using the method of multiple time scales to yield average equations that can be solved to obtain the long time evolution of the concentration profiles. The results obtained by solving the averaged equations agree well with full numerical solutions. The averaged equations are also solved to simulate the PCR to illustrate some interesting aspects of this operation in a microfluidic device. It is shown that insufficient nucleotide concentrations can lead to complete depletion of NTP at certain axial locations, which leads to termination of DNA amplification at these locations, resulting in formation of a plateau in DNA concentration.

  6. Exploring chain length selectivity in HIC-catalyzed polycondensation reactions. (United States)

    Feder, David; Gross, Richard A


    Polyester synthesis activity of immobilized Humicola insolens (HiC) was systematically studied with three-series of substrates varying in (i) omega-hydroxyalkanoic acid (omegaHA), (ii) alpha,omega-n-alkane diol, and (iii) alpha,omega-n-alkane diacid chain length. Covalent immobilization of HiC on Amberzyme oxirane (AO) resin (i.e., AO-HiC) was prepared. HiC-AO's activity for omegaHA substrates with 6, 10, 12, and 16 carbons was C16 > C12, where C10-omegaHA and C6-omegaHA were not polymerized. In contrast, N435's activity for omegaHA substrates was C16 = C12 > C10, where C6-omegaHA was not polymerized. HiC-AO activity for copolymerization of sebacic acid (C10-diacid) with alpha,omega-n-alkane diols with 3-, 4-, 5-, 6-, and 8-carbon chain lengths was C8 > C6, where C3, C4, and C5 diols were not polymerized. N435's relative activity for diol substrates was C8 = C6 = C5 > C4 > C3. HiC-AO activity for copolymerizations of 1,8-octanediol with alpha,omega-n-alkane diacids with 6-, 8-, 9-, 10-, and 13-carbon chain lengths was C13 = C10, where HiC showed little activity for C6, C8, and C9 diacid copolymerization. N435 displayed similar activity for all these diacid chain lengths. Thus, N435 has a broader substrate promiscuity than HiC-AO. This is most apparent for shorter chain length omegaHA, diol, and diacid monomers. These trends were similarly observed for a series of small molecule esterification reactions. Comparison of HiC-AO- and N435-catalyzed C16-HA homopolymerization at 8 h gave polymers with M(n) 40.4 and 25.5 kg/mol, respectively. Furthermore, HiC-AO- and N435-catalyzed copolymerization of 1,8-octanediol/C13-diacid polymerizations at 8 h gave polymers with M(n) of 11.0 and 9.6 kg/mol, respectively.

  7. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed


    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  8. Modelling of Serpentine Continuous Flow Polymerase Chain Reaction Microfluidics

    Directory of Open Access Journals (Sweden)

    Abubakar Mohammed


    Full Text Available The continuous flow Polymerase Chain Reaction (PCR microfluidics DNA amplification device is a recent discovery aimed at eliminating the cyclic hold experienced while using the alternative stationary device.The Application of Computational Fluid Dynamics is increasingly growing and can help achieve optimal designs before actual fabrication. This paper presents a CFD modelling of a continuous flow serpentine PCR device with narrow and wider channels. There are two temperature regions at 950C and 600C for denaturation and annealing respectively. Extension is achieved along the middle of the channel at 720C owing to temperature gradient. The model require a pressure of 42.6KPa for a 30 cycle amplification.

  9. Nested methylation-specific polymerase chain reaction cancer detection method (United States)

    Belinsky, Steven A.; Palmisano, William A.


    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  10. Polymerase chain reaction: A molecular diagnostic tool in periodontology. (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam


    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

  11. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang


    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  12. Polymerase chain reaction-based gene removal from plasmids

    Directory of Open Access Journals (Sweden)

    Vishnu Vardhan Krishnamurthy


    Full Text Available This data article contains supplementary figures and methods to the research article entitled, “Multiplex gene removal by two-step polymerase chain reactions” (Krishnamurthy et al., Anal. Biochem., 2015, doi:, which presents a restriction-enzyme free method to remove multiple DNA segments from plasmids. Restriction-free cloning methods have dramatically improved the flexibility and speed of genetic manipulation compared to conventional assays based on restriction enzyme digestion (Lale and Valla, 2014. DNA Cloning and Assembly Methods, vol. 1116. Here, we show the basic scheme and characterize the success rate for single and multiplex gene removal from plasmids. In addition, we optimize experimental conditions, including the amount of template, multiple primers mixing, and buffers for DpnI treatment, used in the one-pot reaction for multiplex gene removal.

  13. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna


    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...... amplified sequences, Southern hybridization, or dot blot analysis. The PCR assay was optimized and, after 40 cycles of amplification with primer set II, demonstrated a sensitivity of 10(-17) g of DNA, which corresponds to the detection of one copy of the plasmid. Because of the high sensitivity, we...... developed a closed system in which airborne contamination was minimized. Analysis of 228 clinical samples tested by cell culture, IDEIA enzyme immunosorbent assay (Medico-Nobel, Boots-Celltech Ltd., Berkshire, United Kingdom), and PCR showed a sensitivity of 100%, a specificity of 93% when PCR was compared...

  14. Aqueous humor polymerase chain reaction in uveitis - utility and safety. (United States)

    Chronopoulos, Argyrios; Roquelaure, Daniel; Souteyrand, Georges; Seebach, Jörg Dieter; Schutz, James Scott; Thumann, Gabriele


    To study the value and safety of aqueous humor polymerase chain reaction (PCR) analysis for Herpes simplex, varicella zoster, cytomegalovirus, Epstein-Barr virus and Toxoplasma gondii in patients with uveitis. Records of 45 consecutive patients with anterior and posterior uveitis who underwent AC paracentesis with PCR were reviewed. The main outcome measure was frequency of PCR positivity. Secondary outcomes were alteration of treatment, safety of paracentesis, and correlation of keratitic precipitates with PCR positivity, RESULTS: The overall PCR positivity was 48.9 % (22/45). Therapy was changed because of the PCR results in 14/45 patients (37.7 %). One patient experienced a paracentesis related complication (1/45, 2.2 %) without long-term sequelae. Aqueous PCR altered the diagnosis and treatment in over a third of our patients and was relatively safe. Aqueous PCR should be considered for uveitis of atypical clinical appearance, recurrent severe uveitis of uncertain etiology, and therapy refractory cases.

  15. Rapid electrochemiluminescence assays of polymerase chain reaction products. (United States)

    Kenten, J H; Casadei, J; Link, J; Lupold, S; Willey, J; Powell, M; Rees, A; Massey, R


    We demonstrate the first use of an electrochemiluminescent (ECL) label, [4-(N-succimidyloxycarbonylpropyl)-4'-methyl-2,2'- bipyridine]ruthenium(II) dihexafluorophosphate (Origen label; IGEN Inc.), in DNA probe assays. This label allows rapid (less than 25 min) quantification and detection of polymerase chain reaction (PCR)-amplified products from oncogenes, viruses, and cloned genes. For the PCR, we used labeled oligonucleotide primers complementary to human papiloma virus and the Ha-ras oncogene. These samples were followed by ECL analysis or hybridization with specific, Origen-labeled oligonucleotide probes. These studies demonstrate the speed, specificity, and effectiveness of the new ECL labels, compared with 32P, for nucleic acid probe applications. We describe formats involving conventional methodologies and a new format that requires no wash step, allowing simple and rapid sample analysis. These rapid assays also reduce PCR contamination, by requiring less sample handling. Improvements in ECL detectability are currently under investigation for use in DNA probe assays without amplification.

  16. Markov chain aggregation and its applications to combinatorial reaction networks. (United States)

    Ganguly, Arnab; Petrov, Tatjana; Koeppl, Heinz


    We consider a continuous-time Markov chain (CTMC) whose state space is partitioned into aggregates, and each aggregate is assigned a probability measure. A sufficient condition for defining a CTMC over the aggregates is presented as a variant of weak lumpability, which also characterizes that the measure over the original process can be recovered from that of the aggregated one. We show how the applicability of de-aggregation depends on the initial distribution. The application section is devoted to illustrate how the developed theory aids in reducing CTMC models of biochemical systems particularly in connection to protein-protein interactions. We assume that the model is written by a biologist in form of site-graph-rewrite rules. Site-graph-rewrite rules compactly express that, often, only a local context of a protein (instead of a full molecular species) needs to be in a certain configuration in order to trigger a reaction event. This observation leads to suitable aggregate Markov chains with smaller state spaces, thereby providing sufficient reduction in computational complexity. This is further exemplified in two case studies: simple unbounded polymerization and early EGFR/insulin crosstalk.

  17. Marzipan: polymerase chain reaction-driven methods for authenticity control. (United States)

    Brüning, Philipp; Haase, Ilka; Matissek, Reinhard; Fischer, Markus


    According to German food guidelines, almonds are the only oilseed ingredient allowed for the production of marzipan. Persipan is a marzipan surrogate in which the almonds are replaced by apricot or peach kernels. Cross-contamination of marzipan products with persipan may occur if both products are produced using the same production line. Adulterations or dilutions, respectively, of marzipan with other plant-derived products, for example, lupine or pea, have also been found. Almond and apricot plants are closely related. Consequently, classical analytical methods for the identification/differentiation often fail or are not sensitive enough to quantify apricot concentrations below 1%. Polymerase chain reaction (PCR)-based methods have been shown to enable the differentiation of closely related plant species in the past. These methods are characterized by high specificity and low detection limits. Isolation methods were developed and evaluated especially with respect to the matrix marzipan in terms of yield, purity, integrity, and amplificability of the isolated DNA. For the reliable detection of apricot, peach, pea, bean, lupine, soy, cashew, pistachio, and chickpea, qualitative standard and duplex PCR methods were developed and established. The applicability of these methods was tested by cross-reaction studies and analysis of spiked raw pastes. Contaminations at the level of 0.1% could be detected.

  18. Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies. (United States)

    Lorenz, Todd C


    In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

  19. Diagnostic challenges of tuberculous lymphadenitis using polymerase chain reaction analysis: a case study. (United States)

    Taniguchi, Hirokazu; Nakamura, Masahiko; Shimokawa, Kazuki; Kamiseki, Fumi; Ishizawa, Shin; Abo, Hitoshi; Furuse, Hideaki; Tsuda, Takeshi; Masaki, Yasuaki; Suzuki, Kensuke


    This report presents a case of tuberculous lymphadenitis that was difficult to diagnose using polymerase chain reaction analysis. An 80-year-old Japanese female was hospitalized due to swollen cervical lymph nodes. Her lymph node tests revealed paradoxical polymerase chain reaction results. Polymerase chain reaction analysis of two biopsy tissues using the Cobas TaqMan revealed a positive result for Mycobacterium avium and a negative result for Mycobacterium tuberculosis. However, polymerase chain reaction analysis of a cultured colony of acid-fast bacteria from biopsy tissue using the Cobas TaqMan and an alternative polymerase chain reaction analysis of biopsy tissue yielded discordant results. The patient was diagnosed as having tuberculous lymphadenitis. She was treated with antitubercular drugs and subsequently had a reduction in cervical lymph node swelling. Polymerase chain reaction analysis is not 100% accurate; hence, its use as a diagnostic tool for mycobacterial infection requires increased attention.

  20. Combination Primer Polymerase Chain Reaction for Multi-Site Mutagenesis of Close Proximity Sites


    Jensen, Pia Hønnerup; Weilguny, Dietmar


    We describe a rapid and efficient polymerase chain reaction procedure for multi-site-directed mutagenesis for cases in which the sites to be mutated are in close proximity. The combination primer polymer chain reaction method is based on a multi-site directed mutagenesis protocol together with a splicing by overlapping extension polymerase chain reaction protocol. several different combinations of multiple mutations were successfully performed with this method and are reported in this study.

  1. Effects of upconversion nanoparticles on polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Sang-Hyun Hwang

    Full Text Available Nanoparticles (NPs are attractive materials owing to their physical and electrochemical properties, which make them extremely useful in diagnostic applications. Photon upconversion is the phenomenon where high-energy photons are emitted upon excitation of low-energy photons. Nucleic acids detection based on upconversion nanoparticles (UCNPs, which display a high signal-to-noise ratio and no photobleaching, has been widely applied. We evaluated whether UCNPs can improve polymerase chain reaction (PCR specificity and affect PCR amplification. The effects of UCNPs with a diameter size of 40, 70, and 250 nm were evaluated using 3 PCR kits (AccuPower PCR PreMix, AmpliTaq Gold 360 Master Mix, and HotStarTaq Plus Master Mix and 3 real-time PCR kits (AccuPower GreenStar qPCR PreMix, SYBR Green PCR Master Mix, and QuantiTect SYBR Green PCR Kit. Quantum dots were used for comparison with the UCNPs. In the presence of an appropriate concentration of UCNPs, PCR specificity was optimized. UCNPs of 40-nm size improved PCR specificity more effectively than did UCNPs sized 70 or 250 nm. As the size and concentrations of the UCNPs were increased, PCR amplification was more severely inhibited. At lower annealing temperatures (25°C-45°C, addition of the 40 nm UCNP (1 µg/µL to the PCR reagent produced specific PCR products without nonspecific sequence amplification. Therefore, UCNPs of different sizes, with different DNA polymerases used in the commercial kits, showed different inhibitory effects on PCR amplification. These results demonstrate that optimization of UCNPs, added to reaction mixtures at appropriate concentrations, can improve PCR specificity. However, the mechanism underlining UCNPs effect on PCR remains unclear and will require further investigation.

  2. A diagnostic polymerase chain reaction assay for Zika virus. (United States)

    Balm, Michelle N D; Lee, Chun Kiat; Lee, Hong Kai; Chiu, Lily; Koay, Evelyn S C; Tang, Julian W


    Zika virus (ZIKV) is a mosquito-borne flavivirus. Infection results in a dengue-like illness with fever, headache, malaise, and a maculopapular rash. Nearly all cases are mild and self-limiting but in 2007, a large outbreak of ZIKV was reported from the island of Yap (in Micronesia, northwest of Indonesia). Singapore is already endemic for dengue, and its impact on public health and economic burden is significant. Other dengue-like infections (e.g., Chikungunya virus) are present. Yet only 10% of reported dengue cases have laboratory confirmation. The identification and control of other dengue-like, mosquito-transmitted infections is thus important for the health of Singapore's population, as well as its economy. Given that ZIKV shares the same Aedes mosquito vector with both dengue and Chikungunya, it is possible that this virus is present in Singapore and causing some of the mild dengue-like illness. A specific and sensitive one-step, reverse transcription polymerase chain reaction (RT-PCR) with an internal control (IC) was designed and tested on 88 archived samples of dengue-negative, Chikungunya-negative sera from patients presenting to our hospital with a dengue-like illness, to determine the presence of ZIKV in Singapore. The assay was specific for detection of ZIKV and displayed a lower limit of detection (LoD) of 140 copies viral RNA/reaction when tested on synthetic RNA standards prepared using pooled negative patient plasma. Of the 88 samples tested, none were positive for ZIKV RNA, however, the vast majority of these were from patients admitted to hospital and further study may be warranted in community-based environments.

  3. Integrated polymerase chain reaction chips utilizing digital microfluidics. (United States)

    Chang, Yi-Hsien; Lee, Gwo-Bin; Huang, Fu-Chun; Chen, Yi-Yu; Lin, Jr-Lung


    This study reports an integrated microfluidic chip for polymerase chain reaction (PCR) applications utilizing digital microfluidic chip (DMC) technology. Several crucial procedures including sample transportation, mixing, and DNA amplification were performed on the integrated chip using electro-wetting-on-dielectric (EWOD) effect. An innovative concept of hydrophobic/hydrophilic structure has been successfully demonstrated to integrate the DMC chip with the on-chip PCR device. Sample droplets were generated, transported and mixed by the EWOD-actuation. Then the mixture droplets were transported to a PCR chamber by utilizing the hydrophilic/hydrophobic interface to generate required surface tension gradient. A micro temperature sensor and two micro heaters inside the PCR chamber along with a controller were used to form a micro temperature control module, which could perform precise PCR thermal cycling for DNA amplification. In order to demonstrate the performance of the integrated DMC/PCR chips, a detection gene for Dengue II virus was successfully amplified and detected. The new integrated DMC/PCR chips only required an operation voltage of 12V(RMS) at a frequency of 3 KHz for digital microfluidic actuation and 9V(DC) for thermal cycling. When compared to its large-scale counterparts for DNA amplification, the developed system consumed less sample and reagent and could reduce the detection time. The developed chips successfully demonstrated the feasibility of Lab-On-a-Chip (LOC) by utilizing EWOD-based digital microfluidics.

  4. Nucleic acid amplification: Alternative methods of polymerase chain reaction. (United States)

    Fakruddin, Md; Mannan, Khanjada Shahnewaj Bin; Chowdhury, Abhijit; Mazumdar, Reaz Mohammad; Hossain, Md Nur; Islam, Sumaiya; Chowdhury, Md Alimuddin


    Nucleic acid amplification is a valuable molecular tool not only in basic research but also in application oriented fields, such as clinical medicine development, infectious diseases diagnosis, gene cloning and industrial quality control. A comperehensive review of the literature on the principles, applications, challenges and prospects of different alternative methods of polymerase chain reaction (PCR) was performed. PCR was the first nucleic acid amplification method. With the advancement of research, a no of alternative nucleic acid amplification methods has been developed such as loop mediated isothermal amplification, nucleic acid sequence based amplification, strand displacement amplification, multiple displacement amplification. Most of the alternative methods are isothermal obviating the need for thermal cyclers. Though principles of most of the alternate methods are relatively complex than that of PCR, they offer better applicability and sensitivity in cases where PCR has limitations. Most of the alternate methods still have to prove themselves through extensive validation studies and are not available in commercial form; they pose the potentiality to be used as replacements of PCR. Continuous research is going on in different parts of the world to make these methods viable technically and economically.

  5. The Future of Digital Polymerase Chain Reaction in Virology. (United States)

    Vynck, Matthijs; Trypsteen, Wim; Thas, Olivier; Vandekerckhove, Linos; De Spiegelaere, Ward


    Driven by its potential benefits over currently available methods, and the recent development of commercial platforms, digital polymerase chain reaction (dPCR) has received increasing attention in virology research and diagnostics as a tool for the quantification of nucleic acids. The current technologies are more precise and accurate, but may not be much more sensitive, compared with quantitative PCR (qPCR) applications. The most promising applications with the current technology are the analysis of mutated sequences, such as emerging drug-resistant mutations. Guided by the recent literature, this review focuses on three aspects that demonstrate the potential of dPCR for virology researchers and clinicians: the applications of dPCR within both virology research and clinical virology, the benefits of the technique over the currently used real-time qPCR, and the importance and availability of specific data analysis approaches for dPCR. Comments are provided on current drawbacks and often overlooked pitfalls that need further attention to allow widespread implementation of dPCR as an accurate and precise tool within the field of virology.

  6. Nested polymerase chain reaction for early diagnosis of typhoid fever. (United States)

    Sultana, S; Hossain, M A; Alam, M A; Paul, S K; Mahmud, C; Kabir, M R; Haque, N; Yesmin, T; Kayes, M T; Maruf, A A; Kobayashi, N


    Typhoid fever, caused by Salmonella typhi, is an important cause of morbidity and mortality in many developing countries. A rapid and sensitive method for the detection of S. typhi is essential for early diagnosis. This was a study to prospectively evaluate the sensitivity and specificity of nested polymerase chain reaction (PCR) to identify the S. typhi using flagellin gene related primers. The study was carried out in the department of Microbiology, Mymensingh Medical College, Mymensingh between July, 2010 and June, 2011, including 82 individuals of different age and sex. Of them, 62 were clinically suspected cases of typhoid fever and remaining 20 were apparently healthy controls. Cultures as well as PCR of blood specimens were performed for each of the cases. Among the 62 suspected typhoid fever cases, 8(12.9%) were blood culture positive and 55(88.7%) were PCR positive for S. typhi. All culture positive cases were positive by PCR and among 54 culture negative cases, 47(87%) were positive by PCR. Neither of the healthy controls was positive by PCR or blood culture. The sensitivity, specificity, positive predictive value and negative predictive value of PCR using blood culture as gold standard were 88.7%, 100%, 100% and 74% respectively for typhoid fever. In this study, the PCR appears highly specific, very sensitive and superior to blood culture for the early diagnosis of typhoid fever.

  7. Urine Nested Polymerase Chain Reaction in Neonatal Septicemia. (United States)

    Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti


    This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count <1800/mm(3) was observed in 60%, and positive C-reactive protein in 46%. Thirty neonates had positive blood culture, and Klebsiella pneumoniae (22%) was the predominant organism. Nested urine PCR was positive in 38 (76%) and detected bacterial DNA in 8 neonates with negative blood cultures. The sensitivity, specificity, positive predictive value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents.

  8. Fluorescence-based temperature control for polymerase chain reaction. (United States)

    Sanford, Lindsay N; Wittwer, Carl T


    The ability to accurately monitor solution temperature is important for the polymerase chain reaction (PCR). Robust amplification during PCR is contingent on the solution reaching denaturation and annealing temperatures. By correlating temperature to the fluorescence of a passive dye, noninvasive monitoring of solution temperatures is possible. The temperature sensitivity of 22 fluorescent dyes was assessed. Emission spectra were monitored and the change in fluorescence between 45 and 95°C was quantified. Seven dyes decreased in intensity as the temperature increased, and 15 were variable depending on the excitation wavelength. Sulforhodamine B (monosodium salt) exhibited a fold change in fluorescence of 2.85. Faster PCR minimizes cycling times and improves turnaround time, throughput, and specificity. If temperature measurements are accurate, no holding period is required even at rapid speeds. A custom instrument using fluorescence-based temperature monitoring with dynamic feedback control for temperature cycling amplified a fragment surrounding rs917118 from genomic DNA in 3min and 45s using 35 cycles, allowing subsequent genotyping by high-resolution melting analysis. Gold-standard thermocouple readings and fluorescence-based temperature differences were 0.29±0.17 and 0.96±0.26°C at annealing and denaturation, respectively. This new method for temperature cycling may allow faster speeds for PCR than currently considered possible.

  9. Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Toshiaki Higashi


    Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

  10. Monitoring infection: from blood culture to polymerase chain reaction (PCR). (United States)

    Book, Malte; Lehmann, Lutz Eric; Zhang, XiangHong; Stüber, Frank


    In patients with sepsis, diagnosis of blood stream infection (BSI) is a key concern to the therapist. Direct verification of pathogens in the blood stream executed by blood cultures (BC) still is regarded as the gold standard up to date. The quickest possible initiation of an appropriate antimicrobial therapy is a cornerstone of an effective therapy. Moreover, in this view BC can also serve to identify antimicrobial agents to target the pathogen. However, when employing BC the time needed until microbiological results are available ranges from 24 up to 72 h. Moreover, infections caused by multiple pathogens often remain undetected and concurrent antibiotic therapy may lower the overall sensitivity. Alternative pathogen characterization can be performed by polymerase chain reaction (PCR) based amplification methods. Results using PCR can be obtained within 6-8 h. Therefore, the time delay until an appropriate therapy can be reduced enormously. Moreover, these methods have the potential to enhance the sensitivity in the diagnosis of blood stream infections. Therefore, PCR based methods might be a valuable adjunct to present procedures of diagnosing bacteraemia.

  11. Investigation on detection of Haemophilus ducreyi by Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    ZHANG Xibao(张锡宝); FEI Shi(费实); DENG Wenguo(邓文国); CAO wenlig(曹文苓); ZHU huilan(朱慧兰); MENG jinxiu(孟锦秀); YAN jinglan(颜景兰)


    Objective:To investigate the application of polymerase chain reaction (PCR) detection of Haemophilus ducreyi in clinical diagnosis of chancroid.Methods: Nucleotide sequences of 16srRNA gene specific for H. Dureyi were used to develop primer sets for amplification of two strains. The amplified products were tested via PCR and sequenced by electrophoresis in a 1.5 % gel.These products were compared with those of heterogeneous species or related bacteria to test the specificity of the PCR assay. PCR amplification with different concentrations of H.ducreyi was performed to test its sensitivity.Results: PCR amplification of two strains of H. Ducreyi produced a single band of expected 438bp length. The sequence was identified with genomic DNA. None of the other 19 reference species amplified under the same conditions gave this result. The highest sensitivity of PCR assay in the present test was 10ng/L.Conclusions: PCR assay for detection of H. Ducreyi is a rapid, specific, and sensitive detection method. If laboratory conditions are strictly controlled, PCR assay is a potentially useful laboratory test for H. Ducreyi infection diagnosis.

  12. Analysis of human cytomegalovirus using the polymerase chain reaction. (United States)

    Mendelson, M


    As with numerous other branches of science, the study of human cytomegalovirus (HCMV) infection has been revolutionized by the polymerase chain reaction (PCR) method first devised by Mullis and Faloona (1). PCR allows the in vitro amplification of HCMV DNA sequences by the simultaneous primer extension of complementary DNA strands. Similarly, reverse transcription-PCR (RT-PCR) allows the study of targeted gene expression, by reverse transcription of RNA to complementary DNA (cDNA), followed by amplification of target DNA using predetermined primers. The PCR method is used in the clinical diagnosis of HCMV infection, particularly in the setting of transplantation medicine and in those patients infected with the human immunodeficiency virus (HIV). In addition, the advent of PCR and RT-PCR has transformed our understanding of the pathogenesis of HCMV infection, central to which is the definition of the sites of latency, the degree and type of gene expression within the latently infected cell, and the factors influencing both the maintenance of latency and reactivation of the virus during immunosuppression.

  13. Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis

    Directory of Open Access Journals (Sweden)

    Anupam Berwal


    Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.

  14. Identifying of meat species using polymerase chain reaction (PCR) (United States)

    Foong, Chow Ming; Sani, Norrakiah Abdullah


    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  15. Quantitative polymerase chain reaction analysis by deconvolution of internal standard. (United States)

    Hirakawa, Yasuko; Medh, Rheem D; Metzenberg, Stan


    Quantitative Polymerase Chain Reaction (qPCR) is a collection of methods for estimating the number of copies of a specific DNA template in a sample, but one that is not universally accepted because it can lead to highly inaccurate (albeit precise) results. The fundamental problem is that qPCR methods use mathematical models that explicitly or implicitly apply an estimate of amplification efficiency, the error of which is compounded in the analysis to unacceptable levels. We present a new method of qPCR analysis that is efficiency-independent and yields accurate and precise results in controlled experiments. The method depends on a computer-assisted deconvolution that finds the point of concordant amplification behavior between the "unknown" template and an admixed amplicon standard. We apply the method to demonstrate dexamethasone-induced changes in gene expression in lymphoblastic leukemia cell lines. This method of qPCR analysis does not use any explicit or implicit measure of efficiency, and may therefore be immune to problems inherent in other qPCR approaches. It yields an estimate of absolute initial copy number of template, and controlled tests show it generates accurate results.

  16. Quantitative polymerase chain reaction analysis by deconvolution of internal standard

    Directory of Open Access Journals (Sweden)

    Metzenberg Stan


    Full Text Available Abstract Background Quantitative Polymerase Chain Reaction (qPCR is a collection of methods for estimating the number of copies of a specific DNA template in a sample, but one that is not universally accepted because it can lead to highly inaccurate (albeit precise results. The fundamental problem is that qPCR methods use mathematical models that explicitly or implicitly apply an estimate of amplification efficiency, the error of which is compounded in the analysis to unacceptable levels. Results We present a new method of qPCR analysis that is efficiency-independent and yields accurate and precise results in controlled experiments. The method depends on a computer-assisted deconvolution that finds the point of concordant amplification behavior between the "unknown" template and an admixed amplicon standard. We apply the method to demonstrate dexamethasone-induced changes in gene expression in lymphoblastic leukemia cell lines. Conclusions This method of qPCR analysis does not use any explicit or implicit measure of efficiency, and may therefore be immune to problems inherent in other qPCR approaches. It yields an estimate of absolute initial copy number of template, and controlled tests show it generates accurate results.

  17. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)


    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  18. Critical analysis: use of polymerase chain reaction to diagnose leprosy

    Directory of Open Access Journals (Sweden)

    Flaviane Granero Maltempe

    Full Text Available ABSTRACT Leprosy is a neglected tropical disease and an important public health problem, especially in developing countries. It is a chronic infectious disease that is caused by Mycobacterium leprae, which has a predilection for the skin and peripheral nerves. Although it has low sensitivity, slit-skin smear (SSS remains the conventional auxiliary laboratory technique for the clinical diagnosis of leprosy. Polymerase chain reaction (PCR is a molecular biology technique that holds promise as a simple and sensitive diagnostic tool. In the present study, the performance of two PCR methods, using different targets, PCR-LP and PCR-P, were compared with SSS with regard to leprosy diagnosis in a reference laboratory. M. leprae DNA was extracted from 106 lymph samples of 40 patients who had clinical suspicion of leprosy. The samples were subjected to both PCR techniques and SSS. Amplification of the human b-globin gene was used as PCR inhibitor control. The specificity of both PCR techniques was 100%, and sensitivity was 0.007 and 0.015 µg/ml for PCR-LP and PCR-P, respectively. No significant difference was found between either the PCR-LP or PCR-P results and SSS results (p > 0.05. Although PCR is not yet a replacement for SSS in the diagnosis of leprosy, this technique may be used as an efficient auxiliary tool for early detection of the disease, especially in endemic regions. This strategy may also be useful in cases in which SSS results are negative (e.g., in paucibacillary patients and cases in which skin biopsy cannot be performed.

  19. Brucella contamination in raw milk by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Khalili


    Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. Brucella organisms, which are small aerobic, facultative intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. They are shed in large numbers in the animal’s urine, milk, placental fluid, and other fluids. Dairy product from raw milk are a potential threat to public health in endemic developing countries. The gold standard for the diagnosis of brucellosis is isolation of Brucella species. However, isolation Brucella species is time consuming and needed to level 3 biocontainment facilities and highly skilled technical personnel to handle samples and live bacteria for eventual identification. Handling Brucella species increase risk of laboratory infection. Polymerase chain reaction (PCR with high sensitivity and specifity overcomed to these disadvantages. The aim of this study was to detect Brucella species in milk from dairy cattle farms in Kerman province, Iran by PCR technique. Methods: Forty and eight bulk tank milk (BTM were collected from October 2015 to March 2016 from 48 dairy cattle farm including 4200 cows. DNA of milk samples extracted by lysis buffer and proteinase K method. All milk samples were examined by PCR to detect Brucella-specific DNA targeting IS 711. Positive samples must be showed 317 bp amplified, corresponding to the expected size of the IS 711 genome region in all Brucella species. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp. from 48 BTM samples in this area. Conclusion: The results indicate that brucellosis by Brucella species is endemic in the Kerman province dairy farms. Consumption of raw milk dairy products by individual farmers operating under poor hygienic conditions represents an high risk to public health. The need for implementing control measures and raising public awareness on zoonotic transmission of

  20. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices

    Energy Technology Data Exchange (ETDEWEB)

    Ness, K D; Wheeler, E K; Benett, W; Stratton, P; Christian, A; Chen, A; Ortega, J; Weisgraber, T H; Goodson, K E


    Polymerase chain reaction (PCR) facilitates DNA detection by significantly increasing the concentration of specific DNA segments. A new class of PCR instruments uses a buoyancy-driven re-circulating flow to thermally cycle the DNA sample and benefits from reduced cycle times, low sample volumes, a miniaturized format, and low power consumption. This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' geometry to determine key parameters about PCR cycle times and other figures of merit as functions of device dimensions. The 1-D model balances the buoyancy driving force with frictional losses. A hydrostatic pressure imbalance concept is used between the left and right sides of the fluid loop to calculate the buoyancy driving force. Velocity and temperature distributions within the channels are determined from two-dimensional analysis of the channel section, with developing region effects included empirically through scaled values of the local Nusselt number. Good agreement between four independent verification steps validate the 1-D simulation approach: (1) analytical expressions for the thermal entrance length are compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum PCR runtime required to get a positive PCR signal from the buoyancy-driven PCR device. The 1-D approach closely models an actual buoyancy-driven PCR device and can further be used as a rapid design tool to simulate buoyancy PCR flows and perform detailed design optimizations studies.

  1. The ligase chain reaction as a primary screening tool for the detection of culture positive tuberculosis.

    LENUS (Irish Health Repository)

    O'Connor, T M


    BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.

  2. Identification of duck plague virus by polymerase chain reaction (United States)

    Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.


    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto

  3. Chains, necklaces and weaving chain-link grids from self-assembly reactions. (United States)

    Alvariño, Cristina; Simond, Damien; Lorente, Pau Moneva; Besnard, Céline; Williams, Alan F


    Assembly of two ditopic units, a phenanthroline substituted by 4-ethynyl pyridines at the 2-and 9-positions and a dimetallic paddlewheel, gives a linear chain polymer rather than a closed cyclic species, which would appear equally possible. The chain may be decorated by binding a copper-containing macrocycle around the phenanthroline units to form a polypseudorotaxane. When two phenanthroline ligands are assembled in a first step around copper(I), the paddlewheel acceptor can link them in a second step to form a two-dimensional interwoven grid that resembles the form of a chain-link fence. Each copper(I) centre in this structure is chiral, and the crystal shows complete homochirality, implying selection during the assembly process.

  4. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G


    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  5. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  6. Identification of spoilage yeasts in a food-production chain by microsatellite polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Baleiras Couto, M.M.; Hartog, B.J.; Veld, J.H.J. Huis in 't; Hofstra, H.; Vossen, J.M.B.M. van der


    A survey of yeast strains present in the production chain of mayonnaise and salad dressings was carried out over a period of 14 months. Attempts were made to identify the isolated yeasts with the API system, but identification of all species involved was not possible. In the investigation the

  7. The parallel reaction monitoring method contributes to a highly sensitive polyubiquitin chain quantification

    Energy Technology Data Exchange (ETDEWEB)

    Tsuchiya, Hikaru; Tanaka, Keiji, E-mail:; Saeki, Yasushi, E-mail:


    Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures that typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.

  8. Thermal reactions of polymer chains with coal structures

    Energy Technology Data Exchange (ETDEWEB)

    P. Straka; J. Nahunkova [Academy of Sciences of the Czech Republic, Prague (Czech Republic). Institute of Rock Structure and Mechanics


    The thermal decompositions of polyethylene, polystyrene and polyamide 6 in the presence of coal was studied by DSC and TGA methods and reactions of these polymers with coal were described. Tars and cokes obtained were characterized and mass balance of the process expressed. Polyethylene decomposes by a free radical mechanism and the major products are 1-alkenes, {alpha},{omega}-alkadienes and n-alkanes. In the presence of coal, formed unsaturated products are adsorbed on the inner surface of coal and semicoke. Maximum weight losses of the coal-polyethylene mixture occur at higher temperature in comparison with that from the decomposition of polyethylene alone. Further, thermal reactions of coal with polystyrene were studied. In the range of 410 490{sup o}C a thermal degradation of coal proceeded, simultaneously, with decomposition of polystyrene. Because coal is a strong H-donor, unsaturated products of polystyrene decomposition (mainly styrene) was hydrogenated by coal. Some aromatic products of polystyrene decomposition reacted with the coal tar structures and new aromatics were formed. That is why the conversion time of polystyrene decomposition was much higher in the presence of coal. The yields of tar from copyrolysis with styrene polymers are higher in comparison with pyrolysis of coal alone. Also composition of tar is changed. Finally, reactions of coal with polyamide 6 were investigated. During the thermal degradation of coal the decomposition of polyamide 6 occurs and {epsilon}-caprolactam and the cyclic dimer are formed. The {epsilon}-caprolactam formation is promoted by water and hydrogen from coal degradation as due to high content of hydrogen coal acts as a strong H- and water donor. Under high-temperature conditions of copyrolysis beside a-caprolactam mainly carbon oxides, methane, aliphatic hydrocarbons, simple aromatics and stable oil are formed. 8 refs., 3 figs., 7 tabs.

  9. Laser-Initiated Free Radical Chain Reactions: Synthesis Of Hydroperoxides (United States)

    Bray, R. G.; Chou, M. S.


    We have investigated the advantages of using laser-initiation for the synthesis of cumenehydroperoxide and t-butylhydroperoxide. Laser-initiation significantly improves the oxidation rates of cumene in the liquid phase and iso-butane in the vapor phase (using HBr promoters) with moderate photoefficiencies (418 and 490 respectively). The primary effect of laser-initiation is to reduce the induction period of the reaction. For the oxidation of cumene the beneficial effect of laser initiation is strongly dependent on laser wavelength, alternately enhancing (at 351 nm) or inhibiting (at 249 nm) the oxidation rate. For isobutane oxidation, laser-initiation also minimizes the HBr depletion rate relative to oxidation rate.

  10. Highly Sensitive and Reliable Detection of EGFR Exon 19 Deletions by Droplet Digital Polymerase Chain Reaction. (United States)

    Oskina, Natalya; Oscorbin, Igor; Khrapov, Evgeniy; Boyarskikh, Ulyana; Subbotin, Dmitriy; Demidova, Irina; Imyanitov, Evgeny; Filipenko, Maxim


    Analysis of EGFR mutations is becoming a routine clinical practice but the optimal EGFR mutation testing method is still to be determined. We determined the nucleotide sequence of deletions located in exon 19 of the EGFR gene in lung tumor samples of patients residing in different regions of Russia (153 tumor DNA specimens), using Sanger sequencing. We developed a droplet digital polymerase chain reaction assay capable of detecting all common EGFR deletions in exon 19. We also compared the therascreen amplification refractory mutation system assay with a droplet digital polymerase chain reaction assay for the detection of all the deletions in our study. The droplet digital polymerase chain reaction assay demonstrated 100% sensitivity against polymerase chain reaction fragment length analysis and detected all possible types of deletions revealed in our study (22 types). At the same time, the therascreen EGFR RGQ PCR Kit was not able to detect deletions c.2252-2276>A and c.2253-2276 and showed low performance for another long deletion. Thus, we can conclude that the extraordinary length of deletions and their atypical locations (shift at the 3'-region compared to known deletions) could be problematic for the therascreen EGFR RGQ PCR Kit and should be taken into account during targeted mutation test development. However, droplet digital polymerase chain reaction is a promising and reliable assay that can be used as a diagnostic tool to genotype formalin-fixed paraffin-embedded cancer samples for EGFR or another clinically relevant somatic mutation.

  11. DCHAIN: A user-friendly computer program for radioactive decay and reaction chain calculations

    Energy Technology Data Exchange (ETDEWEB)

    East, L.V.


    A computer program for calculating the time-dependent daughter populations in radioactive decay and nuclear reaction chains is described. Chain members can have non-zero initial populations and be produced from the preceding chain member as the result of radioactive decay, a nuclear reaction, or both. As presently implemented, chains can contain up to 15 members. Program input can be supplied interactively or read from ASCII data files. Time units for half-lives, etc. can be specified during data entry. Input values are verified and can be modified if necessary, before used in calculations. Output results can be saved in ASCII files in a format suitable for including in reports or other documents. The calculational method, described in some detail, utilizes a generalized form of the Bateman equations. The program is written in the C language in conformance with current ANSI standards and can be used on multiple hardware platforms.

  12. Stepwise kinetic equilibrium models of quantitative polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Cobbs Gary


    Full Text Available Abstract Background Numerous models for use in interpreting quantitative PCR (qPCR data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Results Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the

  13. Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries. (United States)

    Ragheb, Suzan Mohammed; Jimenez, Luis

    Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices.

  14. Analysis of liver connexin expression using reverse transcription quantitative real-time polymerase chain reaction (United States)

    Maes, Michaël; Willebrords, Joost; Crespo Yanguas, Sara; Cogliati, Bruno; Vinken, Mathieu


    Summary Although connexin production is mainly regulated at the protein level, altered connexin gene expression has been identified as the underlying mechanism of several pathologies. When studying the latter, appropriate methods to quantify connexin mRNA levels are required. The present chapter describes a well-established reverse transcription quantitative real-time polymerase chain reaction procedure optimized for analysis of hepatic connexins. The method includes RNA extraction and subsequent quantification, generation of complementary DNA, quantitative real-time polymerase chain reaction and data analysis. PMID:27207283

  15. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma... (United States)


    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5...

  16. Random Mutagenesis by Error-Prone Polymerase Chain Reaction Using a Heavy Water Solvent. (United States)

    Minamoto, Toshifumi


    Heavy water is a form of water that contains a heavier isotope of hydrogen ((2)H, also known as deuterium, D) or oxygen ((17)O or (18)O). When using heavy water as a solvent, error-prone polymerase chain reaction (epPCR) can induce random mutations independent of the polymerase used or the composition of the PCR reaction mixture. This relatively new method can easily be combined with the existing epPCR methods to increase the rate of mutations.

  17. Detection of specific polymerase chain reaction product by utilizing the 5'----3' exonuclease activity of Thermus aquaticus DNA polymerase.



    The 5'----3' exonuclease activity of the thermostable enzyme Thermus aquaticus DNA polymerase may be employed in a polymerase chain reaction product detection system to generate a specific detectable signal concomitantly with amplification. An oligonucleotide probe, nonextendable at the 3' end, labeled at the 5' end, and designed to hybridize within the target sequence, is introduced into the polymerase chain reaction assay. Annealing of probe to one of the polymerase chain reaction product s...

  18. Evaluation of IgG anti-toxoplasma avidity and polymerase chain reaction in the postnatal diagnosis of congenital toxoplasmosis. (United States)

    Torres, Elizabeth; Rivera, Raul; Cardona, Nestor; Sanchez, Victor; Lora, Fabiana; Gómez-Marín, Jorge Enrique


    Confirmatory tests for congenital toxoplasmosis were evaluated in 23 infected and 31 uninfected newborns. Conventional polymerase chain reaction was better than real-time polymerase chain reaction, but did not identify additional cases. Avidity tests added 2 new cases that were not identified by other criteria. Overall sensitivity was 82.6%. Avidity assay, but not polymerase chain reaction, increased the sensitivity of confirmatory assays in congenital toxoplasmosis.

  19. Haemophilus ducreyi detection by polymerase chain reaction in oesophageal lesions of HIV patients. (United States)

    Borges, M C; Colares, J K B; Lima, D M; Fonseca, B A L


    HIV patients frequently have opportunistic oesophageal infections. We report Haemophilus ducreyi genetic material detected by polymerase chain reaction in biopsies of oesophageal lesions in three HIV-1-infected patients. This finding may be an indication of its aetiopathological role in oesophageal lesions of HIV patients.

  20. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.


    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal


    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...


    Directory of Open Access Journals (Sweden)

    Shafikova T.N.


    Full Text Available Bacterial ring rot caused by Clavibacter michiganensis ssp. sepedonicus is a widespread disease of potato resulting in significant economic lost in agriculture and seed growing. A latent form of this infection makes difficulties for diagnostics and facilitates the quick disease propagation. Polymerase chain reaction is the best method for the disease control.

  3. Use of enrichment real time-Polymerase Chain Reaction to enumerate Salmonella on chicken parts (United States)

    Salmonella that survive cooking and that cross-contaminate other food during meal preparation and serving represent primary routes of consumer exposure to this pathogen from chicken. Consequently, the present study was undertaken to use enrichment real time-polymerase chain reaction (RT-PCR) to enu...

  4. Polymerase chain reaction amplification of genomic fragments of bovine herpesvirus-1


    Cândido AL; ED Bontempo; Resende M.


    Especial conditions were developed for the amplification of five DNA segments from US region of BHV-1 by polymerase chain reaction. In order to eliminate most nonspecific products it was found that addition of three cosolvents DMSO, glycerol and NP 40 was a simple method for increasing the specificity of amplification.

  5. Rapid and sensitive detection of Campylobacter spp. in chicken products by using the polymerase chain reaction

    NARCIS (Netherlands)

    Giesendorf, B A; Quint, W G; Henkens, M H; Stegeman, H; Huf, F A; Niesters, H G


    The polymerase chain reaction (PCR) after a short enrichment culture was used to detect Campylobacter spp. in chicken products. After the 16S rRNA gene sequence of Campylobacter jejuni was determined and compared with known sequences from other enterobacteria, a primer and probe combination was sele

  6. Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction. (United States)

    Igarashi, T; Yamamoto, A; Goto, N


    Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

  7. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory (United States)

    Elkins, Kelly M.


    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  8. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.


    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal sam


    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  10. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.


    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal sam

  11. HLA-DQA1 typing in Danes by two polymerase chain reaction (PCR) based methods

    DEFF Research Database (Denmark)

    Cowland, J B; Madsen, H O; Morling, N


    A total of 280 persons were HLA-DQA1 typed by two different polymerase chain reaction (PCR) based methods; (i) a reverse dot-blot (RDB) method, which can differentiate between six alleles, and (ii) a combined PCR-restriction fragment length polymorphism (PCR-RFLP) and allele-specific amplification...

  12. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory (United States)

    Elkins, Kelly M.


    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  13. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J;


    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...

  14. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    DEFF Research Database (Denmark)

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.;


    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple...

  15. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints." (United States)

    Phelps, Tara L.; And Others


    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  16. Detection of infections of the eye with Chlamydia trachomatis by the polymerase chain reaction

    NARCIS (Netherlands)

    J. Fan (Jun); W.Y. Zhang (Wen); Y.Y. Wu (Yu); X.Y. Jing (Xiou); E.C.J. Claas (Eric)


    textabstractThe aim of this study was to test the diagnostic feasibility of the polymerase chain reaction (PCR) for detection of infections with Chlamydia trachomatis in eye swabs from patients with conjunctivitis, and to establish the basic technique of the PCR for epidemiological survey. The resul

  17. Sustaines high throughput polymerase chain reaction diagnostics during the European epidemic of Bluetongue serotype 8

    NARCIS (Netherlands)

    Rijn, van P.A.; Heutink, C.G.; Boonstra, J.; Kramps, J.A.; Gennip, van H.G.P.


    A real-time reverse transcription polymerase chain reaction assay (PCR test) based on genome segment 10 of Bluetongue virus (BTV) was developed. The PCR test consists of robotized viral RNA isolation from blood samples and an all-in-one method including initial denaturation of genomic

  18. Detection of infections of the eye with Chlamydia trachomatis by the polymerase chain reaction

    NARCIS (Netherlands)

    J. Fan (Jun); W.Y. Zhang (Wen); Y.Y. Wu (Yu); X.Y. Jing (Xiou); E.C.J. Claas (Eric)


    textabstractThe aim of this study was to test the diagnostic feasibility of the polymerase chain reaction (PCR) for detection of infections with Chlamydia trachomatis in eye swabs from patients with conjunctivitis, and to establish the basic technique of the PCR for epidemiological survey. The

  19. Rapid and sensitive detection of Campylobacter spp. in chicken products by using the polymerase chain reaction

    NARCIS (Netherlands)

    Giesendorf, B A; Quint, W G; Henkens, M H; Stegeman, H; Huf, F A; Niesters, H G


    The polymerase chain reaction (PCR) after a short enrichment culture was used to detect Campylobacter spp. in chicken products. After the 16S rRNA gene sequence of Campylobacter jejuni was determined and compared with known sequences from other enterobacteria, a primer and probe combination was

  20. [Application of the polymerase chain reaction for detecting respiratory syncytial virus]. (United States)

    Sarmiento, L; Chacón, D; Valdivia, A; Savón, C; Goyenechea, A


    The polymerase chain reaction (PCR) was developed in order to identify the respiratory syncytial virus by using the reference strain. The high sensitivity and specificity obtained show the PCR utility for detecting the RSV genoma and its application on the diagnosis.

  1. Principles and applications of polymerase chain reaction in medical diagnostic fields: a review


    Marcela Agne Alves Valones; Rafael Lima Guimarães; Lucas André Cavalcanti Brandão; Paulo Roberto Eleutério de Souza; Alessandra Albuquerque Tavares de Carvalho; Sergio Crovela


    Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques,...

  2. [Software and hardware design for the temperature control system of quantitative polymerase chain reaction]. (United States)

    Qiu, Xian-bo; Yuan, Jing-qi; Li, Qi


    A temperature control system for quantitive polymerase chain reaction (PCR) is presented in the paper with both software and hardware configuration. The performance of the control system has been improved by optimizing the software and hardware design according to the system's properties. The control system has been proven to have a good repeatability and reliability as well as high control precision.

  3. Specific Detection of Campylobacter Jejuni and Campylobacter Coli by Using Polymerase Chain Reaction (United States)


    D2676 CDC C. cryaerophila ( Arcobacter cryoaerophilus) 1 D2792 (type strain) CDC C. hyoinestinilis 3 D2189 CDC D2411 (porcine) CDC D1932 (type...polymerase descriptions and proposal of Arcobacter gen. nov. Int. J. Syst. chain reaction for the detection of Mycobacterium leprae. 1. Bacteriol. 41:451-455

  4. Detection and analysis of polymerase chain reaction products by mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Hurst, G.B., Doktycz, M.J., Britt, P.F., Vass, A.A., Buchanan, M.V.


    This paper describes recent and ongoing efforts to overcome some of the obstacles to more routine and robust application of MALDI-TOF to analysis of polymerase chain reaction products and other information- bearing nucleic acid molecules. Methods for purifying nucleic acid samples are described, as is the application of delayed extraction TOF mass spectrometry to analysis of short oligonucleotides.

  5. Diversity of Enterococcus faecalis Genotypes from Multiple Oral Sites Associated with Endodontic Failure Using Repetitive Sequence-based Polymerase Chain Reaction and Arbitrarily Primed Polymerase Chain Reaction. (United States)

    Delboni, Maraísa G; Gomes, Brenda P F A; Francisco, Priscila A; Teixeira, Fabrício B; Drake, David


    The aim of this study was to evaluate the diversity and similarity of Enterococcus faecalis genotype isolates from multiple oral sites using repetitive sequence-based polymerase chain reaction and arbitrarily primed polymerase chain reaction (AP-PCR). Forty-two endodontically treated teeth with apical periodontitis were selected. A total of 126 microbial samples were collected from 3 different sites (saliva, pulp chamber, and root canals, all n = 42) during the nonsurgical retreatment procedures. After growth on m-Enterococcus agar, the colonies were isolated, characterized as gram-positive catalase negative cocci, and identified using an API 20 Strep kit (bioMérieux, Marcy-l'Etoile, France). Seventy-four colonies from 10 patients were confirmed as E. faecalis by polymerase chain reaction (16S ribosomal RNA). Repetitive sequence-based polymerase chain reactions using ERIC and AP-PCR using RW3A primers were performed in all 74 colonies. Fingerprints were analyzed and separated into genotypic groups based on the Dice coefficient percentage of similarity (82% or greater) as determined by ERIC reproducibility assays involving E. faecalis controls. Seven different E. faecalis genotypes (GTs) (GT1 = 27%, GT2 = 17.6%, GT3 = 1.3%, GT4 = 18.9%, GT5 = 9.5%, GT6 = 14.9%, and GT7 = 10.8%) were observed in different subjects and oral sites associated with endodontic failure. Remarkably, in 4 of 5 patients, the same GTs present in the infected root canals were also isolated from either the pulp chamber or the saliva samples. In particular, GT6 was detected in all 3 oral sites of patient 37. E. faecalis GTs isolated from saliva, the pulp chamber, and the root canal were similar using the Rep-PCR and AP-PCR methods. These findings suggest that coronal microleakage is a conceivable cause of endodontic failure. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  6. Amphiphilic Polyphosphazene with Poly(ethylene oxide) Side Chains Prepared through the Decker-Forster Reaction

    Institute of Scientific and Technical Information of China (English)

    LIU Chengmei; HU Fuzhen; QIU Jinjun; LEI Guofu; BAO Rui


    Poly(4-methylphenoxyphosphazene)-graft-poly(ethylene oxide) (PPZ-g-PEO), a novel amphiphilic grafting polymer was prepared via the Decker-Forster reaction. It is found that the graft efficiency increased with extension of reaction time. Low molecular weight of poly(ethylene oxide) favored the grafting reaction. The grafted polymer has two different glass transition temperatures(Tg) with those of pure poly(4-methylphenoxy-phopsphazene) and PEO. The emulsifying ability of grafted polymer was studied with benzene-water mixture. The emulsifying volumes increased with the decreasing of PEO's molecular weight. The contact angle of film forming from grafted polymer decreased after introduction of PEO grafting chain.

  7. Mucosal polymerase chain reaction for diagnosing Helicobacter pylori infection in patients with bleeding peptic ulcers

    Institute of Scientific and Technical Information of China (English)

    Hwai-Jeng Lin; Wen-Ching Lo; Chin-Lin Perng; Guan-Ying Tseng; Anna Fen-Yau Li; Yueh-Hsing Ou


    AIM: Helicobacter pylori(Hpylori) has been linked to chronic gastritis, peptic ulcers, gastric cancer and MALT-lymphoma.Conventional invasive tests are less sensitive than noninvasive tests in diagnosing H pylori infection in patients with bleeding peptic ulcers. Polymerase chain reaction is a sensitive and accurate method for diagnosing H pylori infection. The aim of this study was to evaluate the diagnostic role of mucosal polymerase chain reaction for H pylori infection in patients with bleeding peptic ulcers.METHODS: In patients with bleeding, non-bleeding peptic ulcers and chronic gastritis, we checked rapid urease test,histology, bacterial culture and mucosal polymerase chain reaction for detecting H pylori infection. Positive H pylori infection was defined as positive culture or both a positive histology and a positive rapid urease test. For mucosal polymerase chain reaction of Hpylori, we checked vacA (s1a, s1b, s1c, s2, m1, m1T, m2),iceA1,iceA2 and cag A.RESULTS: Between October 2000 and April 2002, 88 patients with bleeding peptic ulcers (males/females: 60/28, gastric ulcers/duodenal ulcers: 55/33), 81 patients with non-bleeding peptic ulcers (males/females: 54/27, gastric ulcers/duodenal ulcers: 45/36) and 37 patients with chronic gastritis (males/females: 24/13) were enrolled in this study. In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, 45 patients (51%), 71 patients (88%)and 20 patients (54%) respectively were found to have positive H pylori infection (P<0.001). In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, polymerase chain reaction for H pylori infection was positive in 54 patients (61%), 70 patients (86%) and 20 patients (54%) respectively (P<0.001). The sensitivity,positive predictive value and diagnostic accuracy of mucosal polymerase reaction for Hpylori infection were significantly lower in patients with bleeding peptic ulcers (84%, 79%and 81%) than in

  8. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction (United States)

    Sharma, Vinay; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin; Sharma, Shyam Sundar; Agrawal, Kailash


    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

  9. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Vinay, E-mail:; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Sharma, Shyam Sundar [Govt. women Engineering College, Ajmer (India); Agrawal, Kailash [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Department of Botany, University of Rajasthan, Jaipur 302004 (India)


    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.


    Directory of Open Access Journals (Sweden)

    Isti Koesharyani


    Full Text Available Penelitian ini dilakukan karena adanya masalah yang dihadapi seperti pertumbuhan udang yang tidak seragam (ukuran bervariasi, penampakan klinis yang abnormal dan organ yang tidak sempurna. Gejala tersebut akibat dari infeksi penyakit yang disebabkan oleh virus. Untuk mengetahui jenis virus yang menyerang udang tersebut, maka dilakukan analisis Polymerase Chain Reaction (PCR dan Reverse TranscriptasePolymerase Chain Reaction (RT-PCR menggunakan berbagai jenis spesifik primer WSSV, IHHNV, MBV, TSV, IMNV, dan PvNV. Sampel udang yang secara visual normal dan abnormal diambil lalu disimpan dalam larutan pengawet 90% Ethanol dan RNAlater kemudian dianalisis di laboratorium dengan metode yang sudah dikembangkan oleh Pusat Penelitian dan Pengembangan Perikanan Budidaya. Hasilnya menunjukkan bahwa udang yang tumbuh lambat dan mempunyai rostrum bengkok dan warna otot daging memutih ternyata tidak hanya diserang oleh satu virus namun dua virus IHHNV dan IMNV. Hasil penelitian ini juga mengindikasikan bahwa udang yang terserang IHHNV akan tumbuh lambat walaupun tidak mematikan, sedangkan udang yang diserang IMNV otot daging di tubuh memutih terutama pada bagian punggung dan dapat menimbulkan kematian.

  11. Transesterification reaction between medium- and long-chain fatty acid triglycerides using surfactant-modified lipase. (United States)

    Mogi, K; Nakajima, M; Mukataka, S


    Transesterification between medium-chain fatty acid triglycerides (MCT) and long-chain fatty acid triglycerides (LCT) in a nonsolvent system was investigated using surfactant modified lipase which is a complex of lipase, Rhizopus japonicus and surfactant, sorbitan monostearate. 74% conversion of was obtained after a 48-h reaction period, and the triglyceride composition was well described by the 1, 3-random 2-random stochastic model. The transesterification reaction between MCT and LCT closely followed the simple kinetic model, and the change in MCT and LCT contents could be simulated using one parameter. The effects of the water activity (A(w)) of modified lipase, the water content of the reaction system and the reaction temperature on the reaction rate were studied. A modified lipase A(w) of 0.35 and a water content of the reaction system at 0.09 wt % showed the highest activity. Inactivation did not occur below 60 degrees C, however, the activity decreased at temperatures over 70 degrees C. Copyright 2000 John Wiley & Sons, Inc.

  12. Polymerase chain reaction and conventional DNA tests in detection of HPV DNA in cytologically normal and abnormal cervical scrapes

    DEFF Research Database (Denmark)

    Kalia, A.; Jalava, T.; Nieminen, P.


    Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...

  13. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma... (United States)


    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... sample (100 to 2000 ng/5 μl) with one of the following 45 μl PCR cocktails: (i) 5 μl 10x PCR buffer, 1...

  14. Comparison of different polymerase chain reaction-based approaches for clonality assessment of immunoglobulin heavy-chain gene rearrangements in B-cell neoplasia

    NARCIS (Netherlands)

    Derksen, P W; Langerak, A W; Kerkhof, E; Wolvers-Tettero, I L; Boor, P P; Mulder, A H; Vrints, L W; Coebergh, J W; van Krieken, J H; Schuuring, E; Kluin, P M; van Dongen, J J


    Several frequently applied polymerase chain reaction strategies for analysis of immunoglobulin heavy-chain gene rearrangements were compared by analyzing 70 B-cell lymphoproliferative disorders and 24 reactive lymphoid lesions. Southern blot analysis was used as the "gold standard" for clonality ass

  15. Suppression of the chain nuclear fusion reaction based on the p+{sup 11}B reaction because of the deceleration of alpha particles

    Energy Technology Data Exchange (ETDEWEB)

    Shmatov, M. L., E-mail: [Ioffe Institute (Russian Federation)


    It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.

  16. Simplified procedures for applying the polymerase chain reaction to routinely fixed paraffin wax sections. (United States)

    Coates, P J; d'Ardenne, A J; Khan, G; Kangro, H O; Slavin, G


    The polymerase chain reaction was applied to the analysis of DNA contained in archival paraffin wax embedded material. DNA suitable for the reaction was obtained from these tissues by simple extraction methods, without previous dewaxing of tissue sections. When compared with unfixed material, the reaction efficiency was compromised, so that an increased number of amplification cycles were required to produce equivalent amounts of amplified product. This in turn led to an increase in amplification artefacts, which can be minimised by a simple modification of the standard reaction. Amplification of relatively large DNA fragments was not always successful, and it seems prudent to bear this in mind when designing oligonucleotide primers which are to be used for the amplification of archival material. The efficiency of the procedure can be improved by dividing the amplification cycles into two parts: this reduces the amount of reagent needed, is relatively simple and inexpensive, and can be performed in one working day.

  17. Quantitative interpretation to the chain mechanism of free radical reactions in cyclohexane pyrolysis

    Institute of Scientific and Technical Information of China (English)

    Yingxian Zhao; Bo Shen; Feng Wei


    Pyrolysis of cyclohexane was conducted with a plug flow tube reactor in the temperature range of 873-973 K.Based on the experimental data,the mechanism and kinetic model of cyclohexane pyrolysis reaction were proposed.The kinetic analysis shows that overall conversion of cyclohexane is a first order reaction,of which the rate constant increased from 0.0086 to 0.0225 to 0.0623 s- 1 with the increase of temperature from 873 to 923 to 973 K,and the apparent activation energy was determined to be 155.0+1.0 kJ.mo1-1.The mechanism suggests that the cyclohexane is consumed by four processes:the homolysis of C-C bond (Path Ⅰ),the homolysis of C-H bond (Path Ⅱ) in reaction chain initiation,the H-abstraction of various radicals from the feed molecules in reaction chain propagation (Path Ⅲ),and the process associated with coke formation (Path Ⅳ).The reaction path probability (RPP) ratio of Xpath Ⅰ ∶ Xpath Ⅱ∶ XPath Ⅲ ∶ XPath Ⅳ was 0.5420 ∶ 0.0045 ∶ 0.3897 ∶ 0.0638 at 873 K,and 0.4336 ∶ 0.0061 ∶ 0.4885 ∶ 0.0718 at 973 K,respectively.

  18. Instability Criterion of One-Dimensional Detonation Wave with Three-Step Chain Branching Reaction Model

    Institute of Scientific and Technical Information of China (English)

    TENG Hong-Hui; JIANG Zong-Lin


    @@ One-dimensional detonation waves are simulated with the three-step chain branching reaction model, and the instability criterion is studied.The ratio of the induction zone length and the reaction zone length may be used to decide the instability, and the detonation becomes unstable with the high ratio.However, the ratio is not invariable with different heat release values.The critical ratio, corresponding to the transition from the stable detonation to the unstable detonation, has a negative correlation with the heat release.An empirical relation of the Chapman-Jouguet Mach number and the length ratio is proposed as the instability criterion.

  19. Cyclic polyesters prepared by poly(oxypropylene oxymaloyl ring-chain reactions

    Directory of Open Access Journals (Sweden)


    Full Text Available The synthesis of cyclic polyesters of poly(oxypropylene oxymaloyl from a ring-chain reaction was carried out at 40°C with 'Maghnite' an acid exchanged montmorillonite as acid solid ecocatalyst (Mag–H+. 'Maghnite' is already used as catalyst for polymerization of many vinylic and heterocyclic monomers [1]. The effect of amount of catalyst on yield and molecular weight of polymer was studied.A typical reaction product was analyzed by gel permeation chromatography (GPC as well as by nuclear magnetic resonance spectroscopy (1H-NMR and the existence of cyclic species was proven.

  20. Polymerase chain reaction-based molecular diagnosis of cutaneous infections in dermatopathology. (United States)

    Swick, Brian L


    Conventional methods, including microscopy, culture, and serologic studies, are a mainstay in the diagnosis of cutaneous infection. However, owing to limitations associated with these techniques, such as low sensitivity for standard microscopy and in the case of culture delay in diagnosis, polymerase chain-reaction based molecular techniques have taken on an expanding role in the diagnosis of infectious processes in dermatopathology. In particular, these assays are a useful adjunct in the diagnosis of cutaneous tuberculosis, atypical mycobacterial infection, leprosy, Lyme disease, syphilis, rickettsioses, leishmaniasis, and some fungal and viral infections. Already in the case of tuberculosis and atypical mycobacterial infection, standardized polymerase chain-reaction assays are commonly used for diagnostic purposes. With time, additional molecular-based techniques will decrease in cost and gain increased standardization, thus delivering rapid diagnostic confirmation for many difficult-to-diagnose cutaneous infections from standard formalin-fixed paraffin-embedded tissue specimens.

  1. Detection of human papillomaviruses by polymerase chain reaction and ligation reaction on universal microarray.

    Directory of Open Access Journals (Sweden)

    Jarmo Ritari

    Full Text Available Sensitive and specific detection of human papillomaviruses (HPV in cervical samples is a useful tool for the early diagnosis of epithelial neoplasia and anogenital lesions. Recent studies support the feasibility of HPV DNA testing instead of cytology (Pap smear as a primary test in population screening for cervical cancer. This is likely to be an option in the near future in many countries, and it would increase the efficiency of screening for cervical abnormalities. We present here a microarray test for the detection and typing of 15 most important high-risk HPV types and two low risk types. The method is based on type specific multiplex PCR amplification of the L1 viral genomic region followed by ligation detection reaction where two specific ssDNA probes, one containing a fluorescent label and the other a flanking ZipCode sequence, are joined by enzymatic ligation in the presence of the correct HPV PCR product. Human beta-globin is amplified in the same reaction to control for sample quality and adequacy. The genotyping capacity of our approach was evaluated against Linear Array test using cervical samples collected in transport medium. Altogether 14 out of 15 valid samples (93% gave concordant results between our test and Linear Array. One sample was HPV56 positive in our test and high-risk positive in Hybrid Capture 2 but remained negative in Linear Array. The preliminary results suggest that our test has accurate multiple HPV genotyping capability with the additional advantages of generic detection format, and potential for high-throughput screening.

  2. Detection of human papillomaviruses by polymerase chain reaction and ligation reaction on universal microarray. (United States)

    Ritari, Jarmo; Hultman, Jenni; Fingerroos, Rita; Tarkkanen, Jussi; Pullat, Janne; Paulin, Lars; Kivi, Niina; Auvinen, Petri; Auvinen, Eeva


    Sensitive and specific detection of human papillomaviruses (HPV) in cervical samples is a useful tool for the early diagnosis of epithelial neoplasia and anogenital lesions. Recent studies support the feasibility of HPV DNA testing instead of cytology (Pap smear) as a primary test in population screening for cervical cancer. This is likely to be an option in the near future in many countries, and it would increase the efficiency of screening for cervical abnormalities. We present here a microarray test for the detection and typing of 15 most important high-risk HPV types and two low risk types. The method is based on type specific multiplex PCR amplification of the L1 viral genomic region followed by ligation detection reaction where two specific ssDNA probes, one containing a fluorescent label and the other a flanking ZipCode sequence, are joined by enzymatic ligation in the presence of the correct HPV PCR product. Human beta-globin is amplified in the same reaction to control for sample quality and adequacy. The genotyping capacity of our approach was evaluated against Linear Array test using cervical samples collected in transport medium. Altogether 14 out of 15 valid samples (93%) gave concordant results between our test and Linear Array. One sample was HPV56 positive in our test and high-risk positive in Hybrid Capture 2 but remained negative in Linear Array. The preliminary results suggest that our test has accurate multiple HPV genotyping capability with the additional advantages of generic detection format, and potential for high-throughput screening.

  3. Exploiting the tetrazine-norbornene reaction for single polymer chain collapse. (United States)

    Hansell, Claire F; Lu, Annhelen; Patterson, Joseph P; O'Reilly, Rachel K


    Single chain polymer nanoparticles (SCNPs) have been formed using polystyrenes decorated with pendent norbornenes and a bifunctional tetrazine crosslinker. Characterisation by size exclusion chromatography and (1)H NMR gives evidence for the formation of SCNPs by the tetrazine-norbornene reaction, whilst light scattering, neutron scattering, transmission electron microscopy and atomic force microscopy show that discrete well-defined nanoparticles are formed and their size in solution calculated.

  4. Global stability of enzymatic chains of full reversible Michaelis-Menten reactions. (United States)

    Belgacem, Ismail; Gouzé, Jean-Luc


    We consider a chain of metabolic reactions catalyzed by enzymes, of reversible Michaelis-Menten type with full dynamics, i.e. not reduced with any quasi-steady state approximations. We study the corresponding dynamical system and show its global stability if the equilibrium exists. If the system is open, the equilibrium may not exist. The main tool is monotone systems theory. Finally we study the implications of these results for the study of coupled genetic-metabolic systems.

  5. The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

    LENUS (Irish Health Repository)

    Drew, Richard J


    Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

  6. Comparison of polimerase chain reaction and serological methods in the diagnosis of hepatitis C virus infection


    Kaya, Selçuk; Arıdoğan, Buket Cicioğlu; Çetin, Emel Sesli; Adiloğlu, Ali K.; Demirci, Mustafa


    SüleymanDemirel Üniversitesi TIP FAKÜLTESİ DERGİSİ: 2007 Mart; 14(1) Comparison of polimerase chain reaction and serological methods in the diagnosis of hepatitis C virus infection Selçuk Kaya, Buket Cicioğlu-Arıdoğan, Emel Sesli Çetin, Ali K. Adiloğlu, Mustafa Demirci Süleyman Demirel University Medical School Medical Microbiology Department, Isparta, Turkey. Özet Hepatit C Virus inf...

  7. Compact-like kink in a real electrical reaction-diffusion chain

    Energy Technology Data Exchange (ETDEWEB)

    Comte, J.C. [Laboratoire de Physiopathologie des Reseaux Neuronaux du Cycle Veille-Sommeil, CNRS UMR 5167, Faculte de Medecine Laennec 7, Rue Guillaume Paradin, 69372 Lyon Cedex 08 (France)]. E-mail:; Marquie, P. [Laboratoire d' Electronique, Informatique et Image (LE2i) UMR CNRS 5158, Aile des Sciences de l' Ingenieur, BP 47870, 21078 Dijon Cedex (France)


    We demonstrate experimentally the compact-like kinks existence in a real electrical reaction-diffusion chain. Our measures show that such entities are strictly localized and consequently present a finite spatial extent. We show equally that the kink velocity is threshold-dependent. A theoretical quantification of the critical coupling under which propagation fails is also achieved and reveals that nonlinear coupling leads to a propagation failure reduction.

  8. Development of a polymerase chain reaction assay for the detection of pseudorabies virus in clinical samples


    Lester J Pérez; Heidy Díaz de Arce


    Aujeszky's disease, also known as pseudorabies causes severe economic losses in swine industry and affects the pig husbandry all over the world. The conventional diagnostic procedure is time-consuming and false-negative results may occur in submissions from latently infected animals. The development, optimization and evaluation of a polymerase chain reaction (PCR) assay are presented for the diagnosis of pseudorabies infection. This assay was based on the amplification of a highly conserved v...

  9. High-speed droplet-allele-specific polymerase chain reaction for genotyping of single nucleotide polymorphisms. (United States)

    Matsuda, Kazuyuki; Honda, Takayuki


    Single nucleotide alternations such as single nucleotide polymorphisms (SNPs) or single nucleotide mutations are useful genetic markers for molecular diagnosis, prognosis, drug response, and predisposition to diseases. Rapid identification of SNPs or mutations is clinically important, especially for determining drug responses and selection of molecular-targeted therapy. Here, we describe a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) by using our droplet-PCR machine (droplet-AS-PCR).

  10. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics


    Li Jiang; Matthew Mancuso; Zhengda Lu; Gunkut Akar; Ethel Cesarman; David Erickson


    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics ...

  11. Shortening Isolation of Patients With Suspected Tuberculosis by Using Polymerase Chain Reaction Analysis

    DEFF Research Database (Denmark)

    Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard;


    Background. Isolation of patients suspected for pulmonary tuberculosis is guided by serial sputum smears. This can result in isolation for days for patients with noncontagious tuberculosis. To determine whether a single sample negative for Mycobacterium tuberculosis complex at polymerase chain...... reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...

  12. Differentiation of Giardia duodenalis from other Giardia spp. by using polymerase chain reaction and gene probes.


    Mahbubani, M H; Bej, A K; Perlin, M H; Schaefer, F W; Jakubowski, W.; Atlas, R M


    Giardia spp. are waterborne organisms that are the most commonly identified pathogenic intestinal protozoans in the United States. Current detection techniques for Giardia species in water include microscopy and immunofluorescence techniques. Species of the genus Giardia are classified on the basis of taxonomic criteria, such as cell morphology, and on host specificity. We have developed a polymerase chain reaction- and gene probe-based detection system specific for Giardia spp., which can di...

  13. Determination of penicillin susceptibility of Streptococcus pneumoniae using the polymerase chain reaction.


    Jalal, H; Organji, S.; Reynolds, J.; Bennett, D; O'Mason, E.; Millar, M R


    AIM: To develop a polymerase chain reaction (PCR) based method to detect penicillin susceptibility in isolates of Streptococcus pneumoniae (SP). METHOD: PCR primers were designed to amplify differential nucleotide sequences of the penicillin-binding protein (PBP) genes 2b, 2x, and 1a in penicillin susceptible and resistant strains of SP. Primers derived from the PBP 2x and 2b genes were designed to amplify products from penicillin susceptible S pneumoniae (PSSP), whereas primers derived from ...


    Directory of Open Access Journals (Sweden)

    Honcharova S.Y.


    Full Text Available We isolated and identified the pathogens from the urogenital tract in 100 women of 26-55 years in Diagnostic Center of Dnepropetrovsk Medical Academy by polymerase chain reaction. It was found that all investigated microflora was represented by HPV of high and low cancer risk - HSV type 1+2, Ureaplasma urealyticum, Chlamydia trachomatis, Trichomonas vaginalis, Mycoplasma hominis, and Candida yeast species. The most abundant pathogens from the urogenital tract were HPV, Ureaplasma urealyticum, and Chlamydia trachomatis.

  15. A reverse transcription-polymerase chain reaction assay for the detection of avian pneumovirus (Colorado strain). (United States)

    Ali, A; Reynolds, D L


    A reverse transcription-polymerase chain reaction assay was developed for the detection of avian pneumovirus (Colorado strain) (APV-Col). The specific primers were designed from the published sequence of the matrix protein gene of APV-Col. The primers amplified a product of 631 nucleotides from APV-Col. The assay identified only APV-Col and did not react with Newcastle disease virus and infectious bronchitis virus.

  16. Prediction of insecticidal activity of Bacillus thuringiensis strains by polymerase chain reaction product profiles.


    Carozzi, N B; Kramer, V C; Warren, G W; Evola, S; Koziel, M G


    A rapid analysis of Bacillus thuringiensis strains predictive of insecticidal activity was established by using polymerase chain reaction (PCR) technology. Primers specific to regions of high homology within genes encoding three major classes of B. thuringiensis crystal proteins were used to generate a PCR product profile characteristic of each insecticidal class. Predictions of insecticidal activity were made on the basis of the electrophoretic patterns of the PCR products. Included in the s...

  17. Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

    KAUST Repository

    Zhang, Hefeng


    We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b-polystyrenyllithium (PI-. b-PSLi), to the main chain and subsequently to the branches in a divergent way. PI segment is short and serves as a precursor for multifunctional branching unit. The grafting reaction involves two successive steps: i) epoxidation of internal double bonds of PI segments, either in main chain or side chains; ii) ring-opening addition to the resulting epoxy group by the living PI-. b-PSLi. Repeating the two steps affords a series of cylindrical polymer brushes with up to 3rd generation and extremely high molecular weight. The branching multiplicity depends on the average number of oxirane groups per PI segment, usually ca. 8 in the present work. The high branching multiplicity leads to tremendous increase in molecular weights of the cylindrical products with generation growth. Several series of cylindrical polymer brushes with tunable aspect ratios are prepared using backbones and branches with controlled lengths. Shape anisotropy is investigated in dilute solution using light scattering technique. Worm-like single molecular morphology with large persistence length is observed on different substrates by atomic force microscopy.

  18. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman


    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  19. Shielding effects in polymer-polymer reactions. V. Concentration dependence of contact formation between star-branched and linear chains. (United States)

    Nardai, Michael M; Zifferer, Gerhard


    By use of the Dissipative Particle Dynamics (DPD) simulation technique mixtures of star-branched (arm number F = 4) and linear chains in athermal (good) solvent are analyzed regarding probabilities for intermolecular contacts of various reactive sites within different polymer coils. The accompanying sterical hindrances are described in the framework of shielding factors in order to investigate reactions and side reactions in radical polymerization and other techniques that involve polymer-polymer coupling. The shielding factors are studied as a function of total concentration from high dilution up to the bulk for different chain lengths of star-shaped and linear chains. Results indicate that their concentration dependence can be described by a power law for systems above the overlap concentration, whereas the chain length dependence vanishes when extrapolating to infinite chain lengths in that concentration range. Also the influence of the ratio of star chains and linear chains is studied for various concentrations.

  20. Extended kinetic model of real-time polymerase chain reaction process (United States)

    Fedorov, A. A.; Sochivko, D. G.; Varlamov, D. A.; Kurochkin, V. E.


    Real-time polymerase chain reaction (real-time PCR) is the main molecular genetic method used for qualitative and quantitative analysis of specific nucleic acid sequences in many areas of biomedical research. Theoretical study of pCr models allows to estimate the influence of various reaction components and parameters, and to determine the unknown parameter values by approximating the experimental real-time PCR curves. An extended kinetic model of real-time PCR is presented. The model takes into account the enzyme activity based on Michaelis-Menten kinetics, the hybridization of complementary DNA fragments, the presence of a fluorescent probe used for detection of the reaction products, and the temperature dependence of primers and probe hybridization.

  1. Kinetic characteristics of continuous flow polymerase chain reaction chip: A numerical investigation

    Institute of Scientific and Technical Information of China (English)


    Continuous flow PCR (polymerase chain reaction) chip holds impressive advantages compared to micro chamber PCR chip. In order to have better understanding of kinetic characteristics of continuous flow PCR chip, a comprehensive mathematical model is presented in this paper, including melting, annealing and extension phases of a typical PCR process which has the essence of a convection-diffusion-reaction system. Using this model, we can simulate the PCR process in series of reaction cycles. Numerical results show that the average sample velocity plays a significant role in affecting the amplification efficiency. Also, appropriate combination of the PCR mixture is important for high-quality DNA amplification. Giving a large initial DNA concentration range, the continuous flow PCR scheme holds excellent real-time detection ability theoretically. The present numerical model bridges the temperature distribution to the real DNA amplification, and thereby is able to successfully predict continuous flow PCR properties which are important for the chip design.

  2. Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

    DEFF Research Database (Denmark)

    Østergaard, Lars; Traulsen, J; Birkelund, Svend


    Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples...

  3. Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

    DEFF Research Database (Denmark)

    Østergaard, Lars; Traulsen, J; Birkelund, Svend


    Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples...

  4. Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    Wei-Ping Qian; Li-Ka Shing; Yue-Qiu Tan; Ying Chen; Ying Peng; Zhi Li; Guang-Xiu Lu; Marie C. Lin; Hsiang-Fu Kung; Ming-Ling He


    AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen.METHODS: Hepatitis B viral DNA was isolated from HBV carriers' semen and sera using phenol extraction method and QTAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction.RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5×107 and 1.67×107 copies of HBV DNA per mL in two HBV infected patients' sera, while 2.L4×105 and 3.02×105 copies of HBV DNA per mL in the semen.CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen.

  5. An optimized polymerase chain reaction assay to identify avian virus vaccine contamination with Chicken anemia virus. (United States)

    Amer, Haitham M; Elzahed, Hanan M; Elabiare, Elham A; Badawy, Ahmed A; Yousef, Ausama A


    The use of embryonating chicken eggs in preparation of avian virus vaccines is the principle cause for contamination with Chicken anemia virus (CAV). Identification of CAV in contaminated vaccines relies on the expensive, tedious, and time-consuming practice of virus isolation in lymphoblastoid cell lines. The experience of the last 2 decades indicates that polymerase chain reaction is extending to replace most of the classic methods for detection of infectious agents. In the present report, a simple, rapid, and accurate polymerase chain reaction method for detection of CAV in poultry vaccines is described. Oligonucleotide primers homologous to highly conserved sequences of the VP1 gene were used to amplify a fragment of 676 bp. The developed assay was specific for detecting CAV from different sources, with no cross reactivity with many avian viruses. No inter- and intra-assay variations were observed. The analytical sensitivity of the test was high enough to detect 5 TCID(50) (50% tissue culture infective dose) of the virus per reaction; however, different factors related to the vaccine matrix showed considerable effects on the detection limit. In conclusion, this method may represent a suitable alternative to virus isolation for identification of CAV contamination of poultry virus vaccines.

  6. Development of Capillary Loop Convective Polymerase Chain Reaction Platform with Real-Time Fluorescence Detection

    Directory of Open Access Journals (Sweden)

    Wen-Pin Chou


    Full Text Available Polymerase chain reaction (PCR has been one of the principal techniques of molecular biology and diagnosis for decades. Conventional PCR platforms, which work by rapidly heating and cooling the whole vessel, need complicated hardware designs, and cause energy waste and high cost. On the other hand, partial heating on the various locations of vessels to induce convective solution flows by buoyancy have been used for DNA amplification in recent years. In this research, we develop a new convective PCR platform, capillary loop convective polymerase chain reaction (clcPCR, which can generate one direction flow and make the PCR reaction more stable. The U-shaped loop capillaries with 1.6 mm inner diameter are designed as PCR reagent containers. The clcPCR platform utilizes one isothermal heater for heating the bottom of the loop capillary and a CCD device for detecting real-time amplifying fluorescence signals. The stable flow was generated in the U-shaped container and the amplification process could be finished in 25 min. Our experiments with different initial concentrations of DNA templates demonstrate that clcPCR can be applied for precise quantification. Multiple sample testing and real-time quantification will be achieved in future studies.

  7. Sensitive electrochemical monitoring of nucleic acids coupling DNA nanostructures with hybridization chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping, E-mail:


    Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling.

  8. Ligase chain reaction amplification for sensitive electrochemiluminescent detection of single nucleotide polymorphisms

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Ying; Yang, Mengli; Xiang, Yun, E-mail:; Yuan, Ruo, E-mail:; Chai, Yaqin


    Graphical abstract: -- Highlights: •Ligase chain reaction amplification (LCR) is employed to sensitively detect single nucleotide polymorphisms. •During LCR, the mutant target gene is recycled and duplicated exponentially to achieve dramatic signal amplification. •The method shows a selectivity factor of 10{sup 3} toward the mutant target gene against the interfering wild target gene. -- Abstract: Single nucleotide polymorphisms are the most common type of genetic variations among human beings and can serve as biomarkers for various types of diseases. In this work, based on ligase chain reaction amplification for the production of massive hemin/G-quadruplex DNAzymes to quench the electrochemiluminescent (ECL) emission of quantum dots (QDs), a universal and sensitive single nucleotide polymorphism detection method is described. During the ligase chain reaction process, the mutant K-ras target gene is recycled and exponentially duplicated, leading to the attachment of numerous G-rich sequences on the QD-embedded sensing surface. Upon the addition of the assistant sequences and hemin, numerous hemin/G-quadruplex DNAzymes are formed, which consume the dissolved oxygen in the detection buffer and result in significant quenching of QD ECL emission for sensitive single nucleotide polymorphism determination. The developed method shows a linear range of 50 fM to 50 pM and an estimated detection limit of 45 fM for the mutant K-ras gene. The proposed strategy also exhibits high selectivity towards the mutant K-ras gene against the co-existence of 10{sup 3}-fold excess of the wild-type K-ras gene, which makes our method a useful addition to the alternatives for single nucleotide polymorphism monitoring.

  9. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G


    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial repetiti

  10. Gynecological manifestations, histopathological findings, and schistosoma-specific polymerase chain reaction results among women with Schistosoma haematobium infection

    DEFF Research Database (Denmark)

    Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline;


    BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma...

  11. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial

  12. Application of polymerase chain reaction (PCR) for diagnosis of equine herpes virus-1 (EHV-1). (United States)

    Gupta, A K; Singh, B K; Yadav, M P


    Fifty aborted foetus samples were diagnosed for the presence of equine herpes virus-1 (EHV-1) by polymerase chain reaction (PCR) technique. Specific primer pair for amplification of a particular segment of EHV-1 DNA in gc region having 3 Hae III restriction endonuclease sites was used. A 409 base pair segment obtained as PCR amplification product in 9 samples was digested with Hae III to confirm the presence of EHV-1 as the infectious agent in aborted tissues. It was observed that PCR technique was more sensitive, specific and rapid than the conventional virological diagnostic methods.

  13. Rapid diagnosis of invasive pulmonary aspergillosis by quantitative polymerase chain reaction using bronchial lavage fluid. (United States)

    Kawazu, Masahito; Kanda, Yoshinobu; Goyama, Susumu; Takeshita, Masataka; Nannya, Yasuhito; Niino, Miyuki; Komeno, Yukiko; Nakamoto, Tetsuya; Kurokawa, Mineo; Tsujino, Shiho; Ogawa, Seishi; Aoki, Katsunori; Chiba, Shigeru; Motokura, Toru; Ohishi, Nobuya; Hirai, Hisamaru


    Polymerase chain reaction (PCR) is a sensitive method for detection of Aspergillus DNA in bronchoalveolar lavage fluid, but it has not yet been able to distinguish infection from contamination. We have established a technique to quantify Aspergillus DNA using a real-time PCR method to resolve this problem, and we report herein a successful application of real-time PCR to diagnose invasive pulmonary aspergillosis by comparing the amount of Aspergillus DNA in bronchial lavage fluid from an affected area to that from an unaffected area. This novel tool will provide rapid, sensitive, and specific diagnosis of pulmonary aspergillosis.

  14. Toxocara polymerase chain reaction on ocular fluids in bilateral granulomatous chorioretinitis

    Directory of Open Access Journals (Sweden)

    Tian JX


    Full Text Available Jenny Xue Tian,1 Stephen O’Hagan2 1Ophthalmology Department, Cairns Base Hospital, Cairns, QLD, Australia; 2Ophthalmology, James Cook University, Cairns, QLD, Australia Abstract: To report a rare case of bilateral granulomatous chorioretinitis complicated by bilateral peripapillary choroidal neovascular membranes. This is the first reported case in Australia where intravitreal injections of anti-vascular endothelial growth factor ranibizumab were used to successfully treat choroidal neovascular membrane caused by granulomatous chorioretinitis. This is also the first reported case in Australia of Toxocara polymerase chain reaction being performed on intraocular fluids. Keywords: granulomatous chorioretinitis, ocular toxocariasis, neovascular membrane, anti-VEGF

  15. Low predictive value of polymerase chain reaction for diagnosis of cytomegalovirus disease in liver transplant recipients. (United States)

    Delgado, R; Lumbreras, C; Alba, C; Pedraza, M A; Otero, J R; Gómez, R; Moreno, E; Noriega, A R; Payá, C V


    The polymerase chain reaction (PCR) and viral culture techniques were prospectively compared for the detection of cytomegalovirus (CMV) in blood samples from 24 liver transplant recipients. Nine patients had one or more episodes of viremia, seven of which were clinically symptomatic infections. All samples in which CMV was isolated by culture were positive by the PCR. However, the PCR result was also positive for one or more samples from 11 patients who never developed CMV-related symptoms. Although the PCR is a very sensitive technique for CMV detection in blood samples from liver transplant recipients, it is not useful as a marker of symptomatic CMV disease.

  16. [Detection of leptospirosis reservoirs in Madagascar using the polymerase chain reaction technique]. (United States)

    Ralaiarijaona, R L; Bellenger, E; Chanteau, S; Roger, F; Pérolat, P; Rasolofo Razanamparany, V


    A polymerase chain reaction (PCR) technique was used for detection of the Leptospira interrogans rrs gene in kidney tissue from 115 rats, 50 zebu cattles and 13 pigs in an attempt to identify a possible animal reservoir of leptospirosis in Madagascar. In addition, serological testing of 105 individuals in close contact with animals was carried out. The PCR analysis was negative for all the samples tested and only one person was found seropositive at a low titer. The findings suggest that leptospirosis, if prevalent in Madagascar, is likely rare.

  17. Comparison of proteases in DNA extraction via quantitative polymerase chain reaction. (United States)

    Eychner, Alison M; Lebo, Roberta J; Elkins, Kelly M


    We compared four proteases in the QIAamp DNA Investigator Kit (Qiagen) to extract DNA for use in multiplex polymerase chain reaction (PCR) assays. The aim was to evaluate alternate proteases for improved DNA recovery as compared with proteinase K for forensic, biochemical research, genetic paternity and immigration, and molecular diagnostic purposes. The Quantifiler Kit TaqMan quantitative PCR assay was used to measure the recovery of DNA from human blood, semen, buccal cells, breastmilk, and earwax in addition to low-template samples, including diluted samples, computer keyboard swabs, chewing gum, and cigarette butts. All methods yielded amplifiable DNA from all samples.

  18. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J;


    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  19. Multiplex polymerase chain reaction tests for detection of pathogens associated with gastroenteritis. (United States)

    Zhang, Hongwei; Morrison, Scott; Tang, Yi-Wei


    A wide range of enteric pathogens can cause infectious gastroenteritis. Conventional diagnostic algorithms are time-consuming and often lack sensitivity and specificity. Advances in molecular technology have provided new clinical diagnostic tools. Multiplex polymerase chain reaction (PCR)-based testing has been used in gastroenterology diagnostics in recent years. This article presents a review of recent laboratory-developed multiplex PCR tests and current commercial multiplex gastrointestinal pathogen tests. It focuses on two commercial syndromic multiplex tests: Luminex xTAG Gastrointestinal Pathogen Panel and BioFire FilmArray gastrointestinal test. Multiplex PCR tests have shown superior sensitivity to conventional methods for detection of most pathogens.

  20. Preparative isolation of polymerase chain reaction products using mixed-mode chromatography. (United States)

    Matos, T; Silva, G; Queiroz, J A; Bülow, L


    The polymerase chain reaction (PCR) has become one of the most useful techniques in molecular biology laboratories around the world. The purification of the target DNA product is often challenging, however, and most users are restricted to employing available commercial kits. The recent developments in mixed-mode chromatography have shown higher selectivity for a variety of nucleic acid-containing samples. Capto Adhere is a mixed-mode chromatography resin that offers a high-selectivity ligand and is here applied for the purification of amplified DNAs from PCR mixtures in a 10-min single step, with yields above 95%, high linearity, and high precision for different concentrations.

  1. DNA from oral bacteria by sodium hydroxide-paper method suitable for polymerase chain reaction. (United States)

    Lefimil, Claudia; Lozano, Carla; Morales-Bozo, Irene; Plaza, Anita; Maturana, Cristian; Urzúa, Blanca


    In the oral cavity, we can find a complex mixture of microorganisms, commensals, and pathogens. The studies of normal oral microbiota, as well as the studies of much oral pathology (e.g., caries, periodontitis), involve the isolation and cultivation of these microorganisms and their molecular analysis. The aim of this study was to validate a quick, easy, efficient, and inexpensive DNA extraction method for the recovery of genomic DNA from gram-positive and gram-negative oral bacteria to be used in polymerase chain reaction amplification. This method worked great with all samples analyzed, providing an approach to extract DNA for different microorganisms. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. [Identification of the causative agents of glanders and melioidosis by polymerase chain reaction]. (United States)

    Tkachenko, G A; Antonov, V A; Zamaraev, V S; Iliukhin, V I


    Burkholderia mallei and B. pseudomallei are causative agents of glanders and melioidosis, respectively, i.e. severe and fatal infection diseases of man and animal. The computer-based analysis of the 23S rRNA gene sites was used for selecting the primers. Two pairs of primers were chosen for the identification of B. mallei and Bpseudomallei. DNAs from 48 B. pseudomallei and 15 strains of B. mallei, unlike from other geterological bacteria, were positively amplified. Therefore, the method of polymerase chain reaction can be used in laboratory diagnosis of glanders and melioidosis.

  3. Sex Identification of Red-crowned Crane by the Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    LI Jian-hong; LI Shu-ling; BAO Jun; BAI Xiu-juan


    Sex determining gene primers of Oriental White Stork were used to amplify sex-linked gene of the Red-crowned Crane's W chromosome-specific by PCR for sex identification. The sexes of 7 couples of grown Red-crowned Cranes and 15 youngs were identified. Through DNA sequence analysis, the identity is 94.77% between Red-crowned Crane and Oriental White Stork. The results of this study suggest that the application of the polymerase chain reaction technique is practicable for determining sex in the Red-crowned Crane.

  4. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    DEFF Research Database (Denmark)

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.


    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple...... and efficient method for switching the liquid flow between the PT and PCR chamber. Purification of human genomic DNA from EDTA-treated blood and multiplex PCR were successfully carried out on-chip using the developed lab-on-a-chip system....

  5. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J


    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  6. Diagnostic value of polymerase chain reaction analysis of skin biopsies in purpura fulminans. (United States)

    Beau, Caroline; Vlassova, Natalia; Sarlangue, Jean; Brissaud, Olivier; Léauté-Labrèze, Christine; Boralevi, Franck


    Even though prompt diagnosis and treatment of purpura fulminans (PF) is essential to reduce mortality, early administration of antibiotics may preclude identification of the causative agent by standard bacterial cultures and thus render definitive diagnosis impossible. Here we present a case of an infant with PF and negative bacterial cultures for whom polymerase chain reaction (PCR) analysis of a cutaneous biopsy specimen obtained 4 days after initiation of antibiotics identified the genomic sequence of Neisseria meningitidis genogroup C. When bacterial cultures fail to provide useful information, PCR of skin biopsy specimens can be a valuable diagnostic tool in PF. © 2013 Wiley Periodicals, Inc.

  7. Development and validation of a Myxoma virus real-time polymerase chain reaction assay. (United States)

    Albini, Sarah; Sigrist, Brigitte; Güttinger, Regula; Schelling, Claude; Hoop, Richard K; Vögtlin, Andrea


    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus in fresh and paraffin-embedded rabbit tissues originating from myxomatosis cases from various regions in Switzerland.

  8. Development and validation of a Myxoma virus real-time polymerase chain reaction assay


    Albini, S; Sigrist, B; Guttinger, R; Schelling, C; Hoop, R K; Vogtlin, A


    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus...

  9. Identifiability of parameters and behaviour of MCMC chains: a case study using the reaction norm model. (United States)

    Shariati, M M; Korsgaard, I R; Sorensen, D


    Markov chain Monte Carlo (MCMC) enables fitting complex hierarchical models that may adequately reflect the process of data generation. Some of these models may contain more parameters than can be uniquely inferred from the distribution of the data, causing non-identifiability. The reaction norm model with unknown covariates (RNUC) is a model in which unknown environmental effects can be inferred jointly with the remaining parameters. The problem of identifiability of parameters at the level of the likelihood and the associated behaviour of MCMC chains were discussed using the RNUC as an example. It was shown theoretically that when environmental effects (covariates) are considered as random effects, estimable functions of the fixed effects, (co)variance components and genetic effects are identifiable as well as the environmental effects. When the environmental effects are treated as fixed and there are other fixed factors in the model, the contrasts involving environmental effects, the variance of environmental sensitivities (genetic slopes) and the residual variance are the only identifiable parameters. These different identifiability scenarios were generated by changing the formulation of the model and the structure of the data and the models were then implemented via MCMC. The output of MCMC sampling schemes was interpreted in the light of the theoretical findings. The erratic behaviour of the MCMC chains was shown to be associated with identifiability problems in the likelihood, despite propriety of posterior distributions, achieved by arbitrarily chosen uniform (bounded) priors. In some cases, very long chains were needed before the pattern of behaviour of the chain may signal the existence of problems. The paper serves as a warning concerning the implementation of complex models where identifiability problems can be difficult to detect a priori. We conclude that it would be good practice to experiment with a proposed model and to understand its features

  10. Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

    Directory of Open Access Journals (Sweden)

    Andriani .


    Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

  11. Amplification refractory mutation system polymerase chain reaction versus optimized polymerase chain reaction restriction-fragment length polymorphism for apolipoprotein E genotyping of majorly depressed patients. (United States)

    You, Hongmin; Chen, Jin; Zhou, Jingjing; Huang, Hua; Pan, Junxi; Wang, Ziye; Lv, Lin; Zhang, Lujun; Li, Juan; Qin, Bin; Yang, Yongtao; Xie, Peng


    Major depressive disorder (MDD) is a prevalent, debilitating mood disorder that has been associated with several genetic polymorphisms. One such polymorphism, namely that of apolipoprotein E (APOE), has three allelic forms (ε2, ε3 and ε4) that encode for six unique isoforms of the APOE protein. A growing number of techniques have been developed for APOE genotyping; however, not all polymerase chain reaction (PCR)‑based genotyping techniques are equally accurate or cost‑effective. In order to find a more accurate and cost‑effective APOE genotyping method for MDD screening in large populations, the present study comparatively evaluated two genotyping methods, amplification refractory mutation system PCR (ARMS‑PCR) and optimized PCR restriction‑fragment length polymorphism (PCR‑RFLP), in blood samples taken from a population of 708 MDD patients. Although either of the two methods were able to detect all six unique APOE genotypes, comparisons of the two methods with Sanger sequencing demonstrated that ARMS‑PCR (94%) was significantly more accurate than optimized PCR‑RFLP (82%). ARMS‑PCR should prove useful in quickly verifying ambiguous results obtained by other APOE genotyping methods and can be cost-effectively performed in the setting of a small laboratory or a population-based screening program.

  12. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples. (United States)

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom


    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR.

  13. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana


    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  14. Comparison of a conventional polymerase chain reaction with real-time polymerase chain reaction for the detection of neurotropic viruses in cerebrospinal fluid samples

    Directory of Open Access Journals (Sweden)

    M Ramamurthy


    Full Text Available Purpose : To compare a conventional polymerase chain reaction (PCR and real-time PCR for the detection of neurotropic DNA viruses. Materials and Methods : A total of 147 cerebrospinal fluid (CSF samples was collected from patients attending a tertiary care hospital in South India for a period from 2005 to 2008. All these samples were tested using a conventional multiplex/uniplex PCR and a real-time multiplex/uniplex PCR. This technique was used to detect a large number of herpes viruses responsible for central nervous system infections, including HSV-1, HSV-2, VZV, CMV and EBV and the polyoma virus JCV. Results : Overall, in the entire set of samples, the real-time PCR yielded 88 (59.9% positives and conventional PCR had six (4.1% positives. Conclusion : Our results suggest that the real-time PCR assay was more sensitive compared with the conventional PCR. The advantage of real-time PCR is that it can be performed much faster than conventional PCR. Real-time PCR is less time-consuming, less labour-intensive and also reduces the chance of contamination as there is no post-amplification procedure. In the entire study population, the major viruses detected using real-time PCR were EBV (34%, HSV-2 (10.8% and VZV (6.8%.

  15. Separation-Type Multiplex Polymerase Chain Reaction Chip for Detecting Male Infertility (United States)

    Ha, Seung-Mo; Ju, Jin-Kyoung; Ahn, Yoomin; Hwang, Seung Young


    A novel polymerase chain reaction (PCR) biochip is presented in this paper. In this PCR chip, the glass substrate integrated with the microheater and microsensor is separable from the reaction chamber where the sample is injected, which now makes repeated reuse of the glass substrate possible. The heat transfer efficiency and target gene amplification of the proposed separable PCR chip was compared with that of the conventional united PCR chip. The results showed that the sex-determining Y chromosome (SRY) gene PCR for detecting male infertility was successfully performed in the separable chip. However, repeated multiplex PCR was successful for only two genes, SPGY1 and SRY, but not for gene SY586. Future work is needed for a multiplex PCR with more than three genes.

  16. Absolute rate constants for the reaction of hypochlorous acid with protein side chains and peptide bonds

    DEFF Research Database (Denmark)

    Pattison, D I; Davies, Michael Jonathan


    , absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1......) x s(-1)) > backbone amides (10-10(-3) M(-1) x s(-1)) > Gln(0.03 M(-1) x s(-1)) approximately Asn (0.03 M(-1) x s(-1)). The rate constants for reaction of HOCl with backbone amides (peptide bonds) vary by 4 orders of magnitude with uncharged peptide bonds reacting more readily with HOCl than those...

  17. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    Energy Technology Data Exchange (ETDEWEB)

    Frank F. Roberto


    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  18. Determination of the number of radicals in the initial chain reactions by mathematical methods

    Directory of Open Access Journals (Sweden)

    Pejović Branko B.


    Full Text Available Starting from the fact that the real mechanism in a chemical equation takes places through a certain number of radicals which participate in simultaneous reactions and initiate chain reactions according to a particular pattern, the aim of this study is to determine their number in the first couple of steps of the reaction. Based on this, the numbers of radicals were determined in the general case, in the form of linear difference equations, which, by certain mathematical transformations, were reduced to one equation that satisfies a particular numeric series, entirely defined if its first members are known. The equation obtained was solved by a common method developed in the theory of numeric series, in which its solutions represent the number of radicals in an arbitrary step of the reaction observed, in the analytical form. In the final part of the study, the method was tested and verified using two characteristic examples from general chemistry. The study also gives a suggestion of a more efficient procedure by reducing the difference equation to a lower order.

  19. Multivariate High Order Statistics of Measurements of the Temporal Evolution of Fission Chain-Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Mattingly, J.K.


    The development of high order statistical analyses applied to measurements of the temporal evolution of fission chain-reactions is described. These statistics are derived via application of Bayes' rule to conditional probabilities describing a sequence of events in a fissile system beginning with the initiation of a chain-reaction by source neutrons and ending with counting events in a collection of neutron-sensitive detectors. Two types of initiating neutron sources are considered: (1) a directly observable source introduced by the experimenter (active initiation), and (2) a source that is intrinsic to the system and is not directly observable (passive initiation). The resulting statistics describe the temporal distribution of the population of prompt neutrons in terms of the time-delays between members of a collection (an n-tuplet) of correlated detector counts, that, in turn, may be collectively correlated with a detected active source neutron emission. These developments are a unification and extension of Rossi-a, pulsed neutron, and neutron noise methods, each of which measure the temporal distribution of pairs of correlated events, to produce a method that measures the temporal distribution of n-tuplets of correlated counts of arbitrary dimension n. In general the technique should expand present capabilities in the analysis of neutron counting measurements.


    Directory of Open Access Journals (Sweden)

    Sefrita Tri Utami


    Full Text Available ABSTRACTLeptospirosis is a zoonotic disease, which is caused by leptospira. Leptospirosis cases often show no specificclinical symptoms and is difficult to diagnose without testing samples in the laboratory. Testing using PCR(Polymerase Chain Reaction is considered more accurate than the other methods. Components required in theexamination Leptospira bacteria in human blood samples using PCR method is DNA template, DNA polymeraseenzyme, forward primer (PU1 and SU1 and reverse primer (Lep R1, nuclease free water, Mg 2 +, and dNTPs.Examination of Leptospira bacteria in human blood samples include sampling, DNA isolation, examination byPCR, and electrophoresis running.Key words: leptospirosis, Leptospira, PCR methodsABSTRAKLeptospirosis adalah penyakit zoonosis yang disebabkan oleh bakteri Leptospira. Kasus leptospirosis seringtidak menunjukkan gejala klinis yang spesifik dan sulit didiagnosis tanpa pengujian sampel di laboratorium.Pengujian dengan menggunakan metode PCR (Polymerase Chain Reaction dinilai lebih akurat dibandingkandengan metode yang lain. Komponen-komponen yang dibutuhkan dalam pemeriksaan bakteri Leptospira padasampel darah manusia menggunakan metode PCR adalah DNA template, enzim polymerase, Primer PU 1 danPrimer SU 1, Primer Lep R1, air, Mg2+ , dan dNTP. Pemeriksaan bakteri Leptospira pada sampel darah manusiameliputi pengambilan sampel, isolasi DNA, pemeriksaan dengan metode PCR, dan running elektroforesis.Kata kunci: leptospirosis, Leptospira, metode PCR

  1. Solving the SAT problem using a DNA computing algorithm based on ligase chain reaction. (United States)

    Wang, Xiaolong; Bao, Zhenmin; Hu, Jingjie; Wang, Shi; Zhan, Aibin


    A new DNA computing algorithm based on a ligase chain reaction is demonstrated to solve an SAT problem. The proposed DNA algorithm can solve an n-variable m-clause SAT problem in m steps and the computation time required is O (3m+n). Instead of generating the full-solution DNA library, we start with an empty test tube and then generate solutions that partially satisfy the SAT formula. These partial solutions are then extended step by step by the ligation of new variables using Taq DNA ligase. Correct strands are amplified and false strands are pruned by a ligase chain reaction (LCR) as soon as they fail to satisfy the conditions. If we score and sort the clauses, we can use this algorithm to markedly reduce the number of DNA strands required throughout the computing process. In a computer simulation, the maximum number of DNA strands required was 2(0.48n) when n=50, and the exponent ratio varied inversely with the number of variables n and the clause/variable ratio m/n. This algorithm is highly space-efficient and error-tolerant compared to conventional brute-force searching, and thus can be scaled-up to solve large and hard SAT problems.

  2. Reaction mechanisms in the radiolysis of peptides, polypeptides and proteins II reactions at side-chain loci in model systems

    Energy Technology Data Exchange (ETDEWEB)

    Garrison, W.M.


    The major emphasis in radiation biology at the molecular level has been on the nucleic acid component of the nucleic acid-protein complex because of its primary genetic importance. But there is increasing evidence that radiation damage to the protein component also has important biological implications. Damage to capsid protein now appears to be a major factor in the radiation inactivation of phage and other viruses. And, there is increasing evidence that radiation-chemical change in the protein component of chromation leads to changes in the stability of the repressor-operator complexes involved in gene expression. Knowledge of the radiation chemistry of protein is also of importance in other fields such as the application of radiation sterilization to foods and drugs. Recent findings that a class of compounds, the ..cap alpha..,..cap alpha..'-diaminodicarboxylic acids, not normally present in food proteins, are formed in protein radiolysis is of particular significance since certain of their peptide derivatives have been showing to exhibit immunological activity. The purpose of this review is to bring together and to correlate our present knowledge of products and mechanisms in the radiolysis of peptides, polypeptides and proteins both aqueous and solid-state. In part 1 we presented a discussion of the radiation-induced reactions of the peptide main-chain in model peptide and polypeptide systems. Here in part 2 the emphasis is on the competing radiation chemistry at side-chain loci of peptide derivatives of aliphatic, aromatic-unsaturated and sulfur-containing amino acids in similar systems. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis, and ESR spectroscopy are included.

  3. A study of Hodgkin/Reed-Sternberg cells using single cell polymerase chain reaction. (United States)

    Deng, F; Liao, L; Lü, G; Li, G; Yang, G


    To investigate the characteristics of Hodgkin/Reed-Stemberg (H/R-S) cells found in patients with various types of Hodgkin's disease (HD). H/R-S cells were micropicked from frozen sections of tissues affected by HD. The DNA from these cells was amplified by polymerase chain reaction (PCR) using immunoglobulin heavy chain gene FR III a/JH primers and light chain gene family-specific primers. A total of 52/135 (35.8%) isolated cells showed the specific products in the reactions. IgH and V kappa 4 rearrangements were repeatedly found in many cells from a lymphocyte predominance type sample; repeated V kappa 4 and individual IgH/V kappa 2,4 rearrangements and individual IgH, V lambda 3/ V kappa 4 rearrangements were found in two different cases of the nodular sclerosis type; repeated IgH/ V lambda 3 and individual V lambda 2,4 rearrangements, repeated V kappa 2,4 rearrangements, repeated V kappa 4 and individual IgH/ V kappa 3 rearrangements, repeated IgH and individual V kappa 3/ V lambda 4 rearrangements were detected in 3 cases of the mixed cellularity type. Repeated and individual IgH rearrangements were found in other 2 cases. The H/R-S cells isolated from the lymphocyte predominance subtypes of HD have IgH and V lambda 4 gene rearrangements. This suggests that the lymphocyte predominance type is a proliferation of neoplastic B cells. The cells isolated from the mixed cellularity and nodular sclerosis types derive from B lineage cells at various stages of differentiation because of the presence of their IgH, kappa and/or lambda gene rearrangements. To our knowledge, this is the first time that the lambda gene rearrangement was detected in H/R-S cells.

  4. ISOLASI Campylobacter DARI KARKAS AYAM MENGGUNAKAN METODE KONVENSIONAL DAN POLYMERASE CHAIN REACTIONS [Isolation of Campylobacter from Poultry Carcasses using Conventional and Polymerase Chain Reaction Methods

    Directory of Open Access Journals (Sweden)

    Surachmi Setiyaningsih2


    Full Text Available Campylobacter jejuni and Campylobacter coli are two spesies of Campylobacter sp. frequently found as pathogenic bacteria causing human gastrointestinal infections. Contaminated chicken carcasses have been reported as the source of human campylobacteriosis. In this study, Campylobacter were isolated from chicken carcasses sold in traditional markets and supermarkets. In traditional markets, chicken carcasses are sold without proper packaging or in an open space and stored at room temperature (25-30°C for prolonged period allowing pathogenic bacteria to grow. While at supermarkets, chicken carcasses are openly displayed or enclosed in plastic wrappings and stored in a refrigerator (4-8°C. A total of 298 samples of chicken carcasses from traditional markets and supermarkets in the area of DKI Jakarta, West Java (Bogor and Sukabumi and Central Java (Kudus and Demak were collected. Isolation and identification using conventional and Polymerase Chain Reactions (PCR methods were done to determine the prevalence of C. jejuni and C. coli contamination in poultry. The results showed that chicken carcasses sold in the sampling area, both traditional markets and supermarkets, were contaminated with C. jejuni and C. coli. The contamination rate of Campylobacter sp. in chicken carcasses sold in supermarkets, were 14.1% by conventional methods and 29.5% by PCR. This was higher than those in traditional markets, i.e. 5.7 and 12.1%, respectively. It is also confirmed that the prevalence for contamination of C. jejuni was higher than C. coli in 298 samples, i.e. 16.1% and 3.7% by conventional method and 23.5% and 18.1% by PCR method respectively.

  5. Polymerase chain reaction-mediated characterization of molds belonging to the Aspergillus flavus group and detection of Aspergillus parasiticus in peanut kernels by a multiplex polymerase chain reaction. (United States)

    Chen, Ruey-Shyang; Tsay, Jwu-Guh; Huang, Yu-Fen; Chiou, Robin Y Y


    The Aspergillus flavus group covers species of A. flavus and Aspergillus parasiticus as aflatoxin producers and Aspergillus oryzae and Aspergillus sojae as koji molds. Genetic similarity among these species is high, and aflatoxin production of a culture may be affected by cultivation conditions and substrate composition. Therefore, a polymerase chain reaction (PCR)-mediated method of detecting the aflatoxin-synthesizing genes to indicate the degree of risk a genotype has of being a phenotypic producer was demonstrated. In this study, 19 strains of the A. flavus group, including A. flavus, A. parasiticus, A. oryzae, A. sojae, and one Aspergillus niger, were subjected to PCR testing in an attempt to detect four genes, encoding for norsolorinic acid reductase (nor-1), versicolorin A dehydrogenase (ver-1), sterigmatocystin O-methyltransferase (omt-1), and a regulatory protein (apa-2), involved in aflatoxin biosynthesis. Concurrently, the strains were cultivated in yeast-malt (YM) broth for aflatoxin detection. Fifteen strains were shown to possess the four target DNA fragments. With regard to aflatoxigenicity, all seven aflatoxigenic strains possessed the four DNA fragments, and five strains bearing less than the four DNA fragments did not produce aflatoxin. When peanut kernels were artificially contaminated with A. parasiticus and A. niger for 7 days, the contaminant DNA was extractable from a piece of cotyledon (ca. 100 mg), and when subjected to multiplex PCR testing using the four pairs of primers coding for the above genes, they were successfully detected. The target DNA fragments were detected in the kernels infected with A. parasiticus, and none was detected in the sound (uninoculated) kernels or in the kernels infected with A. niger.

  6. Rapid analysis of rearranged kappa light chain genes of circulating polysaccharide-specific B lymphocytes by means of immunomagnetic beads and the polymerase chain reaction

    DEFF Research Database (Denmark)

    Hougs, L; Barington, T; Madsen, HO


    of the B lymphocytes activated in vivo. Here, we present a method for rapid analysis of the rearranged kappa light chain genes used by human circulating antigen-specific B lymphocytes. After vaccination with Haemophilus influenzae type b capsular polysaccharide (HibCP) conjugated with protein, the Hib......CP-specific B lymphocytes were isolated by antigen-coated immunomagnetic beads. After the purification, at least 98% of the immunoglobulin-secreting recovered cells were HibCP specific. The RNA was isolated and amplified by cDNA synthesis using a kappa constant region primer followed by polymerase chain...... reaction (PCR) using in addition a degenerate kappa light chain signal peptide region primer. The PCR product was cloned into the M13mp18 phage. The cloning efficiency was 100-600 clones/ml of blood. Of the 86 clones sequenced, 90% represented rearranged kappa light chain genes from different antibody...

  7. Rapid analysis of rearranged kappa light chain genes of circulating polysaccharide-specific B lymphocytes by means of immunomagnetic beads and the polymerase chain reaction

    DEFF Research Database (Denmark)

    Hougs, L; Barington, T; Madsen, HO


    reaction (PCR) using in addition a degenerate kappa light chain signal peptide region primer. The PCR product was cloned into the M13mp18 phage. The cloning efficiency was 100-600 clones/ml of blood. Of the 86 clones sequenced, 90% represented rearranged kappa light chain genes from different antibody......CP-specific B lymphocytes were isolated by antigen-coated immunomagnetic beads. After the purification, at least 98% of the immunoglobulin-secreting recovered cells were HibCP specific. The RNA was isolated and amplified by cDNA synthesis using a kappa constant region primer followed by polymerase chain...... of the B lymphocytes activated in vivo. Here, we present a method for rapid analysis of the rearranged kappa light chain genes used by human circulating antigen-specific B lymphocytes. After vaccination with Haemophilus influenzae type b capsular polysaccharide (HibCP) conjugated with protein, the Hib...

  8. Dynamics of interfacial reactions between O(3 P) atoms and long-chain liquid hydrocarbons (United States)

    Allan, Mhairi; Bagot, Paul A. J.; Köhler, Sven P. K.; Reed, Stewart K.; Westacott, Robin E.; Costen, Matthew L.; McKendrick, Kenneth G.


    Recent progress that has been made towards understanding the dynamics of collisions at the gas-liquid interface is summarized briefly. We describe in this context a promising new approach to the experimental study of gas-liquid interfacial reactions that we have introduced. This is based on laser-photolytic production of reactive gas-phase atoms above the liquid surface and laser-spectroscopic probing of the resulting nascent products. This technique is illustrated for reaction of O(3P) atoms at the surface of the long-chain liquid hydrocarbon squalane (2,6,10,15,19,23-hexamethyltetracosane). Laser-induced fluorescence detection of the nascent OH has revealed mechanistically diagnostic correlations between its internal and translational energy distributions. Vibrationally excited OH molecules are able to escape the surface. At least two contributions to the product rotational distributions are identified, confirming and extending previous hypotheses of the participation of both direct and trapping-desorption mechanisms. We speculate briefly on future experimental and theoretical developments that might be necessary to address the many currently unanswered mechanistic questions for this, and other, classes of gas-liquid interfacial reaction.

  9. Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

    Directory of Open Access Journals (Sweden)

    Carla Bertechini Faria


    Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

  10. Identification of aflatoxigenic fungi using polymerase chain reaction-based assay

    Directory of Open Access Journals (Sweden)

    Šošo Vladislava M.


    Full Text Available As the aflatoxins represent a health-risk for humans because of their proven carcinogenicity, food-borne fungi that produce them as secondary metabolites, mainly Aspergillus flavus and Aspergillus parasiticus, have to be isolated and identified. The best argument for identifying problem fungi is that it indicates control points within the food system as part of a hazard analysis critical control point (HACCP approach. This assumes there is a close link between fungus and toxin. Conventional methods for isolation and identification of fungi are time consuming and require admirably dedicated taxonomists. Hence, it is imperative to develop methodologies that are relatively rapid, highly specific and as an alternative to the existing methods. The polymerase chain reaction (PCR facilitates the in vitro amplification of the target sequence. The main advantages of PCR is that organisms need not be cultured, at least not for a long time, prior to their detection, target DNA can be detected even in a complex mixture, no radioactive probes are required, it is rapid, sensitive and highly versatile. The gene afl-2 has been isolated and shown to regulate aflatoxin biosynthesis in A. flavus. Also, the PCR reaction was targeted against aflatoxin synthesis regulatory gene (aflR1 since these genes are nearly identical in A. flavus and A. parasiticus in order to indicate the possibility of detection of both the species with the same PCR system (primers/reaction. [Projekat Ministarstva nauke Republike Srbije, br. III46009

  11. Comparison of analytic methods for quantitative real-time polymerase chain reaction data. (United States)

    Chen, Ping; Huang, Xuelin


    Polymerase chain reaction (PCR) is a laboratory procedure to amplify and simultaneously quantify targeted DNA molecules, and then detect the product of the reaction at the end of all the amplification cycles. A more modern technique, real-time PCR, also known as quantitative PCR (qPCR), detects the product after each cycle of the progressing reaction by applying a specific fluorescence technique. The quantitative methods currently used to analyze qPCR data result in varying levels of estimation quality. This study compares the accuracy and precision of the estimation achieved by eight different models when applied to the same qPCR dataset. Also, the study evaluates a newly introduced data preprocessing approach, the taking-the-difference approach, and compares it to the currently used approach of subtracting the background fluorescence. The taking-the-difference method subtracts the fluorescence in the former cycle from that in the latter cycle to avoid estimating the background fluorescence. The results obtained from the eight models show that taking-the-difference is a better way to preprocess qPCR data compared to the original approach because of a reduction in the background estimation error. The results also show that weighted models are better than non-weighted models, and that the precision of the estimation achieved by the mixed models is slightly better than that achieved by the linear regression models.

  12. Construction of an antimyoglobin single-chain variable fragment with rapid reaction kinetics. (United States)

    Jang, Jun-Hyuck; Kim, Dong-Hyung; Paek, Se-Hwan; Woo, Eui-Jeon; Kim, Young-Wan


    Antibodies with rapid reaction kinetics (high association and dissociation rates), named reversible antibodies, are used to perform continuous monitoring of sensitive disease biomarkers. In cases of acute myocardial infarction (AMI), continuous monitoring and early diagnosis are important. Human myoglobin (Myo) is a useful biomarker for AMI during the early stage after the onset of symptoms. In this study, a single-chain variable fragment (scFv) specific to Myo was derived from an IgG antibody that has rapid reaction kinetics. Enzyme-linked immunosorbent assay revealed that recombinant scFv exhibited 3.8-fold reduced affinity compared with the parent IgG antibody based on the antibody concentration necessary for 50% of the maximum signal. The scFv retained the rapid reaction kinetic mode with average kon and koff of 2.63 × 10(5) M(-1) Sec(-1) and 3.25 × 10(-3) Sec(-1) , respectively, which were reduced to 10- and 2.3-fold compared with those of the parent antibody. The equilibrium constant for the association of the scFv (KA = 8.09 × 10(7) M(-1) ) was 4.6-fold lower than that of its parent IgG antibody. This scFv may be a starting point for further mutagenesis/kinetic and structural analyses providing valuable insight into the mechanism of reversible antibodies.

  13. Analysis of ligase chain reaction products amplified in a silicon-glass chip using capillary electrophoresis. (United States)

    Cheng, J; Shoffner, M A; Mitchelson, K R; Kricka, L J; Wilding, P


    Ligase chain reaction (LCR) is a useful molecular technique for detecting known point mutations. We report the first example of the use of a disposable silicon-glass micro-chip for LCR and the first application of capillary electrophoresis (CE) to analyze samples amplified by LCR in a chip. Silicon-glass chips were manufactured using conventional photolithography and anodic bonding. The chips provide three distinct advantages for LCR: excellent thermal conductivity, a micro reaction volume ( < 10 microliters), and reproducible, low-cost manufacturing. Investigation and quantitation of amplification efficiency of LCR in a chip or in a tube requires an analytical technique that is faster and more convenient than the conventional slab gel methods. Slab gel electrophoresis uses relatively large amounts of sample and is labor-intensive and time-consuming, and thus is unsuitable for the separation and detection of LCR products. In contrast CE requires sample volume (original LCR products) of less than 1 microliter and is therefore well-suited to analysis of the micro-volume reaction mixture from chips. We combined CE with a sensitive laser induced fluorescence (LIF) detection system for the rapid separation and quantitative detection of LCR products amplified from the lacI gene in a silicon-glass chip. Comparative studies were made with LCR between tubes and silicon-glass chips. CE-LIF analysis is ideally suited to examination of micro-LCR amplification with high throughput. The technologies may find medical uses in disease diagnosis and research.

  14. High-throughput Procedure for Single Pollen Grain Collection and Polymerase Chain Reaction in Plants

    Institute of Scientific and Technical Information of China (English)

    Ping-Hua Chen; Yong-Bao Pan; Ru-Kai Chen


    Single pollen grain polymersse chain reaction (PCR) has succeeded in several species, however only limited numbers of pollen grains were involved due to difficulties in pollen isolation and lysis. This has limited its application in genetic analysis and mapping studies in plants. A high-throughput (HT) procedure for collecting and detecting genetic variation in a large number of individual pollen grains by PCR is reported. The HT procedure involved the collection of Individual pollen grains by a pair of special forceps and the lysis of pollen grains in a heated alkali/detergent solution followed by neutralization with a tris-ethylenediamine tetraacetic acid (TE) buffer. These resulting template solutions yielded PCR reactions involving the 5S ribosomal RNA intergenic spacers, randomly amplified polymorphic DNA, and simple sequence repeats markers. Using this procedure, one person with experience could collect and process up to 288 single pollen grain PCR reactions per day. The method worked well on sugarcane, corn, Miscanthus spp., snap bean, sorghum, and tomato. The ability to collect and conduct PCR on individual pollen grains on a large scale offers a new approach to genetic analyses and mapping studies in an easily controllable environment with a considerable cost reduction. The method will also significantly benefit studies in species that are difficult subjects for classical genetic research.

  15. Validity of the polymerase chain reaction in the diagnosis of clinically suspected cases of American visceral leishmaniasis. (United States)

    Pedrosa, Celia Maria Silva; Ximenes, Ricardo Arraes de Alencar; Almeida, Wendell Alexandre Pinheiro de; Rocha, Eliana Maria Mauricio da


    To test the validity of the polymerase chain reaction for diagnosing American visceral leishmaniasis, 88 suspected cases were studied. Diagnosis was confirmed in 47 (53.5%) and ruled out in 41 (46.5%) patients. Samples of bone marrow and peripheral blood were processed by polymerase chain reaction to evaluate the sensitivity and specificity of the test and its agreement beyond chance with microscopy examination. The polymerase chain reaction was positive in bone marrow of 100% of the patients with amastigotes seen with microscopy examination, and in 59.5% in those where no parasite were seen. Agreement beyond chance between visualization of the parasite in bone marrow aspirates and polymerase chain reaction was considered weak (Kappa=0.41). Concordance between polymerase chain reaction of bone marrow aspirates and of peripheral blood was considered excellent (Kappa=0.88). The test turned out positive in all bone marrow aspirates of those with the disease and whereas the positivity rate was 58.5% among those without the disease, with specificity rate of 41.5%.

  16. DNA Polymer Brush Patterning through Photocontrollable Surface-Initiated DNA Hybridization Chain Reaction. (United States)

    Huang, Fujian; Zhou, Xiang; Yao, Dongbao; Xiao, Shiyan; Liang, Haojun


    The fabrication of DNA polymer brushes with spatial resolution onto a solid surface is a crucial step for biochip research and related applications, cell-free gene expression study, and even artificial cell fabrication. Here, for the first time, a DNA polymer brush patterning method is reported based on the photoactivation of an ortho-nitrobenzyl linker-embedded DNA hairpin structure and a subsequent surface-initiated DNA hybridization chain reaction (HCR). Inert DNA hairpins are exposed to ultraviolet light irradiation to generate DNA duplexes with two active sticky ends (toeholds) in a programmable manner. These activated DNA duplexes can initiate DNA HCR to generate multifunctional patterned DNA polymer brushes with complex geometrical shapes. Different multifunctional DNA polymer brush patterns can be fabricated on certain areas of the same solid surface using this method. Moreover, the patterned DNA brush surface can be used to capture target molecules in a desired manner.

  17. Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Radji, M.


    Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

  18. Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cesare Bonacina


    Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

  19. Polymerase chain reaction detection of potentially pathogenic free-living amoebae in dental units. (United States)

    Leduc, Annie; Gravel, Sabrina; Abikhzer, Jérémie; Roy, Stéphane; Barbeau, Jean


    Several genera of amoebae can be found in water from dental units and on the inner surface of waterlines. The presence of bacterial biofilms on these surfaces is thought to favor the proliferation of amoebae. Potentially pathogenic Acanthamoeba and Naegleria spp. may be an infection risk for patients through contact with open surgical sites or aerosolization. A polymerase chain reaction of DNA extracted from pelleted samples showed that Acanthamoeba spp. and Naegleria spp. were present in water from dental units, suction lines, and suction filters at the dental clinic of the Université de Montréal. Acanthamoeba spp. were detected in 24.2% of 66 samples and Naegleria spp. in 3.0%. We discuss the infection risk associated with these results.

  20. Specific and sensitive detection of Trichomonas tenax by the polymerase chain reaction. (United States)

    Kikuta, N; Yamamoto, A; Fukura, K; Goto, N


    A polymerase chain reaction (PCR) protocol was developed for specific detection of Trichomonas tenax by using a pair of primers designed for its 18S rRNA gene. The detection was specific for T. tenax, since no amplification was detected with DNAs from Trichomonas vaginalis, which belongs to the same genus as T. tenax, in addition to various species of oral protists, fungi and bacteria, and human leukocytes. This method had a detection limit of 100 fg for T. tenax genomic DNA and could detect T. tenax cells in dental plaque at a concentration of as low as 5 cells per PCR mixture. Direct detection from clinical dental plaque samples was also possible; therefore, the present PCR procedure could provide a simple and rapid detection method of T. tenax in dental plaque.

  1. Genotypic study of verocytotoxic Escherichia coli isolates from deer by multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Raghavendra Prasad Mishra


    Full Text Available Aim: This study was planned to study the genotypes of verocytotoxigenic Escherichia coli (VTEC in fecal samples of deer due to its public health significance. Materials and Methods: A total of 160 fecal samples of deer were taken from Mathura district and Kanpur Zoo and screened for VTEC genes by polymerase chain reaction (PCR. Results: All fecal samples were positive for E. coli. All the E. coli isolates were screened by PCR to detect virulence genes stx1, stx2, eaeA, and hlyA. Of these, 15 isolates were found positive for VTEC having one or more genes in different combinations. Conclusion: Genes such as stx1, stx2, eaeA, and hlyA were prevalent in VTEC isolates from feces of deer. The presence of VTEC isolates having virulent genes may pose a threat to public health.

  2. Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals

    Directory of Open Access Journals (Sweden)

    Mayara C. Lombardi


    Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.

  3. Acanthamoeba can be differentiated by the polymerase chain reaction and simple plating assays. (United States)

    Khan, N A; Jarroll, E L; Paget, T A


    Acanthamoeba are opportunistic pathogens with invasive and noninvasive species. For clinical purposes it is important to differentiate potentially pathogenic from nonpathogenic isolates. For the rapid and sensitive identification of Acanthamoeba at the genus level, we used a polymerase chain reaction (PCR)-based method which detected as few as five cells. Further, we tested nine isolates of Acanthamoeba for their ability to produce cytopathic effects (CPE) on corneal epithelial cells. On the basis of the results, Acanthamoeba were divided into pathogenic or nonpathogenic groups. However, because CPE assays are not available to every diagnostic laboratory, we developed a simple plating assay based on osmotolerance which correlated well with the CPE assays. Pathogenic Acanthamoeba showed growth on higher osmolarity (agar plates containing one molar mannitol), while growth of nonpathogens was inhibited on these plates. In conclusion, we have developed methods for the rapid identification and differentiation of Acanthamoeba.

  4. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction. (United States)

    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P


    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate produced very poor yields, while boiling produced 20% as much DNA as long enzyme digestion. DNA extracted by these methods was suitable for the PCR amplification of a single copy gene. Proteinase K digestion also produced considerable amounts of RNA which has previously been shown to be suitable for PCR analysis. A delay before fixation had no effect on the amount of DNA obtained while fixation in Carnoy's reagent results in a much better preservation of DNA than formalin fixation, allowing greater yields to be extracted.

  5. Treponema pallidum and Haemophilus ducreyi DNA detection by A Multi-Nested Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    郑和平; SylviaBruisten; 何玉山; 黄进梅; 吴兴中


    Objectives: To develop a multi-nested polymerase chain reaction in an assay to detect early Treponema pallidum and Haemophilus ducreyi DNA in the swabs of genital ulcers. Methods: Four pairs of outer and inner primers, specific to the basic membrane protein gene of Treponema pallidum and to the 16s rRNA gene of H ducreyi were synthesized. The multi-nested PCR was developed and applied to detect Treponema pallidum and Haemophilus dicreyi in clinical swabs. Result: The two samples of standard strains of Haemophilus ducreyi and one Treponema pallidum were amplified and showed 309-bp rRNA gene of Haemophilus ducreyi and 506-bp DNA of Treponema palidum, respectively. Out of 51 samples of genital ulcer detected, 29 showed Treponemapallidum positive product and noHaemophilus ducreyi DNA was found. Conclusion: The multi-nested PCR for Treponema pallidum and Haemophilus ducreyi could be useful for early detection and distinguishing diagnosis between syphilis and chancroid.

  6. Diagnosis of Progressive Spinal Muscular Atrophy by Using Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    姚娟; 丁新生; 陈克连; 程虹; 邓晓萱; 沈鸣九; 王颖


    Objective To understand the deletion in the survival motor neuron gene (SMN) of childhood-onset spinal muscular atrophy (SMA) in Chinese, and the value of diagnosis of SMA using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP)method. Methods Deletions of SMN gene of exon 7 and 8 in 10 cases of presumed SMA, and 20 normal controls from 6 families and 30 unrelated controls were performed by PCR-RFLP analysis. Results Deletions of SMN gene detected in 9 of 10 (90%) cases of presumed SMA . No deletions of SMN in the telomere were found in the other members of families and controls.Conclusion PCR-RFLP is a sensitive, specific and simple method in diagnosis of SMA.

  7. Polymerase chain reaction-based assays for the diagnosis of human brucellosis. (United States)

    Wang, Ying; Wang, Zhanli; Zhang, Yaxian; Bai, Liyun; Zhao, Yue; Liu, Chunfang; Ma, An; Yu, Hui


    Polymerase chain reaction (PCR) is an in vitro technique for the nucleic acid amplification, which is commonly used to diagnose infectious diseases. The use of PCR for pathogens detection, genotyping and quantification has some advantages, such as high sensitivity, high specificity, reproducibility and technical ease. Brucellosis is a common zoonosis caused by Brucella spp., which still remains as a major health problem in many developing countries around the world. The direct culture and immunohistochemistry can be used for detecting infection with Brucella spp. However, PCR has the potential to address limitations of these methods. PCR are now one of the most useful assays for the diagnosis in human brucellosis. The aim of this review was to summarize the main PCR techniques and their applications for diagnosis and follow-up of patients with brucellosis. Moreover, advantages or limitation of the different PCR methods as well as the evaluation of PCR results for treatment and follow-up of human brucellosis were also discussed.

  8. Validation study of HPV DNA detection from stained FNA smears by polymerase chain reaction

    DEFF Research Database (Denmark)

    Channir, Hani Ibrahim; Grønhøj Larsen, Christian; Ahlborn, Lise Barlebo;


    BACKGROUND: Human papillomavirus (HPV)-related oropharyngeal squamous cell carcinoma (OPSCC) often presents with cystic cervical metastasis and a small primary tumor localized in the palatine tonsils or base of the tongue, which is diagnostically challenging. Testing for HPV DNA in fine......-needle aspiration (FNA) smears from metastases may facilitate a targeted diagnostic workup for identifying the primary tumor. This study was designed to assess the ability to detect HPV DNA in FNA smears with polymerase chain reaction (PCR). METHODS: May-Grünvald-Giemsa (MGG)-stained FNA smears from metastases...... and corresponding surgical specimens were collected from 71 patients with known HPV-positive OPSCC, 12 patients with oral squamous cell carcinoma (OSCC), 20 patients with branchial cleft cysts, and 20 patients with Warthin tumors. Thirty-eight patients with OPSCC and 7 patients with OSCC had FNA smears available...

  9. The polymerase chain reaction and its application to clinical plastic surgery.

    LENUS (Irish Health Repository)

    Rea, S


    Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.

  10. Detection of Fasciola gigantica infection in snails by polymerase chain reaction. (United States)

    Velusamy, R; Singh, B P; Raina, O K


    Polymerase chain reaction (PCR) was used to detect Fasciola gigantica infection in the snail intermediate host. Fasciola specific primers amplified a 124 bp fragment in PCR when the genomic DNA isolated from F. gigantica infected Lymnaea auricularia snails was used as template. In addition to the 124 bp amplicon, a ladder of DNA fragments representing amplification of the 124 bp repetitive sequences was observed. Genomic DNA of the parasite was used as a positive control, which also gave an amplification of the 124 bp fragment. DNA isolated from non-infected snails was used as a negative control and no amplification of this sequence was observed. This technique is highly specific and sensitive and possesses fairly good prospects of its utility as an epidemiological tool for ascertaining the infectivity status in ubiquitous snail populations.

  11. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur P


    Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  12. Repetitive sequence based polymerase chain reaction to differentiate close bacteria strains in acidic sites

    Institute of Scientific and Technical Information of China (English)

    XIE Ming; YIN Hua-qun; LIU Yi; LIU Jie; LIU Xue-duan


    To study the diversity of bacteria strains newly isolated from several acid mine drainage(AMD) sites in China,repetitive sequence based polymerase chain reaction (rep-PCR),a well established technology for diversity analysis of closely related bacteria strains,was conducted on 30 strains of bacteria Leptospirillum ferriphilium,8 strains of bacteria Acidithiobacillus ferrooxidans,as well as the Acidithiobacillus ferrooxidans type strain ATCC (American Type Culture Collection) 23270.The results showed that,using ERIC and BOX primer sets,rep-PCR produced highly discriminatory banding patterns.Phylogenetic analysis based on ERIC-PCR banding types was made and the results indicated that rep-PCR could be used as a rapid and highly discriminatory screening technique in studying bacterial diversity,especially in differentiating bacteria within one species in AMD.

  13. A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction (United States)

    Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng


    In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples.

  14. Quantitative Profiling of Long-Chain Bases by Mass Tagging and Parallel Reaction Monitoring

    DEFF Research Database (Denmark)

    Ejsing, Christer S; Bilgin, Mesut; Fabregat, Andreu


    Long-chain bases (LCBs) are both intermediates in sphingolipid metabolism and potent signaling molecules that control cellular processes. To understand how regulation of sphingolipid metabolism and levels of individual LCB species impinge upon physiological and pathophysiological processes requires...... sensitive and specific assays for monitoring these molecules. Here we describe a shotgun lipidomics method for quantitative profiling of LCB molecules. The method employs a "mass-tag" strategy where LCBs are chemically derivatized with deuterated methyliodide (CD3I) to produce trimethylated derivatives...... having a positively charged quaternary amine group. This chemical derivatization minimizes unwanted in-source fragmentation of LCB analytes and prompts a characteristic trimethylaminium fragment ion that enables sensitive and quantitative profiling of LCB molecules by parallel reaction monitoring...

  15. Gene analysis of multiple oral bacteria by the polymerase chain reaction coupled with capillary polymer electrophoresis. (United States)

    Liu, Chenchen; Yamaguchi, Yoshinori; Sekine, Shinichi; Ni, Yi; Li, Zhenqing; Zhu, Xifang; Dou, Xiaoming


    Capillary polymer electrophoresis is identified as a promising technology for the analysis of DNA from bacteria, virus and cell samples. In this paper, we propose an innovative capillary polymer electrophoresis protocol for the quantification of polymerase chain reaction products. The internal standard method was modified and applied to capillary polymer electrophoresis. The precision of our modified internal standard protocol was evaluated by measuring the relative standard deviation of intermediate capillary polymer electrophoresis experiments. Results showed that the relative standard deviation was reduced from 12.4-15.1 to 0.6-2.3%. Linear regression tests were also implemented to validate our protocol. The modified internal standard method showed good linearity and robust properties. Finally, the ease of our method was illustrated by analyzing a real clinical oral sample using a one-run capillary polymer electrophoresis experiment.

  16. Epidemiological Investigation of Salmonella Tilene by Pulsed-Field Gel Electrophoresis and Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Chandar M Anand


    Full Text Available Pulsed-field gel electrophoresis (PFGE and DNA fingerprinting by the polymerase chain reaction (PCR were performed on 11 isolates of Salmonella tilene. Five strains were from a cluster of human patients, six from sugar gliders and pygmy hedgehogs kept as family pets or from local pet retailers, and one isolate from the first North American case of S tilene described in Washington State in 1994. The PFGE restriction patterns showed all isolates to be similar. However, PCR using primers to the 16S and 23S rRNA genes of Escherichia coli demonstrated that the Washington State isolate differed from the rest of the other isolates, which were all similar based upon their DNA fingerprint. This study indicates that reliance on one technique alone may be insufficient to show nuances between strains that are, in many respects, closely related.

  17. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats (United States)

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.


    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  18. Total chemical synthesis of a thermostable enzyme capable of polymerase chain reaction. (United States)

    Xu, Weiliang; Jiang, Wenjun; Wang, Jiaxing; Yu, Linping; Chen, Ji; Liu, Xianyu; Liu, Lei; Zhu, Ting F


    Polymerase chain reaction (PCR) has been a defining tool in modern biology. Towards realizing mirror-image PCR, we have designed and chemically synthesized a mutant version of the 352-residue thermostable Sulfolobus solfataricus P2 DNA polymerase IV with l-amino acids and tested its PCR activity biochemically. To the best of our knowledge, this enzyme is the largest chemically synthesized protein reported to date. We show that with optimization of PCR conditions, the fully synthetic polymerase is capable of amplifying template sequences of up to 1.5 kb. The establishment of this synthetic route for chemically synthesizing DNA polymerase IV is a stepping stone towards building a d-enzyme system for mirror-image PCR, which may open up an avenue for the creation of many mirror-image molecular tools such as mirror-image systematic evolution of ligands by exponential enrichment.

  19. An improved electrochemiluminescence polymerase chain reaction method for the detection of Fusarium wilts

    Institute of Scientific and Technical Information of China (English)

    Jie Wei; Xiao Ming Zhou


    An improved electrochemiluminescence polymerase chain reaction (ECL-PCR) method was developed and applied to detect Fusarium wilt. Briefly, the internal transcribed spacer (ITS) sequence of Fusarium oxysporum f. sp Cubense (FOC) was amplified by PCR. Two universal fragments, which were complimentary to Ru(bpy)32+ (TBR) labeled probe and Biotin labeled probe, respectively, were connected to the tail of primers so that all the PCR products got universal sequences. Then biotin labeled probes and TBR labeled probes were hybridized with the PCR products at the same time. Through the specific interaction between biotin and streptavidin, the PCR products were captured by streptavidin coated magnetic bead and then detected by ECL assay. The experiment results showed that the healthy banana samples and infected ones can be discriminated by this ECL-PCR method. This improved ECL-PCR approach is useful in Fusarium wilt detection due to its high sensitivity, simplicity and stability.

  20. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting (United States)

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.


    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  1. Use of polymerase chain reaction (PCR for detection of Chlamydia trachomatis infection in cervical swab samples

    Directory of Open Access Journals (Sweden)

    Mania-Pramanik Jayanti


    Full Text Available A polymerase chain reaction (PCR based method has been set up for detection of Chlamydia trachomatis (C. trachomatis infection in single cervical swab samples. A primer pair specific to the major outer membrane protein (MOMP gene common to all serotypes of C. trachomatis was used. This method was validated for its sensitivity as well as specificity. A minimum Ing of DNA could be used for detection of the infection. Specificity of the method was confirmed by carrying out a sample dilution curve. The cervical swab samples analysed in the present study were in coded form for validation of the PCR with an established commercial ELISA (Chlamydiazyme. Both the sensitivity and specificity of PCR was 100% when the ELISA results of these samples were decoded. Thus, this PCR technique could be used for better diagnosis of C. trachomatis infection in comparison to the commercially available ELISA technique.

  2. A Micro Polymerase Chain Reaction Module for Integrated and Portable DNA Analysis Systems

    Directory of Open Access Journals (Sweden)

    Elisa Morganti


    Full Text Available This work deals with the design, fabrication, and thermal characterization of a disposable miniaturized Polymerase Chain Reaction (PCR module that will be integrated in a portable and fast DNA analysis system. It is composed of two independent parts: a silicon substrate with embedded heater and thermometers and a PDMS (PolyDiMethylSiloxane chamber reactor as disposable element; the contact between the two parts is assured by a mechanical clamping obtained using a Plastic Leaded Chip Carrier (PLCC. This PLCC is also useful, avoid the PCR mix evaporation during the thermal cycles. Finite Element Analysis was used to evaluate the thermal requirements of the device. The thermal behaviour of the device was characterized revealing that the temperature can be controlled with a precision of ±0.5°C. Different concentrations of carbon nanopowder were mixed to the PDMS curing agent in order to increase the PDMS thermal conductivity and so the temperature control accuracy.

  3. Polymerase Chain Reaction Identification of a Hymenopteran Insect in the Cornea: a Case Report

    Directory of Open Access Journals (Sweden)

    Hsien-Chung Lin


    Full Text Available The type of corneal injuries associated with insect encounters is related to the composition of the foreign body. However, previous reports on corneal foreign bodies as insects were rarely based on scientific evidence. Here, we report on a 49-year-old male who was stung in his left eye by an unknown insect. Emergent keratotomy was performed to remove the embedded corneal foreign body. The removed foreign body was observed under light microscopy, and a fragment of insect was suspected. The sample was sent for molecular analysis. The polymerase chain reaction product was sequenced, subjected to a BLAST search, and identified as an ichneumonoid member of the insect order Hymenoptera.

  4. Quantitative Analysis of Periodontal Pathogens Using Real-Time Polymerase Chain Reaction (PCR). (United States)

    Marin, Mª José; Figuero, Elena; Herrera, David; Sanz, Mariano


    The quantitative polymerase chain reaction (qPCR) is a variant of PCR aimed to detect and quantify a targeted DNA molecule through the addition of probes labeled with fluorescent molecules that emit fluorescence within each amplification cycle, what results in fluorescence values proportional to the amount of accumulated PCR product. This chapter presents the detailed procedures for quantification of different periodontal pathogens (Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, Tannerella forsythia, Campylobacter rectus, and Fusobacterium spp.) using qPCR. It also includes the description of the most frequent problems encountered and how to solve them. In addition, a detailed protocol for multiplex qPCR to detect and quantify P. gingivalis and A. actinomycetemcomitans is included.

  5. Thermostable Mismatch-Recognizing Protein MutS Suppresses Nonspecific Amplification during Polymerase Chain Reaction (PCR) (United States)

    Fukui, Kenji; Bessho, Yoshitaka; Shimada, Atsuhiro; Yokoyama, Shigeyuki; Kuramitsu, Seiki


    Polymerase chain reaction (PCR)-related technologies are hampered mainly by two types of error: nonspecific amplification and DNA polymerase-generated mutations. Here, we report that both errors can be suppressed by the addition of a DNA mismatch-recognizing protein, MutS, from a thermophilic bacterium. Although it had been expected that MutS has a potential to suppress polymerase-generated mutations, we unexpectedly found that it also reduced nonspecific amplification. On the basis of this finding, we propose that MutS binds a mismatched primer-template complex, thereby preventing the approach of DNA polymerase to the 3′ end of the primer. Our simple methodology improves the efficiency and accuracy of DNA amplification and should therefore benefit various PCR-based applications, ranging from basic biological research to applied medical science. PMID:23519109

  6. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing. (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo


    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%.

  7. Detection of Trypanosoma cruzi DNA within murine cardiac tissue sections by in situ polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Joshua E Lane


    Full Text Available The use of in situ techniques to detect DNA and RNA sequences has proven to be an invaluable technique with paraffin-embedded tissue. Advances in non-radioactive detection systems have further made these procedures shorter and safer. We report the detection of Trypanosoma cruzi, the causative agent of Chagas disease, via indirect and direct in situ polymerace chain reaction within paraffin-embedded murine cardiac tissue sections. The presence of three T. cruzi specific DNA sequences were evaluated: a 122 base pair (bp sequence localized within the minicircle network, a 188 bp satellite nuclear repetitive sequence and a 177 bp sequence that codes for a flagellar protein. In situ hybridization alone was sensitive enough to detect all three T. cruzi specific DNA sequences.

  8. A simple multiplex polymerase chain reaction to determine ABO blood types of rhesus macaques (Macaca mulatta). (United States)

    Premasuthan, A; Kanthaswamy, S; Satkoski, J; Smith, D G


    Rhesus macaques are the most common nonhuman primate model organism used in biomedical research. Their increasingly frequent use as subjects in studies involving transplantation requires that blood and other tissue antigens of donors and recipients be compatible. We report here an easy and rapid multiplex polymerase chain reaction (PCR) to determine the ABO blood group phenotypes of rhesus macaques that can be performed with only small amounts of DNA. We phenotyped 78 individuals and found this species to exhibit the A, B and AB phenotypes in frequencies that vary by geographic region. The probability of randomly pairing rhesus macaque donors and recipients that exhibit major ABO phenotype incompatibility is approximately 0.35 and 0.45 for Indian and Chinese rhesus macaques, respectively.

  9. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots (United States)

    Liang, Gaofeng; Ma, Chao; Zhu, Yanliang; Li, Shuchun; Shao, Youhua; Wang, Yong; Xiao, Zhongdang


    Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR). Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase concentration or by adding bovine serum albumin (BSA). The mechanisms underlying these effects were also discussed. The results indicated that CdTe QDs could be used to optimize the amplification products of the PCR, especially in the multi-PCR system with different primers annealing temperatures, which is of great significance for molecular diagnosis.

  10. Prevalence of Dirofilaria immitis infection in dogs from Celestun, Mexico, using polymerase chain reaction test. (United States)

    Caro-Gonzalez, Johny Antonio; Bolio-Gonzalez, Manuel Emilio; Escobedo-Ortegón, Francisco Javier; Manrique-Saide, Pablo; Rodriguez-Vivas, Roger Ivan; Rodriguez-Buenfil, Jorge Carlos; Sauri-Arceo, Carlos Humberto


    The aim of this study was to determine the prevalence of Dirofilaria immitis in dogs and to analyze risk factors associated with infection at Celestun, a coastal locality in southeast Mexico. Blood samples were collected from 279 asymptomatic individuals between August 2007 and March 2008 and analyzed by polymerase chain reaction technique. The association between D. immitis infection and sex, age group, and distance of residence from a wetland of dogs was statistically analyzed. Prevalence of D. immitis infection was of 59.8%. Age of individuals (>2 years) was a risk factor for infection with D. immitis (odds ratio 2.49, confidence interval 1.47-4.23, p=0.001). In conclusion, Celestun can be considered a focus of D. immitis infection with high levels of transmission among the local dog population, as confirmed by the high prevalence reported and the association of age (dogs >2 years) as a risk associated with infection.

  11. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur R


    Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  12. Detection of Helicobactor pylori by polymerase chain reaction: A comparison in sample preparation

    Directory of Open Access Journals (Sweden)

    Murugesan R


    Full Text Available Gastric biopsy samples obtained from 14 patients with upper abdominal pain, clinically diagnosed as acid peptic disease, were analysed for the presence of Helicobacter pylori (H. pylori by Polymerase Chain Reaction (PCR using partially (template A and completely purified DNA (template B. Antigen specific primer was used to analyse the sample by PCR method. The presence of H. pylori in the samples was confirmed by running a positive control. The presence of H. pylori was also detected by urease method using standard protocol. Among the 14 samples studied, 8 showed the presence of H. pylori with both templates A and B. Among these 8 samples only 3 showed positive for the presence of H. pylori with urease method. The present work discusses the results obtained in the detection of H. pylori in template A and B by PCR method.

  13. Discrepancies between Antigen and Polymerase Chain Reaction Tests for the Detection of Rotavirus and Norovirus. (United States)

    Kim, Hyun Soo; Kim, Jae-Seok


    We compared the results of an antigen test (ELISA) with those of polymerase chain reaction (PCR) for the detection of rotavirus and norovirus in stool specimens. Rotavirus and norovirus antigen-positive stool specimens were collected, and rotavirus and norovirus PCRs were performed on these specimens. Of the 325 rotavirus antigen-positive specimens, 200 were positive for both assays and 125 were PCR negative. Of 286 norovirus antigen-positive specimens, 51 were PCR negative. Comparison of the lower limit of detection showed that rotavirus PCR was 16 times more sensitive and norovirus PCR was over 4,000 times more sensitive than the ELISA. Discrepant results between ELISA and PCR were common, and the possibility of false-positive and false-negative results should be considered with rotavirus and norovirus assays.

  14. Detection of gonorrhea among HIV infected patients by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Pragya Poudel


    Full Text Available Objective: To determine the burden of gonorrhea among HIV patients using PCR technique. Methods: A cross sectional study was carried out in a HIV clinic of Sparsha Nepal from January to March, 2011. Standard microbiological procedures were followed during collection and processing of urine samples. DNA amplification, isolation and detection were carried out. Gonorrhoea diagnosis was done by multiplex polymerase chain reaction. Results: Among the 119 HIV positive patients, 12 (10.08% were positive for N. gonorrheae. The cases were more among the males than in females. The age of patients ranged from 20- 45 years and the highest prevalence was among the age group 20-35 years. The distribution of gonorrhea infected patients according to marital status revealed that 8 cases were among the married patients. Conclusions: This study revealed that the incidence of gonorrhoea was higher in males and in married people. So, the control measures should be targeted to these groups of people.

  15. Chain reaction. History of the atomic bomb; Kettenreaktion. Die Geschichte der Atombombe

    Energy Technology Data Exchange (ETDEWEB)

    Mania, Hubert


    Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

  16. Polymerase chain reaction of Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia in primary endodontic infections. (United States)

    Gomes, Brenda P F A; Montagner, Francisco; Jacinto, Rogério Castilho; Zaia, Alexandre A; Ferraz, Caio Cezar Randi; Souza-Filho, Francisco J


    The aim of this study was to investigate the correlation between endodontic clinical signs and symptoms and the presence of Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia or their association by nested polymerase chain reaction assay. Microbial samples were taken from 50 cases with necrotic pulp tissues in primary infections. DNA was extracted from the samples, which were analyzed for the presence of three endodontic pathogens by using species-specific primers. P gingivalis, T denticola, and T forsythia were detected in 46%, 38%, and 22% of the symptomatic cases, respectively. The bacterial complex composed by T forsythia, P gingivalis, and T denticola was found in 14% of the cases with spontaneous pain, tenderness to percussion, swelling, and pain on palpation. The high prevalence of P gingivalis, T denticola, and T forsythia in the samples examined suggests that these bacteria are related to the etiology of symptomatic periradicular diseases.

  17. Detection of PERV by polymerase chain reaction and its safety in bioartificial liver support system

    Institute of Scientific and Technical Information of China (English)

    Hai-Hui Wang; Ying-Jie Wang; Hong-Ling Liu; Jun Liu; Yan-Ping Huang; Hai-Tao Guo; Yu-Ming Wang


    AIM: To establish a method detecting porcine endogenous retrovirus (PERV) in China experimental minipigs and to evaluate the safety of PERV in three individuals treated with bioartificial liver support systems based on porcine hepatocytes.METHODS: Porcine hepatocytes were isolated with two-stage perfusion method, then cultured in the bioreactor, which is separated by a semipermeable membrane (0.2μm) from the lumen through which the patients' blood plasma was circulated. After post-hemoperfusion, patients' blood was obtained for screening. Additionally, samples of medium collected from both intraluminal and extraluminal compartments of the laboratory bioreactor and culture supernate in vitro was analyzed. The presence of viral sequences was estimated by polymerase chain reaction (PCR) and reverse transcriptase-polymerase chain reaction (RT-PCR). Finally, the infection of virus in the supernate of common culture was ascertained by exposure to the fetal liver cells.RESULTS: PERV-specific gag sequences were found in the porcine hepatocytes using RT-PCR. and were detected in all samples from the intraluminal,extraluminal samples and culture supernate. However,culture supernatant from primary porcine hepatocytes (cleared of cellular debris) failed to infect human fetal liver cells. Finally, RT-PCR detected no PERV infection was found in the blood samples obtained from three patients at various times post-hemoperfusion.CONCLUSION: The assays used are specific and sensitive, identified by second PCR. PERVs could be released from hepatocytes cultured in bioreactor without the stimulation of mitogen and could not be prevented by the hollow fiber semipermeable membrane, indicating the existence of PERV safety in extracorporeal bioartificial liver support system (EBLSS).

  18. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains (United States)

    Pérez Urquiza, M.; Acatzi Silva, A. I.


    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  19. Hybridization chain reaction-based fluorescence immunoassay using DNA intercalating dye for signal readout. (United States)

    Deng, Yan; Nie, Ji; Zhang, Xiao-hui; Zhao, Ming-Zhe; Zhou, Ying-Lin; Zhang, Xin-Xiang


    A novel format of fluorescence immunosorbent assay based on the hybridization chain reaction (HCR) using a DNA intercalating dye for signal readout was constructed for the sensitive detection of targets, both in competitive and sandwich modes. In this platform, the capture and recognition processes are based on immunoreactions and the signal amplification depends on the enzyme-free, isothermal HCR-induced labelling event. After a competitive or a sandwich immunoreaction, a biotinylated capture DNA was bound to a biotinylated signal antibody through avidin, and triggered the HCR by two specific hairpins into a nicked double helix. Gene Finder (GF), a fluorescent probe for double-strand DNA, was intercalated in situ into the amplified chain to produce the fluorescence signal. The limit of detection (LOD) for rabbit IgG in competitive mode by HCR/GF immunoassay was improved at least 100-fold compared with the traditional fluorescence immunoassay using the fluorescein isothiocyanate-labelled-streptavidin or fluorescein isothiocyanate-labelled second antibody as the signal readout. The proposed fluorescence immunoassay was also demonstrated by using α-fetoprotein as the model target in sandwich mode, and showed a wide linear range from 28 ng mL(-1) to 20 μg mL(-1) with a LOD of 6.0 ng mL(-1). This method also showed satisfactory analysis in spiked human serum, which suggested that it might have great potential for versatile applications in life science and point-of-care diagnostics.

  20. Variance-reduced simulation of lattice discrete-time Markov chains with applications in reaction networks (United States)

    Maginnis, P. A.; West, M.; Dullerud, G. E.


    We propose an algorithm to accelerate Monte Carlo simulation for a broad class of stochastic processes. Specifically, the class of countable-state, discrete-time Markov chains driven by additive Poisson noise, or lattice discrete-time Markov chains. In particular, this class includes simulation of reaction networks via the tau-leaping algorithm. To produce the speedup, we simulate pairs of fair-draw trajectories that are negatively correlated. Thus, when averaged, these paths produce an unbiased Monte Carlo estimator that has reduced variance and, therefore, reduced error. Numerical results for three example systems included in this work demonstrate two to four orders of magnitude reduction of mean-square error. The numerical examples were chosen to illustrate different application areas and levels of system complexity. The areas are: gene expression (affine state-dependent rates), aerosol particle coagulation with emission and human immunodeficiency virus infection (both with nonlinear state-dependent rates). Our algorithm views the system dynamics as a "black-box", i.e., we only require control of pseudorandom number generator inputs. As a result, typical codes can be retrofitted with our algorithm using only minor changes. We prove several analytical results. Among these, we characterize the relationship of covariances between paths in the general nonlinear state-dependent intensity rates case, and we prove variance reduction of mean estimators in the special case of affine intensity rates.

  1. Kinetics and mechanism of the chain reaction between N-phenyl-1,4-benzoquinone monoimine and thiophenol (United States)

    Varlamov, V. T.; Gadomsky, S. Ya.


    The kinetics of the reaction between N-phenyl-1,4-benzoquinone monoimine (quinone monoimine) and thiophenol is studied in chlorobenzene at 343 K. The reaction has the same mechanism proposed earlier for a similar reaction involving N,N'-diphenyl-1,4-benzoquinone diimine (quinone diimine). This mechanism has two paths: chain and nonchain. An important difference between the kinetics of the two reactions is the apparent reversible nature of the chain reaction in the quinone monoimine + thiophenol system. This nature reveals itself when the concentrations of thiophenol are comparable to or slightly higher than the concentrations of quinone imine. In light of this, kinetic research is conducted under conditions where the concentrations of thiophenol are significantly higher than those of quinone monoimine, allowing us to simplify the kinetic features and obtain interpretable data. The rate constants of the reaction's elementary steps are estimated and found to be three to five times lower for the reaction involving quinone monoamine than for the one involving quinone diimine. Both reactions have relatively short chains whose lengths do not exceed several tens of units.

  2. Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano. (United States)

    Garg, Pankaj


    Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

  3. Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum. (United States)

    Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing


    The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis.


    Institute of Scientific and Technical Information of China (English)

    Shinichi GODA; Yukio OHSAWA


    Chain reaction bankruptcy is regarded as common phenomenon and its effect is to be taken into account when credit risk portfolio is analyzed. But consideration and modeling of its effect leave much room for improvement. That is mainly because method for grasping relations among companies with limited data is underdeveloped. In this article, chance discovery method is applied to estimate industrial relations that are to include companies' relations that transmit chain reaction of bankruptcy.Time order method and directed KeyGraph are newly introduced to distinguish and express the time order among defaults that is essential information for the analysis of chain reaction bankruptcy. The steps for the data analysis are introduced and result of example analysis with default data in Kyushu,Japan, 2005 is presented. The structure estimated by the new method is compared with the structure of actual account receivable holders of bankrupted companies for evaluation.

  5. Kinetics and reaction mechanism of yeast alcohol dehydrogenase with long-chain primary alcohols. (United States)

    Schöpp, W; Aurich, H


    Kinetic studies of yeast alcohol dehydrogenase with NAD+ and ethanol, hexanol or decanol as substrates invariably result in non-linear Lineweaver-Burk plots if the alcohol is the variable substrate. The kinetic coefficients determined from secondary plots are consistent with an 'equilibrium random-order' mechanism for extremely low alcohol concentrations and for all alcohols, the transformation of the ternary complexes being the rate-limiting step of the reaction. This mechanism also applies to long-chain substrates at high concentrations, whereas the rate of the ethanol-NAD+ reaction at high ethanol concentrations is determined by the dissociation of the enzyme-NADH complex. The dissociation constants for the enzyme-NAD+ complex and for the enzyme-alcohol complexes obtained from the kinetic quotients satisfactorily correspond to the dissociation constants obtained by use of other techniques. It is suggested that the non-linear curves may be attributed to a structural change in the enzyme itself, caused by the alcohol. PMID:183740

  6. A disposable, continuous-flow polymerase chain reaction device: design, fabrication and evaluation. (United States)

    Ragsdale, Victoria; Li, Huizhong; Sant, Himanshu; Ameel, Tim; Gale, Bruce K


    Polymerase Chain Reaction (PCR) is used to amplify a specific segment of DNA through a thermal cycling protocol. The PCR industry is shifting its focus away from macro-scale systems and towards micro-scale devices because: micro-scale sample sizes require less blood from patients, total reaction times are on the order of minutes opposed to hours, and there are cost advantages as many microfluidic devices are manufactured from inexpensive polymers. Some of the fastest PCR devices use continuous flow, but they have all been built of silicon or glass to allow sufficient heat transfer. This article presents a disposable polycarbonate (PC) device that is capable of achieving real-time, continuous flow PCR in a completely disposable polymer device in less than 13 minutes by thermally cycling the sample through an established temperature gradient in a serpentine channel. The desired temperature gradient was determined through simulations and validated by experiments which showed that PCR was achieved. Practical demonstration included amplification of foot-and-mouth disease virus (FMDV) derived cDNA.

  7. A comparison of three DNA extractive procedures with Leptospira for polymerase chain reaction analysis

    Directory of Open Access Journals (Sweden)

    Veloso IF


    Full Text Available Three DNA extraction methods were evaluated in this study: proteinase K followed by phenol-chloroform; a plant proteinase (E6870 followed by phenol-chloroform; and boiling of leptospires in 0.1 mM Tris, pH 7.0 for 10 min at 100°C, with no phenol treatment. Every strain treated with proteinase K or E6870 afforded positive polymerase chain reaction (PCR reaction. On the other hand, from five strains extracted by the boiling method, three did not feature the 849 bp band characteristic in Leptospira. We also evaluated by RAPD-PCR, DNAs from serovars isolated with proteinase K and proteinase 6870 with primers B11/B12. Each of the DNA samples provided PCR profiles in agreement with previous data. Moreover, the results with E6870 showed less background non-specific amplification, suggesting that removal of nucleases was more efficient with E6870. The limit for detection by PCR using Lep13/Lep14 was determined to be 10(2 leptospira, using the silver stain procedure.

  8. A new method for quantitative real-time polymerase chain reaction data analysis. (United States)

    Rao, Xiayu; Lai, Dejian; Huang, Xuelin


    Quantitative real-time polymerase chain reaction (qPCR) is a sensitive gene quantification method that has been extensively used in biological and biomedical fields. The currently used methods for PCR data analysis, including the threshold cycle method and linear and nonlinear model-fitting methods, all require subtracting background fluorescence. However, the removal of background fluorescence can hardly be accurate and therefore can distort results. We propose a new method, the taking-difference linear regression method, to overcome this limitation. Briefly, for each two consecutive PCR cycles, we subtract the fluorescence in the former cycle from that in the latter cycle, transforming the n cycle raw data into n-1 cycle data. Then, linear regression is applied to the natural logarithm of the transformed data. Finally, PCR amplification efficiencies and the initial DNA molecular numbers are calculated for each reaction. This taking-difference method avoids the error in subtracting an unknown background, and thus it is more accurate and reliable. This method is easy to perform, and this strategy can be extended to all current methods for PCR data analysis.

  9. A power-efficient thermocycler based on induction heating for DNA amplification by polymerase chain reaction (United States)

    Pal, Debjani; Venkataraman, V.; Mohan, K. Naga; Chandra, H. Sharat; Natarajan, Vasant


    We have built a thermocycler based on the principles of induction heating for polymerase chain reaction (PCR) of target sequences in DNA samples of interest. The cycler has an average heating rate of ˜0.8 °C/s and a cooling rate of ˜0.5 °C/s, and typically takes ˜4 h to complete a 40-cycle PCR protocol. It is power-efficient (˜6 W per reaction tube), micro-processor controlled, and can be adapted for battery operation. Using this instrument, we have successfully amplified a 350 bp segment from a plasmid and SRY, the human sex determining gene, which occurs as a single-copy sequence in genomic DNA of human males. The PCR products from this thermocycler are comparable to those obtained by the use of commercially available machines. Its easy front-end operation, low-power design, portability and low cost makes it suitable for diagnostic field applications of PCR.

  10. A multiplex real-time polymerase chain reaction assay to diagnose Epiphyas postvittana (Lepidoptera: Tortricidae). (United States)

    Barr, N B; Ledezma, L A; Farris, R E; Epstein, M E; Gilligan, T M


    A molecular assay for diagnosis of light brown apple moth, Epiphyas postvittana (Walker) (Lepidoptera: Tortricidae), in North America is reported. The assay multiplexes two TaqMan real-time polymerase chain reaction (RT-PCR) probe systems that are designed to target DNA segments of the internal transcribed spacer region 2 (ITS2) and 18S rRNA gene. The RT-PCR probe designed for the 18S target recognizes a DNA sequence conserved in all of the moths included in the study and functions as a control in the assay. The second probe recognizes a segment of the ITS2 specifically found in E. postvittana and not found in the other moths included in the study, i.e., this segment is not conserved. Inclusion of the two markers in a single multiplex reaction did not affect assay performance. The assay was tested against 637 moths representing > 90 taxa in 15 tribes in all three subfamilies in the Tortricidae. The assay generated no false negatives based on analysis of 355 E. postvittana collected from California, Hawaii, England, New Zealand, and Australia. Analysis of a data set including 282 moths representing 41 genera generated no false positives. Only three inconclusive results were generated from the 637 samples. Spike experiments demonstrated that DNA contamination in the assay can affect samples differently. Contaminated samples analyzed with the ITS2 RT-PCR assay and DNA barcode methodology by using the cytochrome oxidase I gene can generate contradictory diagnoses.

  11. Continuous reaction performances of benzene alkylation with long chain olefins catalyzed by ionic liquid

    Institute of Scientific and Technical Information of China (English)

    Congzhen QIAO; Chengyue LI


    Based on a compulsive mixing-reacting-sepa-rating-recycling small experimental setup,the continuous reaction performances of benzene alkylation with long chain olefins catalyzed by [BMIM]Cl-AlCl3 ionic liquid were investigated. Three different situations including normal continuous operation mode (reagent materials), sidetrack feeding from different axial positions along the static mixing reactor (reagent materials) and normal con-tinuous alkylation using industrial paraffin and olefins materials were examined. Even under the relatively hype-critical reaction conditions, the single pass conversion of pure 1-dodecene could reach to nearly 100.0%, and the selectivity of 2-phenyl isomer was higher than 37.7%. Although the positions along the reactor for sidetrack feeding were different, the 100.0% single pass conversion of 1-dodecene was also attained before the outlet of the reactor. The refined industrial olefins as raw material could meet with the requirements of continuous alkyla-tion. The influences of impurities such as di-olefins and non-benzene aromatics on the catalytic activity and stability should be studied further.

  12. Effect of surface functionalisation on the interaction of iron oxide nanoparticles with polymerase chain reaction. (United States)

    Aysan, Ayse Beyza; Knejzlík, Zdeněk; Ulbrich, Pavel; Šoltys, Marek; Zadražil, Aleš; Štěpánek, František


    The combination of nanoparticles with the polymerase chain reaction (PCR) can have benefits such as easier sample handling or higher sensitivity, but also drawbacks such as loss of colloidal stability or inhibition of the PCR. The present work systematically investigates the interaction of magnetic iron oxide nanoparticles (MIONs) with the PCR in terms of colloidal stability and potential PCR inhibition due to interaction between the PCR components and the nanoparticle surface. Several types of MIONs with and without surface functionalisation by sodium citrate, dextran and 3-aminopropyl-triethoxysilane (APTES) were prepared and characterised by Transmission Electron Microscopy (TEM), dynamic light scattering (DLS) and Fourier Transform Infrared (FT-IR) spectroscopy. Colloidal stability in the presence of the PCR components was investigated both at room temperature and under PCR thermo-cycling. Dextran-stabilized MIONs show the best colloidal stability in the PCR mix at both room and elevated temperatures. Citrate- and APTES-stabilised as well as uncoated MIONs show a comparable PCR inhibition near the concentration 0.1mgml(-1) while the inhibition of dextran stabilized MIONs became apparent near 0.5mgml(-1). It was demonstrated that the PCR could be effectively carried out even in the presence of elevated concentration of MIONs up to 2mgml(-1) by choosing the right coating approach and supplementing the reaction mix by critical components, Taq DNA polymerase and Mg(2+) ions. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei


    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  14. Use of Polymerase Chain Reaction To Detect the Take-All Fungus, Gaeumannomyces graminis, in Infected Wheat Plants


    Schesser, Kurt; Luder, Andreas; Henson, Joan M.


    Gaeumannomyces graminis, the causative agent of take-all disease of wheat, barley, and oats, was detected in infected wheat seedlings by using the polymerase chain reaction to amplify Gaeumannomyces-specific DNA fragments. Nested primers and two rounds of amplification were used to amplify two fragments, approximately 287 and 188 bp in size, from G. graminis-infected wheat seedlings. The use of nested primers greatly decreased the number of nonspecific amplification products. Polymerase chain...

  15. A mutation specific polymerase chain reaction for detecting hepatitis B virus genome mutations at nt551

    Institute of Scientific and Technical Information of China (English)

    Chun-Ling Ma; De-Xing Fang; Hua-Biao Chen; Fa-Qing Li; Hui-Ying Jin; Su-Qin Li; Wei-Guo Tan


    AIM: The hepatitis B surface antigen (HBsAg) is considered to be one of the best markers for the diagnosis of acute and chronic HBV infection. But in some patients, this antigen cannot be detected by routine serological assays despite the presence of virus. One of the most important explanations for the lack of detectable HBsAg is that mutations which occur within the "a" determinant of HBV S gene can alter expression of HBsAg and lead to changes of antigenicity and immunogenicity of HBsAg accordingly. As a result, these mutants cannot be detected by diagnosis assays. Thus, it is essential to find out specific and sensitive methods to test the new mutants and further investigate their distribution. This study is to establish a method to investigate the distribution of the HBsAg mutant at nt551.METHODS: A mutation specific polymerase chain reaction (msPCR) was established for amplifying HBV DNA with a mutation at nt551. Four sets of primer pairs, P551A-PPS,P551G-PPS, P551C-PPS and P551T-PPS, with the same sequences except for one base at 3' terminus were designed and synthesized according to the known HBV genome sequences and the popular HBV subtypes, adr and adw, in China. At the basis of regular PCR method, we explored the specific conditions for amplifying HBV DNAs with a mutation at nt551 by regulating annealing temperature and the concentration of these primers. 126 serum samples from patients of hepatitis B were collected, among which 16 were positive for HBV S DNA in the nested PCR amplification. These 16 HBV S DNAs were detected by using the msPCR method.RESULTS: When the annealing temperature was raised to 71 °C, nt551A and nt551G were amplified specifically by P551A-PPS and P551G-PPS; At 72 °C and 5 pmole of the primers (each) in reaction of 25 μl volume, nt551C and nt551T were amplified specifically by P551C-PPS and P551TPPS. 16 of HBV S gene fragments were characterized by using this method. 14 of them were positive for nt551A, one was positive for nt

  16. A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

    Directory of Open Access Journals (Sweden)

    Figueiredo Luiz Tadeu M


    Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

  17. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Cruz-Perez, Patricia; Buttner, Mark P.


    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  18. Kinematic chain reactions on trunk and dynamic postural steadiness in subjects with recurrent low back pain. (United States)

    Sung, Paul S; Maxwell, Michael J


    Although subjects with recurrent low back pain (LBP) demonstrate altered trunk control, the kinematic and kinetic responses of the trunk have not been carefully investigated. This study was conducted to compare the standing time, spine range of motion (ROM), and dynamic postural steadiness index (DPSI) based on visual condition between subjects with and without recurrent LBP during upright one leg standing. Sixty-three individuals participated in the study, including 34 control subjects and 29 subjects with recurrent LBP. The DPSI was a composite of the medio-lateral (MLSI), anterior-posterior (APSI), and vertical steadiness indices (VSI) on a force platform. The control group demonstrated longer standing time (s) during the eyes-open condition than the LBP group (26.82±6.03 vs. 19.87±9.36; t=2.96, p=0.01). Regarding spine ROM, visual condition was significantly different between groups (F=7.09, p=0.01) and demonstrated interactions with spine region and group (F=5.53, p=0.02). For the kinetic measures, there was a significant interaction between visual conditions and indices (F=25.30, p=0.001). In the LBP group, the DPSI was significantly correlated with the MLSI (r=0.59, p=0.002), APSI (r=0.44, p=0.03), and VSI (r=0.98, p=0.01) in the eyes-closed condition. Overall, the results of this study indicated that the LBP group decreased thorax and lumbar spine rotations during the eyes-closed condition. The LBP group also demonstrated positive correlations with the kinetic indices, enhancing dynamic postural steadiness in the eyes-closed condition in order to possibly avoid pain or further injury. This dynamic postural steadiness strategy is necessary to improve kinetic and kinematic chain reactions in the LBP group. This compensatory pattern supports the development of optimal postural correction strategies to prevent LBP recurrence and might represent a chain reaction to protect trunk control without visual input. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Optimization of competitively differentiated polymerase chain reaction in detection of HBV basal core promoter mutation

    Institute of Scientific and Technical Information of China (English)

    Xiao-Mou Peng; Lin Gu; Xue-Juan Chen; Jian-Guo Li; Yang-Su Huang; Zhi-Liang Gao


    AIM: To improve competitively differentiated polymerase chain reaction (CD-PCR) in detection of HBV basal core promoter mutation.METHODS: Recombinant plasmid of double point mutation A1762T/G1764A in basal core promoter of HBV constructed by site-directed mutagenesis was used as mutant control.To reveal the deficiency mechanism of CD-PCR, relationship between the circle number of PCR and the increased speed of products of each competitive primer was comparatively studied. Diversified amount of dNTPs and mutual primer of the competitive primers were tried to optimize CDPCR. Optimized CD-PCR was evaluated by detecting A1762T/G1764A mutation in recombinant plasmids and clinical sera from patients with HBV infection. RESULTS: The deficiency mechanism of CD-PCR was that the products of mismatched competitive primer grew fast when the amplification of matched primer entered into plateau stage, which led to decrease in or disappearance of the difference in the amount of their products. This phenomenon could be eliminated by reducing dNTPs to10 μmol/L and mutual primer to about 100 nmol/L. Optimized CD-PCR could detect both mutant and wild strain indepe ndent of the amount of templates and the number of PCRcycles. Its detection limit was 103 copies/mL, about 50 copies/reaction. About 10% of mutant DNAs among wild type DNAs could be detected. A1762T/G1764A mutant was detected in 41.8% (51/122) of patients with HBV infection, but not detected in controls with negative HBsAg. CONCLUSION: Optimized CD-PCR can detect mutation independent of the amount of initial templates and the number of PCR cycles.


    Directory of Open Access Journals (Sweden)

    H. Movahedyan ، H. Khorsandi ، R. Salehi ، M. Nikaeen


    Full Text Available Phenol is one of the organic pollutants in various industrial wastewaters especially petrochemical and oil refining. Biological treatment is one of the considerable choices for removing of phenol present in these wastewaters. Identification of effective microbial species is considered as one of the important priorities for production of the biomass in order to achieve desirable kinetic of biological reactions. Basic purpose of this research is identification of phenol-degrading Pseudomonas Putida in activated sludge by polymerase chain reaction (PCR that has high speed and specificity. In this research, 10 various colonies of phenol-degrading bacteria were isolated from municipal activated sludge and the rate of phenol removal and growth rate of these bacteria were assessed in different concentrations of phenol (200 – 900 mg/L. Confirmation of the largest subunit of multicomponent phenol hydroxylase (LmPH gene and gene coding the N fragment in Pseudomonas Putida-derived methyl phenol operon (DmpN gene through PCR were used for general identification of phenol-degrading bacteria and Pseudomonas Putida, respectively. Presence of a 600 bp (base pairs bond in all of isolated strains indicated that they contain phenol hydroxylase gene. 6 of 10 isolated bacteria were Pseudomonas Putida because they produced a 199 bp PCR product by DmpN primers. According to PCR results in this study, the best phenol-degrading bacteria that can utilize 500 – 600 mg/L phenol completely after 48 hours incubation, belong to Pseudomonas Putida strains. It is clear that use of isolated bacteria can lead to considerable decrease of treatment time as well as promotion of phenol removal rate.

  1. Impact of Fungicide Residues on Polymerase Chain Reaction and on Yeast Metabolism

    Directory of Open Access Journals (Sweden)

    Gildo Almeida da Silva

    Full Text Available ABSTRACT The indiscriminate use of pesticides on grape crops is harmful for consumers´ healthin “in natura” consumption and in the ingestion of wine and grape juice. During winemaking, a rapid and efficient fermentation stage is critical to avoid proliferation of contaminating microorganisms and to guarantee the product´s quality. Polymerase chain reaction (PCR has the advantage of detecting these contaminants in the early stages of fermentation. However,this enzymatic reaction may also be susceptible to specific problems, reducing its efficiency. Agricultural practices, such as fungicide treatments, may be a source of PCR inhibiting factors and may also interfere in the normal course of fermentation.The action of the pesticides captan and folpet on PCR and on yeast metabolism was evaluated, once these phthalimide compounds are widely employed in Brazilian vineyards. DNA amplification was only observed at 75 and 37.5 µg/mL of captan concentrations, whereas with folpet, amplification was observed only in the two lowest concentrations tested (42.2 and 21.1µg/mL.Besides the strong inhibition on Taq polymerase activity, phthalimides also inhibited yeast metabolism at all concentrations analyzed.Grape must containing captan and folpet residues could not be transformed into wine due to stuck fermentation caused by the inhibition of yeast metabolism. Non-compliance with the waiting period for phthalimide fungicides may result in financial liabilities to the viticulture sector.The use of yeasts with high fungicide sensitivity should be selected for must fermentation as a strategy for sustainable wine production and to assure that products comply with health and food safety standards.

  2. Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism

    DEFF Research Database (Denmark)

    Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld


    Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage...

  3. Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Rubayet Hasan


    Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

  4. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes (United States)

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  5. Real time polymerase chain reaction (rt-pcr for mycobacterium tuberculosis in serpiginous choroiditis- A study of 29 cases

    Directory of Open Access Journals (Sweden)

    RadhaAnnamalai, Jyotirmay Biswas, Sudharshan S, Gayathri R, Lily Therese, Viswanathan S, NamithaBhuvaneswari


    Full Text Available Purpose: A study of real time Polymerase Chain Reaction for Mycobacterium tuberculosis (M. tuberculosis DNA in 29 cases of active serpiginous choroiditis. Design: Case control study. Methods: DNA extraction from the aqueous humor was carried out using QIAMP DNA extraction kit. Real- time Polymerase Chain reaction (RT-PCR for MTB was carried out using Genosen’s Mtb complex quantitative Real time PCR kit. All patients were also subjected to complete blood count, venereal disease research laboratory test, chest radiograph, QuantiFERON TB Gold test on the blood and polymerase chain reaction on a sample of aqueous humor. Results: Aqueous aspirate showed copies of mycobacterium tuberculosis DNA in one out of twenty nine cases of serpiginous choroiditis. Direct smear and culture for mycobacteria was negative in all cases. Conclusion: RT-PCR identifies MTB DNA in suspected latent tuberculosis in serpiginous choroiditis with high specificity. Serpiginous choroiditis and multifocal choroiditis due to tuberculosis may resemble each other clinically but have distinct clinical features which can be confirmed by real time polymerase chain reaction performed on the aqueous humor The association between serpiginous choroiditis and tuberculosis would be a chance association or if present a rare association.

  6. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears. (United States)

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh


    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence.

  7. An In Vitro Model for Studying Neutrophil Activation During Cardiopulmonary Bypass by Using a Polymerase Chain Reaction Thermocycler

    NARCIS (Netherlands)

    Tang, Min; Zhao, Xiao-Gang; Gu, Y. John; Chen, Chang-Zhi


    The accurate temperature control of a polymerase chain reaction (PCR) thermocycler was exploited in developing an in vitro model to study neutrophil activation during cardiopulmonary bypass. Neutrophils from 12 volunteers underwent temperature changes in a PCR thermocycler (37 degrees C for 30 minut

  8. Diagnosis of ventricular drainage-related bacterial meningitis by broad-range real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper;


    OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR...

  9. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    DEFF Research Database (Denmark)

    Teglbjaerg, L L; Hansen, J E; Dalbøge, H;


    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot...

  10. Polymerase chain reaction (PCR)-based typing analysis of atypical isolates of the fish pathogen Aeromonas salmonicida

    DEFF Research Database (Denmark)

    Høie, S.; Dalsgaard, Inger; Aase, I.L.;


    Two hundred and five isolates of atypical Aeromonas salmonicida, recovered from a wide range of hosts and countries were characterized by polymerase chain reaction (PCR) targeting four genes. The chosen genes were those encoding the extracellular A-layer protein (AP), the serine protease (Sprot...

  11. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students (United States)

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary


    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  12. Pooling of porcine fecal samples for quantification of Lawsonia intracellularis by real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Pedersen, Ken Steen; Johansen, Markku; Jorsal, Sven Erik Lind;


    obtained by averaging test results from individual fecal samples in relation to a quantitative polymerase chain reaction (qPCR) test for Lawsonia intracellularis. Ten diarrheic and 10 normal fecal samples were submitted from each of 43 Danish swine herds (n = 860 fecal samples). Pools (n = 43), each...


    Kartashov, M Yu; Mikryukova, T P; Ternovoi, V A; Moskvitina, N S; Loktev, V B


    The article considers development of highly effective technique of detection of genetic material of ricketsia based on polymerase chain reaction in real-time using original primers to the most conservative sites of gene of citrate synthase (gItA). The analytical sensitivity of the developed polymerase chain reaction in real-time test permits to detect from 80 genome equivalents in analyzed sample during three hours. The high specificity of test-system is substantiated by detection of nucleotide sequences of amplificated fragments of gene gltA. The approbation ofthe polymerase chain reaction in real-time test is carried out on collection of 310 ticks of species I. persulcatus, I. pavlovskyi, D. reticulatus. It is demonstrated that the developed alternate ofprimers and probe permits with high degree of sensitivity and specifcity to detect DNA of different species of ricketsia widespread on territory of Russia (R. sibirica, R. raoultii, R. helvetica, R. tarasevichiae). The proposed polymerase chain reaction in real-time test can be appliedfor isolation of fragment of gene gltA with purpose for detecting nucleotide sequence and subsequent genetic typing of ricketsia. The application ofthe proposed technique can facilitate task of monitoring hot spots of ricketsiosis.

  14. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.


    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...

  15. An In Vitro Model for Studying Neutrophil Activation During Cardiopulmonary Bypass by Using a Polymerase Chain Reaction Thermocycler

    NARCIS (Netherlands)

    Tang, Min; Zhao, Xiao-Gang; Gu, Y. John; Chen, Chang-Zhi

    The accurate temperature control of a polymerase chain reaction (PCR) thermocycler was exploited in developing an in vitro model to study neutrophil activation during cardiopulmonary bypass. Neutrophils from 12 volunteers underwent temperature changes in a PCR thermocycler (37 degrees C for 30

  16. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students (United States)

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary


    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  17. Whole Blood Polymerase Chain Reaction in a Neonate with Disseminated Herpes Simplex Virus Infection and Liver Failure

    Directory of Open Access Journals (Sweden)

    Jennifer A. Scoble


    Full Text Available A late preterm neonate born by cesarean section with intact membranes presented at 9 days of life with shock and liver failure. Surface cultures were negative but whole blood polymerase chain reaction was positive for herpes simplex virus type 2, underscoring the value of this test in early diagnosis of perinatally acquired disseminated herpes simplex virus infection without skin lesions.


    Institute of Scientific and Technical Information of China (English)

    连伟; 罗慰慈


    Polymerase chain reaction (PCR) was used to detect the presence of Borretia burgdoferi DNA in biological samples from patients with sarcoidcsis. The target DNA sequence was of chromosomal origin. The amplified DNA sequence was analyzed by agarose gel electrophoresis, PAGE with silver staining, and the identity of amplified DNA was confirmed by restriction enzyme cleavage and DNA-DNA hybridlzation with a 32P-labelled probe. The assay was sensitive to fewer than two copies of B. burgdor feri genome, even in the presence of a 104-fold excess of human eukaryotic DNA, and was also specific to different B. burgdorferl strains tested. Sera seroiogieally positive to B. burgdorferi (n=26), broncbemlveolar lavage fluid and supematant of BALF (n=26) and peripheral blood (n=9) from sarcoidosis patients were tested. The positive rate was low (4/26, 2/26, and 0/9, respectively). It was considered that DNA from B. bur gdor feri may be identified in a minority of patients with s,arcoidosis, and it may play a pathogenetic rote in such cases. More studies need to be done before advancing the hypothesis of an etiologic role of B. burgdorferi in sarcoidosis.

  19. Multiplex Polymerase Chain Reaction for Detection of Gastrointestinal Pathogens in Migrant Workers in Qatar. (United States)

    Humphrey, John M; Ranbhise, Sanjay; Ibrahim, Emad; Al-Romaihi, Hamad E; Farag, Elmoubasher; Abu-Raddad, Laith J; Glesby, Marshall J


    The causes of infectious diarrhea among the migrant worker population in Qatar are not well understood. We conducted a prospective observational study to understand the demographic and clinical characteristics and infectious causes of diarrhea among migrant workers in Doha, Qatar. A total of 126 male workers presenting to the Qatar Red Crescent Worker's Health Center outpatient clinic or emergency department were studied over a 5-month period in 2015-2016. Epidemiologic surveys were administered to all subjects and the prevalence of 22 different stool pathogens was determined using multiplex polymerase chain reaction (PCR) (FilmArray(®) Gastrointestinal PCR). A target pathogen was identified in 62.7% of subjects. Enteropathogenic Escherichia coli was the most prevalent pathogen and was detected in 24.6% of subjects, followed by Salmonella (22.2%), enteroaggregative E. coli (15.1%), Giardia lamblia (9.5%), and enterotoxigenic E. coli (8.7%). Multiple pathogens were identified in 49.3% of positive stool samples. In a multivariable analysis, the presence of a heart rate ≥ 90 (adjusted odds ratio [OR] = 3.7, 95% confidence interval [CI] = 1.4-10.0) and > 5 fecal leukocytes/high-power field (adjusted OR = 2.8, 95% CI = 1.2-7.0) were significant predictors of detecting an acute inflammatory pathogen by PCR. Use of multiplex PCR enabled the detection of gastrointestinal pathogens in a high proportion of cases, illustrating the utility of this diagnostic tool in epidemiologic studies of infectious diarrhea.

  20. Polymerase chain reaction with lesion scrapping for the diagnosis of human American tegumentary leishmaniasis

    Directory of Open Access Journals (Sweden)

    Eneide Aparecida Sabaini Venazzi


    Full Text Available The objective of this work was to compare the polymerase chain reaction (PCR using lesion scrapping with other conventional techniques for the diagnosis of the American tegumentary leishmaniasis (ATL. For this, patients with cutaneous lesions suspected to be ATL were studied. The DNA was amplified with the MP1L/MP3H primers. From the 156 studied patients, 79 (50.6% presented positive parasite direct search (PD, 81 (51.9% had positive Montenegro skin test (MST, and 90 (57.7% presented PD and/or MST positive. The PCR was positive in all of the positive-PD patients (100% sensitivity, in 91.1% of the positive PD and/or MST patients, and in 27.3% of the patients that presented negative PD and positive MST. The PCR positivity was similar to the PD (P = 0.2482 and inferior to the MST (P = 0.0455, and to the PD/MST association (P = 0.0133. The high PCR sensitivity, and positivity in those cases where the PD was negative, highlights the importance of this technique as an auxiliary tool for the diagnosis of ATL.

  1. Polymerase chain reaction with lesion scrapping for the diagnosis of human American tegumentary leishmaniasis. (United States)

    Venazzi, Eneide Aparecida Sabaini; Roberto, Andréa Claudia Bekner Silva; Barbosa-Tessmann, Ione Parra; Zanzarini, Paulo Donizeti; Lonardoni, Maria Valdrinez Campana; Silveira, Thaís Gomes Verzignassi


    The objective of this work was to compare the polymerase chain reaction (PCR) using lesion scrapping with other conventional techniques for the diagnosis of the American tegumentary leishmaniasis (ATL). For this, patients with cutaneous lesions suspected to be ATL were studied. The DNA was amplified with the MP1L/MP3H primers. From the 156 studied patients, 79 (50.6%) presented positive parasite direct search (PD), 81 (51.9%) had positive Montenegro skin test (MST), and 90 (57.7%) presented PD and/or MST positive. The PCR was positive in all of the positive-PD patients (100% sensitivity), in 91.1% of the positive PD and/or MST patients, and in 27.3% of the patients that presented negative PD and positive MST. The PCR positivity was similar to the PD (P = 0.2482) and inferior to the MST (P = 0.0455), and to the PD/MST association (P = 0.0133). The high PCR sensitivity, and positivity in those cases where the PD was negative, highlights the importance of this technique as an auxiliary tool for the diagnosis of ATL.

  2. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism. (United States)

    Srinivasa, Chandrashekar; Sharanaiah, Umesha; Shivamallu, Chandan


    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens. Ralstonia solanacearum, Xanthomoans axonopodis pv. vesicatoria, and Xanthomonas oryzae pv. oryzae are phytopathogenic bacteria, which can infect vegetables, cause severe yield loss. PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA. The technique of PCR-SSCP is being exploited so far, only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi. Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials. In this study, we developed PCR-SSCP technique to identify phytopathogenic bacteria. The PCR product was denatured and separated on a non-denaturing polyacrylamide gel. SSCP banding patterns were detected by silver staining of nucleic acids. We tested over 56 isolates of R. solanacearum, 44 isolates of X. axonopodis pv. vesicatoria, and 20 isolates of X. oryzae pv. oryzae. With the use of universal primer 16S rRNA, we could discriminate such species at the genus and species levels. Species-specific patterns were obtained for bacteria R. solanacearum, X. axonopodis pv. vesicatoria, and X. oryzae pv. oryzae. The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  3. Molecular identification of Amazonian stingless bees using polymerase chain reaction single-strand conformation polymorphism. (United States)

    Souza, M T; Carvalho-Zilse, G A


    In countries containing a mega diversity of wildlife, such as Brazil, identifying and characterizing biological diversity is a continuous process for the scientific community, even in face of technological and scientific advances. This activity demands initiatives for the taxonomic identification of highly diverse groups, such as stingless bees, including molecular analysis strategies. This type of bee is distributed in all of the Brazilian states, with the highest species diversity being found in the State of Amazônia. However, the estimated number of species diverges among taxonomists. These bees are considered the main pollinators in the Amazon rainforest, in which they obtain food and shelter; however, their persistence is constantly threatened by deforestation pressure. Hence, it is important to classify the number and abundance of bee specie, to measure their decline and implement meaningful, priority conservation strategies. This study aims to maximize the implementation of more direct, economic and successful techniques for the taxonomic identification of stingless bees. Specifically, the genes 16S rRNA and COI from mitochondrial DNA were used as molecular markers to differentiate 9 species of Amazonian stingless bees based on DNA polymorphism, using the polymerase chain reaction-single-strand conformation polymorphism technique. We registered different, exclusive SSCP haplotypes for both genes in all species analyzed. These results demonstrate that SSCP is a simple and cost-effective technique that is applicable to the molecular identification of stingless bee species.

  4. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism

    Institute of Scientific and Technical Information of China (English)

    Chandrashekar Srinivasa; Umesha Sharanaiah; Chandan Shivamallu


    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens.Ralstonia solanacearum,Xanthomoans axonopodis pv.vesicatoria,and Xanthomonas oryzae pv.oryzae are phytopathogenic bacteria,which can infect vegetables,cause severe yield loss.PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA.The technique of PCR-SSCP is being exploited so far,only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi.Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials.In this study,we developed PCR-SSCP technique to identify phytopathogenic bacteria.The PCR product was denatured and separated on a non-denaturing polyacrylamide gel.SSCP banding patterns were detected by silver staining of nucleic acids.We tested over 56 isolates of R. solanacearum,44 isolates of X. axonopodis pv.vesicatoria,and 20 isolates of X.oryzae pv.oryzae.With the use of universal primer 16S rRNA,we could discriminate such species at the genus and species levels.Speciesspecific patterns were obtained for bacteria R.solanacearum,X.axonopodis pv.vesicatoria,and X.oryzae pv.oryzae.The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  5. Detection of Salmonella invA gene in shrimp enrichment culture by polymerase chain reaction. (United States)

    Upadhyay, Bishnu Prasad; Utrarachkij, Fuangfa; Thongshoob, Jarinee; Mahakunkijcharoen, Yuvadee; Wongchinda, Niracha; Suthienkul, Orasa; Khusmith, Srisin


    Contamination of seafood with salmonellae is a major public health concern. Detection of Salmonella by standard culture methods is time consuming. In this study, an enrichment culture step prior to polymerase chain reaction (PCR) was applied to detect 284 bp fragment of Salmonella invA in comparison with the conventional culture method in 100 shrimp samples collected from four different shrimp farms and fresh food markets around Bangkok. Samples were pre-enriched in non-selective lactose broth (LB) and selective tetrathionate broth (TTB). PCR detection limit was 10 pg and 10(4) cfu/ml of viable salmonellae with 100% specificity. PCR assay detected 19 different Salmonella serovars belonging to 8 serogroups (B, C1, C2-C3, D1, E1, E4 and K) commonly found in clinical and environmental samples in Thailand. The detection rate of PCR following TTB enrichment (24%) was higher than conventional culture method (19%). PCR following TTB, but not in LB enrichment allowed salmonella detection with 84% sensitivity, 90% specificity and 89% accuracy. Shrimp samples collected from fresh food markets had higher levels of contaminated salmonellae than those from shrimp farms. The results indicated that incorporation of an enrichment step prior to PCR has the potential to be applied for detection of naturally contaminated salmonellae in food, environment and clinical samples.

  6. Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens

    Directory of Open Access Journals (Sweden)

    Adriana Antônia da Cruz Furini


    Full Text Available OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens.METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results.RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard, we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively.CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis.

  7. Design, construction, and validation of a modular library of sequence diversity standards for polymerase chain reaction. (United States)

    Baum, Paul D; Young, Jennifer J; Zhang, Qianjun; Kasakow, Zeljka; McCune, Joseph M


    Methods to measure the sequence diversity of polymerase chain reaction (PCR)-amplified DNA lack standards for use as assay calibrators and controls. Here we present a general and economical method for developing customizable DNA standards of known sequence diversity. Standards ranging from 1 to 25,000 sequences were generated by directional ligation of oligonucleotide "words" of standard length and GC content and then amplified by PCR. The sequence accuracy and diversity of the library were validated using AmpliCot analysis (DNA hybridization kinetics) and Illumina sequencing. The library has the following features: (i) pools containing tens of thousands of sequences can be generated from the ligation of relatively few commercially synthesized short oligonucleotides; (ii) each sequence differs from all others in the library at a minimum of three nucleotide positions, permitting discrimination between different sequences by either sequencing or hybridization; (iii) all sequences have identical length, GC content, and melting temperature; (iv) the identity of each standard can be verified by restriction digestion; and (v) once made, the ends of the library may be cleaved and replaced with sequences to match any PCR primer pair. These standards should greatly improve the accuracy and reproducibility of sequence diversity measurements.

  8. A rapid polymerase chain reaction-based test for screening Steinert′s disease (DM1

    Directory of Open Access Journals (Sweden)

    Hamzi Khalil


    Full Text Available Myotonic dystrophy (DM is a multisystemic neuromuscular disorder caused by a dynamic mutation of (CTG trinucleotide repeats in the 3′ untranslated region of the myotonic dystrophy protein kinase gene (DMPK. The aim of the present study was to establish the use of polymerase chain reaction (PCR-based simple and rapid method for initial sample screening. Only a minority of samples were tested positive with the above method and need to be detected by tri primer (TP-PCR and Southern blotting which is more time consuming and involves use of radioactive material. This study concerned 24 patients from nine families with a clinical diagnosis of the DM1. DNA extracted from the blood was used for amplification of the triplet repeat sequences at the DMPK loci. We obtained two bands for the normal subjects and one band for patients corresponding to normal DMPK allele, confirmed by the TP-PCR and the Southern blot. This rapid test for initial screening of samples for the presence of DMPK mutations is economical and reliable method. This method reduces the number of samples needing TP-PCR and Southern blotting.

  9. Toxin genotyping of Clostridium perfringens strains using a polymerase chain reaction protocol

    Directory of Open Access Journals (Sweden)

    Elisabetta Di Giannatale


    Full Text Available A polymerase chain reaction protocol consisting of a multiplex to identify the cpa, cpb1, cpetx, cpi genes and a duplex to identify the cpe and cpb2 genes encoding for a, b1, e, i, enterotoxin and b2 toxins, respectively, was applied to DNA extracted from two collections of Clostridium perfringens strains. The first collection involved 19 isolates from rabbits. The second collection of 41 isolates came from routine necropsies. The cpa gene alone, or in association with the cpb2 gene, was detected in all DNA samples examined. The cpa gene, together with cpb2 gene, were detected in seven of the rabbit C. perfringens strains (36.8% and in nine isolates from necropsies (21.9%. The cpa gene was found in 63.2% of rabbit strains and 76.9% of strains from other animal species. In rabbits, the pathological lesions associated with C. perfringens detection were predominantly forms of non-inflammatory enteropathies. In other species, C. perfringens was mainly associated with congestive-haemorrhagic enteropathy, but also with fatal traumatic lesions, degenerative diseases and organs with post-mortem autolysis. No clear correlation was observed between detection of b2 toxin gene and species-specific pathological features.

  10. Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum

    Directory of Open Access Journals (Sweden)

    Ching Giap Tan


    Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.

  11. Improved polymerase chain reaction conditions for quick diagnostics of Huntington disease. (United States)

    Culjković, B; Ruzdijić, S; Rakić, L; Romac, S


    Huntington disease (HD) belongs to a growing list of neurodegenerative disorders (fragile X syndrome [6], myotonic dystrophy [1], spino-bulbar muscular atrophy [2] etc.) characterized by unstable expanded trinucleotide repeats (so-called 'dynamic mutations'). The dynamic mutation causing HD represents the expansion of CAG triplets in the first exon of a gene IT15 (chromosome 4) coding for huntington. This trinucleotide stretch is varying in the range of 11-34 in normal chromosomes and 39-121 in HD chromosomes. The most direct diagnostic approach is to amplify the proximal region of IT15 gene (from patients genomic DNA) by polymerase chain reaction (PCR) and estimate the number of CAG triplets. All protocols published to date are difficult to reproduce because amplification is inefficient giving additional non-specific products. The strategy of our experiment is shown in Fig. 1. We designed one new primer, primer No. 2 (another primer was primer No. 1) and novel PCR conditions. Primer No. 2 is located closer to CAG triplets and its extension is not including the GC rich region. PCR amplified products, using primer Nos. 1 and 2, thus do not include the GC rich region and, therefore, are much more efficiently amplified (compared to the products of amplification with primer Nos. 1 and 3).

  12. Genital infection caused by Entamoeba histolytica confirmed by polymerase chain reaction analyses. (United States)

    Asano, Hiroshi; Kaneuchi, Masanori; Furuta, Itsuko; Yamaya, Yukie; Hatanaka, Kanako C; Takeda, Mahito; Matsuno, Yoshihiro; Sakuragi, Noriaki


    Entamoeba histolytica is estimated to infect approximately 1% of the global population. In Japan, the prevalence of amebic dysentery has been increasing, with more than 800 patients newly diagnosed annually. However, genital infection with E. histolytica is uncommon even in endemic areas. We present a case of vaginitis caused by E. histolytica. A 50-year-old Japanese woman without history of overseas travel presented to a nearby clinic with increased vaginal discharge. She had hemorrhagic erosion at the uterine cervix with yellowish vaginal discharge, and was referred to our hospital for exclusion of malignancy. Cervical cytology revealed periodic acid-Schiff-positive protozoa not aggregating around squamous cells, and thus amebic vaginitis was suspected. We performed polymerase chain reaction (PCR) analyses and identified E. histolytica. The vaginitis was treated with metronidazole, and the disappearance of amebic protozoa was confirmed by cytology and PCR. Therefore, it may be important to obtain early diagnosis by cervical cytology and PCR.

  13. Polymerase chain reaction-based screening for the ceftriaxone-resistant Neisseria gonorrhoeae F89 strain. (United States)

    Goire, N; Lahra, M M; Ohnishi, M; Hogan, T; Liminios, A E; Nissen, M D; Sloots, T P; Whiley, D M


    Emergence and spread of Neisseria gonorrhoeae resistant to extended spectrum cephalosporins is a major problem threatening treatment of gonorrhoea and is further highlighted by the recent report of a second ceftriaxone-resistant N. gonorrhoeae strain (F89) in Europe, initially observed in France and subsequently identified in Spain. N. gonorrhoeae antimicrobial resistance (AMR) surveillance has acquired new importance and molecular tools have the potential to enhance bacterial culture-based methods. In this study, we established a polymerase chain reaction (PCR) protocol for direct detection of the F89 strain. A key component of this screening protocol was the development of a hybridisation probe-based melting curve analysis assay (mosaic501-hybPCR) to detect the presence of an A501P substitution on the N. gonorrhoeae mosaic penicillin binding protein 2 (PBP2) sequence, an important characteristic of the F89 strain. The mosaic501-hybPCR was evaluated using plasmid-derived positive controls (n=3) and characterised gonococcal (n=33) and non-gonococcal (n=58) isolates. The protocol was then applied to 159 clinical specimens from Sydney, Australia, collected during the first half of the year 2012 that were N. gonorrhoeae PCR-positive. Overall, the results indicate that the PCR-based protocol is suitable for direct detection of the N. gonorrhoeae F89 strain in non-cultured clinical samples. It therefore provides an additional tool to aid investigations into the potential spread of F89 strain throughout Europe and elsewhere.

  14. Analysis of polymorphism in the bovine casein genes by use of the polymerase chain reaction. (United States)

    Pinder, S J; Perry, B N; Skidmore, C J; Savva, D


    Methods have been devised for detecting polymorphisms in the bovine beta- and kappa-casein genes using the polymerase chain reaction (PCR) followed either by restriction enzyme digestion (to reveal a restriction fragment length polymorphism (RFLP] or by hybridization of an allele-specific oligonucleotide. These methods, as well as being faster and more sensitive than traditional RFLP methods, are of more general applicability since they can detect any change in DNA sequence. They require only a small sample of blood or semen and are applicable to animals of any age or sex. These methods make possible large-scale screening and thus selection for alleles at these loci. Typing of blood DNA can give erroneous results when the animal concerned is a twin; however, this can be overcome by retesting using milk or semen. Analysis of the kappa-casein genotype of Holstein-Friesian bulls gives frequencies for the A and B alleles of 0.80 and 0.20 respectively. Selection in favour of the B allele, which is superior for cheese production, could thus have a large effect. The A3 and B alleles at the beta-casein locus have been shown to be rare in the Holstein-Friesian population. Linkage disequilibrium exists between beta-casein B and kappa-casein B.

  15. Clonality assessment of lymphoproliferative lesions using the polymerase chain reaction: An analysis of two methods

    Directory of Open Access Journals (Sweden)

    Nikhil Moorchung


    Full Text Available Background: Lymphoid malignancies are a heterogeneous group of disorders which may be difficult to differentiate from reactive proliferations even after immunohistochemistry. Polymerase chain reaction (PCR is believed to be a good adjunct tool for diagnosis. Materials and Methods: We examined 24 cases of neoplastic and non-neoplastic lymphoproliferative lesions in this study and evaluated the PCR as an additional tool in the confirmation of the diagnosis. Two different PCR methodologies were evaluated. Results: In the evaluation of the T-cell PCR, it was seen that the correlation using both the commercial kits and the custom-synthesized primers was highly significant at a P value of 0.05. Conclusions: Both the methods showed an excellent concordance for T-cell γ gene rearrangements, However, the same was not seen in the B-cell receptor rearrangements. This may be because of the small sample size or the inability of consensus V primers to recognize complementary DNA sequences in all of the V segments.

  16. Isolation and polymerase chain reaction-based identification of Riemerella anatipestifer from ducks in Kerala, India

    Directory of Open Access Journals (Sweden)

    Manju Soman


    Full Text Available Aim: The aim was to isolate and characterize Riemerella anatipestifer organisms from disease outbreaks in ducks in Kerala. Materials and Methods: Ducklings, suspected of Riemerella infection, were sacrificed and subjected to post-mortem examination. Heart blood smears and impression smears from liver and spleen were examined for the presence of pathogenic organisms. Heart blood, lung, liver, and spleen collected aseptically from the birds were subjected to isolation trials in brain heart infusion agar and 10% bovine blood agar. The isolates were characterized based on morphology, cultural characteristics and biochemical tests, and their identity were confirmed by polymerase chain reaction (PCR and the PCR amplified DNA was sequenced. The antibiotic sensitivity testing of the isolates were carried out using six antibiotics viz ciprofloxacin, chloramphenicol, enrofloxacin, amoxycillin, cotrimoxazole, and gentamicin. Results: Colonies suggestive of Riemerella organisms could be isolated on blood agar. Biochemical characterization and PCR confirmed the identity of isolates as R. anatipestifer. The nucleotide sequence of the PCR product showed 99% homology to the R. anatipestifer sequences in the NCBI. The antibiogram revealed that the organisms were sensitive to ciprofloxacin, enrofloxacin, and gentamicin. Conclusion: The present study suggests that the PCR assay can facilitate fast and proper identification of R. anatipestifer infection in ducks. The assay can also differentiate between R. anatipestifer and Pasteurella multocida and can replace the traditional methods of differentiation which are cumbersome and time-consuming.

  17. Low-Cost Temperature Logger for a Polymerase Chain Reaction Thermal Cycler

    Directory of Open Access Journals (Sweden)

    Chan-Young Park


    Full Text Available Polymerase chain reaction (PCR is a method of amplifying DNA which is normally carried out with a thermal cycler. To obtain more accurate and reliable PCR results, the temperature change within the chamber of the thermal cycler needs to be verified and calibrated regularly. Commercially available temperature loggers commonly used for temperature verification tests usually require a graphical user interface (GUI attached to the logger for convenience and straightforward understanding of the device. In this study, a host-local architecture for the temperature logger that significantly reduces the development time and cost is proposed. Employing standard computing devices as the host gives better development environment and user-friendly GUI. This paper presents the hardware and software design of the host-local temperature logger, and demonstrates the use of the local temperature logger connected to a personal computer with a Windows operating system. The probe design, thermistor resistance measurement, temperature filtering, and temperature calibration is described in detail. The thermistor self-heating problem was investigated in particular to determine the reference resistor that was serially connected to the thermistor. The temperature accuracy and temporal precision of the proposed system was 0.1 K.

  18. Detection of Salmonella sp. in Dermanyssus gallinae using an FTA filter-based polymerase chain reaction. (United States)

    Moro, C Valiente; Desloire, S; Chauve, C; Zenner, L


    Salmonella spp. bacteria are responsible for some of the most important zoonoses worldwide. Because Dermanyssus gallinae (DeGeer) (Acari: Dermanyssidae) has been recently reported to be an experimental vector of Salmonella Enteritidis, it would be of benefit to evaluate the presence of this bacterium in mites. A molecular detection tool associating a simple filter-based DNA preparation with a specific 16S rDNA Salmonella sp. polymerase chain reaction (PCR) amplification was described. The limit of detection with this method was 2 x 10(4) bacteria per mite. To adapt this technique for large-scale studies, two sizes of mite pools were tested and a preliminary investigation was carried out on mites from 16 currently or previously contaminated farms. Mites sampled from one farm of each type were positive for Salmonella, suggesting that Dermanyssus could act as a reservoir between flocks. In further investigations, it will be necessary to carry out a large-scale study to assess the role of D. gallinae in the epidemiology of avian salmonellosis.

  19. Ion-Mediated Polymerase Chain Reactions Performed with an Electronically Driven Microfluidic Device. (United States)

    Zhang, Yi; Li, Qian; Guo, Linjie; Huang, Qing; Shi, Jiye; Yang, Yang; Liu, Dongsheng; Fan, Chunhai


    The polymerase chain reaction (PCR) is a powerful method for exponentially amplifying very low amounts of target DNA from genetic, clinical, and forensic samples. However, the heating and cooling steps in PCR largely hamper the miniaturization of thermocyclers for on-site detection of pathogens and point-of-care tests. Herein, we devise an ion-mediated PCR (IM-PCR) strategy by exploiting ion-induced DNA denaturation/renaturation cycles. DNA duplexes are effectively denatured in alkaline solutions; whereas, the denatured single-stranded DNA strands readily reform duplexes at neutral pH. By using an integrated microchip that can programmably control the solution pH simply switching the potential in a range of several hundred millivolts, we can trigger IM-PCR at a constant temperature. Analogously to thermal cycling, 30 cycles of pH-induced denaturation/renaturation were used to amplify protein DNA fragments as confirmed by DNA sequencing. We anticipate that this portable, low-cost, and scalable IM-PCR holds great promise for widespread biological, clinical, and environmental applications.

  20. Detection of horses infected naturally with equine infectious anemia virus by nested polymerase chain reaction. (United States)

    Nagarajan, M M; Simard, C


    A nested polymerase chain reaction (PCR) amplifying a region of the gag gene of equine infectious anemia virus (EIAV) was developed for the rapid and direct detection of proviral DNA from the peripheral blood of naturally infected horses and was compared with the Coggins test. DNA prepared from white blood cells of 122 field horses from 15 stables with reported cases of EIAV and one seronegative stable were analysed. Amplifications of expected size fragments were obtained by nested PCR for 88 horses using two different sets of primers targeting the gag region. The specificity of the amplified products was confirmed by hybridization using a digoxigenin-labeled probe. Gag-nested PCR-restriction fragment length polymorphism analysis distinguished two different subtypes of gag gene, A and B. Subtype A was found to be the most prevalent among the infected horses that were tested. The PCR-gag amplified sequence of subtype A shared 84.6% nucleotide and 93% deduced amino acid sequence identities with the prototype Wyoming strain whereas subtype B sequence was almost 100% identical to the prototype. Sequence analysis of gag subtype A suggests the presence of a novel EIAV variant among infected horses in Canada. The nested PCR assay developed in the present study detected more EIAV positive animals and was found as specific as the agar gel immunodiffusion (Coggins) assay and offers great potential a diagnostic test for the detection of EIAV infections in field horses.

  1. Improving Nuclear Safety of Fast Reactors by Slowing Down Fission Chain Reaction

    Directory of Open Access Journals (Sweden)

    G. G. Kulikov


    Full Text Available Light materials with small atomic mass (light or heavy water, graphite, and so on are usually used as a neutron reflector and moderator. The present paper proposes using a new, heavy element as neutron moderator and reflector, namely, “radiogenic lead” with dominant content of isotope 208Pb. Radiogenic lead is a stable natural lead. This isotope is characterized by extremely low micro cross-section of radiative neutron capture (~0.23 mb for thermal neutrons, which is smaller than graphite and deuterium cross-sections. The reflector-converter for a fast reactor core is the structure capable of transforming some part of prompt neutrons leaked from the core into the reflected neutrons with properties similar to those of delayed neutrons, that is, sufficiently large contribution to reactivity at the level of effective fraction of delayed neutrons and relatively long lifetime, comparable with lifetimes of radionuclides-emitters of delayed neutrons. It is evaluated that the use of radiogenic lead makes it possible to slow down the chain fission reaction on prompt neutrons in the fast reactor. This can improve the fast reactor safety and reduce some requirements to the technologies used to fabricate fuel for the fast reactor.

  2. Alkyl chain length-dependent surface reaction of dodecahydro-N-alkylcarbazoles on Pt model catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Gleichweit, Christoph; Amende, Max; Bauer, Udo; Schernich, Stefan; Höfert, Oliver; Lorenz, Michael P. A.; Zhao, Wei; Bachmann, Philipp; Papp, Christian, E-mail: [Lehrstuhl für Physikalische Chemie II, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Müller, Michael; Koch, Marcus [Lehrstuhl für Chemische Reaktionstechnik, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Wasserscheid, Peter [Lehrstuhl für Chemische Reaktionstechnik, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Erlangen Catalysis Resource Center, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Libuda, Jörg; Steinrück, Hans-Peter [Lehrstuhl für Physikalische Chemie II, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Erlangen Catalysis Resource Center, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany)


    The concept of liquid organic hydrogen carriers (LOHC) holds the potential for large scale chemical storage of hydrogen at ambient conditions. Herein, we compare the dehydrogenation and decomposition of three alkylated carbazole-based LOHCs, dodecahydro-N-ethylcarbazole (H{sub 12}-NEC), dodecahydro-N-propylcarbazole (H{sub 12}-NPC), and dodecahydro-N-butylcarbazole (H{sub 12}-NBC), on Pt(111) and on Al{sub 2}O{sub 3}-supported Pt nanoparticles. We follow the thermal evolution of these systems quantitatively by in situ high-resolution X-ray photoelectron spectroscopy. We show that on Pt(111) the relevant reaction steps are not affected by the different alkyl substituents: for all LOHCs, stepwise dehydrogenation to NEC, NPC, and NBC is followed by cleavage of the C–N bond of the alkyl chain starting at 380–390 K. On Pt/Al{sub 2}O{sub 3}, we discern dealkylation on defect sites already at 350 K, and on ordered, (111)-like facets at 390 K. The dealkylation process at the defects is most pronounced for NEC and least pronounced for NBC.

  3. Analysis of hepcidin expression: in situ hybridization and quantitative polymerase chain reaction from paraffin sections. (United States)

    Sakuraoka, Yuhki; Sawada, Tokihiko; Shiraki, Takayuki; Park, Kyunghwa; Sakurai, Yuhichiro; Tomosugi, Naohisa; Kubota, Keiichi


    To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC). Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC. Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years. Quantitative PCR was performed. Immunohistochemistry and in situ hybridization for hepcidin were also performed. Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully. The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues. A method of in situ hybridization for hepcidin was established successfully, and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue. We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.

  4. [The applications of thermostable ligase chain reaction in facilitating DNA recombination]. (United States)

    Xiangda, Zhou; Xiao, Song; Cong, Huai; Haiyan, Sun; Hongyan, Chen; Daru, Lu


    The traditional Type Ⅱ restriction enzyme-based method is restricted by the purification steps, and therefore, cannot be applied to specific DNA assembly in chaotic system. To solve this problem, Thermostable Ligase Chain Reaction (TLCR) was introduced in the process of DNA assembly and capture. This technique combines the feature of thermostable DNA ligase and sequence specific oligo ligation template, "Helper", to achieve specific assembly of target fragments and exponential increase of products in multiple thermocyclings. Two plasmid construction experiments were carried out in order to test the feasibility and practical performance of TLCR. One was that, TLCR was used to specifically capture a 1.5 kb fragment into vector from an unpurified chaotic system which contained 7 different sizes of fragments. The results showed that the capturing accuracy was around 80%, which proved the feasibility and accuracy of using TLCR to specific assembly of DNA fragments in a complicated mixed system. In the other experiment, TLCR was used to capture two fragments (total length was 27 kb) from Hind Ⅲ digestion of Lambda genome into vector by order. The results also showed an accuracy of around 80%. As demonstrated in the results, TLCR can simplify the process of DNA recombination experiments and is suitable for the assembly of multiple and large DNA fragments. This technique can provide convenience to biological experiments.

  5. Detection of herpesviral sequences in tissues of green turtles with fibropapilloma by polymerase chain reaction. (United States)

    Lu, Y; Wang, Y; Yu, Q; Aguirre, A A; Balazs, G H; Nerurkar, V R; Yanagihara, R


    An alpha-herpesvirus has been associated recently with green turtle fibropapilloma (FP). To further clarify the role of this newfound green turtle herpesvirus (GTHV) in the pathogenesis of FP, various normal-appearing tissues and organs (including skin, eye, brain, heart, liver, spleen, intestine, lung, kidney, nerve, gonad, tongue, gall bladder, urinary bladder, thyroid and peripheral blood mononuclear cells (PBMC) from blood) and tumor tissues from 19 green turtles (Chelonia mydas) with FP, and tissues from three green turtles without FP, collected during 1997 to 1999 in the Hawaiian Islands, were tested for GTHV sequences by nested polymerase chain reaction (PCR), using GTHV-specific oligonuclotide primers. GTHV sequences were detected in all tumors (51/51) and most tissues (133/167) of tumored turtles. By contrast, such sequences were undetectable in tissues (0/28) of three non-tumored turtles. Analysis of GTHV sequences detected in different tissues and tumors revealed a low degree of genetic diversity (green turtles and its absence in tissues of non-tumored turtles, argues for an etiologic role in FP.

  6. Nanostructured biochip for label-free and real-time optical detection of polymerase chain reaction. (United States)

    Hiep, Ha Minh; Kerman, Kagan; Endo, Tatsuro; Saito, Masato; Tamiya, Eiichi


    In this report, Au-coated nanostructured biochip with functionalized thiolated primers on its surface is developed for label-free and real-time optical detection of polymerase chain reaction (PCR). A PCR chamber of 150 microm in thickness containing Au-coated nanostructured substrate in the bottom layer was bordered with SU-8 100 walls. After immobilization of 5'-thiolated primers on the surface, simultaneous DNA amplification and detection were performed without any labeled molecules via the relative reflected intensity (RRI) of Au-coated nanostructured substrate. When human genomic DNA at several concentrations of 0.2, 0.5 and 1 ng microL(-1) was included in the initial DNA samples, the increases in the RRI peak values were clearly observed with the increasing PCR cycle numbers. We found that the starting point of the optical signal, which was divergent from the background in our PCR biochip, was around 3-4 cycles, much lower than that of the fluorescent real-time PCR analysis (around 23-25 cycles). Our proposed PCR device using Au-coated nanostructured substrate holds noteworthy promise for rapid, label-free and real-time DNA detection for point-of-care testing (POCT) applications.

  7. Real-time polymerase chain reaction for detection of Strongyloides stercoralis in stool. (United States)

    Sultana, Yasmin; Jeoffreys, Neisha; Watts, Matthew R; Gilbert, Gwendolyn L; Lee, Rogan


    The use of real-time polymerase chain reaction (PCR) for detection of Strongyloides stercoralis in stool has recently been described. We compared five DNA extraction methods by using normal human stool spiked with Strongyloides ratti and tested by using a real-time PCR. The PowerSoil kit was found to be the best technique in terms of sensitivity and ease of use. The PCR detected DNA extracted from one spiked S. ratti larva diluted 10⁻². The PowerSoil kit was then used to extract DNA from 160 human survey samples. All culture positive specimens with a high and moderate larval load were identified by real-time PCR, but only 15% of specimens with low larval load were positive. Specificity was greater than 99%. The combination of the PowerSoil kit and real-time PCR reliably detected high to moderate larval numbers of S. stercoralis in stools but was less sensitive when the larval load was low.

  8. Hybridization chain reaction amplification for highly sensitive fluorescence detection of DNA with dextran coated microarrays. (United States)

    Chao, Jie; Li, Zhenhua; Li, Jing; Peng, Hongzhen; Su, Shao; Li, Qian; Zhu, Changfeng; Zuo, Xiaolei; Song, Shiping; Wang, Lianhui; Wang, Lihua


    Microarrays of biomolecules hold great promise in the fields of genomics, proteomics, and clinical assays on account of their remarkably parallel and high-throughput assay capability. However, the fluorescence detection used in most conventional DNA microarrays is still limited by sensitivity. In this study, we have demonstrated a novel universal and highly sensitive platform for fluorescent detection of sequence specific DNA at the femtomolar level by combining dextran-coated microarrays with hybridization chain reaction (HCR) signal amplification. Three-dimensional dextran matrix was covalently coated on glass surface as the scaffold to immobilize DNA recognition probes to increase the surface binding capacity and accessibility. DNA nanowire tentacles were formed on the matrix surface for efficient signal amplification by capturing multiple fluorescent molecules in a highly ordered way. By quantifying microscopic fluorescent signals, the synergetic effects of dextran and HCR greatly improved sensitivity of DNA microarrays, with a detection limit of 10fM (1×10(5) molecules). This detection assay could recognize one-base mismatch with fluorescence signals dropped down to ~20%. This cost-effective microarray platform also worked well with samples in serum and thus shows great potential for clinical diagnosis.

  9. Prescription Surveillance and Polymerase Chain Reaction Testing to Identify Pathogens during Outbreaks of Infection

    Directory of Open Access Journals (Sweden)

    Hiroaki Sugiura


    Full Text Available Syndromic surveillance, including prescription surveillance, offers a rapid method for the early detection of agents of bioterrorism and emerging infectious diseases. However, it has the disadvantage of not considering definitive diagnoses. Here, we attempted to definitively diagnose pathogens using polymerase chain reaction (PCR immediately after the prescription surveillance system detected an outbreak. Specimens were collected from 50 patients with respiratory infections. PCR was used to identify the pathogens, which included 14 types of common respiratory viruses and Mycoplasma pneumoniae. Infectious agents including M. pneumoniae, respiratory syncytial virus (RSV, rhinovirus, enterovirus, and parainfluenza virus were detected in 54% of patients. For the rapid RSV diagnosis kit, sensitivity was 80% and specificity was 85%. For the rapid adenovirus diagnosis kit, no positive results were obtained; therefore, sensitivity could not be calculated and specificity was 100%. Many patients were found to be treated for upper respiratory tract infections without the diagnosis of a specific pathogen. In Japan, an outbreak of M. pneumoniae infection began in 2011, and our results suggested that this outbreak may have included false-positive cases. By combining syndromic surveillance and PCR, we were able to rapidly and accurately identify causative pathogens during a recent respiratory infection outbreak.

  10. Electrochemical detection of protein based on hybridization chain reaction-assisted formation of copper nanoparticles. (United States)

    Zhao, Jing; Hu, Suisui; Cao, Ya; Zhang, Bin; Li, Genxi


    In this paper, we report an electrochemical method for highly sensitive and specific detection of protein based on hybridization chain reaction (HCR)-assisted formation of copper nanoparticles by using small molecule such as folate-linked DNA as probe. In the presence of target protein, taking folate receptor (FR) as the model protein in this study, its binding with folate can protect the probe DNA from exonuclease I-catalyzed degradation, thus the probe DNA can be immobilized onto the electrode surface through the hybridization with capture DNA, triggering HCR on the electrode surface. Subsequently, copper nanoparticles can be formed on the electrode surface by using long duplex DNA oligomers from HCR as templates. Furthermore, copper ions released from acid-dissolution of copper nanoparticles can catalyze the oxidation of ο-phenylenediamine by dissolved oxygen, leading to significant electrochemical responses. As a result, our method can sensitively detect FR in the linear range from 0.01ng/mL to 100ng/mL with a detection limit of 3pg/mL. It can also specifically distinguish the target protein in both buffer and complex serum samples. Since many other proteins can be assayed by changing the corresponding small molecule, this method may be promising for the development of the technique for protein detections. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Analysis of adult otitis media: polymerase chain reaction versus culture for bacteria and viruses. (United States)

    Liederman, E M; Post, J C; Aul, J J; Sirko, D A; White, G J; Buchman, C A; Ehrlich, G D


    Recent studies using the polymerase chain reaction (PCR) have identified bacterial and viral genomic sequences in culture-negative pediatric middle ear effusions. To evaluate this technique in adults, 19 effusions were analyzed to compare bacterial and viral culture and PCR detection of Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, and adenovirus. Effusions from 4 subjects positive for human immunodeficiency virus (HIV) were analyzed by PCR for HIV virus. Three of 19 effusions were culture-positive for bacteria, and 0 of 19 for viruses. Fifteen of 19 effusions were PCR-positive for bacterial genomic sequences, and 0 of 19 for adenovirus. Thirteen of 15 PCR-positive specimens demonstrated S pneumoniae, 5 of 15 H influenzae, and 0 of 13 M catarrhalis. All 4 effusions from HIV-positive subjects were PCR-positive for HIV. No effusion was culture-positive and PCR-negative. These results confirm that culture-negative middle ear effusions contain genomic sequences from bacterial pathogens. Finding of HIV RNA and DNA in effusion from HIV-positives suggests replicating virus in this fluid.

  12. Diagnosis of neonatal sepsis by broad-range 16S real-time polymerase chain reaction. (United States)

    Ohlin, Andreas; Bäckman, Anders; Ewald, Uwe; Schollin, Jens; Björkqvist, Maria


    The standard diagnostic test (blood culture) for suspected neonatal sepsis has limitations in sensitivity and specificity, and 16S polymerase chain reaction (PCR) has been suggested as a new diagnostic tool for neonatal sepsis. To develop and evaluate a new real-time PCR method for detection of bacterial DNA in blood samples collected from infants with suspected neonatal sepsis. Immediately after blood culture, a study sample of 0.5-1.0 ml whole blood was collected and used for a novel 16S real-time PCR assay. All positive samples were sequenced. Detailed case studies were performed in all cases with conflicting results, to verify if PCR could detect pathogens in culture negative sepsis. 368 samples from 317 infants were included. When compared with blood culture, the assay yielded a sensitivity of 79%, a specificity of 90%, a positive predictive value of 59%, and a negative predictive value of 96%. Seven of the 31 samples with a positive PCR result and a negative blood culture had definite or suspected bacterial sepsis. In five samples, PCR (but not blood culture) could detect a pathogen that was present in a blood culture collected more than 24 h prior to the PCR sample. This study presents an evaluation of a new real-time PCR technique that can detect culture-positive sepsis, and suggests that PCR has the potential to detect bacteria in culture-negative samples even after the initiation of intravenous antibiotics. Copyright © 2011 S. Karger AG, Basel.


    Institute of Scientific and Technical Information of China (English)

    刘跃华; 王家璧; 司静懿


    This study differentiated pseudocondyloma of vulva from condyloma acunainata using dot blot hybridization and polymerase chain reaction (PCR). A total of 27 cases o{ pseudocondyloma of vulva and 65 cases of condyloma acuminata were selected for the sttldy. The genital lesions were examined clinically and were biopsled. Each biopsy v-as subjected to histological examination and HPV DNA analysis by dot blot hybridization and PCR. Dot blot analysis detected HPV DNA in 19(82.6%) out of 23 cases of condyloma acuminata and 2(25%) out of 8 cases pseudocondyloma of vulvae(P<0. 05). PCR detected HPV DNA in 51(92.7%) our of 55 cases of eondyloma acuminata, compared with none in 23 cases of pseudocondylorna(P<0. 001). HPV DNA was present in the majority of condyloma acuminata specimens, HPV 6 and 11 were the predominant types. Peudocondyloma is probably not associated with HPV. PCR was the most sensitive and useful techntque for HPV DNA detection.

  14. Fabrication of Polymerase Chain Reaction Plastic Lab-on-a-Chip Device for Rapid Molecular Diagnoses. (United States)

    Trinh, Kieu The Loan; Zhang, Hainan; Kang, Dong-Jin; Kahng, Sung-Hyun; Tall, Ben D; Lee, Nae Yoon


    We aim to fabricate a thermoplastic poly(methylmethacrylate) (PMMA) Lab-on-a-Chip device to perform continuous- flow polymerase chain reactions (PCRs) for rapid molecular detection of foodborne pathogen bacteria. A miniaturized plastic device was fabricated by utilizing PMMA substrates mediated by poly(dimethylsiloxane) interfacial coating, enabling bonding under mild conditions, and thus avoiding the deformation or collapse of microchannels. Surface characterizations were carried out and bond strength was measured. The feasibility of the Lab-on-a-Chip device for performing on-chip PCR utilizing a lab-made, portable dual heater was evaluated. The results were compared with those obtained using a commercially available thermal cycler. A PMMA Lab-on-a-Chip device was designed and fabricated for conducting PCR using foodborne pathogens as sample targets. A robust bond was established between the PMMA substrates, which is essential for performing miniaturized PCR on plastic. The feasibility of on-chip PCR was evaluated using Escherichia coli O157:H7 and Cronobacter condimenti, two worldwide foodborne pathogens, and the target amplicons were successfully amplified within 25 minutes. In this study, we present a novel design of a low-cost and high-throughput thermoplastic PMMA Lab-on-a-Chip device for conducting microscale PCR, and we enable rapid molecular diagnoses of two important foodborne pathogens in minute resolution using this device. In this regard, the introduced highly portable system design has the potential to enable PCR investigations of many diseases quickly and accurately.

  15. Use of neuropathological tissue for molecular genetic studies: parameters affecting DNA extraction and polymerase chain reaction. (United States)

    Kösel, S; Graeber, M B


    Nuclear and mitochondrial DNA were extracted from gray matter of human cerebral cortex which had either been formalin-fixed and embedded into paraffin or stored in formalin for up to 26 years. Extraction conditions were optimized for proteinase K digestion, i.e., enzyme concentration, digestion temperature and incubation time. Using the polymerase chain reaction (PCR), DNA was successfully amplified from archival material and sequenced employing a direct nonradioactive cycle sequencing protocol. In general, tissue embedded into paraffin following brief fixation in formalin gave good quantitative results, i.e., up to 1 microgram DNA/mg tissue were extracted. This yield was at least one order of magnitude higher than that obtained with tissue stored in formalin. However, paraffin-embedded neuropathological material was found to contain an as-yet-unidentified PCR inhibitor, and a deleterious effect of long-term fixation in unbuffered low-grade formalin was clearly detectable. Importantly, both paraffin-embedded tissue blocks and human brain that had been stored in formalin for many years yielded DNA sufficient for qualitative analysis. The implications of these findings for the use of neuropathological material in molecular genetic studies are discussed.

  16. Polymerase chain reaction based epidemiological investigation of canine parvoviral disease in dogs at Bareilly region

    Directory of Open Access Journals (Sweden)

    Jobin Thomas


    Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.

  17. Molecular typing of canine parvovirus variants by polymerase chain reaction and restriction enzyme analysis. (United States)

    Kumar, M; Nandi, S


    Canine parvovirus type 2 (CPV-2) is a pathogen of dogs, which causes acute gastroenteritis and lymphopenia mostly in young pups. This paper reports the incidence of CPV-2 infection in diarrhoeic dogs with an aim to define the involvement of various variants of canine parvovirus circulating in India. CPV-2a, a variant of CPV-2 was differentiated from CPV-2b by polymerase chain reaction (PCR). The samples positive for CPV-2b were further analysed by PCR and restriction endonuclease (RE) analysis using Mbo II to detect the CPV-2c variant. Of 129 faecal samples studied, 78 were found positive for canine parvovirus by PCR. Among the 78 samples, 27 were of CPV-2a, 39 of CPV-2b and 12 of CPV-2c type, respectively. This study also showed that CPV-2c, anew variant, is circulating in India. The CPV-2c could be successfully detected by PCR and RE analysis while CPV-2b is the major antigenic type prevalent in this region followed by CPV-2a.

  18. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus (United States)

    Tolardo, Aline Lavado; de Souza, William Marciel; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; de Araujo, Jansen; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; da Fonseca, Benedito Antonio Lopes; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes


    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  19. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections

    Institute of Scientific and Technical Information of China (English)

    Yuhki Sakuraoka; Tokihiko Sawada; Takayuki Shiraki; Kyunghwa Park; Yuhichiro Sakurai; Naohisa Tomosugi; Keiichi Kubota


    AIM:TO establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).METHODS:Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC.Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years.Quantitative PCR was performed.Immunohistochemistry and in situ hybridization for hepcidin were also performed.RESULTS:Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully.The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues.A method of in situ hybridization for hepcidin was established successfully,and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue.CONCLUSION:We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.

  20. Polymerase Chain Reaction: A Better Method for Diagnosing Chronic Schistosoma mansoni Infections. (United States)

    Abdel-Hafeez, Ekhlas Hamed; Mohamed, Rabie M; Belal, Usama S; Abdel-Raheem, Ehab M; Naoi, Koji; Norose, Kazumi


    For more effective diagnosis of the acute and chronic stages of Schistosoma mansoni infection in humans, the polymerase chain reaction (PCR) technique was compared with the Kato-Katz method. A total of 150 stool samples were collected from inpatient and outpatient clinics at the Department of Tropical Medicine, Minia University Hospital, Egypt. Three groups of patients, 50 with acute intestinal schistosomiasis, 70 with chronic intestinal schistosomiasis and 30 normal healthy controls were studied. Stool samples were analyzed by PCR and the Kato-Katz method. The mean number of eggs per gram of feces was 4.6 when estimated by the Kato-Katz method in positive stool samples from acute schistosomiasis cases but only 1.7 in chronic cases. In acute intestinal schistosomiasis, 15 and 45 out of 50 cases were positive by Kato-Katz and PCR, respectively. In the chronic intestinal schistosomiasis cases, 6 and 68 out of 70 cases were positive by the Kato-Katz and PCR methods, respectively. We conclude that PCR appears to be an effective diagnostic technique for S. mansoni infection, especially where a low worm burden exists, such as in chronic cases.

  1. Differentiation of Helicobacter pylori isolates by polymerase chain reaction-restriction fragment length polymorphism

    Institute of Scientific and Technical Information of China (English)

    SHI Li; SUN Yong; ZHANG Ya-li; ZHANG Zhen-shu; ZHOU Dian-yuan


    Objective: To investigate the association between the diversity of urease gene and urease activity of clinical isolates of Helicobacter pylori (H. pylori). Methods: Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) of urease gene and rapid urease activity test were used to study the urease activity of different clinical isolates of H. pylori. Results: H. pylori clinical isolates were divided into 4types according to their PCR-RFLP results of urease gene and urease activity. Type I , possessing strong urease activity (0. 11) and presented 1 fragment of 1.7 kb by PCR-RFLP, had close relations with gastric ulcer; type Ⅱ , with the weakest urease activity (0. 07) and 2 fragments (1.3 and 0. 4 kb respectively), was associated with duodenal bulb ulcer; type Ⅱ , with the strongest urease activity (0. 12) and 2 fragments (0. 4and 0. 17 kb) with or without 1 fragment (0. 23 or 0. 37 kb) , was responsible for gastritis; type Ⅳ, with weak urease activity (0. 09) and 2 fragments (1.5 and 0. 2 kb), was shown to be related to both gastric and duodenal bulb ulcers. Conclusion: The diversity of urease gene decides different urease activities of different clinical isolates of H. pylori, hence the different possibilities of pathogenesis due to this bacteria.

  2. Detection of Brucella sp. and Leptospira sp. in dogs using conventional polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Khamesipour Faham


    Full Text Available The study was conducted to detect Brucella sp. and Leptospira sp. in blood samples of dogs in Isfahan and Shahrekord province in Iran. A total of 94 blood samples were collected from dogs of different breed, age, sex, and dogs’ type (stray or nonstray. The samples were examined using conventional polymerase chain reaction (PCR. Fourteen (14.89% dogs were positive for Brucella sp. and 18 (19.15%. dogs for Leptospira sp. There were no significant differences between the prevalence of the pathogens, provinces, sex, and age groups (P > 0.05. However, there was a statistically significant difference in prevalence of Brucella sp. and Leptospira sp. between stray and non-stray dogs (P < 0.0001; χ2 = 30.3767. The study also demonstrated that PCR was successfully used for the first time in Iran for the detection of Brucella sp. and Leptospira sp. in blood samples of dogs. Therefore, we recommend the PCR as a supplementary method with other commonly recognised methods (e.g. serological methods for the diagnosis of subclinical infections with the microorganisms. Strict measures for the control of stray dogs are also highly recommended.

  3. Detection of Staphylococcus aureus in Dairy Products by Polymerase Chain Reaction Assay

    Institute of Scientific and Technical Information of China (English)

    YANG Yang; SU Xu-dong; YUAN Yao-wu; KANG Chun-yu; LI Ying-jun; ZHANG wei; ZHONG Xiao-ying


    A polymerase chain reaction (PCR) assay was employed for direct detection of Staphylococcus aureus without enrichment in dairy products. A solvent extraction procedure was successfully modified for the extraction of Staphylococcus aureus DNA from artificially contaminated whole milk, skim milk, and cheese. A primer targeting the thermostable nuclease gene (nuc) was used in the PCR. A DNA fragment of 279 bp was amplified. The PCR product was confirmed by DNA sequencing. In this study, the PCR, GB- 4789.10-94, Perifilm RSA.Count Plate, and Baird-Parker + RPF Agar were compared.The sensitivity of the PCR was 10 CFU mL-1 of whole milk, skim milk, and 55 CFU g-1 of cheese. The developed methodology allowed for detection of Staphylococcus aureus in dairy products in less than 6 h. The time taken for the development of this PCR assay was 12-24 h, less than the time taken by the general PCR assay using the enrichment method, and the coincidence rate of this developed PCR was 94.3%, the sensitivity was 100%. It was a rapid, sensitive, and effective method for PCR to detect Staphylococcus aureus in milk and milk products.

  4. Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods?

    Directory of Open Access Journals (Sweden)

    Daniela Camargos Costa


    Full Text Available The polymerase chain reaction (PCR-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34 of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.

  5. Development and application of polymerase chain reaction test for detection of Conidiobolus lamprauges

    Directory of Open Access Journals (Sweden)

    Marcelo M. Silveira


    Full Text Available Conidiobolomycosis is a granulomatous disease caused by the fungus Conidiobolus spp. in humans and animals. Traditional technique for diagnosis of the disease is isolation of the agent associated with the presence of typical clinical signs and pathological conditions. The aim of this study was to describe the development of a specific polymerase chain reaction (PCR test for Conidiobolus lamprauges to detect the fungus in clinical samples. Samples from suspected animals were collected and submitted to isolation, histopathological analysis and amplification by PCR. DNA from tissues was subjected to PCR with fungi universal primers 18S rDNA gene, and specific primers were designed based on the same gene in C. lamprauges that generated products of about 540 bp and 222 bp respectively. The culture was positive in 26.6% of clinical samples. The PCR technique for C. lamprauges showed amplification of DNA from fresh tissues (80% and paraffin sections (44.4%. In conclusion, the PCR technique described here demonstrated a high sensitivity and specificity for detection of fungal DNA in tissue samples, providing a tool for the rapid diagnosis of C. lamprauges.

  6. Detecting and resolving position-dependent temperature effects in real-time quantitative polymerase chain reaction. (United States)

    von Kanel, Thomas; Gerber, Dominik; Wittwer, Carl T; Hermann, Mark; Gallati, Sabina


    Real-time quantitative polymerase chain reaction (qPCR) depends on precise temperature control of the sample during cycling. In the current study, we investigated how temperature variation in plate-based qPCR instruments influences qPCR results. Temperature variation was measured by amplicon melting analysis as a convenient means to assess well-to-well differences. Multiple technical replicates of several SYBR Green I-based qPCR assays allowed correlation of relative well temperature to quantification cycle. We found that inadequate template denaturation results in an inverse correlation and requires increasing the denaturation temperature, adding a DNA destabilizing agent, or pretreating with a restriction enzyme. In contrast, inadequate primer annealing results in a direct correlation and requires lowering the annealing temperature. Significant correlations were found in 18 of 25 assays. The critical nature of temperature-dependent effects was shown in a blinded study of 29 patients for the diagnosis of Prader-Willy and Angelman syndromes, where eight diagnoses were incorrect unless temperature-dependent effects were controlled. A method to detect temperature-dependent effects by pairwise comparisons of replicates in routine experiments is presented and applied. Systematic temperature errors in qPCR instruments can be recognized and their effects eliminated when high precision is required in quantitative genetic diagnostics and critical complementary DNA analyses. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Sensitive Detection of Thirteen Bacterial Vaginosis-Associated Agents Using Multiplex Polymerase Chain Reaction. (United States)

    Malaguti, Natália; Bahls, Larissa Danielle; Uchimura, Nelson Shozo; Gimenes, Fabrícia; Consolaro, Marcia Edilaine Lopes


    Bacterial vaginosis (BV) is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR) assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs) related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs) 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR) were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%), and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future.

  8. Detection of Leuconostoc strains at a meat processing plant using polymerase chain reaction. (United States)

    Goto, Seitaro; Takahashi, Hajime; Kawasaki, Susumu; Kimura, Bon; Fujii, Tateo; Nakatsuji, Miki; Watanabe, Itaru


    To simplify the labor-intensive conventional routine testing of samples to detect Leuconostoc at a meat processing plant, we developed polymerase chain reaction (PCR) primers specific for Leuconostoc from 16S rRNA gene sequences. These primers did not detect other common lactic acid bacteria such as Lactobacillus plantarum, Lact. sake, Lact. fermentum, Lact. acidophilus and Weissella viridescens. PCR with this primer detected all Leuconostoc species tested (Leu. mesenteroides subsp. mesenteroides, Leu. pseudomesenteroides, Leu. carnosum, Leu. lactic, Leu. citreum, Leu. amelibiosum, Leu. gelidum), except for Leu. fallax, and no other lactic acid bacteria on agarose gel electrophoresis. The method could identify areas contaminated with Leuconostoc in a large-scale industrial meat processing plant. Of 69 samples analyzed, 34 were positive for Leuconostoc according to the conventional culture method (isolation of LAB producing dextran) and PCR, whereas 29 were negative according to both. Six samples were culture-negative but positive by PCR. No false negative results were generated by PCR. The method is rapid and simple, is useful for routinely monitoring areas contaminated with Leuconostoc in meat processing plants, and could help to prevent the spoilage of meat products.

  9. Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods? (United States)

    Costa, Daniela Camargos; Madureira, Ana Paula; Amaral, Lara Cotta; Sanchez, Bruno Antônio Marinho; Gomes, Luciano Teixeira; Fontes, Cor Jésus Fernandes; Limongi, Jean Ezequiel; Brito, Cristiana Ferreira Alves de; Carvalho, Luzia Helena


    The polymerase chain reaction (PCR)-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene) were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34) of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.

  10. Laboratory reporting accuracy of polymerase chain reaction testing for avian polyomavirus. (United States)

    Fitzgerald, Brenna; Olsen, Geoff; Speer, Brian


    Polymerase chain reaction (PCR) assays are available for detection of birds infected with avian polyomavirus (APV). Several laboratories offer this diagnostic assay in the United States, but little information is available regarding assay sensitivity, specificity, and accuracy. In this study, known APV-positive and APV-negative samples (each n = 10, 5 undiluted and 5 diluted) were sent to 5 commercial laboratories. A significant difference in reporting accuracy was found among laboratories, most notably for dilute APV-positive samples. Two out of 5 laboratories provided 100% accurate results, 1 had an accuracy of 90%, and 2 reported 80% and 75% accuracy, respectively. The accuracies of the last 2 laboratories were negatively affected by test sensitivities of 60% and 50%, respectively. These findings show that although accurate results were reported by most laboratories, both false-positive and false-negative results were reported by at least 3 laboratories, and false-negative results reported for dilute APV-positive samples predominated. These study findings illustrate a need for veterinary diagnostic laboratories to institute improved voluntary quality control measures.

  11. Quantitative and selective polymerase chain reaction analysis of highly similar human alpha-class glutathione transferases. (United States)

    Larsson, Emilia; Mannervik, Bengt; Raffalli-Mathieu, Françoise


    Alpha-class glutathione transferases (GSTs) found expressed in human tissues constitute a family of four homologous enzymes with contrasting enzyme activities. In particular, GST A3-3 has been shown to contribute to the biosynthesis of steroid hormones in human cells and is selectively expressed in steroidogenic tissues. The more ubiquitous GST A1-1, GST A2-2, and GST A4-4 appear to be primarily involved in detoxification processes and are expressed at higher levels than GST A3-3. We are interested in studying the cell and tissue expression of the GST A3-3 gene, yet the existence of highly expressed sequence-similar homologs and of several splice variants is a serious challenge for the specific detection of unique transcript species. We found that published polymerase chain reaction (PCR) primers for GST A3-3 lack the specificity required for reliable quantitative analysis. Therefore, we designed quantitative PCR (qPCR) primers with greatly increased discrimination power for the human GSTA3 full-length transcript. The improved primers allow accurate discrimination between GST A3-3 and the other alpha-class GSTs and so are of great value to studies of the expression of the GSTA3 gene. The novel primers were used to quantify GSTA3 transcripts in human embryonic liver and steroidogenic cell lines.

  12. Evaluation of Immunomagnetic Separation for the Detection of Salmonella in Surface Waters by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Chao-Yu Hsu


    Full Text Available Salmonella spp. is associated with fecal pollution and capable of surviving for long periods in aquatic environments. Instead of the traditional, time-consuming biochemical detection, polymerase chain reaction (PCR allows rapid identification of Salmonella directly concentrated from water samples. However, prevalence of Salmonella may be underestimated because of the vulnerability of PCR to various environmental chemicals like humic acid, compounded by the fact that various DNA polymerases have different susceptibility to humic acid. Because immunomagnetic separation (IMS theoretically could isolate Salmonella from other microbes and facilitate removal of aquatic PCR inhibitors of different sizes, this study aims to compare the efficiency of conventional PCR combined with immunomagnetic separation (IMS for Salmonella detection within a moderately polluted watershed. In our study, the positive rate was increased from 17.6% to 47% with nearly ten-fold improvement in the detection limit. These results suggest the sensitivity of Salmonella detection could be enhanced by IMS, particularly in low quality surface waters. Due to its effects on clearance of aquatic pollutants, IMS may be suitable for most DNA polymerases for Salmonella detection.

  13. Analysis ulcerative colitis for presence Epstein-Barr virus DNA sequences by polymerase chain reaction technique

    Directory of Open Access Journals (Sweden)

    Sahar Mehrabani khasraghi


    Full Text Available Introduction: Ulcerative colitis (UC is one type of inflammatory bowel disease (IBD. The purpose of this study is to explore the prevalence of Epstein–Barr virus (EBV in UC patients in comparison with healthy subjects using the polymerase chain reaction (PCR method. Methods: In this case-control study, five biopsies of patients with UC and 30 healthy people as controls were selected. Sampling was performed by endoscopic biopsy operation. After DNA extraction, PCR was used to determine EBV genome by specific primers. Statistical analysis was performed using the chi-square test. Results: The results of PCR indicated that EBV genome was detected in 60.0% of samples in the case group, and 36.7% of samples in the control group were positive for EBV. Thus, no significant association was observed between the prevalence of EBV and incidence of UC in comparison with the control group (P = 0.36. Conclusion: The findings presented herein demonstrate no direct molecular evidence to support an association of EBV with UC. These results, do not exclude the possibility oncogenic role of EBV to infect the different colon cell.

  14. A Novel, Essential Control for Clonality Analysis with Human Androgen Receptor Gene Polymerase Chain Reaction (United States)

    van Dijk, Jeroen P.; Heuver, Leonie H.; van der Reijden, Bert A.; Raymakers, Reinier A.; de Witte, Theo; Jansen, Joop H.


    The most widely used technique for determining clonality based on X-chromosome inactivation is the human androgen receptor gene polymerase chain reaction (PCR). The reliability of this assay depends critically on the digestion of DNA before PCR with the methylation-sensitive restriction enzyme HpaII. We have developed a novel method for quantitatively monitoring the HpaII digestion in individual samples. Using real-time quantitative PCR we measured the efficiency of HpaII digestion by measuring the amplification of a gene that escapes X-chromosome inactivation (XE169) before and after digestion. This method was tested in blood samples from 30 individuals: 2 healthy donors and 28 patients with myelodysplastic syndrome. We found a lack of XE169 DNA reduction after digestion in the granulocytes of two myelodysplastic syndrome patients leading to a false polyclonal X-chromosome inactivation pattern. In all other samples a significant reduction of XE169 DNA was observed after HpaII digestion. The median reduction was 220-fold, ranging from a 9.0-fold to a 57,000-fold reduction. Also paraffin-embedded malignant tissue was investigated from two samples of patients with mantle cell lymphoma and two samples of patients with colon carcinoma. In three of these cases inefficient HpaII digestion led to inaccurate X-chromosome inactivation pattern ratios. We conclude that monitoring the efficiency of the HpaII digestion in a human androgen receptor gene PCR setting is both necessary and feasible. PMID:12213708

  15. Determination of Sperm Sex Ratio in Bovine Semen Using Multiplex Real-time Polymerase Chain Reaction. (United States)

    Khamlor, Trisadee; Pongpiachan, Petai; Sangsritavong, Siwat; Chokesajjawatee, Nipa


    Gender selection is important in livestock industries; for example, female calves are required in the dairy industry. Sex-sorted semen is commonly used for the production of calves of the desired gender. However, assessment of the sex ratio of the sorted semen is tedious and expensive. In this study, a rapid, cost effective and reliable method for determining the sex ratio was developed using a multiplex real-time polymerase chain reaction (PCR) assay. In this assay, the X and Y chromosome-specific markers, i.e., bovine proteolipid protein (PLP) gene and sex-determining region Y (SRY) were simultaneously quantified in a single tube. The multiplex real-time PCR assay was shown to have high amplification efficiencies (97% to 99%) comparable to the separated-tube simplex real-time PCR assay. The results obtained from both assays were not significantly different (p>0.05). The multiplex assay was validated using reference DNA of known X ratio (10%, 50%, and 90%) as templates. The measured %X in semen samples were the same within 95% confidence intervals as the expected values, i.e., >90% in X-sorted semen, PCR assay as shown in this study can thus be used to assess purity of sex-sorted semen.

  16. Cattle fetal sex determination by polymerase chain reaction using DNA isolated from maternal plasma. (United States)

    da Cruz, A S; Silva, D C; Costa, E O A; De M-Jr, P; da Silva, C C; Silva, D M; da Cruz, A D


    The objective of this study was to evaluate the use of polymerase chain reaction analysis (PCR) of fetal cells/DNA in the maternal plasma of pregnant cows to determine the sex of the fetus. Plasma was harvested from 35 cows of mixed genotype at different stages of pregnancy ranging from 5 to 35 weeks. A male calf and a heifer calf provided the control samples. Fetal sex was determined by amplification of Y-specific sequences. For the 35 cows, the fetal sex predicted by this technique was in accordance with the sex of the calf at birth in 88.6% of cases. The agreement between predicted and observed fetal sex was less for cows with a gestational length of 35-48 days (63.6%). Regression analysis showed that there was a strong relationship between the probability of correctly predicting fetal sex and the stage of gestation. It was estimated that the test performed at 43.8 days post fertilization would have 95% accuracy, increasing to 99% accuracy for testing at 48.4 days and 99.9% accuracy for tests at 55.0 days or later. It was concluded that PCR analysis of fetal cells in maternal plasma can be used to predict successfully the sex of the fetus in cattle.

  17. Polymerase chain reaction and real-time PCR for diagnosing of Leishmania infantum chagasi in dogs. (United States)

    Ramos, Rafael Antonio do Nascimento; Ramos, Carlos Alberto do Nascimento; Jusi, Márcia Mariza Gomes; de Araújo, Flábio Ribeiro; Machado, Rosangela Zacarias; Faustino, Maria Aparecida da Glória; Alves, Leucio Câmara


    The importance of dogs as a reservoir for Leishmania infantumchagasi in urban environments has stimulated numerous studies assessing diagnostic techniques. When performed properly, such procedures are an important step in preventing leishmaniasis in humans. Molecular methods have become prominent for this purpose. The aim of the present study was to determine the performance of the polymerase chain reaction (PCR) and real-time PCR (qPCR) for diagnosing of canine visceral leishmaniasis (CVL) using different biological samples. For this, 35 dogs from an area endemic for CVL were used. Bone marrow aspirate and lymph node and spleen fragments from these dogs were used for the molecular diagnosis. In the present study, qPCR was able to detect a greater number of positive animals than seen with PCR. Among the different biological samples used, there was no significant difference in L. infantumchagasi DNA detection between PCR and qPCR. However, considering that lymph nodes are easy to acquire, these can be considered to be the best samples for making molecular diagnoses of L. infantum chagasi infection.

  18. Molecular sexing of birds: A comparative review of polymerase chain reaction (PCR)-based methods. (United States)

    Morinha, F; Cabral, J A; Bastos, E


    Accurate identification of sex in birds is important for the management and conservation of avian wildlife in several ways, namely in the development of population, behavioral and ecological studies, as well as in the improvement of ex situ captive breeding programs. In general, nestlings, juveniles and adult birds of a wide number of sexually monomorphic species cannot be sexed based on phenotypic traits. The development of molecular methodologies for avian sexing overcame these difficulties, allowing a reliable gender differentiation for these species. The polymerase chain reaction (PCR)-based methods have been widely applied in molecular sexing of birds, using a large diversity of sex-linked markers. During the last 15 yrs, there was a continuous improvement in the PCR-based protocols for bird sexing, increasing the accuracy, speed and high-throughput applicability of these techniques. The recent advances in real-time PCR platforms and whole genome analysis methods provided new resources for the detection and analysis of novel specific markers and protocols. This review presents a comparative guide of classical and recent advances in PCR-based methods for avian molecular sexing, highlighting its strengths and limitations. Future research opportunities in this field are also addressed.

  19. Detection of helicobacter pylori in benign laryngeal lesions by polymerase chain reaction: a cross sectional study

    Directory of Open Access Journals (Sweden)

    Izadi Farzad


    Full Text Available Abstract Background Although Helicobacter Pylori (HP was detected in some cases of chronic laryngitis, the results were not confirmed by polymerase chain reaction (PCR. By this time, it has not been found in laryngeal lesions by in house PCR, the most sensitive method for detecting the genome tracks. Regarding the previous results and also few numbers of studies about the presence of HP in benign laryngeal lesions, specifically by PCR, we aimed to investigate the presence of HP in benign laryngeal lesions by in-house PCR. Methods The samples were taken from 55 patients with benign laryngeal lesions and frozen in −20°C. One milliliter (ml of lysis buffer was added to 100 mg (mg of each sample and the tube was placed in 56°C overnight. Then DNA extraction was carried out. Results To find HP DNA, in-house PCR was performed that revealed 5 positive results among 55 patients with benign laryngeal lesions. Of them, 3 were polyp, 1 was nodule and 1 was papilloma. Conclusion Although the number of positive results was not a lot in this study, it was in contrast with previous studies which could not find any HP tracks in benign laryngeal lesions by other methods. More studies about the prevalence of HP in benign laryngeal lesions improve judging about the effect of this infection on benign laryngeal lesions.

  20. Accuracy of mucocutaneous leishmaniasis diagnosis using polymerase chain reaction: systematic literature review and meta-analysis

    Directory of Open Access Journals (Sweden)

    Ciro Martins Gomes


    Full Text Available The diagnosis of mucocutaneous leishmaniasis (MCL is hampered by the absence of a gold standard. An accurate diagnosis is essential because of the high toxicity of the medications for the disease. This study aimed to assess the ability of polymerase chain reaction (PCR to identify MCL and to compare these results with clinical research recently published by the authors. A systematic literature review based on the Preferred Reporting Items for Systematic Reviews and Meta-Analyses: the PRISMA Statement was performed using comprehensive search criteria and communication with the authors. A meta-analysis considering the estimates of the univariate and bivariate models was performed. Specificity near 100% was common among the papers. The primary reason for accuracy differences was sensitivity. The meta-analysis, which was only possible for PCR samples of lesion fragments, revealed a sensitivity of 71% [95% confidence interval (CI = 0.59; 0.81] and a specificity of 93% (95% CI = 0.83; 0.98 in the bivariate model. The search for measures that could increase the sensitivity of PCR should be encouraged. The quality of the collected material and the optimisation of the amplification of genetic material should be prioritised.

  1. Detection of Listeria monocytogenes in cheese with the magnetic immuno-polymerase chain reaction assay. (United States)

    Fluit, A C; Torensma, R; Visser, M J; Aarsman, C J; Poppelier, M J; Keller, B H; Klapwijk, P; Verhoef, J


    A new detection system, the magnetic immuno-polymerase chain reaction (PCR) assay (MIPA) has been developed to detect Listeria monocytogenes in food. This method separates Listeria cells from PCR-inhibitory factors present in enrichment broths containing food samples by using magnetic beads coated with specific monoclonal antibodies (MAbs). The separated bacteria were lysed, and the supernatant containing the bacterial DNA was subjected to the PCR. Detection of L. monocytogenes in three naturally contaminated cheese samples with two different MAbs and PCR primers specific for the gene encoding the delayed-hypersensitivity factor showed that with MAb 55 all three samples were positive whereas with MAb A two samples were positive. A further improvement of the method was obtained by using a PCR step based on the listeriolysin O gene. A MIPA employing MAb 55 and the listeriolysin O gene primer set detected L. monocytogenes after 24 h of culture in Listeria Enrichment Broth samples from Port Salut artificially contaminated with 40 CFU/25 g. We could detect 1 CFU of L. monocytogenes per g of cheese after a second enrichment for 24 h in Fraser broth. The analysis time including both enrichments is approximately 55 h.

  2. An evaluation of serotyping of Avibacterium paragallinarum by use of a multiplex polymerase chain reaction. (United States)

    Morales-Erasto, Vladimir; Posadas-Quintana, José de Jesús; Fernández-Díaz, Manolo; Saravia, Luis E; Martínez-Castañeda, José Simón; Blackall, Patrick J; Soriano-Vargas, Edgardo


    In the present study, the ability of a recently proposed multiplex polymerase chain reaction (mPCR) to determine the serogroups (A, B, and C) of Avibacterium paragallinarum was evaluated. A total of 12 reference strains and 69 field isolates of Av. paragallinarum from Ecuador, Mexico, Panama, and Peru were included in the study. With some exceptions (which were serotyped in the current study), all of the isolates and strains had been previously examined by 2 serotyping schemes (Page and Kume) or were the formal reference strains for the schemes. Three of 6 (50%) reference strains of serogroup A, 2 (100%) of serogroup B, and 1 of 4 (25%) reference strains of serogroup C were correctly serotyped by the mPCR. With the field isolates, the mPCR correctly recognized 16 of the 17 serogroup A isolates, 10 of the 12 serogroup B isolates, and 18 of the 37 serogroup C isolates. Overall, the specificity and sensitivity of the PCR test was as follows: 82.6% and 87.3% (serogroup A), 85.7% and 71.9% (serogroup B), and 46.3% and 100% (serogroup C). The poor performance of the mPCR in terms of recognition of serogroup C isolates (low sensitivity of 46.3%) and the relatively high level of uncertainty about the accuracy of the serogroup A and B results (specificity of 87.3% and 71.9%, respectively) means that the assay cannot be recommended as a replacement for conventional serotyping.


    Institute of Scientific and Technical Information of China (English)

    Ai-ying Liu; Ming-jun Jiang; Yue-ping Yin; Jiang-fang Sun


    Objective To establish a multiplex polymerase chain reaction (M-PCR) assay for simultaneous detection of pathogens causing genital ulcer disease (GUD).Methods Based on the gene-specific region of the following pathogens: Chlamydia trachomatis ompl/ompb, herpes simplex virus (HSV) DNA polymerase, Treponema pallidum tpp47, Haemophilus ducreyi 16s rRNA, four sets of primers were designed and an M-PCR assay was developed to detect four pathogens in one test. The assay was evaluated with diagnostic result of golden standard for each pathogen.Results Of the 51 clinical samples, M-PCR showed slightly higher positive rate (47.1%) of HSV than cell culture (23.6%).Meanwhile, the positive rate of T. p allidum detected by M-PCR and dark-field microscopy was 19.6% ( 10/51) and 15.7% (8/51),respectively. Only one sample was positive for H. ducreyiand no sample was positive for C. trachomatis detected by both M-PCR assay and culture.Conclusion This primary study indicated that M-PCR assay can simultaneously and rapidly detect the four etiologic pathogens causing GUD.

  4. Mechanisms of Propidium Monoazide Inhibition of Polymerase Chain Reaction and implications for Propidium Monoazide Applications (United States)

    Lee, C. M.; Darrach, H.; Ponce, A.; McFarland, E.; Laymon, C.; Fingland, N. K.


    PMA-qPCR is a laboratory technique that can be used to identify viable microbes by employing the use of propidium monoazide (PMA), a DNA-intercalating dye, and quantitative polymerase chain reaction (qPCR). The current model of PMA-qPCR operates under the assumption that PMA is only capable of entering membrane-compromised cells, where it irreversibly cross-links to DNA and makes it unavailable for amplification via qPCR. However, the exact mechanism behind PMA's entry into the cell and its interaction with genetic material is not well understood. To better understand PMA's capabilities, we have examined the effect PMA has on enzyme binding and processivity using endonucleases and exonucleases. Our results suggest that the current model behind PMA-qPCR inhibition is incomplete, in that rather than precipitating the entirety of the DNA, PMA also inhibits enzyme binding and/or processivity in soluble DNA. These results have important implications for studying the viable community of microorganisms in various applications, such as environmental monitoring, planetary protection and bioburden assessment, and biohazard detection.

  5. Quantitative polymerase chain reaction: another tool to evaluate viable virus content in live attenuated orf vaccine

    Directory of Open Access Journals (Sweden)

    Durlav Prasad Bora


    Full Text Available A probe-based real-time polymerase chain reaction (PCR assay based on the highly conserved DNA polymerase gene of orf virus (ORFV for the quality control of attenuated orf vaccine is reported. Primary lamb testis (PLT cells were infected with orf vaccine virus and harvested at a critical time point to obtain maximum viable virus content as determined by real-time PCR. DNA extracted from these harvests was subjected to real-time PCR. A critical time point for the harvesting of PLT cells infected with various log10 dilutions of vaccine virus was found to be 42 h (highest slope of 3.335, which was obtained by comparing the slopes of standard curves of different time intervals. The assay was employed to evaluate viable virus content in different batches of orf vaccine. The titres estimated by real-time PCR and conventional TCID50 were comparable with a correlation of 0.8169. Thus, the real-time PCR assay could provide an alternative method or supplementary tool to estimate live ORFV particles in attenuated orf vaccine.

  6. Diagnosis of Brazilian vesiculoviruses by reverse transcription-polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Daniela Wey Bonutti


    Full Text Available We describe a reverse transcription-polymerase chain reaction (RT-PCR and a nested-PCR for diagnosis of Piry, Carajás, Cocal, and Alagoas vesiculoviruses from Brazil. The RNA extracts of viral and clinical samples were submitted to a RT-PCR using Vesiculovirus G primers that amplify part of the glycoprotein gene. The RT-PCR produced amplicons of expected size, 290 base pair, for the four studied viruses. The RT-PCR showed a high sensitivity being 151.3 times (2.18 log more sensitive for the detection of Piry virus than the classical procedure for virus detection in tissue culture based on the viral cytophatic effect. Amplicons had nucleotides sequenced and were aligned in order to select internal primers for a nested-PCR to confirm the origin of Piry, Carajás, Cocal, and Alagoas Vesiculovirus. Ten blood and tarsal pad epithelial samples of infected Guinea-pigs had Vesiculovirus genome amplified by RT-nested-PCR.

  7. Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Richard Atherton


    Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

  8. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)


    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  9. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    Energy Technology Data Exchange (ETDEWEB)

    Tang Yabing [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Xing Da [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)]. E-mail:; Zhu Debin [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Liu Jinfeng [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)


    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity.

  10. Coccidioidomycosis: adenosine deaminase levels, serologic parameters, culture results, and polymerase chain reaction testing in pleural fluid. (United States)

    Thompson, George R; Sharma, Shobha; Bays, Derek J; Pruitt, Rachel; Engelthaler, David M; Bowers, Jolene; Driebe, Elizabeth M; Davis, Michael; Libke, Robert; Cohen, Stuart H; Pappagianis, Demosthenes


    In a patient with positive serum serology for coccidioidomycosis, the differential diagnosis of concurrent pleural effusions can be challenging. We, therefore, sought to clarify the performance characteristics of biochemical, serologic, and nucleic-acid-based testing in an attempt to avoid invasive procedures. The utility of adenosine deaminase (ADA), coccidioidal serology, and polymerase chain reaction (PCR) in the evaluation of pleuropulmonary coccidioidomycosis has not been previously reported. Forty consecutive patients evaluated for pleuropulmonary coccidioidomycosis were included. Demographic data, pleural fluid values, culture results, and clinical diagnoses were obtained from patient chart review. ADA testing was performed by ARUP Laboratories, coccidioidal serologic testing was performed by the University of California-Davis coccidioidomycosis serology laboratory, and PCR testing was performed by the Translational Genomics Research Institute using a previously published methodology. Fifteen patients were diagnosed with pleuropulmonary coccidioidomycosis by European Organization for the Research and Treatment of Cancer/Mycoses Study Group criteria. Pleural fluid ADA concentrations were coccidioidomycosis were not elevated in this study. The sensitivity and specificity of coccidioidal serologic testing in nonserum samples remained high, but the clinical usefulness of PCR testing in pleural fluid was disappointing and was comparable to pleural fluid culture.

  11. Epstein-Barr virus (EBV) load determination using real-time quantitative polymerase chain reaction. (United States)

    Fan, Hongxin; Robetorye, Ryan S


    Epstein-Barr virus (EBV) infects virtually the entire human population and infection persists throughout the lifetime of its host. EBV has been associated with the development of a wide variety of neoplasms, including lymphoma, carcinoma, and sarcoma. In addition, EBV-associated lymphoproliferative disorders are particularly prevalent in immunosuppressed individuals, including AIDS patients, transplant recipients, and patients with congenital immunodeficiencies. In recent years, EBV viral load assessment has been extensively implemented in clinical practice for the diagnosis and monitoring of EBV-associated malignancies and lymphoproliferative disorders. The real-time quantitative polymerase chain reaction (RQ-PCR) has become the method of choice for quantification of specific EBV nucleic acid sequences. This method is fast, extremely sensitive, and accurate, requires only very small amounts of input nucleic acid, and is relatively simple to perform. These characteristics have made it the method of choice for EBV viral load determination. This chapter describes the use of a laboratory-developed RQ-PCR EBV viral load assay for the detection of EBV DNA in cell-free plasma and cerebrospinal fluid samples.

  12. Oral candidiasis: a comparison between conventional methods and multiplex polymerase chain reaction for species identification. (United States)

    Liguori, G; Di Onofrio, V; Lucariello, A; Gallé, F; Signoriello, G; Colella, G; D'Amora, M; Rossano, F


    Oral candidiasis is the most common fungal infection in dental practice, and is caused by yeasts that are normally present in the endogenous flora. To evaluate a rapid diagnostic method for identification of Candida oral isolates, a multiplex polymerase chain reaction (PCR) was carried out on colonies and on oral rinse solutions from 95 subjects with suspected oral candidiasis and results were compared with those from seven commonly used phenotypic identification systems. Between four and nine species were characterized in the samples by the phenotypic methods. PCR identified the same species in 60 (74%) samples from both colony and oral rinse solutions. Statistical analysis, carried out only for the three most frequently isolated species (Candida albicans, Candida glabrata, and Candida tropicalis), showed good concordance in the comparison of multiplex PCR with API 20C AUX and with the Rapid Yeast Identification Panel; conversely, significant differences were registered in the comparison between the molecular method and other phenotypic systems, including four chromogenic media and the automated system Vitek2. Multiplex PCR was rapid and effective in the identification of Candida species and allowed the detection of more than one species in the same sample.

  13. Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema. (United States)

    Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal


    Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

  14. Accuracy of universal polymerase chain reaction (PCR) for detection of bacterial meningitis among suspected patients. (United States)

    Moayedi, Ali Reza; Nejatizadeh, Abdolazim; Mohammadian, Maryam; Rahmati, Mohammad Bagher; Namardizadeh, Vahideh


    Central nervous system (CNS) infections are life-threatening diseases caused by viral, bacterial, parasitic and fungal microorganisms. The aim of this study was to determine the accuracy of universal polymerase chain reaction (PCR) for the detection of bacterial meningitis among patients who were referred to Koodakan Hospital in Bandar Abbas because they were suspected of having the disease. This study was conducted in 2013 on the patients who were admitted to Bandar Abbas' Koodakan Hospital because they were suspected of having meningitis. A questionnaire, including demographic data, was completed for each patient. Universal PCR, Cerebrospinal fluid (CSF) analysis, and gram staining and cultures were done for all the patients. The data were analyzed using SPSS software. Among the 100 patients studied 59 (59%) were male and 41 (41%) were female. No patient in our study had a positive smear and culture for meningitis. Among the patients with negative smears and cultures six (6%) had positive universal PCR, and 94 (94%) had negative universal PCR. Based on these results, PCR had 95% specificity and 100% negative predictive value for the prediction of meningitis. In 30 patients (30%), the biochemical analysis of CSF were in favor of meningitis. Among the 30 patients, six patients (20%) had positive universal PCR and 24 patients (80%) had negative universal PCR. Based on our results, the universal PCR test is useful in the diagnosis of bacterial meningitis in children. We recommend using it in combination with other tests, such as CSF analysis, for diagnosis of bacterial meningitis.

  15. Gene-expression analysis of single cells-nested polymerase chain reaction afte laser microdissection

    Institute of Scientific and Technical Information of China (English)

    Xin Shi; Jorg Kleeff; Zhao-Wen Zhu; Bruno Schmied; Wen-Hao Tang; Arthur Zimmermann; Markus W. Bucher; Helmut Friess


    AIM: The structural and functional characteristics of cells are dependent on the specific gene expression profile. The ability to study and compare gene expression at the cellular level will therefore provide valuable insights into cell physiology and pathophysiology. METHODS: Individual cells were isolated from frozen colon tissue sections using laser microdissection. DNA as well as RNA were extracted, and total RNA was reversely transcribed to complementary DNA (cDNA). Both DNA and cDNA were analyzed by nested polymerase chain reaction (PCR). The quality of isolated DNA and RNA was satisfactory. RESULTS: Single cells were successfully microdissected using an ultraviolet laser micromanipulator. Nested PCR amplification products of DNA and cDNA of single cells could clearly be visualized by agarose gel electrophoresis. CONCLUSION: The combined use of laser microdissection and nested-PCR provides an opportunity to analyze geneexpression in single cells. This method allows the analysisand identification of specific genes which are involved inphysiological and pathophysiological processes in a complexof variable cell phenotypes.

  16. Culture-Negative Endocarditis Diagnosed Using 16S DNA Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Stephen Duffett


    Full Text Available 16S DNA polymerase chain reaction (PCR is a molecular amplification technique that can be used to identify bacterial pathogens in culture-negative endocarditis. Bacterial DNA can be isolated from surgically excised valve tissue or from blood collected in EDTA vials. Use of this technique is particularly helpful in identifying the bacterial pathogen in cases of culture-negative endocarditis. A case involving a 48-year-old man who presented with severe aortic regurgitation and a four-month prodrome of low-grade fever is reported. Blood and valve tissue cultures following valve replacement were negative. A valve tissue sample was sent for investigation with 16S DNA PCR, which successfully identified Streptococcus salivarius and was interpreted as the true diagnosis. A review of the literature suggests that 16S DNA PCR from valve tissue is a more sensitive diagnostic test than culture. It is also extremely specific, based on a sequence match of at least 500 base pairs.

  17. Modeling the Manipulation of Natural Populations by the Mutagenic Chain Reaction. (United States)

    Unckless, Robert L; Messer, Philipp W; Connallon, Tim; Clark, Andrew G


    The use of recombinant genetic technologies for population manipulation has mostly remained an abstract idea due to the lack of a suitable means to drive novel gene constructs to high frequency in populations. Recently Gantz and Bier showed that the use of CRISPR/Cas9 technology could provide an artificial drive mechanism, the so-called mutagenic chain reaction (MCR), which could lead to rapid fixation of even a deleterious introduced allele. We establish the near equivalence of this system to other gene drive models and review the results of simple models showing that, when there is a fitness cost to the MCR allele, an internal equilibrium may exist that is usually unstable. In this case, introductions must be at a frequency above this critical point for the successful invasion of the MCR allele. We obtain estimates of fixation and invasion probabilities for the appropriate scenarios. Finally, we discuss how polymorphism in natural populations may introduce sources of natural resistance to MCR invasion. These modeling results have important implications for application of MCR in natural populations.

  18. Molecular probes and the polymerase chain reaction for detection and typing of Leishmania species in Mexico. (United States)

    Monroy-Ostria, Amalia; Sanchez-Tejeda, Gustavo


    Leishmaniasis in Mexico is a public health problem because all the clinical forms have been recorded in most Mexican states. We studied patients showing clinical symptoms of any form of leishmaniasis, from several endemic areas. Bone marrow samples, aspirates or skin biopsies were taken and deoxyribonucleic acid (DNA) was extracted and amplified by the polymerase chain reaction (PCR) with universal primers AJS1 and DeB8, specific for the Leishmania subgenus Leishmania. The PCR products were then hybridized by dot- or Southern blotting and probed with probe 9.2, specific for the L. mexicana complex. If hybridization did not occur, the DNA was amplified with primers D1 and D2, specific for members of the L. donovani complex, and PCR products were hybridized with probe B4Rsa, also specific for the L. donovani complex. DNA was also amplified with primers B1 and B2, specific for the subgenus Viannia, and the PCR products were hybridized with probe B18, specific for the L. braziliensis complex. It was found that in Tabasco and Veracruz, Mexico, localized cutaneous leishmaniasis (LCL) is caused by infection with members of the L. mexicana complex, whereas in the states of Nayarit and Campeche it was due to infection with the L. mexicana and/or L. braziliensis complexes. Visceral leishmaniasis was caused by L. (L.) chagasi, mainly in the states of Chiapas and Guerrero, and by L. (L.) mexicana in one immunocompromised patient from Tabasco.

  19. Salmonellae in fish feces analyzed by in situ hybridization and quantitative polymerase chain reaction. (United States)

    Sha, Qiong; Forstner, Michael R J; Bonner, Timothy H; Hahn, Dittmar


    The potential of fish to transfer salmonellae from heterogeneous aquatic biofilms into feces was assessed in controlled aquarium studies with Suckermouth Catfish Hypostomus plecostomus and with biofilms inoculated with salmonellae. Neither the presence of catfish nor inoculation with salmonellae had detectable effects on the abundance of the microbial community. Densities of the microbial community were about 10(5) cells/mL in the water during a 1-week period, whereas densities of the microbial community increased 10-fold (10(6) to 10(7) cells/mg) in catfish feces during the same period. Salmonellae were detected by both quantitative polymerase chain reaction (qPCR) and situ hybridization in water samples immediately after inoculation, in numbers of about 10(4) cells/mL, representing up to 20% of the cells of the microbial community. Numbers decreased by three orders of magnitude within the first 3 d of the study, which represented only 0.01% of the community, and became undetectable after day 5. In catfish feces, numbers of Salmonella initially increased to up to 6% of the cells of the community but then declined. These results suggest that Salmonella are not biomagnified during gut passage, and thus, fish only provide a means for the translocation of this pathogen.

  20. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction. (United States)

    Pittet, Laure F; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M


    Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001-, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.

  1. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Laure F Pittet

    Full Text Available Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR. In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old, formerly diagnosed as Bordetella pertussis (IS481+. No B. holmesii (IS481+, IS1001-, hIS1001+ was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.

  2. Detection of Alternaria fungal contamination in cereal grains by a polymerase chain reaction-based assay. (United States)

    Zur, Gideon; Shimoni, Eyal; Hallerman, Eric; Kashi, Yechezkel


    Alternaria sp. are important fungal contaminants of grain products; they secrete four structural classes of compounds that are toxic or carcinogenic to plants and animals and cause considerable economic losses to growers and the food-processing industry. Alternaria toxins have been detected by high-performance liquid chromatography (HPLC), enzyme-linked immunosorbent assay, and other techniques. Here, we report the development of a polymerase chain reaction (PCR)-based method for the detection of Alternaria DNA. PCR primers were designed to anneal to the ITS1 and ITS2 regions of the 5.8S rDNA gene of Alternaria alternata or Alternaria solani but not to other microbial or plant DNA. We compared the sensitivity of PCR in detecting Alternaria DNA, that of the HPLC method in detecting Alternaria alternariol and alternariol methyl ether toxins, and that of the morphological examination of mycelia and conidia in experimentally infested corn samples. The sensitivity of toxin detection for HPLC was above the level of contamination in a set of commercially obtained grain samples, resulting in negative scores for all samples, while the PCR-based method and mold growth plating followed by morphological identification of Alternaria gave parallel, positive results for 8 of 10 samples. The PCR assay required just 8 h, enabling the rapid and simultaneous testing of many samples at a low cost. PCR-based evidence for the presence of Alternaria DNA followed by positive assay results for Alternaria toxins would support the rejection of a shipment of grain.

  3. Detection of Toxoplasma gondii DNA by polymerase chain reaction in experimentally desiccated tissues

    Directory of Open Access Journals (Sweden)

    Márcia Andreia Barge Loução Terra


    Full Text Available Despite toxoplasmosis being a common infection among human and other warm-blooded animals worldwide, there are no findings about Toxoplasma gondii evolutionary forms in ancient populations. The molecular techniques used for amplification of genetic material have allowed recovery of ancient DNA (aDNA from parasites contained in mummified tissues. The application of polymerase chain reaction (PCR to paleoparasitological toxoplasmosis research becomes a promising option, since it might allow diagnosis, acquisition of paleoepidemiological data, access to toxoplasmosis information related origin, evolution, and distribution among the ancient populations.Furthermore, it makes possible the analysis of parasite aDNA aiming at phylogenetic studies. To standardize and evaluate PCR applicability to toxoplasmosis paleodiagnostic, an experimental mummification protocol was tested using desiccated tissues from mice infected with the ME49 strain cysts, the chronic infection group (CIG, or infected with tachyzoites (RH strain, the acute infection group (AIG. Tissues were subjected to DNA extraction followed by PCR amplification of T. gondii B1 gene. PCR recovered T. gondii DNA in thigh muscle, encephalon, heart, and lung samples. AIG presented PCR positivity in encephalon, lungs, hearts, and livers. Based on this results, we propose this molecular approach for toxoplasmosis research in past populations.

  4. Clinical value of polymerase chain reaction in detecting group B streptococcus during labor. (United States)

    Koppes, Dorothea Maria; Vriends, Antonius Arnoldus Cornelis Maria; van Rijn, Michiel; van Heesewijk, Antonine Dimphne


    To reduce the intrapartum use of antibiotics in women with prolonged rupture of the membranes (PROM) by restriction of antibiotics to women who are colonized with group B streptococci (GBS), as identified with the Cepheid Gene Xpert polymerase chain reaction (PCR) for detecting GBS. We conducted a randomized controlled trial among full-term delivering women with PROM. Fifty-four women were enrolled, based on a power calculation with a significance level of 5% and a power of 95%. Twenty-seven women received the standard treatment (rectovaginal swab [RVS] for bacterial culture and antibiotics). For another 27 women PCR was performed on the RVS and antibiotics were used only when the PCR was positive. The primary outcome was reduction in antibiotic use, defined as the percentage of women who received antibiotics during labor. 54 Women were enrolled in the study between 1 May and 18 November 2014. There were no significant differences in baseline characteristics. In total, 10 of the 54 women were GBS positive (18.5%). Of those 10 women, three were identified on bacterial culture and seven on PCR. In the bacterial culture group all the women received antibiotics. In the PCR group 10 women (37%) received antibiotics (P = 0.002). Two false-positive PCR tests were identified. There were no false-negative PCR tests. Real-time identification of GBS on PCR reduces the intrapartum use of antibiotics in women with PROM. © 2017 Japan Society of Obstetrics and Gynecology.

  5. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    Directory of Open Access Journals (Sweden)

    Ana Lisa do Vale Gomes


    Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

  6. Keratinizing odontogenic cyst with verrucous pattern featuring negative human papillomavirus status by polymerase chain reaction. (United States)

    Argyris, Prokopios P; Nelson, Andrew C; Koutlas, Ioannis G


    Verrucous odontogenic cysts (OCs) are extremely rare. Here, we report the clinicopathologic features of this unusual entity and investigate the role of human papillomavirus (HPV) by p16INK4A immunohistochemistry and HPV-DNA polymerase chain reaction (PCR). A 32-year-old male presented with a 8.3 × 4.0 cm, multilocular radiolucency of the left ascending ramus of the mandible. Microscopically, the cystic cavity was lined by hyperplastic stratified squamous epithelium demonstrating marked verrucous morphology with multiple sharp or blunt projections. Mild dysplastic features were also identified. A final diagnosis of keratinizing OC with verrucous hyperplasia and epithelial dysplasia was rendered. Immunohistochemically, the verrucous OC showed foci of moderate-to-intense and diffuse, nuclear, and cytoplasmic p16INK4A positivity as well as weak or absent p53 immunopositivity in the p16INK4A labeled areas. The Ki-67 expression was increased. Interestingly, HPV-DNA PCR failed to reveal transcriptionally active HPV genotypes. Complete surgical excision was performed, with no recurrences seen during a 66-month follow-up. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Improved Multiplex Polymerase Chain Reaction for Rapid Staphylococcus Aureus Detection in Meat and Milk Matrices

    Directory of Open Access Journals (Sweden)

    Šramková Zuzana


    Full Text Available Staphylococcal food poisoning represents one of the most frequently occurring intoxications, caused by staphylococcal enterotoxins (SE-s and staphylococcal enterotoxin-like proteins (SEl-s. Therefore, there is a need for rapid, sensitive and specific detection method for this human pathogen and its toxin genes in food matrices. The present work is focused on Staphylococcus aureus detection by a nonaplex polymerase chain reaction, which targets the 23S rRNA gene for identification of S. aureus at the species level, genes for classical SE-s (SEA, SEC, SED, new SE-s (SEH, SEI, SEl-s (SEK, SEL and tsst-1 gene (toxic shock syndrome toxin. Primers were properly designed to avoid undesirable interactions and to create a reliably identifiable profile of amplicons when visualized in agarose gel. According to obtained results, this approach is able to reach the detection sensitivity of 12 colony forming units from milk and meat matrices without prior culturing and DNA extraction.

  8. Rapid diagnosis of scrub typhus in rural Thailand using polymerase chain reaction. (United States)

    Sonthayanon, Piengchan; Chierakul, Wirongrong; Wuthiekanun, Vanaporn; Blacksell, Stuart D; Pimda, Kriangsak; Suputtamongkol, Yupin; Pukrittayakamee, Sasithon; White, Nicholas J; Day, Nicholas P; Peacock, Sharon J


    The aim of this study was to evaluate the use of polymerase chain reaction (PCR) amplification of the O. tsutsugamushi 16S rRNA gene for the diagnosis of scrub typhus in rural Thailand. A prospective study of acute febrile illness in Udon Thani, northeast Thailand, identified 183 patients as having scrub typhus on the basis of immunofluorescent antibody testing (IFA) of paired sera. A further 366 febrile patients admitted concurrently with a range of other diagnoses acted as negative controls. Diagnostic sensitivity and specificity of 16S rRNA PCR was 44.8% and 99.7%, respectively, compared with IFA. PCR positivity was related to duration of symptoms and presence of eschar (P < 0.001, both cases). PCR using primers to amplify a fragment of the 56-kd gene had a sensitivity and specificity of 29.0% and 99.2%, respectively. PCR has a high specificity but low sensitivity for the rapid diagnosis of scrub typhus in this endemic setting.

  9. A novel technique for measuring variations in DNA copy-number: competitive genomic polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Nakagawara Akira


    Full Text Available Background Changes in genomic copy number occur in many human diseases including cancer. Characterization of these changes is important for both basic understanding and diagnosis of these diseases. Microarrays have recently become the standard technique and are commercially available. However, it is useful to have an affordable technique to complement them. Results We describe a novel polymerase chain reaction (PCR-based technique, termed competitive genomic PCR (CGP. The main characteristic of CGP is that different adaptors are added to the sample and control genomic DNAs after appropriate restriction enzyme digestion. These adaptor-supplemented DNAs are subjected to competitive PCR using an adaptor-primer and a locus-specific primer. The amplified products are then separated according to size differences between the adaptors. CGP eliminates the tedious steps inherent in quantitative PCR and achieves moderate throughput. Assays with different X chromosome numbers showed that it can provide accurate quantification. High-resolution analysis of neuroblastoma cell lines around the MYCN locus revealed novel junctions for amplification, which were not detected by a commercial array. Conclusion CGP is a moderate throughput technique for analyzing changes in genomic copy numbers. Because CGP can measure any genomic locus using PCR primers, it is especially useful for detailed analysis of a genomic region of interest.

  10. Spatiotemporal Patterns in a Ratio-Dependent Food Chain Model with Reaction-Diffusion

    Directory of Open Access Journals (Sweden)

    Lei Zhang


    Full Text Available Predator-prey models describe biological phenomena of pursuit-evasion interaction. And this interaction exists widely in the world for the necessary energy supplement of species. In this paper, we have investigated a ratio-dependent spatially extended food chain model. Based on the bifurcation analysis (Hopf and Turing, we give the spatial pattern formation via numerical simulation, that is, the evolution process of the system near the coexistence equilibrium point (u2*,v2*,w2*, and find that the model dynamics exhibits complex pattern replication. For fixed parameters, on increasing the control parameter c1, the sequence “holes → holes-stripe mixtures → stripes → spots-stripe mixtures → spots” pattern is observed. And in the case of pure Hopf instability, the model exhibits chaotic wave pattern replication. Furthermore, we consider the pattern formation in the case of which the top predator is extinct, that is, the evolution process of the system near the equilibrium point (u1*,v1*,0, and find that the model dynamics exhibits stripes-spots pattern replication. Our results show that reaction-diffusion model is an appropriate tool for investigating fundamental mechanism of complex spatiotemporal dynamics. It will be useful for studying the dynamic complexity of ecosystems.

  11. Rapid detection of genetically modified organisms on a continuous-flow polymerase chain reaction microfluidics. (United States)

    Li, Yuyuan; Xing, Da; Zhang, Chunsun


    The ability to perform DNA amplification on a microfluidic device is very appealing. In this study, a compact continuous-flow polymerase chain reaction (PCR) microfluidics was developed for rapid analysis of genetically modified organisms (GMOs) in genetically modified soybeans. The device consists of three pieces of copper and a transparent polytetrafluoroethylene capillary tube embedded in the spiral channel fabricated on the copper. On this device, the P35S and Tnos sequences were successfully amplified within 9min, and the limit of detection of the DNA sample was estimated to be 0.005 ng microl(-1). Furthermore, a duplex continuous-flow PCR was also reported for the detection of the P35S and Tnos sequences in GMOs simultaneously. This method was coupled with the intercalating dye SYBR Green I and the melting curve analysis of the amplified products. Using this method, temperature differences were identified by the specific melting temperature values of two sequences, and the limit of detection of the DNA sample was assessed to be 0.01 ng microl(-1). Therefore, our results demonstrated that the continuous-flow PCR assay could discriminate the GMOs in a cost-saving and less time-consuming way.

  12. Maedi in slaughtered sheep: a pathology and polymerase chain reaction study in southwestern Iran. (United States)

    Azizi, Shahrzad; Tajbakhsh, Elahe; Fathi, Farzad; Oryan, Ahmad; Momtaz, Hassan; Goodarzi, Mehdi


    Maedi-visna (MV) is an important slow viral disease of sheep leading to a progressive lymphoproliferative disease. It affects multiple organs primarily the lungs, where it causes interstitial pneumonia (maedi). In this study, the lungs of 1,000 sheep carcasses were grossly inspected and those suspected to have maedi were studied at histopathological and molecular levels. A polymerase chain reaction (PCR) technique that amplified a 291-base pair DNA in the long terminal repeat (LTR) sequence of MV provirus was conducted on all the 50 suspected lungs together with 10 normal appearing lungs as controls. Amplicons of the expected size were detected in 11 (n=11/50) suspected sheep, and one of the 10 control sheep. Histopathologic study of the pulmonary lesions of all 11 (n=11/11) positive sheep showed MV lesions, including hyperplasia of the perivascular and peribronchiolar lymphoid cells, interstitial lymphoplasmacytic infiltration and smooth muscle hyperplasia and the histopathologic findings were correlated with PCR results. In contrast, the tissue sections of control animals were almost normal at histopathological level; however, PCR technique demonstrated that one of them was affected by maedi. This study showed that the LTR-PCR had high specificity and sensitivity in diagnosis of this viral infection. This study is the first to evaluate the prevalence of MV virus infection in sheep in Iran.

  13. Pouched Rats’ Detection of Tuberculosis in Human Sputum: Comparison to Culturing and Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Amanda Mahoney


    Full Text Available Setting. Tanzania. Objective. To compare microscopy as conducted in direct observation of treatment, short course centers to pouched rats as detectors of Mycobacterium tuberculosis. Design. Ten pouched rats were trained to detect tuberculosis in sputum using operant conditioning techniques. The rats evaluated 910 samples previously evaluated by smear microscopy. All samples were also evaluated through culturing and multiplex polymerase chain reaction was performed on culture growths to classify the bacteria. Results. The patientwise sensitivity of microscopy was 58.0%, and the patient-wise specificity was 97.3%. Used as a group of 10 with a cutoff (defined as the number of rat indications to classify a sample as positive for Mycobacterium tuberculosis of 1, the rats increased new case detection by 46.8% relative to microscopy alone. The average samplewise sensitivity of the individual rats was 68.4% (range 61.1–73.8%, and the mean specificity was 87.3% (range 84.7–90.3%. Conclusion. These results suggest that pouched rats are a valuable adjunct to, and may be a viable substitute for, sputum smear microscopy as a tuberculosis diagnostic in resource-poor countries.

  14. Accuracy of the serological ELISA test compared with the polymerase chain reaction for the diagnosis of cytomegalovirus infection in pregnancy

    Directory of Open Access Journals (Sweden)

    Silvana Varella Parmigiani

    Full Text Available CONTEXT: The most frequently used methods for detecting antibodies are the indirect immunofluorescence test and the enzymatic immunoassay (ELISA. The polymerase chain reaction is a molecular biology technique in which the production of large amounts of specific DNA fragments is induced from very low concentrations of complex substrates aloowing the detection of very low amounts of viral particles. OBJECTIVE: To assess the accuracy of serological/ELISA tests in comparison with the polymerase chain reaction in maternal blood to diagnose cytomegalovirus infection. DESIGN: A descriptive study was performed. SETTING: High-risk outpatient clinic of Campinas University (Unicamp. PARTICIPANTS: We selected 243 pregnant women. All of them had been indicated for blood sampling because of suspicions of cytomegalovirus infection and also because of other infections. MAIN MEASUREMENTS: The group was tested for cytomegalovirus. Serological tests were run and compared to the polymerase chain reaction, which was considered to be the gold standard. Status analyses were done using Fisher's exact test, via the SAS software. RESULTS: The previous cytomegalovirus infection rate was 94.6%. The main reasons for inclusion in the study were fetal nervous system malformation (25.5%, maternal toxoplasmosis (25.5% and Rh isoimmunization (14.8%. Only two women were included because of positive serological immunoglobulin M test for cytomegalovirus. The sensitivity and specificity of the serological tests were 94% and 6% for immunoglobulin G. CONCLUSION: Serological tests had lower sensitivity in comparison with the polymerase chain reaction test when diagnosing cytomegalovirus infection. The consequences of positive polymerase chain reaction and negative immunoglobulin M in women remain unknown.

  15. Stereoselective synthesis of 2,2-bis(C-branched-chain) glucopyranosid-3-ulose via autoxidation reaction

    Institute of Scientific and Technical Information of China (English)

    LIU Hong-Min; ZHANG Fuyi; TAO Jing-Chao


    Many different approaches for synthesis of branched chain sugars have beenestablished,1 because they are very useful intermediates for synthesis of other non-sugar chiralmolecules, and usually occur in nature. Branched chain glycosidulose can be used for construction offive- and six-membered carbocyclic rings to which two chiral carbons of sugar are incorporated byintramolecular aldol condensation and Robinson annulation,2 Therefore they are useful in thesynthesis of natural products which consist of annulated carbohydrates or where a highlyfunctionalised enantiomerically pure cyclopentane or cyclohexane is required. Also, this type ofbranched chain sugar can be considered as the synthons of monoterpenoid natural products of theiridoid class which have the cyclopentan-(c)-pyran structure. In view of the importance of branchedchain glycosiduloses, it is desirable to have a general, convenient methodology to their synthesis.However, none of the literature methods was reported on their synthesis by a nuclephilic addition toa partially protected glycosidulose, due to the fact that these glycosiduloses are very difficult tosynthesize selectively and unstable;3 and what is more, one-step synthesis branched chainglycosidulose using this method is almost impossible.In this paper, we report on a general, convenient method for stereoselective syntheses of2,2-bis(C-branched-chain)glucopyranosid-3-uloses by the new reaction of 1 with various activemethylene compounds. The generality of this method was examined in detail. The optimumtemperature was 18-25℃. The solvent DMF was better than the others. In all cases he yields werehigher than 60%.All the 2,2-bis(C-branched-chain)glucopyranosid-3-uloses were characterized by X-raycrystallographic analyses. In addition, the important iintermediate in this reaction was isolated,which is the product of autoxidation of 1 at C-3 position. Thus the reaction mechanism for thesynthesis of 2,2-bis(C-branched-chain) glucopyranosid-3-uloses

  16. Antiadenoviral effects of N-chlorotaurine in vitro confirmed by quantitative polymerase chain reaction methods

    Directory of Open Access Journals (Sweden)

    Eiichi Uchio


    Full Text Available Eiichi Uchio1, Hirotoshi Inoue1, Kazuaki Kadonosono21Department of Ophthalmology, Fukuoka University School of Medicine, Fukuoka, Japan; 2Department of Ophthalmology, Yokohama City University Medical Center, Yokohama, JapanPurpose: Adenoviral keratoconjunctivitis is recognized as one of the major pathogens of ophthalmological nosocomial infection worldwide. N-Chlorotaurine (Cl–HN–CH2–CH2–SO3H, NCT is the N-chloro derivative of the amino acid taurine, which is an oxidant produced by human granulocytes and monocytes during inflammatory reactions. Using conventional viral plaque assay, it was previously shown that NCT causes inactivation of several human adenovirus (HAdV serotypes. In this study, we evaluated the antiadenoviral effect of NCT by quantitative polymerase chain reaction (PCR methods.Methods: A549 cells were used for viral cell culture, and HAdV serotypes 3, 4, 8, 19, and 37 were used. After calculating 50% cytotoxic concentration (CC50 of NCT by MTS (3-(4,5-dimethylthiazol-2-yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium method, HAdV was cultured with NCT for 7 days, and extracted adenoviral DNA was quantitatively measured by real-time PCR.Results: A statistically significant (P < 0.05 dose-dependent inhibition was indicated for all serotypes except HAdV type 4 (HAdV4, which was maximally inhibited by only ~50%. Among the serotypes, NCT was particularly effective against HAdV8, HAdV19a, and HAdV37. The 50% effective concentration (EC50 obtained by real-time PCR of NCT ranged between 49 and 256 µM. EC50 of NCT against HAdV3 was slightly higher than that against serotypes of species D. The selective index (CC50/EC50 ranged between 41 and 60 except for HAdV4 (11.5.Conclusions: These results show that NCT has an antiviral effect against most serotypes of human HAdV inducing keratoconjunctivitis, indicating its possible therapeutic use.Keywords: adenovirus, N-chlorotaurine, epidemic keratoconjunctivitis, antiviral

  17. One-heater flow-through polymerase chain reaction device by heat pipes cooling. (United States)

    Chen, Jyh Jian; Liao, Ming Huei; Li, Kun Tze; Shen, Chia Ming


    This study describes a novel microfluidic reactor capable of flow-through polymerase chain reactions (PCR). For one-heater PCR devices in previous studies, comprehensive simulations and experiments for the chip geometry and the heater arrangement were usually needed before the fabrication of the device. In order to improve the flexibility of the one-heater PCR device, two heat pipes with one fan are used to create the requisite temperature regions in our device. With the integration of one heater onto the chip, the high temperature required for the denaturation stage can be generated at the chip center. By arranging the heat pipes on the opposite sides of the chip, the low temperature needed for the annealing stage is easy to regulate. Numerical calculations and thermal measurements have shown that the temperature distribution in the five-temperature-region PCR chip would be suitable for DNA amplification. In order to ensure temperature uniformity at specific reaction regions, the Re of the sample flow is less than 1. When the microchannel width increases and then decreases gradually between the denaturation and annealing regions, the extension region located in the enlarged part of the channel can be observed numerically and experimentally. From the simulations, the residence time at the extension region with the enlarged channel is 4.25 times longer than that without an enlarged channel at a flow rate of 2 μl/min. The treated surfaces of the flow-through microchannel are characterized using the water contact angle, while the effects of the hydrophilicity of the treated polydimethylsiloxane (PDMS) microchannels on PCR efficiency are determined using gel electrophoresis. By increasing the hydrophilicity of the channel surface after immersing the PDMS substrates into Tween 20 (20%) or BSA (1 mg/ml) solutions, efficient amplifications of DNA segments were proved to occur in our chip device. To our knowledge, our group is the first to introduce heat pipes into

  18. Real Time Polymerase Chain Reaction (rt-PCR): A New Patent to Diagnostic Purposes for Paracoccidioidomycosis. (United States)

    Rocha-Silva, Fabiana; Gomes, Luciana I; Gracielle-Melo, Cidiane; Goes, Alfredo M; Caligiorne, Rachel B


    Paracoccidioidomycosis (PCM) is a systemic mycosis caused by dimorphic fungi Paracoccidioides brasiliensis and Paracoccidioides lutzii. It is prevalent in Latin American, mainly in Brazil. Therefore, PCM has fundamental impact on the Brazilian global economy, especially in public health system, since it is affecting economical active population in different country regions. The present study aimed to standardize the Real Time-Polymerase Chain Reaction (rt-PCR) for an efficient and safe PCM diagnosis amplifying the recombinant protein PB27 gene, only expressed by specimens of Paracoccidioides genus. To standardize a methodology of rt-PCR using species-specific primers and probe designed for annealing in this specific region of the fungi´s genome, amplifying the recombinant protein PB27 gene, only expressed by specimens of Paracoccidioides genus. Followed by design in silico, experiments were performed in vitro to determine rt-PCR specificity, efficiency and genome detection limit. The primers and probe sequences were deposited in Brazilian Coordination of Technological Innovation and Transfer (CTIT), under patent reference number BR1020160078830. The present study demonstrated the rt-PCR applicability for support on diagnosis of paracoccidioidomycosis, presenting low cost, which makes it affordable for public health services in developing countries as Brazil. It is noteworthy that it is necessary to validate this methodology using clinical samples before to use as a safe method of diagnosis. A review of all patents related to this topic was performed and it was shown that, to date, there are no records of patent on kits for paracoccidioidomycosis´s diagnostic. Indeed, there is still a lot to go to reach this goal. The reaction developed was standardized and patented, opening perspectives to molecular diagnosis development for paracoccidioidomycosis, since rt-PCR can be applied to a broad spectrum of infectious diseases. It would need to be tested in biological

  19. Detection of epidermal growth factor receptor mutation in lung cancer by droplet digital polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Xu Q


    Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect

  20. Use of pooled samples for the detection of Salmonella in feces by polymerase chain reaction. (United States)

    Singer, Randall S; Cooke, Cara L; Maddox, Carol W; Isaacson, Richard E; Wallace, Richard L


    Many epidemiological studies of Salmonella rely on conventional bacteriological culture methods to detect Salmonella in fecal samples. These culture-based methods are inefficient for epidemiological studies in populations with a low prevalence of Salmonella. The objective of this study was to optimize a protocol that uses pooled Salmonella enrichment broth cultures of bovine feces and polymerase chain reaction (PCR) for the detection of the invA gene of Salmonella in feces. In one field trial, 196 animals were sampled, and all samples were tested by culture, invA PCR on individual samples, invA PCR on pools of 5 samples, and BAX PCR on individual samples. All assays showed a high agreement on individual samples (kappa > or = 0.75). The invA PCR was run on each of 40 pools and detected 19 of 22 culture-positive pools. In another field trial, 152 samples were taken from 4 dairies, and the invA PCR was performed on pools of 5 samples in addition to bacteriological culture of individual samples. Salmonella was detected in 5 of the 32 pools (7 total positive samples) by both PCR and culture. One pool was PCR-positive but culture-negative. Pooling did not dramatically affect the performance of the invA PCR; most of the culture-positive samples were detected, including all of the samples when there were 4 or more Salmonella colonies on the agar plate. Based on these field trials, invA PCR on pooled samples appears to be an efficient method of Salmonella detection as long as Salmonella loads are not extremely low.

  1. Investigation of polymerase chain reaction assays to improve detection of bacterial involvement in bovine respiratory disease. (United States)

    Bell, Colin J; Blackburn, Paul; Elliott, Mark; Patterson, Tony I A P; Ellison, Sean; Lahuerta-Marin, Angela; Ball, Hywel J


    Bovine respiratory disease (BRD) causes severe economic losses to the cattle farming industry worldwide. The major bacterial organisms contributing to the BRD complex are Mannheimia haemolytica, Histophilus somni, Mycoplasma bovis, Pasteurella multocida, and Trueperella pyogenes. The postmortem detection of these organisms in pneumonic lung tissue is generally conducted using standard culture-based techniques where the presence of therapeutic antibiotics in the tissue can inhibit bacterial isolation. In the current study, conventional and real-time polymerase chain reaction (PCR) assays were used to assess the prevalence of these 5 organisms in grossly pneumonic lung samples from 150 animals submitted for postmortem examination, and the results were compared with those obtained using culture techniques. Mannheimia haemolytica was detected in 51 cases (34%) by PCR and in 33 cases (22%) by culture, H. somni was detected in 35 cases (23.3%) by PCR and in 6 cases (4%) by culture, Myc. bovis was detected in 53 cases (35.3%) by PCR and in 29 cases (19.3%) by culture, P. multocida was detected in 50 cases (33.3%) by PCR and in 31 cases (20.7%) by culture, and T. pyogenes was detected in 42 cases (28%) by PCR and in 31 cases (20.7%) by culture, with all differences being statistically significant. The PCR assays indicated positive results for 111 cases (74%) whereas 82 cases (54.6%) were culture positive. The PCR assays have demonstrated a significantly higher rate of detection of all 5 organisms in cases of pneumonia in cattle in Northern Ireland than was detected by current standard procedures.

  2. Treatment of congenital Chagas' disease diagnosed and followed up by the polymerase chain reaction. (United States)

    Russomando, G; de Tomassone, M M; de Guillen, I; Acosta, N; Vera, N; Almiron, M; Candia, N; Calcena, M F; Figueredo, A


    In 1991 and 1992, a prenatal screening of Trypanosoma cruzi infection was carried out using ELISA and indirect immunofluorescence techniques. A total of 840 blood samples from pregnant women, obtained at the Maternity Ward of the Hospital de Clínicas, National University of Asunción (Asunción, Paraguay), and 1,022 samples from the Regional Hospital of the San Pedro Department of Paraguay were examined. It was observed that 7.7% and 10.5%, respectively, of the pregnant women were serologically positive for infection with T. cruzi. When blood samples obtained from newborns on the day of birth or, at the most, on the first few days afterwards were examined by direct microscopic observation, an incidence of congenital transmission of 3% was found. These results are consistent with those of neighboring countries. When a serologic follow-up was conducted on the newborns until six months of age, the incidence of congenital transmission reached 10%. The same incidence rate was obtained when the samples collected during the first days after birth were examined by the polymerase chain reaction (PCR). Fifty-eight infants born to seropositive mothers were followed-up, two of which were positive by direct microscopic observation at birth, and four who were PCR-positive, but microscopy-negative at birth. None of the infants were positive for IgM at birth. The infected babies were treated with benznidazole and were followed-up by serology and PCR for four years. We conclude that the PCR has a clear advantage over conventional techniques for the early detection of congenital transmission of T. cruzi infection, and for monitoring infants undergoing chemotherapy.

  3. Quantitation of Genital Herpes Virus DNA by Polymerase Chain Reaction and ELISA

    Institute of Scientific and Technical Information of China (English)

    CHENG Peihua(程培华)


    Objective:To detect and quantitate genital herpes simplex virus (HSV) DNA in specimens from 100 patients clinically diagnosed with genital herpes.Methods: Polymerase Chain Reaction (PCR) and enzyme-linked immunosorbent assay (ELISA) were used with a standard curve of DNA copies of HSV as quantitative contrast.Results: Ninety-three cases were confirmed HSV positive and 7 cases were found to be negative. There were 58 cases of HSV-2 (62.4%) and 35 cases of HSV-1 (37.6%) among the 93 positive cases. The number of DNA plasmids ranged from 115 to 1.1×105 per 250μL among the 93 positive samples (mean =7.1×104/250μL). The number of HSV DNA plasmids ranged from 136 to 1.1×105 copies per 250μL (mean =7.6×104) among those with HSV-2, and 115 to 9.4×104 per 250μL (mean =6.3×104) among those with HSV-1. Meanwhile 10μL of extracted and dissolved DNA randomly taken from 8 each of HSV-2 and HSV-1 samples were tested. The number of HSV-2 DNA plasmids ranged from 35 copies to 2.7×104 (Mean =1.8×104) and the number of HSV-1 DNA ranged from 29 to 2.5×104 (Mean = 1.6×104). In the 7 negative cases, the quantity of HSV plasmids was zero.Conclusion: The sensitivity of ELISA quantitation (93%) is equal to that of Southern blot. The sensitivity of PCR for diagnosis is 91%, and 88% for PCR typing.

  4. A fast-and-robust profiler for improving polymerase chain reaction diagnostics.

    Directory of Open Access Journals (Sweden)

    George J Besseris

    Full Text Available Polymerase chain reaction (PCR is an in vitro technology in molecular genetics that progressively amplifies minimal copies of short DNA sequences in a fast and inexpensive manner. However, PCR performance is sensitive to suboptimal processing conditions. Compromised PCR conditions lead to artifacts and bias that downgrade the discriminatory power and reproducibility of the results. Promising attempts to resolve the PCR performance optimization issue have been guided by quality improvement tactics adopted in the past for industrial trials. Thus, orthogonal arrays (OAs have been employed to program quick-and-easy structured experiments. Profiling of influences facilitates the quantification of effects that may counteract the detectability of amplified DNA fragments. Nevertheless, the attractive feature of reducing greatly the amount of work and expenditures by planning trials with saturated-unreplicated OA schemes is known to be relinquished in the subsequent analysis phase. This is because of an inherent incompatibility of ordinary multi-factorial comparison techniques to convert small yet dense datasets. Treating unreplicated-saturated data with either the analysis of variance (ANOVA or regression models destroys the information extraction process. Both of those mentioned approaches are rendered blind to error since the examined effects absorb all available degrees of freedom. Therefore, in lack of approximating an experimental uncertainty, any outcome interpretation is rendered subjective. We propose a profiling method that permits the non-linear maximization of amplicon resolution by eliminating the necessity for direct error estimation. Our approach is distribution-free, calibration-free, simulation-free and sparsity-free with well-known power properties. It is also user-friendly by promoting rudimentary analytics. Testing our method on published amplicon count data, we found that the preponderant effect is the concentration of MgCl2 (p0

  5. Use of Quantitative Polymerase Chain Reaction for Determining Copy Numbers of Transgenes in Lesquerella fendleri

    Directory of Open Access Journals (Sweden)

    Grace Q. Chen


    Full Text Available Problem statement: In transgenic plants, the number of transgene copies could greatly influence the level of expression and genetic stability of the target gene, thus it is important to develop an efficient method for accurate estimation of transgene copies. The quantitative Polymerase Chain Reaction (qPCR technique is becoming more efficient nowadays to determine copy numbers of transgenes in transgenic plants, being used here, for the first time in quantifying copy numbers of transgenes in Lesquerella fendleri. Approach: The system utilized a known one copy gene, LfKCS4/5, from L. fendleri as an endogenous calibrator and the threshold Crossing point (Ct measured by Applied Biosystem 7500 system to calculate the copy numbers of transgenes in primary transgenic lines (T0 generation. Results: The qPCR condition was optimized and each primer set had a PCR efficiency of 0.99 or 1.01. Our data demonstrated unambiguous 2-fold discrimination of the copy number of β-glucuronidase gene (gusA and hygromycine phosphotransferase II (hptII genes in 12 T0 lines. Most of the lines contained one or two copies of each gene. Eight out of 12 samples (66.7% showed more copies of gusA gene than that of hptII gene, suggesting rearrangements of the Transferred (T-DNA. Possible modifications of the T-DNA cassette in L. fendleri are discussed based on main models of T-DNA integration in the plant genome. Conclusion: The qPCR described in this study is an efficient method and it is particularly useful in identification and selection of transgenic plants with desirable copy numbers at early stage.

  6. Diagnosis of leishmaniasis in Maltese dogs with the aid of the polymerase chain reaction. (United States)

    Headington, C E; Barbara, C H; Lambson, B E; Hart, D T; Barker, D C


    Visceral leishmaniasis due to infection with Leishmania infantum (a member of the L. donovani complex) has been known in Malta since the beginning of the century. In 1946, when human diseases became compulsorily notifiable on the islands, the leishmaniasis figures were 1264 visceral cases, 36 cutaneous cases and 5 unspecified. Five cases of cutaneous infection were reported in 1997 and 23 cases of cutaneous and 3 of visceral infection in January-October 1998. There may be considerable under-reporting of the disease. Figures of between 18% and 47% have been reported for canine leishmaniasis. This large discrepancy between reservoir and human hosts suggests that the canine reservoir could be a serious threat and is worthy of careful examination. This pilot study was carried out to determine the proportion of dogs serologically positive for leishmaniasis in order to assess the necessity for a possible control programme in Malta. Using 60 canine blood samples from the Maltese islands, we tested for deoxyribonucleic acid (DNA) of the L. donovani complex using the polymerase chain reaction (PCR). The samples had all been subjected to the indirect immunofluorescent antibody test (IFAT) and a direct comparison was made. DNA was extracted using the phenol/chloroform method and amplified with primers specific for kinetoplast mini-circle DNA of the L. donovani complex and L. major, Southern blotted and hybridized with a radio-labelled probe specific for the L. donovani complex. Twelve of the samples gave positive results in the IFAT, whilst 37 (62%) were positive by PCR and hybridization. All samples from 36 dogs from a non-endemic area in the UK were negative by PCR. Five of the 12 samples positive by IFAT gave negative PCR results.

  7. Multiplex Polymerase Chain Reaction for Detection of Gastrointestinal Pathogens in Migrant Workers in Qatar (United States)

    Humphrey, John M.; Ranbhise, Sanjay; Ibrahim, Emad; Al-Romaihi, Hamad E.; Farag, Elmoubasher; Abu-Raddad, Laith J.; Glesby, Marshall J.


    The causes of infectious diarrhea among the migrant worker population in Qatar are not well understood. We conducted a prospective observational study to understand the demographic and clinical characteristics and infectious causes of diarrhea among migrant workers in Doha, Qatar. A total of 126 male workers presenting to the Qatar Red Crescent Worker's Health Center outpatient clinic or emergency department were studied over a 5-month period in 2015–2016. Epidemiologic surveys were administered to all subjects and the prevalence of 22 different stool pathogens was determined using multiplex polymerase chain reaction (PCR) (FilmArray® Gastrointestinal PCR). A target pathogen was identified in 62.7% of subjects. Enteropathogenic Escherichia coli was the most prevalent pathogen and was detected in 24.6% of subjects, followed by Salmonella (22.2%), enteroaggregative E. coli (15.1%), Giardia lamblia (9.5%), and enterotoxigenic E. coli (8.7%). Multiple pathogens were identified in 49.3% of positive stool samples. In a multivariable analysis, the presence of a heart rate ≥ 90 (adjusted odds ratio [OR] = 3.7, 95% confidence interval [CI] = 1.4–10.0) and > 5 fecal leukocytes/high-power field (adjusted OR = 2.8, 95% CI = 1.2–7.0) were significant predictors of detecting an acute inflammatory pathogen by PCR. Use of multiplex PCR enabled the detection of gastrointestinal pathogens in a high proportion of cases, illustrating the utility of this diagnostic tool in epidemiologic studies of infectious diarrhea. PMID:27928081

  8. Identification of fungemia agents using the polymerase chain reaction and restriction fragment length polymorphism analysis. (United States)

    Santos, M S; Souza, E S; S Junior, R M; Talhari, S; Souza, J V B


    Prompt and specific identification of fungemia agents is important in order to define clinical treatment. However, in most cases conventional culture identification can be considered to be time-consuming and not without errors. The aim of the present study was to identify the following fungemia agents: Candida albicans, Candida parapsilosis, Candida tropicalis, Candida glabrata, Cryptococcus neoformans, Cryptococcus gattii, and Histoplasma capsulatum using the polymerase chain reaction and restriction fragment length polymorphism analysis (PCR/RFLP). More specifically: a) to evaluate 3 different amplification regions, b) to investigate 3 different restriction enzymes, and c) to use the best PCR/RFLP procedure to indentify 60 fungemia agents from a culture collection. All 3 pairs of primers (ITS1/ITS4, NL4/ITS5 and Primer1/Primer2) were able to amplify DNA from the reference strains. However, the size of these PCR products did not permit the identification of all the species studied. Three restriction enzymes were used to digest the PCR products: HaeIII, Ddel and Bfal. Among the combinations of pairs of primers and restriction enzymes, only one (primer pair NL4/ITS5 and restriction enzyme Ddel) produced a specific RFLP pattern for each microorganism studied. Sixty cultures of fungemia agents (selected from the culture collection of Fundação de Medicina Tropical do Amazonas--FMTAM) were correctly identified by PCR/RFLP using the prime pair NL4/ITS5 and Ddel. We conclude that the method proved to be both simple and reproducible, and may offer potential advantages over phenotyping methods.

  9. Polymerase Chain Reaction: An Important Tool for Early Diagnosis of Leptospirosis Cases (United States)

    Mullan, Summaiya


    Introduction Various diagnostic methods like Microscopic Agglutination Test (MAT), IgM ELISA, Isolation of Leptospira from the clinical specimen, Rapid leptocheck tests etc., are available for diagnosis of leptospirosis. Polymerase Chain Reaction (PCR) is used for diagnosis of various diseases of infectious origin including leptospirosis but there is paucity of data about comparison of PCR with other available method of diagnosis of leptospirosis. Aim The aim of the study was to detect the leptospiral DNA by PCR method and to compare the results of PCR with other available diagnostic methods used for diagnosis of suspected leptospirosis cases in acute phase of illness. Materials and Methods A total of 207 blood samples were obtained from suspected patients of leptospirosis admitted in New Civil Hospital, a tertiary care hospital in South Gujarat, during the period of July 2008 to November 2008. These blood samples were subjected to Rapid leptocheck, IgM ELISA, MAT test to detect (IgG or IgM) antibody level, Leptospira culture and PCR. Results In early phase of the disease, Rapid leptocheck test gave 44% detection, but along with PCR seropositivity reached upto 71%. Detection rate by IgM ELISA was 59% which increased to 80% with PCR. By MAT seropositivity was 57% but combined seropositivity of MAT with PCR was 78%. Sensitivity and specificity of PCR as compared to MAT (Gold standard) was 52% and 79% respectively. Leptospira was not growing in culture. Conclusion In present study, PCR picked up to 50% of cases which were negative by other serological tests so these finding suggest that PCR should be used routinely in acute phase of disease.

  10. Use of polymerase chain reaction in the diagnosis of Whipple's disease. (United States)

    Kono, Masanori; Yamamoto, Kei; Nagamatsu, Maki; Kutsuna, Satoshi


    Whipple's disease, a systemic, chronic infectious disease caused by Tropheryma whipplei, is extremely rare in Asian populations. A correct diagnosis is necessary due to its high mortality rate. Unfortunately, patients are apt to be misdiagnosed with connective tissue diseases since they typically present with arthritis or arthralgia. There are three diagnostic tools for Whipple's disease using intestinal tissues: 1) periodic acid-Schiff (PAS)-positive macrophages; 2) electron microscopic observation; and 3) polymerase chain reaction (PCR). It is challenging to diagnose this disease in the absence of histological findings, especially in Japan, where the clinical protocol currently used to make the diagnosis needs improvement, although symptomology and PCR results may be sufficient. Herein, we investigated a 24-year-old Japanese woman who had suffered from intermittent fever, migratory arthralgia, and watery diarrhea for several months. Her biopsied intestinal tissue was negative for foamy macrophages and PAS-positive cells, and electron microscopy did not provide diagnostic insight. PCR amplification of the specimens, however, successfully revealed T. whipplei. Whipple's disease was diagnosed based on a positive PCR result and strong clinical suspicion. The patient was treated parenterally with ceftriaxone (2 g daily) for two weeks, followed by oral treatment with 160 mg trimethoprim and 800 mg sulfamethoxazole twice per day. After one month of treatment, her symptoms disappeared and inflammatory markers returned to normal levels. This case illustrates the practicality and effectiveness of a PCR-based diagnostic test in combination with clinical suspicion to correctly diagnose Whipple's disease, especially in cases when a histological examination does not provide insight.

  11. Multiplex polymerase chain reaction test for the diagnosis of acute viral hepatitis A. (United States)

    Heo, Nae-Yun; Lim, Young-Suk; An, Jihyun; Ko, Sun-Young; Oh, Heung-Bum


    The early diagnosis of acute hepatitis A (AHA) is hindered because serum IgM against hepatitis A virus (HAV) can yield false-negative results during the window period. This study evaluated the diagnostic accuracy of a polymerase chain reaction (PCR) kit for HAV RNA for the diagnosis of AHA. Samples were collected from 136 patients with acute severe hepatitis at their admission to Asan Medical Center between June 2010 and July 2010. Samples were analyzed for serum IgM anti-HAV using an immunoassay test and for qualitative HAV RNA using the Magicplex HepaTrio PCR test kit. The diagnostic accuracies of these methods were tested on the basis of clinical and laboratory diagnoses of AHA. The concordance rate and kappa value between IgM anti-HAV and HAV RNA PCR were 88.2% and 0.707, respectively. For the diagnosis of AHA, the sensitivity and specificity of IgM anti-HAV were 90.7% and 100%, respectively, when an "equivocal" result was regarded as positive; and 79.1% and 100%, respectively, when an "equivocal" result was regarded as negative. The sensitivity and specificity of HAV RNA PCR were 81.4% and 100%, respectively. All four patients with negative IgM anti-HAV and positive HAV RNA PCR results and all four patients with equivocal IgM anti-HAV RNA and positive HAV RNA PCR results were eventually diagnosed with AHA. The qualitative HAV RNA PCR test has an equivalent diagnostic accuracy for AHA compared to IgM anti-HAV and may be more sensitive during the window period.


    Directory of Open Access Journals (Sweden)

    Yu. Rud


    Full Text Available Purpose. To analyse the nucleotide sequences of salmonids Y chromosome and to determine the fragment for specific primers selection and also to develop the PCR based method for sex determination in huchen H. hucho. Methodology. Using the ClustalW algorithm in MEGA 5.2, the nucleotide sequences of salmonids Y chromosome were analysed. For developing of method for rapid diagnostic of huchen sex the polymerase chain reaction (PCR assay was used. Tne nucleotide sequences of amplified products were investigated by sequencing. Findings. Using PCR assay the method of sex determination in huchen H. hucho was developed. It was shown that specific PCR products in size of 450 nucleotides were visible in huchen males only. In addition we showed that selected primers can be used in sex determination of rainbow trout Oncorhynchus mykiss and this fact is proved the high rate of sdY locus similarity and its wide destribution in salmonids. Originality. The nucleotide sequences of salmonids Y chromosome were analysed and highly conservative region of sdY locus for specific primers selection, which covers sex-linked marker, was identified. Practical Value. Rapid sex determination in huchen by the developed method will allow to identify reversal males in process of gormonal sex reversion. At the stage of reversal males screening, this method will allow to identify the genotypic males (XY in experimental group and discard them because only phenotypic males with XX genotype (reversal males must be used in the crosses with native femelas for getting of 100 % all-females stock.

  13. Polymerase chain reaction targeting insertion sequence for the diagnosis of extrapulmonary tuberculosis

    Directory of Open Access Journals (Sweden)

    V Makeshkumar


    Full Text Available Background & objectives: Diagnosis of extrapulmonary tuberculosis (EPTB is difficult using conventional diagnostic methods. This study was conducted to evaluate the use of polymerase chain reaction (PCR in diagnosis of definitive and probable extrapulmonary tuberculosis patients, and to assess the performance of insertion sequence (IS 6110 based PCR assay as compared to conventional culture by Lowenstein-Jensen (LJ method for the diagnosis of EPTB. Methods: A total of 178 non repeated clinical specimens were collected from clinically suspected extrapulmonary tuberculosis patients. The specimens included 59 ascitic fluid, 54 pleural fluid, 25 cerebrospinal fluid (CSF, 12 fine needle aspiration (FNA, 8 urine, 7 pus, 6 synovial fluid, 2 skin tissue, one pericardial fluid, one liver abscess, one pancreatic cyst fluid, one omental biopsy and one semen sample. All these clinical samples were subjected to Ziehl-Neelsen staining (ZN for acid fast bacilli (AFB and culture on LJ medium. PCR was performed by targeting 123bp fragment of insertion sequence IS6110 of Mycobacterium tuberculosis (MTB. Results: Of the 178 specimens, 10 (5.61% were ZN smear positive for AFB, six (3.37% were L-J culture positive from 10 AFB smear positive cases and 48 (26.96% were PCR IS 6110 positive for M. tuberculosis. Interpretation & conclusions: PCR using IS6110 primer was able to pick up more EPTB patients compared to conventional L-J culture method for detection of M. tuberculosis. False positive PCR IS6110 in three CSF samples may be due to latent TB infection which was limitation in this study.

  14. Evaluation of polymerase chain reaction in nerve biopsy specimens of patients with Hansen's disease. (United States)

    Tiwari, Vandana; Malhotra, Kiranpreet; Khan, Kainat; Maurya, Pradeep K; Singh, Ajai Kumar; Thacker, Anup Kumar; Husain, Nuzhat; Kulshreshtha, Dinkar


    Pure neuritic variety of leprosy (PNL) presents as peripheral neuropathy with absent skin lesions and negative skin smears. Diagnosing PNL is an uphill task as most of these patients have nonspecific changes on nerve biopsy. In such circumstances, additional molecular diagnostic tools like polymerase chain reaction (PCR) has proven to be useful in diagnosing leprosy. The present study was planned to evaluate the role of PCR in nerve biopsy specimens of patients with PNL. Patients attending the neuromuscular clinic from January 2013 to June 2014 with mononeuropathy multiplex underwent detailed diagnostic evaluation to ascertain the cause of neuropathy. Patients where this evaluation failed to establish an etiology underwent a nerve biopsy. Nerve biopsy was done in 52 patients, of which 35 were diagnosed as pure neuritic leprosy. Definite leprosy with positive wade fite staining for lepra bacilli was seen in 13 patients and 22 biopsies revealed a probable leprosy without lepra bacilli being identified. PCR for M. leprae was positive in 22 patients (62%). 12 of the 13 cases with definite leprosy on histopathology were PCR positive while in the AFB negative group, PCR was positive in 10 cases. PCR had a sensitivity of 92.3%, specificity of 54.5%. The positive and negative predictive value of PCR was 54.5% and 92.3% respectively. PCR helps in diagnosing PNL in doubtful cases. A positive PCR increases the sensitivity of detection of M. leprae especially in cases of probable PNL group where AFB cannot be demonstrated on histopathology. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Polymerase chain reaction (PCR) amplification of a nucleoprotein gene sequence of infectious hematopoietic necrosis virus (United States)

    Arakawa, C.K.; Deering, R.E.; Higman, K.H.; Oshima, K.H.; O'Hara, P.J.; Winton, J.R.


    The polymerase chain reaction [PCR) was used to amplify a portion of the nucleoprotein [NI gene of infectious hematopoietic necrosis virus (IHNV). Using a published sequence for the Round Butte isolate of IHNV, a pair of PCR pnmers was synthesized that spanned a 252 nucleotide region of the N gene from residue 319 to residue 570 of the open reading frame. This region included a 30 nucleotide target sequence for a synthetic oligonucleotide probe developed for detection of IHNV N gene messenger RNA. After 25 cycles of amplification of either messenger or genomic RNA, the PCR product (DNA) of the expected size was easily visible on agarose gels stained with ethidium bromide. The specificity of the amplified DNA was confirmed by Southern and dot-blot analysis using the biotinylated oligonucleotide probe. The PCR was able to amplify the N gene sequence of purified genomic RNA from isolates of IHNV representing 5 different electropherotypes. Using the IHNV primer set, no PCR product was obtained from viral hemorrhagic septicemia virus RNA, but 2 higher molecular weight products were synthesized from hirame rhabdovirus RNA that did not hybridize with the biotinylated probe. The PCR could be efficiently performed with all IHNV genomic RNA template concentrations tested (1 ng to 1 pg). The lowest level of sensitivity was not determined. The PCR was used to amplify RNA extracted from infected cell cultures and selected tissues of Infected rainbow trout. The combination of PCR and nucleic acid probe promises to provide a detection method for IHNV that is rapid, h~ghly specific, and sensitive.

  16. A new era of uveitis: impact of polymerase chain reaction in intraocular inflammatory diseases. (United States)

    Mochizuki, Manabu; Sugita, Sunao; Kamoi, Koju; Takase, Hiroshi


    Uveitis is a sight-threatening intraocular inflammatory disorder which may occur from both infectious and non-infectious or autoimmune causes. The frequency of infectious uveitis and autoimmune uveitis varies depending on countries and regions. According to a nationwide survey conducted by the Japanese Ocular Inflammation Society, infectious and non-infectious uveitis accounted for 16.4 and 50.1% of new patients, respectively while the remaining 33.5% of new uveitis cases were not classified or were idiopathic uveitis. Infectious uveitis is particularly important because it causes tissue damage to the eye and may result in blindness unless treated. However, it can be treated if the pathogenic microorganisms are identified promptly and accurately. Remarkable advancements in molecular and immunological technologies have been made in the last decade, and the diagnosis of infectious uveitis has been greatly improved by the application of molecular and immunological investigations, particularly polymerase chain reaction (PCR). PCR performed on a small amount of ocular samples provides a prompt, sensitive, and specific molecular diagnosis of pathogenic microorganisms in the eye. This technology has opened a new era in the diagnosis and treatment of uveitis, enabling physicians to establish new clinical entities of uveitis caused by infectious microorganisms, identify pathogens in the eyes of many patients with uveitis, and determine prompt diagnosis and appropriate therapy. Here we review the PCR process, new PCR tests specialized for ocular diseases, microorganisms detected by the PCR tests, diseases in the eye caused by these microorganisms, and the clinical characteristics, diagnosis, and therapy of uveitis.

  17. A novel multiplex polymerase chain reaction assay for profile analyses of gene expression in peripheral blood

    Directory of Open Access Journals (Sweden)

    Jia Xingwang


    Full Text Available Abstract Background Studies have demonstrated that inflammation has a key role in the pathogenesis of atherosclerosis due to the abnormal gene expressions of multiple cytokines. We established an accurate and precise method to observe gene expression in whole blood that might provide specific diagnostic information for coronary artery disease (CAD and other related diseases. Methods The fifteen selected CAD-related genes (IL1B, IL6, IL8, IFNG, MCP-1, VWF, MTHFR, SELL, TNFalpha, ubiquitin, MCSF, ICAM1, ID2, HMOX1 and LDLR and two housekeeping genes (ACTB and GK as internal references have been measured simultaneously with a newly developed multiplex polymerase chain reaction (multi-PCR method. Moreover, the precision was evaluated, and a procedure for distinguishing patients from the normal population has been developed based upon analyses of peripheral blood. A total of 148 subjects were divided into group A (control group without plaques, group B (calcified plaques and group C (non-calcified plaques, and combination group according dual-source CT criteria. Gene expression in blood was analyzed by multi-PCR, and levels of glucose and lipids measured in 50 subjects to explore the relationship among them. Results The precision results of the multi-PCR system revealed within-run and between-run CV values of 3.695–12.537% and 4.405–13.405%, respectively. The profiles of cytokine gene expression in peripheral blood were set: a positive correlation between glucose and MCSF, HMOX1 or TNFalpha were found. We also found that triglyceride levels were negatively correlated with SELL gene expression in 50 subjects. Compared with controls, gene expression levels of IL1B, IL6, IL8 and MCP-1 increased significantly in group C. Conclusions A new multiple gene expression analysis system has been developed. The primary data suggested that gene expression was related to CAD. This system might be used for risk assessment of CVDs and other related diseases.

  18. Biosynthetic enhancement of the detection of bacteria by the polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Julie S Do

    Full Text Available Molecular viability testing (MVT was previously reported to specifically detect viable bacterial cells in complex samples. In MVT, brief nutritional stimulation induces viable cells, but not non-viable cells, to produce abundant amounts of species-specific ribosomal RNA precursors (pre-rRNA. Quantitative polymerase chain reaction (qPCR is used to quantify specific pre-rRNAs in a stimulated aliquot relative to a non-stimulated control. In addition to excluding background signal from non-viable cells and from free DNA, we report here that MVT increases the analytical sensitivity of qPCR when detecting viable cells. Side-by-side limit-of-detection comparisons showed that MVT is 5-fold to >10-fold more sensitive than standard (static DNA-targeted qPCR when detecting diverse bacterial pathogens (Aeromonas hydrophila, Acinetobacter baumannii, Listeria monocytogenes, Mycobacterium avium, and Staphylococcus aureus in serum, milk, and tap water. Sensitivity enhancement may come from the elevated copy number of pre-rRNA relative to genomic DNA, and also from the ratiometric measurement which reduces ambiguity associated with weak or borderline signals. We also report that MVT eliminates false positive signals from bacteria that have been inactivated by moderately elevated temperatures (pasteurization, a condition that can confound widely-used cellular integrity tests that utilize membrane-impermeant compounds such as propidium iodide (PI or propidium monoazide (PMA to differentiate viable from inactivated bacteria. MVT enables the sensitive and specific detection of very small numbers of viable bacteria in complex matrices.

  19. [Value of polymerase chain reaction in serum for the diagnosis of enteroviral meningitis]. (United States)

    Marque Juillet, S; Lion, M; Pilmis, B; Tomini, E; Dommergues, M-A; Laporte, S; Foucaud, P


    Enteroviruses (EV) are a common cause of aseptic meningitis in children. Virological diagnosis of EV meningitis is currently based on the detection of the viral genome in the cerebrospinal fluid (CSF). This study attempted to determine the correlation and the temporality of the polymerase chain reaction (PCR) assay in serum and CSF and to evaluate the possibility of diagnosing EV infection only on the serum PCR. The EV genome was sought by RT real-time PCR (Smart Cycler EV Primer and Probe Set(®), Cepheid) in CSF and serum, collected at the same time, for all children who underwent a lumbar puncture for suspected meningitis, between 1 June and 31 July 2010 at the Versailles Hospital. Forty-four patients were included in the study. EV infection was documented for 22 of them. In 10 patients, the EV genome was detected in CSF only; in 3 patients in serum only, and in 9 patients in both. Among patients with acute EV neurological infection, viremic children were significantly younger (1.6 months versus 5.8 years; Pvalue of EV PCR in serum. It suggests that in some children and under certain conditions (age >3 months, clinical and biological compatibility with a viral infection, no previous antibiotic therapy, time from symptom onset to blood sampling <30 h, PCR in serum analyzed within 3h), PCR in serum, when positive, is a possible alternative. Therefore, it may be possible to diagnose EV infection without performing a lumbar puncture in a limited number of young children (11.4% of our suspected cases). This study needs to be reinforced by a multicenter study with a broader panel of patients. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  20. Polymerase chain reaction with two molecular targets in mucosal leishmaniasis' diagnosis: a validation study

    Directory of Open Access Journals (Sweden)

    Clemencia Ovalle Bracho


    Full Text Available We validated the polymerase chain reaction (PCR with a composite reference standard in 61 patients clinically suspected of having mucosal leishmaniasis, 36 of which were cases and 25 were non-cases according to this reference standard. Patient classification and test application were carried out independently by two blind observers. One pair of primers was used to amplify a fragment of 120 bp in the conserved region of kDNA and another pair was used to amplify the internal transcript spacers (ITS rDNA. PCR showed 68.6% (95% CI 59.2-72.6 sensitivity and 92% (95% CI 78.9-97.7 specificity; positive likelihood ratio: 8.6 (95% CI 2.8-31.3 and negative likelihood ratio: 0.3 (95% CI 0.3-0.5, when kDNA molecular target was amplified. The test performed better on sensitivity using this target compared to the ITS rDNA molecular target which showed 40% (95% CI 31.5-42.3 sensitivity and 96% (95% CI 84.1-99.3 specificity; positive likelihood ratio: 10 (95% CI 2.0-58.8 and negative likelihood ratio: 0.6 (95% CI 0.6-0.8. The inter-observer agreement was excellent for both tests. Based upon results obtained and due to low performance of conventional methods for diagnosing mucosal leishmaniasis, we consider PCR with kDNA as molecular target is a useful diagnostic test and the ITS rDNA molecular target is useful when the aim is to identify species.

  1. Mycoplasma bovis real-time polymerase chain reaction assay validation and diagnostic performance. (United States)

    Clothier, Kristin A; Jordan, Dianna M; Thompson, Curtis J; Kinyon, Joann M; Frana, Timothy S; Strait, Erin L


    Mycoplasma bovis is an important bacterial pathogen in cattle, producing a variety of clinical diseases. The organism, which requires specialized culture conditions and extended incubation times to isolate and identify, is frequently associated with concurrent infection with other pathogens which can potentially be more easily identified. Real-time polymerase chain reaction (real-time PCR) is a valuable diagnostic technique that can rapidly identify infectious agents in clinical specimens. A real-time PCR assay was designed based on the uvrC gene to identify M. bovis in diagnostic samples. Using culture as the gold standard test, the assay performed well in a variety of diagnostic matrices. Initial validation testing was conducted on 122 milk samples (sensitivity: 88.9% [95% confidence interval (CI): 68.4-100%], specificity: 100%); 154 lung tissues (sensitivity: 89.0% [95% CI: 83.1-94.9%], specificity: 97.8% [95% CI: 93.5-100%]); 70 joint tissue/fluid specimens (sensitivity: 92.3% [95% CI: 82.1-100%], specificity: 95.5% [95% CI: 89.3-100%]); and 26 nasal swabs (sensitivity: 75.0% [95% CI: 45.0-100%], specificity: 83.3% [95% CI: 66.1-100%]). Low numbers of other sample matrices showed good agreement between results of culture and PCR. A review of clinical cases from 2009 revealed that, in general, PCR was used much more frequently than culture and provided useful diagnostic information in conjunction with clinical signs, signalment, and gross and histopathologic lesions. Diagnostic performance of the real-time PCR assay developed as a testing method indicates that it is a rapid, accurate assay that is adaptable to a variety of PCR platforms and can provide reliable results on an array of clinical samples.

  2. Comparison of nasopharyngeal culture, polymerase chain reaction (PCR) and serological test for diagnosis of pertussis. (United States)

    Cengiz, Ali Bülent; Yildirim, Inci; Ceyhan, Mehmet; Seçmeer, Gülten; Gür, Deniz; Kara, Ateş


    This prospective study, which was designed to compare nasopharyngeal culture, polymerase chain reaction (PCR) and serology in the diagnosis of pertussis, covered 35 children aged between 0 and 16 who were admitted to Hacettepe University Ihsan Doğramaci Children's Hospital between 1 March 2005 and 31 August 2006 with coughing for 7 days or longer, paroxysmal cough of any duration, or cough with inspiratory whoop and/or vomiting (or apnea) after coughs. The demographic data and vaccination history of the patients were recorded. During the initial examination, samples were taken from the posterior nasopharynx for Bordetella pertussis (B. pertussis) culture and PCR analysis. In order to determine antibody positivity and antibody levels against B. pertussis antigens, serum samples were taken during the initial examination (acute phase) and two weeks later (convalescent phase). In the first serum sample, immunoglobulin M (IgM) was determined against pertussis toxin. In the first and second samples, IgA and IgG antibodies were evaluated against pertussis toxin and filamentous hemagglutinin. Culture yielded negative results in all of the patients. PCR was positive in two cases (5.7%). In the PCR-positive patients, IgM, IgA and IgG type anti-pertussis antibodies were found to be positive in the first serum samples, and IgA and IgG antibodies were found to be positive in the second serum samples. Therefore, it was considered that serology could be as sensitive as PCR when type IgM, IgA and IgG antibodies were found to be positive against a minimum of two antigens of B. pertussis. In conclusion, both PCR and serologic tests--if evaluating all types of antibodies to a minimum of two antigens of B. pertussis obtained in both acute and convalescent sera--could be more sensitive than culture in the diagnosis of pertussis.

  3. Does Polymerase Chain Reaction of Tissue Specimens Aid in the Diagnosis of Tuberculosis?

    Directory of Open Access Journals (Sweden)

    Yoo Jin Lee


    Full Text Available Background Mycobacterial culture is the gold standard test for diagnosing tuberculosis (TB, but it is time-consuming. Polymerase chain reaction (PCR is a highly sensitive and specific method that can reduce the time required for diagnosis. The diagnostic efficacy of PCR differs, so this study determined the actual sensitivity of TB-PCR in tissue specimens. Methods We retrospectively reviewed 574 cases. The results of the nested PCR of the IS6110 gene, mycobacterial culture, TB-specific antigen-induced interferon-γ release assay (IGRA, acid-fast bacilli (AFB staining, and histological findings were evaluated. Results The positivity rates were 17.6% for PCR, 3.3% for the AFB stain, 22.2% for mycobacterial culture, and 55.4% for IGRA. PCR had a low sensitivity (51.1% and a high specificity (86.3% based on the culture results of other studies. The sensitivity was higher (65.5% in cases with necrotizing granuloma but showed the highest sensitivity (66.7% in those with necrosis only. The concordance rate between the methods indicated that PCR was the best method compared to mycobacterial culture, and the concordance rate increased for the methods using positive result for PCR or histologic features. Conclusions PCR of tissue specimens is a good alternative to detect tuberculosis, but it may not be as sensitive as previously suggested. Its reliability may also be influenced by some histological features. Our data showed a higher sensitivity when specimens contained necrosis, which indicated that only specimens with necrosis should be used for PCR to detect tuberculosis.

  4. Differential diagnosis of Taenia saginata and Taenia solium infections: from DNA probes to polymerase chain reaction. (United States)

    González, Luis Miguel; Montero, Estrella; Sciutto, Edda; Harrison, Leslie J S; Parkhouse, R Michael E; Garate, Teresa


    The objective of this work was the rapid and easy differential diagnosis of Taenia saginata and T. solium. First, a T. saginata size-selected genomic deoxyribonucleic acid (gDNA) library was constructed in the vector lambda gt10 using the 2-4 kb fraction from the parasite DNA digested with EcoR1, under 'star' conditions. After differential screening of the library and hybridization analysis with DNA from T. saginata, T. solium, T. taeniaeformis, T. crassiceps, and Echinococcus granulosus (bovine, porcine, and human), 2 recombinant phages were selected. They were designated HDP1 and HDP2. HDP1 reacted specifically with T. saginata DNA, and HDP2 recognized DNA from both T. saginata and T. solium. The 2 DNA probes were then sequenced and further characterized. HDP1 was a repetitive sequence with a 53 bp monomeric unit repeated 24 times in direct tandem along the 1272 bp fragment, while the 3954 bp HDP2 was not a repetitive sequence. Using the sequencing data, oligonucleotides were designed and used in a polymerase chain reaction (PCR). The 2 selected oligonucleotides from probe HDP1 (PTs4F1 and PTs4R1) specifically amplified gDNA from T. saginata, but not T. solium or other related cestodes, with a sensitivity of < 10 pg of T. saginata gDNA, about the quantity of DNA in one taeniid egg. The 3 oligonucleotides selected from the HDP2 sequence (PTs7S35F1, PTs7S35F2, and PTs7S35R1) allowed the differential amplification of gDNA from T. saginata, T. solium and E. granulosus in a multiplex PCR, again with a sensitivity of < 10 pg. These diagnostic tools have immediate application in the differential diagnosis of T. solium and T. saginata in humans and in the diagnosis of dubious cysts in the slaughterhouse. We also hope to apply them to epidemiological surveys of, for example, soil and water in endemic areas.

  5. Catalytic antibody light chain capable of cleaving a chemokine receptor CCR-5 peptide with a high reaction rate constant. (United States)

    Mitsuda, Yukie; Hifumi, Emi; Tsuruhata, Kumi; Fujinami, Hiroko; Yamamoto, Naoki; Uda, Taizo


    A monoclonal antibody (MAb), ECL2B-2, was obtained by immunizing a peptide possessing a part of a sequence of a chemokine receptor, CCR-5, which is present as a membrane protein on the macrophage surface, and which plays an important role in human immunodeficiency virus (HIV) infection. From the DNA and the deduced amino acid sequences of the light and heavy chains of ECL2B-2 MAb, molecular modeling was conducted to calculate the steric conformation of the antibody. Modeling suggested that the structure of ECL2B-2 could possess one or two catalytic triad(s), composed of Asp(1), Ser(27a) (or Ser(27e)), and His(93) (or His(27d)), in the light chain of ECL2B-2. The three amino acid residues, Asp(1), Ser(27a), and His(93), are identical to those of catalytic antibody light chains such as VIPase and i41SL1-2. The light chain of ECL2B-2 MAb degraded the antigenic peptide CCR-5 within about 100 h. Surprisingly, the light chain had a very high catalytic reaction rate constant (k(cat)) of 2.23 min(-1), which is greater by factors of tens to hundreds than those of natural catalytic antibodies obtained previously. The heavy chain of ECL2B-2 MAb, which has no catalytic triad because of a lack of His residue, did not degrade the CCR-5 peptide.

  6. Novel assay of competitively differentiated polymerase chain reaction for screening point mutation of hepatitis B virus

    Institute of Scientific and Technical Information of China (English)

    Xiao-Mou Peng; Xue-Juan Chen; Jian-Guo Li; Lin Gu; Yang-Su Huang; Zhi-Liang Gao


    AIM: Point mutation, one of the commonest gene mutations,is the most important molecular pathogenesis of cancer and chronic infection. The commonest methods for detection of point mutation are based on polymerase chain reaction (PCR). These techniques, however, cannot be used in large scale screening since they are neither accurate nor simple.For this reason, this study established a novel method of competitively differentiated PCR (CD-PCR) for screening point mutation in clinical practice.METHODS: Two competitively differentiated primers for mutant-type and wild-type templates respectively with an identically complemented region in 3′ end except for last 2base pairs and a different non-complemented region in 5′end were designed. Thus, competitive amplification might be carried out at a lower annealing temperature at first, and then differentiated amplification at a higher annealing temperature when primers could not combine with initial templates. The amplification was performed in one-tube.The products of CD-PCR were detected using microplate hybridization assay. CD-PCR was evaluated by detecting G1896A variant of hepatitis B virus (HBV) in form of recombinant plasmids and in sera from patients with hepatitis B, and compared with allele-specific PCR (AS-PCR) and competitive AS-PCR.RESULTS: CD-PCR was successfully established. It could clearly distinguish wild-type and mutant-type plasmid DNA of G1896A variant when the amount of plasmid DNA was between 102-108copies/reaction, while for AS-PCR and competitive AS-PCR, the DNA amount was between 102-104copies/reaction. CD-PCR could detect one copy of G1896A variant among 10-100 copies of wild-type plasmid DNA. The specificity of CD-PCR was higher than those of AS-PCR and competitive AS-PCR in the detection of HBV G1896A variant in sera from patients with hepatitis B. CD-PCR was independent of the amount of HBV DNA in serum. HBV G1896A variant was more often found in HBeAg (-) patients with a lower level of

  7. Chain extension and branching of poly(L-lactic acid produced by reaction with a DGEBA-based epoxy resin

    Directory of Open Access Journals (Sweden)


    Full Text Available Dicarboxylated poly(L-lactic acid (PLLA was synthesized by reacting succinic anhydride with L-lactic acid prepolymer prepared by melt polycondensation. PLLA and epoxy resin based on diglycidyl ether of bisphenol A (DGEBA copolymers were prepared by chain extension of dicarboxylated PLLA with DGEBA. Infrared spectra confirmed the formation of dicarboxylated PLLA and PLLA/DGEBA copolymer. Influences of reaction temperature, reaction time, and the amount of DGEBA on the molecular weight and gel content of PLLA/DGEBA copolymer were studied. The viscosity average molecular weight of PLLA/DGEBA copolymer reached 87 900 when reaction temperature, reaction time, and mol ratio of dicarboxylated PLLA to DGEBA is 150°C, 30 min, and 1:1 respectively, while gel content of PLLA/DGEBA copolymer is almost zero.

  8. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.


    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control....... The selectivity of the assay was evaluated against 155 strains, including 32 E. coli O157, 38 E. coli non-O157, and 85 non-E. coli. It was shown to be highly inclusive (100%) and exclusive (100%). The assay has a 100% detection probability of approximately 2 x 10(3) cells per reaction....

  9. Use of Polymerase Chain Reaction To Detect the Take-All Fungus, Gaeumannomyces graminis, in Infected Wheat Plants. (United States)

    Schesser, K; Luder, A; Henson, J M


    Gaeumannomyces graminis, the causative agent of take-all disease of wheat, barley, and oats, was detected in infected wheat seedlings by using the polymerase chain reaction to amplify Gaeumannomyces-specific DNA fragments. Nested primers and two rounds of amplification were used to amplify two fragments, approximately 287 and 188 bp in size, from G. graminis-infected wheat seedlings. The use of nested primers greatly decreased the number of nonspecific amplification products. Polymerase chain reaction products were not obtained with DNA from seedlings infected with several other phytopathogenic fungi or with DNA from uninfected seedlings. Amplified products were visualized on agarose gels, and their identities were confirmed by DNA hybridization. This method did not require culturing the fungus and has potential for detecting G. graminis in infested wheat, barley, or oat fields.

  10. An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction (United States)

    Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu


    A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

  11. Prognostic significance of bi/oligoclonality in childhood acute lymphoblastic leukemia as determined by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Carlos Alberto Scrideli


    Full Text Available CONTEXT: The CDR-3 region of heavy-chain immunoglobulin has been used as a clonal marker in the study of minimal residual disease in children with acute lymphoblastic leukemia. Southern blot and polymerase chain reaction studies have demonstrated the occurrence of bi/oligoclonality in a variable number of cases of B-lineage acute lymphoblastic leukemia, a fact that may strongly interfere with the detection of minimal residual disease. Oligoclonality has also been associated with a poorer prognosis and a higher chance of relapse. OBJECTIVES: To correlate bi/oligoclonality, detected by polymerase chain reaction in Brazilian children with B-lineage acute lymphoblastic leukemia with a chance of relapse, with immunophenotype, risk group, and disease-free survival. DESIGN: Prospective study of patients’ outcome. SETTING: Pediatric Oncology Unit of the University Hospital, Faculty of Medicine of Ribeirão Preto, University of São Paulo. PARTICIPANTS: 47 children with acute lymphoblastic leukemia DIAGNOSTIC TEST: Polymerase chain reaction using consensus primers for the CDR-3 region of heavy chain immunoglobulin (FR3A, LJH and VLJH for the detection of clonality. RESULTS: Bi/oligoclonality was detected in 15 patients (31.9%. There was no significant difference between the groups with monoclonality and biclonality in terms of the occurrence of a relapse (28.1% versus 26.1%, presence of CALLA+ (81.2% versus 80% or risk group (62.5% versus 60%. Disease-free survival was similar in both groups, with no significant difference (p: 0.7695. CONCLUSIONS: We conclude that bi/oligoclonality was not associated with the factors investigated in the present study and that its detection in 31.9% of the patients may be important for the study and monitoring of minimal residual disease.

  12. Molecular Evidence of Bartonella Infection in Domestic Dogs from Algeria, North Africa, by Polymerase Chain Reaction (PCR)


    Kernif, Tahar; Aissi, Meriem; DOUMANDJI, Salah-eddine; Chomel, Bruno B; Raoult, Didier; Bitam, Idir


    Bartonella species are being recognized as important bacterial human and canine pathogens, and are associated with multiple arthropod vectors. Bartonella DNA extracted from blood samples was obtained from domestic dogs in Algiers, Algeria. Polymerase chain reaction (PCR) and DNA sequence analyses of the ftsZ gene and the 16S-23S intergenic spacer region (ITS) were performed. Three Bartonella species: Bartonella vinsonii subsp. berkhoffii, Bartonella clarridgeiae, and Bartonells elizabethae we...

  13. Rapid Detection/pathotyping of Newcastle disease virus isolates in clinical samples using real time polymerase chain reaction assay




    Authors: Abdul Wajid, Muhammad Wasim, Tahir Yaqub, Shafqat F Rehmani, Tasra Bibi, Nadia Mukhtar, Javed Muhammad, Umar Bacha, Suliman Qadir Afridi, Muhammad Nauman Zahid, Zia u ddin, Muhammad Zubair Shabbir, Kamran Abbas & Muneer Ahmad ### Abstract In the present protocol we describe the real time reverse transcription polymerase chain reaction (rRT-PCR) assay for the rapid detection/pathotyping of Newcastle disease virus (NDV) isoaltes in clinical samples. Fusion gene and matrix ...

  14. Peripheral Blood Leukocytes and Serum Nested Polymerase Chain Reaction Are Complementary Methods for Monitoring Active Cytomegalovirus Infection in Transplant Patients

    Directory of Open Access Journals (Sweden)

    PD Andrade


    Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.

  15. Isolation of Bacterial Agents from the Lungs of Cattle with Pneumonia and Detection of Pasteurella Spp. by Polymerase Chain Reaction


    KILIÇ, Ayşe; MUZ, Adile


    Lungs from 8222 cattle slaughtered at an abattoir in Elazığ were examined macroscopically, and pneumonia was detected in 500 (6.1%) lungs. These samples were inoculated onto blood agar supplemented with 7% sheep blood for isolation of bacterial agents. A polymerase chain reaction (PCR) based upon the use of species-specific primers was carried out on DNA samples extracted from suspected Pasteurella spp. isolates. In addition, a mouse inoculation test was carried out on suspected Pasteurella m...

  16. A multiplex quantitative real-time polymerase chain reaction panel for detecting neurologic pathogens in dogs with meningoencephalitis


    Han, Jae-Ik; Chang, Dong-Woo; Na, Ki-Jeong


    Meningoencephalitis (ME) is a common inflammatory disorder of the central nervous system in dogs. Clinically, ME has both infectious and non-infectious causes. In the present study, a multiplex quantitative real-time polymerase chain reaction (mqPCR) panel was optimized for the detection of eight canine neurologic pathogens (Blastomyces dermatitidis, Cryptococcus spp., Neospora caninum, Borrelia burgdorferi, Bartonella spp., Toxoplasma gondii, Ehrlichia canis, and canine distemper virus [CDV]...

  17. Identification of Endosymbionts in Ticks by Broad-Range Polymerase Chain Reaction and Electrospray Ionization Mass Spectrometry


    ROUNDS, MEGAN A.; Crowder, Christopher D; MATTHEWS, HEATHER E.; PHILIPSON, CURTIS A.; Scoles, Glen A.; Ecker, David J.; Schutzer, Steven E.; Eshoo, Mark W.


    Many organisms, such as insects, filarial nematodes, and ticks, contain heritable bacterial endosymbionts that are often closely related to transmissible tickborne pathogens. These intracellular bacteria are sometimes unique to the host species, presumably due to isolation and genetic drift. We used a polymerase chain reaction/electrospray ionization-mass spectrometry assay designed to detect a wide range of vectorborne microorganisms to characterize endosymbiont genetic signatures from Ambly...

  18. A Pentaplex Real-Time Polymerase Chain Reaction Assay for Detection of Four Species of Soil-Transmitted Helminths


    Basuni, Madihah; Muhi, Jamail; Othman, Nurulhasanah; Verweij, Jaco J.; Ahmad, Maimunah; Miswan, Noorizan; Rahumatullah, Anizah; Aziz, Farhanah Abdul; Zainudin, Nurul Shazalina; Noordin, Rahmah


    Soil-transmitted helminth infections remain a major public health burden in low- and middle-income countries. The traditional diagnosis by microscopic examination of fecal samples is insensitive and time-consuming. In this study, a pentaplex real-time polymerase chain reaction (PCR) was evaluated for the simultaneous detection of Ancylostoma, Necator americanus, Ascaris lumbricoides, and Strongyloides stercoralis. The results were compared with those obtained by conventional parasitological d...

  19. Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK

    Directory of Open Access Journals (Sweden)

    Kosuke Nakamura


    Real-time polymerase chain reaction (PCR detection method for unauthorized genetically modified (GM papaya (Carica papaya L. line PRSV-YK (PRSV-YK detection method was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976. Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.

  20. Use of the Polymerase Chain Reaction to Detect Helicobacter pylori in the Dental Plaque of Healthy and Symptomatic Individuals


    Banatvala, N.; Lopez, C. Romero; Owen, R. J.; Hurtado, A.; Abdi, Y; Davies, G. R.; Hardie, J M; Feldman, R. A.


    A polymerase chain reaction (PCR) assay, based on the amplification of a species specific ureA (urease) gene internal sequence, was used to detect Helicobacter pylori. Total DNA extracts were obtained from dental plaque in patients attending an endoscopy clinic and from apparently healthy schoolchildren of Bangladeshi origin. Of the 54 samples of dental plaque from endoscopy patients examined, 39 were positive (72 per cent). There was 63 per cent correlation (34/54) between H. pylori in the s...

  1. Development of a Polymerase Chain Reaction Assay for Detection of Burkholderia mallei, a Potent Biological Warfare Agent



    Burkholderia mallei is the etiological agent of glanders, primarily a disease of equines. B. mallei is closely related to B. pseudomallei, the causative agent of melioidosis. Therefore, detection of B. mallei and its differentiation from B. pseudomallei, has always been troublesome. In present investigation, a B. mallei specific DNA sequence was identified by performing BLASTn search using ~3000 ORFs of B. mallei NCTC 10229. A polymerase chain reaction (PCR) assay with internal amplification ...

  2. Detection of Mycobacterium tuberculosis DNA in clinical samples by using a simple lysis method and polymerase chain reaction. (United States)

    Folgueira, L; Delgado, R; Palenque, E; Noriega, A R


    We have evaluated the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples from patients with tuberculous infection. Two simple methods for mycobacterial DNA release have been compared: sonication and lysis with nonionic detergents and proteinase K. The more effective method was the enzymatic technique. By using this protocol with 75 specimens we detected M. tuberculosis DNA in all of the samples, whereas only 48 and 71 samples were positive by acid-fast staining and culture, respectively. Images PMID:8463383

  3. Elimination of contaminating DNA within polymerase chain reaction reagents: implications for a general approach to detection of uncultured pathogens.


    Meier, A.; Persing, D. H.; Finken, M; Böttger, E C


    Analysis based on comparisons of 16S rRNA sequences provides a rapid and reliable approach to identifying human pathogens. By directing oligonucleotide primers at sequences conserved throughout the eubacterial kingdom, bacterial 16S ribosomal DNA sequences of virtually any member of the eubacterial kingdom can be amplified by polymerase chain reaction and subsequently analyzed by sequence determination. Indeed, automated systems for broad-range amplification, sequencing, and data analysis are...

  4. Evaluation of canine and feline leishmaniasis by the association of blood culture, immunofluorescent antibody test and polymerase chain reaction


    Campos Braga, Audrey Renno; Langoni, Hélio; Lucheis, Simone Baldini [UNESP


    Background: This study aimed to evaluate the occurrence of Leishmania spp. in dogs and cats from Botucatu, Sao Paulo state, and Campo Grande, Mato Grosso do Sul state, Brazil, by the association of three diagnostic tests: blood culture in liver infusion tryptose medium, immunofluorescent antibody test and polymerase chain reaction. Fifty blood samples of dogs and cats from the Center for Zoonosis Control in Campo Grande, an area endemic for canine visceral leishmaniasis, were collected random...

  5. Multifunctional Nanomaterials Utilizing Hybridization Chain Reaction for Molecular Diagnostics and Bioanalytical Applications (United States)

    Rana, Md. Muhit

    DNA nanotechnology has shown great promise in molecular diagnostic, bioanalytical and biomedical applications. The great challenge of detecting target analytes, biomarkers and small molecules, in molecular diagnostics is low yield sensitivity. To address this challenge, different nanomaterials have been used for a long time and to date there is no such cost-effective bioanalytical technique which can detect these target biomarkers (DNA, RNA, circulating DNA/miRNA) or environmental heavy metal ions (Hg2+ and Ag+) in a cost-effective and efficient manner. Herein, we initially discuss two possible bioanalytical detection methods- a) colorimetric and b) fluorometric assays which are very popular nowadays due to their distinctive spectroscopic properties. Finally, we report the promising colorimetric assay using a novel DNA based amplification strategy know as hybridization chain reaction (HCR) for potential application in the visual detection of low copies of biomarkers (miRNAs as little as 20 femtomole in an RNA pool and cell extracts in seven different combinations and Ebola virus DNA as low as 400 attomoles in liquid biopsy mimics in sixteen different combinations), environmental and biological heavy metal ions (mercury and silver concentrations as low as 10 pM in water, soil and urine samples) and also successfully applied to a molecular logic gate operation to distinguish OR and AND logic gates. No results showed any false-positive or false-negative information. On the other hand, we also discuss the future possibilities of HCR amplification technology, which is very promising for fluorometric bioanalysis. The HCR based nanoprobe technology has numerous remarkable advantages over other methods. It is re-programmable, simple, inexpensive, easy to assemble and operate and can be performed with visual and spectroscopic read-outs upon recognition of the target analytes. This rapid, specific and sensitive approach for biomarkers and heavy metal ion detection generates

  6. Optimizing polymerase chain reaction testing for the diagnosis of pertussis: current perspectives

    Directory of Open Access Journals (Sweden)

    Arbefeville S


    Full Text Available Sophie Arbefeville, Patricia Ferrieri Department of Laboratory Medicine and Pathology, University of Minnesota Medical School, Minneapolis, MN, USA Abstract: Nucleic acid testing has revolutionized the diagnosis of pertussis in the clinical microbiology laboratory and has become the main avenue of testing for pertussis infection. Real-time polymerase chain reaction (RT-PCR is an important tool for timely diagnosis of pertussis and is more sensitive than culture. The most commonly amplified targets are the insertion-sequence (IS genes, which are found in multiple copies in the genome of Bordetella species. Some strains of Bordetella pertussis have more than 200 copies of IS481 in their genome. This high number of repeats allows RT-PCR assays to be very sensitive and makes nucleic acid testing two to three times more sensitive than culture. Despite these advantages, RT-PCR can give inaccurate results due to contamination or lack of specificity. Contamination can easily happen during specimen collection, DNA extraction, or nucleic acid amplification steps. To avoid contamination, laboratories need to have quality controls and good workflows in place. The poor specificity of the nucleic acid assays amplifying the IS genes is because they are found in various Bordetella species and, thus, not unique to a specific species. Bordetella holmesii, a more recently described Bordetella species found to be responsible for respiratory symptoms similar to pertussis in adolescents and adults, can be misidentified as B. pertussis in RT-PCR assays that amplify only the IS481 target. Use of multiple targets may improve specificity of RT-PCR assays for pertussis. In the past few years, the US Food and Drug Administration has cleared three commercial assays for the detection of B. pertussis in respiratory specimens. Several commercial assays and analyte-specific reagents, which are not US Food and Drug Administration cleared, are available for the detection of one

  7. A microfluidic device providing continuous-flow polymerase chain reaction heating and cooling (United States)

    Harandi, A.; Farquhar, T.


    The objective of this study is to describe a new type of microfluidic device that could be used to manipulate fluid temperature in many microfluidic applications. The key component is a composite material containing a thermally conductive phase placed in a purposeful manner to manipulate heat flow into and out of an embedded microchannel. In actual use, the device is able to vary temperature along a defined flow path with remarkable precision. As a demonstration of capability, a functional prototype was designed and fabricated using four layers of patterned copper laminated between alternating layers of polyimide and acrylic. The key fabrication steps included laser micromachining, acid etching, microchannel formation, and hot lamination. In order to achieve the desired temperature variations along the microchannel, an outer optimization loop and an inner finite element analysis loop were used to iteratively obtain a near-optimal copper pattern. With a minor loss of generality, admissible forms were restricted to comb-like patterns. For a given temperature profile, the pattern was found by refining a starting guess based on a deterministic rubric. Thermal response was measured using fine thermocouples placed at critical locations along the microchannel wall. At most of these points, the agreement between measured and predicted temperatures was within 1 °C, and temperature gradients as high as ±45 °C mm-1 (equivalent to ±90 °C s-1 at 2 μl min-1 flow rate) were obtained within the range of 59-91 °C. The particular profile chosen for case study makes it possible to perform five cycles of continuous-flow polymerase chain reaction (PCR) in less than 15 s, i.e. it entails five successive cycles of cooling from 91 to 59 °C, rapid reheating from 59 to 73 °C, slow reheating from 73 to 76 °C, and a final reheating from 73 to 91 °C, using a resistively heated source at 100 °C at and a thermoelectrically cooled sink at 5 °C.

  8. Detection of Food Hazards in Foods: Comparison of Real Time Polymerase Chain Reaction and Cultural Methods. (United States)

    Bonilauri, Paolo; Bardasi, Lia; Leonelli, Roberto; Ramini, Mattia; Luppi, Andrea; Giacometti, Federica; Merialdi, Giuseppe


    Foodstuffs should not contain microorganisms or their toxins or metabolites in quantities suggesting an unacceptable risk for human health. The detection of food hazards in foods is performed by several tests that produce results dependent on the analytical method used: an analytical reference method, defined as standard, is associated with each microbiological criterion laid down in Regulation 2073/2005/EC, but, analytical methods other than the reference ones, in particular more rapid methods, could be used. Combined screening methods performed by real time-polymerase chain reaction (RT-PCR) are currently validated as alternative methods according to the ISO 16140:2003 and certified by the Association Française de Normalisation. However, the positive results obtained with these alternative methods, the investigated molecular relations that resulted positive have to be confirmed with cultural methods using the same enrichment media in which the molecular screening was performed. Since it is necessary to assess if these testing schemes provide equivalent guarantees of food safety, the aim of this retrospective study is to analyse the data collected, from 2012 to 2014 by Emilia Romagna Region in the field of Piano Regionale Alimenti (Food Regional Plan) during official controls monitoring food samples of animal and other than animal origin. Records performed by combined methods of molecular screening of Salmonella spp., Listeria monocytogenes and thermophilic Campylobacter and cultural confirmation results were gathered together and the results were compared in order to assess the sensitivity of the methods. A total of 10,604 food samples were considered in this study: the comparison of the data revealed that the RT-PCR method detected Salmonella, L. monocytogenes, and thermophilic Campylobacter in 2.18, 3.85 and 3.73% of the samples, respectively, whereas by using cultural method these pathogens were isolated in 0.43, 1.57 and 1.57% of samples, respectively. In

  9. [Comparison of direct microscopy, culture and polymerase chain reaction methods for the diagnosis of cutaneous leishmaniasis]. (United States)

    Ertabaklar, Hatice; Özlem Çalışkan, Serçin; Boduç, Erengül; Ertuğ, Sema


    Cutaneous leishmaniasis (CL) is an endemic disease especially in Southeastern Anatolia of Turkey and recently shows a trend for spread to other regions of the country including the Aegean region. The diagnosis of CL is based on combined evaluation of epidemiological data with the clinical symptoms and laboratory findings. Direct microscopic examination and culture methods are mainly used in the routine diagnosis of CL, while molecular methods are mainly used for research. The aim of this study was to detect the presence of Leishmania spp. in samples obtained from CL-suspected patients by using direct microscopy, culture and polymerase chain reaction (PCR) methods and to compare the results. A total of 55 patients who were admitted to Parasitology Laboratory of Adnan Menderes University Hospital, Aydin (located at Aegean region in Turkey), between 2012-2014 were included in the study. Smear preparations from the skin lesions of cases were fixed and stained with Giemsa, and the presence of amastigote forms were evaluated by direct microscopy. NNN medium was used for the cultivation of samples. Total genomic DNA of Leishmania from the samples were extracted with a commercial kit (NucleoSpin Tissue(®) Kit, Macherey-Nagel, Germany) and PCR was performed by using 13A and 13B primers to amplify the 116 base pair fragment of Leishmania spp. specific kinetoplast DNA. Amastigotes were observed in 29 (53%) of the 55 samples by direct microscopy, promastigotes were detected among 34 (62%) samples in culture, and parasite-specific amplicons were revealed in 30 (55%) samples by PCR. All assays were positive in 24 patients while in 18 patients all of the tests yielded negative results. Thirty-seven (67%) out of 55 cases were diagnosed as CL when reactivity in at least one of these three methods were considered as positive. Accordingly the positivity rates of the methods were 78.4% (29/37) for direct microscopy, 92% (34/37) for culture and 81.1% (30/37) for PCR in CL

  10. Detection of campylobacter species: a comparison of culture and polymerase chain reaction based methods (United States)

    Kulkarni, S P; Lever, S; Logan, J M J; Lawson, A J; Stanley, J; Shafi, M S


    Aims: To investigate the optimal method for the detection of campylobacters from stool samples by comparing selective culture with membrane filtration and the polymerase chain reaction (PCR). Methods: Three hundred and forty three stool samples were investigated by each of the three methods mentioned above. Selective culture was performed with charcoal cefoperazone desoxycholate agar plates. Membrane filtration was performed using cellulose triacetate membranes with 0.45 μm pores placed on blood agar plates. Enteropathogenic campylobacters were detected using a PCR identification algorithm, consisting of screening PCRs and species identification using a PCR enzyme linked immunosorbent assay (PCR-ELISA), both based on the 16S rRNA gene. Results: Of the 343 samples tested, 23 were positive by one or more method. Of these, 17 were positive by selective culture, 12 by membrane filtration, and 20 by the PCR identification algorithm. A total of 18 of 23 positives were identified as C jejuni and/or C coli by the PCR identification algorithm, compared with 14 identified to the genus level by selective culture, and 10 by membrane filtration. Among the remaining five positive samples, one C hyointestinalis was detected only by the PCR identification algorithm; one C upsaliensis was detected only by the PCR identification algorithm; one Campylobacter sp was detected by membrane filtration and selective culture and later identified as C concisus; one Campylobacter sp was detected by membrane filtration alone and later identified as Arcobacter sp; and one Campylobacter sp detected only by selective culture was lost to study and therefore not speciated. There was no significant difference between detection by selective culture and the other two methods. However, detection by PCR was significantly better than by membrane filtration (0.05 > p > 0.02). Conclusion: The PCR identification algorithm can detect and identify Campylobacter spp to the species level and the result is

  11. [Evaluation of imported Plasmodium falciparum malaria cases: the use of polymerase chain reaction in diagnosis]. (United States)

    Demiraslan, Hayati; Erdoğan, Emrah; Türe, Zeynep; Kuk, Salih; Yazar, Süleyman; Metan, Gökhan


    Malaria affecting almost half of the world population continues to be an important health problem. Although domestic malaria cases have been decreasing in Turkey recently, cases caused by Plasmodium falciparum have increased due to the frequent travelling to Africa. The aims of this study were to evaluate demographic characteristics, clinical and laboratory findings in cases with falciparum malaria who attended to our clinic in 2012-2013 period, and the impact of polymerase chain reaction (PCR) for diagnosis. Nine patients evaluated were all male with a mean age of 34.3 (age range: 18-48) years, with the history of travel to Africa. Six cases did not take prophylaxis against malaria and other three cases used insufficient time. Mean duration of symptoms after return was 18.4 (range: 1-75) days, and the patients were admitted to the clinic within a mean of 5.2 (range: 1-15) days. Two patients had leucopenia, two patients had anemia, and eight patients had thrombocytopenia on admission. Alanine aminotransferase (ALT) levels in four cases and total bilirubin levels of six cases were over upper normal limits. Definitive diagnosis of cases was performed with the detection of ring and/or gametocytes forms of the parasite in Giemsa-stained peripheral blood smears. Furthermore, samples from seven patients were studied by nested PCR by using genus (Plasmodium rPLU 1 and 5) and species (rFAL 1 and 2, rVIV 1 and 2, rMAL 1 and 2, rOVA 1 and 2) specific primers. All of these seven samples yielded positive results with primers specific for P.falciparum ssrRNA. In the treatment, arthemeter/lumefantrin and doxycycline combination was used in seven patients, while intravenous artesunate and doxycycline combination was given to two patients, resulting with complete cure. Mean duration for the resolving of fever was 3.3 days, and mean duration for clearing the parasitemia from peripheral blood was 4.9 days. Initial ALT values and the duration of fever resolution (-796; p= 0.010), as

  12. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. (United States)

    Brakstad, O G; Aasbakk, K; Maeland, J A


    Synthetic oligonucleotide primers of 21 and 24 bases, respectively, were used in the polymerase chain reaction (PCR) to amplify a sequence of the nuc gene, which encodes the thermostable nuclease of Staphylococcus aureus. A DNA fragment of approximately 270 bp was amplified from lysed S. aureus cells or isolated DNA. The PCR product was detected by agarose gel electrophoresis or Southern blot analysis by using a 33-mer internal nuc gene hybridization probe. With S. aureus cells the lower detection limit was less than 10 CFU, and with the isolated target the lower detection limit was 0.69 pg of DNA. The primers recognized 90 of 90 reference or clinical S. aureus strains. Amplification was not recorded when 80 strains representing 16 other staphylococcal species were tested or when 20 strains representing 9 different nonstaphylococcal species were tested. Some of the non-S. aureus staphylococci produced thermostable nucleases but were PCR negative. The PCR product was generated when in vitro-cultured S. aureus was used to prepare simulated clinical specimens of blood, urine, cerebrospinal fluid, or synovial fluid. No PCR product was generated when the sterile body fluids were tested. However, the sensitivity of the PCR was reduced when S. aureus in blood or urine was tested in comparison with that when bacteria in saline were tested. With the bacteria in blood, the detection limit of the PCR was 10(3) CFU. A positive PCR result was recorded when a limited number of clinical samples from wounds verified to be infected with S. aureus were tested, while the PCR product was not detected in materials from infections caused by other bacteria. Generation of PCR products was not affected by exposure of S. aureus to bactericidal agents, including cloxacillin and gentamicin, prior to testing, but was affected by exposure to UV radiation. The PCR for amplification of the nuc gene has potential for the rapid diagnosis of S. aureus infections by direct testing of clinical

  13. Nanoscale superstructures assembled by polymerase chain reaction (PCR): programmable construction, structural diversity, and emerging applications. (United States)

    Kuang, Hua; Ma, Wei; Xu, Liguang; Wang, Libing; Xu, Chuanlai


    Polymerase chain reaction (PCR) is an essential tool in biotechnology laboratories and is becoming increasingly important in other areas of research. Extensive data obtained over the last 12 years has shown that the combination of PCR with nanoscale dispersions can resolve issues in the preparation DNA-based materials that include both inorganic and organic nanoscale components. Unlike conventional DNA hybridization and antibody-antigen complexes, PCR provides a new, effective assembly platform that both increases the yield of DNA-based nanomaterials and allows researchers to program and control assembly with predesigned parameters including those assisted and automated by computers. As a result, this method allows researchers to optimize to the combinatorial selection of the DNA strands for their nanoparticle conjugates. We have developed a PCR approach for producing various nanoscale assemblies including organic motifs such as small molecules, macromolecules, and inorganic building blocks, such as nanorods (NRs), metal, semiconductor, and magnetic nanoparticles (NPs). We start with a nanoscale primer and then modify that building block using the automated steps of PCR-based assembly including initialization, denaturation, annealing, extension, final elongation, and final hold. The intermediate steps of denaturation, annealing, and extension are cyclic, and we use computer control so that the assembled superstructures reach their predetermined complexity. The structures assembled using a small number of PCR cycles show a lower polydispersity than similar discrete structures obtained by direct hybridization between the nanoscale building blocks. Using different building blocks, we assembled the following structural motifs by PCR: (1) discrete nanostructures (NP dimers, NP multimers including trimers, pyramids, tetramers or hexamers, etc.), (2) branched NP superstructures and heterochains, (3) NP satellite-like superstructures, (4) Y-shaped nanostructures and DNA

  14. Early detection of Brucella canis via quantitative polymerase chain reaction analysis. (United States)

    Kauffman, L K; Bjork, J K; Gallup, J M; Boggiatto, P M; Bellaire, B H; Petersen, C A


    Canine brucellosis is a reportable zoonotic disease that can lead to canine reproductive losses and human infection through contact with infected urine or other genitourinary secretions. Although many locations require testing and euthanasia of positive dogs, current diagnosis is limited by the time required for seroconversion, for example, presence of B. canis-specific antibodies. The goal of this study was to determine the diagnostic ability of Brucella canis-specific quantitative polymerase chain reaction (qPCR) assay to detect B. canis in field samples prior to serological positivity for faster diagnosis and prevention of transmission within kennels or in households. Two kennels, one of which was located in the owner's home, were sampled following observation of suggestive clinical signs and positive serology of at least one dog. Specimens obtained were comparatively analysed via serology and qPCR analysis. 107 dogs were analysed for B. canis infection via qPCR: 105 via whole-blood samples, 65 via vaginal swab, six via urine and seven via genitourinary tract tissue taken at necropsy. Forty-five dogs were found to be infected with canine brucellosis via qPCR, of which 22 (48.89%) were seropositive. A statistically significant number (P = 0.0228) of qPCR-positive dogs, 5/25 (20.00%), seroconverted within a 30-day interval after initial serologic testing. As compared to serology, qPCR analysis of DNA from vaginal swabs had a sensitivity of 92.31% and specificity of 51.92%, and qPCR analysis of DNA from whole-blood samples had a sensitivity of 16.67% and specificity of 100%. B. canis outer membrane protein 25 DNA qPCR from non-invasive vaginal swab and urine samples provided early detection of B. canis infection in dogs prior to detection of antibodies. This assay provides a critical tool to decrease zoonotic spread of canine brucellosis, its associated clinical presentation(s), and emotional and economic repercussions.

  15. An exploratory study to evaluate Clostridium difficile polymerase chain reaction ribotypes and infection outcomes

    Directory of Open Access Journals (Sweden)

    Thabit AK


    Full Text Available Abrar K Thabit,1,2 David P Nicolau1,3 1Center for Anti-Infective Research and Development, Hartford Hospital, Hartford, CT, USA; 2Faculty of Pharmacy, King Abdulaziz University, Jeddah, Saudi Arabia; 3Division of Infectious Diseases, Hartford Hospital, Hartford, CT, USA Background: Clostridium difficile infection ranges from mild to severe prolonged diarrhea with systemic symptoms. Previous studies have assessed the correlation of some disease severity parameters to C. difficile ribotypes. However, certain clinical parameters of interest have not yet been evaluated.Aim: We conducted an exploratory study to evaluate the correlation of C. difficile ribotypes to parameters not assessed previously, notably days to diarrhea resolution (in terms of days to formed stools and days to less than three stools per day, length of hospital stay, 30-day recurrence rates, and 30-day readmission rates. Additional severity parameters evaluated include leukocytosis, serum creatinine, fever, and nausea/vomiting.Methods: Polymerase chain reaction ribotyping was performed on C. difficile isolates from baseline stool samples of 29 patients. A retrospective chart review was conducted to assess the parameters of interest.Results: The most common ribotypes were 027 (38%, 014/020 (21%, and 106/174 (21%. Numerically, 027 ribotype patients required more days to less than three stools per day versus 014/020 and 106/174 ribotype patients (P=0.2. The three ribotypes were similar regarding time to formed stools, duration of hospitalization, and 30-day readmission rate (P=0.2, 0.6, and 0.8, respectively. Recurrence within 30 days occurred in two patients with 027 and two patients with 014/020 (P=0.6. Leukocytosis and fever were more prominent with 027 than with 014/020 and 106/174 (P=0.04 for both parameters, although the degree of nausea/vomiting did not differ between the three groups (P=0.3. A serum creatinine level ≥1.5 times the premorbid level was seen in only three

  16. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. (United States)

    Ye, Jian; Coulouris, George; Zaretskaya, Irena; Cutcutache, Ioana; Rozen, Steve; Madden, Thomas L


    Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR

  17. Detection of food hazards in foods: comparison of real time polymerase chain reaction and cultural methods

    Directory of Open Access Journals (Sweden)

    Paolo Bonilauri


    Full Text Available Foodstuffs should not contain microorganisms or their toxins or metabolites in quantities suggesting an unacceptable risk for human health. The detection of food hazards in foods is performed by several tests that produce results dependent on the analytical method used: an analytical reference method, defined as standard, is associated with each microbiological criterion laid down in Regulation 2073/2005/EC, but, analytical methods other than the reference ones, in particular more rapid methods, could be used. Combined screening methods performed by real time-polymerase chain reaction (RT-PCR are currently validated as alternative methods according to the ISO 16140:2003 and certified by the Association Française de Normalisation. However, the positive results obtained with these alternative methods, the investigated molecular relations that resulted positive have to be confirmed with cultural methods using the same enrichment media in which the molecular screening was performed. Since it is necessary to assess if these testing schemes provide equivalent guarantees of food safety, the aim of this retrospective study is to analyse the data collected, from 2012 to 2014 by Emilia Romagna Region in the field of Piano Regionale Alimenti (Food Regional Plan during official controls monitoring food samples of animal and other than animal origin. Records performed by combined methods of molecular screening of Salmonella spp., Listeria monocytogenes and thermophilic Campylobacter and cultural confirmation results were gathered together and the results were compared in order to assess the sensitivity of the methods. A total of 10,604 food samples were considered in this study: the comparison of the data revealed that the RT-PCR method detected Salmonella, L. monocytogenes, and thermophilic Campylobacter in 2.18, 3.85 and 3.73% of the samples, respectively, whereas by using cultural method these pathogens were isolated in 0.43, 1.57 and 1.57% of samples

  18. [Development of a real-time polymerase chain reaction method for the identification of Candida species]. (United States)

    Ağca, Harun; Dalyan Cilo, Burcu; Özmerdiven, Gülşah Ece; Sağlam, Sezcan; Ener, Beyza


    Candida species are one of the major causes of nosocomial infections and are the fourth most common agent involved in bloodstream infections. The impact of non-albicans Candida species is increasing, however C.albicans is still the most common species. Since the antifungal susceptibility pattern among Candida spp. may be different, rapid diagnosis and identification of non-albicans Candida spp. are important for the determination of antifungal agents that will be used for treatment. The aim of the study was to describe a real-time polymerase chain reaction (Rt-PCR) assay that rapidly detects, identifies and quantitates Candida species from blood culture samples. A total of 50 consecutive positive blood culture bottles (BACTEC, Beckton Dickinson, USA) identified at our laboratory between June-November 2013, were included in the study. Reference strains of Candida spp. (C.albicans ATCC 10231, C.glabrata ATCC 90030, C.tropicalis ATCC 1021, C.krusei ATCC 6258, C.parapsilosis ATCC 22019 and C. dubliniensis CD36) grown on Sabouraud dextrose agar were used for quality control. BACTEC bottles that were positive for Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus were also studied to search the cross-reactivity. A commercial kit (Zymo Research, USA) was used for DNA extraction. Real-time PCR was performed on LightCycler 480 (Roche, Germany) with primers and probes specific for 18S rRNA of Candida species. Twenty microlitres of the reaction mix contained 2 μl of extracted DNA, 2 μl of LightCycler Fast Start DNA Master Probe (Roche Diagnostics, Germany), 2 μl of MgCl(2) (5 mmol), 2 μl of 10x PCR buffer (Roche Diagnostics, Germany), 0.5 μl of each primer (0.01 nmol/μl) and 1 μl of each probe (0.1 μmol/μl) (TibMolBiol, Germany). Amplification was performed using the following conditions; 95°C for 10 mins and 50 cycles of denaturation at 95°C for 10 secs, annealing at 62°C for 10 secs and polymerisation at 72°C for 20 secs. A melting curve was


    Institute of Scientific and Technical Information of China (English)


    The curing process of chemical reacton between flexible unsaturated polymer resin and diphenylmethane bismaleimides which have been chain-prolonged by diaminodiphenylmethane is presented, also the kinetics parameters and curing technology are investigated.

  20. Comparison of two real-time quantitative polymerase chain reaction strategies for minimal residual disease evaluation in lymphoproliferative disorders: correlation between immunoglobulin gene mutation load and real-time quantitative polymerase chain reaction performance. (United States)

    Della Starza, Irene; Cavalli, Marzia; Del Giudice, Ilaria; Barbero, Daniela; Mantoan, Barbara; Genuardi, Elisa; Urbano, Marina; Mannu, Claudia; Gazzola, Anna; Ciabatti, Elena; Guarini, Anna; Foà, Robin; Galimberti, Sara; Piccaluga, Pierpaolo; Gaidano, Gianluca; Ladetto, Marco; Monitillo, Luigia


    We compared two strategies for minimal residual disease evaluation of B-cell lymphoproliferative disorders characterized by a variable immunoglobulin heavy chain (IGH) genes mutation load. Twenty-five samples from chronic lymphocytic leukaemia (n = 18) or mantle cell lymphoma (n = 7) patients were analyzed. Based on IGH variable region genes, 22/25 samples carried > 2% mutations, 20/25 > 5%. In the IGH joining region genes, 23/25 samples carried > 2% mutations, 18/25 > 5%. Real-time quantitative polymerase chain reaction was performed on IGH genes using two strategies: method A utilizes two patient-specific primers, whereas method B employs one patient-specific and one germline primer, with different positions on the variable, diversity and joining regions. Twenty-three samples (92%) resulted evaluable using method A, only six (24%) by method B. Method B poor performance was specifically evident among mutated IGH variable/joining region cases, although no specific mutation load above, which the real-time quantitative polymerase chain reaction failed was found. The molecular strategies for minimal residual disease evaluation should be adapted to the B-cell receptor features of the disease investigated.

  1. A new polymerase chain reaction (PCR) assay for the trinucleotide repeat that is unstable and expanded on Huntington's disease chromosomes. (United States)

    Warner, J P; Barron, L H; Brock, D J


    The Huntington's Disease (HD) Collaborative Research Group has recently published the sequence of a new cDNA, IT15, containing a polymorphic trinucleotide (CAG)n repeat that is expanded and unstable on HD chromosomes. There is a correlation between the repeat size and the age of onset of symptoms. The suggested polymerase chain reaction (PCR) assay of the (CAG)n repeat requires unusual reaction components and primer concentrations and the use of 5% polyacrylamide sequencing gels to resolve the amplification products. We present a simple PCR assay that produces a smaller product using standard reaction conditions. This gives better resolution of the (CAG)n expansion observed on HD chromosomes by acrylamide gel electrophoresis and allows sufficient product to be obtained to perform assays using agarose gels. This will allow diagnostic labs to do rapid and accurate presymptomatic testing of HD in high risk families.

  2. The 1,3-dipolar cycloaddition reaction of chiral carbohydrate-derived nitrone and olefin: towards long-chain sugars. (United States)

    Oukani, Hassan; Pellegrini-Moïse, Nadia; Jackowski, Olivier; Chrétien, Françoise; Chapleur, Yves


    The thermal and microwave-activated 1,3-dipolar cycloadditions of several α,β-unsaturated esters derived from d-mannose and chiral nitrones derived from threitol have been studied as a model reaction en route to eleven carbon long chain carbohydrates. Very high facial selectivity is observed for the chiral nitrones whereas the olefin facial selectivity varies with the substrate. The presence of a dioxolane ring α to the olefinic bond is beneficial to the facial selectivity of the olefin whereas a pyranose ring is not. The combination of a d-mannose derivative and a l-threitol-derived nitrone is a matched pair suitable for the synthesis of long chain sugars with nine contiguous chiral centres. Finally complete facial selectivity was observed with exo-glycals which gave a single cycloadduct.

  3. A novel temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    DEFF Research Database (Denmark)

    Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte

    We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...

  4. Violence and vulnerability of female migrants in drop houses in Arizona: the predictable outcome of a chain reaction of violence. (United States)

    Simmons, William Paul; Menjívar, Cecilia; Téllez, Michelle


    This qualitative research study examines the experiences of immigrant women crossing the U.S./Mexico border and the proliferation of "drop houses" in Arizona as a new phenomenon, one that is often marked by kidnappings and sexual assault. Little research has been published on the violence women face on their journey, and the drop houses have almost completely escaped scholarly analysis. We argue that the drop houses must be seen as a consequence of a "state of emergency" declared by policy makers that led to changes in U.S. national and local immigration policies that fueled what we call a "chain reaction of violence."

  5. Susceptibility of Biomphalaria tenagophila and Biomphalaria straminea to Schistosoma mansoni infection detected by low stringency polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    JANNOTTI-PASSOS Liana Konovaloff


    Full Text Available In order to determine Schistosoma mansoni infection rates in Biomphalaria tenagophila and B. straminea, low stringency polymerase chain reaction (LS-PCR technique was used as a complementary method to light exposure technique. LS-PCR has already been standardized in our laboratory to detect the trematode DNA in B. glabrata. Higher S. mansoni infection rates were detected using conventional method and LS-PCR. The parasite DNA profile was detected in both species after 7-day exposure to miracidia, using LS-PCR. This technique enables early detection of schistosomiasis transmission focuses, in endemic areas, before the beginning of cercariae shedding.

  6. Real-time reverse transcription-polymerase chain reaction assays for identification of wild poliovirus 1 & 3


    Sharma, Deepa K.; Nalavade, Uma P.; Deshpande, Jagadish M.


    Background & objectives: The poliovirus serotype identification and intratypic differentiation by real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay is suitable for serotype mixtures but not for intratypic mixtures of wild and vaccine poliovirus strains. This study was undertaken to develop wild poliovirus 1 and 3 (WPV1 and WPV3) specific rRT-PCR assays for use. Methods: Specific primers and probes for rRT-PCR were designed based on VP1 sequences of WPV1 and WPV3 isolat...

  7. Escherichia coli Vertebral Osteomyelitis Diagnosed According to Broad-range 16S rRNA Gene Polymerase Chain Reaction (PCR). (United States)

    Shibata, Satoshi; Tanizaki, Ryutaro; Watanabe, Koji; Makabe, Kenta; Shoda, Naoki; Kutsuna, Satoshi; Nagamatsu, Maki; Oka, Shinichi; Ohmagari, Norio


    Identifying the causative agent of pyogenic osteomyelitis is often challenging, especially when antibiotics are administered before a biopsy. We herein present a case of osteomyelitis in the cervical vertebrae presenting with progressive paralytic symptoms, in which we successfully identified Escherichia coli from a biopsy specimen using broad-range 16S rRNA gene polymerase chain reaction (PCR) even though sensitive antibiotics had been used for more than 50 days before the biopsy. Broad-range 16S rRNA gene PCR is a useful diagnostic method, especially when prebiopsy antibiotics are unavoidably used for a clinically unstable state.

  8. A simple modification to improve the accuracy of methylation-sensitive restriction enzyme quantitative polymerase chain reaction. (United States)

    Krygier, Magdalena; Podolak-Popinigis, Justyna; Limon, Janusz; Sachadyn, Paweł; Stanisławska-Sachadyn, Anna


    DNA digestion with endonucleases sensitive to CpG methylation such as HpaII followed by polymerase chain reaction (PCR) quantitation is commonly used in molecular studies as a simple and inexpensive solution for assessment of region-specific DNA methylation. We observed that the results of such analyses were highly overestimated if mock-digested samples were applied as the reference. We determined DNA methylation levels in several promoter regions in two setups implementing different references: mock-digested and treated with a restriction enzyme that has no recognition sites within examined amplicons. Fragmentation of reference templates allowed removing the overestimation effect, thereby improving measurement accuracy.

  9. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    DEFF Research Database (Denmark)

    Teglbjærg, Lars Stubbe; Hansen, J-ES; Dalbøge, H;


    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot...... hybridization. It was not possible to detect any viral antigen production in the cultures, and attempts to recover virus by highly sensitive coculture techniques were unsuccessful, indicating that the infection was latent. The PCR technique provides a simple approach to the study of viral infection in cases...

  10. Identification of co-occurring Branchinecta fairy shrimp species from encysted embryos using multiplex polymerase chain reaction (United States)

    Vandergast, A.G.; Wood, D.A.; Simovich, M.; Bohonak, A.J.


    Morphological identification of many fairy shrimp species is difficult because distinguishing characters are restricted to adults. We developed two multiplex polymerase chain reaction assays that differentiate among three Branchinecta fairy shrimp with distributional overlap in southern California vernal pools. Two of the species are federally listed as threatened. Molecular identification of Branchinecta from cysts allows for species surveys to be conducted during the dry season, expanding the timeframe for population assessment and providing a less intrusive method of sampling sensitive vernal pool habitats. ?? Published 2009. This article is a US Government work and is in the public domain in the USA.

  11. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    DEFF Research Database (Denmark)

    Teglbjaerg, L L; Hansen, J E; Dalbøge, H


    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot...... hybridization. It was not possible to detect any viral antigen production in the cultures, and attempts to recover virus by highly sensitive coculture techniques were unsuccessful, indicating that the infection was latent. The PCR technique provides a simple approach to the study of viral infection in cases...

  12. Detection of Natural Toxoplasma gondii Infection in Chicken in Thika Region of Kenya Using Nested Polymerase Chain Reaction



    The detection of Toxoplasma gondii in free-range chickens is a good indicator of possible risk to human beings. The aim of this study was to investigate the occurrence of T. gondii in free-range chicken using polymerase chain reaction (PCR). Brain samples from 105 free-range chickens from three administrative areas in Thika region, Kenya, were collected, DNA-extracted, and analyzed using PCR to detect presence of T. gondii. The overall prevalence of T. gondii in all the three areas was 79.0% ...

  13. Use of Existing Diagnostic Reverse-Transcription Polymerase Chain Reaction Assays for Detection of Ebola Virus RNA in Semen. (United States)

    Pettitt, James; Higgs, Elizabeth S; Adams, Rick D; Jahrling, Peter B; Hensley, Lisa E


    Sexual transmission of Ebola virus in Liberia has now been documented and associated with new clusters in regions previously declared Ebola free. Assays that have Emergency Use Authorization (EUA) and are routinely used to detect Ebola virus RNA in whole blood and plasma specimens at the Liberian Institute for Biomedical Research were tested for their suitability in detecting the presence of Ebola virus RNA in semen. Qiagen AVL extraction protocols, as well as the Ebola Zaire Target 1 and major groove binder quantitative reverse-transcription polymerase chain reaction assays, were demonstrably suitable for this purpose and should facilitate epidemiologic investigations, including those involving long-term survivors of Ebola.

  14. Identification of the five human Plasmodium species including P. knowlesi by real-time polymerase chain reaction. (United States)

    Oddoux, O; Debourgogne, A; Kantele, A; Kocken, C H; Jokiranta, T S; Vedy, S; Puyhardy, J M; Machouart, M


    Recently, Plasmodium knowlesi has been recognised as the fifth Plasmodium species causing malaria in humans. Hundreds of human cases infected with this originally simian Plasmodium species have been described in Asian countries and increasing numbers are reported in Europe from travellers. The growing impact of tourism and economic development in South and Southeast Asia are expected to subsequently lead to a further increase in cases both among locals and among travellers. P. knowlesi is easily misidentified in microscopy as P. malariae or P. falciparum. We developed new primers for the rapid and specific detection of this species by low-cost real-time polymerase chain reaction (PCR) and added this method to an already existing panel of primers used for the molecular identification of the other four species in one reaction. Reference laboratories should now be able to identify undisputably and rapidly P. knowlesi, as it is a potentially fatal pathogen.

  15. Detection of parvalbumin, a common fish allergen gene in food, by real-time polymerase chain reaction. (United States)

    Sun, Min; Liang, Chengzhu; Gao, Hongwei; Lin, Chao; Deng, Mingjun


    Fish, as one of the most common causes of IgE-mediated food hypersensitivity, has recently received increasing attention from the food industry and legislative and regulatory agencies. A real-time polymerase chain reaction assay based on TaqMan-MGB probe technology was developed for the detection of parvalbumin, a major fish allergen gene. The assay had a sensitivity up to 5 pg purified fish DNA and had no cross-reaction with other species, such as cattle, sheep, swine, chicken, shrimp, lobster, crab, squid, clam, rice, soybean, maize, and potato. The coefficient of variation for both intra- and interexperimental variability demonstrated high reproducibility and accuracy. The assay proved to be a potential tool for the detection and label management of fish allergens in food.

  16. [Microarray analytic system for multiplex analysis by real-time polymerase chain reaction with reagents immobilized in microreactors]. (United States)

    Navolotskiĭ, D V; Perchik, A V; Mark'ianov, I A; Ganeev, A A; Sliadnev, M N


    A microarray analytic system that uses a silicon chip with immobilized in microreactor test-system for multiplex analysis of DNA by real-time polymerase chain reaction (RT-PCR) was developed and optimized. We suggested the method of immobilization of PCR-components of a test-system, chose the stabilizer, and conducted the optimization of the composition of reaction mixture to achieve permanent stability of a microarray. We conducted optimization of preparation of samples using magnetic sorbent and indicated that, with 2.6 x 10(4) copies/ml, 60 min are necessary to obtain positive identification including time for preparation of model probes. The abilities of the created system were demonstrated on the example of microarray analysis of samples with different content of DNA, low absolute limits of identification (20 DNA copies in microreactor), and high reproducibility of the analysis.

  17. A polymerase chain reaction assay for ascosporic inoculum of Sclerotinia species (United States)

    A PCR assay was developed which amplified a 170-bp fragment of the intergenic spacer region of Sclerotinia sclerotiorum, the cause of white mould. Sensitivity was 10 S. sclerotiorum ascospores per DNA extraction (0.2 ascospores per PCR reaction). The presence of soil did not affect sensitivity a...

  18. Polymerase Chain Reaction (PCR) applications in white pine blister rust resistance screening (United States)

    Sam Hendricks; Wendy Sutton; Jeffrey Stone; Richard Sniezko; Angelia Kegley; Anna Schoettle


    A goal of breeding programs for resistance to white pine blister rust is the development of multigenic resistance, even if the genetics and mechanisms of resistance may be imperfectly understood. The goal of multigenic resistance has prompted efforts to categorize host resistance reactions at increasingly finer scales, to identify heritable traits that may confer...

  19. Performance of transport and selective media for swine Bordetella bronchiseptica recovery and it comparison to polymerase chain reaction detection (United States)

    Coutinho, Tania Alen; Bernardi, Mari Lourdes; de Itapema Cardoso, Marisa Ribeiro; Borowski, Sandra Maria; Moreno, Andrea Micke; de Barcellos, David Emilio Santos Neves


    Three comparative assays were performed seeking to improve the sensitivity of the diagnosis of Bordetella bronchiseptica infection analyzing swine nasal swabs. An initial assay compared the recovery of B. bronchiseptica from swabs simultaneously inoculated with B. bronchiseptica and some interfering bacteria, immersed into three transport formulations (Amies with charcoal, trypticase soy broth and phosphate buffer according to Soerensen supplemented with 5% of bovine fetal serum) and submitted to different temperatures (10°C and 27°C) and periods of incubation (24, 72 and 120 hours). A subsequent assay compared three selective media (MacConkey agar, modified selective medium G20G and a ceftiofur medium) for their recovery capabilities from clinical specimens. One last assay compared the polymerase chain reaction to the three selective media. In the first assay, the recovery of B. bronchiseptica from transport systems was better at 27°C and the three formulations had good performances at this temperature, but the collection of qualitative and quantitative analysis indicated the advantage of Amies medium for nasal swabs transportation. The second assay indicated that MacConkey agar and modified G20G had similar results and were superior to the ceftiofur medium. In the final assay, polymerase chain reaction presented superior capability of B. bronchiseptica detection to culture procedures. PMID:24031390

  20. Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection. (United States)

    Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao


    An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay.

  1. Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria. (United States)

    Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A


    Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB.

  2. Interphase fluorescence in situ hybridization and reverse transcription polymerase chain reaction as a diagnostic aid for synovial sarcoma. (United States)

    Shipley, J; Crew, J; Birdsall, S; Gill, S; Clark, J; Fisher, C; Kelsey, A; Nojima, T; Sonobe, H; Cooper, C; Gusterson, B


    Identification of the t(X;18)(p11.2;q11.2) that is associated with a high proportion of synovial sarcoma can be a useful diagnostic aid. The translocation results in fusion of the SYT gene on chromosome 18 to either the SSX1 or the SSX2 gene, two homologous genes within Xp11.2. Two-color interphase fluorescence in situ hybridization and reverse transcription polymerase chain reaction were assessed as approaches to identify the rearrangement in well characterized cases. The presence of the translocation, and the specific chromosome X gene disrupted, were inferred from the configuration of signals from chromosome-specific centromere probes, paints, and markers flanking each gene in preparations of interphase nuclei. Rearrangement was found in two cell lines and eight of nine tumor samples, including analysis of five touch imprints. This was consistent with cytogenetic data in four cases and reverse transcription polymerase chain reaction analysis using primers known to amplify both SYT-SSX1 and SYT-SSX2 transcripts. The transcripts were distinguished by restriction with LspI and SmaI. Contrary to previous suggestions, there was no obvious correlation between histological subtype and involvement of the SSX1 or SSX2 gene. These approaches could also be applied to the identification of tumor-free margins and metastatic disease.

  3. Polymerase Chain Reaction (PCR) Versus Bacterial Culture in Detection of Organisms in Otitis Media with Effusion (OME) in Children. (United States)

    Aly, Balegh H; Hamad, Mostafa S; Mohey, Mervat; Amen, Sameh


    The aim of this study was to compare between polymerase chain reaction (PCR) and bacterial culture in detection of Streptococcus Pneumonia and M. Catarrhalis in otitis media with effusion (OME) in children. Fifty patients having OME were included in this study between 2003 and 2008. Myringotomy and tympanostomy tube insertion were done in every patient and the middle ear effusion samples were aspirated. The samples were subjected to bacteriological study in the form of culture and molecular study in the form of PCR using JM201/202-204 primer probe set for both S. pneumonia and M. catarrhalis. The results of Bacterial cultures are as follows: five cases (10%) were culture positive for S. pneumonia. Six cases (12%) were culture positive for M. catarrhalis. Only one case (2%) showed positively for both S. pneumonia and M. catarrhalis. Polymerase chain reaction test shows that 18 cases (36%) were positive for S. pneumonia, 22 cases (44%) were positive for M. catarrhalis, 6 cases (12%) were positive for both organism and 4 cases (8%) were negative. The difference between the proportion of culture positive and PCR positive specimens for both organisms individually and collectively was significant (P PCR is more accurate than bacterial culture in detection of organisms in middle ear fluid in OME and that M. catarrhalis plays a significant rule in OME as it is the sole organism identified more than the other one by PCR.

  4. Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors. (United States)

    Bridge, Julia A


    The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society.

  5. Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis. (United States)

    Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui


    In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis.

  6. Diagnosis of ocular toxoplasmosis by two polymerase chain reaction (PCR) examinations: qualitative multiplex and quantitative real-time. (United States)

    Sugita, Sunao; Ogawa, Manabu; Inoue, Shizu; Shimizu, Norio; Mochizuki, Manabu


    To establish a two-step polymerase chain reaction (PCR) diagnostic system for ocular toxoplasmosis. A total of 13 ocular fluid samples (11 aqueous humor and 2 vitreous fluid) were collected from 13 patients with clinically suspected ocular toxoplasmosis. Ten ocular samples from other uveitis patients and 20 samples from subjects without ocular inflammation were used as controls. Two polymerase chain reaction (PCR) methods, i.e., qualitative multiplex PCR and quantitative real-time PCR, were used to measure the toxoplasma genome (T. gondii B1 gene). Qualitative multiplex PCR detected T. gondii B1 gene in the ocular fluids of 11 out of 13 patients with clinically suspected ocular toxoplasmosis. In real-time PCR, we detected high copy numbers of T. gondii DNA (5.1 × 10(2)-2.1 × 10(6) copies/mL) in a total of 10 patients (10/13, 77%). Only ocular toxoplasmosis scar lesions were observed in the three real-time PCR-negative patients. PCR assay results for the samples from the two control groups were all negative. The two-step PCR examination to detect toxoplasma DNA is a useful tool for diagnosing ocular toxoplasmosis.

  7. Biomimetic surface modification of polypropylene by surface chain transfer reaction based on mussel-inspired adhesion technology and thiol chemistry (United States)

    Niu, Zhijun; Zhao, Yang; Sun, Wei; Shi, Suqing; Gong, Yongkuan


    Biomimetic surface modification of polypropylene (PP) is conducted by surface chain transfer reaction based on the mussel-inspired versatile adhesion technology and thiol chemistry, using 2-methacryloyloxyethylphosphorylcholine (MPC) as a hydrophilic monomer mimicking the cell outer membrane structure and 2,2-azobisisobutyronitrile (AIBN) as initiator in ethanol. A layer of polydopamine (PDA) is firstly deposited onto PP surface, which not only offers good interfacial adhesion with PP, but also supplies secondary reaction sites (-NH2) to covalently anchor thiol groups onto PP surface. Then the radical chain transfer to surface-bonded thiol groups and surface re-initiated polymerization of MPC lead to the formation of a thin layer of polymer brush (PMPC) with cell outer membrane mimetic structure on PP surface. X-ray photoelectron spectrophotometer (XPS), atomic force microscopy (AFM) and water contact angle measurements are used to characterize the PP surfaces before and after modification. The protein adsorption and platelet adhesion experiments are also employed to evaluate the interactions of PP surface with biomolecules. The results show that PMPC is successfully grafted onto PP surface. In comparison with bare PP, the resultant PP-PMPC surface exhibits greatly improved protein and platelet resistance performance, which is the contribution of both increased surface hydrophilicity and zwitterionic structure. More importantly, the residue thiol groups on PP-PMPC surface create a new pathway to further functionalize such zwitterion modified PP surface.

  8. Evaluation of canine and feline leishmaniasis by the association of blood culture, immunofluorescent antibody test and polymerase chain reaction. (United States)

    Braga, Audrey Rennó Campos; Langoni, Hélio; Lucheis, Simone Baldini


    This study aimed to evaluate the occurrence of Leishmania spp. in dogs and cats from Botucatu, São Paulo state, and Campo Grande, Mato Grosso do Sul state, Brazil, by the association of three diagnostic tests: blood culture in liver infusion tryptose medium, immunofluorescent antibody test and polymerase chain reaction. Fifty blood samples of dogs and cats from the Center for Zoonosis Control in Campo Grande, an area endemic for canine visceral leishmaniasis, were collected randomly, as well as canine and feline blood samples from the Municipal Kennel and Animal Protection Association in Botucatu, currently considered a transmission-free, non-endemic area. Of the 50 dog blood cultures from Botucatu, three (6%) were positive and of the 50 cats, two (4%) were positive. In Campo Grande, 29 dog blood cultures (58%) were positive and all (100%) cats negative by this test. Polymerase chain reaction detected Leishmania spp. in 100% of dog and cat samples from Botucatu but found all the cats from Campo Grande to be negative. On the other hand, 36 dogs from Campo Grande were positive (72%) by the same technique. Immunofluorescent antibody test in Botucatu found 100% of dogs and cats non-reactive, while in Campo Grande, it detected positivity in 32 dogs (64%) and 15 cats (30%). The results show the importance of not only continuous epidemiological surveillance in areas not endemic for leishmaniasis, but also research for accurate diagnosis of this zoonosis.

  9. Cloning and sequencing of human lambda immunoglobulin genes by the polymerase chain reaction. (United States)

    Songsivilai, S; Bye, J M; Marks, J D; Hughes-Jones, N C


    Universal oligonucleotide primers, designed for amplifying and sequencing genes encoding the rearranged human lambda immunoglobulin variable region, were validated by amplification of the lambda light chain genes from four human heterohybridoma cell lines and in the generation of a cDNA library of human V lambda sequences from Epstein-Barr virus-transformed human peripheral blood lymphocytes. This technique allows rapid cloning and sequencing of human immunoglobulin genes, and has potential applications in the rescue of unstable human antibody-producing cell lines and in the production of human monoclonal antibodies.

  10. Side chain effects in reactions of the potassium-tyrosine charge transfer complex (United States)

    da Silva, F. Ferreira; Meneses, G.; Ingólfsson, O.; Limão-Vieira, P.


    Fragmentation of transient negative ions of tyrosine formed through electron transfer in collisions with neutral potassium atoms is presented in the collision energy range from 30 to 75 eV. At low collision energies the dominating side chain channel observed corresponds to the cleavage of the bond from the para-position of the phenyl ring to the β-C of the remaining moiety, but cleavage of the Cαsbnd Cβ bond is also observed. Further fragments are formed through cleavage of the Cα bond to the carbonyl group, through decomposition of the carboxyl group or through significant decomposition of the backbone. The dehydrogenated molecular anion is also observed with appreciable intensity. These results are discussed in the context of earlier studies on dissociative electron attachment to tyrosine and other amino acids, as well as within the role of the side chain in electron induced decomposition of this aromatic amino acid. Stabilization of the temporary molecular anion in the transient collision complex is discussed and we argue that this may have significant influence on the branching ratios observed.

  11. Acyl chains of phospholipase D transphosphatidylation products in Arabidopsis cells: a study using multiple reaction monitoring mass spectrometry.

    Directory of Open Access Journals (Sweden)

    Dominique Rainteau

    Full Text Available BACKGROUND: Phospholipases D (PLD are major components of signalling pathways in plant responses to some stresses and hormones. The product of PLD activity is phosphatidic acid (PA. PAs with different acyl chains do not have the same protein targets, so to understand the signalling role of PLD it is essential to analyze the composition of its PA products in the presence and absence of an elicitor. METHODOLOGY/PRINCIPAL FINDINGS: Potential PLD substrates and products were studied in Arabidopsis thaliana suspension cells treated with or without the hormone salicylic acid (SA. As PA can be produced by enzymes other than PLD, we analyzed phosphatidylbutanol (PBut, which is specifically produced by PLD in the presence of n-butanol. The acyl chain compositions of PBut and the major glycerophospholipids were determined by multiple reaction monitoring (MRM mass spectrometry. PBut profiles of untreated cells or cells treated with SA show an over-representation of 160/18:2- and 16:0/18:3-species compared to those of phosphatidylcholine and phosphatidylethanolamine either from bulk lipid extracts or from purified membrane fractions. When microsomal PLDs were used in in vitro assays, the resulting PBut profile matched exactly that of the substrate provided. Therefore there is a mismatch between the acyl chain compositions of putative substrates and the in vivo products of PLDs that is unlikely to reflect any selectivity of PLDs for the acyl chains of substrates. CONCLUSIONS: MRM mass spectrometry is a reliable technique to analyze PLD products. Our results suggest that PLD action in response to SA is not due to the production of a stress-specific molecular species, but that the level of PLD products per se is important. The over-representation of 160/18:2- and 16:0/18:3-species in PLD products when compared to putative substrates might be related to a regulatory role of the heterogeneous distribution of glycerophospholipids in membrane sub-domains.

  12. New Developments in Quantitative Real-time Polymerase Chain Reaction Technology. (United States)

    Gadkar, Vija yJ; Filion, Martin


    Real time-quantitative PCR (RT-qPCR) technology has revolutionized the detection landscape in every area of molecular biology. The fundamental basis of this technology has remained unchanged since its inception, however various modifications have enhanced the overall performance of this highly versatile technology. These improvements have ranged from changes in the individual components of the enzymatic reaction cocktail (polymerizing enzymes, reaction buffers, probes, etc.) to the detection system itself (instrumentation, software, etc.). The RT-qPCR technology currently available to researchers is more sensitive, faster and affordable than when this technology was first introduced. In this article, we summarize the developments of the last few years in RT-qPCR technology and nucleic acid amplification.

  13. Generation of polymerase chain reaction-specific probes for library screening using single degenerate primers. (United States)

    Hommes, N G; Arp, D J; Sayavedra-Soto, L A


    Degenerate oligonucleotide primers were made to peptide sequences from hydroxylamine oxidoreductase (HAO) from Nitrosomonas europaea. The primers were used singly in PCR reactions to amplify portions of the gene for HAO from genomic DNA. Southern hybridizations using fragments amplified with each primer showed that they labeled the same genomic DNA fragments. The PCR-amplified fragments were successfully used to screen a gene library for clones containing the HAO gene. The method of isolating genes by PCR with single primers has general utility.

  14. [The experience of implementation of REP-u RAPD-polymerase chain reaction in epidemiologic characteristic of nosocomial isolates Pseudomonas aeruginosa]. (United States)

    Kuznetsova, M V; Maksimova, A V; Karpunina, T I


    The article presents comparative evaluation of diagnostic value of technique REP- u RAPD-polymerase chain reaction applied under genetic typing of clinical isolates of Pseudomonas Aeruginosa. The strains are isolated in different hospital departments of medical institutions in adult (8 medical institutions; n = 145) and children (5 medical institutions; n = 151) medical networks. The results of study demonstrated different boundary capacity of three reactions. The Simpson discrimination index made up to 0.993, 0.875 and 0.639 for RAPD-, ERIC- and BOX-polymerase chain reaction correspondingly. The RAPD-polymerase chain reaction makes it possible to detect individual characteristics of strains. Out of two alternatives the REP-polymerase chain reaction demonstrated its advantage, besides only with one primer ERIC2. The BOX-polymerase chain reaction has a least discriminating capacity under typing of isolates P. aeruginosa, detecting only species' characteristics. The clinical strains P. aeruginosa are distributed on 24 genome groups and 52 isolates had individual genotypes. The evaluation of results of genetic typing permitted to point out both similarity of tendencies in propagation of strains of P. aeruginosa among hospitalized adults and adolescents and specificity of detection in neonatal clinics. It is obvious that hospitals of different profiles, including departments of reanimation and intensive therapy represent specific ecological environment significantly different in its level of endogenous and exogenous infection.

  15. Pelacakan Virus Bercak Putih pada Udang Vaname (Litopenaeus vannamei di Lombok dengan Real-Time Polymerase Chain Reaction (DETECTION OF WHITE SPOT SYNDROME VIRUS IN LITOPENAEUS VANNAMEI IN LOMBOK ISLAND USING REAL-TIME POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Lulu Arafani


    Full Text Available White spot syndrome virus (WSSV is one of the most threatening diseases in shrimp and othercrustaceans affecting global shrimp farming. Since firstly detected in Taiwan in 1992, the disease hasspread globally and followed with considerable socio-economic consequences. This research was performedto detect the WSSV infection in shrimp farming in Lombok Island’s (West Nusa Tenggara using real-timepolymerase chain reaction. Samples of vaname (Litopenaeus vannamei were collected from several shrimpfarming in Lombok. Results indicated that the spread of WSSV has reached shrimp farms in Lombok,especially in Lendang Jae, West Lombok. Therefore, a biosurveillance program is strongly recommendedto government to avoid and halt the spread of the disease in East Indonesia region .

  16. Dynamics of interfacial reactions between O({sup 3} P) atoms and long-chain liquid hydrocarbons

    Energy Technology Data Exchange (ETDEWEB)

    Allan, Mhairi [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom); Bagot, Paul A J [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom); Koehler, Sven P K [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom); Reed, Stewart K [Department of Physics and Astronomy, University of Edinburgh, The King' s Buildings, Edinburgh EH9 3JZ (United Kingdom); Westacott, Robin E [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom); Costen, Matthew L [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom); McKendrick, Kenneth G [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom)


    Recent progress that has been made towards understanding the dynamics of collisions at the gas-liquid interface is summarized briefly. We describe in this context a promising new approach to the experimental study of gas-liquid interfacial reactions that we have introduced. This is based on laser-photolytic production of reactive gas-phase atoms above the liquid surface and laser-spectroscopic probing of the resulting nascent products. This technique is illustrated for reaction of O({sup 3}P) atoms at the surface of the long-chain liquid hydrocarbon squalane (2,6,10,15,19,23-hexamethyltetracosane). Laser-induced fluorescence detection of the nascent OH has revealed mechanistically diagnostic correlations between its internal and translational energy distributions. Vibrationally excited OH molecules are able to escape the surface. At least two contributions to the product rotational distributions are identified, confirming and extending previous hypotheses of the participation of both direct and trapping-desorption mechanisms. We speculate briefly on future experimental and theoretical developments that might be necessary to address the many currently unanswered mechanistic questions for this, and other, classes of gas-liquid interfacial reaction.

  17. A new era for homolytic aromatic substitution: replacing Bu3SnH with efficient light-induced chain reactions. (United States)

    Gurry, Michael; Aldabbagh, Fawaz


    Herein is a pertinent review of recent photochemical homolytic aromatic substitution (HAS) literature. Issues with using the reductant Bu3SnH in an oxidative process where the net loss of a hydrogen atom occurs is discussed. Nowadays more efficient light-induced chain reactions are used resulting in HAS becoming a synthetic mechanism of choice rivaling organometallic, transition-metal and electrophilic aromatic substitution protocols. The review includes aromatic substitution as part of a tandem or cascade reaction, Pschorr reaction, as well as HAS facilitated by ipso-substitution, and Smiles rearrangement. Recently visible-light photoredox catalysis, which is carried out at room temperature has become one of the most important means of aromatic substitution. The main photoredox catalysts used are polypyridine complexes of Ru(ii) and Ir(iii), although eosin Y is an alternative allowing metal-free HAS. Other radical initiator-free aromatic substitutions have used 9-mesityl-10-methylacridinium ion and N,N-bis(2,6-diisopropylphenyl)perylene-3,4,9,10-bis(dicarboximide) as the photoredox catalyst, UV-light, photoinduced electron-transfer, zwitterionic semiquinone radical anions, and Barton ester intermediates.

  18. Simultaneous detection of hepatitis B virus genotypes and mutations associated with resistance to lamivudine, adefovir, and telbivudine by the polymerase chain reaction-ligase detection reaction

    Directory of Open Access Journals (Sweden)

    Yong-Zhong Wang


    Full Text Available OBJECTIVES: Detection of mutations associated to nucleos(tide analogs and hepatitis B virus (HBV genotyping are essential for monitoring treatment of HBV infection. We developed a multiplex polymerase chain reaction-ligase detection reaction (PCR-LDR assay for the rapid detection of HBV genotypes and mutations associated with lamivudine, adefovir, and telbivudine resistance in HBV-infected patients. METHODS: HBV templates were amplified by PCR, followed by LDR and electrophoresis on a sequencer. The assay was evaluated using plasmids that contained wild-type or mutant HBV sequences and 216 clinical samples. RESULTS: The PCR-LDR assay and sequencing gave comparable results for 158 of the 216 samples (73.1% with respect to mutation detection and genotyping. Complete agreement between the two methods was observed for all the samples (100% at codon 180 and codon 204. Concordant results were observed for 99.4% of the 158 samples at codon 181 and 98.7% at codon 236. The genotyping results were completely concordant between the PCR-LDR assay and sequencing. The PCR-LDR assay could detect a proportion of 1% mutant plasmid in a background of wild-type plasmid. CONCLUSION: The PCR-LDR assay is sensitive and specific for detection of HBV genotypes and drug resistance mutations, and could be helpful for decision making in the treatment of HBV infection.

  19. Evaluation of three different molecular markers for the detection of Staphylococcus aureus by polymerase chain reaction. (United States)

    Riyaz-Ul-Hassan, Syed; Verma, Vijeshwar; Qazi, Ghulam Nabi


    The aim of this study was to target three genes of Staphylococcus aureus-fmhA (coding for a factor of unknown function), catalase and femA (coding for a factor essential for methicillin resistance) to establish and validate a PCR assay for the detection of this pathogen. Two pairs of primers were designed for fmhA and one pair each for catalase and femA genes. The PCR assays were standardized and found to give specific amplicons under similar reaction parameters. Target specificity of the primers was confirmed by DNA sequencing of the amplicons. While the initial inclusivity and exclusivity test reactions were in agreement in case of three of the primer pairs, one pair based on fmhA gene produced a non-specific product with a template DNA used in exclusivity test reactions. Forty-five strains of S. aureus were subjected to these PCR assays for their evaluation. Three among the four pairs of primers, one against each gene detected all the 45 strains precisely whereas one of the PCR assays using primers targeting the fmhA gene did not generate the specific amplicon with several of the strains. Seven unidentified strains of Gram-positive cocci subjected to these PCR assays produced negative results for each culture. Six of the strains were identified as Staphylococcus haemolyticus and one strain as Staphylococcus arlettae by 16S ribosomal gene analyses. All the three assay systems showed a detection limit of 100 cells per 20mul reaction assay. For validation of these assay systems, 80 coded samples of 11% skimmed milk spiked with different pathogens were received from NICED (National Institute of Cholera and Enteric Diseases), Kolkata and subjected to these PCR assays. All the three assays could detect S. aureus correctly in two of the samples. Amongst 150 raw milk samples, 36 (24%) were found positive for S. aureus. We conclude that fmhA, catalase and femA genes are conserved in S. aureus and, therefore, could be used as specific targets for its detection and

  20. Fluorescence detection test by black printed circuit board based microfluidic channel for polymerase chain reaction. (United States)

    Hwang, Ji-Soo; Kim, Yu-Seop; Song, Hye-Jeong; Kim, Jong-Dae; Park, Chan-Young


    This paper proposes the optimal structure of a PCB-based micro PCR chip constructed on a PCB substrate using commercial adhesive tapes and plastic covers. The solder mask of the PCB substrate was coated black, and the area where the reaction chamber is attached was legend printed with white silk to minimize the noise during fluorescence detection. The performance of the PCR and fluorescence detection was compared using 6 types of reaction chambers, each made with different double-sided tapes. Three of the chambers were unsuccessful in completing the PCR. The performance of the other three chambers that successfully amplified DNA was compared using Taqman probe for Chlamydia Trachomatis DNA. The amplified product was illuminated diagonally with a blue LED to excite the product just before imaging, and the LED was turned off when the image was captured to prevent quenching of the probe. The images were taken 10 seconds prior to the last extension step for each cycle using a DSLR camera. The experiments were run as a quartet for each three chambers made with different double-sided tape. The results showed that there were significant difference between the three tapes.