WorldWideScience

Sample records for repeat veeg study

  1. The consistency of ictal SPECT and VEEG studies in localizing the epileptic focus%发作期SPECT脑血流灌注显像和VEEG在癫痫灶定位诊断中的一致性

    Institute of Scientific and Technical Information of China (English)

    王晓慧; 陈雪红; 柳江燕; 冯建中; 鲁秀娟; 王为民; 庞小溪

    2014-01-01

    Objective To localize the epileptic focus by means of ictal SPECT and video-electroencephalography(VEEG) patterns to decide whether the combination of them are capable of localizing epileptic focus correctly.Methods The present study was performed in 45 epileptic patients,who showed spike waves during VEEG monitoring when deprived of sleep to provoke seizures,even oral application of clonidine was given when deprivation of sleep was failed in limited time.Technetium-99m ethyl cysteinate dimer(99Tcm-ECD)was injected within 30 s when a clinical sign and/or an typical VEEG discharge was recognized,then brain SPECT was performed after 30 min.In the end,compared the results of ictal SPECT and VEEG in localization.x2 test was performed by using software SPSS l 9.0.Results Ictal brain SPECT localized in 93.3% (42/45)patients,of whom 95.2% (40/42)patients had single hyperperfusion,and 4.8%(2/42)had multiple hyperperfusion.VEEG showed partial seizures in 68.9% (31/45) patients,and 31.1%(14/45)patients showed generalized spike waves.The relationship of ictal SPECT and VEEG in localizing epileptic focus was turned out as following:Firstly,the consistency of ictal SPECT and VEEG is 83.9%(26/31)in partial seizure,as for generalized tonic-clonic seizure,VEEG showed generalized spike waves,and ictal brain SPECT declared single hyperperfusion,therefore,the localization of them was different.The consistency of partial seizure was significantly higher than that of generalized tonic-clonic seizure (x2=24.478,P<0.05).Conclusions The consistency of ictal SPECT and VEEG in localization has something to do with epilepsy categories.The study indicates that it is possible to obtain localization in patients with partial seizures using a combination of ictal SPECT and VEEG patterns,as for generalized tonic-clonic seizure,the combination of them is not enough and it' s imperative to use other techniques.%目的 探讨癫痫发作期SPECT脑血流灌注显像和视频脑电

  2. Cerebral SPECT under VEEG monitoring combined with semi-quantitative analysis in localization of epileptogenic zone%视频脑电结合半定量分析的脑血流灌注显像定位致痫灶

    Institute of Scientific and Technical Information of China (English)

    郝科技; 王茜; 刘献增; 邱李恒; 高旭光; 李原

    2014-01-01

    目的 评价一种在视频脑电监测(VEEG)下结合半定量分析的脑血流灌注SPECT显像法用于癫痫致痫灶定位诊断的价值.方法 对81例难治性癫痫患者的临床资料进行回顾性分析.脑血流灌注SPECT在VEEG监测下进行,显像前以睡眠剥夺、逐步减少或停服抗癫痫药的方式争取诱发癫痫发作.影像判读采用视觉判断与半定量分析结合的方法.结果 19例同时获得发作期和发作间期显像,62例仅获得发作间期显像.SPECT、VEEG和MRI对病灶的检出率分别为95%、98%和42%,SPECT与VEEG检出率之间差异无统计学意义(P>0.05),但二者均显著高于MRI(x 2=52.913,P<0.001;x2 =59.247,P<0.001).SPECT与VEEG、SPECT与MRI和MRI与VEEG对病灶的定位符合率分别为69%、25%和27%,SPECT与VEEG之间的符合率显著高于SPECT与MRI(x2=26.905,P<0.001)及MRI与VEEG之间的符合率(x2=26.905,P<0.001).SPECT、VEEG和MRI的定位准确性分别为83%、74%和52%;术后随访结果示,疗效达Ⅰ~Ⅱ级患者中,有11例(n=14)其术前SPECT与VEEG定位结果一致.结论 脑SPECT显像法对致痫灶定位具有较高的价值,提倡作为常规检查法用于难治性癫痫的定位诊断.%Objective To investigate the value of the cerebral blood flow SPECT used for localization of epileptogenic zone in patients with intractable epilepsy,which was performed under the videoelectroencephalogram (VEEG) monitoring combined with the semi-quantitative analysis.Methods Ccrcbral blood flow SPECT was performed under VEEG monitoring and seizures were captured either by sleep-deprived or by reducing dose or by withholding of antiepileptic drugs (AEDs).Neurogam analysis was used in the procedure of image interpretation.Results 19 inter-ictal combined with ictal images and 62 only inter-ictal images were obtained in this study.The detection rates of the pathological focus for SPECT,VEEG and MRI were 95%、98% and 42%,respectively.There was no

  3. 外部性脑积水对儿童脑电功能的影响%The influence of external Hydrocephalus on V-EEG in children

    Institute of Scientific and Technical Information of China (English)

    甘颖妍; 麦坚凝

    2009-01-01

    目的 研究外部性脑积水对婴幼儿脑电功能的影响.方法 自2007年3月至2008年3月对82例2~3岁外部性脑积水儿童行视频脑电图检查及分析.结果 有18.29%的患儿脑电图中出现癫痫样放电,余均出现脑电软征象.结论 外部性脑积水儿童的脑电图会出现癫痫样放电和脑电软征象,视频脑电图为评估其预后和制订合理的干预方案提供依据和信息.%Objective To investigate the influence of external hydrocephalus on V-EEG in children. Methods 82 children with external hydrocephalus underwent the V-EEG from 2007 to 2008. Results 18.29% children with external hydrocephalus had epileptiform discharges,others had soft signs. Conclusion Epileptiform discharges and electroencephalography soft signs appear in the children with external hydrocephalus.V-EEG provides information for evaluating prognosis and formulating intervention program.

  4. Analysis of repeated outcome measures from longitudinal studies

    Institute of Scientific and Technical Information of China (English)

    Yuanjia WANG; Naihua DUAN

    2011-01-01

    @@ In many clinical studies repeated measurements of an outcome are collected over time.For example,in an 8-week study of treatment for obsessive compulsive disorder,the severity of the disorder may be measured weekly using the Yale-Brown-Obsessive-Compulsive-Disorder-Scale (YBOCS).For each study participant who completes the study,there will be nine repeated measures of YBOCS (a baseline assessment plus eight assessments during the course of treatment).Such a study in which participants are followed and measured repeatedly over time is called a longitudinal study and the resulting data are called longitudinal data.

  5. Successive failure, repeat entrepreneurship and no learning: A case study

    Directory of Open Access Journals (Sweden)

    Marius Pretorius

    2011-02-01

    Full Text Available Orientation: Current theories of repeat entrepreneurship provide little explanation for the effect of failure as a ‘trigger’ for creating successive ventures or learning from repeated failures. Research purpose: This study attempts to establish the role of previous failures on the ventures that follow them and to determine the process of learning from successive failures.Motivation for the study: Successive failures offer potentially valuable insights into the relationship between failures on the ventures that follow and the process of learning from failure.Research design, approach and method: The researchers investigated a single case study of one entrepreneur’s successive failures over 20 years.Main findings: Although the causes varied, all the failures had fundamental similarities. This suggested that the entrepreneur had not learnt from them. The previous failures did not trigger the subsequent ventures. Instead, they played a role in causing the failures. Learning from failure does not happen immediately but requires deliberate reflection. Deliberate reflection is a prerequisite for learning from failure as the entrepreneur repeated similar mistakes time after time until he reflected on each failure.Practical/managerial implications: It confirms that failure is a part of entrepreneurial endeavours. However, learning from it requires deliberate reflection. Failure does not ‘trigger’ the next venture and educators should note this.Contribution/value-add: Knowing the effect of failure on consecutive ventures may help us to understand the development of prototypes (mental frameworks and expand the theory about entrepreneurial prototype categories.

  6. Repeating tests: different roles in research studies and clinical medicine.

    Science.gov (United States)

    Monach, Paul A

    2012-10-01

    Researchers often decide whether to average multiple results in order to produce more precise data, and clinicians often decide whether to repeat a laboratory test in order to confirm its validity or to follow a trend. Some of the major sources of variation in laboratory tests (analytical imprecision, within-subject biological variation and between-subject variation) and the effects of averaging multiple results from the same sample or from the same person over time are discussed quantitatively in this article. This analysis leads to the surprising conclusion that the strategy of averaging multiple results is only necessary and effective in a limited range of research studies. In clinical practice, it may be important to repeat a test in order to eliminate the possibility of a rare type of error that has nothing to do analytical imprecision or within-subject variation, and for this reason, paradoxically, it may be most important to repeat tests with the highest sensitivity and/or specificity (i.e., ones that are critical for clinical decision-making).

  7. PET functional volume delineation: a robustness and repeatability study

    Energy Technology Data Exchange (ETDEWEB)

    Hatt, Mathieu [CHU Morvan, INSERM, U650, LaTIM, Brest (France); CHU MORVAN, LaTIM, INSERM U650, Brest (France); Cheze-le Rest, Catherine [CHU Morvan, INSERM, U650, LaTIM, Brest (France); CHU, Academic Department of Nuclear Medicine, Brest (France); Albarghach, Nidal; Pradier, Olivier [CHU Morvan, INSERM, U650, LaTIM, Brest (France); CHU, Institute of Oncology, Brest (France); Visvikis, Dimitris [CHU Morvan, INSERM, U650, LaTIM, Brest (France)

    2011-04-15

    Current state-of-the-art algorithms for functional uptake volume segmentation in PET imaging consist of threshold-based approaches, whose parameters often require specific optimization for a given scanner and associated reconstruction algorithms. Different advanced image segmentation approaches previously proposed and extensively validated, such as among others fuzzy C-means (FCM) clustering, or fuzzy locally adaptive bayesian (FLAB) algorithm have the potential to improve the robustness of functional uptake volume measurements. The objective of this study was to investigate robustness and repeatability with respect to various scanner models, reconstruction algorithms and acquisition conditions. Robustness was evaluated using a series of IEC phantom acquisitions carried out on different PET/CT scanners (Philips Gemini and Gemini Time-of-Flight, Siemens Biograph and GE Discovery LS) with their associated reconstruction algorithms (RAMLA, TF MLEM, OSEM). A range of acquisition parameters (contrast, duration) and reconstruction parameters (voxel size) were considered for each scanner model, and the repeatability of each method was evaluated on simulated and clinical tumours and compared to manual delineation. For all the scanner models, acquisition parameters and reconstruction algorithms considered, the FLAB algorithm demonstrated higher robustness in delineation of the spheres with low mean errors (10%) and variability (5%), with respect to threshold-based methodologies and FCM. The repeatability provided by all segmentation algorithms considered was very high with a negligible variability of <5% in comparison to that associated with manual delineation (5-35%). The use of advanced image segmentation algorithms may not only allow high accuracy as previously demonstrated, but also provide a robust and repeatable tool to aid physicians as an initial guess in determining functional volumes in PET. (orig.)

  8. Studies of an expanded trinucleotide repeat in transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Bingham, P.; Wang, S.; Merry, D. [Univ. of Pennsylvania, Philadelphia, PA (United States)

    1994-09-01

    Spinal and bulbar muscular atrophy (SBMA) is a progressive motor neuron disease caused by expansion of a trinucleotide repeat in the androgen receptor gene (AR{sup exp}). AR{sup exp} repeats expand further or contract in approximately 25% of transmissions. Analogous {open_quotes}dynamic mutations{close_quotes} have been reported in other expanded trinucleotide repeat disorders. We have been developing a mouse model of this disease using a transgenic approach. Expression of the SBMA AR was documented in transgenic mice with an inducible promoter. No phenotypic effects of transgene expression were observed. We have extended our previous results on stability of the expanded trinucleotide repeat in transgenic mice in two lines carrying AR{sup exp}. Tail DNA was amplified by PCR using primers spanning the repeat on 60 AR{sup exp} transgenic mice from four different transgenic lines. Migration of the PCR product through an acrylamide gel showed no change of the 45 CAG repeat length in any progeny. Similarly, PCR products from 23 normal repeat transgenics showed no change from the repeat length of the original construct. Unlike the disease allele in humans, the expanded repeat AR cDNA in transgenic mice showed no change in repeat length with transmission. The relative stability of CAG repeats seen in the transgenic mice may indicate either differences in the fidelity of replicative enzymes, or differences in error identification and repair between mice and humans. Integration site or structural properties of the transgene itself might also play a role.

  9. Cytogenetic studies in couples experiencing repeated pregnancy losses.

    Science.gov (United States)

    De Braekeleer, M; Dao, T N

    1990-07-01

    A computerized database generated from the literature on cytogenetic studies in couples experiencing repeated pregnancy losses has been set up at the University of Quebec at Chicoutimi. At the present time, it contains data on 22,199 couples (44,398 individuals). The statistical analyses showed a relationship between the distribution of the chromosome abnormalities and the number of abortions. An uneven distribution of the chromosomal structural rearrangements according to the sex of the carrier was found (P less than 0.05). Overall, 4.7% of the couples ascertained for two or more spontaneous abortions included one carrier. It also appeared that only translocations (both reciprocal and Robertsonian) and inversions were associated with a higher risk of pregnancy wastage. Therefore, genetic counselling should be offered to these couples and investigations performed on their extended families.

  10. Study of simple sequence repeat (SSR) polymorphism for biotic ...

    African Journals Online (AJOL)

    home

    2013-10-02

    Oct 2, 2013 ... back cross breeding; SSRs, simple sequence repeats; PIC, polymorphism ..... PIC values were reported in barley wheat and rice (Gu et ... doubled-haploid rice population. Theor. ... Grover A, Aishwarya V, Sharma PC (2007).

  11. Exposing Students to Repeat Photography: Increasing Cultural Understanding on a Short-Term Study Abroad

    Science.gov (United States)

    Lemmons, Kelly K.; Brannstrom, Christian; Hurd, Danielle

    2014-01-01

    Traditionally, repeat photography has been used to analyze land cover change. This paper describes how repeat photography may be used as a tool to enhance the short-term study abroad experience by facilitating cultural interaction and understanding. We present evidence from two cases and suggest a five-step repeat photography method for educators…

  12. Exposing Students to Repeat Photography: Increasing Cultural Understanding on a Short-Term Study Abroad

    Science.gov (United States)

    Lemmons, Kelly K.; Brannstrom, Christian; Hurd, Danielle

    2014-01-01

    Traditionally, repeat photography has been used to analyze land cover change. This paper describes how repeat photography may be used as a tool to enhance the short-term study abroad experience by facilitating cultural interaction and understanding. We present evidence from two cases and suggest a five-step repeat photography method for educators…

  13. Single and repeated elective abortions in Japan: a psychosocial study.

    Science.gov (United States)

    Kitamura, T; Toda, M A; Shima, S; Sugawara, M

    1998-09-01

    Despite its social, legal and medical importance, termination of pregnancy (TOP) (induced abortion) has rarely been the focus of psychosocial research. Of a total of 1329 women who consecutively attended the antenatal clinic of a general hospital in Japan, 635 were expecting their first baby. Of these 635 women, 103 (16.2%) had experienced TOP once previously (first aborters), while 47 (7.4%) had experienced TOP two or more times (repeated aborters). Discriminant function analysis was performed using psychosocial variables found to be significantly associated with either first abortion or repeated abortion in bivariate analyses. This revealed that both first and repeated aborters could be predicted by smoking habits and an unwanted current pregnancy while the repeated aborters appear to differ from first aborters in having a longer pre-marital dating period, non-arranged marriages, smoking habits, early maternal loss experience or a low level of maternal care during childhood. These findings suggest that both the frequency of abortion and its repetition have psychosocial origins.

  14. Reactor pulse repeatability studies at the annular core research reactor

    Energy Technology Data Exchange (ETDEWEB)

    DePriest, K.R. [Applied Nuclear Technologies, Sandia National Laboratories, Mail Stop 1146, Post Office Box 5800, Albuquerque, NM 87185-1146 (United States); Trinh, T.Q. [Nuclear Facility Operations, Sandia National Laboratories, Mail Stop 0614, Post Office Box 5800, Albuquerque, NM 87185-1146 (United States); Luker, S. M. [Applied Nuclear Technologies, Sandia National Laboratories, Mail Stop 1146, Post Office Box 5800, Albuquerque, NM 87185-1146 (United States)

    2011-07-01

    The Annular Core Research Reactor (ACRR) at Sandia National Laboratories is a water-moderated pool-type reactor designed for testing many types of objects in the pulse and steady-state mode of operations. Personnel at Sandia began working to improve the repeatability of pulse operations for experimenters in the facility. The ACRR has a unique UO{sub 2}-BeO fuel that makes the task of producing repeatable pulses difficult with the current operating procedure. The ACRR produces a significant quantity of photoneutrons through the {sup 9}Be({gamma}, n){sup 8}Be reaction in the fuel elements. The photoneutrons are the result of the gammas produced during fission and in fission product decay, so their production is very much dependent on the reactor power history and changes throughout the day/week of experiments in the facility. Because the photoneutrons interfere with the delayed-critical measurements required for accurate pulse reactivity prediction, a new operating procedure was created. The photoneutron effects at delayed critical are minimized when using the modified procedure. In addition, the pulse element removal time is standardized for all pulse operations with the modified procedure, and this produces less variation in reactivity removal times. (authors)

  15. Association between CAG repeat polymorphisms and the risk of prostate cancer: a meta-analysis by race, study design and the number of (CAG)n repeat polymorphisms.

    Science.gov (United States)

    Sun, Jun-Hyun; Lee, Sang-Ah

    2013-11-01

    Although a number of studies have been conducted on the association between prostate cancer and CAG repeat polymorphisms of the androgen receptor gene, this association remains elusive and controversial. In this meta-analysis, we aimed to evaluate the effects of (CAG)n repeat genetic polymorphisms on the incidence of prostate cancer, particularly as regards race, study design and the number of (CAG)n repeats. To collect articles published on the association between CAG repeats and prostate cancer, publications were identified from the National Center for Biotechnology Information (NCBI) database of epidemiological studies published up to October 2011; our identification of publications was not limited by a language barrier. The following search keywords were used: prostate cancer risk, CAG repeat polymorphism, androgen receptor gene and human. Stata version 10 was used for the meta-analysis and the publication bias was measured through the Begg's test and Egger's test. This meta-analysis included 47 studies with 13,346 cases and 15,172 control or non-cases and consisted of 31 reports based on Caucasians, ten on Asians, one on Hispanics and four on combined ethnic groups. The carriers of a shorter CAG repeat sequence had an increased risk of prostate cancer (OR 1.21, 95% CI 1.10-1.34 for all subjects; OR 1.21, 95% CI 1.10-1.34 for prospective studies; OR 1.32, 95% CI 1.15-1.51 for retrospective studies) regardless of the exact length of the CAG repeat, compared with carriers of a longer repeat sequence. In terms of race, the risk of carrying a shorter CAG repeat sequence was 1.10- and 1.83-fold higher than that of a longer repeat sequence in Caucasians and Asians, respectively. For the specific number of CAG repeat polymorphisms, carriers of repeats were observed to have a higher risk of prostate cancer (OR 1.16, 95% CI 1.04-1.29) compared with carriers with ≥ 22 CAG repeat polymorphisms, particularly for Asians (OR 2.06, 95% CI 1.00-4.24). This meta

  16. Can semiology predict psychogenic nonepileptic seizures? A prospective study.

    Science.gov (United States)

    Syed, Tanvir U; LaFrance, W Curt; Kahriman, Emine S; Hasan, Saba N; Rajasekaran, Vijayalakshmi; Gulati, Deepak; Borad, Samip; Shahid, Asim; Fernandez-Baca, Guadalupe; Garcia, Naiara; Pawlowski, Matthias; Loddenkemper, Tobias; Amina, Shahram; Koubeissi, Mohamad Z

    2011-06-01

    Reducing health and economic burdens from diagnostic delay of psychogenic nonepileptic seizures (PNES) requires prompt referral for video electroencephalography (VEEG) monitoring, the diagnostic gold standard. Practitioners make VEEG referrals when semiology suggests PNES, although few semiological signs are supported by well-designed studies, and most VEEG studies neglect to concurrently measure how accurately seizure witnesses can ascertain semiology. In this study, we estimate the value of eyewitness-reported and video-documented semiology for predicting PNES, and we measure accuracy of eyewitness reports. We prospectively interviewed eyewitnesses of seizures in patients referred for VEEG monitoring, to inquire about 48 putative PNES and ES signs. Multiple, EEG-blinded, epileptologists independently evaluated seizure videos and documented the presence/absence of signs. We used generalized estimating equations to identify reliable video-documented PNES and ES signs, and we compared eyewitness reports with video findings to assess how accurately signs are reported. We used logistic regression to determine whether eyewitness reports could predict VEEG-ascertained seizure type. We analyzed 120 seizures (36 PNES, 84 ES) from 35 consecutive subjects. Of 45 video-documented signs, only 3 PNES signs ("preserved awareness," "eye flutter," and "bystanders can intensify or alleviate") and 3 ES signs ("abrupt onset," "eye-opening/widening," and postictal "confusion/sleep") were significant and reliable indicators of seizure type. Eyewitness reports of these 6 signs were inaccurate and not statistically different from guessing. Consequentially, eyewitness reports of signs did not predict VEEG-ascertained diagnosis. We validated our findings in a second, prospective cohort of 36 consecutive subjects. We identified 6 semiological signs that reliably distinguish PNES and ES, and found that eyewitness reports of these signs are unreliable. We offer suggestions to improve the

  17. Analysing Repeat Visitation on Country Level with Passive Mobile Positioning Method: an Estonian Case Study

    Directory of Open Access Journals (Sweden)

    Andres Kuusik

    2013-01-01

    Full Text Available The purpose of this paper is to investigate the capabilities and limits of the passive mobile positioning (PMP method in studying loyalty of tourists on the macro level. The repeat visitors were identified using database of call activities of roaming phones in Estonia since 25.04.2005 till 31.01.2009. For this purpose was developed model which selected repeat visits on the basis of time interval. The findings of the study revealed that it is possible to observe the duration, density, seasonality and dynamics of repeat visitations. In addition the local destinations and events most loved by repeat visitors and the trajectory they are using could be also identified. Another important finding revealed that repeat visitors stay longer in destination than first time visitors. The results presented in this paper could be used by Estonian Ministry of Economic Affairs and Communications and by Enterprise Estonia developing the Estonian tourism policy

  18. Computational study of the human dystrophin repeats: interaction properties and molecular dynamics.

    Science.gov (United States)

    Legrand, Baptiste; Giudice, Emmanuel; Nicolas, Aurélie; Delalande, Olivier; Le Rumeur, Elisabeth

    2011-01-01

    Dystrophin is a large protein involved in the rare genetic disease Duchenne muscular dystrophy (DMD). It functions as a mechanical linker between the cytoskeleton and the sarcolemma, and is able to resist shear stresses during muscle activity. In all, 75% of the dystrophin molecule consists of a large central rod domain made up of 24 repeat units that share high structural homology with spectrin-like repeats. However, in the absence of any high-resolution structure of these repeats, the molecular basis of dystrophin central domain's functions has not yet been deciphered. In this context, we have performed a computational study of the whole dystrophin central rod domain based on the rational homology modeling of successive and overlapping tandem repeats and the analysis of their surface properties. Each tandem repeat has very specific surface properties that make it unique. However, the repeats share enough electrostatic-surface similarities to be grouped into four separate clusters. Molecular dynamics simulations of four representative tandem repeats reveal specific flexibility or bending properties depending on the repeat sequence. We thus suggest that the dystrophin central rod domain is constituted of seven biologically relevant sub-domains. Our results provide evidence for the role of the dystrophin central rod domain as a scaffold platform with a wide range of surface features and biophysical properties allowing it to interact with its various known partners such as proteins and membrane lipids. This new integrative view is strongly supported by the previous experimental works that investigated the isolated domains and the observed heterogeneity of the severity of dystrophin related pathologies, especially Becker muscular dystrophy.

  19. Computational study of the human dystrophin repeats: interaction properties and molecular dynamics.

    Directory of Open Access Journals (Sweden)

    Baptiste Legrand

    Full Text Available Dystrophin is a large protein involved in the rare genetic disease Duchenne muscular dystrophy (DMD. It functions as a mechanical linker between the cytoskeleton and the sarcolemma, and is able to resist shear stresses during muscle activity. In all, 75% of the dystrophin molecule consists of a large central rod domain made up of 24 repeat units that share high structural homology with spectrin-like repeats. However, in the absence of any high-resolution structure of these repeats, the molecular basis of dystrophin central domain's functions has not yet been deciphered. In this context, we have performed a computational study of the whole dystrophin central rod domain based on the rational homology modeling of successive and overlapping tandem repeats and the analysis of their surface properties. Each tandem repeat has very specific surface properties that make it unique. However, the repeats share enough electrostatic-surface similarities to be grouped into four separate clusters. Molecular dynamics simulations of four representative tandem repeats reveal specific flexibility or bending properties depending on the repeat sequence. We thus suggest that the dystrophin central rod domain is constituted of seven biologically relevant sub-domains. Our results provide evidence for the role of the dystrophin central rod domain as a scaffold platform with a wide range of surface features and biophysical properties allowing it to interact with its various known partners such as proteins and membrane lipids. This new integrative view is strongly supported by the previous experimental works that investigated the isolated domains and the observed heterogeneity of the severity of dystrophin related pathologies, especially Becker muscular dystrophy.

  20. Repeat endocarditis: analysis of risk factors based on the International Collaboration on Endocarditis - Prospective Cohort Study.

    Science.gov (United States)

    Alagna, L; Park, L P; Nicholson, B P; Keiger, A J; Strahilevitz, J; Morris, A; Wray, D; Gordon, D; Delahaye, F; Edathodu, J; Miró, J M; Fernández-Hidalgo, N; Nacinovich, F M; Shahid, R; Woods, C W; Joyce, M J; Sexton, D J; Chu, V H

    2014-06-01

    Repeat episodes of infective endocarditis (IE) can occur in patients who survive an initial episode. We analysed risk factors and 1-year mortality of patients with repeat IE. We considered 1874 patients enrolled in the International Collaboration on Endocarditis - Prospective Cohort Study between January 2000 and December 2006 (ICE-PCS) who had definite native or prosthetic valve IE and 1-year follow-up. Multivariable analysis was used to determine risk factors for repeat IE and 1-year mortality. Of 1874 patients, 1783 (95.2%) had single-episode IE and 91 (4.8%) had repeat IE: 74/91 (81%) with new infection and 17/91 (19%) with presumed relapse. On bivariate analysis, repeat IE was associated with haemodialysis (p 0.002), HIV (p 0.009), injection drug use (IDU) (p < 0.001), Staphylococcus aureus IE (p 0.003), healthcare acquisition (p 0.006) and previous IE before ICE enrolment (p 0.001). On adjusted analysis, independent risk factors were haemodialysis (OR, 2.5; 95% CI, 1.2-5.3), IDU (OR, 2.9; 95% CI, 1.6-5.4), previous IE (OR, 2.8; 95% CI, 1.5-5.1) and living in the North American region (OR, 1.9; 95% CI, 1.1-3.4). Patients with repeat IE had higher 1-year mortality than those with single-episode IE (p 0.003). Repeat IE is associated with IDU, previous IE and haemodialysis. Clinicians should be aware of these risk factors in order to recognize patients who are at risk of repeat IE.

  1. Repeat film analysis and its implications for quality assurance in dental radiology: An institutional case study

    Directory of Open Access Journals (Sweden)

    Shruthi Acharya

    2015-01-01

    Full Text Available Context: The goal of any radiologist is to produce the highest quality diagnostic radiographs, while keeping patient exposure as low as reasonably achievable (ALARA. Aims: The aim of this study was to describe the reasons for radiograph rejections through a repeat film analysis in an Indian dental school. Settings and Design: An observational study conducted in the Department of Oral Medicine and Radiology, Manipal College of Dental Sciences, Manipal. Materials and Methods: During a 6-month study period, a total of 9,495 intra-oral radiographs and 2339 extraoral radiographs taken in the Radiology Department were subjected to repeat film analysis. Statistical Analysis Used: SPSS Version 16. Descriptive analysis used. Results: The results showed that the repeat rates were 7.1% and 5.86% for intraoral and extraoral radiographs, respectively. Among the causes for errors reported, positioning error (38.7% was the most common, followed by improper angulations (26.1%, and improper film placement (11.2% for intra-oral radiographs. The study found that the maximum frequency of repeats among extraoral radiographs was for panoramic radiographs (49% followed by lateral cephalogram (33%, and paranasal sinus view (14%. It was also observed that repeat rate of intraoral radiographs was highest for internees (44.7%, and undergraduate students (28.2%. Conclusions: The study pointed to a need for more targeted interventions to achieve the goal of keeping patient exposure ALARA in a dental school setting.

  2. A study of allelic polymorphism of four short tandem repeats in the population of northwestern Russia

    Energy Technology Data Exchange (ETDEWEB)

    Aseev, M.V.; Skakun, V.N.; Baranov, V.S. [Ott Institute of Obstetrics and Gynecology, St. Petersburg (Russian Federation)

    1995-06-01

    Characteristics of the allelic polymorphisms of the trimeric AGC repeat of the androgen receptor gene (Xq11-12), exon 1 (AR); the tetrameric ATCT repeat of the von Willebrand factor gene (12p12), intron 40 (vWF); the AGAT repeat of the hypoxanthine phosphoribosyltransferase gene (Xq26) (HPRT); and the AGAT repeat of anonymous DNA sequences of the short arm of chromosome X (STRX1) were studied in 160 DNA samples from unrelated inhabitants of northwestern Russia using the method of polymerase chain reaction. Seventeen, ten, eight, and nine alleles were revealed electrophoretically for short tandem repeats of AR, vWF, HPRT, and STRX1, respectively. The heterozygosity indices for these repeats were 0.80, 0.70, 0.54, and 0.58, respectively. The values for AR and vWF correlated with those expected according to the Hardy-Weinberg equilibrium, whereas the values for HPRT and STRX1 differed significantly from those theoretically expected. The individualization potentials were 0.045, 0.135, 0.095, and 0.061 for the short tandem repeats of AR, vWF, HPRT, and STRX1, respectively. The distribution of genotypes for the set of these four loci in the population studied was determined. The possibilities of using the studied polymorphic marker systems in molecular diagnosis of the corresponding monogenic diseases - spinal and bulbar muscle atrophy (AR), Lesch-Nyhan disease (HPRT), and von Willebrand disease (vWF) - as well as in population human genetics, testing of personal identity, and molecular approaches to the estimation of mutagenic activity are discussed. 17 refs., 2 figs., 6 tabs.

  3. Anterior segment biometry: a study and review of resolution and repeatability data.

    Science.gov (United States)

    Reinstein, Dan Z; Gobbe, Marine; Archer, Timothy J

    2012-07-01

    To obtain comparable resolution and repeatability data for a selection of anterior segment imaging devices. A standard letter of request was sent in May 2008 to each device manufacturer requesting resolution and repeatability data for its device to be provided according to specific definitions and protocol; if this was not already published in the peer-reviewed domain, compliant raw data were required. Where applicable, repeatability data were reported for corneal vertex corneal thickness; epithelial and flap thickness; minimum corneal thickness; corneal, epithelial and flap thickness mapping for the central 6-mm diameter; minimum residual stromal thickness; angle-to-angle diameter; sulcus-to-sulcus diameter; and anterior chamber depth. To summarize published repeatability data, a complete review of the peer-reviewed literature waas performed. Nine of the 13 manufacturers contacted agreed to take part and provided the data requested: Pentacam HD (Oculus Optikgeräte GmbH), Galilei (Ziemer), Visante OCT (Carl Zeiss Meditec), SL-OCT (Haag-Streit), RTVue (Optovue), Artemis (ArcScan), Vumax (Sonomed), HiScan (Opticon), and Eye Cubed (Ellex/Innovative). Only one (Carl Zeiss Meditec) of 9 manufacturers was able to provide the data directly upon request, without performing a prospective study. Five of the 9 manufacturers were able to provide a complete set of repeatability data for all parameters measurable with their device; the remaining 4 manufacturers admitted that repeatability of some parameters was unknown. Both literature and manufacturers' data on file were lacking and required the study to be performed. This report provides an imperfect, but most comprehensive to date, resolution and repeatability data review of biometric devices intended for surgical planning. Copyright 2012, SLACK Incorporated.

  4. Receptionist input to quality and safety in repeat prescribing in UK general practice: ethnographic case study.

    Science.gov (United States)

    Swinglehurst, Deborah; Greenhalgh, Trisha; Russell, Jill; Myall, Michelle

    2011-11-03

    To describe, explore, and compare organisational routines for repeat prescribing in general practice to identify contributors and barriers to safety and quality. Ethnographic case study. Four urban UK general practices with diverse organisational characteristics using electronic patient records that supported semi-automation of repeat prescribing. 395 hours of ethnographic observation of staff (25 doctors, 16 nurses, 4 healthcare assistants, 6 managers, and 56 reception or administrative staff), and 28 documents and other artefacts relating to repeat prescribing locally and nationally. Potential threats to patient safety and characteristics of good practice. Observation of how doctors, receptionists, and other administrative staff contributed to, and collaborated on, the repeat prescribing routine. Analysis included mapping prescribing routines, building a rich description of organisational practices, and drawing these together through narrative synthesis. This was informed by a sociological model of how organisational routines shape and are shaped by information and communications technologies. Results Repeat prescribing was a complex, technology-supported social practice requiring collaboration between clinical and administrative staff, with important implications for patient safety. More than half of requests for repeat prescriptions were classed as "exceptions" by receptionists (most commonly because the drug, dose, or timing differed from what was on the electronic repeat list). They managed these exceptions by making situated judgments that enabled them (sometimes but not always) to bridge the gap between the idealised assumptions about tasks, roles, and interactions that were built into the electronic patient record and formal protocols, and the actual repeat prescribing routine as it played out in practice. This work was creative and demanded both explicit and tacit knowledge. Clinicians were often unaware of this input and it did not feature in policy

  5. Planned Repeat Cesarean Section at Term and Adverse Childhood Health Outcomes: A Record-Linkage Study.

    Directory of Open Access Journals (Sweden)

    Mairead Black

    2016-03-01

    Full Text Available Global cesarean section (CS rates range from 1% to 52%, with a previous CS being the commonest indication. Labour following a previous CS carries risk of scar rupture, with potential for offspring hypoxic brain injury, leading to high rates of repeat elective CS. However, the effect of delivery by CS on long-term outcomes in children is unclear. Increasing evidence suggests that in avoiding exposure to maternal bowel flora during labour or vaginal birth, offspring delivered by CS may be adversely affected in terms of energy uptake from the gut and immune development, increasing obesity and asthma risks, respectively. This study aimed to address the evidence gap on long-term childhood outcomes following repeat CS by comparing adverse childhood health outcomes after (1 planned repeat CS and (2 unscheduled repeat CS with those that follow vaginal birth after CS (VBAC.A data-linkage cohort study was performed. All second-born, term, singleton offspring delivered between 1 January 1993 and 31 December 2007 in Scotland, UK, to women with a history of CS (n = 40,145 were followed up until 31 January 2015. Outcomes assessed included obesity at age 5 y, hospitalisation with asthma, learning disability, cerebral palsy, and death. Cox regression and binary logistic regression were used as appropriate to compare outcomes following planned repeat CS (n = 17,919 and unscheduled repeat CS (n = 8,847 with those following VBAC (n = 13,379. Risk of hospitalisation with asthma was greater following both unscheduled repeat CS (3.7% versus 3.3%, adjusted hazard ratio [HR] 1.18, 95% CI 1.05-1.33 and planned repeat CS (3.6% versus 3.3%, adjusted HR 1.24, 95% CI 1.09-1.42 compared with VBAC. Learning disability and death were more common following unscheduled repeat CS compared with VBAC (3.7% versus 2.3%, adjusted odds ratio 1.64, 95% CI 1.17-2.29, and 0.5% versus 0.4%, adjusted HR 1.50, 95% CI 1.00-2.25, respectively. Risk of obesity at age 5 y and risk of cerebral

  6. Longitudinal study of repeated sprint performance in youth soccer players of contrasting skeletal maturity status

    NARCIS (Netherlands)

    Valente-dos-Santos, Joao; Coelho-e-Silva, Manuel J.; Severino, Vitor; Duarte, Joao; Martins, Raul S.; Figueiredo, Antonio J.; Seabra, Andre T.; Philippaerts, Renaat M.; Cumming, Sean P.; Elferink-Gemser, Marije; Malina, Robert M.

    The purpose of the study was to evaluate the developmental changes in performance in a repeated-sprint ability (RSA) test in young soccer players of contrasting maturity status. A total of 83 regional level Portuguese youth soccer players, aged 11-13 years at baseline was assessed annually. Stature,

  7. Longitudinal study of repeated sprint performance in youth soccer players of contrasting maturity status

    NARCIS (Netherlands)

    V. Duarte; A. Seabra; A. Figueiredo; S. Cumming; R. Martins; R. Philippaerts; M. Coelho e Silva; J. Valente dos Santos; V. Severino; Marije Elferink-Gemser

    2012-01-01

    The purpose of the study was to evaluate the developmental changes in performance in a repeated-sprint ability (RSA) test in young soccer players of contrasting maturity status. A total of 83 regional level Portuguese youth soccer players, aged 11- 13 years at baseline was assessed annually.

  8. 40 CFR 799.9305 - TSCA Repeated dose 28-day oral toxicity study in rodents.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 31 2010-07-01 2010-07-01 true TSCA Repeated dose 28-day oral toxicity study in rodents. 799.9305 Section 799.9305 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... strains of young healthy adult animals should be employed. The females should be nulliparous and...

  9. Optimal selection of individuals for repeated covariate measurements in follow-up studies.

    Science.gov (United States)

    Reinikainen, Jaakko; Karvanen, Juha; Tolonen, Hanna

    2016-12-01

    Repeated covariate measurements bring important information on the time-varying risk factors in long epidemiological follow-up studies. However, due to budget limitations, it may be possible to carry out the repeated measurements only for a subset of the cohort. We study cost-efficient alternatives for the simple random sampling in the selection of the individuals to be remeasured. The proposed selection criteria are based on forms of the D-optimality. The selection methods are compared with the simulation studies and illustrated with the data from the East-West study carried out in Finland from 1959 to 1999. The results indicate that cost savings can be achieved if the selection is focused on the individuals with high expected risk of the event and, on the other hand, on those with extreme covariate values in the previous measurements. © The Author(s) 2014.

  10. Brexpiprazole Alters Monoaminergic Systems following Repeated Administration: an in Vivo Electrophysiological Study

    OpenAIRE

    Oosterhof, Chris A.; Mansari, Mostafa El; Bundgaard, Christoffer; Blier, Pierre

    2015-01-01

    Background: Brexpiprazole was recently approved as adjunctive therapy for depression and treatment of schizophrenia in adults. To complement results from a previous study in which its acute effects were characterized, the present study assessed the effect of repeated brexpiprazole administration on monoaminergic systems. Methods: Brexpiprazole (1mg/kg, subcutaneous) or vehicle was administered once daily for 2 and 14 days. Single-unit electrophysiological recordings from noradrenaline neurons...

  11. Evaluation of statistical tools used in short-term repeated dose administration toxicity studies with rodents.

    Science.gov (United States)

    Kobayashi, Katsumi; Pillai, K Sadasivan; Sakuratani, Yuki; Abe, Takemaru; Kamata, Eiichi; Hayashi, Makoto

    2008-02-01

    In order to know the different statistical tools used to analyze the data obtained from twenty-eight-day repeated dose oral toxicity studies with rodents and the impact of these statistical tools on interpretation of data obtained from the studies, study reports of 122 numbers of twenty-eight-day repeated dose oral toxicity studies conducted in rats were examined. It was found that both complex and easy routes of decision trees were followed for the analysis of the quantitative data. These tools include Scheffe's test, non-parametric type Dunnett's and Scheffe's tests with very low power. Few studies used the non-parametric Dunnett type test and Mann-Whitney's U test. Though Chi-square and Fisher's tests are widely used for analysis of qualitative data, their sensitivity to detect a treatment-related effect is questionable. Mann-Whitney's U test has better sensitivity to analyze qualitative data than the chi-square and Fisher's tests. We propose Dunnett's test for analysis of quantitative data obtained from twenty-eight-day repeated dose oral toxicity tests and for qualitative data, Mann-Whitney's U test. For both tests, one-sided test with p=0.05 may be applied.

  12. Acute and repeated dose toxicity studies of different β-cyclodextrin-based nanosponge formulations.

    Science.gov (United States)

    Shende, Pravin; Kulkarni, Yogesh A; Gaud, R S; Deshmukh, Kiran; Cavalli, Roberta; Trotta, Francesco; Caldera, Fabrizio

    2015-05-01

    Nanosponges (NS) show promising results in different fields such as medicine, agriculture, water purification, fire engineering and so on. The present study was designed to evaluate toxicity of different NS formulations (namely, S1-S6) synthesized with different cross-linking agents such as carbonyl diimidazole, pyromellitic dianhydride and hexamethylene diisocynate; and preparation methods in experimental animals. Acute and repeated dose toxicity studies of formulations were carried out as per OECD guidelines 423 and 407, respectively. For acute toxicity study, formulations were administered to female rats at doses of 300 and 2000 mg/kg orally. The general behaviour of the rats was continuously monitored for 1 h after dosing, periodically during the first 24 h and daily thereafter for a total of 14 days. On day 14, animals were fasted overnight, weighed, and sacrificed. After sacrification, animals were subjected to necropsy. For repeated dose toxicity study, rats of either sex were orally administered with formulations at the dose of 300 mg/kg per day for a period of 28 days. The maximally tolerated dose of all formulations was found to be 2000 mg/kg. Repeated administration of formulations for 28 days did not show any significant changes in haematological and biochemical parameters in experimental animals. These results indicate that the formulations are safe, when tested in experimental animals.

  13. Repeated vertebral augmentation for new vertebral compression fractures of postvertebral augmentation patients: a nationwide cohort study

    Directory of Open Access Journals (Sweden)

    Liang CL

    2015-03-01

    Full Text Available Cheng-Loong Liang,1 Hao-Kwan Wang,1 Fei-Kai Syu,2 Kuo-Wei Wang,1 Kang Lu,1 Po-Chou Liliang1 1Department of Neurosurgery, E-Da Hospital, I-Shou University, Kaohsiung City, Taiwan; 2Department of Pharmacy, China Medical University Hospital, Taichung City, Taiwan Purpose: Postvertebral augmentation vertebral compression fractures are common; repeated vertebral augmentation is usually performed for prompt pain relief. This study aimed to evaluate the incidence and risk factors of repeat vertebral augmentation.Methods: We performed a retrospective, nationwide, population-based longitudinal observation study, using the National Health Insurance Research Database (NHIRD of Taiwan. All patients who received vertebral augmentation for vertebral compression fractures were evaluated. The collected data included patient characteristics (demographics, comorbidities, and medication exposure and repeat vertebral augmentation. Kaplan–Meier and stratified Cox proportional hazard regressions were performed for analyses.Results: The overall incidence of repeat vertebral augmentation was 11.3% during the follow-up until 2010. Patients with the following characteristics were at greater risk for repeat vertebral augmentation: female sex (AOR=1.24; 95% confidence interval [CI]: 1.10–2.36, advanced age (AOR=1.60; 95% CI: 1.32–2.08, diabetes mellitus (AOR=4.31; 95% CI: 4.05–5.88, cerebrovascular disease (AOR=4.09; 95% CI: 3.44–5.76, dementia (AOR=1.97; 95% CI: 1.69–2.33, blindness or low vision (AOR=3.72; 95% CI: 2.32–3.95, hypertension (AOR=2.58; 95% CI: 2.35–3.47, and hyperlipidemia (AOR=2.09; 95% CI: 1.67–2.22. Patients taking calcium/ vitamin D (AOR=2.98; 95% CI: 1.83–3.93, bisphosphonates (AOR=2.11; 95% CI: 1.26–2.61, or calcitonin (AOR=4.59; 95% CI: 3.40–5.77 were less likely to undergo repeat vertebral augmentation; however, those taking steroids (AOR=7.28; 95% CI: 6.32–8.08, acetaminophen (AOR=3.54; 95% CI: 2.75–4.83, or nonsteroidal

  14. Prolonged repeated acupuncture stimulation induces habituation effects in pain-related brain areas: an FMRI study.

    Science.gov (United States)

    Li, Chuanfu; Yang, Jun; Park, Kyungmo; Wu, Hongli; Hu, Sheng; Zhang, Wei; Bu, Junjie; Xu, Chunsheng; Qiu, Bensheng; Zhang, Xiaochu

    2014-01-01

    Most previous studies of brain responses to acupuncture were designed to investigate the acupuncture instant effect while the cumulative effect that should be more important in clinical practice has seldom been discussed. In this study, the neural basis of the acupuncture cumulative effect was analyzed. For this experiment, forty healthy volunteers were recruited, in which more than 40 minutes of repeated acupuncture stimulation was implemented at acupoint Zhusanli (ST36). Three runs of acupuncture fMRI datasets were acquired, with each run consisting of two blocks of acupuncture stimulation. Besides general linear model (GLM) analysis, the cumulative effects of acupuncture were analyzed with analysis of covariance (ANCOVA) to find the association between the brain response and the cumulative duration of acupuncture stimulation in each stimulation block. The experimental results showed that the brain response in the initial stage was the strongest although the brain response to acupuncture was time-variant. In particular, the brain areas that were activated in the first block and the brain areas that demonstrated cumulative effects in the course of repeated acupuncture stimulation overlapped in the pain-related areas, including the bilateral middle cingulate cortex, the bilateral paracentral lobule, the SII, and the right thalamus. Furthermore, the cumulative effects demonstrated bimodal characteristics, i.e. the brain response was positive at the beginning, and became negative at the end. It was suggested that the cumulative effect of repeated acupuncture stimulation was consistent with the characteristic of habituation effects. This finding may explain the neurophysiologic mechanism underlying acupuncture analgesia.

  15. Chromosomal abnormalities in couples with repeated fetal loss: An Indian retrospective study

    Directory of Open Access Journals (Sweden)

    Frenny J Sheth

    2013-01-01

    Full Text Available Background: Recurrent pregnancy loss is a common occurrence and a matter of concern for couples planning the pregnancy. Chromosomal abnormalities, mainly balanced rearrangements, are common in couples with repeated miscarriages. Purpose: The purpose of this study is to evaluate the contribution of chromosomal anomalies causing repeated spontaneous miscarriages and provide detailed characterization of a few structurally altered chromosomes. Materials and Methods: A retrospective cytogenetic study was carried out on 4859 individuals having a history of recurrent miscarriages. The cases were analyzed using G-banding and fluorescence in situ hybridization wherever necessary. Results: Chromosomal rearrangements were found in 170 individuals (3.5%. Translocations were seen in 72 (42.35% cases. Of these, reciprocal translocations constituted 42 (24.70% cases while Robertsonian translocations were detected in 30 (17.64% cases. 7 (4.11% cases were mosaic, 8 (4.70% had small supernumerary marker chromosomes and 1 (0.6% had an interstitial microdeletion. Nearly, 78 (1.61% cases with heteromorphic variants were seen of which inversion of Y chromosome (57.70% and chromosome 9 pericentromeric variants (32.05% were predominantly involved. Conclusions: Chromosomal analysis is an important etiological investigation in couples with repeated miscarriages. Characterization of variants/marker chromosome enable calculation of a more precise recurrent risk in a subsequent pregnancy thereby facilitating genetic counseling and deciding further reproductive options.

  16. On the Applicability of Elastic Network Models for the Study of RNA CUG Trinucleotide Repeat Overexpansion.

    Directory of Open Access Journals (Sweden)

    Àlex L González

    Full Text Available Non-coding RNAs play a pivotal role in a number of diseases promoting an aberrant sequestration of nuclear RNA-binding proteins. In the particular case of myotonic dystrophy type 1 (DM1, a multisystemic autosomal dominant disease, the formation of large non-coding CUG repeats set up long-tract hairpins able to bind muscleblind-like proteins (MBNL, which trigger the deregulation of several splicing events such as cardiac troponin T (cTNT and insulin receptor's, among others. Evidence suggests that conformational changes in RNA are determinant for the recognition and binding of splicing proteins, molecular modeling simulations can attempt to shed light on the structural diversity of CUG repeats and to understand their pathogenic mechanisms. Molecular dynamics (MD are widely used to obtain accurate results at atomistic level, despite being very time consuming, and they contrast with fast but simplified coarse-grained methods such as Elastic Network Model (ENM. In this paper, we assess the application of ENM (traditionally applied on proteins for studying the conformational space of CUG repeats and compare it to conventional and accelerated MD conformational sampling. Overall, the results provided here reveal that ANM can provide useful insights into dynamic rCUG structures at a global level, and that their dynamics depend on both backbone and nucleobase fluctuations. On the other hand, ANM fail to describe local U-U dynamics of the rCUG system, which require more computationally expensive methods such as MD. Given that several limitations are inherent to both methods, we discuss here the usefulness of the current theoretical approaches for studying highly dynamic RNA systems such as CUG trinucleotide repeat overexpansions.

  17. Study of Optimal Perimetric Testing in Children (OPTIC: Feasibility, Reliability and Repeatability of Perimetry in Children.

    Directory of Open Access Journals (Sweden)

    Dipesh E Patel

    Full Text Available To investigate feasibility, reliability and repeatability of perimetry in children.A prospective, observational study recruiting 154 children aged 5-15 years, without an ophthalmic condition that affects the visual field (controls, identified consecutively between May 2012 and November 2013 from hospital eye clinics. Perimetry was undertaken in a single sitting, with standardised protocols, in a randomised order using the Humphrey static (SITA 24-2 FAST, Goldmann and Octopus kinetic perimeters. Data collected included test duration, subjective experience and test quality (incorporating examiner ratings on comprehension of instructions, fatigue, response to visual and auditory stimuli, concentration and co-operation to assess feasibility and reliability. Testing was repeated within 6 months to assess repeatability.Overall feasibility was very high (Goldmann=96.1%, Octopus=89% and Humphrey=100% completed the tests. Examiner rated reliability was 'good' in 125 (81.2% children for Goldmann, 100 (64.9% for Octopus and 98 (63.6% for Humphrey perimetry. Goldmann perimetry was the most reliable method in children under 9 years of age. Reliability improved with increasing age (multinomial logistic regression (Goldmann, Octopus and Humphrey, p<0.001. No significant differences were found for any of the three test strategies when examining initial and follow-up data outputs (Bland-Altman plots, n=43, suggesting good test repeatability, although the sample size may preclude detection of a small learning effect.Feasibility and reliability of formal perimetry in children improves with age. By the age of 9 years, all the strategies used here were highly feasible and reliable. Clinical assessment of the visual field is achievable in children as young as 5 years, and should be considered where visual field loss is suspected. Since Goldmann perimetry is the most effective strategy in children aged 5-8 years and this perimeter is no longer available, further

  18. Using Bayesian analysis in repeated preclinical in vivo studies for a more effective use of animals.

    Science.gov (United States)

    Walley, Rosalind; Sherington, John; Rastrick, Joe; Detrait, Eric; Hanon, Etienne; Watt, Gillian

    2016-05-01

    Whilst innovative Bayesian approaches are increasingly used in clinical studies, in the preclinical area Bayesian methods appear to be rarely used in the reporting of pharmacology data. This is particularly surprising in the context of regularly repeated in vivo studies where there is a considerable amount of data from historical control groups, which has potential value. This paper describes our experience with introducing Bayesian analysis for such studies using a Bayesian meta-analytic predictive approach. This leads naturally either to an informative prior for a control group as part of a full Bayesian analysis of the next study or using a predictive distribution to replace a control group entirely. We use quality control charts to illustrate study-to-study variation to the scientists and describe informative priors in terms of their approximate effective numbers of animals. We describe two case studies of animal models: the lipopolysaccharide-induced cytokine release model used in inflammation and the novel object recognition model used to screen cognitive enhancers, both of which show the advantage of a Bayesian approach over the standard frequentist analysis. We conclude that using Bayesian methods in stable repeated in vivo studies can result in a more effective use of animals, either by reducing the total number of animals used or by increasing the precision of key treatment differences. This will lead to clearer results and supports the "3Rs initiative" to Refine, Reduce and Replace animals in research. Copyright © 2016 John Wiley & Sons, Ltd.

  19. Implementation of repeat HIV testing during pregnancy in Kenya: a qualitative study.

    Science.gov (United States)

    Rogers, Anna Joy; Weke, Elly; Kwena, Zachary; Bukusi, Elizabeth A; Oyaro, Patrick; Cohen, Craig R; Turan, Janet M

    2016-07-11

    Repeat HIV testing in late pregnancy has the potential to decrease rates of mother-to-child transmission of HIV by identifying mothers who seroconvert after having tested negative for HIV in early pregnancy. Despite being national policy in Kenya, the available data suggest that implementation rates are low. We conducted 20 in-depth semi-structured interviews with healthcare providers and managers to explore barriers and enablers to implementation of repeat HIV testing guidelines for pregnant women. Participants were from the Nyanza region of Kenya and were purposively selected to provide variation in socio-demographics and job characteristics. Interview transcripts were coded and analyzed in Dedoose software using a thematic analysis approach. Four themes were identified a priori using Ferlie and Shortell's Framework for Change and additional themes were allowed to emerge from the data. Participants identified barriers and enablers at the client, provider, facility, and health system levels. Key barriers at the client level from the perspective of providers included late initial presentation to antenatal care and low proportions of women completing the recommended four antenatal visits. Barriers to offering repeat HIV testing for providers included heavy workloads, time limitations, and failing to remember to check for retest eligibility. At the facility level, inconsistent volume of clients and lack of space required for confidential HIV retesting were cited as barriers. Finally, at the health system level, there were challenges relating to the HIV test kit supply chain and the design of nationally standardized antenatal patient registers. Enablers to improving the implementation of repeat HIV testing included client dissemination of the benefits of antenatal care through word-of-mouth, provider cooperation and task shifting, and it was suggested that use of an electronic health record system could provide automatic reminders for retest eligibility. This study

  20. The role of exposure history on HIV acquisition: insights from repeated low-dose challenge studies.

    Directory of Open Access Journals (Sweden)

    Roland R Regoes

    Full Text Available To assess the efficacy of HIV vaccine candidates or preventive treatment, many research groups have started to challenge monkeys repeatedly with low doses of the virus. Such challenge data provide a unique opportunity to assess the importance of exposure history for the acquisition of the infection. I developed stochastic models to analyze previously published challenge data. In the mathematical models, I allowed for variation of the animals' susceptibility to infection across challenge repeats, or across animals. In none of the studies I analyzed, I found evidence for an immunizing effect of non-infecting challenges, and in most studies, there is no evidence for variation in the susceptibilities to the challenges across animals. A notable exception was a challenge experiment by Letvin et al. Sci Translat Med (2011 conducted with the strain SIVsmE660. The challenge data of this experiment showed significant susceptibility variation from animal-to-animal, which is consistent with previously established genetic differences between the involved animals. For the studies which did not show significant immunizing effects and susceptibility differences, I conducted a power analysis and could thus exclude a very strong immunization effect for some of the studies. These findings validate the assumption that non-infecting challenges do not immunize an animal - an assumption that is central in the argument that repeated low-dose challenge experiments increase the statistical power of preclinical HIV vaccine trials. They are also relevant for our understanding of the role of exposure history for HIV acquisition and forecasting the epidemiological spread of HIV.

  1. Factors associated with repeated outbreak of anthrax in Bangladesh: qualitative and quantitative study

    Directory of Open Access Journals (Sweden)

    Jayedul Hassan

    2015-06-01

    Full Text Available Anthrax, caused by Bacillus anthracis is an acute, febrile disease of warm blooded animals including humans. Social norms and poverty in addition to climatic factors such as soil conditions, seasons of year, ambient temperature and rainfall influence the persistence of the B. anthracis and anthrax outbreaks. The present study was designed to reveal the factors influencing the repeated outbreak of anthrax in Bangladesh. Considering the previous outbreaks of anthrax, Sirajganj, Bogra, Kushtia, Tangail and Mymensingh districts of Bangladesh were selected for this study. To elucidate the factors, qualitative data relating to the animal management, knowledge and behavior of the people; and quantitative data relating to soil conditions, ambient temperature and rainfall were acquired, and analyzed critically. Based on the outbreak histories, a year was divided into two seasons, anthrax prone season (May-November and anthrax dry season (December-April. Anthrax spores could be isolated from 11.67% (n=14/120 of the soil samples collected from the study areas. The present study revealed that poor knowledge, lack of awareness, improper carcass disposal, inadequate vaccination, high Ca content and moisture in the soil along with high ambient temperature and rainfall during the anthrax prone season were the possible influencing factors of repeated outbreaks of anthrax in the study areas. Intensive propaganda to create public awareness of anthrax together with proper vaccination may reduce anthrax outbreaks in Bangladesh.

  2. Prolonged repeated acupuncture stimulation induces habituation effects in pain-related brain areas: an FMRI study.

    Directory of Open Access Journals (Sweden)

    Chuanfu Li

    Full Text Available Most previous studies of brain responses to acupuncture were designed to investigate the acupuncture instant effect while the cumulative effect that should be more important in clinical practice has seldom been discussed. In this study, the neural basis of the acupuncture cumulative effect was analyzed. For this experiment, forty healthy volunteers were recruited, in which more than 40 minutes of repeated acupuncture stimulation was implemented at acupoint Zhusanli (ST36. Three runs of acupuncture fMRI datasets were acquired, with each run consisting of two blocks of acupuncture stimulation. Besides general linear model (GLM analysis, the cumulative effects of acupuncture were analyzed with analysis of covariance (ANCOVA to find the association between the brain response and the cumulative duration of acupuncture stimulation in each stimulation block. The experimental results showed that the brain response in the initial stage was the strongest although the brain response to acupuncture was time-variant. In particular, the brain areas that were activated in the first block and the brain areas that demonstrated cumulative effects in the course of repeated acupuncture stimulation overlapped in the pain-related areas, including the bilateral middle cingulate cortex, the bilateral paracentral lobule, the SII, and the right thalamus. Furthermore, the cumulative effects demonstrated bimodal characteristics, i.e. the brain response was positive at the beginning, and became negative at the end. It was suggested that the cumulative effect of repeated acupuncture stimulation was consistent with the characteristic of habituation effects. This finding may explain the neurophysiologic mechanism underlying acupuncture analgesia.

  3. Accuracy and repeatability of an inertial measurement unit system for field-based occupational studies.

    Science.gov (United States)

    Schall, Mark C; Fethke, Nathan B; Chen, Howard; Oyama, Sakiko; Douphrate, David I

    2016-04-01

    The accuracy and repeatability of an inertial measurement unit (IMU) system for directly measuring trunk angular displacement and upper arm elevation were evaluated over eight hours (i) in comparison to a gold standard, optical motion capture (OMC) system in a laboratory setting, and (ii) during a field-based assessment of dairy parlour work. Sample-to-sample root mean square differences between the IMU and OMC system ranged from 4.1° to 6.6° for the trunk and 7.2°-12.1° for the upper arm depending on the processing method. Estimates of mean angular displacement and angular displacement variation (difference between the 90th and 10th percentiles of angular displacement) were observed to change IMU system may serve as an acceptable instrument for directly measuring trunk and upper arm postures in field-based occupational exposure assessment studies with long sampling durations. Practitioner Summary: Few studies have evaluated inertial measurement unit (IMU) systems in the field or over long sampling durations. Results of this study indicate that the IMU system evaluated has reasonably good accuracy and repeatability for use in a field setting over a long sampling duration.

  4. Association study of the trinucleotide repeat polymorphism within SMARCA2 and schizophrenia

    Directory of Open Access Journals (Sweden)

    Danics Zoltan

    2006-06-01

    Full Text Available Abstract Background Brahma (BRM is a key component of the multisubunit SWI/SNF complex, a complex which uses the energy of ATP hydrolysis to remodel chromatin. BRM contains an N-terminal polyglutamine domain, encoded by a polymorphic trinucleotide (CAA/CAG repeat, the only known polymorphism in the coding region of the gene (SMARCA2. We have examined the association of this polymorphism with schizophrenia in a family-based and case/control study. SMARCA2 was chosen as a candidate gene because of its specific role in developmental pathways, its high expression level in the brain and some evidence of its association with schizophrenia spectrum disorder from genome-wide linkage analysis. Results Family-based analysis with 281 complete and incomplete triads showed that there is no significant preferential transmission of any of the alleles to the affected offspring. Also, in the case/control analysis, similar allele and genotype distributions were observed between affected cases (n = 289 and unaffected controls (n = 273 in each of three Caucasian populations studied: French Canadian, Tunisian and other Caucasians of European origin. Conclusion Results from our family-based and case-control association study suggest that there is no association between the trinucleotide repeat polymorphism within SMARCA2 and schizophrenia.

  5. Investigation of the toxicity of some organophosphorus pesticides in a repeated dose study in rats.

    Science.gov (United States)

    Baconi, Daniela Luiza; Bârcă, Maria; Manda, Gina; Ciobanu, Anne Marie; Bălălău, C

    2013-01-01

    The study aimed to the investigation of the toxicity of organophosphorus pesticides malathion (MLT) and diazinon (DZN) in Wistar rats in a repeated dose study for 35 days. MLT and DZN in corn oil vehicle were oral administered. Body and organs weights, plasma and brain cholinesterase activities, serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) activities, histopathological changes in liver and kidney, and some parameters of the immune function, such as leukocyte formula, spleen weight and cellularity, spleen lymphocytes proliferation in response to concanavalin A (Con A) were investigated; the potential oxidative stress (malondialdehyde in plasma and brain, and blood catalase activity) was also evaluated. No clinical toxicity signs attributed to pesticides were noted; no significant changes in the organ weights have been found. Body weight tends slightly to increase, predominantly in DZN treated rats. The results suggest that plasma cholinesterase is more susceptible than brain cholinesterase to the inhibitory effect of DZN and MLT. Other serum biochemical parameters showed no significant difference. DZN produced a marked increase of the number of spleen lymphocytes without a significant gain of the relative spleen weight. The both pesticides produced an increase of the number of mononuclear cells÷weight spleen. The splenic lymphocyte proliferation has not been influenced by MLT or DZN treatment. Histopathological observations identified some changes (vasodilatation, microvacuoles, and granular dystrophy) in the liver, with MLT, inducing macrovacuolar steatosis. The study indicates that repeated exposure, at subclinical doses, to organophosphorus MLT and DZN causes some biochemical, histopathological and immune alterations in rats.

  6. Potential Role of the Last Half Repeat in TAL Effectors Revealed by a Molecular Simulation Study

    Directory of Open Access Journals (Sweden)

    Hua Wan

    2016-01-01

    Full Text Available TAL effectors (TALEs contain a modular DNA-binding domain that is composed of tandem repeats. In all naturally occurring TALEs, the end of tandem repeats is invariantly a truncated half repeat. To investigate the potential role of the last half repeat in TALEs, we performed comparative molecular dynamics simulations for the crystal structure of DNA-bound TALE AvrBs3 lacking the last half repeat and its modeled structure having the last half repeat. The structural stability analysis indicates that the modeled system is more stable than the nonmodeled system. Based on the principle component analysis, it is found that the AvrBs3 increases its structural compactness in the presence of the last half repeat. The comparison of DNA groove parameters of the two systems implies that the last half repeat also causes the change of DNA major groove binding efficiency. The following calculation of hydrogen bond reveals that, by stabilizing the phosphate binding with DNA at the C-terminus, the last half repeat helps to adopt a compact conformation at the protein-DNA interface. It further mediates more contacts between TAL repeats and DNA nucleotide bases. Finally, we suggest that the last half repeat is required for the high-efficient recognition of DNA by TALE.

  7. Potential Role of the Last Half Repeat in TAL Effectors Revealed by a Molecular Simulation Study

    Science.gov (United States)

    Wan, Hua; Chang, Shan; Hu, Jian-ping; Tian, Xu-hong

    2016-01-01

    TAL effectors (TALEs) contain a modular DNA-binding domain that is composed of tandem repeats. In all naturally occurring TALEs, the end of tandem repeats is invariantly a truncated half repeat. To investigate the potential role of the last half repeat in TALEs, we performed comparative molecular dynamics simulations for the crystal structure of DNA-bound TALE AvrBs3 lacking the last half repeat and its modeled structure having the last half repeat. The structural stability analysis indicates that the modeled system is more stable than the nonmodeled system. Based on the principle component analysis, it is found that the AvrBs3 increases its structural compactness in the presence of the last half repeat. The comparison of DNA groove parameters of the two systems implies that the last half repeat also causes the change of DNA major groove binding efficiency. The following calculation of hydrogen bond reveals that, by stabilizing the phosphate binding with DNA at the C-terminus, the last half repeat helps to adopt a compact conformation at the protein-DNA interface. It further mediates more contacts between TAL repeats and DNA nucleotide bases. Finally, we suggest that the last half repeat is required for the high-efficient recognition of DNA by TALE. PMID:27803930

  8. Does repeated reading predict reading development over time? A study of children from Grade 3 to 4.

    Science.gov (United States)

    Gellert, Anna S

    2014-08-01

    The purpose of this study was to investigate whether immediate gains in reading fluency achieved during repeated reading of text can predict long-term reading development over and above traditional predictors of reading development. Eighty-one Grade 3 children read texts three times consecutively and were instructed either to read as quickly as possible (speed-focused repeated reading), or to retell the text afterwards (meaning-focused repeated reading). Measures of text reading fluency, sentence reading fluency, and text comprehension were administered to the children in Grades 3 and 4 to assess their reading development over time. The results indicate that children's immediate response to repeated reading can contribute to the prediction of their development of reading fluency over time. Even after controlling for individual differences in general cognitive ability, word reading fluency, rapid automatized naming, and vocabulary, the experimental measure with meaning-focused repeated reading remained a significant predictor.

  9. 5-Day repeated inhalation and 28-day post-exposure study of graphene.

    Science.gov (United States)

    Shin, Jae Hoon; Han, Sung Gu; Kim, Jin Kwon; Kim, Boo Wook; Hwang, Joo Hwan; Lee, Jong Seong; Lee, Ji Hyun; Baek, Jin Ee; Kim, Tae Gyu; Kim, Keun Soo; Lee, Heon Sang; Song, Nam Woong; Ahn, Kangho; Yu, Il Je

    2015-01-01

    Graphene has recently been attracting increasing attention due to its unique electronic and chemical properties and many potential applications in such fields as semiconductors, energy storage, flexible electronics, biosensors and medical imaging. However, the toxicity of graphene in the case of human exposure has not yet been clarified. Thus, a 5-day repeated inhalation toxicity study of graphene was conducted using a nose-only inhalation system for male Sprague-Dawley rats. A total of three groups (20 rats per group) were compared: (1) control (ambient air), (2) low concentration (0.68 ± 0.14 mg/m(3) graphene) and (3) high concentration (3.86 ± 0.94 mg/m(3) graphene). The rats were exposed to graphene for 6 h/day for 5 days, followed by recovery for 1, 3, 7 or 28 days. The bioaccumulation and macrophage ingestion of the graphene were evaluated in the rat lungs. The exposure to graphene did not change the body weights or organ weights of the rats after the 5-day exposure and during the recovery period. No statistically significant difference was observed in the levels of lactate dehydrogenase, protein and albumin between the exposed and control groups. However, graphene ingestion by alveolar macrophages was observed in the exposed groups. Therefore, these results suggest that the 5-day repeated exposure to graphene only had a minimal toxic effect at the concentrations and time points used in this study.

  10. Validation of a track repeating algorithm for intensity modulated proton therapy: clinical cases study

    Science.gov (United States)

    Yepes, Pablo P.; Eley, John G.; Liu, Amy; Mirkovic, Dragan; Randeniya, Sharmalee; Titt, Uwe; Mohan, Radhe

    2016-04-01

    Monte Carlo (MC) methods are acknowledged as the most accurate technique to calculate dose distributions. However, due its lengthy calculation times, they are difficult to utilize in the clinic or for large retrospective studies. Track-repeating algorithms, based on MC-generated particle track data in water, accelerate dose calculations substantially, while essentially preserving the accuracy of MC. In this study, we present the validation of an efficient dose calculation algorithm for intensity modulated proton therapy, the fast dose calculator (FDC), based on a track-repeating technique. We validated the FDC algorithm for 23 patients, which included 7 brain, 6 head-and-neck, 5 lung, 1 spine, 1 pelvis and 3 prostate cases. For validation, we compared FDC-generated dose distributions with those from a full-fledged Monte Carlo based on GEANT4 (G4). We compared dose-volume-histograms, 3D-gamma-indices and analyzed a series of dosimetric indices. More than 99% of the voxels in the voxelized phantoms describing the patients have a gamma-index smaller than unity for the 2%/2 mm criteria. In addition the difference relative to the prescribed dose between the dosimetric indices calculated with FDC and G4 is less than 1%. FDC reduces the calculation times from 5 ms per proton to around 5 μs.

  11. Repeat Colonoscopy within 6 Months after Initial Outpatient Colonoscopy in Ontario: A Population-Based Cross-Sectional Study

    Directory of Open Access Journals (Sweden)

    Lawrence Paszat

    2017-01-01

    Full Text Available Background. The goal of this study is to examine utilization of early repeat colonoscopy ≤ 6 months after an index procedure. Methods. We identified persons having repeat colonoscopy ≤ 6 months following outpatient colonoscopy without prior colonoscopy ≤ 5 years or prior diagnosis of colorectal cancer (CRC. We modeled repeat colonoscopy using a generalized estimating equation with an exchangeable correlation structure to account for clustering of patients by endoscopist. Results. The population included 334,663 persons, 7,892 (2.36% of whom had an early repeat colonoscopy within 6 months. Overall, endoscopist prior year colonoscopy volume was inversely related to repeat ≤ 6 months. Repeat colonoscopy ≤ 6 months varied by the clinical setting of the index colonoscopy (adjusted OR = 1.41 (95% CI 1.29–1.55 at nonhospital facilities compared to teaching or community hospitals. Among those who had polypectomy or biopsy, the adjusted OR for early repeat ≤ 6 months was elevated among those whose index colonoscopy was at a nonhospital facility (OR 1.44, 95% CI 1.30–1.60, compared to those at a teaching hospital or community hospital. Conclusions. Repeat colonoscopy ≤ 6 months after an index procedure is associated with the clinical setting of the index colonoscopy.

  12. Seroepidemiological studies indicate frequent and repeated exposure to Campylobacter spp. during childhood.

    Science.gov (United States)

    Ang, C W; Teunis, P F M; Herbrink, P; Keijser, J; Van Duynhoven, Y H T P; Visser, C E; Van Pelt, W

    2011-09-01

    The annual number of episodes of clinical gastroenteritis caused by Campylobacter spp. in The Netherlands is estimated to be 75 000, i.e. once per 200 person life-years. This number is based on extrapolation of culture results from population-based studies. The number of culture-confirmed cases of Campylobacter infection peaks in the first 3 years of life and again between the ages of 20 and 25 years. The seroepidemiology of Campylobacter describes the relationship between age and exposure to Campylobacter and reflects both symptomatic and asymptomatic infections. Using a validated ELISA system, antibodies to Campylobacter were measured in an age-stratified sample (n=456) of the PIENTER serum collection of the Dutch general population. The seroprevalence of Campylobacter IgG antibodies increased with age, reaching almost 100% at age 20 years. Antibody levels steadily increased with age until young adulthood, suggesting repeated exposure to Campylobacter. In conclusion, seroepidemiological data demonstrated repeated exposures to Campylobacter throughout life, most of which do not lead to clinical symptoms. From young adulthood, >95% of the population in The Netherlands had serological evidence for exposure to Campylobacter.

  13. Effects of repeated walking in a perturbing environment: a 4-day locomotor learning study.

    Science.gov (United States)

    Blanchette, Andreanne; Moffet, Helene; Roy, Jean-Sébastien; Bouyer, Laurent J

    2012-07-01

    Previous studies have shown that when subjects repeatedly walk in a perturbing environment, initial movement error becomes smaller, suggesting that retention of the adapted locomotor program occurred (learning). It has been proposed that the newly learned locomotor program may be stored separately from the baseline program. However, how locomotor performance evolves with repeated sessions of walking with the perturbation is not yet known. To address this question, 10 healthy subjects walked on a treadmill on 4 consecutive days. Each day, locomotor performance was measured using kinematics and surface electromyography (EMGs), before, during, and after exposure to a perturbation, produced by an elastic tubing that pulled the foot forward and up during swing, inducing a foot velocity error in the first strides. Initial movement error decreased significantly between days 1 and 2 and then remained stable. Associated changes in medial hamstring EMG activity stabilized only on day 3, however. Aftereffects were present after perturbation removal, suggesting that daily adaptation involved central command recalibration of the baseline program. Aftereffects gradually decreased across days but were still visible on day 4. Separation between the newly learned and baseline programs may take longer than suggested by the daily improvement in initial performance in the perturbing environment or may never be complete. These results therefore suggest that reaching optimal performance in a perturbing environment should not be used as the main indicator of a completed learning process, as central reorganization of the motor commands continues days after initial performance has stabilized.

  14. Study of four week repeated dose toxic test of Sweet Bee Venom in Beagle Dogs

    Directory of Open Access Journals (Sweden)

    Jae-Seuk Park

    2010-12-01

    Full Text Available Objectives: This study was performed to analyse four week repeated dose toxicity of Sweet Bee Venom(Sweet BV extracted from the bee venom in Beagle dogs. Methods: All experiments were conducted under the regulations of Good Laboratory Practice (GLP at Biotoxtech Company, a non-clinical study authorized institution. Male and female Beagle dogs of 5-6 months old were chosen for the pilot study of four week repeated dose toxicity of Sweet BV which was administered at the level of 0.56㎎/㎏ body weight which is eighty times higher than the clinical application dosage as the high dosage, followed by 0.28 and 0.14㎎/㎏ as midium and low dosage, respectively. Equal amount of excipient(normal saline to the Sweet BV experiment groups was administered as the control group every day for four weeks. Results: 1. No mortality was witnessed in all of the experiment groups. 2. All experiment groups were appealed pain sense in the treating time compared to the control group, and hyperemia and movement disorder were observed around the area of administration in all experiment groups, and higher occurrence in the higher dosage treatment. 3. For weight measurement, Neither male nor female groups showed significant changes. 4. In the urine analysis, CBC and biochemistry didn't show any significant changes in the experiment groups compared with control group. 5. For weight measurement of organs, experiment groups didn't show any significant changes compared with control group. 6. To verify abnormalities of organs and tissues, thigh muscle which treated with Sweet BV, cerebrum, liver, lung, kidney, and spinal cords were removed and conducted histologocal observation with H-E staining. In the histologocal observation of thigh muscle, cell infiltration, inflammatory, degeneration, necrosis of muscle fiber, and fibrosis were found in both thigh tissue. And the changes were depend on the dose of Sweet BV. But another organs were not detected in any abnormalities. 7

  15. Reducing impaired driving through the identification of Repeat Target Vehicles: A case study.

    Science.gov (United States)

    Stewart, James

    2012-02-01

    One of the most persistent groups of impaired drivers that are seemingly unaffected by social pressure, moral appeals, and the fear of arrest is that of the repeat impaired driver. This smaller group accounts for a disproportionate number of all impaired driving trips, often with high blood alcohol contents. New approaches are needed to identify and deal with the repeat impaired driver. We propose a method based on the discovery that almost 10% of all impaired driving calls for service involve repeat vehicles. Using the number of times a vehicle appears in our data, the average time to repeat, and the personality characteristics of the repeat impaired driver, we are able to create a comprehensive and predictive description of a Repeat Target Vehicle (RTV). Our method provides an opportunity to explore new and innovative crime reduction strategies that were never before possible. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. A study on ten short tandem repeat systems: African immigrant and Spanish population data.

    Science.gov (United States)

    Gamero, J J; Romero, J L; Gonzalez, J L; Arufe, M I; Cuesta, M I; Corte-Real, F; Carvalho, M; Anjos, M J; Vieira, D N; Vide, M C

    2000-06-05

    This work presents the results obtained from a genetic-population study for the D1S1656 system in the population of Southwest Spain (Huelva, Cádiz and Sevilla), Spaniards of Caucasian origin from North Africa (Ceuta), as well as in the black Central West African and Moroccan immigrant populations in Spain. The results of a study of the autochtonous population of the Canary Islands (n=138), and immigrant Central West African populations in Spain (n=132), obtained for nine short tandem repeat (STR) loci (D3S1358, VWA, FGA, D8S1179, D21S11, D18S51, D5S818, D13S317, D7S820), as well as the amelogenin locus, all contained in Profiler Plus (Perkin-Elmer) PCR amplification kits, are also presented. Except for the FGA and VWA data on immigrant Central West African populations in Spain, no deviations from the Hardy-Weinberg equilibrium were detected.

  17. A Prospective Study of Psychiatric Comorbidity and Recidivism Among Repeat DUI Offenders

    OpenAIRE

    Nelson, Sarah E.; Belkin, Katerina; LaPlante, Debi A.; Bosworth, Leslie; Shaffer, Howard J.

    2015-01-01

    Psychiatric comorbidity has emerged as a key element distinguishing DUI offenders from others, and, in some cases, distinguishing repeat offenders from first-time offenders. This paper utilizes a prospective design to determine whether the comorbid disorders identified among repeat DUI offenders can predict recidivism. Seven hundred forty-three repeat DUI offenders were recruited from a two-week inpatient treatment program at which they received a standardized mental health assessment and fol...

  18. Bayesian latent variable models for hierarchical clustered count outcomes with repeated measures in microbiome studies.

    Science.gov (United States)

    Xu, Lizhen; Paterson, Andrew D; Xu, Wei

    2017-04-01

    Motivated by the multivariate nature of microbiome data with hierarchical taxonomic clusters, counts that are often skewed and zero inflated, and repeated measures, we propose a Bayesian latent variable methodology to jointly model multiple operational taxonomic units within a single taxonomic cluster. This novel method can incorporate both negative binomial and zero-inflated negative binomial responses, and can account for serial and familial correlations. We develop a Markov chain Monte Carlo algorithm that is built on a data augmentation scheme using Pólya-Gamma random variables. Hierarchical centering and parameter expansion techniques are also used to improve the convergence of the Markov chain. We evaluate the performance of our proposed method through extensive simulations. We also apply our method to a human microbiome study.

  19. [Repeat induced abortion: A multicenter study on medical abortions in France in 2014].

    Science.gov (United States)

    Opatowski, M; Bardy, F; David, P; Dunbavand, A; Saurel-Cubizolles, M-J

    2017-01-01

    To describe the social characteristics of women seeking a medical abortion, and the conditions of that abortion, according to whether they had one or more previous induced abortions. An observational study was carried out in 11 French units in 2013-2014, among women 18 years or older. A self-administered questionnaire on the abortion context and social situation was given to them, as well as a diary to record the pain level for each of five days following the mifepristone intake. The sample included 453 women. Among the respondents, 22% had had one previous abortion and 8% had had two or more. Women having had a previous voluntary abortion were more often isolated and in a poorer social situation than women having their first abortion. Better support for contraception after abortion could reduce the number of repeated abortions. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  20. A Review on the Study of "Repeating Earthquakes" by Cross-correlation of Seismic Waveforms~%A Review on the Study of "Repeating Earthquakes" by Cross-correlation of Seismic Waveforms~

    Institute of Scientific and Technical Information of China (English)

    Li Yutong; Jiang Changsheng

    2012-01-01

    "Repeating earthquakes", identified by cross-correlation of seismic waveforms, are found to be much more abundant in the nature than conventionally expected. In recent years, with the development of digital seismic networks, waveform cross correlation and "repeating earthquakes" have caused much attention to the measuring the variation of crustal medium properties and estimation of location accuracy and fault slip rate at depth or earthquake recurrence intervals. Moreover, as a useful tool, the "repeating earthquake" approach has also been used in the assessment of the accuracy of seismic phase picking, hypocenter location, fault structure and physics of earthquake sources, as well as the study of earthquake prediction. In this paper, we summarized the latest research and applications of "repeating earthquakes".

  1. Causal inference in longitudinal comparative effectiveness studies with repeated measures of a continuous intermediate variable.

    Science.gov (United States)

    Wang, Chen-Pin; Jo, Booil; Brown, C Hendricks

    2014-09-10

    We propose a principal stratification approach to assess causal effects in nonrandomized longitudinal comparative effectiveness studies with a binary endpoint outcome and repeated measures of a continuous intermediate variable. Our method is an extension of the principal stratification approach originally proposed for the longitudinal randomized study "Prevention of Suicide in Primary Care Elderly: Collaborative Trial" to assess the treatment effect on the continuous Hamilton depression score adjusting for the heterogeneity of repeatedly measured binary compliance status. Our motivation for this work comes from a comparison of the effect of two glucose-lowering medications on a clinical cohort of patients with type 2 diabetes. Here, we consider a causal inference problem assessing how well the two medications work relative to one another on two binary endpoint outcomes: cardiovascular disease-related hospitalization and all-cause mortality. Clinically, these glucose-lowering medications can have differential effects on the intermediate outcome, glucose level over time. Ultimately, we want to compare medication effects on the endpoint outcomes among individuals in the same glucose trajectory stratum while accounting for the heterogeneity in baseline covariates (i.e., to obtain 'principal effects' on the endpoint outcomes). The proposed method involves a three-step model estimation procedure. Step 1 identifies principal strata associated with the intermediate variable using hybrid growth mixture modeling analyses. Step 2 obtains the stratum membership using the pseudoclass technique and derives propensity scores for treatment assignment. Step 3 obtains the stratum-specific treatment effect on the endpoint outcome weighted by inverse propensity probabilities derived from Step 2.

  2. The PICTURE study: diagnostic accuracy of multiparametric MRI in men requiring a repeat prostate biopsy.

    Science.gov (United States)

    Simmons, Lucy A M; Kanthabalan, Abi; Arya, Manit; Briggs, Tim; Barratt, Dean; Charman, Susan C; Freeman, Alex; Gelister, James; Hawkes, David; Hu, Yipeng; Jameson, Charles; McCartan, Neil; Moore, Caroline M; Punwani, Shonit; Ramachandran, Navin; van der Meulen, Jan; Emberton, Mark; Ahmed, Hashim U

    2017-04-25

    Transrectal prostate biopsy has limited diagnostic accuracy. Prostate Imaging Compared to Transperineal Ultrasound-guided biopsy for significant prostate cancer Risk Evaluation (PICTURE) was a paired-cohort confirmatory study designed to assess diagnostic accuracy of multiparametric magnetic resonance imaging (mpMRI) in men requiring a repeat biopsy. All underwent 3 T mpMRI and transperineal template prostate mapping biopsies (TTPM biopsies). Multiparametric MRI was reported using Likert scores and radiologists were blinded to initial biopsies. Men were blinded to mpMRI results. Clinically significant prostate cancer was defined as Gleason ⩾4+3 and/or cancer core length ⩾6 mm. Two hundred and forty-nine had both tests with mean (s.d.) age was 62 (7) years, median (IQR) PSA 6.8 ng ml (4.98-9.50), median (IQR) number of previous biopsies 1 (1-2) and mean (s.d.) gland size 37 ml (15.5). On TTPM biopsies, 103 (41%) had clinically significant prostate cancer. Two hundred and fourteen (86%) had a positive prostate mpMRI using Likert score ⩾3; sensitivity was 97.1% (95% confidence interval (CI): 92-99), specificity 21.9% (15.5-29.5), negative predictive value (NPV) 91.4% (76.9-98.1) and positive predictive value (PPV) 46.7% (35.2-47.8). One hundred and twenty-nine (51.8%) had a positive mpMRI using Likert score ⩾4; sensitivity was 80.6% (71.6-87.7), specificity 68.5% (60.3-75.9), NPV 83.3% (75.4-89.5) and PPV 64.3% (55.4-72.6). In men advised to have a repeat prostate biopsy, prostate mpMRI could be used to safely avoid a repeat biopsy with high sensitivity for clinically significant cancers. However, such a strategy can miss some significant cancers and overdiagnose insignificant cancers depending on the mpMRI score threshold used to define which men should be biopsied.

  3. SU-E-J-263: Repeatability of SUV and Texture Parameters in Serial PET Studies

    Energy Technology Data Exchange (ETDEWEB)

    Schwartz, J; Humm, J; Nehmeh, S; Schoder, H [Memorial Sloan-Kettering Cancer Center, New York, NY (United States)

    2015-06-15

    Purpose: Standardized uptake values (SUV) are standard quantitative PET measures of FDG tumor uptake used,and are used as a tool to monitor response to therapy. Textural analysis is emerging as a new tool for assessing intratumoral heterogeneity which may allow better tissue characterization and improved prediction of response and survival rate.Understanding what variations may be expected in these parameters is key in order to make decisions based on how the change throughout the course of treatment. The aim of this study was to assess repeatability in SUV measures and texture parameters,and establish criteria that differentiate changes associated with treatment rather than statistical variability. Methods: Eighty patients,167 random lesions total,were scanned in a GE Discovery STE PET/CT Scanner. One field-of-view was chosen centered on the largest lesion observed in a clinical whole-body FDG PET.Immediately following,a gated 9 min scan was acquired in list mode,without changing the patient’s position between any scans. Data was replayed into 3 time bins,3 min each,in order to insure equivalent noise characteristics in each replicate.Data was reconstructed into 128×128×47 square matrices.One VOI was drawn over each lesion for each patient and used to segment all 3 replicates. The mean.max and peak SUV were calculated for each VOI and replicate. First-order textural features were also calculated (skewness and kurtosis). Repeatability was calculated as the average standard deviation over the mean for the 3 repeated measurements for each lesion. Results: The average percent error in the SUV max,peak and mean were 3.4%(0– 12.9%),1.9% (0–7.5%),2.8% (0–12.2%),respectively.For skewness and kurtosis they were 10.9% and 17.8%. Conclusion: We have shown that there is a large variation in %error in SUV measures across patients. SUVpeak is the least variable and kurtosis and skewness parameters are less reliable thatn SUVs.Higher order textures are be.

  4. Prognostic usefulness of repeated echocardiographic evaluation after acute myocardial infarction. TRACE Study Group. TRAndolapril Cardiac Evaluation

    DEFF Research Database (Denmark)

    Korup, E; Køber, L; Torp-Pedersen, C;

    1999-01-01

    The prognostic value of repeated echocardiographic measurement of left ventricular function after acute myocardial infarction was evaluated. We found that repeated measurements of wall motion index in survivors of acute myocardial infarction, with no reinfarction, provide important prognostic inf...... information about death and worsening of heart failure....

  5. Studies of the CAG repeat in the Machado-Joseph disease gene in Taiwan.

    Science.gov (United States)

    Hsieh, M; Tsai, H F; Lu, T M; Yang, C Y; Wu, H M; Li, S Y

    1997-08-01

    Machado-Joseph disease (MJD) is an autosomal dominant spinocerebellar degeneration characterized by cerebellar ataxia and pyramidal signs associated in varying degrees with a dystonic-rigid extrapyramidal syndrome or peripheral amyotrophy. Unstable CAG trinucleotide repeat expansion in the MJD gene on the long arm of chromosome 14 has been identified as the pathological mutation for MJD. While investigating the distribution of CAG repeat lengths of the MJD gene in Taiwan's population, we have identified 18 MJD-affected patients and 12 at-risk individuals in seven families. In addition, we have analyzed the range of CAG repeat lengths in 96 control individuals. The CAG repeat number ranged from 13 to 44 in the controls and 72-85 in the affected and at-risk individuals. Our results indicated that the CAG repeat number was inversely correlated with the age of onset. The differences in CAG repeat length between parent and child and between siblings are greater with paternal transmission than maternal transmission. Our data show a tendency towards the phenomenon of anticipation in the MJD families but do not support unidirectional expansion of CAG repeats during transmission. We also demonstrated that PCR amplification of the CAG repeats in the MJD gene from villous DNA was possible and might prove useful as a diagnostic tool for affected families in the future.

  6. A study on the trinucleotide repeat associated with Huntington`s disease in the Chinese

    Energy Technology Data Exchange (ETDEWEB)

    Bing-wen Soong; Jih-tsuu Wang [Neurological Institute, Taipei (Taiwan, Province of China)

    1994-09-01

    Analysis of the polymorphic (CAG)n repeat in the hungingtin gene in the chinese confirmed the presence of an expanded repeat on all Huntington`s disease chromosomes. Measurement of the specific CAG repeat sequence in 34 HD chromosomes from 15 unrelated families and 190 control chromosomes from the Chinese population showed a range from 9 to 29 repeats in normal subjects and 40 to 58 in affected subjects. The size distributions of normal and affected alleles did not overlap. A clear correlation bewteen early onset of symptoms and very high repeat number was seen, but the spread of the age-at-onset in the major repeat range producing characteristic HD it too wide to be of diagnostic value. There was also variability in the transmitted repeat size for both sexes in the HD size range. Maternal HD alleles showed a moderate instability with a preponderance of size decrease, while paternal HD alleles had a tendency to increase in repeat size on transmission, the degree of which appeared proportional to the initial size.

  7. Repeat colonoscopy after a colonoscopy with a negative result in Ontario: a population-based cohort study.

    Science.gov (United States)

    Hol, Lieke; Sutradhar, Rinku; Gu, Sumei; Baxter, Nancy N; Rabeneck, Linda; Tinmouth, Jill M; Paszat, Lawrence F

    2015-01-01

    Data suggest the overuse of repeat colonoscopies, especially in patients at low risk for colorectal cancer. Our objective was to evaluate the time to repeat colonoscopies in low-risk patients aged 50-79 years old and the associated patient- and endoscopist-related factors. All patients aged 50-79 years of age who underwent a complete outpatient colonoscopy with a negative result between 2000 and 2007 were identified from the Ontario Health Insurance Plan database. A colonoscopy performed within 5.5 years of follow-up after the index colonoscopy was considered an early repeat colonoscopy. Patient, endoscopist and endoscopy setting characteristics were recorded and their association with an early repeat colonoscopy was determined using an extended Cox proportional hazards regression model. The cohort consisted of 546 467 patients: 55.4% of the patients were female with a mean age of 61.1 years (95% confidence interval [CI] 61.1-61.2). The cumulative percentage of early repeat colonoscopy after 5.5 years was 33.7%. The rate decreased significantly between 2000 and 2007 (hazard ratio [HR] 0.35, 95% CI 0.34-0.36). General surgeons were associated with a higher risk of early repeat colonoscopy than gastroenterologists (HR 1.27, 95% CI 1.25-1.28). Endoscopists practising in a nonhospital setting were more likely to perform an early repeat colonoscopy (HR 1.26, 95% CI 1.22-1.30) than endoscopists at a hospital. This study showed that there was overuse of early repeat colonoscopy in more than 30% of patients who were at low risk for colorectal cancer. The risk decreased significantly between 2000 and 2007 but was still greater than 20% in 2007. Our findings can be used to develop targeted educational interventions among subgroups of endoscopists with a higher rate of early repeat colonoscopy.

  8. A Prospective Study of Psychiatric Comorbidity and Recidivism Among Repeat DUI Offenders.

    Science.gov (United States)

    Nelson, Sarah E; Belkin, Katerina; LaPlante, Debi A; Bosworth, Leslie; Shaffer, Howard J

    2015-04-13

    Psychiatric comorbidity has emerged as a key element distinguishing DUI offenders from others, and, in some cases, distinguishing repeat offenders from first-time offenders. This paper utilizes a prospective design to determine whether the comorbid disorders identified among repeat DUI offenders can predict recidivism. Seven hundred forty-three repeat DUI offenders were recruited from a two-week inpatient treatment program at which they received a standardized mental health assessment and followed across five years post-treatment to track DUI offense, motor vehicle-related offenses, and general criminal offenses. Psychiatric comorbidity, though it did not predict DUI recidivism specifically, predicted criminal re-offense more generally. In addition, there was a specific relationship between lifetime attention deficit disorder and repeated motor vehicle-related offenses. These findings suggest that for many repeat offenders, DUI is one outlet in a constellation of criminal behavior, and that psychiatric comorbidity increases vulnerability for criminal re-offense.

  9. Strengths and limitations of using repeat-dose toxicity studies to predict effects on fertility.

    Science.gov (United States)

    Dent, M P

    2007-08-01

    The upcoming European chemicals legislation REACH (Registration, Evaluation, and Authorisation of Chemicals) will require the risk assessment of many thousands of chemicals. It is therefore necessary to develop intelligent testing strategies to ensure that chemicals of concern are identified whilst minimising the testing of chemicals using animals. Xenobiotics may perturb the reproductive cycle, and for this reason several reproductive studies are recommended under REACH. One of the endpoints assessed in this battery of tests is mating performance and fertility. Animal tests that address this endpoint use a relatively large number of animals and are also costly in terms of resource, time, and money. If it can be shown that data from non-reproductive studies such as in-vitro or repeat-dose toxicity tests are capable of generating reliable alerts for effects on fertility then some animal testing may be avoided. Available rat sub-chronic and fertility data for 44 chemicals that have been classified by the European Union as toxic to fertility were therefore analysed for concordance of effects. Because it was considered appropriate to read across data for some chemicals these data sets were considered relevant for 73 of the 102 chemicals currently classified as toxic to reproduction (fertility) under this system. For all but 5 of these chemicals it was considered that a well-performed sub-chronic toxicity study would have detected pathology in the male, and in some cases, the female reproductive tract. Three showed evidence of direct interaction with oestrogen or androgen receptors (linuron, nonylphenol, and fenarimol). The remaining chemicals (quinomethionate and azafenidin) act by modes of action that do not require direct interaction with steroid receptors. However, both these materials caused in-utero deaths in pre-natal developmental toxicity studies, and the relatively low NOAELs and the nature of the hazard identified in the sub-chronic tests provides an alert

  10. Non-target effects of repeated chlorothalonil application on soil nitrogen cycling: The key functional gene study.

    Science.gov (United States)

    Zhang, Manyun; Xu, Zhihong; Teng, Ying; Christie, Peter; Wang, Jun; Ren, Wenjie; Luo, Yongming; Li, Zhengao

    2016-02-01

    The widespread and increasing application of chlorothalonil (CTN) raises concerns about its non-target impacts, but little information is available on the effect of CTN on the key functional genes related to soil nitrogen (N) cycling, especially in the case of repeated applications. In the present study, a microcosm incubation was conducted to determine CTN residues and the impacts on the abundances of key functional genes related to N cycling after repeated CTN applications. The results demonstrated that repeated CTN applications at the recommended application rate and five times the recommended rate led to the accumulation of CTN residue in soil at concentrations of 5.59 and 78.79 mg kg(-1), respectively, by the end of incubation. Real time PCR (RT-PCR) revealed that repeated CTN applications had negative effects on the chiA and aprA gene abundances. There were significantly negative correlations between CTN residues and abundances of AOA and AOB genes. In addition, the abundances of key functional genes involved in soil denitrification were declined by repeated CTN applications with the sole exception of the nosZ gene. This study suggests that repeated CTN applications could lead to the accumulation of CTN residue and generate somewhat inconsistent and erratic effects on the abundances of key functional genes related to soil N cycling.

  11. Impact of repeated measures and sample selection on genome-wide association studies of fasting glucose

    Science.gov (United States)

    Rasmussen-Torvik, Laura J.; Alonso, Alvaro; Li, Man; Kao, Wen; Köttgen, Anna; Yan, Yuer; Couper, David; Boerwinkle, Eric; Bielinski, Suzette J.; Pankow, James S.

    2010-01-01

    Although GWAS have been performed in longitudinal studies, most used only a single trait measure. GWAS of fasting glucose have generally included only normoglycemic individuals. We examined the impact of both repeated measures and sample selection on GWAS in ARIC, a study which obtained four longitudinal measures of fasting glucose and included both individuals with and without prevalent diabetes. The sample included Caucasians and the Affymetrix 6.0 chip was used for genotyping. Sample sizes for GWAS analyses ranged from 8372 (first study visit) to 5782 (average fasting glucose). Candidate SNP analyses with SNPs identified through fasting glucose or diabetes GWAS were conducted in 9133 individuals, including 761 with prevalent diabetes. For a constant sample size, smaller p-values were obtained for the average measure of fasting glucose compared to values at any single visit, and two additional significant GWAS signals were detected. For four candidate SNPs (rs780094, rs10830963, rs7903146, and rs4607517), the strength of association between genotype and glucose was significantly (p-interaction fasting glucose candidate SNPs (rs780094, rs10830963, rs560887, rs4607517, rs13266634) the association with measured fasting glucose was more significant in the smaller sample without prevalent diabetes than in the larger combined sample of those with and without diabetes. This analysis demonstrates the potential utility of averaging trait values in GWAS studies and explores the advantage of using only individuals without prevalent diabetes in GWAS of fasting glucose. PMID:20839289

  12. A nationwide, population-based, long-term follow-up study of repeated self-harm in Taiwan

    Directory of Open Access Journals (Sweden)

    Chung Chi-Hsiang

    2012-09-01

    Full Text Available Abstract Background Previous follow-up studies of repeated self-harm show that the cumulative risk of repeated self-harm within one year is 5.7%–15%, with females at greatest risk. However, relatively few studies have focused on the Far East. The objective of this study was to calculate the cumulative risk of repeated self-harm over different lengths of follow-up time (3 months, 6 months, and 1–8 years, to determine factors influencing repeated self-harm and to explore the interaction between gender and self-harm methods. Methods We used self-harm patient who hospitalized due to first-time self-harm between 2000 and 2007 from 1,230 hospitals in Taiwan. Hospitalization for repeated self-harm among members of this cohort was tracked after 3 months, 6 months, and 1–8 years. Tracking continued until December 31, 2008. We analyzed the cumulative risk and risk factors of repeated self-harm by using negative binomial regression. Results Of the 39,875 individual study samples, 3,388 individuals (8.50% were found to have repeatedly self-harmed. The cumulative risk of repeated self-harm within three months was 7.19% and within one year was 8%. Within 8 years, it was 8.70%. Females were more likely to repeatedly self-harm than males (RR = 1.21, 95% CI = 1.15–1.76. The main method of self-harm was solid or liquid substances (RR = 1.88, 95% CI = 1.23–2.04 or cutting or piercing (RR = 1.36, 95% CI = 1.02–1.82, and in patients with psychiatric disorders were more likely to self-harm (RR = 1.61, 95% CI = 1.48–1.75. Conclusions The key time for intervention for repeated self-harm is within three months. Appropriate prevention programs should be developed based on gender differences.

  13. Thermal stability of chicken brain {alpha}-spectrin repeat 17: a spectroscopic study

    Energy Technology Data Exchange (ETDEWEB)

    Brenner, Annette K. [University of Bergen, Department of Chemistry (Norway); Kieffer, Bruno [Ecole Superieure de Biotechnologie de Strasbourg, IGBMC Biomolecular NMR Group, CNRS UMR 7104 (France); Trave, Gilles [Ecole Superieure de Biotechnologie de Strasbourg, Equipe Oncoproteines, IREBS, UMR 7242 (France); Froystein, Nils Age [University of Bergen, Department of Chemistry (Norway); Raae, Arnt J., E-mail: arnt.raae@mbi.uib.no [University of Bergen, Department of Molecular Biology (Norway)

    2012-06-15

    Spectrin is a rod-like multi-modular protein that is mainly composed of triple-helical repeats. These repeats show very similar 3D-structures but variable conformational and thermodynamical stabilities, which may be of great importance for the flexibility and dynamic behaviour of spectrin in the cell. For instance, repeat 17 (R17) of the chicken brain spectrin {alpha}-chain is four times less stable than neighbouring repeat 16 (R16) in terms of Increment G. The structure of spectrin repeats has mainly been investigated by X-ray crystallography, but the structures of a few repeats, e.g. R16, have also been determined by NMR spectroscopy. Here, we undertook a detailed characterization of the neighbouring R17 by NMR spectroscopy. We assigned most backbone resonances and observed NOE restraints, relaxation values and coupling constants that all indicated that the fold of R17 is highly similar to that of R16, in agreement with previous X-ray analysis of a tandem repeat of the two domains. However, {sup 15}N heteronuclear NMR spectra measured at different temperatures revealed particular features of the R17 domain that might contribute to its lower stability. Conformational exchange appeared to alter the linker connecting R17 to R16 as well as the BC-loop in close proximity. In addition, heat-induced splitting was observed for backbone resonances of a few spatially related residues including V99 of helix C, which in R16 is replaced by the larger hydrophobic tryptophan residue that is relatively conserved among other spectrin repeats. These data support the view that the substitution of tryptophan by valine at this position may contribute to the lower stability of R17.

  14. Essays on diffusion and repeat sales of consumer durables : a study of the consumer electronics market

    OpenAIRE

    Kaya, Maria

    2008-01-01

    Although repeat purchases dominate overall sales of consumer durables, diffusion of innovations research has paid them far less attention than new product adoptions. A large survey of 8,077 households allowed a detailed investigation of the differences between households in terms of their repeat purchase behavior of durables. Asymmetric effects were investigated using competing hazard models and showed that consumer innovativeness has a strong impact on discretionary replacements. A modified ...

  15. CAG repeat polymorphisms in the androgen receptor and breast cancer risk in women: a meta-analysis of 17 studies.

    Science.gov (United States)

    Mao, Qixing; Qiu, Mantang; Dong, Gaochao; Xia, Wenjie; Zhang, Shuai; Xu, Youtao; Wang, Jie; Rong, Yin; Xu, Lin; Jiang, Feng

    2015-01-01

    The association between polymorphic CAG repeats in the androgen receptor gene in women and breast cancer susceptibility has been studied extensively. However, the conclusions regarding this relationship remain conflicting. The purpose of this meta-analysis was to identify whether androgen receptor CAG repeat lengths were related to breast cancer susceptibility. The MEDLINE, PubMed, and EMBASE databases were searched through to December 2014 to identify eligible studies. Data and study quality were rigorously assessed by two investigators according to the Newcastle-Ottawa Quality Assessment Scale. The publication bias was assessed by the Begg's test. Seventeen eligible studies were included in this meta-analysis. The overall analysis suggested no association between CAG polymorphisms and breast cancer risk (odds ratio [OR] 1.031, 95% confidence interval [CI] 0.855-1.245). However, in the subgroup analysis, we observed that long CAG repeats significantly increased the risk of breast cancer in the Caucasian population (OR 1.447, 95% CI 1.089-1.992). Additionally, the risk was significantly increased in Caucasian women carrying two alleles with CAG repeats ≥22 units compared with those with two shorter alleles (OR 1.315, 95% CI 1.014-1.707). These findings suggest that long CAG repeats increase the risk of breast cancer in Caucasian women. However, larger scale case-control studies are needed to validate our results.

  16. Intimate partner violence and repeat induced abortion in Italy: A cross sectional study.

    Science.gov (United States)

    Citernesi, Angela; Dubini, Valeria; Uglietti, Anna; Ricci, Elena; Cipriani, Sonia; Parazzini, Fabio

    2015-01-01

    To investigate the impact of intimate partner violence (IPV) on the risk of repeat induced abortion (RIA), we compared IPV history among women with and without previous induced abortion (IA). All consecutive women aged 18 years or more requiring IA in 12 Italian abortion clinics were eligible for inclusion in the study. They were asked to fill in an anonymous, self-developed questionnaire assessing sociodemographic data and their history of different types of violence and related risk factors. The analysis included 1030 women, 624 (60.6%) of whom reported a previous IA. Past or current IPV was reported by 19.3%: 7.0% reported sexual violence, 11.3% physical abuse and 12.1% psychological abuse. Past or current IPV was reported by 22.3% of women with RIA and 14.8% of those undergoing their first IA (adjusted odds ratio 1.57, 95% confidence interval 1.07-2.30; p = 0.02). When we considered sexual, psychological and physical abuse separately, we found that any kind of abuse was more frequent in women with RIA than in women with no previous IA. This study underlines the impact of IPV on the risk of RIA and suggests the need for screening for IPV among women requiring abortion, in order to identify women at risk of RIA and to improve their general and reproductive health.

  17. Repeated open application test with methyldibromo glutaronitrile, a multicentre study within the EECDRG.

    Science.gov (United States)

    Gruvberger, B; Andersen, K E; Brandão, F M; Bruynzeel, D P; Bruze, M; Frosch, P J; Goossens, A; Lahti, A; Maibach, H I; Menné, T; Orton, D; Seidenari, S

    2005-01-01

    Contact allergy to and allergic contact dermatitis from methyldibromo glutaronitrile (MDBGN) have frequently been reported. This study was initiated to help determine the optimal patch test preparation for MDBGN. In 51 patients with a doubtful or a positive patch test reaction to at least 1 of 4 test preparations with MDBGN in petrolatum at 1.0% w/w, 0.5%, 0.3% and 0.1%, a repeated open application test (ROAT) with moisturizers with and without MDBGN at 0.03% w/w was performed on the upper arms for 2 weeks. 18 of the 51 (35.3%) patients developed a positive ROAT. In all patients, there was a positive ROAT only to the moisturizer with MDBGN (P < 0.001). A statistically significant association was also found between the patch test reactivity (PTRL) and the outcome of the ROAT (P < 0.001). If only considering those with a PTRL above 0.3%, thus with negative or doubtful test reactions to 0.1% and 0.3%, there were still statistically significantly more patients with a positive ROAT to the moisturizer with MDBGN than to the moisturizer without MDBGN. The study demonstrates that patch testing with MDBGN at 0.3% and 0.1% will miss clinically relevant patch test reactions to MDBGN.

  18. Repeated exposure of acidic beverages on esthetic restorative materials: An in-vitro surface microhardness study.

    Science.gov (United States)

    Xavier, Arun M; Sunny, Steffy M; Rai, Kavita; Hegde, Amitha M

    2016-07-01

    A manifold increase in the consumption of aerated beverages has witnessed a twin increase in tooth wear and raised demand for esthetic restorative materials. This study aimed to evaluate the surface microhardness changes of esthetic restorative materials following treatment with aerated beverages in an in-vitro situation. The initial surface microhardness of the restorative materials GC Fuji II LC, GC Fuji IX, Nano Glass ionomer, Resin and Nano composite was recorded. These materials were studied under 3 groups that included those exposed to the acidic beverages daily, weekly once in a month and those that had no exposures at all. The final surface microhardness of the materials was recorded following experimentation and was subjected to statistical comparisons. The restorative materials were compared for their surface microhardness changes following respective treatments using the T-test and One-way ANOVA analysis. Inter-comparisons between the groups showed statistical significance (pmaterials revealed surface microhardness loss; the maximum reduction noticed with the Nano glass ionomer cement tested (pmaterials markedly reduced upon repeated exposures with acidic beverages; the product with phosphoric acid producing the maximum surface microhardness loss. Restorative materials, acidic beverages, surface microhardness, resin composites, glass ionomers.

  19. The Study on the Ferrokinetics and Acquired Immunity in Repeated Hookworm Infections

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Mun Ho; Lee, Pyl Ung [Seoul National University College of Medicine, Seoul (Korea, Republic of)

    1967-09-15

    In order to confirm whether acquired immunity or resistance can be developed by the repeated hookworm infections, the 150 mature actively moving filariform ancylostoma duodenale larvae obtained from the severe hookworm anemia patients were orally given to 8 healthy volunteers in three divided doses, 50 in each, at 5 day interval. Also the hematological changes as well as several ferrokinetics using {sup 59}Fe were done and were compared with 10 controls. The clinical symptoms and signs were checked every day for the first 3 weeks and then twice weekly until the end of the experiment. The appearance of the ova in the stool was examined by the formalin ether method and the ova was counted by the Stoll's method. The following laboratory tests were done:1) Red blood cell count, venous blood hematocrit (micromethod), hemoglobin count (cyanomethemoglobin method) were checked every 5 to 7 day interval. 2) Plasma iron concentration (Barkan's modified method) was determined every 2 to 3 week interval. 3) Radioisotope studies:a) Ferrokinetics: Huff et al and Bothwell's method were applied. Erythropoietic Index (% of normal)= ['Subject's turnover/100 ml whole bloodX100'] over ['Average normal turnover/100 ml whole blood'] b) Quantitative measurement of the gastrointestinal absorption of iron:Radioiron ({sup 59}Fe) balance method was applied. c) Determination of the plasma erythropoietin activity: Fried's method was applied. Following were the results: 1) The serum iron level was lower. The red cell volume was decreased, but with relative increase of plasma volume. 2) The plasma iron disappearance time was accelerated and the plasma iron turnover rate was decreased. The red cell iron turnover rate was markedly increased, while all of the red cell iron concentration, circulating red cell iron, plasma iron pool were decreased. The daily iron pool turnover and red cell renewal rate were increased. 3) The erythropoietic index

  20. Structural Studies of a Four-MBT Repeat Protein MBTD1

    Energy Technology Data Exchange (ETDEWEB)

    Eryilmaz, Jitka; Pan, Patricia; Amaya, Maria F.; Allali-Hassani, Abdellah; Dong, Aiping; Adams-Cioaba, Melanie A.; MacKenzie, Farrell; Vedadi, Masoud; Min, Jinrong; (Toronto); (Toronto)

    2010-08-17

    The Polycomb group (PcG) of proteins is a family of important developmental regulators. The respective members function as large protein complexes involved in establishment and maintenance of transcriptional repression of developmental control genes. MBTD1, Malignant Brain Tumor domain-containing protein 1, is one such PcG protein. MBTD1 contains four MBT repeats. We have determined the crystal structure of MBTD1 (residues 130-566aa covering the 4 MBT repeats) at 2.5 {angstrom} resolution by X-ray crystallography. The crystal structure of MBTD1 reveals its similarity to another four-MBT-repeat protein L3MBTL2, which binds lower methylated lysine histones. Fluorescence polarization experiments confirmed that MBTD1 preferentially binds mono- and di-methyllysine histone peptides, like L3MBTL1 and L3MBTL2. All known MBT-peptide complex structures characterized to date do not exhibit strong histone peptide sequence selectivity, and use a 'cavity insertion recognition mode' to recognize the methylated lysine with the deeply buried methyl-lysine forming extensive interactions with the protein while the peptide residues flanking methyl-lysine forming very few contacts. Nevertheless, our mutagenesis data based on L3MBTL1 suggested that the histone peptides could not bind to MBT repeats in any orientation. The four MBT repeats in MBTD1 exhibits an asymmetric rhomboid architecture. Like other MBT repeat proteins characterized so far, MBTD1 binds mono- or dimethylated lysine histones through one of its four MBT repeats utilizing a semi-aromatic cage.

  1. Resistance repeatability study of ion-beam deposited vanadium oxide thin films

    Science.gov (United States)

    Alvarez, P.; Pearson, D. I. C.; Pochon, S.; Thomas, O.; Cooke, M.; Gunn, R.

    2016-09-01

    Ion Beam Sputter Deposition (IBSD) is a versatile technique particularly suited to applications requiring high quality, high performance layer materials as it allows independent and accurate control of the process parameters. Vanadium oxides, used for example in the fabrication of microbolometers, optical switches or optical storage, exhibit interesting properties such as a high Temperature Coefficient of Resistance (TCR), relatively low 1/f noise and a semiconductormetal phase transition close to room temperature. However, it is very challenging to control the stoichiometry of the deposited film as there are at least 25 different oxidation states of vanadium, few of which display the required electrical characteristics. In the present study, vanadium oxide thin layers were deposited by IBSD using an Oxford Ionfab300+ and analyzed with regard to their electrical properties. The impact of the system parameters on the resistance repeatability, wafer-to-wafer and batch-to-batch, was thoroughly investigated to provide the end user with a clear understanding of the factors affecting film resistivity while ensuring at the same time a steep variation of resistance with temperature, as notably required for uncooled bolometers. These parameters were balanced to also achieve a good deposition rate, throughput and uniformity over large device areas, compatible with the requirements of industrial applications.

  2. Comparative Genomic Hybridization Selection of Blastocysts for Repeated Implantation Failure Treatment: A Pilot Study

    Science.gov (United States)

    Greco, Ermanno; Bono, Sara; Ruberti, Alessandra; Lobascio, Anna Maria; Greco, Pierfrancesco; Biricik, Anil; Spizzichino, Letizia; Greco, Alessia; Tesarik, Jan; Minasi, Maria Giulia; Fiorentino, Francesco

    2014-01-01

    The aim of this study is to determine if the use of preimplantation genetic screening (PGS) by array comparative genomic hybridization (array CGH) and transfer of a single euploid blastocyst in patients with repeated implantation failure (RIF) can improve clinical results. Three patient groups are compared: 43 couples with RIF for whom embryos were selected by array CGH (group RIF-PGS), 33 couples with the same history for whom array CGH was not performed (group RIF NO PGS), and 45 good prognosis infertile couples with array CGH selected embryos (group NO RIF PGS). A single euploid blastocyst was transferred in groups RIF-PGS and NO RIF PGS. Array CGH was not performed in group RIF NO PGS in which 1-2 blastocysts were transferred. One monoembryonic sac with heartbeat was found in 28 patients of group RIF PGS and 31 patients of group NO RIF PGS showing similar clinical pregnancy and implantation rates (68.3% and 70.5%, resp.). In contrast, an embryonic sac with heartbeat was only detected in 7 (21.2%) patients of group RIF NO PGS. In conclusion, PGS by array CGH with single euploid blastocyst transfer appears to be a successful strategy for patients with multiple failed IVF attempts. PMID:24779011

  3. Repeated dose (14 days) rat intramuscular toxicology study of Her1 vaccine.

    Science.gov (United States)

    Mancebo, A; Casacó, A; Sánchez, B; González, B; Gómez, D; León, A; Bada, A M; Arteaga, M E; González, Y; González, C; Pupo, M; Fuentes, Dasha

    2012-12-01

    Our goal was to assess the toxicity of two strengths (200 and 400 μg) of HER1 cancer vaccine (Center of Molecular Immunology, Cuba), presented in two different formulations, in Sprague Dawley rats after repeated intramuscular administration (14 days). Four groups (5 animals/sex) were established: Control, Placebo (adjuvant), and two Treated groups receiving a dose representing ten times of human total dose (10×), 28.6 and 57.1 μg/kg. Clinical observations, body weight and rectal temperature were measured during the study. Clinical pathology analysis was performed, besides gross necropsy and histological examination of tissues on animals at the end of the assay. The assay ended with a 100% survival. Injection site damage, with the presence of cysts and granulomas, was observed in adjuvant and vaccine treated groups, with most severe cases predominating at higher strength. Administration of Placebo and Her1 vaccine induced increase in polymorphonuclear cells, with relative lymphopenia conditioned by primary neutrophilia. In summary, results suggest that Her1 immunization was capable of inducing an inflammatory effect at the injection site, leading to systemic alterations, more significant at higher strength (400 μg, 57.1 μg/kg), probably affected by the immunizations' schedule used. The vaccine was shown to be well tolerated without any obvious signs of systemic toxicity, with findings largely attributable to the adjuvant used.

  4. Study on the homocysteine metabolism of patients with unexplained repeated spontaneous abortion

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Objective:To study the metabolism abnormality of homocysteine(Hcy) in unexplained repeated spontaneous abortion(URSA).Methods:The level of Hcy in sera was measured with hyperpressure liquid chromatography(HPLC);Folic acid and vitamin B12 were detected by radioimmune assay;anticardiolipin antibody (ACA) was detected by ELISA.Results:(1)The level of serum Hcy in URSA group was significantly higher than that in control group,showing a statistical significant difference(P<0.01).The level of Hcy was correlated with ages,but not correlated with areas,numbers of miscarriage,gestation age,primary or secondary abortions.(2)The levels of folic acid and vitamin B12 in URSA group were significantly lower than those in control group.The levels of serum folic acid and vitamin B12 were not correlated with age,area,numbers of miscarriage and abortion periods.(3)ACA positive rate in URSA was significantly higher than that in control group.The level of Hcy in ACA(+) group was significantly higher than that in ACA(-) group among URSA patients.Conclusions:Hyperhomocysteinemia,low folic acid state,and ACA were all the independent risk factors for URSA.Lacking of folic acid and vitamin B12 is one of the important causes of hyperhomocysteinemia.ACA and hyperhomocysteinemia may have synergistic action in the occurrence of URSA.

  5. Identification and characterization of simple sequence repeats (SSRs) for population studies of Puccinia novopanici.

    Science.gov (United States)

    Orquera-Tornakian, Gabriela K; Garrido, Patricia; Kronmiller, Brent; Hunger, Robert; Tyler, Brett M; Garzon, Carla D; Marek, Stephen M

    2017-08-01

    Switchgrass (Panicum virgatum L.) can be severely affected by rust disease. Recently switchgrass rust caused by P. emaculata (now confirmed to be Puccinia novopanici) has received most of the attention by the research community because this pathogen is responsible for reducing the biomass production and biofuel feedstock quality of switchgrass. Microsatellite markers found in the literature were either not informative (no allele frequency) or showed few polymorphisms in the target populations, therefore additional markers are needed for future studies of the genetic variation and population structure of P. novopanici. This study reports the development and characterization of novel simple sequence repeat (SSR) markers from a Puccinia emaculata s.l. microsatellite-enriched library and expressed sequence tags (ESTs). Microsatellites were evaluated for polymorphisms on P. emaculata s.l. urediniospores collected in Iowa (IA), Mississippi (MS), Oklahoma (OK), South Dakota (SD) and Virginia (VA). Puccinia novopanici single spore whole genome amplifications were used as templates to validate the SSR reactions protocol and to assess a preliminary population genetics statistics of the pathogen. Eighteen microsatellite markers were polymorphic (average PIC=0.72) on individual urediniospores, with an average of 8.3 alleles per locus (range 3 to 17). Of the 49 SSRs loci initially identified in P. emaculata s.l., 18 were transferable to P. striiformis f. sp. tritici, 23 to P. triticina, 20 to P. sorghi and 31 to P. andropogonis. Thus, these markers could be useful for DNA fingerprinting and population structure analysis for population genetics, epidemiology and ecological studies of P. novopanici and potentially other related Puccinia species. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Repeat sleeve gastrectomy compared with primary sleeve gastrectomy: a single-center, matched case study.

    Science.gov (United States)

    Rebibo, Lionel; Fuks, David; Verhaeghe, Pierre; Deguines, Jean-Baptiste; Dhahri, Abdennaceur; Regimbeau, Jean-Marc

    2012-12-01

    Longitudinal sleeve gastrectomy (LSG) has been validated for the treatment of morbid obesity. However, treatment failures can appear several months after SG. Additional malabsorptive surgery is generally recommended in such cases. The objective of the present study was to evaluate the outcomes of repeat SG (re-SG) relative to first-line SG. This was a retrospective study included 15 patients underwent re-SG after failure of first-line SG (i.e. University Hospital, France; Public Practice). These patients were matched (for age, gender, body mass index and comorbidities) 1:2 with 30 patients having undergone first-line SG. The efficacy criteria comprised intra-operative data and postoperative data. The overall study population comprised 45 patients. The re-SG and first-line SG groups did not differ significantly in terms of median age (p = NS). The median BMI was similar in the two groups (43 kg/m(2) vs. 42.3 kg/m(2), p = NS). The two groups were similar in terms of the prevalence of comorbidities. The mean operating time was longer in the re-SG group (116 vs. 86 min; p ≤ 0.01). The postoperative complication rate was twice as high in the re-SG group (p = 0.31). Two patients in the re-SG group developed a gastric fistula (p = 0.25) and one of the latter died. At 12 months, the Excess Weight Loss was 66% (re-SG group) and 77% (first-line SG group) (p = 0.05). Re-SG is feasible but appears to be associated with a greater risk of complications. Nevertheless, re-SG can produce results (in terms of weight loss), equivalent to those obtained after first-line SG.

  7. Quantum repeated games revisited

    CERN Document Server

    Frackiewicz, Piotr

    2011-01-01

    We present a scheme for playing quantum repeated 2x2 games based on the Marinatto and Weber's approach to quantum games. As a potential application, we study twice repeated Prisoner's Dilemma game. We show that results not available in classical game can be obtained when the game is played in the quantum way. Before we present our idea, we comment on the previous scheme of playing quantum repeated games.

  8. Responsiveness of 5-HT2C receptors in repeatedly diazepam-injected rats: a behavioral and neurochemical study.

    Science.gov (United States)

    Khan, Asma; Haleem, Darakhshan J

    2008-01-01

    The role of 5-hydroxytryptamine (serotonin; 5-HT)2C receptors in anxiety and the anxiolytic effects of drugs is well documented. In view of the withdrawal anxiety associated with repeated diazepam intake, the present study concerns the efficacy of 5-HT2C receptors in rats treated with diazepam. Results show that diazepam injections at a dose of 2 mg/kg daily for two weeks increased weekly food intake and growth rate. Anxiolytic effects of the drug monitored in a light/dark activity box were not significant after single administration. One week and two weeks of administration elicited anxiolytic effects, which were smaller after two weeks of administration as compared to one week, suggesting the development of tolerance to the anxiolytic profile of diazepam. Moreover, three days' withdrawal from repeated administration elicited anxiogenic behavior in the light/dark activity box. The behavioral and neurochemical effects of 1-(m-chlorophenyl)piperazine (m-CPP) (3 mg/kg), a 5-HT2C agonist, were monitored following withdrawal (three days) from two weeks of diazepam administration. Results showed that hypophagic as well as anxiogenic-like effects of m-CPP were not different from repeated saline or repeated diazepam-injected animals. Administration of m-CPP increased 5-HT metabolism in repeated saline as well as repeated diazepam-injected animals. However, m-CPP-induced increases in 5-HT metabolism were greater in repeated diazepam-injected animals. Results are discussed in the context of the role of 5-HT2C receptors in the precipitation of withdrawal anxiety.

  9. Genetic structure of the Azores Islands: a study using 15 autosomal short tandem repeat loci.

    Science.gov (United States)

    Santos, Cristina; Alvarez, Luis; Aluja, Maria Pilar; Bruges-Armas, Jacome; Lima, Manuela

    2009-12-01

    The Azores archipelago (Portugal), located in the Atlantic Ocean, 1,500 km from the European mainland, is formed by nine islands of volcanic origin. The relative position of these islands allows the definition of three geographical groups: Eastern, Central and Western. Previous studies of the Azores using Short Tandem Repeats (STRs) have highlighted differences in the frequencies of several loci, when compared to Mainland Portugal or Madleira Island. Furthermore, linkage disequilibrium (LD), described for Azorean samples has been tentatively explained as reflecting the presence of genetic sub-structuring in the archipelago. To provide information concerning the genetic profile of the Azores Islands and to evaluate the presence of substructuring we have determined the allelic frequencies of 15 autosomal STR loci, using the AmpFlSTR Identifiler Kit, in representative samples from the Azorean Islands. Either considering the Azores as a whole, or analysing by island all the loci were in conformity with Hardy-Weinberg equilibrium. Average gene diversity ranged from 0.7669 in Corvo to 0.7972 in Terceira Island. Allelic independence between loci, tested for the global sample, detected significant LD (after correction for multiple tests) for pairs D21S11/D7S820 and D3S1358/D5S818. The exact test of population differentiation, combining the information of the 15 markers analysed, revealed significant differences between the three groups of islands, and between islands. Inter-island analysis reinforces the previous data that suggested the existence of sub-structuring in the Azores archipelago. Moreover, the data generated by this study can be used in a future forensic genetic database of the Azores after the appropriate enlacement of sample size by island, preventing, in that way, misinterpretations caused by population substructuring and small sample sizes.

  10. LONGITUDINAL STUDY OF REPEATED SPRINT PERFORMANCE IN YOUTH SOCCER PLAYERS OF CONTRASTING SKELETAL MATURITY STATUS

    Directory of Open Access Journals (Sweden)

    João Valente-dos-Santos

    2012-09-01

    Full Text Available The purpose of the study was to evaluate the developmental changes in performance in a repeated-sprint ability (RSA test in young soccer players of contrasting maturity status. A total of 83 regional level Portuguese youth soccer players, aged 11- 13 years at baseline was assessed annually. Stature, body mass, 7x34.2-m sprint protocol (25-s active recovery, 20-m multi-stage continuous shuttle endurance run and counter-movement jump (CMJ without the use of the arms were measured. Fat-free mass (FFM was determined by age and gender- specific formulas. Developmental changes in total sprint time across ages were predicted using multilevel modeling. Corresponding measurements were performed on an independent cross-sectional subsample of 52 youth soccer players 11-17 years to evaluate the predictive model. CA, CA2, maturational status (SA-CA, body size (mass and stature, FFM, aerobic endurance, lower limb explosive strength and annual volume training significantly improved the statistical fit of the RSA multilevel model. In 'late' maturing athletes, the best model for predicting change in RSA was expressed by the following equation: 86.54 - 2.87 x CA + 0.05 x CA2 - 0.25 x FFM + 0.15 x body mass + 0.05 x stature - 0.05 x aerobic endurance - 0.09 x lower limb explosive strength - 0.01 x annual volume training. The best fitting models for players who were 'on time' and 'early' maturing were identical to the best model for late maturing players, less 0.64 seconds and 1.74 seconds, respectively. Multilevel modeling provided performance curves that permitted the prediction of individual RSA performance across adolescent years in regional level soccer players

  11. A 13-week dermal repeat-dose neurotoxicity study of hydrodesulfurized kerosene in rats.

    Science.gov (United States)

    Breglia, Rudolph; Bui, Quang; Burnett, Donald; Koschier, Francis; Lapadula, Elizabeth; Podhasky, Paula; Schreiner, Ceinwen; White, Russell

    2014-01-01

    A 13-week dermal repeat-dose toxicity study was conducted with hydrodesulfurized (HDS) kerosene, a test material that also met the commercial specifications for aviation turbine fuel (jet A). The objectives were to assess the potential for target organ toxicity and neurotoxicity. The HDS kerosene was applied to the shaved backs of Sprague-Dawley CD rats, 12/sex/group, 6 h/d, 5 d/wk in doses of 0 (vehicle control), 165 mg/kg (20% HDS kerosene), 330 mg/kg (40% HDS kerosene), or 495 mg/kg (60% HDS kerosene). Additional rats (12/sex) from the control and the high-dose groups were held without treatment for 4 weeks to assess recovery. Standard parameters of toxicity were investigated during the in-life phase. At necropsy, organs were weighed and selected tissues were processed for microscopic evaluation. Neurobehavioral evaluations included tests of motor activity and functional observations that were conducted pretest, at intervals during the exposure period and after recovery. No test substance-related effects on mortality, clinical observations (except dermal irritation), body weight, or clinical chemistry values were observed. A dose-related increase in skin irritation, confirmed histologically as minimal, was evident at the dosing site. The only statistically significant change considered potentially treatment related was an increase in the neutrophil count in females at 13 weeks. No test article-related effects were observed in the neurobehavioral assessments or gross or microscopic findings in the peripheral or central nervous system tissues in any of the dose groups. Excluding skin irritation, the no observed adverse effect level value for all effects was considered 495 mg/kg/d.

  12. Population genetic study of 10 short tandem repeat loci from 600 domestic dogs in Korea

    Science.gov (United States)

    Moon, Seo Hyun; Jang, Yoon-Jeong

    2016-01-01

    Dogs have long shared close relationships with many humans. Due to the large number of dogs in human populations, they are often involved in crimes. Occasionally, canine biological evidence such as saliva, bloodstains and hairs can be found at crime scenes. Accordingly, canine DNA can be used as forensic evidence. The use of short tandem repeat (STR) loci from biological evidence is valuable for forensic investigations. In Korea, canine STR profiling-related crimes are being successfully analyzed, leading to diverse crimes such as animal cruelty, dog-attacks, murder, robbery, and missing and abandoned dogs being solved. However, the probability of random DNA profile matches cannot be analyzed because of a lack of canine STR data. Therefore, in this study, 10 STR loci were analyzed in 600 dogs in Korea (344 dogs belonging to 30 different purebreds and 256 crossbred dogs) to estimate canine forensic genetic parameters. Among purebred dogs, a separate statistical analysis was conducted for five major subgroups, 97 Maltese, 47 Poodles, 31 Shih Tzus, 32 Yorkshire Terriers, and 25 Pomeranians. Allele frequencies, expected (Hexp) and observed heterozygosity (Hobs), fixation index (F), probability of identity (P(ID)), probability of sibling identity (P(ID)sib) and probability of exclusion (PE) were then calculated. The Hexp values ranged from 0.901 (PEZ12) to 0.634 (FHC2079), while the P(ID)sib values were between 0.481 (FHC2079) and 0.304 (PEZ12) and the P(ID)sib was about 3.35 × 10−5 for the combination of all 10 loci. The results presented herein will strengthen the value of canine DNA to solving dog-related crimes. PMID:26645337

  13. Pilot study: Assessing repeatability of the EcoWalk platform resistive pressure sensors to measure plantar pressure during barefoot standing

    Science.gov (United States)

    Zequera, Martha; Perdomo, Oscar; Wilches, Carlos; Vizcaya, Pedro

    2013-06-01

    Plantar pressure provides useful information to assess the feet's condition. These systems have emerged as popular tools in clinical environment. These systems present errors and no compensation information is presented by the manufacturer, leading to uncertainty in the measurements. Ten healthy subjects, 5 females and 5 males, were recruited. Lateral load distribution, antero-posterior load distribution, average pressure, contact area, and force were recorded. The aims of this study were to assess repeatability of the EcoWalk system and identify the range of pressure values observed in the normal foot. The coefficient of repeatability was less than 4% for all parameters considered.

  14. Reduction and technical simplification of testing protocol for walking based on repeatability analyses: An Interreg IVa pilot study

    Directory of Open Access Journals (Sweden)

    Nejc Sarabon

    2010-12-01

    Full Text Available The aim of this study was to define the most appropriate gait measurement protocols to be used in our future studies in the Mobility in Ageing project. A group of young healthy volunteers took part in the study. Each subject carried out a 10-metre walking test at five different speeds (preferred, very slow, very fast, slow, and fast. Each walking speed was repeated three times, making a total of 15 trials which were carried out in a random order. Each trial was simultaneously analysed by three observers using three different technical approaches: a stop watch, photo cells and electronic kinematic dress. In analysing the repeatability of the trials, the results showed that of the five self-selected walking speeds, three of them (preferred, very fast, and very slow had a significantly higher repeatability of the average walking velocity, step length and cadence than the other two speeds. Additionally, the data showed that one of the three technical methods for gait assessment has better metric characteristics than the other two. In conclusion, based on repeatability, technical and organizational simplification, this study helped us to successfully define a simple and reliable walking test to be used in the main study of the project.

  15. Prospective study on determinants of repeat attendance and attendance patterns in breast cancer screening using the Theory of Planned Behaviour.

    NARCIS (Netherlands)

    Drossaert, Constance H.C.; Boer, Hendrik; Seydel, E.R.

    2003-01-01

    This prospective study, using the Theory of Planned Behaviour (TPB) as a theoretical framework, was carried out to identify the determinants of repeat attendance and attendance patterns in organised breast screening. A group of 2657 women filled out a baseline questionnaire, approximately 8 weeks

  16. Assessing the repeatability of terrestrial laser scanning for monitoring gully topography: A case study from Aratula, Queensland, Australia

    Science.gov (United States)

    Goodwin, Nicholas Robert; Armston, John; Stiller, Isaac; Muir, Jasmine

    2016-06-01

    Terrestrial laser scanning (TLS) technology is a powerful tool for quantifying gully morphology and monitoring change over time. This is due to the high sampling density, sub-centimetre positional accuracies (x, y, z), flexibility of survey configurations and ability to link multiple TLS scans together. However, to ensure correct interpretation of results, research is needed to test the repeatability of TLS derived products to quantify the accuracy and separate 'false' from 'true' geomorphic change. In this study, we use the RIEGL VZ400 scanner to test the repeatability of TLS datasets for mapping gully morphology. We then quantify change following a rainfall event of approximately 100 mm. Our study site, located in south-east Queensland, Australia was chosen to be challenging from a repeatability perspective with high topographic variability. The TLS data capture involved three sets of linked scans: one survey pre-rainfall, to be compared to two surveys post-rainfall acquired on consecutive days. Change is considered negligible in the two post-rainfall scans to test survey repeatability. To verify TLS accuracy, an independent dataset of gully extent and spot heights were acquired using traditional total station techniques. Results confirm that the TLS datasets can be registered multi-temporally at sub-centimetre levels of accuracy in three dimensions. Total station and TLS elevation samples showed strong agreement with a mean error and standard deviation (SD) of residuals equal to 0.052 and 0.047 m, respectively (n = 889). Significantly, our repeatability tests found that return type and pulse deviation influence the accuracy and repeatability of DEMs in gully environments. Analysis of consecutive day datasets showed that DEMs derived from first return data recorded 40% higher SD of residual error than DEMs using multiple return data. A significant empirical relationship between pulse deviation and the variance of residuals for repeat DEMs is also shown (r2 = 0

  17. Progress study on the mechanism of CAG repeats dynamic mutation in polyQ disease

    Directory of Open Access Journals (Sweden)

    WANG Chun-rong

    2012-06-01

    Full Text Available Polyglutamine (polyQ disease is a group of neurodegenerative disorders caused by abnormal expansion of CAG repeats within coding regions of certain causative genes, which are translated into a series of abnormally expanded polyQ tracts causing cytotoxicity. So far, nine diseases caused by expanded polyQ tracts have been demonstrated including Huntington's disease (HD, spinobulbar muscular atrophy (SBMA, dentatorubral-pallidoluysian atrophy (DRPLA and several spinocerebellar ataxias subtypes (SCA. In human, long CAG repeats tend to expand during transmissions from parent to offspring, named as dynamic mutation, leading to an earlier age of disease onset and more severe symptoms in subsequent generations. The review presents some novel mechanisms based on dynamic mutation.

  18. PCR bias in amplification of androgen receptor alleles, a trinucleotide repeat marker used in clonality studies.

    OpenAIRE

    Mutter, G L; Boynton, K A

    1995-01-01

    Trinucleotide CAG repeats in the X-linked human androgen receptor gene (HUMARA) have proved a useful means of determining X chromosome haplotypes, and when combined with methylation analysis of nearby cytosine residues permits identification of non-random X inactivation in tumors of women. Co-amplification of two alleles in a heterozygote generates PCR products which differ in the number of CAG units, and thus their melting and secondary structure characteristics. We have shown that under opt...

  19. A genetic and structural study of genome rearrangements mediated by high copy repeat Ty1 elements.

    Directory of Open Access Journals (Sweden)

    Jason E Chan

    2011-05-01

    Full Text Available Ty elements are high copy number, dispersed repeated sequences in the Saccharomyces cerevisiae genome known to mediate gross chromosomal rearrangements (GCRs. Here we found that introduction of Ty912, a previously identified Ty1 element, onto the non-essential terminal region of the left arm of chromosome V led to a 380-fold increase in the rate of accumulating GCRs in a wild-type strain. A survey of 48 different mutations identified those that either increased or decreased the rate of Ty-mediated GCRs and demonstrated that suppression of Ty-mediated GCRs differs from that of both low copy repeat sequence- and single copy sequence-mediated GCRs. The majority of the Ty912-mediated GCRs observed were monocentric nonreciprocal translocations mediated by RAD52-dependent homologous recombination (HR between Ty912 and a Ty element on another chromosome arm. The remaining Ty912-mediated GCRs appeared to involve Ty912-mediated formation of unstable dicentric translocation chromosomes that were resolved by one or more Ty-mediated breakage-fusion-bridge cycles. Overall, the results demonstrate that the Ty912-mediated GCR assay is an excellent model for understanding mechanisms and pathways that suppress genome rearrangements mediated by high copy number repeat sequences, as well as the mechanisms by which such rearrangements occur.

  20. Study of the repeatability of histone genes in the ploidy series of wheat and Aegilops

    Energy Technology Data Exchange (ETDEWEB)

    Vakhitov, V.A.; Kulikov, A.M.

    1986-10-01

    The hDNA content and number of histone genes in the genomes of different wheat and Aegilops species have been determined by molecular hybridization of DNA with /sup 125/I-histone DNA of Drosophila (L-repeat) on nitrocellulose filters. It has been demonstrated that the proportion of hDNA in the total DNA of diploid and polyploid wheat species is (1.3-7.7) x 10/sup -3/% (57-850 genes), and in the ploidy series of Aegilops species (2.0-8.0) x 10/sup -3/% (89-780 genes). The repeatability of the histone genes generally increases at each ploidy level in the species with higher DNA content. At the same time, it has been demonstrated that the DNA content is not the only factor determining repeatability of the histone genes, as some diploid and allopolyploid species have similar number of these genes. It has been concluded that genetic mechanisms are involved in the regulation of the number of histone genes.

  1. Repeatability study of mechanomyography in submaximal isometric contractions using coefficient of variation and intraclass correlation coefficient.

    Science.gov (United States)

    Akataki, K; Mita, K; Itoh, Y

    1999-01-01

    The within-day and between-day repeatability of the mechanomyogram (MMG) was assessed using the coefficient of variation (CV) and the intraclass correlation coefficient (ICC) and was compared with that of the electromyogram (EMG). The MMG and EMG were recorded simultaneously during isometric elbow flexion trials at different submaximal levels of 10% to 90% MVC. The testing session consisting of 9 submaximal trials was repeated 8 times on the same day for estimation of the within-day variation. In order to examine the between-day variation, the same testing session was also performed 8 times over 3 weeks with a 2-day rest interval between each session. The CVs within-day and between-day in both the MMG and EMG did not demonstrate any significant differences relating to the magnitude of force exerted. The CVs combined over all the force levels were approximately 10% within the same day and 25% between days for both the MMG and EMG. These corresponded to the within-day ICC of approximately 0.95 and the between-day ICC of 0.80. The repeatability of the MMG during submaximal isometric contractions of biceps brachii muscles is considered to be similar to that of the more established EMG.

  2. Deployment Repeatability

    Science.gov (United States)

    2016-04-01

    controlled to great precision, but in a Cubesat , there may be no attitude determination at all. Such a Cubesat might treat sun angle and tumbling rates as...could be sensitive to small differences in motor controller timing. In these cases, the analyst might choose to model the entire deployment path, with...knowledge of the material damage model or motor controller timing precision. On the other hand, if many repeated and environmentally representative

  3. Variability in prefrontal hemodynamic response during exposure to repeated self-selected music excerpts, a near-infrared spectroscopy study.

    Science.gov (United States)

    Moghimi, Saba; Schudlo, Larissa; Chau, Tom; Guerguerian, Anne-Marie

    2015-01-01

    Music-induced brain activity modulations in areas involved in emotion regulation may be useful in achieving therapeutic outcomes. Clinical applications of music may involve prolonged or repeated exposures to music. However, the variability of the observed brain activity patterns in repeated exposures to music is not well understood. We hypothesized that multiple exposures to the same music would elicit more consistent activity patterns than exposure to different music. In this study, the temporal and spatial variability of cerebral prefrontal hemodynamic response was investigated across multiple exposures to self-selected musical excerpts in 10 healthy adults. The hemodynamic changes were measured using prefrontal cortex near infrared spectroscopy and represented by instantaneous phase values. Based on spatial and temporal characteristics of these observed hemodynamic changes, we defined a consistency index to represent variability across these domains. The consistency index across repeated exposures to the same piece of music was compared to the consistency index corresponding to prefrontal activity from randomly matched non-identical musical excerpts. Consistency indexes were significantly different for identical versus non-identical musical excerpts when comparing a subset of repetitions. When all four exposures were compared, no significant difference was observed between the consistency indexes of randomly matched non-identical musical excerpts and the consistency index corresponding to repetitions of the same musical excerpts. This observation suggests the existence of only partial consistency between repeated exposures to the same musical excerpt, which may stem from the role of the prefrontal cortex in regulating other cognitive and emotional processes.

  4. Repeated hands-and-knees positioning during labour: a randomized pilot study.

    Science.gov (United States)

    Hodnett, Ellen D; Stremler, Robyn; Halpern, Stephen H; Weston, Julie; Windrim, Rory

    2013-01-01

    Background. Caesarean birth rates in North America continue to rise, in the absence of benefit for mothers and babies. One reason may be that hospitalized labouring women spend most of their labours in recumbent or semi-recumbent positions. Although hands-and-knees position has theoretical advantages, efforts to encourage its adoption in practice are severely hampered by the lack of compelling evidence that it is beneficial. Before a definitive, large scale trial, with spontaneous vaginal birth as the primary outcome, could be justified in terms of time, effort, and expense, several feasibility and acceptability questions had to be addressed. We aimed to enrol 60 women in a pilot study to assess feasibility and acceptability of the trial protocol, and to obtain estimates of treatment effects on method of birth and persistent back pain. Methods. We conducted a pilot study at two North American hospitals. In ten months of recruitment, 30 nulliparous women in labour at term were randomly allocated to either usual care (use of any position during labour except hands-and-knees) or to try hands-and-knees for 15 min every hour during labour. Data were collected about compliance, acceptability, persistent back pain, intrapartum interventions, and women's views of their experiences. Results. Although mean length of time from randomization to delivery was over 12 hours, only 9 of the 16 women allocated to repeated hands-and-knees used it more than twice. Two of the 14 in the usual care group used hands-and-knees once. Twenty-seven women had regional analgesia (15 in the hands-and-knees group and 12 in the usual care group). Eleven in the hands-and-knees group and 14 in the usual care group had spontaneous vaginal births. One woman (in the hands-and-knees group) had a vacuum extraction. Four women in the hands-and-knees group and none in the usual care group gave birth by caesarean section. Hourly back pain ratings were highly variable in both groups, covering the full range

  5. Repeated hands-and-knees positioning during labour: a randomized pilot study

    Directory of Open Access Journals (Sweden)

    Ellen D. Hodnett

    2013-02-01

    Full Text Available Background. Caesarean birth rates in North America continue to rise, in the absence of benefit for mothers and babies. One reason may be that hospitalized labouring women spend most of their labours in recumbent or semi-recumbent positions. Although hands-and-knees position has theoretical advantages, efforts to encourage its adoption in practice are severely hampered by the lack of compelling evidence that it is beneficial. Before a definitive, large scale trial, with spontaneous vaginal birth as the primary outcome, could be justified in terms of time, effort, and expense, several feasibility and acceptability questions had to be addressed. We aimed to enrol 60 women in a pilot study to assess feasibility and acceptability of the trial protocol, and to obtain estimates of treatment effects on method of birth and persistent back pain.Methods. We conducted a pilot study at two North American hospitals. In ten months of recruitment, 30 nulliparous women in labour at term were randomly allocated to either usual care (use of any position during labour except hands-and-knees or to try hands-and-knees for 15 min every hour during labour. Data were collected about compliance, acceptability, persistent back pain, intrapartum interventions, and women’s views of their experiences.Results. Although mean length of time from randomization to delivery was over 12 hours, only 9 of the 16 women allocated to repeated hands-and-knees used it more than twice. Two of the 14 in the usual care group used hands-and-knees once. Twenty-seven women had regional analgesia (15 in the hands-and-knees group and 12 in the usual care group. Eleven in the hands-and-knees group and 14 in the usual care group had spontaneous vaginal births. One woman (in the hands-and-knees group had a vacuum extraction. Four women in the hands-and-knees group and none in the usual care group gave birth by caesarean section. Hourly back pain ratings were highly variable in both groups

  6. 磁源性影像对癫痫灶定位的临床应用--与VEEG、ECoG比较%Clinical application of magnetic source imaging in localization of epileptic foci-comparison with VEEG and ECoG

    Institute of Scientific and Technical Information of China (English)

    孙吉林; 王建华; 李铮; 吴杰; 李素敏; 吴育锦

    2004-01-01

    目的:探讨磁源性影像在癫痫灶定位中的应用价值.方法:20例难治性癫痫患者,男15例,女5例,手术前均行视频脑电图(Video-Electroencephalography,VEEG)、MRI及脑磁图(Magnetoencephalography,MEG)检查.将MEG所得的电生理资料与MRI所获得的解剖结构资料叠加,形成磁源性影像(magnetic source imaging,MSI).所有患者手术均在MSI指导下进行术中皮层脑电图(Electrocorticography,ECoG)监测.结果:20例患者MSI与VEEG符合率为50%,与ECoG符合率为70%,术后(3~20月)随访16例患者疗效满意.结论:MSI是难治性癫痫患者手术前无创伤性癫痫灶精确定位方法.

  7. Corneal epithelial toxicity of antiglaucoma formulations: in vitro study of repeated applications

    Directory of Open Access Journals (Sweden)

    Meloni M

    2012-09-01

    Full Text Available Marisa Meloni,1 Giampiero Cattaneo,2 Barbara De Servi11VitroScreen In Vitro Research Laboratories, 2Thea Farma, Milan, ItalyBackground: By using a biologically relevant and sensitive three-dimensional model of human corneal epithelium and multiple endpoint analysis, assessment of the potential for eye irritation and long-term compatibility of four registered ophthalmological preparations, ie, Timolabak®, Timoptol®, Nyogel®, and Timogel®, was performed. This approach enables classification of the potential for irritation, discriminating between mildly irritant and non-irritant ocular substances.Methods: The exposure protocol included two time periods, ie, 24 hours (acute application and 72 hours (repeated applications twice daily. This approach allows assessment of not only the acute reaction but also possible recovery, as well as mimicking the potential cumulative effects associated with long-term application. Using benzalkonium chloride (BAK 0.01% as a positive control, the following parameters were quantified: cellular viability by MTT test, histological analysis by hematoxylin and eosin staining, passive release of interleukin-1a by enzyme-linked immunosorbent assay, and OCLN gene expression by quantitative real-time polymerase chain reaction.Results: Cell viability was reduced to under the 50% cutoff value after acute exposure (24 hours to BAK 0.01%, and after repeated application (72 hours of Timoptol and Nyogel. Histological analysis after acute exposure showed signs of superficial damage with all formulations, and severe changes after repeated applications of Timoptol, BAK 0.01%, and Nyogel. Timolabak and Timogel did not significantly alter the morphology of the human corneal epithelial cells after the different exposure times. Interleukin-1α release was greater than that for the negative control (>20 pg/mL and the positive control (BAK 0.01%, Nyogel, and Timoptol treatments and not different after treatment with Timolabak and

  8. CAG repeat polymorphisms in the androgen receptor and breast cancer risk in women: a meta-analysis of 17 studies

    Directory of Open Access Journals (Sweden)

    Mao Q

    2015-08-01

    Full Text Available Qixing Mao,1–3,* Mantang Qiu,1–3,* Gaochao Dong,3 Wenjie Xia,1–3 Shuai Zhang,1,3 Youtao Xu,1,3 Jie Wang,3 Yin Rong,1,3 Lin Xu,1,3 Feng Jiang1,3 1Department of Thoracic Surgery, Nanjing Medical University Affiliated Cancer Institute of Jiangsu Province, 2Fourth Clinical College of Nanjing Medical University, 3Jiangsu Key Laboratory of Molecular and Translational Cancer Research, Nanjing, People’s Republic of China *These authors contributed equally to this work Abstract: The association between polymorphic CAG repeats in the androgen receptor gene in women and breast cancer susceptibility has been studied extensively. However, the conclusions regarding this relationship remain conflicting. The purpose of this meta-analysis was to identify whether androgen receptor CAG repeat lengths were related to breast cancer susceptibility. The MEDLINE, PubMed, and EMBASE databases were searched through to December 2014 to identify eligible studies. Data and study quality were rigorously assessed by two investigators according to the Newcastle-Ottawa Quality Assessment Scale. The publication bias was assessed by the Begg’s test. Seventeen eligible studies were included in this meta-analysis. The overall analysis suggested no association between CAG polymorphisms and breast cancer risk (odds ratio [OR] 1.031, 95% confidence interval [CI] 0.855–1.245. However, in the subgroup analysis, we observed that long CAG repeats significantly increased the risk of breast cancer in the Caucasian population (OR 1.447, 95% CI 1.089–1.992. Additionally, the risk was significantly increased in Caucasian women carrying two alleles with CAG repeats ≥22 units compared with those with two shorter alleles (OR 1.315, 95% CI 1.014–1.707. These findings suggest that long CAG repeats increase the risk of breast cancer in Caucasian women. However, larger scale case-control studies are needed to validate our results. Keywords: androgen, CAG repeat polymorphism, women

  9. Repeat prenatal corticosteroid prior to preterm birth: a systematic review and individual participant data meta-analysis for the PRECISE study group (prenatal repeat corticosteroid international IPD study group: assessing the effects using the best level of evidence - study protocol

    Directory of Open Access Journals (Sweden)

    Crowther Caroline A

    2012-02-01

    Full Text Available Abstract Background The aim of this individual participant data (IPD meta-analysis is to assess whether the effects of repeat prenatal corticosteroid treatment given to women at risk of preterm birth to benefit their babies are modified in a clinically meaningful way by factors related to the women or the trial protocol. Methods/Design The Prenatal Repeat Corticosteroid International IPD Study Group: assessing the effects using the best level of Evidence (PRECISE Group will conduct an IPD meta-analysis. The PRECISE International Collaborative Group was formed in 2010 and data collection commenced in 2011. Eleven trials with up to 5,000 women and 6,000 infants are eligible for the PRECISE IPD meta-analysis. The primary study outcomes for the infants will be serious neonatal outcome (defined by the PRECISE International IPD Study Group as one of death (foetal, neonatal or infant; severe respiratory disease; severe intraventricular haemorrhage (grade 3 and 4; chronic lung disease; necrotising enterocolitis; serious retinopathy of prematurity; and cystic periventricular leukomalacia; use of respiratory support (defined as mechanical ventilation or continuous positive airways pressure or other respiratory support; and birth weight (Z-scores. For the children, the primary study outcomes will be death or any neurological disability (however defined by trialists at childhood follow up and may include developmental delay or intellectual impairment (developmental quotient or intelligence quotient more than one standard deviation below the mean, cerebral palsy (abnormality of tone with motor dysfunction, blindness (for example, corrected visual acuity worse than 6/60 in the better eye or deafness (for example, hearing loss requiring amplification or worse. For the women, the primary outcome will be maternal sepsis (defined as chorioamnionitis; pyrexia after trial entry requiring the use of antibiotics; puerperal sepsis; intrapartum fever requiring the use

  10. Uncontrolled variables in frying studies: differences in repeatability between thermoxidation and frying experiments

    Directory of Open Access Journals (Sweden)

    Dobarganes, Carmen

    2007-09-01

    Full Text Available Palm oil, soybean oil and partially hydrogenated soybean oil were used to define the repeatability of oil degradation under thermoxidation in the absence of food and during the frying of potatoes. Total polar compounds and their constituent polymeric triglycerides, oxidized monomeric triglycerides and diglycerides were analyzed. The oils were thermoxidized under standard conditions in a Rancimat apparatus at 180 °C for 25 hours. Discontinuous frying experiments were carried out in triplicate in three apparently identical domestic fryers. Five batches of potatoes were fried per day in each fryer. Oils were heated at 180 °C in periods of 5 h per day during 5 consecutive days so that the total heating period was 25 h. Repeatability was high in the thermoxidation assays and rather low in the frying experiments. Significant differences between the oils were found in the thermoxidation experiments, while no significant differences were found in the frying assays due to large standard deviations. The participation of variables related to the fryer performance which are difficult to control, was deduced. Among them, differences in the heating/cooling cycles at high temperature might be important. The contribution of fryer performance to the decreased repeatability was confirmed in further frying experiments with palm oil. Results showed that repeatability for the same fryer was higher than that obtained when different fryers were considered.Se estudia la repetibilidad de los resultados obtenidos en el calentamiento de los aceites y grasas a temperatura elevada utilizando aceite de palma, aceite de soja y aceite de soja parcialmente hidrogenado. Partiendo de la repetibilidad de las determinaciones analíticas utilizadas para la evaluación de la degradación de los aceites y grasas a elevada temperatura, el análisis de compuestos polares y de su distribución en polímeros de triglicéridos, triglicéridos monómeros oxidados y diglicéridos, se

  11. Use of short tandem repeat sequences to study Mycobacterium leprae in leprosy patients in Malawi and India.

    Directory of Open Access Journals (Sweden)

    Saroj K Young

    2008-04-01

    Full Text Available Inadequate understanding of the transmission of Mycobacterium leprae makes it difficult to predict the impact of leprosy control interventions. Genotypic tests that allow tracking of individual bacterial strains would strengthen epidemiological studies and contribute to our understanding of the disease.Genotyping assays based on variation in the copy number of short tandem repeat sequences were applied to biopsies collected in population-based epidemiological studies of leprosy in northern Malawi, and from members of multi-case households in Hyderabad, India. In the Malawi series, considerable genotypic variability was observed between patients, and also within patients, when isolates were collected at different times or from different tissues. Less within-patient variability was observed when isolates were collected from similar tissues at the same time. Less genotypic variability was noted amongst the closely related Indian patients than in the Malawi series.Lineages of M. leprae undergo changes in their pattern of short tandem repeat sequences over time. Genetic divergence is particularly likely between bacilli inhabiting different (e.g., skin and nerve tissues. Such variability makes short tandem repeat sequences unsuitable as a general tool for population-based strain typing of M. leprae, or for distinguishing relapse from reinfection. Careful use of these markers may provide insights into the development of disease within individuals and for tracking of short transmission chains.

  12. Revisiting the TALE repeat.

    Science.gov (United States)

    Deng, Dong; Yan, Chuangye; Wu, Jianping; Pan, Xiaojing; Yan, Nieng

    2014-04-01

    Transcription activator-like (TAL) effectors specifically bind to double stranded (ds) DNA through a central domain of tandem repeats. Each TAL effector (TALE) repeat comprises 33-35 amino acids and recognizes one specific DNA base through a highly variable residue at a fixed position in the repeat. Structural studies have revealed the molecular basis of DNA recognition by TALE repeats. Examination of the overall structure reveals that the basic building block of TALE protein, namely a helical hairpin, is one-helix shifted from the previously defined TALE motif. Here we wish to suggest a structure-based re-demarcation of the TALE repeat which starts with the residues that bind to the DNA backbone phosphate and concludes with the base-recognition hyper-variable residue. This new numbering system is consistent with the α-solenoid superfamily to which TALE belongs, and reflects the structural integrity of TAL effectors. In addition, it confers integral number of TALE repeats that matches the number of bound DNA bases. We then present fifteen crystal structures of engineered dHax3 variants in complex with target DNA molecules, which elucidate the structural basis for the recognition of bases adenine (A) and guanine (G) by reported or uncharacterized TALE codes. Finally, we analyzed the sequence-structure correlation of the amino acid residues within a TALE repeat. The structural analyses reported here may advance the mechanistic understanding of TALE proteins and facilitate the design of TALEN with improved affinity and specificity.

  13. Spa Goers' Repeated Visits for Health and Wellness and the Influential Factors: An Exploratory Study of the UK Spa Goers.

    Science.gov (United States)

    Choi, Myungsuk; Poade, Donna; Sohn, Minsung; Choi, Mankyu

    2016-01-01

    Dissemination of spa services across the globe and its market saturation drive demand for differentiated communication methods. This study aims to explore the influential factors on spa goers' repeated visits and their practical applications in the health and wellness spa industry. The identified factors were used as the measurement variables to examine the relation with spa goers' repeated visits. The proposed concept was tested by a mixed method combining a self-administered questionnaire and semistructured interview with 54 survey participants and 6 interviewees. It was meaningful to use a sample of the UK spa goers from the southwest region since global spa trends stem from the EU spas, and the United Kingdom is one of the market leaders. The data were analyzed using frequency, percentage, multiple logistic regression analysis, and coding process. The survey findings demonstrated that the most significant influential factor on the repeated spa visits is a memorable experience of which showed 13.7 times higher probability than the reference up-to-date facility. The details of memorable experiences were discovered throughout the interviews that include the rediscovery of self, feeling of connectedness, recharge for positive emotions, self-reward through escapism, and experience of noncommercialized local products and attractions. Therefore, using experiential marketing methods can be effective spa service marketing.

  14. The prodromal phase of leucine-rich repeat kinase 2-associated Parkinson disease: Clinical and imaging Studies.

    Science.gov (United States)

    Pont-Sunyer, Claustre; Tolosa, Eduardo; Caspell-Garcia, Chelsea; Coffey, Christopher; Alcalay, Roy N; Chan, Piu; Duda, John E; Facheris, Maurizio; Fernández-Santiago, Rubén; Marek, Kenneth; Lomeña, Francisco; Marras, Connie; Mondragon, Elisabet; Saunders-Pullman, Rachel; Waro, Bjorg

    2017-05-01

    Asymptomatic, nonmanifesting carriers of leucine-rich repeat kinase 2 mutations are at increased risk of developing PD. Clinical and neuroimaging features may be associated with gene carriage and/or may demarcate individuals at greater risk for phenoconversion to PD. To investigate clinical and dopamine transporter single-photon emission computed tomography imaging characteristics of leucine-rich repeat kinase 2 asymptomatic carriers. A total of 342 carriers' and 259 noncarriers' relatives of G2019S leucine-rich repeat kinase 2/PD patients and 39 carriers' and 31 noncarriers' relatives of R1441G leucine-rich repeat kinase 2/PD patients were evaluated. Motor and nonmotor symptoms were assessed using specific scales and questionnaires. Neuroimaging quantitative data were obtained in 81 carriers and compared with 41 noncarriers. G2019S carriers scored higher in motor scores and had lower radioligand uptake compared to noncarriers, but no differences in nonmotor symptoms scores were observed. R1441G carriers scored higher in motor scores, had lower radioligand uptake, and had higher scores in depression, dysautonomia, and Rapid Eye Movements Sleep Behavior Disorder Screening Questionnaire scores, but had better cognition scores than noncarriers. Among G2019S carriers, a group with "mild motor signs" was identified, and was significantly older, with worse olfaction and lower radioligand uptake. G2019S and R1441G carriers differ from their noncarriers' relatives in higher motor scores and slightly lower radioligand uptake. Nonmotor symptoms were mild, and different nonmotor profiles were observed in G2019S carriers compared to R1441G carriers. A group of G2019S carriers with known prodromal features was identified. Longitudinal studies are required to determine whether such individuals are at short-term risk of developing overt parkinsonism. © 2017 International Parkinson and Movement Disorder Society. © 2017 International Parkinson and Movement Disorder Society.

  15. Variability in prefrontal hemodynamic response during exposure to repeated self-selected music excerpts, a near-infrared spectroscopy study.

    Directory of Open Access Journals (Sweden)

    Saba Moghimi

    Full Text Available Music-induced brain activity modulations in areas involved in emotion regulation may be useful in achieving therapeutic outcomes. Clinical applications of music may involve prolonged or repeated exposures to music. However, the variability of the observed brain activity patterns in repeated exposures to music is not well understood. We hypothesized that multiple exposures to the same music would elicit more consistent activity patterns than exposure to different music. In this study, the temporal and spatial variability of cerebral prefrontal hemodynamic response was investigated across multiple exposures to self-selected musical excerpts in 10 healthy adults. The hemodynamic changes were measured using prefrontal cortex near infrared spectroscopy and represented by instantaneous phase values. Based on spatial and temporal characteristics of these observed hemodynamic changes, we defined a consistency index to represent variability across these domains. The consistency index across repeated exposures to the same piece of music was compared to the consistency index corresponding to prefrontal activity from randomly matched non-identical musical excerpts. Consistency indexes were significantly different for identical versus non-identical musical excerpts when comparing a subset of repetitions. When all four exposures were compared, no significant difference was observed between the consistency indexes of randomly matched non-identical musical excerpts and the consistency index corresponding to repetitions of the same musical excerpts. This observation suggests the existence of only partial consistency between repeated exposures to the same musical excerpt, which may stem from the role of the prefrontal cortex in regulating other cognitive and emotional processes.

  16. PCR bias in amplification of androgen receptor alleles, a trinucleotide repeat marker used in clonality studies.

    Science.gov (United States)

    Mutter, G L; Boynton, K A

    1995-04-25

    Trinucleotide CAG repeats in the X-linked human androgen receptor gene (HUMARA) have proved a useful means of determining X chromosome haplotypes, and when combined with methylation analysis of nearby cytosine residues permits identification of non-random X inactivation in tumors of women. Co-amplification of two alleles in a heterozygote generates PCR products which differ in the number of CAG units, and thus their melting and secondary structure characteristics. We have shown that under optimal conditions amplification efficiency of two HUMARA alleles is near-equivalent, generating PCR products in a ratio proportional to that of the genomic template. In contrast, reduction of template quantity, damage of template by ultraviolet irradiation or addition of monovalent salts (sodium chloride, sodium acetate or ammonium acetate) produces highly variable imbalances of allelic PCR products, with a strong tendency to preferentially amplify lower molecular weight alleles. Variability and biasing was diminished by substitution of 7-deaza-2'-dGTP for dGTP during amplification, an intervention which reduces stability of intramolecular and intermolecular GC base pairing. We conclude that DNA which is scanty, damaged or salt contaminated may display amplification bias of GC-rich PCR targets, potentially confounding accurate interpretation or reproducibility of assays which require co-amplification of alleles.

  17. Analyzing repeated measures semi-continuous data, with application to an alcohol dependence study.

    Science.gov (United States)

    Liu, Lei; Strawderman, Robert L; Johnson, Bankole A; O'Quigley, John M

    2016-02-01

    Two-part random effects models (Olsen and Schafer,(1) Tooze et al.(2)) have been applied to repeated measures of semi-continuous data, characterized by a mixture of a substantial proportion of zero values and a skewed distribution of positive values. In the original formulation of this model, the natural logarithm of the positive values is assumed to follow a normal distribution with a constant variance parameter. In this article, we review and consider three extensions of this model, allowing the positive values to follow (a) a generalized gamma distribution, (b) a log-skew-normal distribution, and (c) a normal distribution after the Box-Cox transformation. We allow for the possibility of heteroscedasticity. Maximum likelihood estimation is shown to be conveniently implemented in SAS Proc NLMIXED. The performance of the methods is compared through applications to daily drinking records in a secondary data analysis from a randomized controlled trial of topiramate for alcohol dependence treatment. We find that all three models provide a significantly better fit than the log-normal model, and there exists strong evidence for heteroscedasticity. We also compare the three models by the likelihood ratio tests for non-nested hypotheses (Vuong(3)). The results suggest that the generalized gamma distribution provides the best fit, though no statistically significant differences are found in pairwise model comparisons.

  18. NMR studies on domain diffusion and alignment in modular GB1 repeats.

    Science.gov (United States)

    Walsh, Joseph D; Meier, Katlyn; Ishima, Rieko; Gronenborn, Angela M

    2010-10-20

    Modular proteins contain individual domains that are often connected by flexible, unstructured linkers. Using a model system based on the GB1 domain, we constructed tandem repeat proteins and investigated the rotational diffusion and long-range angular ordering behavior of individual domains by measuring NMR relaxation parameters and residual dipolar couplings. Although they display almost identical protein-solvent interfaces, each domain exhibits distinct rotational diffusion and alignment properties. The diffusion tensor anisotropy of the N-terminal domain (NTD) is D(‖)/D(⊥) = 1.5-1.6, similar to that of single-GB1 domains (D(‖)/D(⊥) = 1.6-1.7), whereas the value for the C-terminal domain (CTD) is D(‖)/D(⊥) = 2.0-2.2. In addition, the two domains have different rotational correlation times. These effects are observed for linkers of three to 24 residues, irrespective of linker length. The NTD and CTD also differ in their degree of magnetic alignment, even with a flexible linker of 18 residues, exhibiting D(a) values of 7.7 Hz and 9.7 Hz, respectively. Our results suggest that diffusion differences and long-range influences may persist in modular protein systems, even for systems that have highly flexible linkers and exhibit no domain-domain or domain-linker interactions.

  19. Does sequential embryo transfer improve pregnancy rate in patients with repeated implantation failure? A randomized control study

    Directory of Open Access Journals (Sweden)

    Wael A. Ismail Madkour

    2015-12-01

    Full Text Available Background: Repeated failure of in vitro fertilization treatment is frustrating to the patients and their clinicians. Various treatment plans and a change of protocol have been suggested for “low responders”; however, patients who fail treatment repeatedly inspite of good quality embryos pose a special therapeutic challenge. Additional challenge would be imposed on that particular group when the local IVF regulating low does not permit surplus embryo freezing. Objective: To examine whether sequential transfer of embryos on day 3 and on day 5 after ovum pick-up improves IVF/ET success rates in patients with repeated consecutive IVF failures (⩾ 3 trials compared to day 3 alone, with the background that local regulation prohibits embryo freezing. Study design: Randomized controlled study. Women scheduled for IVF/ET with repeated consecutive IVF failures (⩾ 3 trials were randomized to either sequential transfer of embryos on day 3 and on day 5 after ovum pick-up (Group I = 74 or conventional day 3 transfer (Group II = 73 as a control. The primary outcome measures were clinical pregnancy rate and implantation rate. The secondary outcome measures were ongoing pregnancy rate and early pregnancy loss. Results: Baseline and cycle characteristics were comparable in both groups. Clinical pregnancy rate (per embryo transfer was significantly higher in sequential ET group (37. 8% compared to that in day 3 group (21.9% (P value <0.05. Also, implantation rate (per embryos transferred was significantly higher in sequential ET group (17.1% compared to that in control group (10.5% (P value <0.01. Similarly, ongoing pregnancy (per embryo transfer was significantly higher in sequential ET group (33. 8% compared to that in day 3 group (19.2% (P value <0.05. Conclusions: Patients with repeated implantation failures, treatment with the sequential embryo transfer approach had significantly improved pregnancy outcomes compared to regular day 3 transfers

  20. GSTM1 and APE1 genotypes affect arsenic-induced oxidative stress: a repeated measures study

    Directory of Open Access Journals (Sweden)

    Quamruzzaman Quazi

    2007-12-01

    Full Text Available Abstract Background Chronic arsenic exposure is associated with an increased risk of skin, bladder and lung cancers. Generation of oxidative stress may contribute to arsenic carcinogenesis. Methods To investigate the association between arsenic exposure and oxidative stress, urinary 8-hydroxy-2'-deoxyguanosine (8-OHdG was evaluated in a cohort of 97 women recruited from an arsenic-endemic region of Bangladesh in 2003. Arsenic exposure was measured in urine, toenails, and drinking water. Drinking water and urine samples were collected on three consecutive days. Susceptibility to oxidative stress was evaluated by genotyping relevant polymorphisms in glutathione-s transferase mu (GSTM1, human 8-oxoguanine glycosylase (hOGG1 and apurinic/apyrimidinic endonuclease (APE1 genes using the Taqman method. Data were analyzed using random effects Tobit regression to account for repeated measures and 8-OHdG values below the detection limit. Results A consistent negative effect for APE1 was observed across water, toenail and urinary arsenic models. APE1 148 glu/glu + asp/glu genotype was associated with a decrease in logged 8-OHdG of 0.40 (95%CI -0.73, -0.07 compared to APE1 148 asp/asp. An association between total urinary arsenic and 8-OHdG was observed among women with the GSTM1 null genotype but not in women with GSTM1 positive. Among women with GSTM1 null, a comparison of the second, third, and fourth quartiles of total urinary arsenic to the first quartile resulted in a 0.84 increase (95% CI 0.27, 1.42, a 0.98 increase (95% CI 033, 1.66 and a 0.85 increase (95% CI 0.27, 1.44 in logged 8-OHdG, respectively. No effects between 8-OHdG and toenail arsenic or drinking water arsenic were observed. Conclusion These results suggest the APE1 variant genotype decreases repair of 8-OHdG and that arsenic exposure is associated with oxidative stress in women who lack a functional GSTM1 detoxification enzyme.

  1. [A case-control study of factors associated with repeat teen pregnancy based on a sample from a university maternity hospital].

    Science.gov (United States)

    Silva, Andréa de Albuquerque Arruda; Coutinho, Isabela C; Katz, Leila; Souza, Alex Sandro Rolland

    2013-03-01

    Repeat teen pregnancy is a frequent issue and is considered an aggravating factor for increased maternal and fetal morbidity and social problems. The aim of the study was to identify factors associated with repeat teen pregnancy. A case-control study was conducted in 90 postpartum adolescents with more than one pregnancy (cases) and 90 adult women with a history of only one pregnancy during adolescence (controls). Statistical analysis used hierarchical logistic regression with 5% significance. Early sexual initiation (< 15 years), early age at first pregnancy (< 16 years), not raising the children themselves, and low family income (< one minimum wage) were associated with repeat teenage pregnancy, while partner change was inversely associated. Repeat teen pregnancy was mainly associated with reproductive and socioeconomic factors. Partner change appeared as a protective factor. Measures should be adopted during the postpartum period of teenage mothers in order to avoid repeat pregnancy.

  2. Prolonged Repeated Acupuncture Stimulation Induces Habituation Effects in Pain-Related Brain Areas: An fMRI Study

    Science.gov (United States)

    Li, Chuanfu; Yang, Jun; Park, Kyungmo; Wu, Hongli; Hu, Sheng; Zhang, Wei; Bu, Junjie; Xu, Chunsheng; Qiu, Bensheng; Zhang, Xiaochu

    2014-01-01

    Most previous studies of brain responses to acupuncture were designed to investigate the acupuncture instant effect while the cumulative effect that should be more important in clinical practice has seldom been discussed. In this study, the neural basis of the acupuncture cumulative effect was analyzed. For this experiment, forty healthy volunteers were recruited, in which more than 40 minutes of repeated acupuncture stimulation was implemented at acupoint Zhusanli (ST36). Three runs of acupuncture fMRI datasets were acquired, with each run consisting of two blocks of acupuncture stimulation. Besides general linear model (GLM) analysis, the cumulative effects of acupuncture were analyzed with analysis of covariance (ANCOVA) to find the association between the brain response and the cumulative duration of acupuncture stimulation in each stimulation block. The experimental results showed that the brain response in the initial stage was the strongest although the brain response to acupuncture was time-variant. In particular, the brain areas that were activated in the first block and the brain areas that demonstrated cumulative effects in the course of repeated acupuncture stimulation overlapped in the pain-related areas, including the bilateral middle cingulate cortex, the bilateral paracentral lobule, the SII, and the right thalamus. Furthermore, the cumulative effects demonstrated bimodal characteristics, i.e. the brain response was positive at the beginning, and became negative at the end. It was suggested that the cumulative effect of repeated acupuncture stimulation was consistent with the characteristic of habituation effects. This finding may explain the neurophysiologic mechanism underlying acupuncture analgesia. PMID:24821143

  3. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Yan-Min Ma

    2014-06-01

    Full Text Available This study aimed to investigate the correlations among androgen receptor (AR CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and fifty-three healthy men (aged 22.8 ± 3.1 years were enrolled. The individuals were grouped as CAG short (CAG S if they harbored repeat length of ≤20 or as CAG long (CAG L if their CAG repeat length was >20. Body height/weight, penile length and other parameters were examined and recorded by the specified physicians; CAG repeat polymorphism was determined by the polymerase chain reaction (PCR method; and the serum levels of the sex hormones were detected by radioimmunoassay. Student's t-test or linear regression analysis was used to assess the associations among AR CAG repeat polymorphism, sex hormones and penile length. This investigation showed that the serum total testosterone (T level was positively associated with the AR CAG repeat length (P = 0.01; whereas, no significant correlation of T or AR CAG repeat polymorphism with the penile length was found (P = 0.593. Interestingly, an inverse association was observed between serum prolactin (PRL levels and penile length by linear regression analyses (β= −0.024, P = 0.039, 95% confidence interval (CI: −0.047, 0. Collectively, this study provides the first evidence that serum PRL, but not T or AR CAG repeat polymorphism, is correlated with penile length in the Han adult population from northwestern China.

  4. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China: a cross-sectional study.

    Science.gov (United States)

    Ma, Yan-Min; Wu, Kai-Jie; Ning, Liang; Zeng, Jin; Kou, Bo; Xie, Hong-Jun; Ma, Zhen-Kun; Wang, Xin-Yang; Gong, Yong-Guang; He, Da-Lin

    2014-01-01

    This study aimed to investigate the correlations among androgen receptor (AR) CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and fifty-three healthy men (aged 22.8 ± 3.1 years) were enrolled. The individuals were grouped as CAG short (CAG S ) if they harbored repeat length of ≤ 20 or as CAG long (CAG L ) if their CAG repeat length was >20. Body height/weight, penile length and other parameters were examined and recorded by the specified physicians; CAG repeat polymorphism was determined by the polymerase chain reaction (PCR) method; and the serum levels of the sex hormones were detected by radioimmunoassay. Student's t-test or linear regression analysis was used to assess the associations among AR CAG repeat polymorphism, sex hormones and penile length. This investigation showed that the serum total testosterone (T) level was positively associated with the AR CAG repeat length (P = 0.01); whereas, no significant correlation of T or AR CAG repeat polymorphism with the penile length was found (P = 0.593). Interestingly, an inverse association was observed between serum prolactin (PRL) levels and penile length by linear regression analyses (β= -0.024, P = 0.039, 95% confidence interval (CI): -0.047, 0). Collectively, this study provides the first evidence that serum PRL, but not T or AR CAG repeat polymorphism, is correlated with penile length in the Han adult population from northwestern China.

  5. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China:a cross-sectional study

    Institute of Scientific and Technical Information of China (English)

    YanMin Ma; DaLin He; KaiJie Wu; Liang Ning; Jin Zeng; Bo Kou; HongJun Xie; ZhenKun Ma; XinYang Wang; YongGuang Gong

    2014-01-01

    This study aimed to investigate the correlations among androgen receptor (AR) CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and iffty-three healthy men (aged 22.8 ± 3.1 years) were enrolled. The individuals were grouped as CAG short (CAGS) if they harbored repeat length of≤20 or as CAG long (CAGL) if their CAG repeat length was>20. Body height/weight, penile length and other parameters were examined and recorded by the speciifed physicians;CAG repeat polymorphism was determined by the polymerase chain reaction (PCR) method;and the serum levels of the sex hormones were detected by radioimmunoassay. Student’s t-test or linear regression analysis was used to assess the associations among AR CAG repeat polymorphism, sex hormones and penile length. This investigation showed that the serum total testosterone (T) level was positively associated with the AR CAG repeat length (P= 0.01); whereas, no signiifcant correlation of T or AR CAG repeat polymorphism with the penile length was found (P= 0.593). Interestingly, an inverse association was observed between serum prolactin (PRL) levels and penile length by linear regression analyses (b=-0.024, P= 0.039, 95%conifdence interval (CI):-0.047, 0). Collectively, this study provides the ifrst evidence that serum PRL, but not T or AR CAG repeat polymorphism, is correlated with penile length in the Han adult population from northwestern China.

  6. No Improved Performance With Repeated-Sprint Training in Hypoxia Versus Normoxia: A Double-Blind and Crossover Study.

    Science.gov (United States)

    Montero, David; Lundby, Carsten

    2017-02-01

    Few recent studies indicate that short-term repeated-sprint (RS) training in hypoxia (RSH) improves RS performance compared with identical training under normoxic conditions (RSN) in endurance-trained subjects. To determine the effects of RSH against RSN on RS performance under normoxic and moderate hypoxic conditions, using a randomized, doubleblind, crossover experimental design. Fifteen endurance-trained male subjects (age 25 ± 4 y) performed 4 wk of RS training (3 sessions/wk) in normobaric hypoxia (RSH, FiO2 = 13.8%) and normoxia (RSN, FiO2 = 20.9%) in a crossover manner. Before and after completion of training, RS tests were performed on a cycle ergometer with no prior exercise (RSNE), after an incremental exercise test (RSIE), and after a time-trial test (RSTT) in normoxia and hypoxia. Peak power outputs at the incremental exercise test and time-trial performance were unaltered by RSH in normoxia and hypoxia. RS performance was generally enhanced by RSH, as well as RSN, but there were no additional effects of RSH over RSN on peak and mean sprint power output and the number of repeated sprints performed in the RSNE, RSIE, and RSTT trials under normoxic and hypoxic conditions. The present double-blind crossover study indicates that RSH does not improve RS performance compared with RSN in normoxic and hypoxic conditions in endurance-trained subjects. Therefore, caution should be exercised when proposing RSH as an advantageous method to improve exercise performance.

  7. Drosophila melanogaster As a Model Organism to Study RNA Toxicity of Repeat Expansion-Associated Neurodegenerative and Neuromuscular Diseases

    Science.gov (United States)

    Koon, Alex C.; Chan, Ho Yin Edwin

    2017-01-01

    For nearly a century, the fruit fly, Drosophila melanogaster, has proven to be a valuable tool in our understanding of fundamental biological processes, and has empowered our discoveries, particularly in the field of neuroscience. In recent years, Drosophila has emerged as a model organism for human neurodegenerative and neuromuscular disorders. In this review, we highlight a number of recent studies that utilized the Drosophila model to study repeat-expansion associated diseases (READs), such as polyglutamine diseases, fragile X-associated tremor/ataxia syndrome (FXTAS), myotonic dystrophy type 1 (DM1) and type 2 (DM2), and C9ORF72-associated amyotrophic lateral sclerosis/frontotemporal dementia (C9-ALS/FTD). Discoveries regarding the possible mechanisms of RNA toxicity will be focused here. These studies demonstrate Drosophila as an excellent in vivo model system that can reveal novel mechanistic insights into human disorders, providing the foundation for translational research and therapeutic development. PMID:28377694

  8. Tectonomagnetic study in the seismoactive area of Narmada–Son lineament, central India: Preliminary results on repeat field observations

    Indian Academy of Sciences (India)

    S Y Waghmare; S D Pimprikar; P B Gawali; L Carlo; A G Patil

    2009-06-01

    Repeated measurements of the total geomagnetic field on the five profiles have revealed a picture of stress-induced tectonomagnetic effect in the form of secular variation of the total geomagnetic field in the tectonically and seismically active area of Jabalpur and adjoining areas of the Narmada-Son lineament (NSL),central India.For this experiment,a reference base station was established within the study area at Jabalpur.Using proton precession magnetometers with a sensitivity of 0.1 nT, simultaneous measurements of total geomagnetic field were made annually at the base and all field stations.Five cycles of repeated observations have been performed between 2003 and 2007.For data analysis,a difference method has been applied and the residuals have been calculated as secular variations of the total geomagnetic field with values ranging from ± 0.1nT to about > ± 14.6nT/yr over the different stations.The anomalies in secular variation of the total geomagnetic field may be related to anomalous accumulation of tectonic stresses and tensions on the deep fault zones and crustal blocks due to recent geodynamic processes and active geological inhomogeneities in the NSL.

  9. Multi-laboratory validation study of multilocus variable-number tandem repeat analysis (MLVA) for Salmonella enterica serovar Enteritidis, 2015

    Science.gov (United States)

    Peters, Tansy; Bertrand, Sophie; Björkman, Jonas T; Brandal, Lin T; Brown, Derek J; Erdõsi, Tímea; Heck, Max; Ibrahem, Salha; Johansson, Karin; Kornschober, Christian; Kotila, Saara M; Le Hello, Simon; Lienemann, Taru; Mattheus, Wesley; Nielsen, Eva Møller; Ragimbeau, Catherine; Rumore, Jillian; Sabol, Ashley; Torpdahl, Mia; Trees, Eija; Tuohy, Alma; de Pinna, Elizabeth

    2017-01-01

    Multilocus variable-number tandem repeat analysis (MLVA) is a rapid and reproducible typing method that is an important tool for investigation, as well as detection, of national and multinational outbreaks of a range of food-borne pathogens. Salmonella enterica serovar Enteritidis is the most common Salmonella serovar associated with human salmonellosis in the European Union/European Economic Area and North America. Fourteen laboratories from 13 countries in Europe and North America participated in a validation study for MLVA of S. Enteritidis targeting five loci. Following normalisation of fragment sizes using a set of reference strains, a blinded set of 24 strains with known allele sizes was analysed by each participant. The S. Enteritidis 5-loci MLVA protocol was shown to produce internationally comparable results as more than 90% of the participants reported less than 5% discrepant MLVA profiles. All 14 participating laboratories performed well, even those where experience with this typing method was limited. The raw fragment length data were consistent throughout, and the inter-laboratory validation helped to standardise the conversion of raw data to repeat numbers with at least two countries updating their internal procedures. However, differences in assigned MLVA profiles remain between well-established protocols and should be taken into account when exchanging data. PMID:28277220

  10. Effect of repeated sterilization cycles on the physical properties of scaling instruments: a scanning electron microscopy study.

    Science.gov (United States)

    Porto, Alessandra Nogueira; Borges, Álvaro Henrique; Semenoff-Segundo, Alex; Raslan, Suzane A; Pedro, Fábio Luis Miranda; Jorge, Antônio Olavo Cardoso; Bandeca, Matheus Coelho

    2015-05-01

    Repeated sterilizations cycles cause undesirable alterations in the material properties of the instruments, such as corrosion, alterations in the hardness of the metal and the loss of the cutting sharpness of the instrument. This research examined the effect of repeated dry heat sterilization and autoclaves cycles on carbon steel (CS) and stainless steel (SS) curettes during the scaling and root planning. A total of 77 Gracey curettes were used in this study. Of these, 35 were SS and 42 were CS curettes submitted in different process: Dry heat, autoclave, inhibition of corrosion and autoclave, scaling, root planning and dry heat, scaling, root planning, inhibition of corrosion and autoclave. The inhibition of corrosion used on the carbon curettes (prior to sterilization in the autoclave) was sodium nitrite at 2%. The curettes received 10 consecutive cycles of sterilization and after that the cutting edges were examined in the electronic microscope, at 60 and 100 magnification times. The images were evaluated by three independent examiners, who compared the photographs of each group with the control group. The surface corrosion products and a deterioration of the edges were observed and the results showed that the SS curettes suffered little alteration with sterilization, scaling, root planning whereas the CS curettes were visibly affected by sterilization in the autoclave, but when the inhibition of corrosion was used prior to the sterilization, the oxidation was considerably reduced.

  11. Repeated-Doses Toxicity Study of the Essential Oil of Hyptis martiusii Benth. (Lamiaceae in Swiss Mice

    Directory of Open Access Journals (Sweden)

    Germana Freire Rocha Caldas

    2013-01-01

    Full Text Available Hyptis martiusii Benth. (Lamiaceae is found in abundance in Northeastern Brazil where it is used in traditional medicine to treat gastric disorders. Since there are no studies reporting the toxicity and safety profile of this species, we investigated repeated-doses toxicity of the essential oil of Hyptis martiusii (EOHM. Swiss mice of both sexes were orally treated with EOHM (100 and 500 mg/kg for 30 days, and biochemical, hematological, and morphological parameters were determined. No toxicity signs or deaths were recorded during the treatment with EOHM. The body weight gain was not affected, but there was an occasional variation in water and food consumption among mice of both sexes treated with both doses. The hematological and biochemical profiles did not show significant differences except for a decrease in the MCV and an increase in albumin, but these variations are within the limits described for the species. The microscopic analysis showed changes in liver, kidneys, lungs, and spleen; however, these changes do not have clinical relevance since they varied among the groups, including the control group. The results indicate that the treatment of repeated-doses with the essential oil of Hyptis martiusii showed low toxicity in mice.

  12. Effectiveness of repeated photodynamic therapy in the elimination of intracanal Enterococcus faecalis biofilm: an in vitro study.

    Science.gov (United States)

    Prażmo, Ewa Joanna; Godlewska, Renata Alicja; Mielczarek, Agnieszka Beata

    2017-04-01

    The study aimed to investigate the effectiveness of photodynamic therapy in the elimination of intracanal Enterococcus faecalis biofilm and to analyse how a repeated light irradiation, replenishment of oxygen and photosensitiser affect the results of the photodynamic disinfecting protocol. After chemomechanical preparation, 46 single-rooted human teeth were infected with a clinical strain of E. faecalis and incubated for a week in microaerobic conditions. The experimental procedures included groups of single application of photodynamic therapy, two cycles of PDT, irrigation with 5.25% NaOCl solution and negative and positive control. The number of residing bacterial colonies in the root canals was determined based on the CFU/ml method. In the group of preparations irrigated with NaOCl, bacterial colonies were not observed. A single PDT eliminated 45% of the initial CFU/ml. Repeated PDT eradicated 95% of the intracanal bacterial biofilm. Photodynamic therapy has a high potential for the elimination of E. faecalis biofilm. There is a safe therapeutic window where photoinduced disinfection can be used as an adjuvant to conventional endodontic treatment, which remains the most effective.

  13. Broad and narrow personality traits as markers of one-time and repeated suicide attempts: A population-based study

    Directory of Open Access Journals (Sweden)

    Vitaro Frank

    2008-03-01

    Full Text Available Abstract Background Studying personality traits with the potential to differentiate between individuals engaging in suicide attempts of different degrees of severity could help us to understand the processes underlying the link of personality and nonfatal suicidal behaviours and to identify at-risk groups. One approach may be to examine whether narrow, i.e., lower-order personality traits may be more useful than their underlying, broad personality trait dimensions. Methods We investigated qualitative and quantitative differences in broad and narrow personality traits between one-time and repeated suicide attempters in a longitudinal, population-based sample of young French Canadian adults using two multivariate regression models. Results One broad (Compulsivity: OR = 2.0; 95% CI 1.2–3.5 and one narrow personality trait (anxiousness: OR = 1.1; 95% CI 1.01–1.1 differentiated between individuals with histories of repeated and one-time suicide attempts. Affective instability [(OR = 1.1; 95% CI 1.04–1.1] and anxiousness [(OR = .92; 95% CI .88–.95], on the other hand, differentiated between nonattempters and one-time suicide attempters. Conclusion Emotional and cognitive dysregulation and associated behavioural manifestations may be associated with suicide attempts of different severity. While findings associated with narrow traits may be easier to interpret and link to existing sociobiological theories, larger effect sizes associated with broad traits such as Compulsivity may be better suited to objectives with a more clinical focus.

  14. Case study: videogame distraction reduces behavioral distress in a preschool-aged child undergoing repeated burn dressing changes: a single-subject design

    National Research Council Canada - National Science Library

    Sil, Soumitri; Dahlquist, Lynnda M; Burns, Andrew J

    2013-01-01

    This single-subject design study evaluated the feasibility and efficacy of passive and interactive videogame distraction on behavioral distress for a preschool-aged child receiving repeated burn dressing changes...

  15. Prevention of eating disorders among minority youth: a matched-sample repeated measures study.

    Science.gov (United States)

    Cook-Cottone, Catherine; Jones, Lakaii A; Haugli, Sara

    2010-01-01

    The purpose of this study was to examine ethnic differences in primary prevention programs for eating disorders in young girls. In order to address the dearth of research in this area, this study examined the comparative response to an eating disorder prevention program on fifth-grade minority and White females. Pre- and post-test data were collected from 10 groups participating in the prevention program for a total of 50 girls. Minority participants and White participants were then matched based on Body Mass Index (BMI) and socioeconomic status in order to examine ethnic differences in group effectiveness. Findings indicated that minority and White participants were equally responsive to the prevention program.

  16. [The study of interaction between paralogous tandem repeats stellate and suppressor of stellate in the genome of Drosophila melanogaster].

    Science.gov (United States)

    Aravin, A A; Naumova, N M; Tulin, A V; Klenov, M S; Gvozdev, V A

    2000-04-01

    Testis-specific expression of tandemly repeated Stellate genes, located in eu- and heterochromatin regions of the X chromosome of Drosophila melanogaster, is suppressed by homologous Suppressor of Stellate repeats located on the Y chromosome. Using transgenic lines, we have demonstrated that three Su(Ste) copies failed to change the expression of the reporter construction carrying the bacterial beta-galactosidase gene under control of the Stellate gene regulatory sequence. Possible mechanisms of the Su(Ste) repeat suppressor activity are discussed.

  17. Discovery, Characterization, and Functional Study of a Novel MEF2D CAG Repeat in Duck (Anas platyrhynchos).

    Science.gov (United States)

    Wang, Yushi; Wang, Jiwen; Liu, Hehe; Zhang, Rongping; Zhang, Tao; Gan, Xiang; Huang, Huilan; Chen, Da; Li, Liang

    2016-08-01

    Myocyte enhancer transcription factor 2D (MEF2D) is an important transcription factor for promoting the growth and development of muscle. CAG repeats have been found in the coding sequence (CDS) of avian MEF2D; however, their functions remain unknown and require further investigation. Here, we examined the characteristics and functional role of MEF2D CAG repeat in duck. The full-length CDS of duck MEF2D was cloned for the first time, and a novel CAG repeat was identified and located in exon 9. Sequence analysis indicated that the protein domains of duck MEF2D are highly conserved relative to other vertebrates, whereas MEF2D CAG repeats with variable repeat numbers are specific to avian species. Furthermore, sequencing has revealed polymorphisms in MEF2D CAG repeat at both DNA and mRNA levels. Four MEF2D CAG repeat genotypes and 10 MEF2D cDNA variants with different CAG repeat numbers were detected in two duck populations. A t-test showed that the expanded CAG repeat generated significantly longer transcription products (p analysis demonstrated positive correlations between the expansion of the CAG repeat and five muscle-related traits. By using protein structure prediction, we suggested that the polymorphisms of the CAG repeat affect protein structures within protein domains. Taken together, these findings reveal that duck MEF2D CAG repeat is a potential functional element with polymorphisms and may cause differences in MEF2D function between duck and other vertebrate species.

  18. Repeated versus wide reading: A randomized control design study examining the impact of fluency interventions on underlying reading behavior.

    Science.gov (United States)

    Ardoin, Scott P; Binder, Katherine S; Foster, Tori E; Zawoyski, Andrea M

    2016-12-01

    Repeated readings (RR) has garnered much attention as an evidence based intervention designed to improve all components of reading fluency (rate, accuracy, prosody, and comprehension). Despite this attention, there is not an abundance of research comparing its effectiveness to other potential interventions. The current study presents the findings from a randomized control trial study involving the assignment of 168second grade students to a RR, wide reading (WR), or business as usual condition. Intervention students were provided with 9-10weeks of intervention with sessions occurring four times per week. Pre- and post-testing were conducted using Woodcock-Johnson III reading achievement measures (Woodcock, McGrew, & Mather, 2001, curriculum-based measurement (CBM) probes, measures of prosody, and measures of students' eye movements when reading. Changes in fluency were also monitored using weekly CBM progress monitoring procedures. Data were collected on the amount of time students spent reading and the number of words read by students during each intervention session. Results indicate substantial gains made by students across conditions, with some measures indicating greater gains by students in the two intervention conditions. Analyses do not indicate that RR was superior to WR. In addition to expanding the RR literature, this study greatly expands research evaluating changes in reading behaviors that occur with improvements in reading fluency. Implications regarding whether schools should provide more opportunities to repeatedly practice the same text (i.e., RR) or practice a wide range of text (i.e., WR) are provided. Copyright © 2016 Society for the Study of School Psychology. Published by Elsevier Ltd. All rights reserved.

  19. The Effect of Image Quality, Repeated Study, and Assessment Method on Anatomy Learning

    Science.gov (United States)

    Fenesi, Barbara; Mackinnon, Chelsea; Cheng, Lucia; Kim, Joseph A.; Wainman, Bruce C.

    2017-01-01

    The use of two-dimensional (2D) images is consistently used to prepare anatomy students for handling real specimen. This study examined whether the quality of 2D images is a critical component in anatomy learning. The visual clarity and consistency of 2D anatomical images was systematically manipulated to produce low-quality and high-quality…

  20. Repeated open application test with methyldibromo glutaronitrile, a multicentre study within the EECDRG

    DEFF Research Database (Denmark)

    Gruvberger, B; Andersen, Klaus Ejner; Brandão, F M

    2005-01-01

    Contact allergy to and allergic contact dermatitis from methyldibromo glutaronitrile (MDBGN) have frequently been reported. This study was initiated to help determine the optimal patch test preparation for MDBGN. In 51 patients with a doubtful or a positive patch test reaction to at least 1 of 4 ...

  1. Mouth opening in patients irradiated for head and neck cancer : A prospective repeated measures study

    NARCIS (Netherlands)

    Kamstra, J. I.; Dijkstra, P. U.; van Leeuwen, M.; Roodenburg, J. L. N.; Langendijk, J. A.

    2015-01-01

    Objectives: Aims of this prospective cohort study were (1) to analyze the course of mouth opening up to 48 months post-radiotherapy (RT), (2) to assess risk factors predicting decrease in mouth opening, and (3) to develop a multivariable prediction model for change in mouth opening in a large sample

  2. Mouth opening in patients irradiated for head and neck cancer : A prospective repeated measures study

    NARCIS (Netherlands)

    Kamstra, J. I.; Dijkstra, P. U.; van Leeuwen, M.; Roodenburg, J. L. N.; Langendijk, J. A.

    Objectives: Aims of this prospective cohort study were (1) to analyze the course of mouth opening up to 48 months post-radiotherapy (RT), (2) to assess risk factors predicting decrease in mouth opening, and (3) to develop a multivariable prediction model for change in mouth opening in a large sample

  3. International Mycoplasma pneumoniae typing study: interpretation of M. pneumoniae multilocus variable-number tandem-repeat analysis

    Directory of Open Access Journals (Sweden)

    V.J. Chalker

    2015-09-01

    Full Text Available Typing of Mycoplasma pneumoniae by multiple-locus variable-number tandem repeat analysis (MLVA is increasingly in use. However, no specific internationally agreed guidance is available. Thirty M. pneumoniae DNA samples including serial dilutions of a type strain were sent to six international laboratories to perform MLVA and results were compared. Good correlation was observed, indicating that this methodology can be robustly performed in multiple sites. However, differences due to interpretation of fragment size, repeat sequence identification and repeat numbering led to inconsistency in the final profiles assigned by laboratories. We propose guidelines for interpreting M. pneumoniae MLVA typing and assigning the number of repeats.

  4. Repeated exposure of acidic beverages on esthetic restorative materials: an in-vitro surface microhardness study

    OpenAIRE

    Xavier, Arun M.; Sunny, Steffy M.; Rai, Kavita; Amitha M Hegde

    2016-01-01

    Background A manifold increase in the consumption of aerated beverages has witnessed a twin increase in tooth wear and raised demand for esthetic restorative materials. This study aimed to evaluate the surface microhardness changes of esthetic restorative materials following treatment with aerated beverages in an in-vitro situation. Material and Methods The initial surface microhardness of the restorative materials GC Fuji II LC, GC Fuji IX, Nano Glass ionomer, Resin and Nano composite was re...

  5. URINARY CREATINE AT REST AND AFTER REPEATED SPRINTS IN ATHLETES: A PILOT STUDY

    Directory of Open Access Journals (Sweden)

    I. Bezrati-Benayed

    2014-07-01

    Full Text Available Creatine plays a key role in muscle function and its evaluation is important in athletes. In this study, urinary creatine concentration was measured in order to highlight its possible significance in monitoring sprinters. The study included 51 sprinters and 25 age- and sex-matched untrained subjects as a control group. Body composition was measured and dietary intake estimated. Urine samples were collected before and after standardized physical exercise. Creatine was assessed by gas chromatography mass spectrometry. Basal urinary creatine (UC was significantly lower in sprinters than controls (34±30 vs. 74±3 μmol/mmol creatinine, p<0.05. UC was inversely correlated with body mass (r=-0.34, p<0.01 and lean mass (r=- 0.30, p<0.05, and positively correlated with fat mass (r=0.32, p<0.05. After acute exercise, urinary creatine significantly decreased in both athletes and controls. UC is low in sprinters at rest and further decreases after exercise, most likely due to a high uptake and use of creatine by muscles, as muscle mass and physical activity are supposed to be greater in athletes than untrained subjects. Further studies are needed to test the value of urinary creatine as a non-invasive marker of physical condition and as a parameter for managing Cr supplementation in athletes.

  6. Urinary creatine at rest and after repeated sprints in athletes: a pilot study.

    Science.gov (United States)

    Bezrati-Benayed, I; Nasrallah, F; Feki, M; Chamari, K; Omar, S; Alouane-Trabelsi, L; Ben Mansour, A; Kaabachi, N

    2014-03-01

    Creatine plays a key role in muscle function and its evaluation is important in athletes. In this study, urinary creatine concentration was measured in order to highlight its possible significance in monitoring sprinters. The study included 51 sprinters and 25 age- and sex-matched untrained subjects as a control group. Body composition was measured and dietary intake estimated. Urine samples were collected before and after standardized physical exercise. Creatine was assessed by gas chromatography mass spectrometry. Basal urinary creatine (UC) was significantly lower in sprinters than controls (34±30 vs. 74±3 µmol/mmol creatinine, p sprinters at rest and further decreases after exercise, most likely due to a high uptake and use of creatine by muscles, as muscle mass and physical activity are supposed to be greater in athletes than untrained subjects. Further studies are needed to test the value of urinary creatine as a non-invasive marker of physical condition and as a parameter for managing Cr supplementation in athletes.

  7. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China: a cross-sectional study

    OpenAIRE

    Yan-Min Ma; Kai-Jie Wu; Liang Ning; Jin Zeng; Bo Kou; Hong-Jun Xie; Zhen-Kun Ma; Xin-Yang Wang; Yong-Guang Gong; Da-Lin He

    2014-01-01

    This study aimed to investigate the correlations among androgen receptor (AR) CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and fifty-three healthy men (aged 22.8 ± 3.1 years) were enrolled. The individuals were grouped as CAG short (CAG S ) if they harbored repeat length of ≤20 or as CAG long (CAG L ) if their CAG repeat length was >20. Body height/weight, penile length and other parameters were examined and recorded by the specified ...

  8. The haemotoxicity of azathioprine in repeat dose studies in the female CD-1 mouse.

    Science.gov (United States)

    Molyneux, Gemma; Gibson, Frances M; Chen, Christabelle M; Marway, Harpal K; McKeag, Sean; Mifsud, Charles V J; Pilling, Andrew M; Whayman, Matthew J; Turton, John A

    2008-04-01

    Azathioprine (AZA) is a cytotoxic immunosuppressive drug used in the prevention of rejection in organ transplants and the treatment of auto-immune diseases. However, AZA is haemotoxic causing significant bone marrow depression. The present studies were to characterize the haemotoxicity of AZA in the female CD-1 mouse. In Experiment 1, a dose-ranging study, with AZA gavaged daily for 10 days, clinical evidence of toxicity was evident at 125 mg/kg and above. Experiment 2 was a dose-response study with AZA gavaged daily for 10 days at 40-120 mg/kg. At day 1 after the final dose, AZA induced a dose-related pancytopaenia, reduced femoral marrow cellularity, increases in serum levels of the cytokine fms-like tyrosine kinase 3 ligand, reduction in granulocyte-monocyte colony-forming units and erythroid colonies, and increased bone marrow apoptosis. Histology demonstrated hepatocyte hypertrophy, thymic atrophy, reduced splenic extramedullary haemopoiesis, and reduced cellularity of sternal bone marrow. In Experiment 3, AZA was dosed for 10 days at 100 mg/kg with autopsies at 1, 3, 9, 22, 29, 43 and 57 days postdosing. At 1, 3 and 9 days, haematological parameters reflected changes in Experiment 2. At 22/29 days, many blood parameters were returning towards normal; at 43/57 days, most parameters compared with controls. However, there was some evidence of a persistent (i.e. residual/late-stage) mild reduction in RBC and erythroid progenitor cell counts at day 43/57. We conclude that the CD-1 mouse provides an acceptable model for the haemotoxicity of AZA in man.

  9. Women's risk of repeat abortions is strongly associated with alcohol consumption: a longitudinal analysis of a Russian national panel study, 1994-2009.

    Directory of Open Access Journals (Sweden)

    Katherine Keenan

    Full Text Available Abortion rates in Russia, particularly repeat abortions, are among the highest in the world, and abortion complications make a substantial contribution to the country's high maternal mortality rate. Russia also has a very high rate of hazardous alcohol use. However, the association between alcohol use and abortion in Russia remains unexplored. We investigated the longitudinal predictors of first and repeat abortion, focussing on women's alcohol use as a risk factor. Follow-up data from 2,623 women of reproductive age (16-44 years was extracted from 14 waves of the Russian Longitudinal Monitoring Survey (RLMS, a nationally representative panel study covering the period 1994-2009. We used discrete time hazard models to estimate the probability of having a first and repeat abortion by social, demographic and health characteristics at the preceding study wave. Having a first abortion was associated with demographic factors such as age and parity, whereas repeat abortions were associated with low education and alcohol use. After adjustment for demographic and socioeconomic factors, the risk of having a repeat abortion increased significantly as women's drinking frequency increased (P<0.001, and binge drinking women were significantly more likely to have a repeat abortion than non-drinkers (OR 2.28, 95% CI 1.62-3.20. This association was not accounted for by contraceptive use or a higher risk of pregnancy. Therefore the determinants of first and repeat abortion in Russia between 1994-2009 were different. Women who had repeat abortions were distinguished by their heavier and more frequent alcohol use. The mechanism for the association is not well understood but could be explained by unmeasured personality factors, such as risk taking, or social non-conformity increasing the risk of unplanned pregnancy. Heavy or frequent drinkers constitute a particularly high risk group for repeat abortion, who could be targeted in prevention efforts.

  10. Magnetic Resonance Spectroscopy in Patients with Insomnia: A Repeated Measurement Study.

    Science.gov (United States)

    Spiegelhalder, Kai; Regen, Wolfram; Nissen, Christoph; Feige, Bernd; Baglioni, Chiara; Riemann, Dieter; Hennig, Jürgen; Lange, Thomas

    2016-01-01

    Chronic insomnia is one of the most prevalent central nervous system disorders. It is characterized by increased arousal levels, however, the neurobiological causes and correlates of hyperarousal in insomnia remain to be further determined. In the current study, magnetic resonance spectroscopy was used in the morning and evening in a well-characterized sample of 20 primary insomnia patients (12 females; 8 males; 42.7 ± 13.4 years) and 20 healthy good sleepers (12 females; 8 males; 44.1 ± 10.6 years). The most important inhibitory and excitatory neurotransmitters of the central nervous system, γ-aminobutyric acid (GABA) and glutamate/glutamine (Glx), were assessed in the anterior cingulate cortex (ACC) and dorsolateral prefrontal cortex (DLPFC). The primary hypothesis, a diurnal effect on GABA levels in patients with insomnia, could not be confirmed. Moreover, the current results did not support previous findings of altered GABA levels in individuals with insomnia. Exploratory analyses, however, suggested that GABA levels in the ACC may be positively associated with habitual sleep duration, and, thus, reduced GABA levels may be a trait marker of objective sleep disturbances. Moreover, there was a significant GROUP x MEASUREMENT TIME interaction effect on Glx in the DLPFC with increasing Glx levels across the day in the patients but not in the control group. Therefore, Glx levels may reflect hyperarousal at bedtime in those with insomnia. Future confirmatory studies should include larger sample sizes to investigate brain metabolites in different subgroups of insomnia.

  11. Global sensitivity analysis for repeated measures studies with informative drop-out: A semi-parametric approach.

    Science.gov (United States)

    Scharfstein, Daniel; McDermott, Aidan; Díaz, Iván; Carone, Marco; Lunardon, Nicola; Turkoz, Ibrahim

    2017-05-23

    In practice, both testable and untestable assumptions are generally required to draw inference about the mean outcome measured at the final scheduled visit in a repeated measures study with drop-out. Scharfstein et al. (2014) proposed a sensitivity analysis methodology to determine the robustness of conclusions within a class of untestable assumptions. In their approach, the untestable and testable assumptions were guaranteed to be compatible; their testable assumptions were based on a fully parametric model for the distribution of the observable data. While convenient, these parametric assumptions have proven especially restrictive in empirical research. Here, we relax their distributional assumptions and provide a more flexible, semi-parametric approach. We illustrate our proposal in the context of a randomized trial for evaluating a treatment of schizoaffective disorder. © 2017, The International Biometric Society.

  12. Zinc oxide nanoparticles: a 90-day repeated-dose dermal toxicity study in rats

    Directory of Open Access Journals (Sweden)

    Ryu HJ

    2014-12-01

    Full Text Available Hwa Jung Ryu,1,* Mu Yeb Seo,2,* Sung Kyu Jung,1 Eun Ho Maeng,2 Seung-Young Lee,2 Dong-Hyouk Jang,2 Taek-Jin Lee,2 Ki-Yeon Jo,2 Yu-Ri Kim,3 Kyu-Bong Cho,4 Meyoung-Kon Kim,3 Beom Jun Lee,5 Sang Wook Son1 1Department of Dermatology, Korea University College of Medicine, Seoul, 2Korea Testing and Research Institute, Gyunggido, 3Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul, 4Department of Clinical Laboratory Science, Shinheung College, Uijeongbu, 5College of Veterinary Medicine, Chungbuk National University, Cheongju, Republic of Korea *These authors contributed equally to this work and both should be considered first authors Abstract: Zinc oxide (ZnO works as a long-lasting, broad-spectrum physical sunblock, and can prevent skin cancer, sunburn, and photoaging. Nanosized ZnO particles are used often in sunscreens due to consumer preference over larger sizes, which appear opaque when dermally applied. Although the US Food and Drug Administration approved the use of nanoparticles (NPs in sunscreens in 1999, there are ongoing safety concerns. The aim of this study was to evaluate the subchronic toxicity of ZnO NPs after dermal application according to the Organization for Economic Cooperation and Development Test Guidelines 411 using Good Laboratory Practice. Sprague Dawley rats were randomly divided into eight (one control, one vehicle control, three experimental, and three recovery groups. Different concentrations of ZnO NPs were dermally applied to the rats in the experimental groups for 90 days. Clinical observations as well as weight and food consumption were measured and recorded daily. Hematology and biochemistry parameters were determined. Gross pathologic and histopathologic examinations were performed on selected tissues from all animals. Analyses of tissue were undertaken to determine target organ tissue distribution. There was no increased mortality in the experimental group. Although there

  13. The effect of image quality, repeated study, and assessment method on anatomy learning.

    Science.gov (United States)

    Fenesi, Barbara; Mackinnon, Chelsea; Cheng, Lucia; Kim, Joseph A; Wainman, Bruce C

    2017-06-01

    The use of two-dimensional (2D) images is consistently used to prepare anatomy students for handling real specimen. This study examined whether the quality of 2D images is a critical component in anatomy learning. The visual clarity and consistency of 2D anatomical images was systematically manipulated to produce low-quality and high-quality images of the human hand and human eye. On day 0, participants learned about each anatomical specimen from paper booklets using either low-quality or high-quality images, and then completed a comprehension test using either 2D images or three-dimensional (3D) cadaveric specimens. On day 1, participants relearned each booklet, and on day 2 participants completed a final comprehension test using either 2D images or 3D cadaveric specimens. The effect of image quality on learning varied according to anatomical content, with high-quality images having a greater effect on improving learning of hand anatomy than eye anatomy (high-quality vs. low-quality for hand anatomy P = 0.018; high-quality vs. low-quality for eye anatomy P = 0.247). Also, the benefit of high-quality images on hand anatomy learning was restricted to performance on short-answer (SA) questions immediately after learning (high-quality vs. low-quality on SA questions P = 0.018), but did not apply to performance on multiple-choice (MC) questions (high-quality vs. low-quality on MC questions P = 0.109) or after participants had an additional learning opportunity (24 hours later) with anatomy content (high vs. low on SA questions P = 0.643). This study underscores the limited impact of image quality on anatomy learning, and questions whether investment in enhancing image quality of learning aids significantly promotes knowledge development. Anat Sci Educ 10: 249-261. © 2016 American Association of Anatomists. © 2016 American Association of Anatomists.

  14. Does Repeated Ticking Maintain Tic Behavior? An Experimental Study of Eye Blinking in Healthy Individuals

    Directory of Open Access Journals (Sweden)

    Daniel J. V. Beetsma

    2013-01-01

    Full Text Available Tics in Tourette Syndrome (TS are often preceded by 'premonitory urges': annoying feelings or bodily sensations. We hypothesized that, by reducing annoyance of premonitory urges, tic behaviour may be reinforced. In a 2X2 experimental design in healthy participants, we studied the effects of premonitory urges (operationalized as air puffs on the eye and tic behaviour (deliberate eye blinking after a puff or a sound on changes in subjective evaluation of air puffs, and EMG responses on the m. orbicularis oculi. The experimental group with air puffs+ blinking experienced a decrease in subjective annoyance of the air puff, but habituation of the EMG response was blocked and length of EMG response increased. In the control groups (air puffs without instruction to blink, no air puffs, these effects were absent. When extrapolating to the situation in TS patients, these findings suggest that performance of tics is reinforced by reducing the subjective annoyance of premonitory urges, while simultaneously preventing habituation or even inducing sensitisation of the physiological motor response.

  15. Reported food intake and distribution of body fat: a repeated cross-sectional study

    Directory of Open Access Journals (Sweden)

    Stenlund Hans

    2006-12-01

    Full Text Available Abstract Background Body mass, as well as distribution of body fat, are predictors of both diabetes and cardiovascular disease. In Northern Sweden, despite a marked increase in average body mass, prevalence of diabetes was stagnant and myocardial infarctions decreased. A more favourable distribution of body fat is a possible contributing factor. This study investigates the relative importance of individual food items for time trends in waist circumference (WC and hip circumference (HC on a population level. Methods Independent cross-sectional surveys conducted in 1986, 1990, 1994 and 1999 in the two northernmost counties of Sweden with a common population of 250000. Randomly selected age stratified samples, altogether 2982 men and 3087 women aged 25–64 years. Questionnaires were completed and anthropometric measurements taken. For each food item, associations between frequency of consumption and waist and hip circumferences were estimated. Partial regression coefficients for every level of reported intake were multiplied with differences in proportion of the population reporting the corresponding levels of intake in 1986 and 1999. The sum of these product terms for every food item was the respective estimated impact on mean circumference. Results Time trends in reported food consumption associated with the more favourable gynoid distribution of adipose tissue were increased use of vegetable oil, pasta and 1.5% fat milk. Trends associated with abdominal obesity were increased consumption of beer in men and higher intake of hamburgers and French fried potatoes in women. Conclusion Food trends as markers of time trends in body fat distribution have been identified. The method is a complement to conventional approaches to establish associations between food intake and disease risk on a population level.

  16. Breath acidification in adolescent runners exposed to atmospheric pollution: A prospective, repeated measures observational study

    Directory of Open Access Journals (Sweden)

    Van Sickle David

    2008-03-01

    Full Text Available Abstract Background Vigorous outdoors exercise during an episode of air pollution might cause airway inflammation. The purpose of this study was to examine the effects of vigorous outdoor exercise during peak smog season on breath pH, a biomarker of airway inflammation, in adolescent athletes. Methods We measured breath pH both pre- and post-exercise on ten days during peak smog season in 16 high school athletes engaged in daily long-distance running in a downwind suburb of Atlanta. The association of post-exercise breath pH with ambient ozone and particulate matter concentrations was tested with linear regression. Results We collected 144 pre-exercise and 146 post-exercise breath samples from 16 runners (mean age 14.9 years, 56% male. Median pre-exercise breath pH was 7.58 (interquartile range: 6.90 to 7.86 and did not change significantly after exercise. We observed no significant association between ambient ozone or particulate matter and post-exercise breath pH. However both pre- and post-exercise breath pH were strikingly low in these athletes when compared to a control sample of 14 relatively sedentary healthy adults and to published values of breath pH in healthy subjects. Conclusion Although we did not observe an acute effect of air pollution exposure during exercise on breath pH, breath pH was surprisingly low in this sample of otherwise healthy long-distance runners. We speculate that repetitive vigorous exercise may induce airway acidification.

  17. Toxicity evaluation of zinc aluminium levodopa nanocomposite via oral route in repeated dose study

    Science.gov (United States)

    Kura, Aminu Umar; Cheah, Pike-See; Hussein, Mohd Zobir; Hassan, Zurina; Tengku Azmi, Tengku Ibrahim; Hussein, Nor Fuzina; Fakurazi, Sharida

    2014-05-01

    Nanotechnology, through nanomedicine, allowed drugs to be manipulated into nanoscale sizes for delivery to the different parts of the body, at the same time, retaining the valuable pharmacological properties of the drugs. However, efficient drug delivery and excellent release potential of these delivery systems may be hindered by possible untoward side effects. In this study, the sub-acute toxicity of oral zinc aluminium nanocomposite with and without levodopa was assessed using the Organization for Economic Co-operation and Development guidelines. No sign or symptom of toxicity was observed in orally treated rats with the nanocomposite at 5 and 500 mg/kg concentrations. Body weight gain, feeding, water intake, general survival and organosomatic index were not significantly different between control and treatment groups. Aspartate aminotransferase (AST) in 500 mg/kg levodopa nanocomposite (169 ± 30 U/L), 5 mg/kg levodopa nanocomposite (172 ± 49 U/L), and 500 mg/kg layered double hydroxides (LDH) nanocomposite (175 ± 25 U/L) were notably elevated compared to controls (143 ± 05 U/L); but the difference were not significant ( p > 0.05). However, the differences in aspartate aminotransferase/alanine aminotransferase (AST/ALT) ratio of 500 mg/kg levodopa nanocomposite (0.32 ± 0.12) and 500 mg/kg LDH nanocomposite (0.34 ± 0.12) were statistically significant ( p brain was found to be of similar morphology in both control and experimental groups. The kidneys of 500-mg/kg-treated rats with levodopa nanocomposite and LDH nanocomposite were found to have slight inflammatory changes, notably leukocyte infiltration around the glomeruli. The ultra-structure of the neurons from the substantia nigra of nanocomposite-exposed group was similar to those receiving only normal saline. The observed result has suggested possible liver and renal toxicity in orally administered levodopa intercalated nanocomposite; it is also dose-dependent that needs further assessment.

  18. Understanding how adherence goals promote adherence behaviours: a repeated measure observational study with HIV seropositive patients

    Directory of Open Access Journals (Sweden)

    Jones Gareth

    2012-08-01

    behaviours over and above the effects of the behaviour-specific thinking and ii the relationship between adherence to exercise and to medical treatment is stronger among those with more favourable views about the goal. Results from this study should identify the key contributing factors to inform subsequent adherence research and afford a more streamlined assessment matrix. The project also aims to inform patient care practices. UK Clinical Research Network registration number UKCRN 7842.

  19. A new technique for repeated biopsies of the mammary gland in dairy cows allotted to Latin-square design studies.

    Science.gov (United States)

    de Lima, Luciano S; Martineau, Eric; De Marchi, Francilaine E; Palin, Marie-France; Dos Santos, Geraldo T; Petit, Hélène V

    2016-07-01

    The objective of this study was to develop a technique for carrying out repeated biopsies of the mammary gland of lactating dairy cows that provides enough material to monitor enzyme activities and gene expression in mammary secretory tissue. A total of 16 Holstein cows were subjected to 4 mammary biopsies each at 3-week intervals for a total of 64 biopsies. A 0.75-cm incision was made through the skin and subcutaneous tissue of the mammary gland and a trocar and cannula were inserted using a circular motion. The trocar was withdrawn and a syringe was plugged into the base of the cannula to create a vacuum for sampling mammary tissue. To reduce bleeding, hand pressure was put on the surgery site after biopsy and skin closure and ice was applied for at least 2 h after the biopsy using a cow bra. The entire procedure took an average of 25 min. Two attempts were usually enough to obtain 800 mg of tissue. Visual examination of milk samples 10 d after the biopsy indicated no trace of blood, except in samples from 2 cows. All wounds healed without infection and subcutaneous hematomas resorbed within 7 d. There was no incidence of mastitis throughout the lactation. This technique provides a new tool for biopsy of the mammary gland repeated at short intervals with the main effect being a decrease in milk production. Although secondary complications leading to illness or death are always a risk with any procedure, this biopsy technique was carried out without complications to the health of animals and with no incidence of mastitis during the lactation.

  20. Effects of Cold Water Immersion on Muscle Oxygenation During Repeated Bouts of Fatiguing Exercise: A Randomized Controlled Study.

    Science.gov (United States)

    Yeung, Simon S; Ting, Kin Hung; Hon, Maurice; Fung, Natalie Y; Choi, Manfi M; Cheng, Juno C; Yeung, Ella W

    2016-01-01

    Postexercise cold water immersion has been advocated to athletes as a means of accelerating recovery and improving performance. Given the effects of cold water immersion on blood flow, evaluating in vivo changes in tissue oxygenation during cold water immersion may help further our understanding of this recovery modality. This study aimed to investigate the effects of cold water immersion on muscle oxygenation and performance during repeated bouts of fatiguing exercise in a group of healthy young adults. Twenty healthy subjects performed 2 fatiguing bouts of maximal dynamic knee extension and flexion contractions both concentrically on an isokinetic dynamometer with a 10-min recovery period in between. Subjects were randomly assigned to either a cold water immersion (treatment) or passive recovery (control) group. Changes in muscle oxygenation were monitored continuously using near-infrared spectroscopy. Muscle performance was measured with isokinetic dynamometry during each fatiguing bout. Skin temperature, heart rate, blood pressure, and muscle soreness ratings were also assessed. Repeated measures ANOVA analysis was used to evaluate treatment effects. The treatment group had a significantly lower mean heart rate and lower skin temperature compared to the control group (P Cold water immersion attenuated a reduction in tissue oxygenation in the second fatiguing bout by 4% when compared with control. Muscle soreness was rated lower 1 day post-testing (P cold water immersion had no significant effect on muscle performance in subsequent exercise. As the results show that cold water immersion attenuated decreased tissue oxygenation in subsequent exercise performance, the metabolic response to exercise after cold water immersion is worthy of further exploration.

  1. High-Throughput Mycobacterial Interspersed Repetitive-Unit–Variable-Number Tandem-Repeat Genotyping for Mycobacterium tuberculosis Epidemiological Studies

    Science.gov (United States)

    Bidault, Floriane; Mosnier, Amandine; Bablishvili, Nino; Tukvadze, Nestani; Somphavong, Silaphet; Paboriboune, Phimpha; Ocheretina, Oksana; Pape, Jean William; Paranhos-Baccala, Glaucia; Berland, Jean-Luc

    2014-01-01

    The emergence of drug-resistant forms of tuberculosis (TB) represents a major public health concern. Understanding the transmission routes of the disease is a key factor for its control and for the implementation of efficient interventions. Mycobacterial interspersed repetitive-unit–variable-number tandem-repeat (MIRU-VNTR) marker typing is a well-described method for lineage identification and transmission tracking. However, the conventional manual genotyping technique is cumbersome and time-consuming and entails many risks for errors, thus hindering its implementation and dissemination. We describe here a new approach using the QIAxcel system, an automated high-throughput capillary electrophoresis system that also carries out allele calling. This automated method was assessed on 1,824 amplicons from 82 TB isolates and tested with sets of markers of 15 or 24 loci. Overall allele-calling concordance between the methods from 140 to 1,317 bp was 98.9%. DNA concentrations and repeatability and reproducibility performances showed no biases in allele calling. Furthermore, turnaround time using this automated system was reduced by 81% compared to the conventional manual agarose gel method. In sum, this new automated method facilitates MIRU-VNTR genotyping and provides reliable results. Therefore, it is well suited for field genotyping. The implementation of this method will help to achieve accurate and cost-effective epidemiological studies, especially in countries with a high prevalence of TB, where the high number of strains complicates the surveillance of circulating lineages and requires efficient interventions to be carried out in an urgent manner. PMID:25428144

  2. Huntington CAG repeat size does not modify onset age in familial Parkinson’s disease: The GenePD Study

    Science.gov (United States)

    McNicoll, Christopher F.; Latourelle, Jeanne C.; MacDonald, Marcy E.; Lew, Mark F.; Suchowersky, Oksana; Klein, Christine; Golbe, Lawrence I.; Mark, Margery H.; Growdon, John H.; Wooten, G. Frederick; Watts, Ray L.; Guttman, Mark; Racette, Brad A.; Perlmutter, Joel S.; Ahmed, Anwar; Shill, Holly A.; Singer, Carlos; Saint-Hilaire, Marie H.; Massood, Tiffany; Huskey, Karen W.; DeStefano, Anita L.; Gillis, Tammy; Mysore, Jayalakshmi; Goldwurm, Stefano; Pezzoli, Gianni; Baker, Kenneth B.; Itin, Ilia; Litvan, Irene; Nicholson, Garth; Corbett, Alastair; Nance, Martha; Drasby, Edward; Isaacson, Stuart; Burn, David J.; Chinnery, Patrick F.; Pramstaller, Peter P.; Al-hinti, Jomana; Moller, Anette T.; Ostergaard, Karen; Sherman, Scott J.; Roxburgh, Richard; Snow, Barry; Slevin, John T.; Cambi, Franca; Gusella, James F.; Myers, Richard H.

    2009-01-01

    The ATP/ADP ratio reflects mitochondrial function and has been reported to be influenced by the size of the Huntington disease gene (HD) repeat. Impaired mitochondrial function has long been implicated in the pathogenesis of Parkinson’s disease (PD) and therefore, we evaluated the relationship of the HD CAG repeat size to PD onset age in a large sample of familial PD cases. PD affected siblings (n=495) with known onset ages from 248 families, were genotyped for the HD CAG repeat. Genotyping failed in 11 cases leaving 484 for analysis, including 35 LRRK2 carriers. All cases had HD CAG repeats (range 15 to 34) below the clinical range for HD, although 5.2 percent of the sample (n=25) had repeats in the intermediate range (the intermediate range lower limit=27; upper limit=35 repeats), suggesting that the prevalence of intermediate allele carriers in the general population is significant. No relation between the HD CAG repeat size and the age at onset for PD was found in this sample of familial PD. PMID:18649400

  3. Repeat spinal anesthesia in cesarean section: A comparison between 10 mg and 12 mg doses of intrathecal hyperbaric (0.05%) bupivacaine repeated after failed spinal anesthesia: A prospective, parallel group study.

    Science.gov (United States)

    Bhar, Debasish; RoyBasunia, Sandip; Das, Anjan; Chhaule, Subinay; Mondal, Sudipta Kumar; Bisai, Subrata; Chattopadhyay, Surajit; Mandal, Subrata Kumar

    2016-01-01

    Spinal anesthesia for cesarean section is not a 100% successful technique. At times, despite straightforward insertion and drug administration, intrathecal anesthesia for cesarean section fails to obtain any sensory or motor block. Very few studies and literature are available regarding repeat administration of spinal anesthesia and its drug dosage, especially after first spinal failure in cesarean section lower segment cesarean section (LSCS) due to fear of the excessive spread of drug. The aim of our study is to compare the outcome between two different doses of 0.5% hyperbaric bupivacaine repeated intrathecally after failed spinal. After taking informed consent and Ethical Committee approval this prospective, randomized single-blinded study was conducted in 100 parturients of American Society of Anesthesiologists I-II who were posted for elective LSCS and had Bromage score 0 and no sensory block even at L4 dermatome after 10 min of first spinal anesthesia; were included in the study. Group A (n = 50) patients received 2.4 ml and Group B (n = 50) patients received 2 ml of 0.5% hyperbaric bupivacaine respectively for administering repeat spinal anesthesia. Heart rate (HR), systolic blood pressure (SBP), diastolic blood pressure (DBP), oxygen saturation, respiratory rate and electrocardiogram were monitored both intra- and post-operatively and complications were recorded. Incidence of high spinal, bradycardia, hypotension, respiratory complications, and nausea vomiting are significantly higher in Group A compared to Group B (P cesarean section with 10 mg of 0.5% hyperbaric bupivacaine provided after first spinal anesthesia, the level of sensory block is below L4 and motor power in Bromage scale is 0.

  4. Risk factors for complications in donors at first and repeat whole blood donation: a cohort study with assessment of the impact on donor return.

    Science.gov (United States)

    Wiersum-Osselton, Johanna C; Marijt-van der Kreek, Tanneke; Brand, Anneke; Veldhuizen, Ingrid; van der Bom, Johanna G; de Kort, Wim

    2014-01-01

    First-time donation is among recognised risk factors for vasovagal reactions to blood donation and reactions are known to reduce donor return. We assessed associations between potential risk factors and vasovagal reactions and needle-related complications in first-time whole blood donation in comparison to repeat donation and analysed the impact of complications on donor return. We performed a cohort study on whole blood donations in The Netherlands from 1/1/2010 to 31/12/2010 using data extracted from the blood service information system. Donation data up to 31/12/2011 were used to ascertain donor return. In 2010 28,786 donors made first whole blood donations and there were 522,958 repeat donations. Vasovagal reactions occurred in 3.9% of first donations by males and 3.5% of first donations by females compared to in 0.2% and 0.6%, respectively, of repeat donations. Associations of vasovagal reactions with other factors including age, body weight, systolic and diastolic blood pressure were similar in first-time and repeat donors. Needle-related complications occurred in 0.2% of male and 0.5% of female first-time donations and in 0.1% and 0.3%, respectively, of repeat donations. Among first-time donors, the return rate within 1 year was 82% following an uncomplicated first donation, but 55% and 61% following vasovagal reactions and needle-related complications, respectively; the corresponding percentages among repeat donors were 86%, 58% and 82%. Among first-time donors, females suffered less than males from vasovagal reactions. Other risk factors had similar associations among first-time and repeat donors. Vasovagal reactions and needle-related complications in both first-time and repeat donors are followed by reduced donor return.

  5. Application of transrectal ultrasound-guided repeat needle biopsy in the diagnosis of prostate cancer in Chinese population: A retrospective study

    Directory of Open Access Journals (Sweden)

    Yi Wang

    2016-01-01

    Full Text Available Background: Transrectal ultrasound-guided repeat needle biopsy (TUGRNB is widely used for diagnosis of prostate cancer (PCa. However, significance of TUGRNB in Chinese population was rarely reported. A retrospective study was conducted to evaluate the significance of TUGRNB applied in prediction of PCa in Chinese population. Materials and Methods: A total of 960 from January 2009 to December 2012 were included. Repeat needle biopsy rate and PCa positive detection rate were evaluated. Relationship between prostate specific antigen (PSA levels and PCa positive rates was analyzed. Results: PCa positive detection rate after initial needle biopsy was 28.4%, which was lower than the rate of repeat needle biopsy (40%. The rate for immediate transurethral resection (TUR, surgery after initial needle biopsy, was 27.1%, however with a low PCa positive detection rate (0.66%. The repeat needle biopsy rate was lower compared with the initial biopsy rate (P 20 ng/ml, PCa positive rate was significantly higher than those with PSA < 20 ng/ml (P < 0.05. Conclusion: PCa positive detection rate following repeat needle biopsy in Chinese population was higher, although the repeated needle biopsy rate was still in a low level. TUGRNB should attract more attention in the diagnosis of PCa.

  6. Expansion of protein domain repeats.

    Directory of Open Access Journals (Sweden)

    Asa K Björklund

    2006-08-01

    Full Text Available Many proteins, especially in eukaryotes, contain tandem repeats of several domains from the same family. These repeats have a variety of binding properties and are involved in protein-protein interactions as well as binding to other ligands such as DNA and RNA. The rapid expansion of protein domain repeats is assumed to have evolved through internal tandem duplications. However, the exact mechanisms behind these tandem duplications are not well-understood. Here, we have studied the evolution, function, protein structure, gene structure, and phylogenetic distribution of domain repeats. For this purpose we have assigned Pfam-A domain families to 24 proteomes with more sensitive domain assignments in the repeat regions. These assignments confirmed previous findings that eukaryotes, and in particular vertebrates, contain a much higher fraction of proteins with repeats compared with prokaryotes. The internal sequence similarity in each protein revealed that the domain repeats are often expanded through duplications of several domains at a time, while the duplication of one domain is less common. Many of the repeats appear to have been duplicated in the middle of the repeat region. This is in strong contrast to the evolution of other proteins that mainly works through additions of single domains at either terminus. Further, we found that some domain families show distinct duplication patterns, e.g., nebulin domains have mainly been expanded with a unit of seven domains at a time, while duplications of other domain families involve varying numbers of domains. Finally, no common mechanism for the expansion of all repeats could be detected. We found that the duplication patterns show no dependence on the size of the domains. Further, repeat expansion in some families can possibly be explained by shuffling of exons. However, exon shuffling could not have created all repeats.

  7. Repeat induced abortion - a matter of individual behaviour or societal factors? A cross-sectional study among Swedish women.

    Science.gov (United States)

    Makenzius, Marlene; Tydén, Tanja; Darj, Elisabeth; Larsson, Margareta

    2011-10-01

    Almost 40% of all induced abortions in Sweden are repeat abortions; little is known about the risk factors. To investigate differences between women who had a first-time abortion and those with repeat abortion, and to identify factors associated with repeat abortion. A questionnaire was answered by 798 abortion-seeking women in Sweden during 2009. A regression model was used to assess risk factors for repeat abortions. In the age range 20-49 years, 41% of women had experienced at least one previous abortion. Risk factors for repeat abortion were parity (OR 2.57), lack of emotional support (OR 2.09), unemployment or sick leave (OR 1.65), tobacco use (OR 1.56), and low educational level (OR 1.5). Some women (n = 55) considered economic support and work opportunities could have enabled them to continue the pregnancy. Increased Sex and Relationship Education (SRE), easy access to high-quality contraception and counselling, were suggested (n = 86) as interventions for preventing unintended pregnancies. Even in a country with long established SRE and a public health policy to enhance sexual and reproductive health over a third of women requesting abortion have experienced one previously and the rate is maintained. Some specific factors are identified but, overall, a picture of vulnerability among women seeking repeat abortion stands out that needs to be considered in the prevention of unintended pregnancies.

  8. Decision-to-Delivery Time Intervals in Emergency Caesarean Section Cases: Repeated cross-sectional study from Oman.

    Science.gov (United States)

    Tashfeen, Kaukab; Patel, Malini; Hamdi, Ilham M; Al-Busaidi, Ibrahim H A; Al-Yarubi, Mansour N

    2017-02-01

    In cases of fetal intolerance to labour, meeting the standard decision-to-delivery time interval (DDI) of ≤30 minutes is challenging. This study aimed to assess DDIs in emergency Caesarean section (CS) cases to identify factors causing DDI delays and the impact of a delayed DDI on perinatal outcomes. This repeated cross-sectional study included all emergency CS procedures performed due to acute fetal distress, antepartum haemorrhage or umbilical cord prolapse at the Nizwa Hospital, Nizwa, Oman. Three audit cycles of three months each were conducted between April 2011 and June 2013, including an initial retrospective cycle and two prospective cycles following the implementation of improvement strategies to address factors causing DDI delays. Poor perinatal outcomes were defined as Apgar scores of 60 minutes was significantly associated with poor neonatal outcomes in terms of increased SCBU admissions and low Apgar scores (P <0.001 each). Factors causing DDI delays included obtaining consent for the CS procedure, a lack of operating theatre availability and moving patients to the operating theatre. The identification of factors causing DDI delays may provide opportunities to improve perinatal outcomes.

  9. Decision-to-Delivery Time Intervals in Emergency Caesarean Section Cases; Repeated cross-sectional study from Oman

    Directory of Open Access Journals (Sweden)

    Kaukab Tashfeen

    2017-03-01

    Full Text Available Objectives: In cases of fetal intolerance to labour, meeting the standard decision-to-delivery time interval (DDI of ≤30 minutes is challenging. This study aimed to assess DDIs in emergency Caesarean section (CS cases to identify factors causing DDI delays and the impact of a delayed DDI on perinatal outcomes. Methods: This repeated cross-sectional study included all emergency CS procedures performed due to acute fetal distress, antepartum haemorrhage or umbilical cord prolapse at the Nizwa Hospital, Nizwa, Oman. Three audit cycles of three months each were conducted between April 2011 and June 2013, including an initial retrospective cycle and two prospective cycles following the implementation of improvement strategies to address factors causing DDI delays. Poor perinatal outcomes were defined as Apgar scores of 60 minutes was significantly associated with poor neonatal outcomes in terms of increased SCBU admissions and low Apgar scores (P <0.001 each. Factors causing DDI delays included obtaining consent for the CS procedure, a lack of operating theatre availability and moving patients to the operating theatre. Conclusion: The identification of factors causing DDI delays may provide opportunities to improve perinatal outcomes.

  10. First worldwide proficiency study on variable-number tandem-repeat typing of Mycobacterium tuberculosis complex strains.

    Science.gov (United States)

    de Beer, Jessica L; Kremer, Kristin; Ködmön, Csaba; Supply, Philip; van Soolingen, Dick

    2012-03-01

    Although variable-number tandem-repeat (VNTR) typing has gained recognition as the new standard for the DNA fingerprinting of Mycobacterium tuberculosis complex (MTBC) isolates, external quality control programs have not yet been developed. Therefore, we organized the first multicenter proficiency study on 24-locus VNTR typing. Sets of 30 DNAs of MTBC strains, including 10 duplicate DNA samples, were distributed among 37 participating laboratories in 30 different countries worldwide. Twenty-four laboratories used an in-house-adapted method with fragment sizing by gel electrophoresis or an automated DNA analyzer, nine laboratories used a commercially available kit, and four laboratories used other methods. The intra- and interlaboratory reproducibilities of VNTR typing varied from 0% to 100%, with averages of 72% and 60%, respectively. Twenty of the 37 laboratories failed to amplify particular VNTR loci; if these missing results were ignored, the number of laboratories with 100% interlaboratory reproducibility increased from 1 to 5. The average interlaboratory reproducibility of VNTR typing using a commercial kit was better (88%) than that of in-house-adapted methods using a DNA analyzer (70%) or gel electrophoresis (50%). Eleven laboratories using in-house-adapted manual typing or automated typing scored inter- and intralaboratory reproducibilities of 80% or higher, which suggests that these approaches can be used in a reliable way. In conclusion, this first multicenter study has documented the worldwide quality of VNTR typing of MTBC strains and highlights the importance of international quality control to improve genotyping in the future.

  11. Nifty Nines and Repeating Decimals

    Science.gov (United States)

    Brown, Scott A.

    2016-01-01

    The traditional technique for converting repeating decimals to common fractions can be found in nearly every algebra textbook that has been published, as well as in many precalculus texts. However, students generally encounter repeating decimal numerals earlier than high school when they study rational numbers in prealgebra classes. Therefore, how…

  12. Nifty Nines and Repeating Decimals

    Science.gov (United States)

    Brown, Scott A.

    2016-01-01

    The traditional technique for converting repeating decimals to common fractions can be found in nearly every algebra textbook that has been published, as well as in many precalculus texts. However, students generally encounter repeating decimal numerals earlier than high school when they study rational numbers in prealgebra classes. Therefore, how…

  13. Repeat-until-success quantum repeaters

    Science.gov (United States)

    Bruschi, David Edward; Barlow, Thomas M.; Razavi, Mohsen; Beige, Almut

    2014-09-01

    We propose a repeat-until-success protocol to improve the performance of probabilistic quantum repeaters. Conventionally, these rely on passive static linear-optics elements and photodetectors to perform Bell-state measurements (BSMs) with a maximum success rate of 50%. This is a strong impediment for entanglement swapping between distant quantum memories. Every time a BSM fails, entanglement needs to be redistributed between the corresponding memories in the repeater link. The key ingredients of our scheme are repeatable BSMs. Under ideal conditions, these turn probabilistic quantum repeaters into deterministic ones. Under realistic conditions, our protocol too might fail. However, using additional threshold detectors now allows us to improve the entanglement generation rate by almost orders of magnitude, at a nominal distance of 1000 km, compared to schemes that rely on conventional BSMs. This improvement is sufficient to make the performance of our scheme comparable to the expected performance of some deterministic quantum repeaters.

  14. Collaborative work on evaluation of ovarian toxicity. 2) Two- or four-week repeated dose studies and fertility study of mifepristone in female rats.

    Science.gov (United States)

    Tamura, Toru; Yokoi, Ryohei; Okuhara, Yuji; Harada, Chiho; Terashima, Yukari; Hayashi, Morimichi; Nagasawa, Tatsuya; Onozato, Tomoya; Kobayashi, Kazuo; Kuroda, Junji; Kusama, Hiroshi

    2009-01-01

    In order to assess ovarian pathological changes and their relationship to changes in female fertility parameters, mifepristone, a progesterone receptor antagonist, was selected as the test article and was administered orally to female rats at dose levels of 0, 0.8, 4, 20 and 100 mg/kg for 2 or 4 weeks in repeated dose-toxicity studies and in a female fertility study at dose levels of 0, 0.8, 4 and 20 mg/kg from > 2 weeks before copulation to postcoital day 7. In the repeated dose toxicity studies, persistent estrus was seen in the vaginal smears, and multiple cysts in the ovaries at necropsy, increases in luteinized cysts and hypertrophy of previously formed corpora lutea were observed in the histopathological examination of ovaries in rats receiving 20 mg/kg or more for 2 or 4 weeks. In female fertility studies, persistent vaginal cornification was also observed at 20 mg/kg and the precoital interval was significantly shortened. All of the animals were completely infertile when dosed with 20 mg/kg during the post-coital period. An increase in pre-implantation losses was observed in the animals treated with 20 mg/kg during the pre-coital phase, while treatment with 4 mg/kg mifepristone during the post-coital phase induced an increase in post-implantation losses. These results suggested that a 2-week administration period would be sufficient to detect the ovarian toxicity of mifepristone in repeated dose toxicity study and the pathological findings in the ovaries would reflect the alterations in female reproductive endpoints in the female fertility study.

  15. Inter-Simple Sequence Repeat (ISSR Markers to Study Genetic Diversity Among Cotton Cultivars in Associated with Salt Tolerance

    Directory of Open Access Journals (Sweden)

    Ali Akbar ABDI

    2012-11-01

    Full Text Available Developing salt-tolerant crops is very important as a significant proportion of cultivated land is salt-affected. Screening and selection of salt tolerant genotypes of cotton using DNA molecular markers not only introduce tolerant cultivars useful for hybridization and breeding programs but also detect DNA regions involved in mechanism of salinity tolerance. To study this, 28 cotton cultivars, including 8 Iranian cotton varieties were grown in pots under greenhouse condition and three salt treatments were imposed with salt solutions (0, 70 and 140 mM NaCl. Eight agronomic traits including root length, root fresh weight, root dry weight, chlorophyll and fluorescence index, K+ and Na+ contents in shoot (above ground biomass, and K+/Na+ ratio were measured. Cluster analysis of cultivars based on measured agronomic traits, showed �Cindose� and �Ciacra� as the most tolerant cultivars, and �B-557� and �43347� as the most sensitive cultivars of salt damage. A total of 65 polymorphic DNA fragments were generated at 14 inter-simple sequence repeat (ISSR loci. Plants of 28 cultivars of cotton grouped into three clusters based on ISSR markers. Regression analysis of markers in relation with traits data showed that 23, 33 and 30 markers associated with the measured traits in three salt treatments respectively. These markers might help breeders in any marker assisted selection program in order to improving cotton cultivars against salt stress.

  16. Are diagnostic criteria for acute malnutrition affected by hydration status in hospitalized children? A repeated measures study

    Directory of Open Access Journals (Sweden)

    Fegan Gregory

    2011-09-01

    Full Text Available Abstract Introduction Dehydration and malnutrition commonly occur together among ill children in developing countries. Dehydration (change in total body water is known to alter weight. Although muscle tissue has high water content, it is not known whether mid-upper arm circumference (MUAC may be altered by changes in tissue hydration. We aimed to determine whether rehydration alters MUAC, MUAC Z score (MUACz, weight-for-length Z-score (WFLz and classification of nutritional status among hospitalised Kenyan children admitted with signs of dehydration. Study procedure We enrolled children aged from 3 months to 5 years admitted to a rural Kenyan district hospital with clinical signs compatible with dehydration, and without kwashiorkor. Anthropometric measurements were taken at admission and repeated after 48 hours of treatment, which included rehydration by WHO protocols. Changes in weight observed during this period were considered to be due to changes in hydration status. Results Among 325 children (median age 11 months the median weight gain (rehydration after 48 hours was 0.21 kg, (an increase of 2.9% of admission body weight. Each 1% change in weight was associated with a 0.40 mm (95% CI: 0.30 to 0.44 mm, p Conclusion MUAC is less affected by dehydration than WFLz and is therefore more suitable for nutritional assessment of ill children. However, both WFLz and MUAC misclassify SAM among dehydrated children. Nutritional status should be re-evaluated following rehydration, and management adjusted accordingly.

  17. A Study for the Characteristic Changes Under the Repeated Thermal Exposure in the Process of Repairing Aircraft Sandwich Structures

    Science.gov (United States)

    Kim, Yun Hae; Han, Joong Won; Kim, Don Won; Choi, Byung Keun; Murakami, R.

    Delamination can be observed in the sound areas during and/or after a couple times exposure to the elevated curing temperature due to the repeated repair condition. This study was conducted for checking the degree of degradation of properties of the cured parts and delamination between skin prepreg and honeycomb core. Specimens with glass honeycomb sandwich construction and glass/epoxy prepreg were prepared. The specimens were cured 1 to 5 times at 260°F in an autoclave and each additionally exposed 50, 100 and 150 hours in the 260°F oven. Each specimen was tested for tensile strength, compressive strength, flatwise tensile strength and interlaminar shear strength. To monitor the characteristics of the resin itself, the cured resin was tested using DMA and DSC. As a results, the decrease of Tg value were observed in the specific specimen which is exposed over 50 hrs at 260°F. This means the change or degradative of resin properties is also related to the decrease of flatwise tensile properties. Accordingly, minimal exposure on the curing temperature is recommended for parts in order to prevent the delation and maintain the better condition.

  18. Public perception of drinking water safety in South Africa 2002–2009: a repeated cross-sectional study

    Directory of Open Access Journals (Sweden)

    Wright Jim A

    2012-07-01

    Full Text Available Abstract Background In low and middle income countries, public perceptions of drinking water safety are relevant to promotion of household water treatment and to household choices over drinking water sources. However, most studies of this topic have been cross-sectional and not considered temporal variation in drinking water safety perceptions. The objective of this study is to explore trends in perceived drinking water safety in South Africa and its association with disease outbreaks, water supply and household characteristics. Methods This repeated cross-sectional study draws on General Household Surveys from 2002–2009, a series of annual nationally representative surveys of South African households, which include a question about perceived drinking water safety. Trends in responses to this question were examined from 2002–2009 in relation to reported cholera cases. The relationship between perceived drinking water safety and organoleptic qualities of drinking water, supply characteristics, and socio-economic and demographic household characteristics was explored in 2002 and 2008 using hierarchical stepwise logistic regression. Results The results suggest that perceived drinking water safety has remained relatively stable over time in South Africa, once the expansion of improved supplies is controlled for. A large cholera outbreak in 2000–02 had no apparent effect on public perception of drinking water safety in 2002. Perceived drinking water safety is primarily related to water taste, odour, and clarity rather than socio-economic or demographic characteristics. Conclusion This suggests that household perceptions of drinking water safety in South Africa follow similar patterns to those observed in studies in developed countries. The stability over time in public perception of drinking water safety is particularly surprising, given the large cholera outbreak that took place at the start of this period.

  19. Contributions by the CAG-repeat Polymorphism of the Androgen Receptor Gene and Circulating Androgens to Muscle Size. Odense Androgen Study - A Population-based Study of 20-29 Year-old Danish Men

    DEFF Research Database (Denmark)

    Nielsen, Torben Leo; Hagen, Claus; Wraae, Kristian;

    2007-01-01

    Context: The number of CAG-repeats within the CAG-repeat polymorphism of the androgen receptor gene is inversely correlated with the transcriptional activity of the androgen receptor. Objective: To study the effect of the CAG-repeat number and circulating androgens on muscle size, to examine......-repeat number correlated inversely with thigh and axial muscle area and with lower and upper extremity lean body mass. Except for upper extremity lean body mass, these findings remained significant in multivariate analyses controlling for circulating androgens, physical activity, smoking, alcohol intake...

  20. Repeated Insulin-like Growth Factor 1 (IGF1 treatment in a patient with Rett Syndrome: a single case study

    Directory of Open Access Journals (Sweden)

    Giorgio ePini

    2014-06-01

    Full Text Available Rett syndrome (RTT is a devastating neurodevelopmental disorder that has no cure. Patients show regression of acquired skills, motor and speech impairment, cardio-respiratory distress, microcephaly and stereotyped hand movements. The majority of RTT patients display mutations in the gene that codes for the Methyl-CpG binding protein 2 (MeCP2, which is involved in the development of the central nervous system, especially synaptic and circuit maturation. Thus, agents that promote brain development and synaptic function are good candidates for ameliorating the symptoms of RTT. In particular, Insulin-like growth Factor 1 (IGF1 and its active peptide (1-3IGF1 cross the Blood Brain Barrier, and therefore are ideal treatments for RTT Indeed, both (1-3IGF1 and IGF1 treatment significantly ameliorates RTT symptoms in a mouse model of the disease In a previous study we established that IGF1 is safe and well tolerated on Rett patients. In this open label clinical case study, we assess the safety and tolerability of IGF1 administration in two cycles of the treatment. Before and after each cycle we monitored the clinical and blood parameters, autonomic function and social and cognitive abilities, and we found that IGF1 was well tolerated each time and did not induce any side effect, nor it interfered with the other treatments that the patient was undergoing. We noticed a moderate improvement in the cognitive, social and autonomic abilities of the patient after each cycle but the benefits were not retained between the two cycles, consistent with the preclinical observation that treatments for RTT should be administered through life. We find that repeated IGF1 treatment is safe and well tolerated in Rett patients but observed effects are not retained between cycles. These results have applications to other pathologies considering that IGF1 has been shown to be effective in other disorders of the autism spectrum.

  1. Repeated insulin-like growth factor 1 treatment in a patient with rett syndrome: a single case study.

    Science.gov (United States)

    Pini, Giorgio; Scusa, M Flora; Benincasa, Alberto; Bottiglioni, Ilaria; Congiu, Laura; Vadhatpour, Cyrus; Romanelli, Anna Maria; Gemo, Ilaria; Puccetti, Chetti; McNamara, Rachel; O'Leary, Seán; Corvin, Aiden; Gill, Michael; Tropea, Daniela

    2014-01-01

    Rett syndrome (RTT) is a devastating neurodevelopmental disorder that has no cure. Patients show regression of acquired skills, motor, and speech impairment, cardio-respiratory distress, microcephaly, and stereotyped hand movements. The majority of RTT patients display mutations in the gene that codes for the Methyl-CpG binding protein 2 (MeCP2), which is involved in the development of the central nervous system, especially synaptic and circuit maturation. Thus, agents that promote brain development and synaptic function are good candidates for ameliorating the symptoms of RTT. In particular, insulin-like growth factor 1 (IGF1) and its active peptide (1-3) IGF1 cross the Blood Brain Barrier, and therefore are ideal treatments for RTT Indeed, both (1-3) IGF1 and IGF1 treatment significantly ameliorates RTT symptoms in a mouse model of the disease In a previous study, we established that IGF1 is safe and well tolerated on Rett patients. In this open label clinical case study, we assess the safety and tolerability of IGF1 administration in two cycles of the treatment. Before and after each cycle, we monitored the clinical and blood parameters, autonomic function, and social and cognitive abilities, and we found that IGF1 was well tolerated each time and did not induce any side effect, nor it interfered with the other treatments that the patient was undergoing. We noticed a moderate improvement in the cognitive, social, and autonomic abilities of the patient after each cycle but the benefits were not retained between the two cycles, consistent with the pre-clinical observation that treatments for RTT should be administered through life. We find that repeated IGF1 treatment is safe and well tolerated in Rett patients but observed effects are not retained between cycles. These results have applications to other pathologies considering that IGF1 has been shown to be effective in other disorders of the autism spectrum.

  2. Intermediate CAG repeat expansion in the ATXN2 gene is a unique genetic risk factor for ALS--a systematic review and meta-analysis of observational studies.

    Directory of Open Access Journals (Sweden)

    Ming-Dong Wang

    Full Text Available Amyotrophic lateral sclerosis (ALS is a rare degenerative condition of the motor neurons. Over 10% of ALS cases are linked to monogenic mutations, with the remainder thought to be due to other risk factors, including environmental factors, genetic polymorphisms, and possibly gene-environmental interactions. We examined the association between ALS and an intermediate CAG repeat expansion in the ATXN2 gene using a meta-analytic approach. Observational studies were searched with relevant disease and gene terms from MEDLINE, EMBASE, and PsycINFO from January 2010 through to January 2014. All identified articles were screened using disease terms, gene terms, population information, and CAG repeat information according to PRISMA guidelines. The final list of 17 articles was further evaluated based on the study location, time period, and authors to exclude multiple usage of the same study populations: 13 relevant articles were retained for this study. The range 30-33 CAG repeats in the ATXN2 gene was most strongly associated with ALS. The meta-analysis revealed that the presence of an intermediate CAG repeat (30-33 in the ATXN2 gene was associated with an increased risk of ALS [odds ratio (OR = 4.44, 95%CI: 2.91-6.76] in Caucasian ALS patients. There was no significant difference in the association of this CAG intermediate repeat expansion in the ATXN2 gene between familial ALS cases (OR = 3.59, 1.58-8.17 and sporadic ALS cases (OR = 3.16, 1.88-5.32. These results indicate that the presence of intermediate CAG repeat expansion in the ATXN2 gene is a specific genetic risk factor for ALS, unlike monogenic mutations with an autosomal dominant transmission mode, which cause a more severe phenotype of ALS, with a higher prevalence in familial ALS.

  3. Intermediate CAG repeat expansion in the ATXN2 gene is a unique genetic risk factor for ALS--a systematic review and meta-analysis of observational studies.

    Science.gov (United States)

    Wang, Ming-Dong; Gomes, James; Cashman, Neil R; Little, Julian; Krewski, Daniel

    2014-01-01

    Amyotrophic lateral sclerosis (ALS) is a rare degenerative condition of the motor neurons. Over 10% of ALS cases are linked to monogenic mutations, with the remainder thought to be due to other risk factors, including environmental factors, genetic polymorphisms, and possibly gene-environmental interactions. We examined the association between ALS and an intermediate CAG repeat expansion in the ATXN2 gene using a meta-analytic approach. Observational studies were searched with relevant disease and gene terms from MEDLINE, EMBASE, and PsycINFO from January 2010 through to January 2014. All identified articles were screened using disease terms, gene terms, population information, and CAG repeat information according to PRISMA guidelines. The final list of 17 articles was further evaluated based on the study location, time period, and authors to exclude multiple usage of the same study populations: 13 relevant articles were retained for this study. The range 30-33 CAG repeats in the ATXN2 gene was most strongly associated with ALS. The meta-analysis revealed that the presence of an intermediate CAG repeat (30-33) in the ATXN2 gene was associated with an increased risk of ALS [odds ratio (OR) = 4.44, 95%CI: 2.91-6.76)] in Caucasian ALS patients. There was no significant difference in the association of this CAG intermediate repeat expansion in the ATXN2 gene between familial ALS cases (OR = 3.59, 1.58-8.17) and sporadic ALS cases (OR = 3.16, 1.88-5.32). These results indicate that the presence of intermediate CAG repeat expansion in the ATXN2 gene is a specific genetic risk factor for ALS, unlike monogenic mutations with an autosomal dominant transmission mode, which cause a more severe phenotype of ALS, with a higher prevalence in familial ALS.

  4. A review of the reporting and handling of missing data in cohort studies with repeated assessment of exposure measures

    Directory of Open Access Journals (Sweden)

    Karahalios Amalia

    2012-07-01

    Full Text Available Abstract Background Retaining participants in cohort studies with multiple follow-up waves is difficult. Commonly, researchers are faced with the problem of missing data, which may introduce biased results as well as a loss of statistical power and precision. The STROBE guidelines von Elm et al. (Lancet, 370:1453-1457, 2007; Vandenbroucke et al. (PLoS Med, 4:e297, 2007 and the guidelines proposed by Sterne et al. (BMJ, 338:b2393, 2009 recommend that cohort studies report on the amount of missing data, the reasons for non-participation and non-response, and the method used to handle missing data in the analyses. We have conducted a review of publications from cohort studies in order to document the reporting of missing data for exposure measures and to describe the statistical methods used to account for the missing data. Methods A systematic search of English language papers published from January 2000 to December 2009 was carried out in PubMed. Prospective cohort studies with a sample size greater than 1,000 that analysed data using repeated measures of exposure were included. Results Among the 82 papers meeting the inclusion criteria, only 35 (43% reported the amount of missing data according to the suggested guidelines. Sixty-eight papers (83% described how they dealt with missing data in the analysis. Most of the papers excluded participants with missing data and performed a complete-case analysis (n = 54, 66%. Other papers used more sophisticated methods including multiple imputation (n = 5 or fully Bayesian modeling (n = 1. Methods known to produce biased results were also used, for example, Last Observation Carried Forward (n = 7, the missing indicator method (n = 1, and mean value substitution (n = 3. For the remaining 14 papers, the method used to handle missing data in the analysis was not stated. Conclusions This review highlights the inconsistent reporting of missing data in cohort studies and the continuing

  5. A review of the reporting and handling of missing data in cohort studies with repeated assessment of exposure measures.

    Science.gov (United States)

    Karahalios, Amalia; Baglietto, Laura; Carlin, John B; English, Dallas R; Simpson, Julie A

    2012-07-11

    Retaining participants in cohort studies with multiple follow-up waves is difficult. Commonly, researchers are faced with the problem of missing data, which may introduce biased results as well as a loss of statistical power and precision. The STROBE guidelines von Elm et al. (Lancet, 370:1453-1457, 2007); Vandenbroucke et al. (PLoS Med, 4:e297, 2007) and the guidelines proposed by Sterne et al. (BMJ, 338:b2393, 2009) recommend that cohort studies report on the amount of missing data, the reasons for non-participation and non-response, and the method used to handle missing data in the analyses. We have conducted a review of publications from cohort studies in order to document the reporting of missing data for exposure measures and to describe the statistical methods used to account for the missing data. A systematic search of English language papers published from January 2000 to December 2009 was carried out in PubMed. Prospective cohort studies with a sample size greater than 1,000 that analysed data using repeated measures of exposure were included. Among the 82 papers meeting the inclusion criteria, only 35 (43%) reported the amount of missing data according to the suggested guidelines. Sixty-eight papers (83%) described how they dealt with missing data in the analysis. Most of the papers excluded participants with missing data and performed a complete-case analysis (n=54, 66%). Other papers used more sophisticated methods including multiple imputation (n=5) or fully Bayesian modeling (n=1). Methods known to produce biased results were also used, for example, Last Observation Carried Forward (n=7), the missing indicator method (n=1), and mean value substitution (n=3). For the remaining 14 papers, the method used to handle missing data in the analysis was not stated. This review highlights the inconsistent reporting of missing data in cohort studies and the continuing use of inappropriate methods to handle missing data in the analysis. Epidemiological journals

  6. Duct Leakage Repeatability Testing

    Energy Technology Data Exchange (ETDEWEB)

    Walker, Iain [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Sherman, Max [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2014-01-01

    Duct leakage often needs to be measured to demonstrate compliance with requirements or to determine energy or Indoor Air Quality (IAQ) impacts. Testing is often done using standards such as ASTM E1554 (ASTM 2013) or California Title 24 (California Energy Commission 2013 & 2013b), but there are several choices of methods available within the accepted standards. Determining which method to use or not use requires an evaluation of those methods in the context of the particular needs. Three factors that are important considerations are the cost of the measurement, the accuracy of the measurement and the repeatability of the measurement. The purpose of this report is to evaluate the repeatability of the three most significant measurement techniques using data from the literature and recently obtained field data. We will also briefly discuss the first two factors. The main question to be answered by this study is to determine if differences in the repeatability of these tests methods is sufficient to indicate that any of these methods is so poor that it should be excluded from consideration as an allowed procedure in codes and standards.

  7. Origin and fate of repeats in bacteria.

    Science.gov (United States)

    Achaz, G; Rocha, E P C; Netter, P; Coissac, E

    2002-07-01

    We investigated 53 complete bacterial chromosomes for intrachromosomal repeats. In previous studies on eukaryote chromosomes, we proposed a model for the dynamics of repeats based on the continuous genesis of tandem repeats, followed by an active process of high deletion rate, counteracted by rearrangement events that may prevent the repeats from being deleted. The present study of long repeats in the genomes of Bacteria and Archaea suggests that our model of interspersed repeats dynamics may apply to them. Thus the duplication process might be a consequence of very ancient mechanisms shared by all three domains. Moreover, we show that there is a strong negative correlation between nucleotide composition bias and the repeat density of genomes. We hypothesise that in highly biased genomes, non-duplicated small repeats arise more frequently by random effects and are used as primers for duplication mechanisms, leading to a higher density of large repeats.

  8. ProtRepeatsDB: a database of amino acid repeats in genomes

    Directory of Open Access Journals (Sweden)

    Chauhan Virander S

    2006-07-01

    Full Text Available Abstract Background Genome wide and cross species comparisons of amino acid repeats is an intriguing problem in biology mainly due to the highly polymorphic nature and diverse functions of amino acid repeats. Innate protein repeats constitute vital functional and structural regions in proteins. Repeats are of great consequence in evolution of proteins, as evident from analysis of repeats in different organisms. In the post genomic era, availability of protein sequences encoded in different genomes provides a unique opportunity to perform large scale comparative studies of amino acid repeats. ProtRepeatsDB http://bioinfo.icgeb.res.in/repeats/ is a relational database of perfect and mismatch repeats, access to which is designed as a resource and collection of tools for detection and cross species comparisons of different types of amino acid repeats. Description ProtRepeatsDB (v1.2 consists of perfect as well as mismatch amino acid repeats in the protein sequences of 141 organisms, the genomes of which are now available. The web interface of ProtRepeatsDB consists of different tools to perform repeat s; based on protein IDs, organism name, repeat sequences, and keywords as in FASTA headers, size, frequency, gene ontology (GO annotation IDs and regular expressions (REGEXP describing repeats. These tools also allow formulation of a variety of simple, complex and logical queries to facilitate mining and large-scale cross-species comparisons of amino acid repeats. In addition to this, the database also contains sequence analysis tools to determine repeats in user input sequences. Conclusion ProtRepeatsDB is a multi-organism database of different types of amino acid repeats present in proteins. It integrates useful tools to perform genome wide queries for rapid screening and identification of amino acid repeats and facilitates comparative and evolutionary studies of the repeats. The database is useful for identification of species or organism specific

  9. Twenty-eight-day repeated inhalation toxicity study of nano-sized lanthanum oxide in male sprague-dawley rats.

    Science.gov (United States)

    Shin, Seo-Ho; Lim, Cheol-Hong; Kim, Yong-Soon; Lee, Yong-Hoon; Kim, Sung-Hwan; Kim, Jong-Choon

    2017-04-01

    Although the use of lanthanum has increased in field of high-tech industry worldwide, potential adverse effects to human health and to the environment are largely unknown. The present study aimed to investigate the potential toxicity of nano-sized lanthanum oxide (La2 O3 ) following repeated inhalation exposure in male Sprague-Dawley rats. Male rats were exposed nose-only to nano-sized La2 O3 for 28 days (5 days/week) at doses of 0, 0.5, 2.5, and 10 mg/m(3) . In the experimental period, we evaluated treatment-related changes including clinical signs, body weight, hematology, serum biochemistry, necropsy findings, organ weight, and histopathology findings. We also analyzed lanthanum distribution in the major organs and in the blood, bronchoalveolar lavage fluids (BALF), and oxidative stress in lung tissues. Lanthanum level was highest in lung tissues and showed a dose-dependent relation. Alveolar proteinosis was observed in all treatment groups and was accompanied by an increase in lung weight; moreover, lung inflammation was observed in the 2.5 mg/m(3) and higher dose groups and was accompanied by an increase in white blood cells. In the BALF, total cell counts including macrophages and neutrophils, lactate dehydrogenase, albumin, nitric oxide, and tumor necrosis factor-alpha increased significantly in all treatment groups. Furthermore, these changes tended to deteriorate in the 10 mg/m(3) group at the end of the recovery period. In the present experimental conditions, we found that the lowest-observed-adverse-effect level of nano-sized La2 O3 was 0.5 mg/m(3) in male rats, and the target organ was the lung. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 1226-1240, 2017. © 2016 Wiley Periodicals, Inc.

  10. [C-11]raclopride-PET studies of the Huntington's disease rate of progression : Relevance of the trinucleotide repeat length

    NARCIS (Netherlands)

    Antonini, A; Leenders, KL; Eidelberg, D

    1998-01-01

    We used [C-11]raclopride and positron emission tomography (PET) to assess the relationship between striatal dopamine D2 receptor binding, trinucleotide repeat number (GAG), and subject age in 10 asymptomatic and 8 symptomatic carriers of the Huntington's disease (HD) mutation. In both preclinical an

  11. Pharmacokinetic evaluation of pamidronate after oral administration: a study on dose proportionality, absolute bioavailability, and effect of repeated administration

    DEFF Research Database (Denmark)

    Hyldstrup, Lars; Flesch, G; Hauffe, S A

    1993-01-01

    30 minutes at constant infusion rate. Repeated peroral doses (75 and 150 mg) were administered to 12 females (aged 51-70 years) for 10 consecutive days. Urinary excretion of pamidronate after peroral and i.v. administration was used for estimation of pamidronate absorption. Renal excretion...

  12. Primary and Repeat Cesarean Deliveries: A Population-based Study in the United States, 1979-2010.

    Science.gov (United States)

    Ananth, Cande V; Friedman, Alexander M; Keyes, Katherine M; Lavery, Jessica A; Hamilton, Ava; Wright, Jason D

    2017-07-01

    Despite the temporal increase in cesarean deliveries, the extent to which maternal age, period, and maternal birth cohorts may have contributed to these trends remains unknown. We performed an analysis of 123 million singleton deliveries in the United States (1979-2010). We estimated rate ratio (RR) with 95% confidence interval (CI) for primary and repeat cesarean deliveries. We examined changes in cesarean rates with weighted Poisson regression models across three time-scales: maternal age, year of delivery, and birth cohort (mother's birth year). The primary cesarean rate increased by 68% (95% confidence interval [CI]: 67%, 69%) between 1979 (11.0%) and 2010 (18.5%). Repeat cesarean deliveries increased by 178% (95% CI: 176, 179) from 5.2% in 1979 to 14.4% in 2010. Cesarean rates increased with advancing age. Compared with 1979, the RR for the period effect in primary and repeat cesarean deliveries increased up to 1990, fell to a nadir at 1993, and began to rise thereafter. A small birth cohort effect was evident, with women born before 1950 at increased risk of primary cesarean; no cohort effect was seen for repeat cesarean deliveries. Adjustment for maternal BMI had a small effect on these findings. Period effects in primary cesarean were explained by a combination of trends in obesity and chronic hypertension, as well as demographic shifts over time. Maternal age and period appear to have important contributions to the temporal increase in the cesarean rates, although the effect of parity on these associations remains undetermined.

  13. A Cross-Sectional Study on the Perceptions and Practices of Teenagers With Inflammatory Bowel Disease About Repeated Stool Sampling

    NARCIS (Netherlands)

    Heida, Anke; Dijkstra, Alie; Dantuma, Sietske K.; van Rheenen, Patrick F.

    2016-01-01

    Purpose: Repeated stool sampling to monitor disease activity is increasingly used in teenagers with inflammatory bowel disease (IBD). Knowledge about their perceptions and practices regarding collection of feces will increase the success rate of this monitoring strategy. Methods: We sent a survey to

  14. Repeated administration of D-amphetamine induces loss of [I-123]FP-CIT binding to striatal dopamine transporters in rat brain: a validation study

    NARCIS (Netherlands)

    J. Booij; K. de Bruin; W.B. Gunning

    2006-01-01

    In recent years, several PET and SPECT studies have shown loss of striatal dopamine transporter (DAT) binding in arnphetamine (AMPH) users. However, the use of DAT SPECT tracers to detect AMPH-induced changes in DAT binding has not been validated. We therefore examined if repeated administration of

  15. Prospective study on the determinants of repeat attendance and attendance patterns in breast cancer screening using the Theory of Planned Behaviour

    NARCIS (Netherlands)

    Drossaert, C.H.C.; Boer, H.; Seydel, E.R.

    2003-01-01

    This prospective study, using the Theory of Planned Behaviour (TPB) as a theoretical framework, was carried out to identify the determinants of repeat attendance and attendance patterns in organised breast screening. A group of 2657 women filled out a baseline questionnaire, approximately 8 weeks af

  16. Automatization and familiarity in repeated checking

    NARCIS (Netherlands)

    Dek, Eliane C P; van den Hout, Marcel A.; Giele, Catharina L.; Engelhard, Iris M.

    2014-01-01

    Repeated checking paradoxically increases memory uncertainty. This study investigated the underlying mechanism of this effect. We hypothesized that as a result of repeated checking, familiarity with stimuli increases, and automatization of the checking procedure occurs, which should result in decrea

  17. Reported frequency of physical activity in a large epidemiological study: relationship to specific activities and repeatability over time

    Directory of Open Access Journals (Sweden)

    Reeves Gillian K

    2011-06-01

    Full Text Available Abstract Background How overall physical activity relates to specific activities and how reported activity changes over time may influence interpretation of observed associations between physical activity and health. We examine the relationships between various physical activities self-reported at different times in a large cohort study of middle-aged UK women. Methods At recruitment, Million Women Study participants completed a baseline questionnaire including questions on frequency of strenuous and of any physical activity. About 3 years later 589,896 women also completed a follow-up questionnaire reporting the hours they spent on a range of specific activities. Time spent on each activity was used to estimate the associated excess metabolic equivalent hours (MET-hours and this value was compared across categories of physical activity reported at recruitment. Additionally, 18,655 women completed the baseline questionnaire twice, at intervals of up to 4 years; repeatability over time was assessed using the weighted kappa coefficient (κweighted and absolute percentage agreement. Results The average number of hours per week women reported doing specific activities was 14.0 for housework, 4.5 for walking, 3.0 for gardening, 0.2 for cycling, and 1.4 for all strenuous activity. Time spent and the estimated excess MET-hours associated with each activity increased with increasing frequency of any or strenuous physical activity reported at baseline (tests for trend, P weighted = 0.71 for questionnaires administered less than 6 months apart, and 52% (κweighted = 0.51 for questionnaires more than 2 years apart. Corresponding values for any physical activity were 57% (κweighted = 0.67 and 47% (κweighted = 0.58. Conclusions In this cohort, responses to simple questions on the frequency of any physical activity and of strenuous activity asked at baseline were associated with hours spent on specific activities and the associated estimated excess MET

  18. Collaborative work on evaluation of ovarian toxicity. 17) Two- or four-week repeated-dose studies and fertility study of sulpiride in female rats.

    Science.gov (United States)

    Ishii, Shun-ichiro; Ube, Masayuki; Okada, Miyoko; Adachi, Tamiko; Sugimoto, Jiro; Inoue, Yoshimi; Uno, Yoshifumi; Mutai, Mamoru

    2009-01-01

    To find the appropriate dosing period to detect ovarian toxicity, sulpiride, a D2 antagonist was orally dosed to female rats at dose levels of 1, 10, and 100 mg/kg/day daily for 2 or 4 weeks in repeated-dose toxicity studies. In addition, sulpiride at the same dose levels was given to female rats daily during the pre-mating period, mating period, and Days 0-7 of gestation to assess its effect on fertility. In ovarian histology in the 2-week study, increases in atretic follicle were seen at 1 mg/kg or more and increases in follicular cysts at 10 mg/kg or more. In the 4-week study, these findings were seen at 1 mg/kg or more, and a decrease in large follicles was seen at 10 mg/kg or more. Increased body weight gain was observed at 10 mg/kg or more in the 2- and 4-week studies. The females in these groups exhibited development of mammary alveolus by sulpiride-induced hyperprolactinemia. In the fertility study, sulpiride-treated females showing persistent diestrus resulted in successful mating, and almost all females got pregnant. However, increased implantation loss was observed at 10 mg/kg or more, which was considered to be caused by the adverse effect of sulpiride on oocyte development. From these results, sulpiride-induced ovarian toxicity was seen at 1 mg/kg or more in the 2- and 4-week repeated-dose toxicity studies, and the observed ovarian changes were considered to be related to adverse effects on female fertility.

  19. A Preliminary Study of the Effects of Repeated Massage on Hypothalamic–Pituitary–Adrenal and Immune Function in Healthy Individuals: A Study of Mechanisms of Action and Dosage

    Science.gov (United States)

    Schettler, Pamela; Bresee, Catherine

    2012-01-01

    Abstract Objectives This study gathers preliminary data about the biologic effects of repeated Swedish massage therapy compared to a light-touch control condition. Design The study design was a 5-week comparison of repeated Swedish massage and light touch on oxytocin (OT), arginine-vasopressin (AVP), adrenal corticotropin hormone (ACTH), cortisol (CORT), circulating phenotypic lymphocyte markers, and mitogen-stimulated cytokine function. Setting The setting was an outpatient research unit in an academic medical center. Participants The study subjects were medically and psychiatrically healthy young adults. Intervention The study comprised 45 minutes of Swedish massage or light touch, using highly specified and identical protocols, either weekly or twice weekly for 5 weeks. Outcome measures The outcome measures were mean differences between massage and light touch on OT, AVP, ACTH, CORT, lymphocyte markers, and cytokine levels. Results Compared to the touch control condition, weekly Swedish massage stimulated a sustained pattern of increased circulating phenotypic lymphocyte markers and decreased mitogen-stimulated cytokine production, similar to what was previously reported for a single massage session, while having minimal effect on hypothalamic–pituitary–adrenal function. Twice-weekly massage produced a different response pattern with increased OT levels, decreased AVP, and decreased CORT but little effect on circulating lymphocyte phenotypic markers and a slight increase in mitogen-stimulated interferon-γ, tumor necrosis factor-α, interleukin (IL)-1b and IL-2 levels, suggesting increased production of pro-inflammatory cytokines. Conclusions There are sustained cumulative biologic actions for the massage and touch interventions that persist for several days or a week, and these differ profoundly depending on the dosage (frequency) of sessions. Confirmatory studies in larger samples are needed. PMID:22775448

  20. Beverage Intake Assessment Questionnaire: Relative Validity and Repeatability in a Spanish Population with Metabolic Syndrome from the PREDIMED-PLUS Study

    Science.gov (United States)

    Ferreira-Pêgo, Cíntia; Nissensohn, Mariela; Kavouras, Stavros A.; Babio, Nancy; Serra-Majem, Lluís; Martín Águila, Adys; Mauromoustakos, Andy; Álvarez Pérez, Jacqueline; Salas-Salvadó, Jordi

    2016-01-01

    We assess the repeatability and relative validity of a Spanish beverage intake questionnaire for assessing water intake from beverages. The present analysis was performed within the framework of the PREDIMED-PLUS trial. The study participants were adults (aged 55–75) with a BMI ≥27 and <40 kg/m2, and at least three components of Metabolic Syndrome (MetS). A trained dietitian completed the questionnaire. Participants provided 24-h urine samples, and the volume and urine osmolality were recorded. The repeatability of the baseline measurement at 6 and 1 year was examined by paired Student’s t-test comparisons. A total of 160 participants were included in the analysis. The Bland–Altman analysis showed relatively good agreement between total daily fluid intake assessed using the fluid-specific questionnaire, and urine osmolality and 24-h volume with parameter estimates of −0.65 and 0.22, respectively (R2 = 0.20; p < 0.001). In the repeatability test, no significant differences were found between neither type of beverage nor total daily fluid intake at 6 months and 1-year assessment, compared to baseline. The proposed fluid-specific assessment questionnaire designed to assess the consumption of water and other beverages in Spanish adult individuals was found to be relatively valid with good repeatability. PMID:27483318

  1. TU-AB-BRA-05: Repeatability of [F-18]-NaF PET Imaging Biomarkers for Bone Lesions: A Multicenter Study

    Energy Technology Data Exchange (ETDEWEB)

    Lin, C; Bradshaw, T; Perk, T; Harmon, S; Jeraj, R [University of Wisconsin - Madison, School of Medicine and Public Health, Madison, WI (United States); Liu, G

    2015-06-15

    Purpose: Quantifying the repeatability of imaging biomarkers is critical for assessing therapeutic response. While therapeutic efficacy has been traditionally quantified by SUV metrics, imaging texture features have shown potential for use as quantitative biomarkers. In this study we evaluated the repeatability of quantitative {sup 18}F-NaF PET-derived SUV metrics and texture features in bone lesions from patients in a multicenter study. Methods: Twenty-nine metastatic castrate-resistant prostate cancer patients received whole-body test-retest NaF PET/CT scans from one of three harmonized imaging centers. Bone lesions of volume greater than 1.5 cm{sup 3} were identified and automatically segmented using a SUV>15 threshold. From each lesion, 55 NaF PET-derived texture features (including first-order, co-occurrence, grey-level run-length, neighbor gray-level, and neighbor gray-tone difference matrix) were extracted. The test-retest repeatability of each SUV metric and texture feature was assessed with Bland-Altman analysis. Results: A total of 315 bone lesions were evaluated. Of the traditional SUV metrics, the repeatability coefficient (RC) was 12.6 SUV for SUVmax, 2.5 SUV for SUVmean, and 4.3 cm{sup 3} for volume. Their respective intralesion coefficients of variation (COVs) were 12%, 17%, and 6%. Of the texture features, COV was lowest for entropy (0.03%) and highest for kurtosis (105%). Lesion intraclass correlation coefficient (ICC) was lowest for maximum correlation coefficient (ICC=0.848), and highest for entropy (ICC=0.985). Across imaging centers, repeatability of texture features and SUV varied. For example, across imaging centers, COV for SUVmax ranged between 11–23%. Conclusion: Many NaF PET-derived SUV metrics and texture features for bone lesions demonstrated high repeatability, such as SUVmax, entropy, and volume. Several imaging texture features demonstrated poor repeatability, such as SUVtotal and SUVstd. These results can be used to establish

  2. Effects of repeatability measures on results of fMRI sICA: a study on simulated and real resting-state effects.

    Science.gov (United States)

    Remes, Jukka J; Starck, Tuomo; Nikkinen, Juha; Ollila, Esa; Beckmann, Christian F; Tervonen, Osmo; Kiviniemi, Vesa; Silven, Olli

    2011-05-15

    Spatial independent components analysis (sICA) has become a widely applied data-driven method for fMRI data, especially for resting-state studies. These sICA approaches are often based on iterative estimation algorithms and there are concerns about accuracy due to noise. Repeatability measures such as ICASSO, RAICAR and ARABICA have been introduced as remedies but information on their effects on estimates is limited. The contribution of this study was to provide more of such information and test if the repeatability analyses are necessary. We compared FastICA-based ordinary and repeatability approaches concerning mixing vector estimates. Comparisons included original FastICA, FSL4 Melodic FastICA and original and modified ICASSO. The effects of bootstrapping and convergence threshold were evaluated. The results show that there is only moderate improvement due to repeatability measures and only in the bootstrapping case. Bootstrapping attenuated power from time courses of resting-state network related ICs at frequencies higher than 0.1 Hz and made subsets of low frequency oscillations more emphasized IC-wise. The convergence threshold did not have a significant role concerning the accuracy of estimates. The performance results suggest that repeatability measures or strict converge criteria might not be needed in sICA analyses of fMRI data. Consequently, the results in existing sICA fMRI literature are probably valid in this sense. A decreased accuracy of original bootstrapping ICASSO was observed and corrected by using centrotype mixing estimates but the results warrant for thorough evaluations of data-driven methods in general. Also, given the fMRI-specific considerations, further development of sICA methods is strongly encouraged. Copyright © 2010 Elsevier Inc. All rights reserved.

  3. A study of the evolution of inverted-topology repeats from LeuT-fold transporters using AlignMe.

    Science.gov (United States)

    Khafizov, Kamil; Staritzbichler, René; Stamm, Marcus; Forrest, Lucy R

    2010-12-21

    X-ray crystal structures have revealed that numerous secondary transporter proteins originally categorized into different sequence families share similar structures, namely, the LeuT fold. The core of this fold consists of two units of five transmembrane helices, whose conformations have been proposed to exchange to form the two alternate states required for transport. That these two units are related implies that LeuT-like transporters evolved from gene-duplication and fusion events. Thus, the origins of this structural repeat may be relevant to the evolution of transport function. However, the lack of significant sequence similarity requires sensitive sequence search methods for analyzing their evolution. To this end, we developed a software application called AlignMe, which can use various types of input information, such as residue hydrophobicity, to perform pairwise alignments of sequences and/or of hydropathy profiles of (membrane) proteins. We used AlignMe to analyze the evolutionary relationships between repeats of the LeuT fold. In addition, we identified proteins from the so-called DedA family that potentially share a common ancestor with these repeats. DedA domains have been implicated in, e.g., selenite uptake; they are found widely distributed across all kingdoms of life; two or more DedA domains are typically found per genome, and some may adopt dual topologies. These results suggest that DedA proteins existed in ancient organisms and may function as dimers, as required for a would-be ancestor of the LeuT fold. In conclusion, we provide novel insights into the evolution of this important structural motif and thus potentially into the alternating-access mechanism of transport itself.

  4. Repeat-pulse 13CO2 labeling of canola and field pea: implications for soil organic matter studies.

    Science.gov (United States)

    Sangster, Amy; Knight, Diane; Farrell, Richard; Bedard-Haughn, Angela

    2010-10-15

    Both the quantity and quality of plant residues can impact soil properties and processes. Isotopic tracers can be used to trace plant residue decomposition if the tracer is homogeneously distributed throughout the plant. Continuous labeling will homogeneously label plants but is not widely accessible because elaborate equipment is needed. In order to determine if the more accessible repeat-pulse labeling method could be used to trace plant residue decomposition, this labeling procedure was employed using (13)CO(2) to enrich field pea and canola plants in a controlled environment. Plants were exposed weekly to pulses of 33 atom% (13)CO(2) and grown to maturity. The distribution of the label throughout the plant parts (roots, stem, leaves, and pod) and biochemical fractions (ADF and ADL) was determined. The label was not homogeneously distributed throughout the plant; in particular, the pod fractions were less enriched than other fractions indicating the importance of continuing labeling well into plant maturity for pod-producing plants. The ADL fraction was also less enriched than the ADF fraction. Because of the heterogeneity of the label throughout the plant, caution should be applied when using the repeat-pulse method to trace the fate of (13)C-labeled residues in the soil. However, root contributions to below-ground C were successfully determined from the repeat-pulse labeled root material, as was (13)C enrichment of soil within the top 15 cm. Canola contributed more above- and below-ground residue C than field pea; however, canola was also higher in ADF and ADL fractions indicating a more recalcitrant residue.

  5. Evaluation of a repeated dose liver micronucleus assay in rats treated with two genotoxic hepatocarcinogens, dimethylnitrosamine and 2-acetylaminofluorene: the possibility of integrating micronucleus tests with multiple tissues into a repeated dose general toxicity study.

    Science.gov (United States)

    Takashima, Rie; Takasawa, Hironao; Kawasako, Kazufumi; Ohyama, Wakako; Okada, Emiko; Narumi, Kazunori; Fujiishi, Yohei; Wako, Yumi; Yasunaga, Katsuaki; Hattori, Akiko; Kawabata, Masayoshi; Nakadate, Kiyoko; Nakagawa, Munehiro; Hamada, Shuichi

    2015-03-01

    As part of a collaborative study by the Collaborative Study Group for Micronucleus Test (CSGMT) of the Mammalian Mutagenicity Study Group (MMS) in the Japanese Environmental Mutagen Society (JEMS), the present study evaluated the effectiveness of the repeated dose liver micronucleus (RDLMN) assay. Two genotoxic hepatocarcinogens, dimethylnitrosamine (DMN) and 2-acetylaminofluorene (2-AAF), were administered orally to male rats (6 weeks old at the initial dosing) once daily for 14 and 28 days to evaluate the micronucleus (MN) inducibility in the liver. In addition, these chemicals were evaluated for MN inducibility in the bone marrow (BM) and gastrointestinal (GI) tract, i.e. glandular stomach and colon of the same animals used in the RDLMN assay. As a result, both chemicals produced positive results in the liver, although a weak positive response was given by 2-AAF. DMN gave negative results in the tissues other than the liver. 2-AAF produced positive responses in the BM and glandular stomach, and a prominent response was particularly observed in the glandular stomach, which is directly exposed to the test chemicals by gavage. The present results suggest that the RDLMN assay is a useful method for detecting genotoxic hepatocarcinogens, and that it is especially effective for evaluating test chemicals, such as DMN, undetectable by the BM and GI tract MN assay. Moreover, the results in this investigation indicate that the use of multiple tissues in the study integrating the MN tests is more effective than using a single tissue, for detection of the MN induction produced by chemical exposure to rats, and helps to determine the characteristics of the test chemicals.

  6. Heart rate variability and DNA methylation levels are altered after short-term metal fume exposure among occupational welders: a repeated-measures panel study

    OpenAIRE

    2014-01-01

    Background: In occupational settings, boilermakers are exposed to high levels of metallic fine particulate matter (PM2.5) generated during the welding process. The effect of welding PM2.5 on heart rate variability (HRV) has been described, but the relationship between PM2.5, DNA methylation, and HRV is not known. Methods: In this repeated-measures panel study, we recorded resting HRV and measured DNA methylation levels in transposable elements Alu and long interspersed nuclear element-1 (LINE...

  7. Modelling studies on neurodegenerative disease-causing triplet repeat sequences d(GGC/GCC)n and d(CAG/CTG)n

    Indian Academy of Sciences (India)

    Shibasish Chowdhury; Manju Bansal

    2001-12-01

    Model building and molecular mechanics studies have been carried out to examine the potential structures for d(GGC/GCC)5 and d(CAG/CTG)5 that might relate to their biological function and association with triplet repeat expansion diseases. Model building studies suggested that hairpin and quadruplex structures could be formed with these repeat sequences. Molecular mechanics studies have demonstrated that the hairpin and hairpin dimer structures of triplet repeat sequences formed by looping out of the two strands are as favourable as the corresponding B-DNA type hetero duplex structures. Further, at high salt condition, Greek key type quadruplex structures are energetically comparable with hairpin dimer and B-DNA type duplex structures. All tetrads in the quadruplex structures are well stacked and provide favourable stacking energy values. Interestingly, in the energy minimized hairpin dimer and Greek key type quadruplex structures, all the bases even in the non-G tetrads are cyclically hydrogen bonded, even though the A, C and T-tetrads were not hydrogen bonded in the starting structures.

  8. Contributions by the CAG-repeat Polymorphism of the Androgen Receptor Gene and Circulating Androgens to Muscle Size. Odense Androgen Study - A Population-based Study of 20-29 Year-old Danish Men

    DEFF Research Database (Denmark)

    Nielsen, Torben Leo; Hagen, Claus; Wraae, Kristian

    2007-01-01

    Context: The number of CAG-repeats within the CAG-repeat polymorphism of the androgen receptor gene is inversely correlated with the transcriptional activity of the androgen receptor. Objective: To study the effect of the CAG-repeat number and circulating androgens on muscle size, to examine the ...... muscle size increased exponentially with decreasing androgen levels and was tripled at total testosterone levels...... the CAG-repeat number in relation to body fat mass and circulating androgens, and to identify the best hormonal marker of low muscle size amongst total testosterone, bioavailable testosterone, and dihydrotestosterone. Design, Setting, and Participants: Population-based study of 783 Danish men aged 20...... continuous outcomes (thigh and axial muscle area, lower extremity, upper extremity, and trunk lean body mass, and total body fat mass) and five binary outcomes of low muscle size defined as men with muscle size below the lower 10 percentile of each continuous outcome of muscle size. Results: The CAG...

  9. Diabetic Foot Prevention: Repeatability of the Loran Platform Plantar Pressure and Load Distribution Measurements in Nondiabetic Subjects during Bipedal Standing—A Pilot Study

    Directory of Open Access Journals (Sweden)

    Martha Zequera

    2011-01-01

    Full Text Available This study was designed to assess the repeatability of the Loran Platform and evaluate the variability of plantar pressure and postural balance, during barefoot standing in nondiabetic subjects, for future diabetic foot clinical evaluation. Measurements were taken for eight nondiabetic subjects (4 females, 4 males, aged 47±7.2 years who had no musculoskeletal symptoms. Five variables were measured with the platform in the barefoot standing position. Ten measurements were taken using two different techniques for feet and posture positioning, during three sessions, once a week. For most measurements, no significant effect over time was found with Student's t-test (P<.000125. The ANOVA test of statistical significance confirmed that measurement differences between subjects showed higher variations than measurements taken from the same subject (P<.001. The measurements taken by the Loran Platform system were found to be repeatable.

  10. A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene.

    Science.gov (United States)

    Leonova, J; Hanson, C

    1999-01-01

    This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.

  11. A comparative evaluation of tray spacer thickness and repeat pour on the accuracy of monophasic polyvinyl siloxane impression material: In vitro study

    Directory of Open Access Journals (Sweden)

    Sandeep Kumar

    2014-01-01

    Full Text Available Purpose: This study was aimed to determine the effect of various tray spacer thickness and subsequent repeated pours on the accuracy and dimensional stability of the impression made from monophasic polyvinyl siloxane material. Materials and Methods: Custom trays with different spacer thickness (2, 4 and 6 mm were used for making an impression of a master model simulating 3 unit fixed partial denture with monophasic polyvinyl siloxane material. These impressions were poured with die stone and repoured. Distance between the reference points were measured and subjected to statistical analysis. Result: Casts obtained from 1 st , 2 nd and 3 rd pour of the impression in 2, 4 and 6 mm spacer thickness tray have similar dimensional accuracy amongst each other and with the master model except in molar diameter and inter-abutment distances of cast obtained from 6 mm spacer thickness tray. Conclusion: The vertical distance of stone dies were decreased, whereas horizontal distance increased as the thickness of impression material is increased. There were statistically non-significant changes occurring among the repeated pours in 2, 4 and 6 mm spacer thickness. Clinical Implication: 2 and 4 mm spacer thickness are acceptable for making an impression for three unit fixed partial denture with monophasic polyvinyl siloxane material and it was not affected by two subsequent (1 st and 2 nd repeated pours.

  12. Vaginal birth after cesarean section (VBAC versus emergency repeat cesarean section at teaching hospitals in India: an ICMR task force study

    Directory of Open Access Journals (Sweden)

    B. S. Dhillon

    2014-06-01

    Results: A total of 155863 deliveries occurred during the study duration, there were 28.1% (n=43824 cesarean section and (10.1% (n=15664 were the number of previous cesarean section. In 84% (n=13151 had repeat cesarean delivery and 2513 (16% delivered vaginally. A trial of labor was planned in 4035 (25.8% women. The success rate of VBAC was 62.3% with 2513 women had successful vaginal delivery and 1522 (37.7% delivered by emergency repeat cesarean section. Major indication of emergency cesarean section was CPD (52.9%, foetal distress (25.8%, severe PIH/eclampsia (5.0%, previous 2 CS (0.7%, APH (1.4% and others (2.7%. In majority, surgical technique was conventional and in 3.7% the Misgav-Ladach technique was used. Scar dehiscence and surgical complications were observed in 5.4% and 4.0% of cases respectively. Blood transfusion was given in 7.0% and post-operative complications were seen in 6.8%. Perinatal and maternal mortality was 18.0/1000 and 257/100000 deliveries respectively. Conclusions: Safety in childbirth for women with prior cesarean is a major public health concern. Repeat caesarean section and planned vaginal birth after cesarean section are both associated with benefits and harms and correct management represents one of the most significant and challenging issues in obstetric practice. [Int J Reprod Contracept Obstet Gynecol 2014; 3(3.000: 592-597

  13. The effect of repeated immersion of gypsum cast in sodium hypochlorite and glutaraldehyde on its physical properties: An in vitro study

    Directory of Open Access Journals (Sweden)

    Rachuri Narendra Kumar

    2012-01-01

    Full Text Available Background: One method used to disinfect a dental cast is immersion in a disinfecting solution. Repeated immersion of a cast in disinfectant may affect its physical properties. Purpose: The purpose of this study was to evaluate the changes in dimensional accuracy and hardness of the dental casts as a result of repeated disinfection in 0.525% sodium hypochlorite and 2% glutaraldehyde solutions. Materials and Methods: Sixty specimens were made of type III dental stone. Twenty specimens were immersed in slurry, a supernatant solution of calcium sulfate in distilled water (control casts, 20 specimens in 0.525% sodium hypochlorite, and 20 specimens in 2% glutaraldehyde solutions for 30 min and air dried for 24 h. This process was repeated for 7 times for testing. Linear dimensional change and hardness were determined according to American National Standards Institute/American Dental Association (ANSI/ADA standards. The data were analyzed using two-way analysis of variance. Results: For specimens prepared with type III stones, treatment was by immersion in slurry (group I - control casts, and by immersion in 0.525% sodium hypochlorite (group II - test group 1 and in 2% glutaraldehyde solution (group III - test group 2. The specimens treated with sodium hypochlorite and glutaraldehyde showed more linear dimensional change compared to the specimens treated in slurry. However, the difference between test casts and control casts was significant. But the difference between the two test groups was not significant. Both the test groups showed decrease in hardness of the specimens compared to that specimens in control group. But the difference between two test groups was not significant in hardness.However,the values remained close to ANSI/ADA standards. Conclusion: The results demonstrated that repeated immersion of type III dental stone specimens in slurry with distilled water, 0.525% sodium hypochlorite and 2% glutaraldehyde, along with drying in air

  14. Personal semantics: Is it distinct from episodic and semantic memory? An electrophysiological study of memory for autobiographical facts and repeated events in honor of Shlomo Bentin.

    Science.gov (United States)

    Renoult, Louis; Tanguay, Annick; Beaudry, Myriam; Tavakoli, Paniz; Rabipour, Sheida; Campbell, Kenneth; Moscovitch, Morris; Levine, Brian; Davidson, Patrick S R

    2016-03-01

    Declarative memory is thought to consist of two independent systems: episodic and semantic. Episodic memory represents personal and contextually unique events, while semantic memory represents culturally-shared, acontextual factual knowledge. Personal semantics refers to aspects of declarative memory that appear to fall somewhere in between the extremes of episodic and semantic. Examples include autobiographical knowledge and memories of repeated personal events. These two aspects of personal semantics have been studied little and rarely compared to both semantic and episodic memory. We recorded the event-related potentials (ERPs) of 27 healthy participants while they verified the veracity of sentences probing four types of questions: general (i.e., semantic) facts, autobiographical facts, repeated events, and unique (i.e., episodic) events. Behavioral results showed equivalent reaction times in all 4 conditions. True sentences were verified faster than false sentences, except for unique events for which no significant difference was observed. Electrophysiological results showed that the N400 (which is classically associated with retrieval from semantic memory) was maximal for general facts and the LPC (which is classically associated with retrieval from episodic memory) was maximal for unique events. For both ERP components, the two personal semantic conditions (i.e., autobiographical facts and repeated events) systematically differed from semantic memory. In addition, N400 amplitudes also differentiated autobiographical facts from unique events. Autobiographical facts and repeated events did not differ significantly from each other but their corresponding scalp distributions differed from those associated with general facts. Our results suggest that the neural correlates of personal semantics can be distinguished from those of semantic and episodic memory, and may provide clues as to how unique events are transformed to semantic memory.

  15. Ambient particulate air pollution and circulating antioxidant enzymes: A repeated-measure study in healthy adults in Beijing, China.

    Science.gov (United States)

    Wu, Shaowei; Wang, Bin; Yang, Di; Wei, Hongying; Li, Hongyu; Pan, Lu; Huang, Jing; Wang, Xin; Qin, Yu; Zheng, Chanjuan; Shima, Masayuki; Deng, Furong; Guo, Xinbiao

    2016-01-01

    The association of systemic antioxidant activity with ambient air pollution has been unclear. A panel of 40 healthy college students underwent repeated blood collection for 12 occasions under three exposure scenarios before and after relocating from a suburban area to an urban area in Beijing, China in 2010-2011. We measured various air pollutants including fine particles (PM2.5) and determined circulating levels of antioxidant enzymes extracellular superoxide dismutase (EC-SOD) and glutathione peroxidase 1 (GPX1) in the laboratory. An interquartile range increase of 63.4 μg/m(3) at 3-d PM2.5 moving average was associated with a 6.3% (95% CI: 0.6, 12.4) increase in EC-SOD and a 5.5% (95% CI: 1.3, 9.8) increase in GPX1. Several PM2.5 chemical constituents, including negative ions (nitrate and chloride) and metals (e.g., iron and strontium), were consistently associated with increases in EC-SOD and GPX1. Our results support activation of circulating antioxidant enzymes following exposure to particulate air pollution. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. A Study on the Efficiency Improvement of Dye-Sensitized Solar Cell (DSSC) by Repeated Dye Coating.

    Science.gov (United States)

    Seo, Young Ho; Choi, Eun Chang; Hong, Byungyou

    2015-10-01

    Dye-sensitized solar cell (DSSC) is being extensively investigated as the next generation energy source. Despite of the attractive features like simple fabrication process and its economic efficiency, there are some problems such as low efficiency, long fabrication time and low long-term stability. Conventionally, the dye adsorption on TiO2 photo-electrode film needs long time in the solvent with low concentration of dye to get the high efficiency. In this work, the dye coating process was considerably shortened, albeit plenty of dye was used comparing with the conventional way. Our needs were met for the best result in our working environment and the relevant conditions to our work were obtained, which were the coating temperature of 70 °C, the dye concentration of 10 mM and the coating time of 3 min. And this coating process was successively repeated several times to maximize the dye adsorption and to improve the cell efficiency. Therefore, the efficiency increased by 13% in the proper condition.

  17. Reconfigurable multiport EPON repeater

    Science.gov (United States)

    Oishi, Masayuki; Inohara, Ryo; Agata, Akira; Horiuchi, Yukio

    2009-11-01

    An extended reach EPON repeater is one of the solutions to effectively expand FTTH service areas. In this paper, we propose a reconfigurable multi-port EPON repeater for effective accommodation of multiple ODNs with a single OLT line card. The proposed repeater, which has multi-ports in both OLT and ODN sides, consists of TRs, BTRs with the CDR function and a reconfigurable electrical matrix switch, can accommodate multiple ODNs to a single OLT line card by controlling the connection of the matrix switch. Although conventional EPON repeaters require full OLT line cards to accommodate subscribers from the initial installation stage, the proposed repeater can dramatically reduce the number of required line cards especially when the number of subscribers is less than a half of the maximum registerable users per OLT. Numerical calculation results show that the extended reach EPON system with the proposed EPON repeater can save 17.5% of the initial installation cost compared with a conventional repeater, and can be less expensive than conventional systems up to the maximum subscribers especially when the percentage of ODNs in lightly-populated areas is higher.

  18. TU-C-12A-05: Repeatability Study of Reduced Field-Of-View Diffusion-Weighted MRI On Human Thyroid Gland

    Energy Technology Data Exchange (ETDEWEB)

    Shukla-Dave, A; Lu, Y; Hatzoglou, V; Stambuk, H; Mazaheri, Y [Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Banerjee, S; Shankaranarayanan, A [GE Healthcare, Menlo Park, California (United States); Deasy, J [Memorial Sloan Kettering Cancer Center, New York, NY (United States)

    2014-06-15

    Purpose: To investigate the repeatability of reduced field-of-view diffusion-weighted imaging (rFOV DWI) in quantifying apparent diffusion coefficients (ADCs) for human thyroid glands in a clinical setting. Methods: Nine healthy human volunteers were enrolled and underwent 3T MRI exams. For each volunteer, 3 longitudinal exams (2 weeks apart) with 2 repetitive sessions within each exam, including rFOV and conventional full field-of-view (fFOV) DWI scans, were performed. In the acquired DWI images, a fixed-size region of interest (ROI; diameter=8mm) was placed on thyroid glands to calculate ADC. ADC was calculated using a monoexponential function with a noise correction scheme. The repeatability of ADC was assessed by using coefficient variation (CV) across sessions or exams, which was defined to be: r = 1-CV, 0 < r < 1, where CV=STD/m, STD is the standard deviation of ADC, and m is the average of ADC across sessions or exams. An experienced radiologist assessed and scored rFOV and fFOV DW images based on image characteristics (1, nondiagnostic; 2, poor; 3, satisfactory; 4, good; and 5, excellent).Analysis of variance (ANOVA) was performed to compare ADC values, CV of ADC, repeatability of ADC across sessions and exams, and radiologic scores between rFOV and fFOV DWI techniques. Results: There was no significant difference in ADC values across sessions and exams either in rFOV or fFOV DWI. The average CVs of both rFOV and fFOV DWI were less than 13%. The repeatability of ADC measurement between rFOV and fFOV DWI was not significantly different. The overall image quality was significantly higher with rFOV DWI than with fFOV DWI. Conclusion: This study suggested that ADCs from both rFOV and fFOV DWI were repeatable, but rFOV DWI had superior imaging quality for human thyroid glands in a clinical setting.

  19. Recursive quantum repeater networks

    CERN Document Server

    Van Meter, Rodney; Horsman, Clare

    2011-01-01

    Internet-scale quantum repeater networks will be heterogeneous in physical technology, repeater functionality, and management. The classical control necessary to use the network will therefore face similar issues as Internet data transmission. Many scalability and management problems that arose during the development of the Internet might have been solved in a more uniform fashion, improving flexibility and reducing redundant engineering effort. Quantum repeater network development is currently at the stage where we risk similar duplication when separate systems are combined. We propose a unifying framework that can be used with all existing repeater designs. We introduce the notion of a Quantum Recursive Network Architecture, developed from the emerging classical concept of 'recursive networks', extending recursive mechanisms from a focus on data forwarding to a more general distributed computing request framework. Recursion abstracts independent transit networks as single relay nodes, unifies software layer...

  20. Effect of repeated intracoronary injection of bone marrow cells in patients with ischaemic heart failure the Danish stem cell study - congestive heart failure trial (DanCell-CHF)

    DEFF Research Database (Denmark)

    Diederichsen, A.C.; Møller, Jacob Eifer; Thayssen, P.;

    2008-01-01

    BACKGROUND: It has been suggested that myocardial regeneration may be achieved by a single intracoronary bone marrow derived stem cell infusion in selected patients with ischaemic heart disease. The effect is uncertain in patients with chronic ischaemic heart failure and it is not known whether...... repeated infusions would have additional positive effects. AIMS: To assess whether two treatments of intracoronary infusion of bone marrow stem cells, administered 4 months apart, could improve left ventricular (LV) systolic function in patients with chronic ischaemic heart failure. METHODS: The study......, NYHA class improved (pstem cell treatment in patients with chronic ischaemic heart failure Udgivelsesdato: 2008/7...

  1. Hysteresis of magnetostructural transitions: Repeatable and non-repeatable processes

    Energy Technology Data Exchange (ETDEWEB)

    Provenzano, Virgil [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States); Della Torre, Edward; Bennett, Lawrence H. [Department of Electrical and Computer Engineering, The George Washington University, Washington, DC 20052 (United States); ElBidweihy, Hatem, E-mail: Hatem@gwmail.gwu.edu [Department of Electrical and Computer Engineering, The George Washington University, Washington, DC 20052 (United States)

    2014-02-15

    The Gd{sub 5}Ge{sub 2}Si{sub 2} alloy and the off-stoichiometric Ni{sub 50}Mn{sub 35}In{sub 15} Heusler alloy belong to a special class of metallic materials that exhibit first-order magnetostructural transitions near room temperature. The magnetic properties of this class of materials have been extensively studied due to their interesting magnetic behavior and their potential for a number of technological applications such as refrigerants for near-room-temperature magnetic refrigeration. The thermally driven first-order transitions in these materials can be field-induced in the reverse order by applying a strong enough field. The field-induced transitions are typically accompanied by the presence of large magnetic hysteresis, the characteristics of which are a complicated function of temperature, field, and magneto-thermal history. In this study we show that the virgin curve, the major loop, and sequentially measured MH loops are the results of both repeatable and non-repeatable processes, in which the starting magnetostructural state, prior to the cycling of field, plays a major role. Using the Gd{sub 5}Ge{sub 2}Si{sub 2} and Ni{sub 50}Mn{sub 35}In{sub 15} alloys, as model materials, we show that a starting single phase state results in fully repeatable processes and large magnetic hysteresis, whereas a mixed phase starting state results in non-repeatable processes and smaller hysteresis.

  2. Fixed-flexion knee radiography using a new positioning device produced highly repeatable measurements of joint space width: ELSA-Brasil Musculoskeletal Study (ELSA-Brasil MSK).

    Science.gov (United States)

    Telles, Rosa Weiss; Costa-Silva, Luciana; Machado, Luciana A C; Reis, Rodrigo Citton Padilha Dos; Barreto, Sandhi Maria

    To describe the performance of a non-fluoroscopic fixed-flexion PA radiographic protocol with a new positioning device, developed for the assessment of knee osteoarthritis (OA) in Brazilian Longitudinal Study of Adult Health Musculoskeletal Study (ELSA-Brasil MSK). A test-retest design including 19 adults (38 knee images) was conducted. Feasibility of the radiographic protocol was assessed by image quality parameters and presence of radioanatomic alignment according to intermargin distance (IMD) values. Repeatability was assessed for IMD and joint space width (JSW) measured at three different locations. Approximately 90% of knee images presented excellent quality. Frequencies of nearly perfect radioanatomic alignment (IMD ≤1mm) ranged from 29% to 50%, and satisfactory alignment was found in up to 71% and 76% of the images (IMD ≤1.5mm and ≤1.7mm, respectively). Repeatability analyses yielded the following results: IMD [SD of mean difference=1.08; coefficient of variation (%CV)=54.68%; intraclass correlation coefficient (ICC) (95%CI)=0.59 (0.34-0.77)]; JSW [SD of mean difference=0.34-0.61; %CV=4.48%-9.80%; ICC (95%CI)=0.74 (0.55-0.85)-0.94 (0.87-0.97)]. Adequately reproducible measurements of IMD and JSW were found in 68% and 87% of the images, respectively. Despite the difficulty in achieving consistent radioanatomic alignment between subsequent radiographs in terms of IMD, the protocol produced highly repeatable JSW measurements when these were taken at midpoint and 10mm from the medial extremity of the medial tibial plateau. Therefore, measurements of JSW at these locations can be considered adequate for the assessment of knee OA in ELSA-Brasil MSK. Copyright © 2016. Published by Elsevier Editora Ltda.

  3. Automated quality checks on repeat prescribing.

    OpenAIRE

    Rogers, Jeremy E; Wroe, Christopher J; Roberts, Angus; Swallow, Angela; Stables, David; Cantrill, Judith A; Rector, Alan L.

    2003-01-01

    BACKGROUND: Good clinical practice in primary care includes periodic review of repeat prescriptions. Markers of prescriptions that may need review have been described, but manually checking all repeat prescriptions against the markers would be impractical. AIM: To investigate the feasibility of computerising the application of repeat prescribing quality checks to electronic patient records in United Kingdom (UK) primary care. DESIGN OF STUDY: Software performance test against benchmark manual...

  4. Strengthening concept learning by repeated testing.

    Science.gov (United States)

    Wiklund-Hörnqvist, Carola; Jonsson, Bert; Nyberg, Lars

    2014-02-01

    The aim of this study was to examine whether repeated testing with feedback benefits learning compared to rereading of introductory psychology key-concepts in an educational context. The testing effect was examined immediately after practice, after 18 days, and at a five-week delay in a sample of undergraduate students (n = 83). The results revealed that repeated testing with feedback significantly enhanced learning compared to rereading at all delays, demonstrating that repeated retrieval enhances retention compared to repeated encoding in the short- and the long-term. In addition, the effect of repeated testing was beneficial for students irrespectively of working memory capacity. It is argued that teaching methods involving repeated retrieval are important to consider by the educational system.

  5. The Pentapeptide Repeat Proteins

    Energy Technology Data Exchange (ETDEWEB)

    Vetting,M.; Hegde, S.; Fajardo, J.; Fiser, A.; Roderick, S.; Takiff, H.; Blanchard, J.

    2006-01-01

    The Pentapeptide Repeat Protein (PRP) family has over 500 members in the prokaryotic and eukaryotic kingdoms. These proteins are composed of, or contain domains composed of, tandemly repeated amino acid sequences with a consensus sequence of [S, T,A, V][D, N][L, F]-[S, T,R][G]. The biochemical function of the vast majority of PRP family members is unknown. The three-dimensional structure of the first member of the PRP family was determined for the fluoroquinolone resistance protein (MfpA) from Mycobacterium tuberculosis. The structure revealed that the pentapeptide repeats encode the folding of a novel right-handed quadrilateral {beta}-helix. MfpA binds to DNA gyrase and inhibits its activity. The rod-shaped, dimeric protein exhibits remarkable size, shape and electrostatic similarity to DNA.

  6. Can a Repeated Sprint Ability Test Help Clear a Previously Injured Soccer Player for Fully Functional Return to Activity? A Pilot Study.

    Science.gov (United States)

    Padulo, Johnny; Attene, Giuseppe; Ardigò, Luca P; Bragazzi, Nicola L; Maffulli, Nicola; Zagatto, Alessandro M; Dello Iacono, Antonio

    2017-07-01

    To investigate the effects of fatigue induced by a repeated sprint ability (RSA) test on the neuromuscular responses of soccer players with a recent history of lower limb injuries (CH) and a matched control group in good fitness condition (GH). This was a case-control study. Nine CH and 9 GH. Allocation to CH or GH. Each player was assessed for blood lactate concentration and jumping performance [squat jump (SJ) and countermovement jump (CMJ)] before/after RSA. Post-RSA rate of perceived exertion (RPE) was obtained. Receiver operating characteristic analysis was performed to calculate RSA sensitivity and specificity in distinguishing between CH and GH. Intraclass correlation coefficient was used to assess reliability. No baseline differences were found for any variable. ΔSJ before/after RSA was -14 ± 2% and -5 ± 2% in CH and GH, respectively (P Repeated sprint ability is a simple, low-cost field test potentially able to assist in clinical decision making for return to sport.

  7. Repeating the Past

    Science.gov (United States)

    Moore, John W.

    1998-05-01

    As part of the celebration of the Journal 's 75th year, we are scanning each Journal issue from 25, 50, and 74 years ago. Many of the ideas and practices described are so similar to present-day "innovations" that George Santayana's adage (1) "Those who cannot remember the past are condemned to repeat it" comes to mind. But perhaps "condemned" is too strong - sometimes it may be valuable to repeat something that was done long ago. One example comes from the earliest days of the Division of Chemical Education and of the Journal.

  8. Phylogenetic study and molecular identification of 31 Dendrobium species using inter-simple sequence repeat (ISSR) markers

    National Research Council Canada - National Science Library

    Wang, H.-Z; Feng, S.-G; Lu, J.-J; Shi, N.-N; Liu, J.-J

    2009-01-01

    The genetic diversity of the genus Dendrobium is not well known and the phylogenetic relationship of Dendrobium species are mainly determined by studies of the comparative vegetative anatomy and plant systematics...

  9. Second time around: Corticospinal responses following repeated sports-related concussions within the same season. A transcranial magnetic stimulation study

    Directory of Open Access Journals (Sweden)

    Alan J Pearce

    2014-01-01

    Conclusions: This multiple-case study has demonstrated that concussion result in increased intracortical inhibition and reduction in cognitive and motor performance. Further, TMS, in conjunction with tests of cognitive and motor performance, can be useful as a prognostic technique in assessing recovery from acute concussion injury.

  10. Reduction of smoking in Dutch adolescents over the past decade and its health gains : a repeated cross-sectional study

    NARCIS (Netherlands)

    Gielkens-Sijstermans, Cindy M.; Mommers, Monique A.; Hoogenveen, Rudolf T.; Feenstra, Talitha L.; de Vreede, Jacqueline; Bovens, Fons M.; van Schayck, Onno C.

    Background: Smoking is the main preventable lifestyle-related risk factor threatening human health. In this study, time trends in smoking behaviour between 1996 and 2005 among adolescents enrolled in secondary school were assessed. Methods: In 1996, 2001 and 2005, a survey was conducted in the

  11. A repeated-measures study of recreational water exposure, non-point source pollution, and risk of illness

    Science.gov (United States)

    Discharge of stormwater runoff onto beaches is a major cause of beach closings and advisories in the United States. Prospective studies of recreational water quality and health have often been limited to two time points (baseline and follow-up). Little is known about the risk of ...

  12. All-optical repeater.

    Science.gov (United States)

    Silberberg, Y

    1986-06-01

    An all-optical device containing saturable gain, saturable loss, and unsaturable loss is shown to transform weak, distorted optical pulses into uniform standard-shape pulses. The proposed device performs thresholding, amplification, and pulse shaping as required from an optical repeater. It is shown that such a device could be realized by existing semiconductor technology.

  13. Bidirectional Manchester repeater

    Science.gov (United States)

    Ferguson, J.

    1980-01-01

    Bidirectional Manchester repeater is inserted at periodic intervals along single bidirectional twisted pair transmission line to detect, amplify, and transmit bidirectional Manchester 11 code signals. Requiring only 18 TTL 7400 series IC's, some line receivers and drivers, and handful of passive components, circuit is simple and relatively inexpensive to build.

  14. The necessity of repeated assessment of imaging studies contained in medical records in medico-legal opinions

    Directory of Open Access Journals (Sweden)

    Aleksandra Borowska-Solonynko

    2014-12-01

    Full Text Available The paper presents two case reports of living victims, in which imaging studies of the chest conducted at a medical facility were an essential part of the medico-legal opinion. The first case was that of a young male hospitalized due to CT evidence of bilateral rib fractions, who claimed to have been assaulted by police officers. The other case was that of a six week old baby hospitalized due to chest X-ray evidence of right hand side rib fractions. The chest X-ray was performed due to one bruise found on the baby’s forehead and two small bruises on the back, which gave rise to suspicions of child abuse. In both cases, expert witnesses in radiology definitively excluded the presence of any fractures. These cases indicate that a new assessment of imaging studies contained in medical records is needed. Expert opinions based solely on the description of imaging studies may result in grave consequences.

  15. Repeated dose 28-days oral toxicity study of Carica papaya L. leaf extract in Sprague Dawley rats.

    Science.gov (United States)

    Afzan, Adlin; Abdullah, Noor Rain; Halim, Siti Zaleha; Rashid, Badrul Amini; Semail, Raja Hazlini Raja; Abdullah, Noordini; Jantan, Ibrahim; Muhammad, Hussin; Ismail, Zakiah

    2012-04-10

    Carica papaya L. leaves have been used in ethnomedicine for the treatment of fevers and cancers. Despite its benefits, very few studies on their potential toxicity have been described. The aim of the present study was to characterize the chemical composition of the leaf extract from 'Sekaki' C. papaya cultivar by UPLC-TripleTOF-ESI-MS and to investigate the sub-acute oral toxicity in Sprague Dawley rats at doses of 0.01, 0.14 and 2 g/kg by examining the general behavior, clinical signs, hematological parameters, serum biochemistry and histopathology changes. A total of twelve compounds consisting of one piperidine alkaloid, two organic acids, six malic acid derivatives, and four flavonol glycosides were characterized or tentatively identified in the C. papaya leaf extract. In the sub-acute study, the C. papaya extract did not cause mortality nor were treatment-related changes in body weight, food intake, water level, and hematological parameters observed between treatment and control groups. Some biochemical parameters such as the total protein, HDL-cholesterol, AST, ALT and ALP were elevated in a non-dose dependent manner. Histopathological examination of all organs including liver did not reveal morphological alteration. Other parameters showed non-significant differences between treatment and control groups. The present results suggest that C. papaya leaf extract at a dose up to fourteen times the levels employed in practical use in traditional medicine in Malaysia could be considered safe as a medicinal agent.

  16. Generosity pays in the presence of direct reciprocity: a comprehensive study of 2 × 2 repeated games.

    Directory of Open Access Journals (Sweden)

    Luis A Martinez-Vaquero

    Full Text Available By applying a technique previously developed to study ecosystem assembly [Capitán et al., Phys. Rev. Lett. 103, 168101 (2009] we study the evolutionary stable strategies of iterated 2 × 2 games. We focus on memory-one strategies, whose probability to play a given action depends on the actions of both players in the previous time step. We find the asymptotically stable populations resulting from all possible invasions of any known stable population. The results of this invasion process are interpreted as transitions between different populations that occur with a certain probability. Thus the whole process can be described as a Markov chain whose states are the different stable populations. With this approach we are able to study the whole space of symmetric 2 × 2 games, characterizing the most probable results of evolution for the different classes of games. Our analysis includes quasi-stationary mixed equilibria that are relevant as very long-lived metastable states and is compared to the predictions of a fixation probability analysis. We confirm earlier results on the success of the Pavlov strategy in a wide range of parameters for the iterated Prisoner's Dilemma, but find that as the temptation to defect grows there are many other possible successful strategies. Other regions of the diagram reflect the equilibria structure of the underlying one-shot game, albeit often some non-expected strategies arise as well. We thus provide a thorough analysis of iterated 2 × 2 games from which we are able to extract some general conclusions. Our most relevant finding is that a great deal of the payoff parameter range can still be understood by focusing on win-stay, lose-shift strategies, and that very ambitious ones, aspiring to obtaining always a high payoff, are never evolutionary stable.

  17. Changes in surgical team performance and safety climate attitudes following expansion of perioperative services: a repeated-measures study.

    Science.gov (United States)

    Gillespie, Brigid M; Harbeck, Emma; Kang, Evelyn; Steel, Catherine; Fairweather, Nicole; Chaboyer, Wendy

    2017-08-10

    Objective The aim of the present study was to describe process changes in surgical team performance and team members' attitudes to safety culture following hospital relocation and expansion of perioperative services.Methods The study was a naturalistic study using structured observations and surveys to assess non-technical skills (NTS; i.e. communication, teamwork, situational awareness, decision making and leadership) in surgery. This interrupted time series design used mixed-linear regression models to examine the effect of phase (before and after hospital relocation) on surgical teams' NTS and their processes that may affect performance. Differences in self-reported teamwork and safety climate attitudes were also examined.Results In all, 186 procedures (100 before and 81 after hospital relocation) were observed across teams working in general, paediatric, orthopaedic and thoracic surgeries. Interobserver agreement ranged from 86% to 95%. An effect of phase was found, indicating that there were significant improvements after relocation in the use of NTS by the teams observed (P=0.020; 95% confidence interval 1.9-4.7).Conclusions The improvements seen in surgical teams' NTS performance and safety culture attitudes may be related to the move to a new state-of-the-art perioperative department.What is known about the topic? Patient safety in surgery relies on optimal team performance, underpinned by effective NTS.What does this paper add? The NTS of surgical teams may be improved through ergonomic innovations that promote teams' shared mental models.What are the implications for practitioners? Effective multidisciplinary teamwork relies on a combination of NTS and ergonomic factors, which inherently contribute to team performance and safety climate attitudes.

  18. Feedback from an image of finger and an actual finger produce similar prismatic after-effect: a repeated measures study

    DEFF Research Database (Denmark)

    Wilms, Inge Linda; Assentoft, Emilie

    2014-01-01

    by seeing their fingertip. In the second condition subjects saw an image of a fingertip. The results indicate that the two conditions are significantly different. The study is an important step in understanding what actually makes a difference in training when trying to convert paper-and-pencil training...... if it is the format rather than the indirectness of the feedback creating this difference. 27 healthy subjects were subjected to a single session of Prism Adaptation Training under two different feedback conditions. In the first feedback condition, subjects were exposed to visual feedback on pointing precision...

  19. Long-term facial improvement after repeated BoNT-A injections and mirror biofeedback exercises for chronic facial synkinesis: a case-series study.

    Science.gov (United States)

    Mandrini, Silvia; Comelli, Mario; Dall'angelo, Anna; Togni, Rossella; Cecini, Miriam; Pavese, Chiara; Dalla Toffola, Elena

    2016-12-01

    Only few studies have considered the effects of the combined treatment with onabotulinumtoxinA (BoNT-A) injections and biofeedback (BFB) rehabilitation in the recovery of postparetic facial synkinesis (PPFS). To explore the presence of a persistent improvement in facial function out of the pharmacological effect of BoNT-A in subjects with established PPFS, after repeated sessions of BoNT-A injections combined with an educational facial training program using mirror biofeedback (BFB) exercises. Secondary objective was to investigate the trend of the presumed persistent improvement. Case-series study. Outpatient Clinic of Physical Medicine and Rehabilitation Unit. Twenty-seven patients (22 females; mean age 45±16 years) affected by an established peripheral facial palsy, treated with a minimum of three BoNT-A injections in association with mirror BFB rehabilitation. The interval between consecutive BoNT-A injections was at least five months. At baseline and before every BoNT-A injection+mirror BFB session (when the effect of the previous BoNT-A injection had vanished), patients were assessed with the Italian version of Sunnybrook Facial Grading System (SB). The statistical analysis considered SB composite and partial scores before each treatment session compared to the baseline scores. A significant improvement of the SB composite and partial scores was observed until the fourth session. Considering the "Symmetry of Voluntary Movement" partial score, the main improvement was observed in the muscles of the lower part of the face. In a chronic stage of postparetic facial synkinesis, patients may benefit from a combined therapy with repeated BoNT-A injections and an educational facial training program with mirror BFB exercises, gaining an improvement of the facial function up to the fourth session. This improvement reflects the acquired ability to use facial muscle correctly. It doesn't involve the injected muscles but those trained with mirror biofeedback exercises

  20. Repeated dose studies with pure Epigallocatechin-3-gallate demonstrated dose and route dependant hepatotoxicity with associated dyslipidemia

    Directory of Open Access Journals (Sweden)

    Balaji Ramachandran

    2016-01-01

    Full Text Available EGCG (Epigallocatechin-3-gallate is the major active principle catechin found in green tea. Skepticism regarding the safety of consuming EGCG is gaining attention, despite the fact that it is widely being touted for its potential health benefits, including anti-cancer properties. The lack of scientific data on safe dose levels of pure EGCG is of concern, while EGCG has been commonly studied as a component of GTE (Green tea extract and not as a single active constituent. This study has been carried out to estimate the maximum tolerated non-toxic dose of pure EGCG and to identify the treatment related risk factors. In a fourteen day consecutive treatment, two different administration modalities were compared, offering an improved [i.p (intraperitoneal] and limited [p.o (oral] bioavailability. A trend of dose and route dependant hepatotoxicity was observed particularly with i.p treatment and EGCG increased serum lipid profile in parallel to hepatotoxicity. Fourteen day tolerable dose of EGCG was established as 21.1 mg/kg for i.p and 67.8 mg/kg for p.o. We also observed that, EGCG induced effects by both treatment routes are reversible, subsequent to an observation period for further fourteen days after cessation of treatment. It was demonstrated that the severity of EGCG induced toxicity appears to be a function of dose, route of administration and period of treatment.

  1. Study on critical heat flux in narrow rectangular channel with repeated-rib roughness. 1. Experimental facility and preliminary experiments

    Energy Technology Data Exchange (ETDEWEB)

    Kinoshita, Hidetaka; Terada, Atsuhiko; Kaminaga, Masanori; Hino, Ryutaro [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    2001-10-01

    In the design of a spallation target system, the water cooling system, for example a proton beam window and a safety hull, is used with narrow channels, in order to remove high heat flux and prevent lowering of system performance by absorption of neutron. And in narrow channel, heat transfer enhancement using 2-D rib is considered for reduction the cost of cooling component and decrease inventory of water in the cooling system, that is, decrease of the amount of irradiated water. But few studies on CHF with rib have been carried out. Experimental and analytical studies with rib-roughened test section, in 10:1 ratio of pitch to height, are being carried out in order to clarify the CHF in rib-roughened channel. This paper presents the review of previous researches on heat transfer in channel with rib roughness, overview of the test facility and the preliminary experimental and analytical results. As a result, wall friction factors were about 3 times as large as that of smooth channel, and heat transfer coefficients are about 2 times as large as that of smooth channel. The obtained CHF was as same as previous mechanistic model by Sudo. (author)

  2. Repeated head trauma is associated with smaller thalamic volumes and slower processing speed: the Professional Fighters' Brain Health Study.

    Science.gov (United States)

    Bernick, Charles; Banks, Sarah J; Shin, Wanyong; Obuchowski, Nancy; Butler, Sam; Noback, Michael; Phillips, Michael; Lowe, Mark; Jones, Stephen; Modic, Michael

    2015-08-01

    Cumulative head trauma may alter brain structure and function. We explored the relationship between exposure variables, cognition and MRI brain structural measures in a cohort of professional combatants. 224 fighters (131 mixed martial arts fighters and 93 boxers) participating in the Professional Fighters Brain Health Study, a longitudinal cohort study of licensed professional combatants, were recruited, as were 22 controls. Each participant underwent computerised cognitive testing and volumetric brain MRI. Fighting history including years of fighting and fights per year was obtained from self-report and published records. Statistical analyses of the baseline evaluations were applied cross-sectionally to determine the relationship between fight exposure variables and volumes of the hippocampus, amygdala, thalamus, caudate, putamen. Moreover, the relationship between exposure and brain volumes with cognitive function was assessed. Increasing exposure to repetitive head trauma measured by number of professional fights, years of fighting, or a Fight Exposure Score (FES) was associated with lower brain volumes, particularly the thalamus and caudate. In addition, speed of processing decreased with decreased thalamic volumes and with increasing fight exposure. Higher scores on a FES used to reflect exposure to repetitive head trauma were associated with greater likelihood of having cognitive impairment. Greater exposure to repetitive head trauma is associated with lower brain volumes and lower processing speed in active professional fighters. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  3. Violence towards health care workers in a Public Health Care Facility in Italy: a repeated cross-sectional study

    Directory of Open Access Journals (Sweden)

    Magnavita Nicola

    2012-05-01

    Full Text Available Abstract Background Violence at work is one of the major concerns in health care activities. The aim of this study was to identify the prevalence of physical and non-physical violence in a general health care facility in Italy and to assess the relationship between violence and psychosocial factors, thereby providing a basis for appropriate intervention. Methods All health care workers from a public health care facility were invited to complete a questionnaire containing questions on workplace violence. Three questionnaire-based cross-sectional surveys were conducted. The response rate was 75 % in 2005, 71 % in 2007, and 94 % in 2009. The 2009 questionnaire contained the VIF (Violent Incident Form for reporting violent incidents, the DCS (demand/control/support model for job strain, the Colquitt 20 item questionnaire for perceived organizational justice, and the GHQ-12 General Health Questionnaire for the assessment of mental health. Results One out of ten workers reported physical assault, and one out of three exposure to non-physical violence in the workplace in the previous year. Nurses and physicians were the most exposed occupational categories, whereas the psychiatric and emergency departments were the services at greatest risk of violence. Workers exposed to non-physical violence were subject to high job strain, low support, low perceived organizational justice, and high psychological distress. Conclusion Our study shows that health care workers in an Italian local health care facility are exposed to violence. Workplace violence was associated with high demand and psychological disorders, while job control, social support and organizational justice were protective factors.

  4. Fatigue In U12 Soccer-7 Players During Repeated One-Day Tournament Games - A Pilot Study.

    Science.gov (United States)

    Sanchez-Sanchez, Javier; Sanchez, Mario; Hernandez, Daniel; Ramirez-Campillo, Rodrigo; Martínez, Cristian; Nakamura, Fabio Y

    2017-07-12

    The aim of this study was to describe and compare the distances and displacement speeds of U12 Soccer-7 athletes during four tournament Soccer-7 games (TG) played in less than 24-h (experimental condition) with those recorded during two league Soccer-7 games (LG) with 24-h of rest prior to the match (control condition). Ten participants (age = 10.3 ± 0.5 years) were recruited for the study. Main data analyzed during games included distance completed relative to match duration (Drel), maximal velocity and distance completed at different running speeds (including acceleration, deceleration, standing, walking, jogging, medium-intensity running, high-intensity running and sprinting). For data collection during games, athletes wore a GPS unit. Different (p0.05) and during the two LG between 84.2 ± 10.9 m/min and 87.5 ± 9.9 m/min (P>0.05). Moreover, similar Drel was recorded during TG and LG (86.8 m/min and 85.9 m/min, respectively). Compared to LG, during TG maximal velocity was lower (23.0 km/h and 21.3 km/h, respectively; Pgame of the tournament, in the preceding games the distance covered at low speeds (3.1-8.0 km/h) was lower (37.7% and 32.4%, respectively; Pgames with less than 24-h of inter-day rest negatively affects displacement speeds distribution (but not overall relative distances) in U12 Soccer-7 athletes. These results may help to better plan training and competition schedules to youth players.

  5. Effects of ambient air pollution on functional status in patients with chronic congestive heart failure: a repeated-measures study

    Directory of Open Access Journals (Sweden)

    Phillips Russell S

    2007-09-01

    Full Text Available Abstract Background Studies using administrative data report a positive association between ambient air pollution and the risk of hospitalization for congestive heart failure (HF. Circulating levels of B-type natriuretic peptide (BNP are directly associated with cardiac hemodynamics and symptom severity in patients with HF and, therefore, serves as a marker of functional status. We tested the hypothesis that BNP levels would be positively associated with short-term changes in ambient pollution levels among 28 patients with chronic stable HF and impaired systolic function. Methods BNP was measured in whole blood at 0, 6, and 12 weeks. We used linear mixed models to evaluate the association between fine particulate matter (PM2.5, carbon monoxide, sulfur dioxide, nitrogen dioxide, ozone, and black carbon and log(BNP. Lags of 0 to 3 days were considered in separate models. We calculated the intraclass correlation coefficient and within-subject coefficient of variation as measures of reproducibility. Results We found no association between any pollutant and measures of BNP at any lag. For example, a 10 μg/m3 increase in PM2.5 was associated with a 0.8% (95% CI: -16.4, 21.5; p = 0.94 increase in BNP on the same day. The within-subject coefficient of variation was 45% on the natural scale and 9% on the log scale. Conclusion These results suggest that serial BNP measurements are unlikely to be useful in a longitudinal study of air pollution-related acute health effects. The magnitude of expected ambient air pollution health effects appears small in relation to the considerable within-person variability in BNP levels in this population.

  6. Characterization of regional left ventricular function in nonhuman primates using magnetic resonance imaging biomarkers: a test-retest repeatability and inter-subject variability study.

    Directory of Open Access Journals (Sweden)

    Smita Sampath

    Full Text Available Pre-clinical animal models are important to study the fundamental biological and functional mechanisms involved in the longitudinal evolution of heart failure (HF. Particularly, large animal models, like nonhuman primates (NHPs, that possess greater physiological, biochemical, and phylogenetic similarity to humans are gaining interest. To assess the translatability of these models into human diseases, imaging biomarkers play a significant role in non-invasive phenotyping, prediction of downstream remodeling, and evaluation of novel experimental therapeutics. This paper sheds insight into NHP cardiac function through the quantification of magnetic resonance (MR imaging biomarkers that comprehensively characterize the spatiotemporal dynamics of left ventricular (LV systolic pumping and LV diastolic relaxation. MR tagging and phase contrast (PC imaging were used to quantify NHP cardiac strain and flow. Temporal inter-relationships between rotational mechanics, myocardial strain and LV chamber flow are presented, and functional biomarkers are evaluated through test-retest repeatability and inter subject variability analyses. The temporal trends observed in strain and flow was similar to published data in humans. Our results indicate a dominant dimension based pumping during early systole, followed by a torsion dominant pumping action during late systole. Early diastole is characterized by close to 65% of untwist, the remainder of which likely contributes to efficient filling during atrial kick. Our data reveal that moderate to good intra-subject repeatability was observed for peak strain, strain-rates, E/circumferential strain-rate (CSR ratio, E/longitudinal strain-rate (LSR ratio, and deceleration time. The inter-subject variability was high for strain dyssynchrony, diastolic strain-rates, peak torsion and peak untwist rate. We have successfully characterized cardiac function in NHPs using MR imaging. Peak strain, average systolic strain

  7. Between two roles - Experiences of newly trained nurse practitioners in surgical care in Sweden: A qualitative study using repeated interviews.

    Science.gov (United States)

    Jangland, Eva; Yngman Uhlin, Pia; Arakelian, Erebouni

    2016-11-01

    The position of Nurse Practitioner is a new role in Nordic countries. The transition from a registered nurse to the Nurse Practitioner role has been reported to be a personal challenge. This study, guided by the Nordic theoretical model for use in the education of advanced practice nurses, represents a unique opportunity to describe this transition for newly graduated Nurse Practitioners in an interprofessional surgical care team in Sweden. The aim was to explore how the first Nurse Practitioners in surgical care experienced the transition into a new role and what competences they used in the team. Eight new Nurse Practitioners with parallel work in clinical practice were interviewed twice around the time of their graduation. The qualitative analyses show that the participants integrated several central competences, but the focus in this early stage in their new role was on direct clinical praxis, consultation, cooperation, case management, and coaching. Transition from the role of clinical nurse specialist to nurse practitioner was a challenging process in which the positive response from patients was a driving force for the new Nurse Practitioners. The participants felt prepared for and determined to solve the challenging situations they approached working in the interprofessional team.

  8. (1)H NMR-based metabolomics study on repeat dose toxicity of fine particulate matter in rats after intratracheal instillation.

    Science.gov (United States)

    Zhang, Yannan; Hu, Hejing; Shi, Yanfeng; Yang, Xiaozhe; Cao, Lige; Wu, Jing; Asweto, Collins Otieno; Feng, Lin; Duan, Junchao; Sun, Zhiwei

    2017-07-01

    Systemic metabolic effects and toxicity mechanisms of ambient fine particulate matter (PM2.5) remain uncertain. In order to investigate the mechanisms in PM2.5 toxicity, we explored the endogenous metabolic changes and possible influenced metabolic pathways in rats after intratracheal instillation of PM2.5 by using a (1)H nuclear magnetic resonance (NMR)-based metabolomics approach. Liver and kidney histopathology examinations were also performed. Chemical characterization demonstrated that PM2.5 was a complex mixture of elements. Histopathology showed cellular edema in liver and glomerulus atrophy of the PM2.5 treated rats. We systematically analyzed the metabolites changes of serum and urine in rats using (1)H NMR techniques in combination with multivariate statistical analysis. Significantly reduced levels of lactate, alanine, dimethylglycine, creatine, glycine and histidine in serum, together with increased levels of citrate, arginine, hippurate, allantoin and decreased levels of allthreonine, lactate, alanine, acetate, succinate, trimethylamine, formate in urine were observed of PM2.5 treated rats. The mainly affected metabolic pathways by PM2.5 were glycine, serine and threonine metabolism, glyoxylate and dicarboxylate metabolism, citrate cycle (TCA cycle), nitrogen metabolism and methane metabolism. Our study provided important information on assessing the toxicity of PM2.5 and demonstrated that metabolomics approach can be employed as a tool to understand the toxicity mechanism of complicated environmental pollutants. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Socioeconomic inequalities in smoking in The Netherlands before and during the Global Financial Crisis: a repeated cross-sectional study.

    Science.gov (United States)

    Benson, Fiona E; Kuipers, Mirte A G; Nierkens, Vera; Bruggink, Jan-Willem; Stronks, Karien; Kunst, Anton E

    2015-05-06

    The Global Financial Crisis (GFC) increased levels of financial strain, especially in those of low socioeconomic status (SES). Financial strain can affect smoking behaviour. This study examines socioeconomic inequalities in current smoking and smoking cessation in The Netherlands before and during the Global Financial Crisis (GFC). Participants were 66,960 Dutch adults (≥ 18 years) who took part in the annual national Health Survey (2004-2011). Period was dichotomised: 'pre-' and 'during-GFC'. SES measures used were income, education and neighbourhood deprivation. Outcomes were current smoking rates (smokers/total population) and smoking cessation ratios (former smokers/ever smokers). Multilevel logistic regression models controlled for individual characteristics and tested for interaction between period and SES. In both periods, high SES respondents (in all indicators) had lower current smoking levels and higher cessation ratios than those of middle or low SES. Inequalities in current smoking increased significantly in poorly educated adults of 45-64 years of age (Odds Ratio (OR) low educational level compared with high: 2.00[1.79-2.23] compared to pre-GFC 1.67[1.50-1.86], p for interaction = 0.02). Smoking cessation inequalities by income in 18-30 year olds increased with borderline significance during the GFC (OR low income compared to high income: 0.73[0.58-0.91]) compared to pre-GFC (OR: 0.98[0.80-1.20]), p for interaction = 0.051). Overall, socioeconomic inequalities in current smoking and smoking cessation were unchanged during the GFC. However, current smoking inequalities by education, and smoking cessation inequalities by income, increased in specific age groups. Increased financial strain caused by the crisis may disproportionately affect smoking behaviour in some disadvantaged groups.

  10. Burden of hospital admission and repeat angiography in angina pectoris patients with and without coronary artery disease: a registry-based cohort study.

    Directory of Open Access Journals (Sweden)

    Lasse Jespersen

    Full Text Available AIMS: To evaluate risk of hospitalization due to cardiovascular disease (CVD and repeat coronary angiography (CAG in stable angina pectoris (SAP with no obstructive coronary artery disease (CAD versus obstructive CAD, and asymptomatic reference individuals. METHODS AND RESULTS: We followed 11,223 patients with no prior CVD having a first-time CAG in 1998-2009 due to SAP symptoms and 5,695 asymptomatic reference individuals from the Copenhagen City Heart Study through registry linkage for 7.8 years (median. In recurrent event survival analysis, patients with SAP had 3-4-fold higher risk of hospitalization for CVD irrespective of CAG findings and cardiovascular comorbidity. Multivariable adjusted hazard ratios(95%CI for patients with angiographically normal coronary arteries was 3.0(2.5-3.5, for angiographically diffuse non-obstructive CAD 3.9(3.3-4.6 and for 1-3-vessel disease 3.6-4.1(range(all P<0.001. Mean accumulated hospitalization time was 3.5(3.0-4.0(days/10 years follow-up in reference individuals and 4.5(3.8-5.2/7.0(5.4-8.6/6.7(5.2-8.1/6.1(5.2-7.4/8.6(6.6-10.7 in patients with angiographically normal coronary arteries/angiographically diffuse non-obstructive CAD/1-, 2-, and 3-vessel disease, respectively (all P<0.05, age-adjusted. SAP symptoms predicted repeat CAG with multivariable adjusted hazard ratios for patients with angiographically normal coronary arteries being 2.3(1.9-2.9, for angiographically diffuse non-obstructive CAD 5.5(4.4-6.8 and for obstructive CAD 6.6-9.4(range(all P<0.001. CONCLUSIONS: Patients with SAP symptoms and angiographically normal coronary arteries or angiographically diffuse non-obstructive CAD suffer from considerably greater CVD burdens in terms of hospitalization for CVD and repeat CAG compared with asymptomatic reference individuals even after adjustment for cardiac risk factors and exclusion of cardiovascular comorbidity as cause. Contrary to common perception, excluding obstructive CAD by CAG in such

  11. Facilitating the Development and Evaluation of a Citizen Science Web Site: A Case Study of Repeat Photography and Climate Change in Southwest Alaska's National Parks

    Science.gov (United States)

    Mullen, Karina C.; Newman, Gregory; Thompson, Jessica L.

    2013-01-01

    Interviews with national park visitors across the country revealed that climate change education through place-based, hands-on learning using repeat photographs and technology is appealing to park visitors. This manuscript provides a summary of the development of a repeat photography citizen science Web site for national parks in Southwest Alaska.…

  12. Facilitating the Development and Evaluation of a Citizen Science Web Site: A Case Study of Repeat Photography and Climate Change in Southwest Alaska's National Parks

    Science.gov (United States)

    Mullen, Karina C.; Newman, Gregory; Thompson, Jessica L.

    2013-01-01

    Interviews with national park visitors across the country revealed that climate change education through place-based, hands-on learning using repeat photographs and technology is appealing to park visitors. This manuscript provides a summary of the development of a repeat photography citizen science Web site for national parks in Southwest Alaska.…

  13. Childhood experiences and repeated suicidal behavior

    DEFF Research Database (Denmark)

    Krarup, Gertrud; Nielsen, Bent; Rask, P

    1991-01-01

    The aim of this study was to elucidate the influence of various events in childhood on suicidal behavior in adult age. For this purpose, 99 patients admitted to the Department of Psychiatry of Odense University Hospital after making a suicide attempt were followed for 5 years, to register repeated...... suicidal behavior. The results showed that three fourths of the patients attempted suicide more than once (62% nonfatal and 14% fatal outcome). The sex distribution was about the same among the first-evers as among the repeaters. Most repeaters were younger people in their twenties and thirties......, and the first-evers on average were past the age of 40. Somewhat unexpectedly, significantly more repeaters than first-evers had grown up with both their parents. However, the results also showed that significantly more repeaters than first-evers had had an unhappy childhood. This indicates...

  14. Repeated administration of D-amphetamine induces loss of [{sup 123}I]FP-CIT binding to striatal dopamine transporters in rat brain: a validation study

    Energy Technology Data Exchange (ETDEWEB)

    Booij, Jan [Department of Nuclear Medicine, Academic Medical Center, 1105 AZ Amsterdam (Netherlands)]. E-mail: j.booij@amc.uva.nl; Bruin, Kora de [Department of Nuclear Medicine, Academic Medical Center, 1105 AZ Amsterdam (Netherlands); Gunning, W. Boudewijn [Department of Neurology, Epilepsy Centre Kempenhaeghe, 5590 AB Heeze (Netherlands)

    2006-04-15

    In recent years, several PET and SPECT studies have shown loss of striatal dopamine transporter (DAT) binding in amphetamine (AMPH) users. However, the use of DAT SPECT tracers to detect AMPH-induced changes in DAT binding has not been validated. We therefore examined if repeated administration of D-AMPH or methamphetamine (METH) may induce loss of binding to striatal DATs in rats by using an experimental biodistribution study design and a SPECT tracer for the DAT ([{sup 123}I]FP-CIT). Methods: Groups of male rats (n=10 per group) were treated with D-AMPH (10 mg/kg body weight), METH (10 mg/kg body weight), or saline, twice a day for 5 consecutive days. Five days later, [{sup 123}I]FP-CIT was injected intravenously, and 2 h later, the rats were sacrificed and radioactivity was assayed. Results: In D-AMPH but not METH-treated rats, striatal [{sup 123}I]FP-CIT uptake was significantly lower (approximately 17%) than in the control group. Conclusion: These data show that [{sup 123}I]FP-CIT can be used to detect AMPH-induced changes in DAT binding and may validate the use of DAT radiotracers to study AMPH-induced changes in striatal DAT binding in vivo.

  15. Estimation of acute oral toxicity using the No Observed Adverse Effect Level (NOAEL) from the 28 day repeated dose toxicity studies in rats.

    Science.gov (United States)

    Bulgheroni, Anna; Kinsner-Ovaskainen, Agnieszka; Hoffmann, Sebastian; Hartung, Thomas; Prieto, Pilar

    2009-02-01

    Acute systemic toxicity is one of the areas of particular concern due to the 2009 deadline set by the 7th Amendment of the Cosmetics Directive (76/768/EEC), which introduces a testing and marketing ban of cosmetic products with ingredients tested on animals. The scientific community is putting considerable effort into developing and validating non-animal alternatives in this area. However, it is unlikely that validated and regulatory accepted alternative methods and/or strategies will be available in March 2009. Following the initiatives undertaken in the pharmaceutical industry to waive the acute oral toxicity testing before going to clinical studies by using information from other in vivo studies, we proposed an approach to identify non-toxic compounds (LD50>2000mg/kg) using information from 28 days repeated dose toxicity studies. Taking into account the high prevalence of non-toxic substances (87%) in the New Chemicals Database, it was possible to set a NOAEL threshold of 200mg/kg that allowed the correct identification of 63% of non-toxic compounds, while testing of cosmetic ingredients.

  16. Influence of coefficient of variation in determining significant difference of quantitative values obtained from 28-day repeated-dose toxicity studies in rats.

    Science.gov (United States)

    Kobayashi, Katsumi; Sakuratani, Yuki; Abe, Takemaru; Yamazaki, Kazuko; Nishikawa, Satoshi; Yamada, Jun; Hirose, Akihiko; Kamata, Eiichi; Hayashi, Makoto

    2011-01-01

    In order to understand the influence of coefficient of variation (CV) in determining significant difference of quantitative values of 28-day repeated-dose toxicity studies, we examined 59 parameters of 153 studies conducted in accordance with Chemical Substance Control Law in 12 test facilities. Sex difference was observed in 12 parameters and 10 parameters showed large CV in females. The minimum CV was 0.74% for sodium. CV of electrolytes was comparatively small, whereas enzymes had large CV. Large differences in CV were observed for major parameters among 7-8 test facilities. The changes in CV were grossly classified into 11. Our study revealed that a statistical significant difference is usually detected if there is a difference of 7% in mean values between the groups and the groups have a CV of about 7%. A parameter with a CV as high as 30% may be significantly different, if the difference of the mean between the groups is 30%. It would be ideal to use median value to assess the treatment-related effect, rather than mean, when the CV is very high. We recommend using CV of the body weight as a standard to judge the adverse effect level.

  17. Common interruptions in the repeating tripeptide sequence of non-fibrillar collagens: sequence analysis and structural studies on triple-helix peptide models.

    Science.gov (United States)

    Thiagarajan, Geetha; Li, Yingjie; Mohs, Angela; Strafaci, Christopher; Popiel, Magdalena; Baum, Jean; Brodsky, Barbara

    2008-02-22

    Interruptions in the repeating (Gly-X1-X2)(n) amino acid sequence pattern are found in the triple-helix domains of all non-fibrillar collagens, and perturbations to the triple-helix at such sites are likely to play a role in collagen higher-order structure and function. This study defines the sequence features and structural consequences of the most common interruption, where one residue is missing from the tripeptide pattern, Gly-X1-X2-Gly-AA(1)-Gly-X1-X2, designated G1G interruptions. Residues found within G1G interruptions are predominantly hydrophobic (70%), followed by a significant amount of charged residues (16%), and the Gly-X1-X2 triplets flanking the interruption are atypical. Studies on peptide models indicate the degree of destabilization is much greater when Pro is in the interruption, GP, than when hydrophobic residues (GF, GY) are present, and a rigid Gly-Pro-Hyp tripeptide adjacent to the interruption leads to greater destabilization than a flexible Gly-Ala-Ala sequence. Modeling based on NMR data indicates the Phe residue within a GF interruption is located on the outside of the triple helix. The G1G interruptions resemble a previously studied collagen interruption GPOGAAVMGPO, designated G4G-type, in that both are destabilizing, but allow continuation of rod-like triple helices and maintenance of the single residue stagger throughout the imperfection, with a loss of axial register of the superhelix on both sides. Both kinds of interruptions result in a highly localized perturbation in hydrogen bonding and dihedral angles, but the hydrophobic residue of a G4G interruption packs near the central axis of the superhelix, while the hydrophobic residue of a G1G interruption is located on the triple-helix surface. The different structural consequences of G1G and G4G interruptions in the repeating tripeptide sequence pattern suggest a physical basis for their differential susceptibility to matrix metalloproteinases in type X collagen.

  18. Evidence of cormorant-induced mortality, disparate migration strategies and repeatable circadian rhythm in the endangered North Sea houting (Coregonus oxyrinchus): A telemetry study mapping the postspawning migration

    DEFF Research Database (Denmark)

    Jensen, Lasse Fast; Rognon, Paul C.B.; Aarestrup, Kim

    2017-01-01

    , possibly indicating constrained navigation through the lakes. The migration into the Wadden Sea correlated with temperature indicating osmoregulatory constraints of sea entry. Unlike most salmonid species, migration occurred both day and night. Moreover, fish exhibited repeatable individual differences...

  19. Simulated Conversations With Virtual Humans to Improve Patient-Provider Communication and Reduce Unnecessary Prescriptions for Antibiotics: A Repeated Measure Pilot Study

    Science.gov (United States)

    2017-01-01

    Background Despite clear evidence that antibiotics do not cure viral infections, the problem of unnecessary prescribing of antibiotics in ambulatory care persists, and in some cases, prescribing patterns have increased. The overuse of antibiotics for treating viral infections has created numerous economic and clinical consequences including increased medical costs due to unnecessary hospitalizations, antibiotic resistance, disruption of gut bacteria, and obesity. Recent research has underscored the importance of collaborative patient-provider communication as a means to reduce the high rates of unnecessary prescriptions for antibiotics. However, most patients and providers do not feel prepared to engage in such challenging conversations. Objectives The aim of this pilot study was to assess the ability of a brief 15-min simulated role-play conversation with virtual humans to serve as a preliminary step to help health care providers and patients practice, and learn how to engage in effective conversations about antibiotics overuse. Methods A total of 69 participants (35 providers and 34 patients) completed the simulation once in one sitting. A pre-post repeated measures design was used to assess changes in patients’ and providers’ self-reported communication behaviors, activation, and preparedness, intention, and confidence to effectively communicate in the patient-provider encounter. Changes in patients’ knowledge and beliefs regarding antibiotic use were also evaluated. Results Patients experienced a short-term positive improvement in beliefs about appropriate antibiotic use for infection (F1,30=14.10, P=.001). Knowledge scores regarding the correct uses of antibiotics improved immediately postsimulation, but decreased at the 1-month follow-up (F1,30=31.16, P.10) Patients with lower levels of activation exhibited positive, short-term benefits in increased intent and confidence to discuss their needs and ask questions in the clinic visit, positive attitudes

  20. Repeatability of Cryogenic Multilayer Insulation

    Science.gov (United States)

    Johnson, W. L.; Vanderlaan, M.; Wood, J. J.; Rhys, N. O.; Guo, W.; Van Sciver, S.; Chato, D. J.

    2017-01-01

    Due to the variety of requirements across aerospace platforms, and one off projects, the repeatability of cryogenic multilayer insulation has never been fully established. The objective of this test program is to provide a more basic understanding of the thermal performance repeatability of MLI systems that are applicable to large scale tanks. There are several different types of repeatability that can be accounted for: these include repeatability between multiple identical blankets, repeatability of installation of the same blanket, and repeatability of a test apparatus. The focus of the work in this report is on the first two types of repeatability. Statistically, repeatability can mean many different things. In simplest form, it refers to the range of performance that a population exhibits and the average of the population. However, as more and more identical components are made (i.e. the population of concern grows), the simple range morphs into a standard deviation from an average performance. Initial repeatability testing on MLI blankets has been completed at Florida State University. Repeatability of five GRC provided coupons with 25 layers was shown to be +/- 8.4 whereas repeatability of repeatedly installing a single coupon was shown to be +/- 8.0. A second group of 10 coupons have been fabricated by Yetispace and tested by Florida State University, through the first 4 tests, the repeatability has been shown to be +/- 16. Based on detailed statistical analysis, the data has been shown to be statistically significant.

  1. The effects of repeated administration of camphor-crataegus berry extract combination on blood pressure and on attentional performance - a randomized, placebo-controlled, double-blind study.

    Science.gov (United States)

    Erfurt, L; Schandry, R; Rubenbauer, S; Braun, U

    2014-09-25

    The present study investigated the effects of repeated administration of Korodin(®), a combination of camphor and crataegus berry extract, on blood pressure and attentional functioning. This study was conducted based on a randomized, placebo-controlled, double-blind design. 54 persons participated (33 female, 21 male) with a mean age of 24.3 years. Blood pressure and body mass index were in the normal range. Participants received 20 drops of either Korodin(®) or a placebo for four times with interjacent time intervals of about 10 min. Blood pressure was measured sphygmomanometrically before and after each administration. Attentional performance was quantified by using two paper-and-pencil tests, the d2 Test of Attention and Digit Symbol Test. Greater increases in blood pressure occurred after the four Korodin(®) administrations in comparison to the four placebo administrations. The performance in two parameters of d2 Test of Attention was consistently superior after the intake of Korodin(®). The excellent tolerability and safety of Korodin(®), even after a total consumption of 80 drops, was confirmed. Copyright © 2014 Elsevier GmbH. All rights reserved.

  2. Determination of the ideal sampling technique to reduce repeated procedures:a comparative study including 393 fine-needle aspirations for thyroid nodules.

    Science.gov (United States)

    Uzunkaya, Fatih; Özden, Ahmet

    2017-02-27

    Fine-needle aspiration biopsy is an established method for the evaluation of thyroid nodules, but it has not been standardized worldwide yet. Adequacy of the aspirations is affected by several factors. The aim of this study is to determine the main factors affecting the adequacy and to suggest a procedural technique expected to reduce repeated procedures. A total of 393 aspiration procedures performed using either 22-gauge or 27-gauge needles were included in the study. The samplings were classified as inadequate or adequate according to the cytopathological reports, and results were compared. The rate of adequate samplings was higher in the 27-gauge group and the difference was statistically significant. Neither the size of nodules nor the number of slides used for smearing affected the adequacy. There was not a statistically significant relation between the needle size and the nodule size or the number of slides in terms of adequacy. Needle size is an important factor that affects the adequacy of samplings. The nodule size and the number of slides do not affect the adequacy. However, bloody and thicker smears are difficult for pathologists to evaluate and result in inadequacy.

  3. Diurnal variations of plasma homocysteine, total antioxidant status, and biological markers of muscle injury during repeated sprint: effect on performance and muscle fatigue--a pilot study.

    Science.gov (United States)

    Hammouda, Omar; Chtourou, Hamdi; Chahed, Henda; Ferchichi, Salyma; Kallel, Choumous; Miled, Abdelhedi; Chamari, Karim; Souissi, Nizar

    2011-12-01

    The aim of this study was (i) to evaluate whether homocysteine (Hcy), total antioxidant status (TAS), and biological markers of muscle injury would be affected by time of day (TOD) in football players and (ii) to establish a relationship between diurnal variation of these biomarkers and the daytime rhythm of power and muscle fatigue during repeated sprint ability (RSA) exercise. In counterbalanced order, 12 football (soccer) players performed an RSA test (5 x[6 s of maximal cycling sprint + 24 s of rest]) on two different occasions: 07:00-08:30 h and 17:00-18:30 h. Fasting blood samples were collected from a forearm vein before and 3-5 min after each RSA test. Core temperature, rating of perceived exertion, and performances (i.e., Sprint 1, Sprint 2, and power decrease) during the RSA test were significantly higher at 17:00 than 07:00 h (p RSA test. However, biomarkers of antioxidant status' resting levels (i.e., total antioxidant status, uric acid, and total bilirubin) were higher in the morning. This TOD effect was suppressed after exercise for TAS and uric acid. In conclusion, the present study confirms diurnal variation of Hcy, selected biological markers of cellular damage, and antioxidant status in young football players. Also, the higher performances and muscle fatigue showed in the evening during RSA exercise might be due to higher levels of biological markers of muscle injury and lower antioxidant status at this TOD.

  4. Repeatability of clades as a criterion of reliability: a case study for molecular phylogeny of Acanthomorpha (Teleostei) with larger number of taxa.

    Science.gov (United States)

    Chen, Wei-Jen; Bonillo, Céline; Lecointre, Guillaume

    2003-02-01

    Although much progress has been made recently in teleostean phylogeny, relationships among the main lineages of the higher teleosts (Acanthomorpha), containing more than 60% of all fish species, remain poorly defined. This study represents the most extensive taxonomic sampling effort to date to collect new molecular characters for phylogenetic analysis of acanthomorph fishes. We compiled and analyzed three independent data sets, including: (i) mitochondrial ribosomal fragments from 12S and 16s (814bp for 97 taxa); (ii) nuclear ribosomal 28S sequences (847bp for 74 taxa); and (iii) a nuclear protein-coding gene, rhodopsin (759bp for 86 taxa). Detailed analyses were conducted on each data set separately and the principle of taxonomic congruence without consensus trees was used to assess confidence in the results as follows. Repeatability of clades from separate analyses was considered the primary criterion to establish reliability, rather than bootstrap proportions from a single combined (total evidence) data matrix. The new and reliable clades emerging from this study of the acanthomorph radiation were: Gadiformes (cods) with Zeioids (dories); Beloniformes (needlefishes) with Atheriniformes (silversides); blenioids (blennies) with Gobiesocoidei (clingfishes); Channoidei (snakeheads) with Anabantoidei (climbing gouramies); Mastacembeloidei (spiny eels) with Synbranchioidei (swamp-eels); the last two pairs of taxa grouping together, Syngnathoidei (aulostomids, macroramphosids) with Dactylopteridae (flying gurnards); Scombroidei (mackerels) plus Stromatoidei plus Chiasmodontidae; Ammodytidae (sand lances) with Cheimarrhichthyidae (torrentfish); Zoarcoidei (eelpouts) with Cottoidei; Percidae (perches) with Notothenioidei (Antarctic fishes); and a clade grouping Carangidae (jacks), Echeneidae (remoras), Sphyraenidae (barracudas), Menidae (moonfish), Polynemidae (threadfins), Centropomidae (snooks), and Pleuronectiformes (flatfishes).

  5. 26-week repeated oral dose toxicity study of UP446, a combination of defined extracts of Scutellaria baicalensis and Acacia catechu, in beagle dogs.

    Science.gov (United States)

    Yimam, Mesfin; Lee, Young Chul; Jia, Qi

    2016-07-01

    The needs for relatively safe botanical alternatives to relieve symptoms associated to arthritis have continued to grow in parallel with the ageing population. UP446, a standardized bioflavonoid composition from the roots of Scutellaria baicalensis and the heartwoods of Acacia catechu, has been used as over the counter joint care dietary supplements and a prescription medical food. Significant safety data have been documented in rodents and human for this composition. Here we evaluated the potential adverse effects of orally administered UP446 in beagle dogs following a 26-week repeated oral dose toxicity study. UP446 at doses of 250, 500 and 1000 mg/kg/day were administered orally to beagle dogs for 26 weeks. A 4-week recovery group from the high dose (1000 mg/kg) and vehicle treated groups were included. No morbidity or mortality was observed for the duration of the study. No significant differences between groups in body weights, food consumption, ophthalmological examinations, electrocardiograms, urinalysis, hematology, clinical chemistry, organ weights, gross pathology and histopathology were documented. Emesis, loose feces and diarrhea were noted in both genders at the 1000 mg/kg treatment groups. These clinical signs were considered to be reversible as they were not evident in the recovery period. In conclusion, the no-observed-adverse-effect-level (NOAEL) of UP446 was considered to be 500 mg/kg/day both in male and female beagle dogs.

  6. Combination of the clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 technique with the piggybac transposon system for mouse in utero electroporation to study cortical development.

    Science.gov (United States)

    Cheng, Man; Jin, Xubin; Mu, Lili; Wang, Fangyu; Li, Wei; Zhong, Xiaoling; Liu, Xuan; Shen, Wenchen; Liu, Ying; Zhou, Yan

    2016-09-01

    In utero electroporation (IUE) is commonly used to study cortical development of cerebrum by downregulating or overexpressing genes of interest in neural progenitor cells (NPCs) of small mammals. However, exogenous plasmids are lost or diluted over time. Furthermore, gene knockdown based on short-hairpin RNAs may exert nonspecific effects that lead to aberrant neuronal migration. Genomic engineering by the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) system has great research and therapeutic potentials. Here we integrate the CRISPR/Cas9 components into the piggyBac (PB) transposon system (the CRISPR/Cas9-PB toolkit) for cortical IUEs. The mouse Sry-related HMG box-2 (Sox2) gene was selected as the target for its application. Most transduced cortical NPCs were depleted of SOX2 protein as early as 3 days post-IUE, whereas expressions of SOX1 and PAX6 remained intact. Furthermore, both the WT Cas9 and the D10A nickase mutant Cas9n showed comparable knockout efficiency. Transduced cortical cells were purified with fluorescence-activated cell sorting, and effective gene editing at the Sox2 loci was confirmed. Thus, application of the CRISPR/Cas9-PB toolkit in IUE is a promising strategy to study gene functions in cortical NPCs and their progeny. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  7. The effect of technical replicate (repeats) on Nix Pro Color Sensor™ measurement precision for meat: A case-study on aged beef colour stability.

    Science.gov (United States)

    Holman, Benjamin W B; Collins, Damian; Kilgannon, Ashleigh K; Hopkins, David L

    2017-09-04

    The Nix Pro Colour Sensor™ (NIX) can be potentially used to measure meat colour, but procedural guidelines that assure measurement reproducibility and repeatability (precision) must first be established. Technical replicate number (r) will minimise response variation, measureable as standard error of predicted mean (SEM), and contribute to improved precision. Consequently, we aimed to explore the effects of r on NIX precision when measuring aged beef colour (colorimetrics; L*, a*, b*, hue and chroma values). Each colorimetric SEM declined with increasing r to indicate improved precision and followed a diminishing rate of improvement that allowed us to recommend r=7 for meat colour studies using the NIX. This definition was based on practical limitations and a* variability, as additional r would be required if other colorimetrics or advanced levels of precision are necessary. Beef ageing and display period, holding temperature, loin and sampled portion were also found to contribute to colorimetric variation, but were incorporated within our definition of r. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  8. Multi locus variable-number tandem repeat (MLVA typing tools improved the surveillance of Salmonella enteritidis: a 6 years retrospective study.

    Directory of Open Access Journals (Sweden)

    Sophie Bertrand

    Full Text Available Surveillance of Salmonella enterica subsp. enterica serovar Enteritidis is generally considered to benefit from molecular techniques like multiple-locus variable-number of tandem repeats analysis (MLVA, which allow early detection and confinement of outbreaks. Here, a surveillance study, including phage typing, antimicrobial susceptibility testing and MLVA on 1,535 S. Enteritidis isolates collected between 2007 and 2012, was used to evaluate the added value of MLVA for public health surveillance in Belgium. Phage types PT4, PT8, PT21, PT1, PT6, PT14b, PT28 and PT13 dominate the Belgian S. Enteritidis population. The isolates of S. Enteritidis were most frequently susceptible to all antibiotics tested. 172 different MLVA profiles were detected, of which 9 frequent profiles included 67.2% of the S. Enteritidis population. During a serial passage experiment on selected isolates to investigate the in vitro stability of the 5 MLVA loci, no variations over time were observed indicating that the MLVA profiles were stable. The MLVA profile of isolates originating from different outbreaks in the Democratic Republic of the Congo (DRC between 2010 and 2011 were distinct from any of the MLVA profiles found in Belgian isolates throughout the six year observational period and demonstrates that MLVA improves public health surveillance of S. Enteritidis. However, MLVA should be complemented with other subtyping methods when investigating outbreaks is caused by the most common MLVA profile.

  9. Multi locus variable-number tandem repeat (MLVA) typing tools improved the surveillance of Salmonella enteritidis: a 6 years retrospective study.

    Science.gov (United States)

    Bertrand, Sophie; De Lamine de Bex, Guillaume; Wildemauwe, Christa; Lunguya, Octavie; Phoba, Marie France; Ley, Benedikt; Jacobs, Jan; Vanhoof, Raymond; Mattheus, Wesley

    2015-01-01

    Surveillance of Salmonella enterica subsp. enterica serovar Enteritidis is generally considered to benefit from molecular techniques like multiple-locus variable-number of tandem repeats analysis (MLVA), which allow early detection and confinement of outbreaks. Here, a surveillance study, including phage typing, antimicrobial susceptibility testing and MLVA on 1,535 S. Enteritidis isolates collected between 2007 and 2012, was used to evaluate the added value of MLVA for public health surveillance in Belgium. Phage types PT4, PT8, PT21, PT1, PT6, PT14b, PT28 and PT13 dominate the Belgian S. Enteritidis population. The isolates of S. Enteritidis were most frequently susceptible to all antibiotics tested. 172 different MLVA profiles were detected, of which 9 frequent profiles included 67.2% of the S. Enteritidis population. During a serial passage experiment on selected isolates to investigate the in vitro stability of the 5 MLVA loci, no variations over time were observed indicating that the MLVA profiles were stable. The MLVA profile of isolates originating from different outbreaks in the Democratic Republic of the Congo (DRC) between 2010 and 2011 were distinct from any of the MLVA profiles found in Belgian isolates throughout the six year observational period and demonstrates that MLVA improves public health surveillance of S. Enteritidis. However, MLVA should be complemented with other subtyping methods when investigating outbreaks is caused by the most common MLVA profile.

  10. Second time around:Corticospinal responses following repeated sports-related concussions within the same season. A transcranial magnetic stimulation study

    Institute of Scientific and Technical Information of China (English)

    Alan J Pearce; Daniel T Corp; Charlotte B Davies; Brendan P Major; Jerome J Maller

    2014-01-01

    Objective:To investigate the degree of neurophysiological and cognitive performance changes resulting from repeat concussions sustained in a single season ofAustralianRules football. Methods:Three amateur football players were recruited after sustainingtwo concussions during a single season of playing.Each player was assessed at multiple time points by transcranial magnetic stimulation(TMS) and electromyography, as well as tested for fine motor and cognitive performance after each concussion.Results:In all three cases, concussions resulted in reduction in fine dexterity and visuomotor reaction time, cognitive attention performance and increase in intracortical inhibition fromTMS.No changes in performance orTMS outcomes were found as a result of the order of the concussions.However, changes observed were dependent on the severity of the concussion.Conclusions:This multiple-case study has demonstrated that concussion result in increased intracortical inhibition and reduction in cognitive and motor performance. Further,TMS, in conjunction with tests of cognitive and motor performance, can be useful as a prognostic technique in assessing recovery from acute concussion injury.

  11. Comparative systems toxicology analysis of cigarette smoke and aerosol from a candidate modified risk tobacco product in organotypic human gingival epithelial cultures: A 3-day repeated exposure study.

    Science.gov (United States)

    Zanetti, Filippo; Titz, Bjoern; Sewer, Alain; Lo Sasso, Giuseppe; Scotti, Elena; Schlage, Walter K; Mathis, Carole; Leroy, Patrice; Majeed, Shoaib; Torres, Laura Ortega; Keppler, Brian R; Elamin, Ashraf; Trivedi, Keyur; Guedj, Emmanuel; Martin, Florian; Frentzel, Stefan; Ivanov, Nikolai V; Peitsch, Manuel C; Hoeng, Julia

    2017-03-01

    Smoking is one of the major lifestyle-related risk factors for periodontal diseases. Modified risk tobacco products (MRTP) offer a promising alternative in the harm reduction strategy for adult smokers unable to quit. Using a systems toxicology approach, we investigated and compared the exposure effects of a reference cigarette (3R4F) and a heat-not-burn technology-based candidate MRTP, the Tobacco Heating System (THS) 2.2. Human gingival epithelial organotypic cultures were repeatedly exposed (3 days) for 28 min at two matching concentrations of cigarette smoke (CS) or THS2.2 aerosol. Results showed only minor histopathological alterations and minimal cytotoxicity upon THS2.2 aerosol exposure compared to CS (1% for THS2.2 aerosol vs. 30% for CS, at the high concentration). Among the 14 proinflammatory mediators analyzed, only 5 exhibited significant alterations with THS2.2 exposure compared with 11 upon CS exposure. Transcriptomic and metabolomic analysis indicated a general reduction of the impact in THS2.2 aerosol-exposed samples with respect to CS (∼79% lower biological impact for the high THS2.2 aerosol concentration compared to CS, and 13 metabolites significantly perturbed for THS2.2 vs. 181 for CS). This study indicates that exposure to THS2.2 aerosol had a lower impact on the pathophysiology of human gingival organotypic cultures than CS. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  12. Knowledge and skill retention of in-service versus preservice nursing professionals following an informal training program in pediatric cardiopulmonary resuscitation: a repeated-measures quasiexperimental study.

    Science.gov (United States)

    Sankar, Jhuma; Vijayakanthi, Nandini; Sankar, M Jeeva; Dubey, Nandkishore

    2013-01-01

    Our objective was to compare the impact of a training program in pediatric cardiopulmonary resuscitation (CPR) on the knowledge and skills of in-service and preservice nurses at prespecified time points. This repeated-measures quasiexperimental study was conducted in the pediatric emergency and ICU of a tertiary care teaching hospital between January and March 2011. We assessed the baseline knowledge and skills of nursing staff (in-service nurses) and final year undergraduate nursing students (preservice nurses) using a validated questionnaire and a skill checklist, respectively. The participants were then trained on pediatric CPR using standard guidelines. The knowledge and skills were reassessed immediately after training and at 6 weeks after training. A total of 74 participants-28 in-service and 46 preservice professionals-were enrolled. At initial assessment, in-service nurses were found to have insignificant higher mean knowledge scores (6.6 versus 5.8, P = 0.08) while the preservice nurses had significantly higher skill scores (6.5 versus 3.2, P nurses performing better in knowledge test (10.5 versus 9.1, P = 0.01) and the preservice nurses performing better in skill test (9.8 versus 7.4, P skills of in-service and preservice nurses in pediatric CPR improved with training. In comparison to preservice nurses, the in-service nurses seemed to retain knowledge better with time than skills.

  13. Field study of the urinary excretion of ethoxyacetic acid during repeated daily exposure to the ethyl ether of ethylene glycol and the ethyl ether of ethylene glycol acetate.

    Science.gov (United States)

    Veulemans, H; Groeseneken, D; Masschelein, R; Van Vlem, E

    1987-06-01

    The urinary excretion of ethoxyacetic acid (EAA) was studied in a group of five women daily exposed to the ethyl ether of ethylene glycol (EGEE) and the ethyl ether of ethylene glycol acetate (EGEE-Ac) during 5 d of normal production and 7 d after a 12-d production stop. The mean combined exposure concentration of EGEE and EGEE-Ac (expressed in equivalent weight of EGEE) was 14.0 mg/m3 with occasional slight excursions above the current Belgian occupational exposure limit. The daily combined exposure profiles for EGEE and EGEE-Ac were rather constant during the first observation period, but they tended to decrease during the last week. The urinary EAA excretion clearly increased during the work week. Over the weekends the elimination was far from complete, and even after a prolonged nonexposure period of 12 d traces of the metabolite were still detectable. Based on the observations from the first period, a good linear correlation (r = 0.92) was found between the average exposure over 5 d (14.4 mg/m3) and the EAA excretion at the end of the week (105.7 mg/g creatinine). An EAA estimate of 150 +/- 35 mg/g was found to correspond with repeated 5-d full-shift exposures to the respective occupational exposure limit of EGEE (19 mg/m3) or EGEE-Ac (27 mg/m3).

  14. Is Asp-His-Ser/Thr-Trp tetrad hydrogen-bond network important to WD40-repeat proteins: a statistical and theoretical study.

    Science.gov (United States)

    Wu, Xian-Hui; Zhang, Hui; Wu, Yun-Dong

    2010-04-01

    WD40-repeat proteins are abundant and play important roles in forming protein complexes. The domain usually has seven WD40 repeats, which folds into a seven beta-sheet propeller with each beta-sheet in a four-strand structure. An analysis of 20 available WD40-repeat proteins in Protein Data Bank reveals that each protein has at least one Asp-His-Ser/Thr-Trp (D-H-S/T-W) hydrogen-bonded tetrad, and some proteins have up to six or seven such tetrads. The relative positions of the four residues in the tetrads are also found to be conserved. A sequence alignment analysis of 560 WD40-repeat protein sequences in human reveals very similar features, indicating that such tetrad may be a general feature of WD40-repeat proteins. We carried out density functional theory and found that these tetrads can lead to significant stabilization including hydrogen-bonding cooperativity. The hydrogen bond involving Trp is significant. These results lead us to propose that the tetrads may be critical to the stability and the mechanism of folding of these proteins.

  15. 颞叶癫癎患者长程数字化视频EEG与过度换气EEG癎样放电规律探讨%THE STUDY ON REGULARITY OF EPILEPTIFORM DISCHARGES IN LONG-TERM DIGITAL VEEG (VIDEO-EEG) AND HYPERVENTILATION EEG IN PATIENTS WITH TEMPORAL LOBE EPILEPSY

    Institute of Scientific and Technical Information of China (English)

    刘发富; 袁琼芝

    2013-01-01

    目的:了解长程数字化视频EEG与过度换气EEG的癎样放电规律.方法:评估52例颞叶癫癎患者长程数字化视频EEG与过度换气EEG的癎样放电特点.结果:过度换气EEG癎样放电检出率明显低于浅睡期EEG,差异具有极显著意义(P<0.01);但与清醒期和深睡期EEG癎样放电检出率比较差异无显著意义(P>0.05).结论:颞叶癫癎患者浅睡期EEG癎样放电率明显高于过度换气EEG,对颞叶癫癎患者进行睡眠EEG检测,有助于提高癎样放电的检出率.

  16. Minimal-invasive magnetic heating of tumors does not alter intra-tumoral nanoparticle accumulation, allowing for repeated therapy sessions: an in vivo study in mice

    Science.gov (United States)

    Kettering, Melanie; Richter, Heike; Wiekhorst, Frank; Bremer-Streck, Sibylle; Trahms, Lutz; Alois Kaiser, Werner; Hilger, Ingrid

    2011-12-01

    Localized magnetic heating treatments (hyperthermia, thermal ablation) using superparamagnetic iron oxide nanoparticles (MNPs) continue to be an active area of cancer research. For generating the appropriate heat to sufficiently target cell destruction, adequate MNP concentrations need to be accumulated into tumors. Furthermore, the knowledge of MNP bio-distribution after application and additionally after heating is significant, firstly because of the possibility of repeated heating treatments if MNPs remain at the target region and secondly to study potential adverse effects dealing with MNP dilution from the target region over time. In this context, little is known about the behavior of MNPs after intra-tumoral application and magnetic heating. Therefore, the present in vivo study on the bio-distribution of intra-tumorally injected MNPs in mice focused on MNP long term monitoring of pre and post therapy over seven days using multi-channel magnetorelaxometry (MRX). Subsequently, single-channel MRX was adopted to study the bio-distribution of MNPs in internal organs and tumors of sacrificed animals. We found no distinct change of total MNP amounts in vivo during long term monitoring. Most of the MNP amounts remained in the tumors; only a few MNPs were detected in liver and spleen and less than 1% of totally injected MNPs were excreted. Apparently, the application of magnetic heating and the induction of apoptosis did not affect MNP accumulation. Our results indicate that MNP mainly remained within the injection side after magnetic heating over a seven-days-observation and therefore not affecting healthy tissue. As a consequence, localized magnetic heating therapy of tumors might be applied periodically for a better therapeutic outcome.

  17. Etiological Role and Repeated Infections of Sapovirus among Children Aged Less than 2 Years in a Cohort Study in a Peri-urban Community of Peru.

    Science.gov (United States)

    Liu, Xiaofang; Jahuira, Helena; Gilman, Robert H; Alva, Alicia; Cabrera, Lilia; Okamoto, Michiko; Xu, Hang; Windle, Henry J; Kelleher, Dermot; Varela, Marco; Verastegui, Manuela; Calderon, Maritza; Sanchez, Gerardo; Sarabia, Vanessa; Ballard, Sarah B; Bern, Caryn; Mayta, Holger; Crabtree, Jean E; Cama, Vitaliano; Saito, Mayuko; Oshitani, Hitoshi

    2016-06-01

    Human sapovirus has been shown to be one of the most important etiologies in pediatric patients with acute diarrhea. However, very limited data are available about the causative roles and epidemiology of sapovirus in community settings. A nested matched case-control study within a birth cohort study of acute diarrhea in a peri-urban community in Peru from 2007 to 2010 was conducted to investigate the attributable fraction (AF) and genetic diversity of sapovirus. By quantitative reverse transcription-real-time PCR (qPCR) sapovirus was detected in 12.4% (37/299) of diarrheal and 5.7% (17/300) of nondiarrheal stools (P = 0.004). The sapovirus AF (7.1%) was higher in the second year (13.2%) than in the first year (1.4%) of life of children. Ten known genotypes and one novel cluster (n = 5) within four genogroups (GI, GII, GIV, and GV) were identified by phylogenetic analysis of a partial VP1 gene. Further sequence analysis of the full VP1 gene revealed a possible novel genotype, tentatively named GII.8. Notably, symptomatic reinfections with different genotypes within the same (n = 3) or different (n = 5) genogroups were observed in eight children. Sapovirus exhibited a high attributable burden for acute gastroenteritis, especially in the second year of life, of children in a Peruvian community. Further large-scale studies are needed to understand better the global burden, genetic diversity, and repeated infections of sapovirus. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  18. Associations of repeated high alcohol use with unsafe driving behaviors, traffic offenses, and traffic crashes among young drivers: Findings from the New Zealand Drivers Study.

    Science.gov (United States)

    Begg, Dorothy; Brookland, Rebecca; Connor, Jennie

    2017-02-17

    The objective of this study was to describe self-reported high alcohol use at each of the 3 licensing stages of graduated driver licensing and its relationship to drink-driving behaviors, intentional risky driving, aggressive driving, alcohol traffic offenses, non-alcohol traffic offenses, and traffic crashes. The New Zealand Drivers Study (NZDS) is a multistage, prospective cohort study of newly licensed drivers interviewed at all 3 stages of the graduated driver licensing system: learner (baseline), restricted (intermediate), and full license. At each stage, alcohol use was self-reported using the Alcohol Use Disorders Identification Test (AUDIT-C), with high alcohol use defined as a score of ≥4 for males and ≥3 for females. Sociodemographic and personality data were obtained at the baseline interview. Alcohol-related, intentional risky, and aggressive driving behaviors were self-reported following each license stage. Traffic crashes and offenses were identified from police records. Crashes were also self-reported. Twenty-six percent (n = 397) reported no high alcohol use, 22% at one license stage, 30% at 2 stages, and 22% at 3 stages. Poisson regression results (unadjusted and adjusted) showed that the number of stages where high alcohol use was reported was significantly associated with each of the outcomes. For most outcomes, and especially the alcohol-involved outcomes, the relative risk increased with the number of stages of high alcohol use. We found that high alcohol use was common among young newly licensed drivers and those who repeatedly reported high alcohol use were at a significantly higher risk of unsafe driving behaviors. Recently introduced zero blood alcohol concentration (BAC) should help to address this problem, but other strategies are required to target persistent offenders.

  19. Repeated high-dose (5 × 10(8) TCID50) toxicity study of a third generation smallpox vaccine (IMVAMUNE) in New Zealand white rabbits.

    Science.gov (United States)

    Tree, Julia A; Hall, Graham; Rees, Peter; Vipond, Julia; Funnell, Simon G P; Roberts, Allen D

    2016-07-01

    Concern over the release of variola virus as an agent of bioterrorism remains high and a rapid vaccination regimen is desirable for use in the event of a confirmed release of virus. A single, high-dose (5×10(8) TCID50) of Bavarian Nordic's IMVAMUNE was tested in a Phase-II clinical trial, in humans, as a substitute for the standard (1×10(8) TCID50), using a 2-dose, 28-days apart regimen. Prior to this clinical trial taking place a Good Laboratory Practice, repeated high-dose, toxicology study was performed using IMVAMUNE, in New Zealand white rabbits and the results are reported here. Male and female rabbits were dosed twice, subcutaneously, with 5×10(8) TCID50 of IMVAMUNE (test) or saline (control), 7-days apart. The clinical condition, body-weight, food consumption, haematology, blood chemistry, immunogenicity, organ-weight, and macroscopic and microscopic pathology were investigated. Haematological investigations indicated changes within the white blood cell profile that were attributed to treatment with IMVAMUNE; these comprised slight increases in neutrophil and monocyte numbers, on study days 1-3 and a marginal increase in lymphocyte numbers on day 10. Macroscopic pathology revealed reddening at the sites of administration and thickened skin in IMVAMUNE, treated animals. After the second dose of IMVAMUNE 9/10 rabbits seroconverted, as detected by antibody ELISA on day 10, by day 21, 10/10 rabbits seroconverted. Treatment-related changes were not detected in other parameters. In conclusion, the subcutaneous injection of 2 high-doses of IMVAMUNE, to rabbits, was well tolerated producing only minor changes at the site of administration. Vaccinia-specific antibodies were raised in IMVAMUNE-vaccinated rabbits only.

  20. Large-scale studies of the HphI insulin gene variable-number-of-tandem-repeats polymorphism in relation to Type 2 diabetes mellitus and insulin release

    DEFF Research Database (Denmark)

    Hansen, S K; Gjesing, A P; Rasmussen, S K

    2004-01-01

    The class III allele of the variable-number-of-tandem-repeats polymorphism located 5' of the insulin gene (INS-VNTR) has been associated with Type 2 diabetes and altered birthweight. It has also been suggested, although inconsistently, that the class III allele plays a role in glucose-induced ins......The class III allele of the variable-number-of-tandem-repeats polymorphism located 5' of the insulin gene (INS-VNTR) has been associated with Type 2 diabetes and altered birthweight. It has also been suggested, although inconsistently, that the class III allele plays a role in glucose...

  1. Digital repeat analysis; setup and operation.

    Science.gov (United States)

    Nol, J; Isouard, G; Mirecki, J

    2006-06-01

    Since the emergence of digital imaging, there have been questions about the necessity of continuing reject analysis programs in imaging departments to evaluate performance and quality. As a marketing strategy, most suppliers of digital technology focus on the supremacy of the technology and its ability to reduce the number of repeats, resulting in less radiation doses given to patients and increased productivity in the department. On the other hand, quality assurance radiographers and radiologists believe that repeats are mainly related to positioning skills, and repeat analysis is the main tool to plan training needs to up-skill radiographers. A comparative study between conventional and digital imaging was undertaken to compare outcomes and evaluate the need for reject analysis. However, digital technology still being at its early development stages, setting a credible reject analysis program became the major task of the study. It took the department, with the help of the suppliers of the computed radiography reader and the picture archiving and communication system, over 2 years of software enhancement to build a reliable digital repeat analysis system. The results were supportive of both philosophies; the number of repeats as a result of exposure factors was reduced dramatically; however, the percentage of repeats as a result of positioning skills was slightly on the increase for the simple reason that some rejects in the conventional system qualifying for both exposure and positioning errors were classified as exposure error. The ability of digitally adjusting dark or light images reclassified some of those images as positioning errors.

  2. Association between secondhand smoke exposure at home and cigarette gifting and sharing in Zhejiang, China: a repeat cross-sectional study.

    Science.gov (United States)

    Xu, Yue; Xu, ShuiYang; Wu, QingQing; Guo, YuJie

    2016-03-03

    The aims of the current study were to assess the prevalence of household cigarette gifting and sharing, and to evaluate the relationship between secondhand smoke (SHS) exposure, and cigarette gifting and sharing, in Zhejiang, China. A repeat cross-sectional design. 10 sites in 5 cities in Zhejiang, China. Two surveys were conducted with adults in Zhejiang, China, in 2010 (N=2112) and 2012 (N=2279), respectively. At both waves, the same questionnaire was used; respondents were asked questions on residence, number of family smokers, indoor smoking rules, household income and cigarette gifting and sharing. The findings revealed that more than half of respondents' families (54.50% in 2010, 52.79% in 2012) reported exposure to SHS. Many families (54.73% in 2010, 47.04% in 2012) shared cigarettes with others, and a minority (14.91% in 2010, 14.17% in 2012) reported their family giving cigarettes as a gift. There was a significant decrease in cigarette sharing from 2010 to 2012, irrespective of household with SHS exposure status; and the cigarette gifting was significantly decreased in household without SHS exposure. Compared to households without SHS exposure, the prevalence of cigarette gifting and sharing in households with SHS exposure was more obvious. Encouraging and promoting a smoke-free household environment is necessary to change public smoking customs in Zhejiang, China. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  3. The impact of the CAG repeat polymorphism of the androgen receptor gene on muscle and adipose tissues in 20-29-year-old Danish men: Odense Androgen Study

    DEFF Research Database (Denmark)

    Nielsen, Torben Leo; Hagen, Claus; Wraae, Kristian

    2010-01-01

    not correlate with any circulating androgen. Conclusions: The CAG repeat polymorphism affects body composition in young men: absolute musclethigh and absolute musclelower trunk increase as CAGn decreases. Expressed relatively, muscle areas and LBM increase, while SAT and FM decrease as CAGn decreases......Background: The number of CAG repeats (CAGn) within the CAG repeat polymorphism of the androgen receptor gene correlates inversely with the transactivation of the receptor. Objective: To examine the impact of CAGn on muscle, fat distribution, and circulating androgen levels. Design, settings...... and participants: Population-based, cross-sectional study of 783 Danish men aged 20–29 years. Methods: Genotyping was performed in 767 men. Areas of thigh and lower trunk muscle (musclethigh and musclelower trunk), subcutaneous adipose tissues (SATthigh and SATlower trunk), and deep adipose tissues (i...

  4. Cognitive and clinical characteristics of patients with amyotrophic lateral sclerosis carrying a C9orf72 repeat expansion: a population-based cohort study.

    LENUS (Irish Health Repository)

    Byrne, Susan

    2012-03-01

    Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disease of upper and lower motor neurons, associated with frontotemporal dementia (FTD) in about 14% of incident cases. We assessed the frequency of the recently identified C9orf72 repeat expansion in familial and apparently sporadic cases of ALS and characterised the cognitive and clinical phenotype of patients with this expansion.

  5. Frequency of the C9orf72 hexanucleotide repeat expansion in patients with amyotrophic lateral sclerosis and frontotemporal dementia: A cross-sectional study

    NARCIS (Netherlands)

    E. Majounie (Elisa); A. Renton (Alan); K. Mok (Kin); E.G.P. Dopper (Elise); A. Waite (Adrian); S. Rollinson (Sara); A. Chiò (Adriano); G. Restagno (Gabriella); N. Nicolaou (Nayia); J. Simón-Sánchez (Javier); J.C. van Swieten (John); Y. Abramzon (Yevgeniya); J. Johnson (Janel); M. Sendtner (Michael); R. Pamphlett (Roger); R. Orrell (Richard); S. Mead (Simon); K.C. Sidle (Katie); H. Houlden (Henry); J.D. Rohrer (Jonathan Daniel); K.E. Morrison (Karen); H. Pall (Hardev); D. Talbot; O. Ansorge (Olaf); D.G. Hernandez (Dena); S. Arepalli (Sampath); M. Sabatelli (Mario); G. Mora (Gabriele); J.C. Corbo (Joseph); F. Giannini (Fabio); A. Calvo (Andrea); E. Englund (Elisabet); G. Borghero (Giuseppe); O.A.M. Floris; A. Remes (Anne); H. Laaksovirta (Hannu); L. McCluskey (Leo); J.Q. Trojanowski (John); V.M. Deerlin (Vivianna); G.D. Schellenberg (Gerard); M.A. Nalls (Michael); V.E. Drory (Vivian E); C.S. Lu (Chin-Song); T.-H. Yeh (Tu-Hsueh); H. Ishiura (Hiroyuki); Y. Takahashi (Yukari); S. Tsuji (Shoji); I. Le Ber (Isabelle); A. Brice; C. Drepper (Carsten); N. Williams (Nigel); J. Kirby (Janine); P.J. Shaw (Pamela); J. Hardy (John); P.J. Tienari (Pentti); P. Heutink (Peter); H. Morris (Huw); S. Pickering-Brown (Stuart); B.J. Traynor (Bryan)

    2012-01-01

    textabstractBackground: We aimed to accurately estimate the frequency of a hexanucleotide repeat expansion in C9orf72 that has been associated with a large proportion of cases of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Methods: We screened 4448 patients diagnosed with

  6. Spinocerebellar ataxia type 7 (SCA7): First report of a systematic neuropathological study of the brain of a patient with a very short expanded CAG-repeat

    NARCIS (Netherlands)

    Rub, U.; Brunt, E.R.; Gierga, K.; Seidel, K.; Schultz, C.; Schols, L.; Auburger, G.; Heinsen, H.; Ippel, P.F.; Glimmerveen, W.F.; Wittebol-Post, D.; Arai, K.; Deller, T.; Rai, D.

    2005-01-01

    Spinocerebellar ataxia type 7 (SCA7) represents a very rare and severe autosomal dominantly inherited cerebellar ataxia (ADCA). It belongs to the group of CAG-repeat or polyglutamine diseases with its underlying molecular genetical defect on chromosome 3p12-p21.1. Here, we performed a systematic stu

  7. Spinocerebellar ataxia type 7 (SCA7) : First report of a systematic neuropathological study of the brain of a patient with a very short expanded CAG-repeat

    NARCIS (Netherlands)

    Rub, U; Brunt, ER; Gierga, K; Seidel, K; Schultz, C; Schols, L; Auburger, G; Heinsen, H; Ippel, PF; Glimmerveen, WF; Wittebol-Post, D; Arai, K; Deller, T; Rai, D

    2005-01-01

    Spinocerebellar ataxia type 7 (SCA7) represents a very rare and severe autosomal dominantly inherited cerebellar ataxia (ADCA). It belongs to the group of CAG-repeat or polyglutamine diseases with its underlying molecular genetical defect on chromosome 3p12-p21.1. Here, we performed a systematic stu

  8. Association of Repeatedly Measured High-Sensitivity-Assayed Troponin I with Cardiovascular Disease Events in a General Population from the MORGAM/BiomarCaRE Study

    DEFF Research Database (Denmark)

    Hughes, Maria F; Ojeda, Francisco; Saarela, Olli;

    2017-01-01

    BACKGROUND: High-sensitivity troponin I (hs-cTnI) concentrations reflect myocardial stress. The role of hs-cTnI in predicting long-term changes in the risk of cardiovascular disease (CVD) in general populations is not clearly defined. METHODS: We investigated whether the change in 3 repeated meas...

  9. Novel Approach to Repeated Arterial Blood Sampling in Small Animal PET : Application in a Test-Retest Study with the Adenosine A1 Receptor Ligand [C-11]MPDX

    NARCIS (Netherlands)

    Sijbesma, Jürgen W A; Zhou, Xiaoyun; Vállez García, David; Houwertjes, Martin C; Doorduin, Janine; Kwizera, Chantal; Maas, Bram; Meerlo, Peter; Dierckx, Rudi A; Slart, Riemer H J A; Elsinga, Philip H; van Waarde, Aren

    2016-01-01

    Small animal positron emission tomography (PET) can be used to detect small changes in neuroreceptor availability. This often requires rapid arterial blood sampling. However, current catheterization procedures do not allow repeated blood sampling. We have developed a procedure which allows arterial

  10. Crowding by a repeating pattern.

    Science.gov (United States)

    Rosen, Sarah; Pelli, Denis G

    2015-01-01

    Theinability to recognize a peripheral target among flankers is called crowding. For a foveal target, crowding can be distinguished from overlap masking by its sparing of detection, linear scaling with eccentricity, and invariance with target size.Crowding depends on the proximity and similarity of the flankers to the target. Flankers that are far from or dissimilar to the target do not crowd it. On a gray page, text whose neighboring letters have different colors, alternately black and white, has enough dissimilarity that it might escape crowding. Since reading speed is normally limited by crowding, escape from crowding should allow faster reading. Yet reading speed is unchanged (Chung & Mansfield, 2009). Why? A recent vernier study found that using alternating-color flankers produces strong crowding (Manassi, Sayim, & Herzog, 2012). Might that effect occur with letters and reading? Critical spacing is the minimum center-to-center target-flanker spacing needed to correctly identify the target. We measure it for a target letter surrounded by several equidistant flanker letters of the same polarity, opposite polarity, or mixed polarity: alternately white and black. We find strong crowding in the alternating condition, even though each flanker letter is beyond its own critical spacing (as measured in a separate condition). Thus a periodic repeating pattern can produce crowding even when the individual elements do not. Further, in all conditions we find that, once a periodic pattern repeats (two cycles), further repetition does not affect critical spacing of the innermost flanker.

  11. Association of the D repeat polymorphism in the ASPN gene with developmental dysplasia of the hip: a case-control study in Han Chinese

    Science.gov (United States)

    2011-01-01

    Introduction Developmental dysplasia of the hip (DDH) is a common skeletal disease, which is characterized by abnormal seating of the femoral head in the acetabulum. Genetic factors play a considerable role in the etiology of DDH. Asporin (ASPN) is an ECM protein which can bind to TGF-β1 and sequentially inhibit TGF-β/Smad signaling. A functional aspartic acid (D) repeat polymorphism of ASPN was first described as an osteoarthritis-associated polymorphism. As TGF-β is well known as an important regulator in the development of skeletal components, ASPN may also be involved in the etiology of DDH. Our objective is to evaluate whether the D repeat polymorphism of ASPN is associated with DDH in Han Chinese. Methods The D repeat polymorphism was genotyped in 370 DDH patients and 445 control subjects, and the allelic association of the D repeat was examined. Results From D11 to D18, eight alleles were identified. D13 allele is the most common allele both in control and DDH groups, the frequencies are 67.3% and 58.1% respectively. In the DDH group, a significantly higher frequency of the D14 allele and significantly lower frequency of D13 was observed. The association of D14 and D13 was found in both females and males after stratification by gender. There was no significant difference in any other alleles we examined. Conclusions Our results show an obvious association between the D repeat polymorphism of ASPN and DDH. It indicates that ASPN is an important regulator in the etiology of DDH. PMID:21329514

  12. Copy number of tandem direct repeats within the inverted repeats of Marek's disease virus DNA.

    Science.gov (United States)

    Kanamori, A; Nakajima, K; Ikuta, K; Ueda, S; Kato, S; Hirai, K

    1986-12-01

    We previously reported that DNA of the oncogenic strain BC-1 of Marek's disease virus serotype 1 (MDV1) contains three units of tandem direct repeats with 132 base pair (bp) repeats within the inverted repeats of the long regions of the MDV1 genome, whereas the attenuated, nononcogenic viral DNA contains multiple units of tandem direct repeats (Maotani et al., 1986). In the present study, the difference in the copy numbers of 132 bp repeats of oncogenic and nononcogenic MDV1 DNAs in other strains of MDV1 was investigated by Southern blot hybridization. The main copy numbers in different oncogenic MDV1 strains differed: those of BC-1, JM and highly oncogenic Md5 were 3, 5 to 12 and 2, respectively. The viral DNA population with two units of repeats was small, but detectable, in cells infected with either the oncogenic BC-1 or JM strain. The MDV1 DNA in various MD cell lines contained either two units or both two and three units of repeats. The significance of the copy number of repeats in oncogenicity of MDV1 is discussed.

  13. Effectiveness of two strategies to follow-up ASC-US and LSIL screening results in The Netherlands using repeat cytology with or without additional hrHPV testing: a retrospective cohort study

    NARCIS (Netherlands)

    Siebers, A.G.; Arbyn, M.; Melchers, W.J.; Kemenade, F.J. van; Vedder, J.E.; Linden, H. van der; Ballegooijen, M. van; Bekkers, R.L.; Bulten, J.

    2014-01-01

    PURPOSE: The purpose of the study was to assess the effectiveness of repeat cytology with and without additional high-risk human papilloma virus (hrHPV) testing after atypical squamous cells of undetermined significance/low-grade squamous intraepithelial lesion (ASC-US/LSIL) screening results.

  14. Remarkable selective constraints on exonic dinucleotide repeats.

    Science.gov (United States)

    Haasl, Ryan J; Payseur, Bret A

    2014-09-01

    Long dinucleotide repeats found in exons present a substantial mutational hazard: mutations at these loci occur often and generate frameshifts. Here, we provide clear and compelling evidence that exonic dinucleotides experience strong selective constraint. In humans, only 18 exonic dinucleotides have repeat lengths greater than six, which contrasts sharply with the genome-wide distribution of dinucleotides. We genotyped each of these dinucleotides in 200 humans from eight 1000 Genomes Project populations and found a near-absence of polymorphism. More remarkably, divergence data demonstrate that repeat lengths have been conserved across the primate phylogeny in spite of what is likely considerable mutational pressure. Coalescent simulations show that even a very low mutation rate at these loci fails to explain the anomalous patterns of polymorphism and divergence. Our data support two related selective constraints on the evolution of exonic dinucleotides: a short-term intolerance for any change to repeat length and a long-term prevention of increases to repeat length. In general, our results implicate purifying selection as the force that eliminates new, deleterious mutants at exonic dinucleotides. We briefly discuss the evolution of the longest exonic dinucleotide in the human genome--a 10 x CA repeat in fibroblast growth factor receptor-like 1 (FGFRL1)--that should possess a considerably greater mutation rate than any other exonic dinucleotide and therefore generate a large number of deleterious variants. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

  15. Dynamic combinatorial libraries of artificial repeat proteins.

    Science.gov (United States)

    Eisenberg, Margarita; Shumacher, Inbal; Cohen-Luria, Rivka; Ashkenasy, Gonen

    2013-06-15

    Repeat proteins are found in almost all cellular systems, where they are involved in diverse molecular recognition processes. Recent studies have suggested that de novo designed repeat proteins may serve as universal binders, and might potentially be used as practical alternative to antibodies. We describe here a novel chemical methodology for producing small libraries of repeat proteins, and screening in parallel the ligand binding of library members. The first stage of this research involved the total synthesis of a consensus-based three-repeat tetratricopeptide (TPR) protein (~14 kDa), via sequential attachment of the respective peptides. Despite the effectiveness of the synthesis and ligation steps, this method was found to be too demanding for the production of proteins containing variable number of repeats. Additionally, the analysis of binding of the individual proteins was time consuming. Therefore, we designed and prepared novel dynamic combinatorial libraries (DCLs), and show that their equilibration can facilitate the formation of TPR proteins containing up to eight repeating units. Interestingly, equilibration of the library building blocks in the presence of the biologically relevant ligands, Hsp90 and Hsp70, induced their oligomerization into forming more of the proteins with large recognition surfaces. We suggest that this work presents a novel simple and rapid tool for the simultaneous screening of protein mixtures with variable binding surfaces, and for identifying new binders for ligands of interest.

  16. Prospective study of leptospirosis transmission in an urban slum community: role of poor environment in repeated exposures to the Leptospira agent.

    Directory of Open Access Journals (Sweden)

    Ridalva D M Felzemburgh

    Full Text Available BACKGROUND: Leptospirosis has emerged as an urban health problem as slum settlements have rapidly spread worldwide and created conditions for rat-borne transmission. Prospective studies have not been performed to determine the disease burden, identify risk factors for infection and provide information needed to guide interventions in these marginalized communities. METHODOLOGY/PRINCIPAL FINDINGS: We enrolled and followed a cohort of 2,003 residents from a slum community in the city of Salvador, Brazil. Baseline and one-year serosurveys were performed to identify primary and secondary Leptospira infections, defined as respectively, seroconversion and four-fold rise in microscopic agglutination titers. We used multinomial logistic regression models to evaluate risk exposures for acquiring primary and secondary infection. A total of 51 Leptospira infections were identified among 1,585 (79% participants who completed the one-year follow-up protocol. The crude infection rate was 37.8 per 1,000 person-years. The secondary infection rate was 2.3 times higher than that of primary infection rate (71.7 and 31.1 infections per 1,000 person-years, respectively. Male gender (OR 2.88; 95% CI 1.40-5.91 and lower per capita household income (OR 0.54; 95% CI, 0.30-0.98 for an increase of $1 per person per day were independent risk factors for primary infection. In contrast, the 15-34 year age group (OR 10.82, 95% CI 1.38-85.08, and proximity of residence to an open sewer (OR 0.95; 0.91-0.99 for an increase of 1 m distance were significant risk factors for secondary infection. CONCLUSIONS/SIGNIFICANCE: This study found that slum residents had high risk (>3% per year for acquiring a Leptospira infection. Re-infection is a frequent event and occurs in regions of slum settlements that are in proximity to open sewers. Effective prevention of leptospirosis will therefore require interventions that address the infrastructure deficiencies that contribute to repeated

  17. Trends in socioeconomic inequalities in oral health among 15-year-old Danish adolescents during 1995-2013: A nationwide, register-based, repeated cross-sectional study.

    Science.gov (United States)

    Sengupta, Kaushik; Christensen, Lisa Bøge; Mortensen, Laust Hvas; Skovgaard, Lene Theil; Andersen, Ingelise

    2017-10-01

    Scandinavian welfare states, despite having better population oral health than less egalitarian societies, are characterized by ubiquitous social gradients and large relative socioeconomic inequalities in oral health. However, trends in these inequalities among Scandinavian children and adolescents have not been studied in detail. To describe the associations between socioeconomic position (SEP) and oral health in adolescents and to investigate the trends in these associations between 1995 and 2013. Nationwide repeated cross-sectional studies (using individual-level data) were conducted on 15-year-olds in Denmark from 1995, 2003, and 2013 (N=154,750). Dental data were obtained from the national dental register of the Danish Health Authority (Sundhedsstyrelsens Centrale Odontologiske Register [SCOR]) and data on social variables from administrative registers at Statistics Denmark. SEP measures included previous year's parental education (highest attained educational level by either of the parents), income (equivalized household disposable income), and occupational social class (highest recorded occupational class between the parents). Covariates were immigration status, country of origin, number of children and persons in the family, and household type. The outcome was dental caries experience, represented by the decayed, missing, and filled surfaces (DMFS) index. Negative binomial regression models were used to examine the association between DMFS count and each of the explanatory variables separately while accounting for cluster-correlated family data. Furthermore, hierarchical multiple regressions of DMFS on SEP indicators-using the zero-inflated negative binomial (ZINB) distribution as the outcome distribution-were estimated while successively adjusting for the potential effects of the included covariates. Caries prevalence declined from 71% in 1995 to 63% in 2003 and 45% in 2013. Separate assessment of each covariate showed statistically significant graded

  18. DWI Repeaters and Non-Repeaters: A Comparison.

    Science.gov (United States)

    Weeber, Stan

    1981-01-01

    Discussed how driving-while-intoxicated (DWI) repeaters differed signigicantly from nonrepeaters on 4 of 23 variables tested. Repeaters were more likely to have zero or two dependent children, attend church frequently, drink occasionally and have one or more arrests for public intoxication. (Author)

  19. To Repeat or Not to Repeat a Course

    Science.gov (United States)

    Armstrong, Michael J.; Biktimirov, Ernest N.

    2013-01-01

    The difficult transition from high school to university means that many students need to repeat (retake) 1 or more of their university courses. The authors examine the performance of students repeating first-year core courses in an undergraduate business program. They used data from university records for 116 students who took a total of 232…

  20. Association of STin2 Variable Number of Tandem Repeat (VNTR) Polymorphism of Serotonin Transporter Gene with Lifelong Premature Ejaculation: A Case-Control Study in Han Chinese Subjects

    Science.gov (United States)

    Huang, Yuanyuan; Zhang, Xiansheng; Gao, Jingjing; Tang, Dongdong; Gao, Pan; Peng, Dangwei; Liang, Chaozhao

    2016-01-01

    Background The STin2 VNTR polymorphism has a variable number of tandem repeats in intron 2 of the serotonin transporter gene. We aimed to explore the relationship between STin2 VNTR polymorphism and lifelong premature ejaculation (LPE). Material/Methods We recruited a total of 115 outpatients who complained of ejaculating prematurely and who were diagnosed as LPE, and 101 controls without PE complaint. Allelic variations of STin2 VNTR were genotyped using PCR-based technology. We evaluated the associations between STin2 VNTR allelic and genotypic frequencies and LPE, as well as the intravaginal ejaculation latency time (IELT) of different STin2 VNTR genotypes among LPE patients. Results The patients and controls did not differ significantly in terms of any characteristic except age. A significantly higher frequency of STin2.12/12 genotype was found among LPE patients versus controls (P=0.026). Frequency of patients carrying at least 1 copy of the 10-repeat allele was significantly lower compared to the control group (28.3% vs. 41.8%, OR=0.55; 95%CI=0.31–0.97, P=0.040). In the LPE group, the mean IELT showed significant difference in STin2.12/12 genotype when compared to those with STin2.12/10 and STin2.10/10 genotypes. The mean IELT in10-repeat allele carriers was 50% longer compared to homozygous carriers of the STin2.12 allele. Conclusions Our results indicate the presence of STin2.10 allele is a protective factor for LPE. Men carrying the higher expression genotype STin2. 12/12 have shorter IELT than 10-repeat allele carriers. PMID:27713390

  1. Patients with chronic fatigue syndrome performed worse than controls in a controlled repeated exercise study despite a normal oxidative phosphorylation capacity

    Directory of Open Access Journals (Sweden)

    Sluiter Wim

    2010-10-01

    Full Text Available Abstract Background The aim of this study was to investigate the possibility that a decreased mitochondrial ATP synthesis causes muscular and mental fatigue and plays a role in the pathophysiology of the chronic fatigue syndrome (CFS/ME. Methods Female patients (n = 15 and controls (n = 15 performed a cardiopulmonary exercise test (CPET by cycling at a continuously increased work rate till maximal exertion. The CPET was repeated 24 h later. Before the tests, blood was taken for the isolation of peripheral blood mononuclear cells (PBMC, which were processed in a special way to preserve their oxidative phosphorylation, which was tested later in the presence of ADP and phosphate in permeabilized cells with glutamate, malate and malonate plus or minus the complex I inhibitor rotenone, and succinate with rotenone plus or minus the complex II inhibitor malonate in order to measure the ATP production via Complex I and II, respectively. Plasma CK was determined as a surrogate measure of a decreased oxidative phosphorylation in muscle, since the previous finding that in a group of patients with external ophthalmoplegia the oxygen consumption by isolated muscle mitochondria correlated negatively with plasma creatine kinase, 24 h after exercise. Results At both exercise tests the patients reached the anaerobic threshold and the maximal exercise at a much lower oxygen consumption than the controls and this worsened in the second test. This implies an increase of lactate, the product of anaerobic glycolysis, and a decrease of the mitochondrial ATP production in the patients. In the past this was also found in patients with defects in the mitochondrial oxidative phosphorylation. However the oxidative phosphorylation in PBMC was similar in CFS/ME patients and controls. The plasma creatine kinase levels before and 24 h after exercise were low in patients and controls, suggesting normality of the muscular mitochondrial oxidative phosphorylation. Conclusion The

  2. Trends and interaction of polypharmacy and potentially inappropriate prescribing in primary care over 15 years in Ireland: a repeated cross-sectional study

    Science.gov (United States)

    Moriarty, Frank; Hardy, Colin; Bennett, Kathleen; Smith, Susan M; Fahey, Tom

    2015-01-01

    Objectives To examine: (1) changes in polypharmacy in 1997, 2002, 2007 and 2012 and; (2) changes in potentially inappropriate prescribing (PIP) prevalence and the relationship between PIP and polypharmacy in individuals aged ≥65 years over this period in Ireland. Methods This repeated cross-sectional study using pharmacy claims data included all individuals eligible for the General Medical Services scheme in the former Eastern Health Board region of Ireland in 1997, 2002, 2007 and 2012 (range 338 025–539 752 individuals). Outcomes evaluated were prevalence of polypharmacy (being prescribed ≥5 regular medicines) and excessive polypharmacy (≥10 regular medicines) in all individuals and PIP prevalence in those aged ≥65 years determined by 30 criteria from the Screening Tool for Older Persons’ Prescriptions. Results The prevalence of polypharmacy increased from 1997 to 2012, particularly among older individuals (from 17.8% to 60.4% in those aged ≥65 years). The adjusted incident rate ratio for polypharmacy in 2012 compared to 1997 was 4.16 (95% CI 3.23 to 5.36), and for excessive polypharmacy it was 10.53 (8.58 to 12.91). Prevalence of PIP rose from 32.6% in 1997 to 37.3% in 2012. High-dose aspirin and digoxin prescribing decreased over time, but long-term proton pump inhibitors at maximal dose increased substantially (from 0.8% to 23.8%). The odds of having any PIP in 2012 were lower compared to 1997 after controlling for gender and level of polypharmacy, OR 0.39 (95% CI 0.39 to 0.4). Conclusions Accounting for the marked increase in polypharmacy, prescribing quality appears to have improved with a reduction in the odds of having PIP from 1997 to 2012. With growing numbers of people taking multiple regular medicines, strategies to address the related challenges of polypharmacy and PIP are needed. PMID:26384726

  3. Trends and interaction of polypharmacy and potentially inappropriate prescribing in primary care over 15 years in Ireland: a repeated cross-sectional study.

    Science.gov (United States)

    Moriarty, Frank; Hardy, Colin; Bennett, Kathleen; Smith, Susan M; Fahey, Tom

    2015-09-18

    To examine: (1) changes in polypharmacy in 1997, 2002, 2007 and 2012 and; (2) changes in potentially inappropriate prescribing (PIP) prevalence and the relationship between PIP and polypharmacy in individuals aged ≥65 years over this period in Ireland. This repeated cross-sectional study using pharmacy claims data included all individuals eligible for the General Medical Services scheme in the former Eastern Health Board region of Ireland in 1997, 2002, 2007 and 2012 (range 338,025-539,752 individuals). Outcomes evaluated were prevalence of polypharmacy (being prescribed ≥5 regular medicines) and excessive polypharmacy (≥10 regular medicines) in all individuals and PIP prevalence in those aged ≥65 years determined by 30 criteria from the Screening Tool for Older Persons' Prescriptions. The prevalence of polypharmacy increased from 1997 to 2012, particularly among older individuals (from 17.8% to 60.4% in those aged ≥65 years). The adjusted incident rate ratio for polypharmacy in 2012 compared to 1997 was 4.16 (95% CI 3.23 to 5.36), and for excessive polypharmacy it was 10.53 (8.58 to 12.91). Prevalence of PIP rose from 32.6% in 1997 to 37.3% in 2012. High-dose aspirin and digoxin prescribing decreased over time, but long-term proton pump inhibitors at maximal dose increased substantially (from 0.8% to 23.8%). The odds of having any PIP in 2012 were lower compared to 1997 after controlling for gender and level of polypharmacy, OR 0.39 (95% CI 0.39 to 0.4). Accounting for the marked increase in polypharmacy, prescribing quality appears to have improved with a reduction in the odds of having PIP from 1997 to 2012. With growing numbers of people taking multiple regular medicines, strategies to address the related challenges of polypharmacy and PIP are needed. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  4. What Studying Problems Are Faced by the Adolescent Grade Repeaters in Macao: Uncovering Underlying Mechanisms Based on Evidences from the PISA 2012 Study

    Science.gov (United States)

    Sit, Pou-seong; Cheung, Kwok-cheung; Cheong, Wai-cheong; Mak, Soi-kei; Soh, Kay-cheng; Ieong, Man-kai

    2015-01-01

    Most schools in Macao are private schools, and there is a variety of grade repetition policy practiced in the 45 secondary schools. The policies are translated into school-based accountability of some kind of minimum competency standards. The objective of this study is to uncover the mediation mechanisms accounting for the influences of grade…

  5. All-photonic quantum repeaters

    Science.gov (United States)

    Azuma, Koji; Tamaki, Kiyoshi; Lo, Hoi-Kwong

    2015-01-01

    Quantum communication holds promise for unconditionally secure transmission of secret messages and faithful transfer of unknown quantum states. Photons appear to be the medium of choice for quantum communication. Owing to photon losses, robust quantum communication over long lossy channels requires quantum repeaters. It is widely believed that a necessary and highly demanding requirement for quantum repeaters is the existence of matter quantum memories. Here we show that such a requirement is, in fact, unnecessary by introducing the concept of all-photonic quantum repeaters based on flying qubits. In particular, we present a protocol based on photonic cluster-state machine guns and a loss-tolerant measurement equipped with local high-speed active feedforwards. We show that, with such all-photonic quantum repeaters, the communication efficiency scales polynomially with the channel distance. Our result paves a new route towards quantum repeaters with efficient single-photon sources rather than matter quantum memories. PMID:25873153

  6. Efficacy and safety of guaifenesin for upper back, neck, and shoulder pain: a Phase II proof-of-concept, multicenter, placebo-controlled, repeat-dose, parallel-group study

    OpenAIRE

    Collaku A; Yue Y.; Reed K

    2017-01-01

    Agron Collaku, Yong Yue, Kenneth Reed GlaxoSmithKline Consumer Healthcare, Parsippany, NJ, USA Background/objective: Guaifenesin, an over-the-counter (OTC) expectorant, has exhibited muscle relaxant effects preclinically and clinically. This proof-of-principle study explored whether OTC doses of guaifenesin can provide relief from acute upper back, neck, or shoulder muscle spasm and pain. Methods: This multicenter, placebo-controlled, repeat-dose, parallel study randomly ass...

  7. REPEATED RHYME AND REPEATED REDIF IN GAZELS / GAZELDE İKİLEME REDİF VE İKİLEME KAFİYE

    Directory of Open Access Journals (Sweden)

    Assoc. Prof. Dr. Yaşar AYDEMİR

    2009-04-01

    Full Text Available Meter and rhyme are indispensable elements forClassical Turkish poem. Usually rhyme together withredif (repeated voice/ word after the rhyme is used inClassical Turkish poem. One of the way of using rhymeand redif is "repeated rhyme and repeated redif" in poem.In this paper, "repeated rhyme and repeatedredif" was studied.

  8. Who Repeats Algebra I, and How Does Initial Performance Relate to Improvement When the Course Is Repeated? REL 2015-059

    Science.gov (United States)

    Fong, Anthony B.; Jaquet, Karina; Finkelstein, Neal

    2014-01-01

    This REL West study explores the prevalence of students repeating Algebra I, who is most likely to repeat the course, and the level of improvement for students who repeat. Using six years of data from a cohort of 3,400 first-time seventh grade students in a California school district, authors found that 44 percent of students repeated algebra I.…

  9. Medical students who decompress during the M-1 year outperform those who fail and repeat it: A study of M-1 students at the University of Illinois College of Medicine at Urbana-Champaign 1988–2000

    Directory of Open Access Journals (Sweden)

    Freund Gregory G

    2005-05-01

    Full Text Available Abstract Background All medical schools must counsel poor-performing students, address their problems and assist them in developing into competent physicians. The objective of this study was to determine whether students with academic deficiencies in their M-1 year graduate more often, spend less time to complete the curriculum, and need fewer attempts at passing USMLE Step 1 and Step 2 by entering the Decompressed Program prior to failure of the M-1 year than those students who fail the M-1 year and then repeat it. Method The authors reviewed the performance of M-1 students in the Decompressed Program and compared their outcomes to M-1 students who failed and fully repeated the M-1 year. To compare the groups upon admission, t-Tests comparing the Cognitive Index of students and MCAT scores from both groups were performed. Performance of the two groups after matriculation was also analyzed. Results Decompressed students were 2.1 times more likely to graduate. Decompressed students were 2.5 times more likely to pass USMLE Step 1 on the first attempt than the repeat students. In addition, 46% of those in the decompressed group completed the program in five years compared to 18% of the repeat group. Conclusion Medical students who decompress their M-1 year prior to M-1 year failure outperform those who fail their first year and then repeat it. These findings indicate the need for careful monitoring of M-1 student performance and early intervention and counseling of struggling students.

  10. Development of chloroplast simple sequence repeats (cpSSRs) for the intraspecific study of Gracilaria tenuistipitata (Gracilariales, Rhodophyta) from different populations.

    Science.gov (United States)

    Song, Sze-Looi; Lim, Phaik-Eem; Phang, Siew-Moi; Lee, Weng-Wah; Hong, Dang Diem; Prathep, Anchana

    2014-02-04

    Gracilaria tenuistipitata is an agarophyte with substantial economic potential because of its high growth rate and tolerance to a wide range of environment factors. This red seaweed is intensively cultured in China for the production of agar and fodder for abalone. Microsatellite markers were developed from the chloroplast genome of G. tenuistipitata var. liui to differentiate G. tenuistipitata obtained from six different localities: four from Peninsular Malaysia, one from Thailand and one from Vietnam. Eighty G. tenuistipitata specimens were analyzed using eight simple sequence repeat (SSR) primer-pairs that we developed for polymerase chain reaction (PCR) amplification. Five mononucleotide primer-pairs and one trinucleotide primer-pair exhibited monomorphic alleles, whereas the other two primer-pairs separated the G. tenuistipitata specimens into two main clades. G. tenuistipitata from Thailand and Vietnam were grouped into one clade, and the populations from Batu Laut, Middle Banks and Kuah (Malaysia) were grouped into another clade. The combined dataset of these two primer-pairs separated G. tenuistipitata obtained from Kelantan, Malaysia from that obtained from other localities. Based on the variations in repeated nucleotides of microsatellite markers, our results suggested that the populations of G. tenuistipitata were distributed into two main geographical regions: (i) populations in the west coast of Peninsular Malaysia and (ii) populations facing the South China Sea. The correct identification of G. tenuistipitata strains with traits of high economic potential will be advantageous for the mass cultivation of seaweeds.

  11. Experimental study on the long-term effect of cadmium in mice fed cadmium-polluted rice with special reference to the effect of repeated reproductive cycles

    Energy Technology Data Exchange (ETDEWEB)

    Watanabe, M.; Shiroishi, K.; Nishino, H.; Shinmura, T.; Murase, H.; Shoji, T.; Naruse, Y.; Kagamimori, S.

    1986-06-01

    Long-term biological effects of cadmium-polluted rice and effect of repeated reproductive cycles on them were examined. Female SLC-B6D2F mice (female C57BL/6, male DBA/2) were fed a rice diet containing 65% unpolished rice for about 2 years from 7 weeks of age. The unpolished rice preparations used were commercially available rice (non-Cd-polluted) and Cd-polluted rice (over 1.0 ppm). Average Cd contents in each diet class were 0.12, 0.48, 1.78, 1.75, and 47.1 ppm (50 ppm Cd as CdCl/sub 2/ added). Some experimental mice were subjected to repeated reproductive cycles (parity group). Hematological, biochemical, and pathological examinations of urine, blood, and tissues, including Cd measurement, were carried out. Results after statistical analysis indicate Cd toxicities such as anemia and disturbances of Ca metabolism. These Cd effects were found to be enhanced by the reproductive cycles. Soft X-ray radiograms showed osteoporosis in the parity groups, especially in the groups with diets of higher Cd content. However, we could not find any sign of disturbance of renal function under our experimental conditions.

  12. Analysis of repeated measures data

    CERN Document Server

    Islam, M Ataharul

    2017-01-01

    This book presents a broad range of statistical techniques to address emerging needs in the field of repeated measures. It also provides a comprehensive overview of extensions of generalized linear models for the bivariate exponential family of distributions, which represent a new development in analysing repeated measures data. The demand for statistical models for correlated outcomes has grown rapidly recently, mainly due to presence of two types of underlying associations: associations between outcomes, and associations between explanatory variables and outcomes. The book systematically addresses key problems arising in the modelling of repeated measures data, bearing in mind those factors that play a major role in estimating the underlying relationships between covariates and outcome variables for correlated outcome data. In addition, it presents new approaches to addressing current challenges in the field of repeated measures and models based on conditional and joint probabilities. Markov models of first...

  13. The Effect of Repeaters on Equating

    Science.gov (United States)

    Kim, HeeKyoung; Kolen, Michael J.

    2010-01-01

    Test equating might be affected by including in the equating analyses examinees who have taken the test previously. This study evaluated the effect of including such repeaters on Medical College Admission Test (MCAT) equating using a population invariance approach. Three-parameter logistic (3-PL) item response theory (IRT) true score and…

  14. The Differential Effects of Repeating Kindergarten

    Science.gov (United States)

    Burkam, David T.; LoGerfo, Laura; Ready, Doug; Lee, Valerie E.

    2007-01-01

    We use the Early Childhood Longitudinal Study to investigate national patterns addressing (a) who repeats kindergarten, and (b) the subsequent cognitive effects of this event. Using OLS regression techniques, we investigate 1st-time kindergartners who are promoted, 1st-time kindergartners who are retained, and children who are already repeating…

  15. EVOLUTION AND RECOMBINATION OF BOVINE DNA REPEATS

    NARCIS (Netherlands)

    JOBSE, C; BUNTJER, JB; HAAGSMA, N; BREUKELMAN, HJ; BEINTEMA, JJ; LENSTRA, JA

    The history of the abundant repeat elements in the bovine genome has been studied by comparative hybridization and PCR. The Bov-A and Bov-B SINE elements both emerged just after the divergence of the Camelidae and the true ruminants. A 31-bp subrepeat motif in satellites of the Bovidae species

  16. EVOLUTION AND RECOMBINATION OF BOVINE DNA REPEATS

    NARCIS (Netherlands)

    JOBSE, C; BUNTJER, JB; HAAGSMA, N; BREUKELMAN, HJ; BEINTEMA, JJ; LENSTRA, JA

    1995-01-01

    The history of the abundant repeat elements in the bovine genome has been studied by comparative hybridization and PCR. The Bov-A and Bov-B SINE elements both emerged just after the divergence of the Camelidae and the true ruminants. A 31-bp subrepeat motif in satellites of the Bovidae species cattl

  17. In Vitro Study on Lethal Effect of Human Choroidal Melanoma OCM-1 Cell Line by Repeating-70℃Freeze Thawing%In Vitro Study on Lethal Effect of Human Choroidal Melanoma OCM-1 Cell Line by Repeating-70℃ Freeze Thawing

    Institute of Scientific and Technical Information of China (English)

    Bin Liu; Yongping Li; Bo Zhang; Wenxin Zhang

    2007-01-01

    Objective: To investigate the effects of repeating -70℃ freeze thawing on human choroidal melanoma cell line OCM-1.Methods: OCM-1 cells were frozen by repeating -70℃ freeze thawing with various durations and frequencies. Then the inhibit rate of cells was examined by MTT essay.The cell viability was measured by monoclonal formation assay. We also used the HE staining, immunohistochemistry staining and the laser-scanning confocal microscopy (LSCM) to investigate the morphological changes of the cells.Results: The growth of OCM-1 cells was inhibited by repeating -70℃ freeze thawing in time-dependent and frequency-dependent manners (P < 0.01). Different morphous including necrosis and apoptosis of the cells could be observed after -70℃ freeze thawing by the LSCM.Conclusion: Repeating -70℃ freeze thawing can not only kill cells directly and induce considerable cells to apoptosis, but also inhibit the growth of the survivals. The kill and wound ratio of the cells disposal with different times and frequencies present variance. And the distinction when treated with different frequencies during the same time is much more significant than different times with the same frequency, which guide clinical workers to choose repeating cryotherapy with short term method instead of single cryotherapy with long term in choroidal melanoma treatment.

  18. Repeatability of peripheral aberrations in young emmetropes.

    Science.gov (United States)

    Baskaran, Karthikeyan; Theagarayan, Baskar; Carius, Staffan; Gustafsson, Jörgen

    2010-10-01

    The purpose of this study is to assess the intrasession repeatability of ocular aberration measurements in the peripheral visual field with a commercially available Shack-Hartmann aberrometer (complete ophthalmic analysis system-high definition-vision research). The higher-order off-axis aberrations data in young healthy emmetropic eyes are also reported. The aberrations of the right eye of 18 emmetropes were measured using an aberrometer with an open field of view that allows peripheral measurements. Five repeated measures of ocular aberrations were obtained and assessed in steps of 10° out to ±40° in the horizontal visual field (nasal + and temporal -) and -20° in the inferior visual field. The coefficient of repeatability, coefficient of variation, and the intraclass correlation coefficient were calculated as a measure of intrasession repeatability. In all eccentric angles, the repeatability of the third- and fourth-order aberrations was better than the fifth and sixth order aberrations. The coefficient of variation was coefficient was >0.90 for the third and fourth order but reduced gradually for higher orders. There was no statistical significant difference in variance of total higher-order root mean square between on- and off-axis measurements (p > 0.05). The aberration data in this group of young emmetropes showed that the horizontal coma (C(3)(1)) was most positive at 40° in the temporal field, decreasing linearly toward negative values with increasing off-axis angle into the nasal field, whereas all other higher-order aberrations showed little or no change. The complete ophthalmic analysis system-high definition-vision research provides fast, repeatable, and valid peripheral aberration measurements and can be used efficiently to measure off-axis aberrations in the peripheral visual field.

  19. Repeated-sprint and effort ability in rugby league players.

    Science.gov (United States)

    Johnston, Rich D; Gabbett, Tim J

    2011-10-01

    The aim of this study was to (a) investigate the influence of tackling on repeated-sprint performance; (b) determine whether repeated-sprint ability (RSA) and repeated-effort ability (REA) are 2 distinct qualities; and (c) assess the test-retest reliability of repeated-sprint and repeated-effort tests in rugby league. Twelve rugby league players performed a repeated-sprint (12 × 20-m sprints performed on a 20-second cycle) and a repeated-effort (12 × 20-m sprints with intermittent tackling, performed on a 20-second cycle) test 7 days apart. The test-retest reliability of these tests was also established. Heart rate and rating of perceived exertion were recorded throughout the tests. There was a significantly greater (p ≤ 0.05) and large effect size (ES) differences for total sprint time (ES = 1.19), average heart rate (ES = 1.64), peak heart rate (ES = 1.35), and perceived exertion (ES = 3.39) for the repeated-effort test compared with the repeated-sprint test. A large difference (ES = 1.02, p = 0.06) was detected for percentage decrement between the 2 tests. No significant relationship was found between the repeated-sprint and repeated-effort tests for any of the dependent variables. Both tests proved reliable, with total sprint time being the most reliable method of assessing performance. This study demonstrates that the addition of tackling significantly increases the physiological response to repeated-sprint exercise and reduces repeated-sprint performance in rugby league players. Furthermore, RSA and REA appear to be 2 distinct qualities that can be reliably assessed with total time being the most reliable measure of performance.

  20. Effect of repeated intracoronary injection of bone marrow cells in patients with ischaemic heart failure the Danish stem cell study--congestive heart failure trial (DanCell-CHF)

    DEFF Research Database (Denmark)

    Diederichsen, Axel Cosmus Pyndt; Møller, Jacob E; Thayssen, Per;

    2008-01-01

    BACKGROUND: It has been suggested that myocardial regeneration may be achieved by a single intracoronary bone marrow derived stem cell infusion in selected patients with ischaemic heart disease. The effect is uncertain in patients with chronic ischaemic heart failure and it is not known whether...... repeated infusions would have additional positive effects. AIMS: To assess whether two treatments of intracoronary infusion of bone marrow stem cells, administered 4 months apart, could improve left ventricular (LV) systolic function in patients with chronic ischaemic heart failure. METHODS: The study...... was prospective and non-randomised, comprising an observational baseline period of 4 months followed by an interventional period of 12 months. Intracoronary bone marrow cell infusion was performed at the end of the baseline period and repeated 4 months later. RESULTS: 32 patients were included. LV ejection...

  1. Photometric Repeatability of Scanned Imagery: UVIS

    Science.gov (United States)

    Shanahan, Clare E.; McCullough, Peter; Baggett, Sylvia

    2017-08-01

    We provide the preliminary results of a study on the photometric repeatability of spatial scans of bright, isolated white dwarf stars with the UVIS channel of the Wide Field Camera 3 (WFC3) on the Hubble Space Telescope (HST). We analyze straight-line scans from the first pair of identical orbits of HST program 14878 to assess if sub 0.1% repeatability can be attained with WFC3/UVIS. This study is motivated by the desire to achieve better signal-to-noise in the UVIS contamination and stability monitor, in which observations of standard stars in staring mode have been taken from the installation of WFC3 in 2009 to the present to assess temporal photometric stability. Higher signal to noise in this program would greatly benefit the sensitivity to detect contamination, and to better characterize the observed small throughput drifts over time. We find excellent repeatability between identical visits of program 14878, with sub 0.1% repeatability achieved in most filters. These! results support the initiative to transition the staring mode UVIS contamination and photometric stability monitor from staring mode images to spatial scans.

  2. Intragenic tandem repeat variation between Legionella pneumophila strains

    Directory of Open Access Journals (Sweden)

    Jarraud Sophie

    2008-12-01

    Full Text Available Abstract Background Bacterial genomes harbour a large number of tandem repeats, yet the possible phenotypic effects of those found within the coding region of genes are only beginning to be examined. Evidence exists from other organisms that these repeats can be involved in the evolution of new genes, gene regulation, adaptation, resistance to environmental stresses, and avoidance of the immune system. Results In this study, we have investigated the presence and variability in copy number of intragenic tandemly repeated sequences in the genome of Legionella pneumophila, the etiological agent of a severe pneumonia known as Legionnaires' disease. Within the genome of the Philadelphia strain, we have identified 26 intragenic tandem repeat sequences using conservative selection criteria. Of these, seven were "polymorphic" in terms of repeat copy number between a large number of L. pneumophila serogroup 1 strains. These strains were collected from a wide variety of environments and patients in several geographical regions. Within this panel of strains, all but one of these seven genes exhibited statistically different patterns in repeat copy number between samples from different origins (environmental, clinical, and hot springs. Conclusion These results support the hypothesis that intragenic tandem repeats could play a role in virulence and adaptation to different environments. While tandem repeats are an increasingly popular focus of molecular typing studies in prokaryotes, including in L. pneumophila, this study is the first examining the difference in tandem repeat distribution as a function of clinical or environmental origin.

  3. Impact of Inclusion or Exclusion of Repeaters on Test Equating

    Science.gov (United States)

    Puhan, Gautam

    2011-01-01

    This study examined the effect of including or excluding repeaters on the equating process and results. New forms of two tests were equated to their respective old forms using either all examinees or only the first timer examinees in the new form sample. Results showed that for both tests used in this study, including or excluding repeaters in the…

  4. Can repeating glacial seismic events be used to monitor stress changes within the underlying volcano? -Case study from the glacier overlain Katla volcano, Iceland

    Science.gov (United States)

    Jonsdottir, K.; Vogfjord, K. S.; Bean, C. J.; Martini, F.

    2013-12-01

    individual families are usually clustered in time over several months, and sometimes families may reappear even up to several years later. Using families including many events and covering long periods (10-20 months) we compare the coda (the tail) of individual events within a family. This is repeated for all the surrounding stations. The analysis, coda wave interferometry (cwi) is a correlation method that builds on the fact that changes in stress in the edifice lead to changes in seismic velocities. The coda waves are highly sensitive to small stress changes. By using a repeating source, implying we have the same source mechanism and the same path, we can track temporal stress changes in the medium between the source and the receiver. Preliminary results from Katla suggest that by using the repeating glacial events and the coda wave interferometry technique we observe annual seismic velocity changes around the volcano of ca. 0.7%. We find that seismic velocities increase from January through July and decrease in August to December. These changes can be explained by pore-water pressure changes and/or loading and de-loading of the overlain glacier. We do not find immediate precursors for an impending eruption at Katla; however we now have a better understanding of its background seismicity.

  5. Zinc-finger directed double-strand breaks within CAG repeat tracts promote repeat instability in human cells.

    Science.gov (United States)

    Mittelman, David; Moye, Christopher; Morton, Jason; Sykoudis, Kristen; Lin, Yunfu; Carroll, Dana; Wilson, John H

    2009-06-16

    Expanded triplet repeats have been identified as the genetic basis for a growing number of neurological and skeletal disorders. To examine the contribution of double-strand break repair to CAG x CTG repeat instability in mammalian systems, we developed zinc finger nucleases (ZFNs) that recognize and cleave CAG repeat sequences. Engineered ZFNs use a tandem array of zinc fingers, fused to the FokI DNA cleavage domain, to direct double-strand breaks (DSBs) in a site-specific manner. We first determined that the ZFNs cleave CAG repeats in vitro. Then, using our previously described tissue culture assay for identifying modifiers of CAG repeat instability, we found that transfection of ZFN-expression vectors induced up to a 15-fold increase in changes to the CAG repeat in human and rodent cell lines, and that longer repeats were much more sensitive to cleavage than shorter ones. Analysis of individual colonies arising after treatment revealed a spectrum of events consistent with ZFN-induced DSBs and dominated by repeat contractions. We also found that expressing a dominant-negative form of RAD51 in combination with a ZFN, dramatically reduced the effect of the nuclease, suggesting that DSB-induced repeat instability is mediated, in part, through homology directed repair. These studies identify a ZFN as a useful reagent for characterizing the effects of DSBs on CAG repeats in cells.

  6. Repeats in transforming acidic coiled-coil (TACC) genes.

    Science.gov (United States)

    Trivedi, Seema

    2013-06-01

    Transforming acidic coiled-coil proteins (TACC1, 2, and 3) are essential proteins associated with the assembly of spindle microtubules and maintenance of bipolarity. Dysregulation of TACCs is associated with tumorigenesis, but studies of microsatellite instability in TACC genes have not been extensive. Microsatellite or simple sequence repeat instability is known to cause many types of cancer. The present in silico analysis of SSRs in human TACC gene sequences shows the presence of mono- to hexa-nucleotide repeats, with the highest densities found for mono- and di-nucleotide repeats. Density of repeats is higher in introns than in exons. Some of the repeats are present in regulatory regions and retained introns. Human TACC genes show conservation of many repeat classes. Microsatellites in TACC genes could be valuable markers for monitoring numerical chromosomal aberrations and or cancer.

  7. Survey of simple sequence repeats in woodland strawberry (Fragaria vesca).

    Science.gov (United States)

    Guan, L; Huang, J F; Feng, G Q; Wang, X W; Wang, Y; Chen, B Y; Qiao, Y S

    2013-07-30

    The use of simple sequence repeats (SSRs), or microsatellites, as genetic markers has become popular due to their abundance and variation in length among individuals. In this study, we investigated linkage groups (LGs) in the woodland strawberry (Fragaria vesca) and demonstrated variation in the abundances, densities, and relative densities of mononucleotide, dinucleotide, and trinucleotide repeats. Mononucleotide, dinucleotide, and trinucleotide repeats were more common than longer repeats in all LGs examined. Perfect SSRs were the predominant SSR type found and their abundance was extremely stable among LGs and chloroplasts. Abundances of mononucleotide, dinucleotide, and trinucleotide repeats were positively correlated with LG size, whereas those of tetranucleotide and hexanucleotide SSRs were not. Generally, in each LG, the abundance, relative abundance, relative density, and the proportion of each unique SSR all declined rapidly as the repeated unit increased. Furthermore, the lengths and frequencies of SSRs varied among different LGs.

  8. 中国汉族人群ATXN8OS基因CTA/CTG三核苷酸重复研究%Studies gin the CTA/CTA/CTG trinucleolide repeats of ATXNSOS gene in Chinese Hans

    Institute of Scientific and Technical Information of China (English)

    王俊岭; 夏昆; 唐北沙; 张申; 徐倩; 李晓辉; 宋兴旺; 江泓; 沈璐; 严新翔; 潘乾

    2008-01-01

    目的 研究中国正常人群脊髓小脑性共济失调(spinocerebellar ataxia,SCA)8型(SCA8)致病基因ATXN8OS(CTA/CTG)n正常变异范围,以及AIXN8OS基因(CTA/CTG)n扩展突变在中国大陆SCA患者中的分布.方法 应用荧光PCR、8%变性聚丙烯酰胺凝胶电泳和毛细管凝胶电泳等方法对132例已经排除SCA1、SCA2、SCA3、SCA6、SCA7、SCA12、SCA17和齿状核红核苍白球路易体萎缩(dentatorubral-pallidoluysian atrophy,DRPLA)的SCA患者及261名正常汉族对照人群进行ATXN8OS基因三核苷酸重复次数分析.结果 未发现ATXN8OS基因(CTA/CTG)n核苷酸扩展突变;132例SCA患者中ATXN8OS基因(CTA/CTG)n变异范围为17~47次,平均重复次数(24.20+4.57)次,18次重复最常见,纯合子35例,纯合率为26.5%;261名正常对照人群ATXN8OS基因(CTA/CTG)n正常变异范围为12~43次,均重复次数(24.04+4.53)次,18次重复最常见,纯合子70人,纯合率为26.8%.结论 SCA8在中国大陆为罕见的SCA亚型,中国大陆SCA8发病率低可能和正常人群较大(CTA/CTG)n重复次数的等位基因少见有关.%Objective To study the normal range of(CTA/CTG)n repeats of ATXN80S gene in Chinese Hans,and the frequency of ATXN80S(CTA/CTG)n repeat expansion in spinocerebellar ataxia(SCA)patients in Mainland China.Methods rnle(CTA/CTG)n repeats of ATXN80S gene were detected using fluorescence-PER,8% denaturing polyacrylamide gel and capillary electrophoresis technique in 132 SCA patients in whom CAG expansion at the SCA1,SCA2,SCA3,SCA6,SCA7,SCA12,SCA17 and dentatorubral-pallidoluysian atrophy(DRPLA)loci has been excluded,and 261 healthy controls.Results There were no obvious abnormal changes ofthe(CTA/CTC)n repeats ofATXN80S gene in the 132 SCA patients.Thirty-five SCA patients were homozygotes(26.5%),and the range of CTA/CTG repeat number was 17 to 47(24.20±4.57),among which 18 repeats appeared most frequently.In 261 normal controls,70 were homozygotes(26.8%),and the range of the CTA/CTG repeat

  9. Limitations on quantum key repeaters.

    Science.gov (United States)

    Bäuml, Stefan; Christandl, Matthias; Horodecki, Karol; Winter, Andreas

    2015-04-23

    A major application of quantum communication is the distribution of entangled particles for use in quantum key distribution. Owing to noise in the communication line, quantum key distribution is, in practice, limited to a distance of a few hundred kilometres, and can only be extended to longer distances by use of a quantum repeater, a device that performs entanglement distillation and quantum teleportation. The existence of noisy entangled states that are undistillable but nevertheless useful for quantum key distribution raises the question of the feasibility of a quantum key repeater, which would work beyond the limits of entanglement distillation, hence possibly tolerating higher noise levels than existing protocols. Here we exhibit fundamental limits on such a device in the form of bounds on the rate at which it may extract secure key. As a consequence, we give examples of states suitable for quantum key distribution but unsuitable for the most general quantum key repeater protocol.

  10. Repeated sprint training in normobaric hypoxia.

    Science.gov (United States)

    Galvin, Harvey M; Cooke, Karl; Sumners, David P; Mileva, Katya N; Bowtell, Joanna L

    2013-12-01

    Repeated sprint ability (RSA) is a critical success factor for intermittent sport performance. Repeated sprint training has been shown to improve RSA, we hypothesised that hypoxia would augment these training adaptations. Thirty male well-trained academy rugby union and rugby league players (18.4 ± 1.5 years, 1.83 ± 0.07 m, 88.1 ± 8.9 kg) participated in this single-blind repeated sprint training study. Participants completed 12 sessions of repeated sprint training (10 × 6 s, 30 s recovery) over 4 weeks in either hypoxia (13% FiO₂) or normoxia (21% FiO₂). Pretraining and post-training, participants completed sports specific endurance and sprint field tests and a 10 × 6 s RSA test on a non-motorised treadmill while measuring speed, heart rate, capillary blood lactate, muscle and cerebral deoxygenation and respiratory measures. Yo-Yo Intermittent Recovery Level 1 test performance improved after RS training in both groups, but gains were significantly greater in the hypoxic (33 ± 12%) than the normoxic group (14 ± 10%, prepeated aerobic high intensity workout than an equivalent normoxic training. Performance gains are evident in the short term (4 weeks), a period similar to a preseason training block.

  11. Triggering of repeating earthquakes in central California

    Science.gov (United States)

    Wu, Chunquan; Gomberg, Joan; Ben-Naim, Eli; Johnson, Paul

    2014-01-01

    Dynamic stresses carried by transient seismic waves have been found capable of triggering earthquakes instantly in various tectonic settings. Delayed triggering may be even more common, but the mechanisms are not well understood. Catalogs of repeating earthquakes, earthquakes that recur repeatedly at the same location, provide ideal data sets to test the effects of transient dynamic perturbations on the timing of earthquake occurrence. Here we employ a catalog of 165 families containing ~2500 total repeating earthquakes to test whether dynamic perturbations from local, regional, and teleseismic earthquakes change recurrence intervals. The distance to the earthquake generating the perturbing waves is a proxy for the relative potential contributions of static and dynamic deformations, because static deformations decay more rapidly with distance. Clear changes followed the nearby 2004 Mw6 Parkfield earthquake, so we study only repeaters prior to its origin time. We apply a Monte Carlo approach to compare the observed number of shortened recurrence intervals following dynamic perturbations with the distribution of this number estimated for randomized perturbation times. We examine the comparison for a series of dynamic stress peak amplitude and distance thresholds. The results suggest a weak correlation between dynamic perturbations in excess of ~20 kPa and shortened recurrence intervals, for both nearby and remote perturbations.

  12. History repeats itself: genomic divergence in copepods.

    Science.gov (United States)

    Renaut, Sébastien; Dion-Côté, Anne-Marie

    2016-04-01

    Press stop, erase everything from now till some arbitrary time in the past and start recording life as it evolves once again. Would you see the same tape of life playing itself over and over, or would a different story unfold every time? The late Steven Jay Gould called this experiment replaying the tape of life and argued that any replay of the tape would lead evolution down a pathway radically different from the road actually taken (Gould 1989). This thought experiment has puzzled evolutionary biologists for a long time: how repeatable are evolutionary events? And if history does indeed repeat itself, what are the factors that may help us predict the path taken? A powerful means to address these questions at a small evolutionary scale is to study closely related populations that have evolved independently, under similar environmental conditions. This is precisely what Pereira et al. (2016) set out to do using marine copepods Tigriopus californicus, and present their results in this issue of Molecular Ecology. They show that evolution can be repeatable and even partly predictable, at least at the molecular level. As expected from theory, patterns of divergence were shaped by natural selection. At the same time, strong genetic drift due to small population sizes also constrained evolution down a similar evolutionary road, and probably contributed to repeatable patterns of genomic divergence.

  13. An X-Ray Study of Supernova Remnant N49 and Soft Gamma-Ray Repeater 0526-66 in the Large Magellanic Cloud

    CERN Document Server

    Park, Sangwook; Slane, Patrick O; Burrows, David N; Lee, Jae-Joon; Mori, Koji

    2012-01-01

    We report on the results from our deep Chandra observation (120 ks) of the supernova remnant (SNR) N49 and soft Gamma-ray repeater (SGR) 0526-66 in the Large Magellanic Cloud. We firmly establish the detection of an ejecta "bullet" beyond the southwestern boundary of N49. The X-ray spectrum of the bullet is distinguished from that of the main SNR shell, showing significantly enhanced Si and S abundances. We also detect an ejecta feature in the eastern shell, which shows metal overabundances similar to those of the bullet. If N49 was produced by a core-collapse explosion of a massive star, the detected Si-rich ejecta may represent explosive O-burning or incomplete Si-burning products from deep interior of the supernova. On the other hand, the observed Si/S abundance ratio in the ejecta may favor Type Ia origin for N49. We refine the Sedov age of N49, tau_Sed ~ 4800 yr, with the explosion energy E_0 ~ 1.8 x 10^51 erg. Our blackbody (BB) + power law (PL) model for the quiescent X-ray emission from SGR 0526-66 in...

  14. Collaborative work to evaluate toxicity on male reproductive organs by repeated dose studies in rats 22). Effects of 2- and 4-week administration of theobromine on the testis.

    Science.gov (United States)

    Funabashi, H; Fujioka, M; Kohchi, M; Tateishi, Y; Matsuoka, N

    2000-10-01

    The effects of theobromine, a xanthine derivative, on the testis were compared between rats dosed for 2 and 4 weeks to determine whether a 2-week dosing period is long enough to detect toxicity. Theobromine was administered orally to male Sprague-Dawley rats at dose levels of 250 and 500 mg/kg for 2 weeks starting at the age of 6 or 8 weeks, and for 4 weeks from the age of 6 weeks. Histopathological examination of reproductive organs revealed toxic findings in the testis at 500 mg/kg after 2 weeks of dosing at both ages, and at 250 and 500 mg/kg after 4 weeks of dosing. The primary findings were degeneration/necrosis and desquamation of spermatids and spermatocytes, vacuolization of seminiferous tubules, and multinucleated giant cell formation. These findings were present mainly in stages I-VI and XII-XIV. From these results, it is concluded that the toxic effects of theobromine on the testis can be detected by repeated dosing for 2 weeks as well as for 4 weeks.

  15. Repeated Fish Removal to Restore Lakes: Case Study of Lake Væng, Denmark—Two Biomanipulations during 30 Years of Monitoring

    Directory of Open Access Journals (Sweden)

    Martin Søndergaard

    2017-01-01

    Full Text Available Biomanipulation by fish removal has been used in many shallow lakes as a method to improve lake water quality. Here, we present and analyse 30 years of chemical and biological data from the shallow and 16 ha large Lake Væng, Denmark, which has been biomanipulated twice with a 20-year interval by removing roach (Rutilus rutilus and bream (Abramis brama. After both biomanipulations, Lake Væng shifted from a turbid, phytoplankton-dominated state to a clear, water macrophyte-dominated state. Chlorophyll a was reduced from 60–80 μg·L−1 to 10–30 μg·L−1 and the coverage of submerged macrophytes, dominated by Elodea canadensis, increased from <0.1% to 70%–80%. Mean summer total phosphorus was reduced from about 0.12 to 0.07 mg·L−1 and total nitrogen decreased from 1.0 to 0.4 mg·L−1. On a seasonal scale, phosphorus and chlorophyll concentrations changed from a summer maximum during turbid conditions to a winter maximum under clear conditions. The future of Lake Væng is uncertain and a relatively high phosphorus loading via the groundwater, and the accumulation of a mobile P pool in the sediment make it likely that the lake eventually will return to turbid conditions. Repeated fish removals might be a relevant management strategy to apply in shallow lakes with a relatively high external nutrient loading.

  16. Repeatability and reproducibility of determination of the nitrogen content of fishmeal by the combustion (Dumas) method and comparison with the Kjeldahl method: interlaboratory study.

    Science.gov (United States)

    Miller, Eric L; Bimbo, Anthony P; Barlow, Stuart M; Sheridan, Berni

    2007-01-01

    Ten fishmeal samples (hidden duplicates of 4 meals plus 2 high-protein meals as a Youden pair), tryptophan, and nicotinic acid were analyzed by 18 laboratories using the Dumas method. Thirteen of the laboratories also analyzed the same 12 samples using their current Kjeldahl method. Recoveries (+/-SR) of tryptophan and nicotinic acid were 99.3+/-1.04 and 98.8+/-2.11% by Dumas and 97.1+/-3.03 and 74.6+/-26.76% by Kjeldahl. The Dumas method gave significantly greater values (P Kjeldahl method. For fishmeals, Kjeldahl N = 0.989 of Dumas N (P Kjeldahl. For fishmeals, the relative standard deviations for repeatability and reproducibility were for Dumas 1.48 and 2.01% and Kjeldahl 1.62 and 2.37%, respectively. A single analysis conducted in 2 laboratories should not differ by more than 5.63% of the mean value when measured by Dumas or by more than 6.64% by Kjeldahl. It is concluded that with fishmeal, Dumas gives a more reliable measure of organic nitrogen than Kjeldahl, and, therefore, Dumas should be the method of choice.

  17. Mononucleotide repeats are asymmetrically distributed in fungal genes

    Directory of Open Access Journals (Sweden)

    de Graaff Leo H

    2008-12-01

    Full Text Available Abstract Background Systematic analyses of sequence features have resulted in a better characterisation of the organisation of the genome. A previous study in prokaryotes on the distribution of sequence repeats, which are notoriously variable and can disrupt the reading frame in genes, showed that these motifs are skewed towards gene termini, specifically the 5' end of genes. For eukaryotes no such intragenic analysis has been performed, though this could indicate the pervasiveness of this distribution bias, thereby helping to expose the selective pressures causing it. Results In fungal gene repertoires we find a similar 5' bias of intragenic mononucleotide repeats, most notably for Candida spp., whereas e.g. Coccidioides spp. display no such bias. With increasing repeat length, ever larger discrepancies are observed in genome repertoire fractions containing such repeats, with up to an 80-fold difference in gene fractions at repeat lengths of 10 bp and longer. This species-specific difference in gene fractions containing large repeats could be attributed to variations in intragenic repeat tolerance. Furthermore, long transcripts experience an even more prominent bias towards the gene termini, with possibly a more adaptive role for repeat-containing short transcripts. Conclusion Mononucleotide repeats are intragenically biased in numerous fungal genomes, similar to earlier studies on prokaryotes, indicative of a similar selective pressure in gene organization.

  18. EAMJ Dec. Repeatability.indd

    African Journals Online (AJOL)

    2008-12-12

    Dec 12, 2008 ... Results:Kappa values for four-week repeatability for the wheeze and asthma questions were 0.61 ... for logistic, cultural and ethical reasons, to use ... individual with baseline forced expiratory volume in .... period is likely to also include the effects of true ... data, the writing of the manuscript or the decision.

  19. Effect of Repeated Simulations by Standardized Patients on Intercase Reliability.

    Science.gov (United States)

    Colliver, Jerry A.; And Others

    1991-01-01

    A study using five Southern Illinois University senior medical school classes (n=350 students) investigated whether having a standardized patient simulate a case repeatedly in postclerkship medical student evaluation affects the measure's reliability. Results suggest that repeated simulation had little or no effect on intercase reliability of…

  20. AN X-RAY STUDY OF SUPERNOVA REMNANT N49 AND SOFT GAMMA-RAY REPEATER 0526-66 IN THE LARGE MAGELLANIC CLOUD

    Energy Technology Data Exchange (ETDEWEB)

    Park, Sangwook [Department of Physics, University of Texas at Arlington, Box 19059, Arlington, TX 76019 (United States); Hughes, John P. [Department of Physics and Astronomy, Rutgers University, 136 Frelinghuysen Road, Piscataway, NJ 08854-8019 (United States); Slane, Patrick O. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Burrows, David N. [Department of Astronomy and Astrophysics, Pennsylvania State University, 525 Davey Laboratory, University Park, PA 16802 (United States); Lee, Jae-Joon [Korea Astronomy and Space Science Institute, Daejeon 305-348 (Korea, Republic of); Mori, Koji, E-mail: s.park@uta.edu [Department of Applied Physics, University of Miyazaki, 1-1 Gakuen Kibana-dai Nishi, Miyazaki 889-2192 (Japan)

    2012-04-01

    We report on the results from our deep Chandra observation (120 ks) of the supernova remnant (SNR) N49 and soft gamma-ray repeater (SGR) 0526-66 in the Large Magellanic Cloud. We firmly establish the detection of an ejecta 'bullet' beyond the southwestern boundary of N49. The X-ray spectrum of the bullet is distinguished from that of the main SNR shell, showing significantly enhanced Si and S abundances. We also detect an ejecta feature in the eastern shell, which shows metal overabundances similar to those of the bullet. If N49 was produced by a core-collapse explosion of a massive star, the detected Si-rich ejecta may represent explosive O-burning or incomplete Si-burning products from deep interior of the SN. On the other hand, the observed Si/S abundance ratio in the ejecta may favor Type Ia origin for N49. We refine the Sedov age of N49, {tau}{sub Sed} {approx} 4800 yr, with the explosion energy E{sub 0} {approx} 1.8 Multiplication-Sign 10{sup 51} erg. Our blackbody (BB) + power law (PL) model for the quiescent X-ray emission from SGR 0526-66 indicates that the PL photon index ({Gamma} {approx} 2.5) is identical to that of PSR 1E1048.1-5937, the well-known candidate transition object between anomalous X-ray pulsars and SGRs. Alternatively, the two-component BB model implies X-ray emission from a small (R {approx} 1 km) hot spot(s) (kT {approx} 1 keV) in addition to emission from the neutron star's cooler surface (R {approx} 10 km, kT {approx} 0.4 keV). There is a considerable discrepancy in the estimated column toward 0526-66 between BB+PL and BB+BB model fits. Discriminating these spectral models would be crucial to test the long-debated physical association between N49 and 0526-66.

  1. Repeated vitrification/warming of human sperm gives better results than repeated slow programmable freezing

    Institute of Scientific and Technical Information of China (English)

    Teraporn Vutyavanich; Worashorn Lattiwongsakorn; Waraporn Piromlertamorn; Sudarat Samchimchom

    2012-01-01

    In this study,we compared the effects of repeated freezing/thawing of human sperm by our in-house method of rapid freezing with slow programmable freezing.Sperm samples from 11 normozoospermic subjects were processed through density gradients and divided into three aliquots:non-frozen,rapid freezing and slow programmable freezing.Sperm in the rapid freezing group had better motility and viability than those in the slow freezing group (P<O.01) after the first,second and third cycles of freezing/thawing,but there was no difference in morphology.In the second experiment,rapid freezing was repeated three times in 20 subjects.The samples from each thawing cycle were evaluated for DNA fragmentation using the alkaline comet assay.DNA fragmentation began to increase considerably after the second cycle of freezing/thawing,but to a level that was not clinically important.In the third experiment,rapid freezing was done repeatedly in 10 subjects,until no motile sperm were observed after thawing.The median number of repeated freezing/thawing that yielded no motile sperm was seven (range:5-8,mean:6.8).In conclusion,we demonstrated that repeated freezing/thawing of processed semen using our rapid freezing method gave better results than standard slow programmable freezing.This method can help maximize the usage of precious cryopreserved sperm samples in assisted reproduction technology.

  2. Repeatability of Response to Asthma Medications

    Science.gov (United States)

    Wu, Ann; Tantisira, Kelan; Li, Lingling; Schuemann, Brooke; Weiss, Scott

    2010-01-01

    Background Pharmacogenetic studies of drug response in asthma assume that patients respond consistently to a treatment but that treatment response varies across patients, however, no formal studies have demonstrated this. Objective To determine the repeatability of commonly used outcomes for treatment response to asthma medications: bronchodilator response, forced expiratory volume in 1 second (FEV1), and provocative concentration of methacholine producing a 20% decline in FEV1 (PC20). Methods The Childhood Asthma Management Program (CAMP) was a multi-center clinical trial of children randomized to receiving budesonide, nedocromil, or placebo. We determined the intraclass correlation coefficient (ICC) for each outcome over repeated visits over four years in CAMP using mixed effects regression models. We adjusted for the covariates: age, race/ethnicity, height, family income, parental education, and symptom score. We incorporated each outcome for each child as repeated outcome measurements and stratified by treatment group. Results The ICC for bronchodilator response was 0.31 in the budesonide group, 0.35 in the nedocromil group, and 0.40 in the placebo group, after adjusting for covariates. The ICC for FEV1 was 0.71 in the budesonide group, 0.60 in the nedocromil group, and 0.69 in the placebo group, after adjusting for covariates. The ICC for PC20 was 0.67 in the budesonide and placebo groups and 0.73 in the nedocromil group, after adjusting for covariates. Conclusion The within treatment group repeatability of FEV1 and PC20 are high; thus these phenotypes are heritable. FEV1 and PC20 may be better phenotypes than bronchodilator response for studies of treatment response in asthma. PMID:19064281

  3. Directionality switchable gain stabilized linear repeater

    Science.gov (United States)

    Ota, Takayuki; Ohmachi, Tadashi; Aida, Kazuo

    2004-10-01

    We propose a new approach to realize a bidirectional linear repeater suitable for future optical internet networks and fault location in repeater chain with OTDR. The proposed approach is the linear repeater of simple configuration whose directionality is rearranged dynamically by electrical control signal. The repeater is composed of a magneto-optical switch, a circulator, a dynamically gain stabilized unidirectional EDFA, and control circuits. The repeater directionality is rearranged as fast as 0.1ms by an electrical control pulse. It is experimentally confirmed that OTDR with the directionality switchable repeater is feasible for repeater chain. The detailed design and performance of the repeater are also discussed, including the multi-pass interference (MPI) which may arise in the proposed repeater, the effect of the MPI on SNR degradation of the repeater chain and the feed-forward EDFA gain control circuit.

  4. Measurement-based quantum repeaters

    CERN Document Server

    Zwerger, M; Briegel, H J

    2012-01-01

    We introduce measurement-based quantum repeaters, where small-scale measurement-based quantum processors are used to perform entanglement purification and entanglement swapping in a long-range quantum communication protocol. In the scheme, pre-prepared entangled states stored at intermediate repeater stations are coupled with incoming photons by simple Bell-measurements, without the need of performing additional quantum gates or measurements. We show how to construct the required resource states, and how to minimize their size. We analyze the performance of the scheme under noise and imperfections, with focus on small-scale implementations involving entangled states of few qubits. We find measurement-based purification protocols with significantly improved noise thresholds. Furthermore we show that already resource states of small size suffice to significantly increase the maximal communication distance. We also discuss possible advantages of our scheme for different set-ups.

  5. A Repeating Fast Radio Burst

    CERN Document Server

    Spitler, L G; Hessels, J W T; Bogdanov, S; Brazier, A; Camilo, F; Chatterjee, S; Cordes, J M; Crawford, F; Deneva, J; Ferdman, R D; Freire, P C C; Kaspi, V M; Lazarus, P; Lynch, R; Madsen, E C; McLaughlin, M A; Patel, C; Ransom, S M; Seymour, A; Stairs, I H; Stappers, B W; van Leeuwen, J; Zhu, W W

    2016-01-01

    Fast Radio Bursts are millisecond-duration astronomical radio pulses of unknown physical origin that appear to come from extragalactic distances. Previous follow-up observations have failed to find additional bursts at the same dispersion measures (i.e. integrated column density of free electrons between source and telescope) and sky position as the original detections. The apparent non-repeating nature of the fast radio bursts has led several authors to hypothesise that they originate in cataclysmic astrophysical events. Here we report the detection of ten additional bursts from the direction of FRB121102, using the 305-m Arecibo telescope. These new bursts have dispersion measures and sky positions consistent with the original burst. This unambiguously identifies FRB121102 as repeating and demonstrates that its source survives the energetic events that cause the bursts. Additionally, the bursts from FRB121102 show a wide range of spectral shapes that appear to be predominantly intrinsic to the source and wh...

  6. Influence of the adaptive iterative dose reduction 3D algorithm on the detectability of low-contrast lesions and radiation dose repeatability in abdominal computed tomography: a phantom study.

    Science.gov (United States)

    Yoon, Jeong Hee; Lee, Jeong Min; Hur, Bo Yun; Baek, Jeehyun; Shim, Hackjoon; Han, Joon Koo; Choi, Byung Ihn

    2015-08-01

    The purpose of the study is to evaluate the influence of the adaptive iterative dose reduction (AIDR 3D) algorithm on the detectability of low-contrast focal liver lesions (FLLs) and the radiation dose repeatability of automatic tube current modulation (ATCM) in abdominal CT scans using anthropomorphic phantoms. Three different sizes of anthropomorphic phantoms, each with 4 low-contrast FLLs, were scanned on a 320-channel CT scanner using the ATCM technique and AIDR 3D, at different radiation doses: full-dose, half-dose, and quarter-dose. Scans were repeated three times and reconstructed with filtered back projection (FBP) and AIDR 3D. Radiation dose repeatability was assessed using the intraclass correlation coefficient (ICC). Image noise, quality, and lesion conspicuity were assessed by four reviewers and the number of invisible FLLs was compared among different radiation doses and reconstruction methods. ICCs of radiation dose among the three CT scans were excellent in all phantoms (0.99). Image noise, quality, and lesion conspicuity in the half-dose group were comparable with full-dose FBP after applying AIDR 3D in all phantoms. In small phantoms, the half-dose group reconstructed with AIDR 3D showed similar sensitivity in visualizing low-contrast FLLs compared to full-dose FBP (P = 0.77-0.84). In medium and large phantoms, AIDR 3D reduced the number of missing low-contrast FLLs [3.1% (9/288), 11.5% (33/288), respectively], compared to FBP [10.4% (30/288), 21.9% (63/288), respectively] in the full-dose group. By applying AIDR 3D, half-dose CT scans may be achievable in small-sized patients without hampering diagnostic performance, while it may improve diagnostic performance in medium- and large-sized patients without increasing the radiation dose.

  7. Repeatability of Harris Corner Detector

    Institute of Scientific and Technical Information of China (English)

    HU Lili

    2003-01-01

    Interest point detectors are commonly employed to reduce the amount of data to be processed. The ideal interest point detector would robustly select those features which are most appropriate or salient for the application and data at hand. This paper shows that interest points are geometrically stable under different transformations.This property makes interest points very successful in the context of image matching. To measure this property quantatively, we introduce a evaluation criterion: repeatability rate.

  8. Repeat Testing Effects on Credentialing Exams: Are Repeaters Misinformed or Uninformed?

    Science.gov (United States)

    Feinberg, Richard A.; Raymond, Mark R.; Haist, Steven A.

    2015-01-01

    To mitigate security concerns and unfair score gains, credentialing programs routinely administer new test material to examinees retesting after an initial failing attempt. Counterintuitively, a small but growing body of recent research suggests that repeating the identical form does not create an unfair advantage. This study builds upon and…

  9. 重复荷载作用下钢筋混凝土锚固端黏结性能试验研究%Test study on bonding performance of reinforced concrete anchorage zone under repeated loads

    Institute of Scientific and Technical Information of China (English)

    蒋德稳; 邱洪兴

    2012-01-01

    通过对23个钢筋混凝土试件的静载和重复荷载作用下拔出试验,研究了重复荷载作用下钢筋峰值应变和残余应变、自由端和加载端滑移发展特征,得到了重复荷载作用下黏结应力-滑移滞回曲线变化规律。运用试验测定的钢筋应变,计算了静载和重复荷载作用下锚固端黏结应力分布曲线,总结了重复荷载作用下峰值黏结应力、残余黏结应力变化特征,分析了锚固端黏结应力分布机理。研究结果表明:重复荷载作用后黏结强度并不受重复次数影响;重复荷载作用下,自由端、加载端峰值滑移量和残余滑移量发展均符合疲劳破坏的三阶段特征;当滑移量累积到静载作用下破坏时的峰值滑移量时,发生黏结疲劳破坏;随着重复次数的增加,黏结应力沿锚固长度的分布出现明显的双峰现象,最大黏结应力位于距离加载端和自由端约1/4锚固长度位置处。研究结果可为深入研究混凝土结构疲劳性能提供依据。%23 reinforced concrete Rebar' s peak and residual stress, pull-out specimens were tested under monotonic loading and repeated loading peak slip and residual slip at the loading end and free end were inspected in this test. The bonding stress-slip hysteretic curve was obtained. According to the rebar stress data, the distribution curve in the anchorage was calculated under monotonic loading and repeated loading. Variation characteristics of peak and residual bonding stress under repeated loads were summarized, and bonding stress distribution mechanism was analyzed. Research result shows that bonding strength is not influenced much by repeated loading. The peak slip and residual slip follow the three stage rule of fatigue failure. Bonding fatigue failure occurs when the rebar slippage under repeated loading reaches the maximum slippage under monotonic loading. With the increase of repeating times, the obvious double peak phenomenon was shown in

  10. Monitoring ice shelf velocities from repeat MODIS and Landsat data – a method study on the Larsen C ice shelf, Antarctic Peninsula, and 10 other ice shelves around Antarctica

    Directory of Open Access Journals (Sweden)

    T. Haug

    2010-01-01

    Full Text Available We investigate the velocity field of the Larsen C ice shelf, Antarctic Peninsula, over the periods 2002–2006 and 2006–2009 based on repeat optical satellite data. The velocity field of the entire ice shelf is measured using repeat low resolution MODIS data (250 m spatial resolution. The measurements are validated for two ice shelf sections against repeat medium resolution Landsat 7 ETM+ pan data (15 m spatial resolution. Horizontal surface velocities are obtained through image matching in both frequency and spatial domain, and the two methods compared. The uncertainty in the displacement measurements turns out to be less than 70 m for the MODIS derived data, and less than 15 m for the Landsat derived ones. The difference between MODIS and Landsat based speeds is −15.4 m a−1 and 13.0 m a−1, respectively, for the first period for the two different validation sections on the ice shelf, and −26.7 m a−1 and 27.9 m a−1 for the second period for the same sections. This leads us to conclude that repeat MODIS images are well suited to measure ice shelf velocity fields and monitor their changes over time. The frequency domain image correlation method seems better suited for this purpose because it is faster, produces fewer mismatches, and is able to match images with regular noise and data voids. The latter makes it possible to match Landsat 7 ETM+ images even after the 2003 failure of the Scan Line Corrector (SLC off that leaves significant image sections with no data. Image matching based on the original 12-bit radiometric resolution MODIS data produced slightly better results than using the 8-bit version of the same images. Streamline interpolation from the obtained surface velocity field on Larsen C indicates ice travel times of up to 450 to 550 a between the inland boundary and the ice shelf edge. In a second step of the study we test our method successfully on 10 other ice shelves around

  11. Monitoring ice shelf velocities from repeat MODIS and Landsat data – a method study on the Larsen C ice shelf, Antarctic Peninsula, and 10 other ice shelves around Antarctica

    Directory of Open Access Journals (Sweden)

    P. Skvarca

    2010-05-01

    Full Text Available We investigate the velocity field of the Larsen C ice shelf, Antarctic Peninsula, over the periods 2002–2006 and 2006–2009 based on repeat optical satellite data. The velocity field of the entire ice shelf is measured using repeat low resolution MODIS data (250 m spatial resolution. The measurements are validated for two ice shelf sections against repeat medium resolution Landsat 7 ETM + pan data (15 m spatial resolution. Horizontal surface velocities are obtained through image matching using both orientation correlation operated in the frequency domain and normalized crosscorrelation operated in the spatial domain, and the two methods compared. The uncertainty in the displacement measurements turns out to be about one fourth of the pixel size for the MODIS derived data, and about one pixel for the Landsat derived data. The difference between MODIS and Landsat based speeds is −15.4 m a−1 and 13.0 m a−1, respectively, for the first period for the two different validation sections on the ice shelf, and −26.7 m a−1 and 27.9 m a−1 for the second period for the same sections. This leads us to conclude that repeat MODIS images are well suited to measure ice shelf velocity fields and monitor their changes over time. Orientation correlation seems better suited for this purpose because it produces fewer mismatches, is able to match images with regular noise and data voids, and is faster. Since it can match images with regular data voids it is possible to match Landsat 7 ETM+ images even after the 2003 failure of the Scan Line Corrector (SLC off that leaves significant image stripes with no data. Image matching based on the original 12-bit radiometric resolution MODIS data produced slightly better results than using the 8-bit version of the same images. Streamline interpolation from the obtained surface velocity field on Larsen~C indicates ice travel times of up to 450 to 550 years between the inland boundary and the ice shelf edge. In a

  12. PILER-CR: Fast and accurate identification of CRISPR repeats

    Directory of Open Access Journals (Sweden)

    Edgar Robert C

    2007-01-01

    Full Text Available Abstract Background Sequencing of prokaryotic genomes has recently revealed the presence of CRISPR elements: short, highly conserved repeats separated by unique sequences of similar length. The distinctive sequence signature of CRISPR repeats can be found using general-purpose repeat- or pattern-finding software tools. However, the output of such tools is not always ideal for studying these repeats, and significant effort is sometimes needed to build additional tools and perform manual analysis of the output. Results We present PILER-CR, a program specifically designed for the identification and analysis of CRISPR repeats. The program executes rapidly, completing a 5 Mb genome in around 5 seconds on a current desktop computer. We validate the algorithm by manual curation and by comparison with published surveys of these repeats, finding that PILER-CR has both high sensitivity and high specificity. We also present a catalogue of putative CRISPR repeats identified in a comprehensive analysis of 346 prokaryotic genomes. Conclusion PILER-CR is a useful tool for rapid identification and classification of CRISPR repeats. The software is donated to the public domain. Source code and a Linux binary are freely available at http://www.drive5.com/pilercr.

  13. Analysis of CR1 Repeats in the Zebra Finch Genome

    Directory of Open Access Journals (Sweden)

    George E. Liu

    2013-06-01

    Full Text Available Most bird species have smaller genomes and fewer repeats than mammals. Chicken Repeat 1 (CR1 repeat is one of the most abundant families of repeats, ranging from ~133,000 to ~187,000 copies accounting for ~50 to ~80% of the interspersed repeats in the zebra finch and chicken genomes, respectively. CR1 repeats are believed to have arisen from the retrotransposition of a small number of master elements, which gave rise to multiple CR1 subfamilies in the chicken. In this study, we performed a global assessment of the divergence distributions, phylogenies, and consensus sequences of CR1 repeats in the zebra finch genome. We identified and validated 34 CR1 subfamilies and further analyzed the correlation between these subfamilies. We also discovered 4 novel lineage-specific CR1 subfamilies in the zebra finch when compared to the chicken genome. We built various evolutionary trees of these subfamilies and concluded that CR1 repeats may play an important role in reshaping the structure of bird genomes.

  14. Statistical tools for analysing the data obtained from repeated dose toxicity studies with rodents: a comparison of the statistical tools used in Japan with that of used in other countries.

    Science.gov (United States)

    Kobayashi, Katsumi; Pillai, K Sadasivan; Guhatakurta, Soma; Cherian, K M; Ohnishi, Mariko

    2011-01-01

    In the present study, an attempt was made to compare the statistical tools used for analysing the data of repeated dose toxicity studies with rodents conducted in 45 countries, with that of Japan. The study revealed that there was no congruence among the countries in the use of statistical tools for analysing the data obtained from the above studies. For example, to analyse the data obtained from repeated dose toxicity studies with rodents, Scheffé's multiple range and Dunnett type (joint type Dunnett) tests are commonly used in Japan, but in other countries use of these statistical tools is not so common. However, statistical techniques used for testing the above data for homogeneity of variance and inter-group comparisons do not differ much between Japan and other countries. In Japan, the data are generally not tested for normality and the same is true with the most of the countries investigated. In the present investigation, out of 127 studies examined, data of only 6 studies were analysed for both homogeneity of variance and normal distribution. For examining homogeneity of variance, we propose Levene's test, since the commonly used Bartlett's test may show heterogeneity in variance in all the groups, if a slight heterogeneity in variance is seen any one of the groups. We suggest the data may be examined for both homogeneity of variance and normal distribution. For the data of the groups that do not show heterogeneity of variance, to find the significant difference among the groups, we recommend Dunnett's test, and for those show heterogeneity of variance, we recommend Steel's test.

  15. Repeated-sprint ability and aerobic fitness.

    Science.gov (United States)

    Thébault, Nicolas; Léger, Luc A; Passelergue, Philippe

    2011-10-01

    The purpose of this study was to reinvestigate the relationship between aerobic fitness and fatigue indices of repeated-sprint ability (RSA), with special attention to methodological normalization. Soldiers were divided into low (n = 10) and high (n = 9) fitness groups according to a preset maximal aerobic speed (MAS) of 17 km·h(-1) (∼60 ml O2·kg(-1)·min) measured with the University of Montreal Track Test (UMTT). Subjects' assessment included the RSA test (3 sets of 5 40-m sprints with 1-minute rest between sprints and 1.5 minutes between sets), a 40-m sprint (criterion test used in the computation of fatigue indices for the RSA test), strength and power measurement of the lower limbs, and the 20-m shuttle run test (20-m SRT) and the UMTT, which are measures of maximal aerobic power. The highest correlation with the RSA fatigue indices was obtained with the 20-m SRT (r = 0.90, p = 0.0001, n = 19), a test with 180° direction changes and accelerations and decelerations. The lower correlation (r = 0.66, p repeated sprints and achieved better recovery between series. A MAS of at least 17 km·h(-1) favors constant and high speed level during repeated sprints. From a practical point of view, a high aerobic fitness is a precious asset in counteracting fatigue in sports with numerous sprint repetitions.

  16. Histone deacetylase complexes promote trinucleotide repeat expansions.

    Directory of Open Access Journals (Sweden)

    Kim Debacker

    2012-02-01

    Full Text Available Expansions of DNA trinucleotide repeats cause at least 17 inherited neurodegenerative diseases, such as Huntington's disease. Expansions can occur at frequencies approaching 100% in affected families and in transgenic mice, suggesting that specific cellular proteins actively promote (favor expansions. The inference is that expansions arise due to the presence of these promoting proteins, not their absence, and that interfering with these proteins can suppress expansions. The goal of this study was to identify novel factors that promote expansions. We discovered that specific histone deacetylase complexes (HDACs promote CTG•CAG repeat expansions in budding yeast and human cells. Mutation or inhibition of yeast Rpd3L or Hda1 suppressed up to 90% of expansions. In cultured human astrocytes, expansions were suppressed by 75% upon inhibition or knockdown of HDAC3, whereas siRNA against the histone acetyltransferases CBP/p300 stimulated expansions. Genetic and molecular analysis both indicated that HDACs act at a distance from the triplet repeat to promote expansions. Expansion assays with nuclease mutants indicated that Sae2 is one of the relevant factors regulated by Rpd3L and Hda1. The causal relationship between HDACs and expansions indicates that HDACs can promote mutagenesis at some DNA sequences. This relationship further implies that HDAC3 inhibitors being tested for relief of expansion-associated gene silencing may also suppress somatic expansions that contribute to disease progression.

  17. Landauer's Principle in Repeated Interaction Systems

    Science.gov (United States)

    Hanson, Eric P.; Joye, Alain; Pautrat, Yan; Raquépas, Renaud

    2017-01-01

    We study Landauer's Principle for Repeated Interaction Systems (RIS) consisting of a reference quantum system S in contact with a structured environment E made of a chain of independent quantum probes; S interacts with each probe, for a fixed duration, in sequence. We first adapt Landauer's lower bound, which relates the energy variation of the environment E to a decrease of entropy of the system S during the evolution, to the peculiar discrete time dynamics of RIS. Then we consider RIS with a structured environment E displaying small variations of order {T^{-1}} between the successive probes encountered by S, after {n ˜eq T} interactions, in keeping with adiabatic scaling. We establish a discrete time non-unitary adiabatic theorem to approximate the reduced dynamics of S in this regime, in order to tackle the adiabatic limit of Landauer's bound. We find that saturation of Landauer's bound is related to a detailed balance condition on the repeated interaction system, reflecting the non-equilibrium nature of the repeated interaction system dynamics. This is to be contrasted with the generic saturation of Landauer's bound known to hold for continuous time evolution of an open quantum system interacting with a single thermal reservoir in the adiabatic regime.

  18. Androgen insensitivity syndrome: do trinucleotide repeats in androgen receptor gene have any role?

    Institute of Scientific and Technical Information of China (English)

    Singh Rajender; Nalini J. Gupta; Baidyanath Chakravarty; Lalji Singh; Kumarasamy Thangaraj

    2008-01-01

    Aim: To investigate the role of CAG and GGN repeats as genetic background affecting androgen insensitivity syn- drome (AIS) phenotype. Methods: We analyzed lengths of androgen receptor (AR)-CAG and GGN repeats in 69 AIS cases, along with 136 unrelated normal male individuals. The lengths of repeats were analyzed using polymerase chain reaction (PCR) amplification followed by allelic genotyping to determine allele length. Results: Our study revealed significantly shorter mean lengths of CAG repeats in patients (mean 18.25 repeats, range 14-26 repeats) in comparison to the controls (mean 22.57 repeats, range 12-39 repeats) (two-tailed P < 0.0001). GGN repeats, however, did not differ significantly between patients (mean 21.48 repeats) and controls (mean 21.21 repeats) (two- tailed P = 0.474). Among patients' groups, the mean number of CAG repeats in partial androgen insensitivity cases (mean 15.83 repeats) was significantly less than in complete androgen insensitivity cases (mean 19.46 repeats) (two- tailed P < 0.0001). Conclusion: The findings suggest that shorter lengths of repeats in the AR gene might act as low penetrance genetic background in varying manifestation of androgen insensitivity. (Asian J Androl 2008 Jul; 10: 616-624)

  19. Improving repeatability by improving quality

    Energy Technology Data Exchange (ETDEWEB)

    Ronen, Shuki; Ackers, Mark; Schlumberger, Geco-Prakla; Brink, Mundy

    1998-12-31

    Time lapse (4-D) seismic is a promising tool for reservoir characterization and monitoring. The method is apparently simple: to acquire data repeatedly over the same reservoir, process and interpret the data sets, then changes between the data sets indicate changes in the reservoir. A problem with time lapse seismic data is that reservoirs are a relatively small part of the earth and important reservoir changes may cause very small differences to the time lapse data. The challenge is to acquire and process economical time lapse data such that reservoir changes can be detected above the noise of varying acquisition and environment. 7 refs., 9 figs.

  20. Coordinated hybrid automatic repeat request

    KAUST Repository

    Makki, Behrooz

    2014-11-01

    We develop a coordinated hybrid automatic repeat request (HARQ) approach. With the proposed scheme, if a user message is correctly decoded in the first HARQ rounds, its spectrum is allocated to other users, to improve the network outage probability and the users\\' fairness. The results, which are obtained for single- and multiple-antenna setups, demonstrate the efficiency of the proposed approach in different conditions. For instance, with a maximum of M retransmissions and single transmit/receive antennas, the diversity gain of a user increases from M to (J+1)(M-1)+1 where J is the number of users helping that user.

  1. Highly Informative Simple Sequence Repeat (SSR) Markers for Fingerprinting Hazelnut

    Science.gov (United States)

    Simple sequence repeat (SSR) or microsatellite markers have many applications in breeding and genetic studies of plants, including fingerprinting of cultivars and investigations of genetic diversity, and therefore provide information for better management of germplasm collections. They are repeatab...

  2. simple sequence repeat (SSR) markers in genetic analysis of

    African Journals Online (AJOL)

    Yomi

    2012-08-28

    Aug 28, 2012 ... In the present study, 78 mapped simple sequence repeat (SSR) markers representing 11 ... mean (UPGMA) with each cluster representing a particular Vigna species. ..... were reported to be more frequent than the compound.

  3. Outcomes for Youth with Severe Emotional Disturbance: A Repeated Measures Longitudinal Study of a Wraparound Approach of Service Delivery in Systems of Care

    Science.gov (United States)

    Painter, Kirstin

    2012-01-01

    Background: Systems of care is a family centered, strengths-based service delivery model for treating youth experiencing a serious emotional disturbance. Wraparound is the most common method of service delivery adopted by states and communities as a way to adhere to systems of care philosophy. Objective: The purpose of this study was to evaluate…

  4. A 12-month randomized crossover study on the effects of Lanreotide Autogel and Octreotide long-acting repeatable on GH and IGF-l in patients with acromegaly

    DEFF Research Database (Denmark)

    Andries, Magdalene; Glintborg, Dorte; Kvistborg, Annette

    2007-01-01

    of acromegaly in a randomized study design. Material and methods Twelve acromegalic patients were included and 10 patients completed treatment with LAN or OCT for 6 months and were then switched to the opposite treatment modality for 6 months without a washout period in a randomized crossover design. GH and IGF...

  5. A 28-day repeat dose toxicity study of steroidal glycoalkaloids a-solanine and a-chaconine in the Syrian Golden Hamster

    NARCIS (Netherlands)

    Langkilde, S.; Mandimika, T.; Schroder, M.; Meyer, O.; Slob, W.; Peijnenburg, A.A.C.M.; Poulsen, M.

    2009-01-01

    Glycoalkaloids ¿-solanine and ¿-chaconine are naturally present toxicants in the potato plant (Solanum tuberosum). Human intake of high doses of glycoalkaloids has led to acute intoxication, in severe cases coma and death. Previous studies have indicated that the ratio of ¿-solanine to ¿-chaconine m

  6. A multicenter, open-label study of repeat courses of intramuscular alefacept in combination with other psoriasis therapies in patients with chronic plaque psoriasis.

    NARCIS (Netherlands)

    Krueger, G.G.; Gottlieb, A.B.; Sterry, W.; Korman, N.; Kerkhof, P Van De

    2008-01-01

    OBJECTIVE: To evaluate the safety and efficacy of multiple courses of alefacept in combination with traditional psoriasis therapy for the treatment of chronic plaque psoriasis (CPP). METHODS: Patients with CPP requiring systemic therapy were eligible for this study. Patients received up to three cou

  7. A phase 1 study evaluating the pharmacokinetics, safety and tolerability of repeat dosing with a human IL-13 antibody (CAT-354 in subjects with asthma

    Directory of Open Access Journals (Sweden)

    Roskos Lorin

    2010-01-01

    Full Text Available Abstract Background IL-13 has been implicated in the development of airway inflammation and hyperresponsiveness. This study investigated the multiple-dose pharmacokinetics and safety profile of human anti-IL-13 antibody (CAT-354 in adults with asthma. Methods This was a multiple-dose, randomised, double-blind, placebo-controlled phase 1 study in asthmatics (forced expiratory volume in 1 second [FEV1] ≥ 80% predicted. Subjects were randomised to receive three intravenous infusions of CAT-354 (1 mg/kg, 5 mg/kg or 10 mg/kg or placebo at 28-day intervals. Blood samples were taken for pharmacokinetic measurements. Safety was assessed by adverse events, vital signs, ECGs, laboratory and pulmonary function parameters. Results Twenty-three subjects (aged 21-60 years, FEV1 88-95% predicted received ≥ 1 dose of study medication. The half-life of CAT-354 was 12-17 days and was dose-independent. The maximum serum concentration and area under the curve were dose-dependent. Clearance (2.2-2.6 mL/day/kg and volume of distribution (44-57 mL/kg were both low and dose-independent. The observed maximum serum concentration after each dose increased slightly from dose 1 through dose 3 at all dose levels, consistent with an accumulation ratio of 1.4 to 1.7 for area under the curve. Most adverse events were deemed mild to moderate and unrelated to study medication. One SAE was reported and deemed unrelated to study drug. There were no effects of clinical concern for vital signs, ECG, laboratory or pulmonary parameters. Conclusions CAT-354 exhibited linear pharmacokinetics and an acceptable safety profile. These findings suggest that at the doses tested, CAT-354 can be safely administered in multiple doses to patients with asthma. Trial registration NCT00974675.

  8. Why Have the “Cantankerous Old People” Left the Neighborhood? The Representation of Old Age in Serbian Television Commercials – A Repeated Study

    Directory of Open Access Journals (Sweden)

    Ljubica Milosavljević

    2016-02-01

    Full Text Available The paper represents an attempt to examine to what extent the way in which older members of society are represented in Serbian television commercials has changed in comparison to representations which were present in commercials during the three months in 2009 (Milosavljevic 2010a when the first study was conducted. As was the case in the first study, the focus is on dominant societal attitudes toward old people and old age which were utilized in making the television commercials in question. This was accomplished through analyzing both the positive and the negative stereotypes used to convey meaning in the commercials which were analyzed, as well as through the analysis of the proportional representation of older characters in advertising. The commercials which were analyzed here were broadcasted during the second half of December 2012, January and the first half of February 2013.

  9. Area deprivation and the food environment over time: A repeated cross-sectional study on takeaway outlet density and supermarket presence in Norfolk, UK, 1990–2008

    Science.gov (United States)

    Maguire, Eva R.; Burgoine, Thomas; Monsivais, Pablo

    2015-01-01

    Socioeconomic disparities in the food environment are known to exist but with little understanding of change over time. This study investigated the density of takeaway food outlets and presence of supermarkets in Norfolk, UK between 1990 and 2008. Data on food retail outlet locations were collected from telephone directories and aggregated within electoral wards. Supermarket presence was not associated with area deprivation over time. Takeaway food outlet density increased overall, and was significantly higher in more deprived areas at all time points; furthermore, socioeconomic disparities in takeaway food outlet density increased across the study period. These findings add to existing evidence and help assess the need for environmental interventions to reduce disparities in the prevalence of unhealthy food outlets. PMID:25841285

  10. Area deprivation and the food environment over time: A repeated cross-sectional study on takeaway outlet density and supermarket presence in Norfolk, UK, 1990-2008.

    Science.gov (United States)

    Maguire, Eva R; Burgoine, Thomas; Monsivais, Pablo

    2015-05-01

    Socioeconomic disparities in the food environment are known to exist but with little understanding of change over time. This study investigated the density of takeaway food outlets and presence of supermarkets in Norfolk, UK between 1990 and 2008. Data on food retail outlet locations were collected from telephone directories and aggregated within electoral wards. Supermarket presence was not associated with area deprivation over time. Takeaway food outlet density increased overall, and was significantly higher in more deprived areas at all time points; furthermore, socioeconomic disparities in takeaway food outlet density increased across the study period. These findings add to existing evidence and help assess the need for environmental interventions to reduce disparities in the prevalence of unhealthy food outlets.

  11. Clustured regularly interspersed short palindromic repeats (CRISPR) genetic diversity studies as a mean to reconstruct the evolution of the Mycobacterium tuberculosis complex.

    Science.gov (United States)

    Sola, Christophe

    2015-06-01

    The natural history of tuberculosis may be tackled by various means, among which the record of molecular scars that have been registered by the Mycobacterium tuberculosis complex (MTBC) genomes transmitted from patient to patient for tens of thousands years and possibly more. Recently discovered polymorphic loci, the CRISPR sequences, are indirect witnesses of the historical phage-bacteria struggle, and may be related to the time when the ancestor of today's tubercle bacilli were environmental bacteria, i.e. before becoming intracellular parasites. In this article, we present what are CRISPRs and try to summarize almost 20 years of research results obtained using the genetic diversity of the CRISPR loci in MTBC as a perspective for studying new models. We show that the study of the diversity of CRISPR sequences, thanks to «spoligotyping», has played a great role in our global understanding of the population structure of MTBC. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. A 28-day repeat dose toxicity study of steroidal glycoalkaloids, alpha-solanine and alpha-chaconine in the Syrian Golden hamster

    DEFF Research Database (Denmark)

    Langkilde, Søren; Mandimika, T.; Schrøder, Malene

    2009-01-01

    Glycoalkaloids alpha-solanine and alpha-chaconine are naturally present toxicants in the potato plant (Solanum tuberosum). Human intake of high doses of glycoalkaloids has led to acute intoxication, in severe cases coma and death. Previous studies have indicated that the ratio of alpha-solanine...... to alpha-chaconine may determine the degree and nature of the glycoalkaloid toxicity in potatoes, as the toxicity of the two alkaloids act synergistically. The aim of the present study was to investigate whether an altered ratio of alpha-solanine and alpha-chaconine would reduce the toxicity...... of the glycoalkaloids. The Syrian Golden hamster was given daily doses of alpha-solanine and alpha-chaconine by gavage for 28 days. Doses of up to 33.3 mg total glycoalkaloids/kg body weight were applied in ratios of 1:3.7 and 1:70 (alpha-solanine:alpha-chaconine). Administration of the highest doses of both ratios...

  13. Biosynthesis of highly enriched 13C-lycopene for human metabolic studies using repeated batch tomato cell culturing with 13C-glucose

    OpenAIRE

    Moran, Nancy E.; Rogers, Randy B.; Lu, Chi-Hua; Conlon, Lauren E.; Lila, Mary Ann; Clinton, Steven K.; Erdman, John W

    2013-01-01

    While putative disease-preventing lycopene metabolites are found in both tomato (Solanum lycopersicum) products and in their consumers, mammalian lycopene metabolism is poorly understood. Advances in tomato cell culturing techniques offer an economical tool for generation of highly-enriched 13C-lycopene for human bioavailability and metabolism studies. To enhance the 13C-enrichment and yields of labeled lycopene from the hp-1 tomato cell line, cultures were first grown in 13C-glucose media fo...

  14. Prospective Register Of patients undergoing repeated OFfice and Ambulatory Blood Pressure Monitoring (PROOF-ABPM): protocol for an observational cohort study.

    Science.gov (United States)

    Sheppard, James P; Martin, Una; Gill, Paramjit; Stevens, Richard; McManus, Richard J

    2016-10-31

    The diagnosis and management of hypertension depends on accurate measurement of blood pressure (BP) in order to target antihypertensive treatment appropriately. Most BP measurements take place in a clinic setting, but it has long been recognised that readings taken out-of-office (via home or ambulatory monitoring) estimate true underlying BP more accurately. Recent studies have shown that the change in clinic BP over multiple readings is a significant predictor of the difference between clinic and out-of-office BP. Used in combination with patient characteristics, this change has been shown to accurately predict a patient's out-of-office BP level. The present study proposes to collect real-life BP data to prospectively validate this new prediction tool in routine clinical practice. A prospective, multicentre observational cohort design will be used, recruiting patients from primary and secondary care. All patients attending participating centres for ambulatory BP monitoring will be eligible to participate. Anonymised clinical data will be collected from all eligible patients, who will be invited to give informed consent to permit identifiable data to be collected for data linkage to external outcome registries. Descriptive statistics will be used to calculate the sensitivity, specificity, positive and negative predictive values of the out-of-office BP prediction tool. Area under the receiver operator characteristic curve statistics will be used to examine model performance. Ethical approval for this study has been obtained from the National Research. Ethics Service Committee South Central-Oxford A (reference; 15/SC/0184), and site-specific R&D approval has been acquired from the relevant NHS trusts. All findings will be presented at relevant conferences and published in peer-reviewed journals, on the study website and disseminated in lay and social media where appropriate. Published by the BMJ Publishing Group Limited. For permission to use (where not already

  15. Repeatability and Minimal Detectable Change in Longitudinal Median Nerve Excursion Measures During Upper Limb Neurodynamic Techniques in a Mixed Population: A Pilot Study Using Musculoskeletal Ultrasound Imaging.

    Science.gov (United States)

    Paquette, Philippe; Lamontagne, Martin; Higgins, Johanne; Gagnon, Dany H

    2015-07-01

    This study determined test-retest reliability and minimum detectable change in longitudinal median nerve excursion during upper limb neurodynamic tests (ULNTs). Seven participants with unilateral or bilateral carpal tunnel syndrome and 11 healthy participants were randomly tested with two ULNTs (i.e., tensioner and slider). Each ULNT was performed three times each at 45° and 90° of shoulder abduction on two separate visits. Video sequences of median nerve excursion, recorded by a physical therapist using ultrasound imaging, were quantified using computer software. The generalizability theory, encompassing a G-Study and a D-study, measured the dependability coefficient (Φ) along with standard error of measurement (SEM) accuracy and allowed various testing protocols to be proposed. The highest reliability (Φ = 0.84) and lowest minimal measurement error (SEM = 0.58 mm) of the longitudinal median nerve excursion were reached during the ULNT-slider performed with 45° of shoulder abduction and when measures obtained from three different image sequences recorded during a single visit were averaged. It is recommended that longitudinal median nerve excursion measures computed from three separate image sequences recorded during a single visit be averaged in clinical practice. Ideally, adding a second visit (six image sequences) is also suggested in research protocols.

  16. DSR-Based Selective Repeat ARQ Protocol in MANET

    Institute of Scientific and Technical Information of China (English)

    张全新; 宋瀚涛

    2003-01-01

    The efficient route algorithms involved in mobile ad hoc network(MANET) are studied. An arrangement of a combination of the traditional dynamic source routing(DSR) protocol is put forward and the selective repeat ARQ protocol is put forward by analyzing and studying them in detail and providing the scheme. In networks, especially in wireless networks, the nodes are capable to process data much faster than transmission, the DSR-based selective repeat ARQ protocol has real meanings in MANET.

  17. Long-term aerobic exercise and omega-3 supplementation modulate osteoporosis through inflammatory mechanisms in post-menopausal women: a randomized, repeated measures study

    Directory of Open Access Journals (Sweden)

    Kanaley Jill

    2011-10-01

    Full Text Available Abstract Background Evidence indicates that dietary fats and physical activity influence bone health. The purpose of this study was to examine the effects of long-term aerobic exercise and omega-3 (N-3 supplementation on serum inflammatory markers, bone mineral density (BMD, and bone biomarkers in post-menopausal women. Methods Seventy-nine healthy sedentary post-menopausal women aged 58-78 years participated in this study. Subjects were randomized to one of 4 groups: exercise + supplement (E+S, n = 21, exercise (E, n = 20, supplement (S, n = 20, and control (Con, n = 18 groups. The subjects in the E+S and E groups performed aerobic exercise training (walking and jogging up to 65% of HRmax, three times a week for 24 weeks. Subjects in the E+S and S groups consumed 1000 mg/d N-3 for 24 weeks. The lumbar spine (L2-L4 and femoral neck BMD, serum tumor necrosis factor (TNF α, interleukin (IL 6, prostaglandin (PG E2, estrogen, osteocalcin, 1, 25-dihydroxyvitamin D3 (1, 25 Vit D, C-telopeptide (CTX, parathyroid hormone (PTH and calcitonin (CT were measured at baseline, the end of week 12 and 24. Results Serum estrogen, osteocalcin, 1, 25 Vit D, CT, L2-L4 and femoral neck BMD measures increased (P 2 decreased (P 2-L4 and femoral neck BMD, estrogen, osteocalcin, and CT were negatively (P 2. PTH and CT were correlated positively and negatively with IL-6, respectively (P Conclusions The present study demonstrates that long-term aerobic exercise training plus N-3 supplementation have a synergistic effect in attenuating inflammation and augmenting BMD in post-menopausal osteoporosis.

  18. Effect of restrictions on television food advertising to children on exposure to advertisements for 'less healthy' foods: repeat cross-sectional study.

    Directory of Open Access Journals (Sweden)

    Jean Adams

    Full Text Available BACKGROUND: In 2007, new scheduling restrictions on television food advertising to children in the UK were announced. The aim of the restrictions was to "reduce significantly the exposure of children under 16 to high fat, salt or sugar (HFSS advertising". We explored the impact of the restrictions on relative exposure to HFSS food advertising among all viewers and among child television viewers, as well as adherence to the restrictions. METHODS: We conducted two cross-sectional studies of all advertisements broadcast in one region of the UK over one week periods--the first (week 1 six months before the restrictions were introduced, and the second (week 2 six months after. Data on what products were advertised were linked to data on how many people watched each advertisement. Nutritional content of foods advertised was added to the dataset and used to calculate HFSS status. Relative exposure was calculated as the proportion of all advertising person-minute-views (PMVs that were for HFSS foods. RESULTS: 1,672,417 advertising PMV were included. 14.6% of advertising PMV were for food and 51.1% of these were for HFSS food. Relative exposure of all viewers to HFSS food advertising increased between study weeks 1 and 2 (odds ratio (99% confidence intervals = 1·54 (1·51 to 1·57. Exposure of children to HFSS food advertising did not change between study weeks 1 and 2 (odds ratio (99% confidence intervals = 1·05 (0·99 to 1·12. There was almost universal adherence to the restrictions. CONCLUSIONS: Despite good adherence to the restrictions, they did not change relative exposure of children to HFSS advertising and were associated with an increase in relative exposure of all viewers to HFSS advertising. Stronger restrictions targeting a wider range of advertisements are necessary to reduce exposure of children to marketing of less healthful foods.

  19. Effect of restrictions on television food advertising to children on exposure to advertisements for 'less healthy' foods: repeat cross-sectional study.

    Science.gov (United States)

    Adams, Jean; Tyrrell, Rachel; Adamson, Ashley J; White, Martin

    2012-01-01

    In 2007, new scheduling restrictions on television food advertising to children in the UK were announced. The aim of the restrictions was to "reduce significantly the exposure of children under 16 to high fat, salt or sugar (HFSS) advertising". We explored the impact of the restrictions on relative exposure to HFSS food advertising among all viewers and among child television viewers, as well as adherence to the restrictions. We conducted two cross-sectional studies of all advertisements broadcast in one region of the UK over one week periods--the first (week 1) six months before the restrictions were introduced, and the second (week 2) six months after. Data on what products were advertised were linked to data on how many people watched each advertisement. Nutritional content of foods advertised was added to the dataset and used to calculate HFSS status. Relative exposure was calculated as the proportion of all advertising person-minute-views (PMVs) that were for HFSS foods. 1,672,417 advertising PMV were included. 14.6% of advertising PMV were for food and 51.1% of these were for HFSS food. Relative exposure of all viewers to HFSS food advertising increased between study weeks 1 and 2 (odds ratio (99% confidence intervals) = 1·54 (1·51 to 1·57)). Exposure of children to HFSS food advertising did not change between study weeks 1 and 2 (odds ratio (99% confidence intervals) = 1·05 (0·99 to 1·12)). There was almost universal adherence to the restrictions. Despite good adherence to the restrictions, they did not change relative exposure of children to HFSS advertising and were associated with an increase in relative exposure of all viewers to HFSS advertising. Stronger restrictions targeting a wider range of advertisements are necessary to reduce exposure of children to marketing of less healthful foods.

  20. Relative contributions of interface pressure, shear stress, and temperature on ischemic-induced, skin-reactive hyperemia in healthy volunteers: a repeated measures laboratory study.

    Science.gov (United States)

    Lachenbruch, Charlie; Tzen, Yi-Ting; Brienza, David; Karg, Patricia E; Lachenbruch, Peter A

    2015-02-01

    Although the primary risk factors for pressure ulcer development - pressure, shear, skin temperature, moisture, and friction - have been identified for decades, the relative contribution of each to this risk remains unclear. To confirm the results of and expand upon earlier research into the relative contributions of interface pressures, shear stress, and skin temperature among 4 healthy volunteers, a study involving 6 additional healthy 40- to 75-year-old volunteers was conducted and results of the 2 studies were pooled. All 3 variables (interface pressures, shear stress, and skin temperature) were systematically and randomly varied. In the prone position, volunteers each underwent 18 test conditions representing different combinations of temperature (28˚ C, 32˚ C, 36˚ C), pressure (8.0 and 13.3 kPa), and shear (0, 6.7, and 14.0 kPa) using a computer-controlled indenter applied to the sacrum for 20 minutes exerting weights of 100 g and 200 g to induce 0.98 N and 1.96 N of shear force, respectively. Each condition was tested twice, resulting in a total of 360 trials. Magnitude of postload reactive hyperemia as an index of ischemia was measured by laser Doppler flowmetry. Fixed effects regression models were used to predict 3 different indices of reactive hyperemic magnitude. Friedman tests were performed to compare the reactive hyperemia among 3 different skin temperatures or shear stresses under the same amount of localized pressure. In all regression models, pressure and temperature were highly significant predictors of the extent of reactive hyperemia (P pressure and shear stress, and the difference was more profound between 32˚ C and 36˚ C than between 28˚ C and 32˚ C. These results confirm that, in laboratory settings, temperature is an important factor in tissue ischemia. Additional studies examining the relative importance of pressure, shear, and temperature and potential effects of lowering temperature on tissue ischemia in healthy volunteers and

  1. Perfusion CT measurements in healthy cervical spinal cord: feasibility and repeatability of the study as well as interchangeability of the perfusion estimates using two commercially available software packages

    Energy Technology Data Exchange (ETDEWEB)

    Bisdas, Sotirios [Johann Wolfgang University Hospital, Department of Radiology, Frankfurt (Germany); Medical University of South Carolina, Department of Radiology, Charleston, SC (United States); Johann Wolfgang Goethe University Hospital, Department of Diagnostic and Interventional Radiology, Frankfurt (Germany); Rumboldt, Zoran; Deveikis, John; Spampinato, Maria Vittoria [Medical University of South Carolina, Department of Radiology, Charleston, SC (United States); Surlan, Katarina [Clinical Centre Ljubljana, Department of Clinical Radiology, Ljubljana (Slovenia); Koh, Tong San [Nanyang Technological University, School of Electrical and Electronic Engineering, Singapore (Singapore)

    2008-10-15

    Our purpose was to examine the feasibility and reproducibility of perfusion CT studies in the cervical spinal cord and the interchangeability of the values obtained by two post-processing methods. The perfusion CT studies of 40 patients with neck tumours were post-processed using two software packages (Software-1: deconvolution-based analysis with adiabatic tissue homogeneity approach and Software-2: maximum-slope-model with Patlak analysis). Eight patients were examined twice for assessing the reproducibility of the technique. Two neuroradiologists separately post-processed the images with two arterial input functions (AIFs): (1) the internal carotid artery (ICA) and (2) the vertebral artery (VA). Maps of blood flow (F) in ml/min/100 g, blood volume (V) in ml/100 g, mean transit time (MTT) in seconds (s) and permeability (PS) in ml/min/100 g were generated. The mean F, V, MTT and PS (Software-1) with VA-AIF and ICA-AIF were 8.93, 1.12, 16.3, 1.88 and 8.57, 1.19, 16.85 and 1.94, respectively. The reproducibility of the techniques was satisfactory, while the V and MTT values (in Software-1) and the F and V values (in Software-2) were dependent on the site of the AIF (p{>=}0.03 and p=0.02, respectively). The interobserver agreement was very good. The significant differences in measurements for a single patient (%) using Software-1/Software-2 were {+-}120%/110%, 90%/80%, 180% and 250%/130% for F, V, MTT and PS, respectively. Only F and PS values in the healthy tissue seemed to be interchangeable. Our results were in essential agreement with those derived by invasive measurements in animals. The cervical spine perfusion CT studies are feasible and reproducible. The present knowledge has to be validated with studies in spinal cord tumours in order to decide the usefulness of the perfusion CT in this field. (orig.)

  2. CDC Vital Signs: Preventing Repeat Teen Births

    Science.gov (United States)

    ... file Error processing SSI file Preventing Repeat Teen Births Recommend on Facebook Tweet Share Compartir On this ... Too many teens, ages 15–19, have repeat births. Nearly 1 in 5 births to teens, ages ...

  3. Single- and repeated-dose oral toxicity studies of citicoline free-base (choline cytidine 5'-pyrophosphate) in Sprague-Dawley rats.

    Science.gov (United States)

    Schauss, A G; Somfai-Relle, S; Financsek, I; Glavits, R; Parent, S C; Endres, J R; Varga, T; Szücs, Z; Clewell, A

    2009-01-01

    The dietary supplement Citicoline free-base (choline cytidine 5'-pyrophosphate) was toxicologically evaluated in Sprague-Dawley rats using oral gavage. In an acute 14-day study, 2000 mg/kg was well tolerated. In a 90-day study, 100, 350, and 1000 mg/kg/day doses resulted in no mortality. In males, slight significant increases in serum creatinine (350 and 1000 mg/kg/day), and decreases in urine volume (all treated groups) were observed. In females, slight significant increases in total white blood cell and absolute lymphocyte counts (1000 mg/kg/day), and blood urea nitrogen (BUN) (100 and 350, but not 1000 mg/kg/day) were noted. A dose-related increase in renal tubular mineralization, without degenerative or inflammatory reaction, was found in females (all treated groups) and two males (1000 mg/kg/day). Renal mineralization in rats (especially females) is influenced by calcium:phosphorus ratios in the diet. A high level of citicoline consumption resulted in increased phosphorus intake in the rats, and likely explains this result.

  4. Evaluation of the repeated-dose liver micronucleus assay using N-nitrosomorpholine in young adult rats: report on collaborative study by the Collaborative Study Group for the Micronucleus Test (CSGMT)/Japanese Environmental Mutagen Society (JEMS)-Mammalian Mutagenicity Study (MMS) Group.

    Science.gov (United States)

    Hayashi, Aya; Kosaka, Mizuki; Kimura, Aoi; Wako, Yumi; Kawasako, Kazufumi; Hamada, Shuichi

    2015-03-01

    The present study was conducted to evaluate the suitability of a repeated-dose liver micronucleus (LMN) assay in young adult rats as a collaborative study by the Mammalian mutagenicity study (MMS) group. All procedures were performed in accordance with the standard protocols of the MMS Group. Six-week-old male Crl:CD(SD) rats (5 animals/group) received oral doses of the hepatocarcinogen N-nitrosomorpholine (NMOR) at 0 (control), 5, 10, and 30mg/kg/day (10mL/kg) for 14 days. Control animals received vehicle (water). Hepatocytes were collected from the liver 24h after the last dose, and the number of micronucleated hepatocytes (MNHEPs) was determined by microscopy. The number of micronucleated immature erythrocytes (MNIMEs) in the femoral bone marrow was also determined. The liver was examined using histopathologic methods after formalin fixation. The results showed statistically significant and dose-dependent increases in the number of MNHEPs in the liver at doses of 10mg/kg and greater when compared with the vehicle control. However, no significant increase was noted in the number of MNIMEs in the bone marrow at doses of up to 30mg/kg. Histopathology of the liver revealed hypertrophy and single cell necrosis of hepatocytes at doses of 5mg/kg and above. These results showed that the induction of micronuclei by NMOR was detected by the repeated-dose LMN assay, but not by the repeated-dose bone marrow micronucleus assay.

  5. Sleep Quality and Emotional Correlates in Taiwanese Coronary Artery Bypass Graft Patients 1 Week and 1 Month after Hospital Discharge: A Repeated Descriptive Correlational Study.

    Science.gov (United States)

    Yang, Pei-Lin; Huang, Guey-Shiun; Tsai, Chien-Sung; Lou, Meei-Fang

    2015-01-01

    Poor sleep quality is a common health problem for coronary artery bypass graft patients, however few studies have evaluated sleep quality during the period immediately following hospital discharge. The aim of this study was to investigate changes in sleep quality and emotional correlates in coronary artery bypass graft patients in Taiwan at 1 week and 1 month after hospital discharge. We used a descriptive correlational design for this study. One week after discharge, 87 patients who had undergone coronary artery bypass surgery completed two structured questionnaires: the Pittsburgh Sleep Quality Index and the Hospital Anxiety and Depression Scale. Three weeks later (1 month after discharge) the patients completed the surveys again. Pearson correlations, t-tests, ANOVA and linear multiple regression analysis were used to analyze the data. A majority of the participants had poor sleep quality at 1 week (82.8%) and 1 month (66.7%) post-hospitalization, based on the global score of the Pittsburgh Sleep Quality Index. Despite poor sleep quality at both time-points the sleep quality at 1 month was significantly better than at 1-week post hospitalization. Poorer sleep quality correlated with older age, poorer heart function, anxiety and depression. The majority of participants had normal levels of anxiety at 1 week (69.0%) and 1 month (88.5%) as measured by the Hospital Anxiety and Depression Scale. However, some level of depression was seen at 1 week (78.1%) and 1 month (59.7%). Depression was a significant predictor of sleep quality at 1 week; at 1 month after hospital discharge both anxiety and depression were significant predictors of sleep quality. Sleep quality, anxiety and depression all significantly improved 1 month after hospital discharge. However, more than half of the participants continued to have poor sleep quality and some level of depression. Health care personnel should be encouraged to assess sleep and emotional status in patients after coronary artery

  6. Oxygen uptake during repeated-sprint exercise.

    Science.gov (United States)

    McGawley, Kerry; Bishop, David J

    2015-03-01

    Repeated-sprint ability appears to be influenced by oxidative metabolism, with reductions in fatigue and improved sprint times related to markers of aerobic fitness. The aim of the current study was to measure the oxygen uptake (VO₂) during the first and last sprints during two, 5 × 6-s repeated-sprint bouts. Cross-sectional study. Eight female soccer players performed two, consecutive, 5 × 6-s maximal sprint bouts (B1 and B2) on five separate occasions, in order to identify the minimum time (trec) required to recover total work done (Wtot) in B1. On a sixth occasion, expired air was collected during the first and last sprint of B1 and B2, which were separated by trec. The trec was 10.9 ± 1.1 min. The VO₂ during the first sprint was significantly less than the last sprint in each bout (psprint (measured in kJ) was significantly related to VO₂max in both B1 (r=0.81, p=0.015) and B2 (r=0.93, p=0.001). In addition, the VO₂ attained in the final sprint was not significantly different from VO₂max in B1 (p=0.284) or B2 (p=0.448). The current study shows that the VO₂ increases from the first to the last of 5 × 6-s sprints and that VO₂max may be a limiting factor to performance in latter sprints. Increasing V˙O₂max in team-sport athletes may enable increased aerobic energy delivery, and consequently work done, during a bout of repeated sprints. Copyright © 2014 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  7. Expanded complexity of unstable repeat diseases

    OpenAIRE

    Polak, Urszula; McIvor, Elizabeth; Dent, Sharon Y.R.; Wells, Robert D.; Napierala, Marek.

    2012-01-01

    Unstable Repeat Diseases (URDs) share a common mutational phenomenon of changes in the copy number of short, tandemly repeated DNA sequences. More than 20 human neurological diseases are caused by instability, predominantly expansion, of microsatellite sequences. Changes in the repeat size initiate a cascade of pathological processes, frequently characteristic of a unique disease or a small subgroup of the URDs. Understanding of both the mechanism of repeat instability and molecular consequen...

  8. Does socioeconomic status in adolescence predict low back pain in adulthood? A repeated cross-sectional study of 4,771 Danish adolescents

    DEFF Research Database (Denmark)

    Hestbaek, Lise; Korsholm, Lars; Leboeuf-Yde, Charlotte

    2008-01-01

    Social and economic disadvantage is associated with general poor physical health. This relationship has been recognised for centuries, but it is unknown whether socioeconomic factors have a specific influence on low back pain (LBP). Furthermore, it is unknown how social and economic disadvantages...... in youth affect adult health. Therefore, the specific objectives of this study are to explore (1) the cross-sectional association between socioeconomic status (SES) and LBP in adolescence and (2) the longitudinal association between SES in adolescence and LBP in early adulthood. A database containing LBP...... as well as at follow-up. Finally, the influence of a variable combining the different socioeconomic parameters was established. All estimates were controlled for smoking, alcohol consumption and body mass index at baseline. In the logistic regression models, only three of the 32 estimates were...

  9. Family structure and breakfast consumption of 11-15 year old boys and girls in Scotland, 1994-2010: a repeated cross-sectional study

    Directory of Open Access Journals (Sweden)

    Levin Kate A

    2012-03-01

    Full Text Available Abstract Background The benefits of breakfast during childhood and adolescence have been reported previously though few studies have considered family structure inequalities in breakfast consumption. The proportion of young people living in non-traditional family types has increased in recent years, strengthening the need to describe and monitor the impact of the changing family unit on adolescent breakfast consumption. This study aimed to describe changes in daily breakfast consumption among adolescents in Scotland between 1994 and 2010, while also considering family structure inequalities, and the degree to which these have changed over time. Methods Data from the 1994, 1998, 2002, 2006 and 2010 Scottish Health Behaviour in School-aged Children (HBSC surveys were analysed using logistic multilevel regression models for binary outcome variable daily breakfast consumption. Results Daily breakfast consumption among adolescents increased between 1994 and 2010, although there were differences by age and sex. In fact those aged over 14.5 years saw decreases in breakfast consumption, and girls saw significantly larger increases than boys. Daily breakfast consumption was more prevalent among adolescents from 'both parent' families, with lowest prevalence among those from single parent families. Trends in daily breakfast consumption between 1994 and 2010 also varied by family structure. While prevalence of daily breakfast consumption increased among those living with 'both parents', the largest proportion of the population, prevalence decreased over time among adolescents of single parent families, and particularly among those living with their father. Conclusions Family structure inequalities in daily breakfast consumption increased between 1994 and 2010, while breakfast consumption across the population as a whole increased. As the proportion of young people living in an alternative family structure continues to grow it is important to understand why

  10. A 28-day repeat dose toxicity study of steroidal glycoalkaloids, alpha-solanine and alpha-chaconine in the Syrian Golden hamster.

    Science.gov (United States)

    Langkilde, Søren; Mandimika, Tafadzwa; Schrøder, Malene; Meyer, Otto; Slob, Wout; Peijnenburg, Ad; Poulsen, Morten

    2009-06-01

    Glycoalkaloids alpha-solanine and alpha-chaconine are naturally present toxicants in the potato plant (Solanumtuberosum). Human intake of high doses of glycoalkaloids has led to acute intoxication, in severe cases coma and death. Previous studies have indicated that the ratio of alpha-solanine to alpha-chaconine may determine the degree and nature of the glycoalkaloid toxicity in potatoes, as the toxicity of the two alkaloids act synergistically. The aim of the present study was to investigate whether an altered ratio of alpha-solanine and alpha-chaconine would reduce the toxicity of the glycoalkaloids. The Syrian Golden hamster was given daily doses of alpha-solanine and alpha-chaconine by gavage for 28 days. Doses of up to 33.3 mg total glycoalkaloids/kg body weight were applied in ratios of 1:3.7 and 1:70 (alpha-solanine:alpha-chaconine). Administration of the highest doses of both ratios resulted in distended and fluid filled small intestines and stomach. Animals receiving the ratio with the reduced content of alpha-solanine were less affected compared to those receiving the other ratio. Gene expression profiling experiments were conducted using RNA from epithelial scrapings from the small intestines of the hamsters administered the highest doses of the glycoalkaloid treatments. In general, more differential gene expression was observed in the epithelial scrapings of the hamsters fed the ratio of 1:3.7. Mostly, pathways involved in lipid and energy metabolism were affected by the ratio of 1:3.7.

  11. Prevalence of myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS in three regions of England: a repeated cross-sectional study in primary care

    Directory of Open Access Journals (Sweden)

    Fayyaz Shagufta

    2011-07-01

    Full Text Available Abstract Background Myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS or chronic fatigue syndrome (CFS has been used to name a range of chronic conditions characterized by extreme fatigue and other disabling symptoms. Attempts to estimate the burden of disease have been limited by selection bias, and by lack of diagnostic biomarkers and of agreed reproducible case definitions. We estimated the prevalence and incidence of ME/CFS in three regions in England, and discussed the implications of frequency statistics and the use of different case definitions for health and social care planning and for research. Methods We compared the clinical presentation, prevalence and incidence of ME/CFS based on a sample of 143,000 individuals aged 18 to 64 years, covered by primary care services in three regions of England. Case ascertainment involved: 1 electronic search for chronic fatigue cases; 2 direct questioning of general practitioners (GPs on cases not previously identified by the search; and 3 clinical review of identified cases according to CDC-1994, Canadian and Epidemiological Case (ECD Definitions. This enabled the identification of cases with high validity. Results The estimated minimum prevalence rate of ME/CFS was 0.2% for cases meeting any of the study case definitions, 0.19% for the CDC-1994 definition, 0.11% for the Canadian definition and 0.03% for the ECD. The overall estimated minimal yearly incidence was 0.015%. The highest rates were found in London and the lowest in East Yorkshire. All but one of the cases conforming to the Canadian criteria also met the CDC-1994 criteria, however presented higher prevalence and severity of symptoms. Conclusions ME/CFS is not uncommon in England and represents a significant burden to patients and society. The number of people with chronic fatigue who do not meet specific criteria for ME/CFS is higher still. Both groups have high levels of need for service provision, including health and social

  12. Does Obesity Modify the Ability of Prebiopsy Prostate Specific Antigen to Detect Prostate Cancer on Repeat Biopsy? Results from the REDUCE Study.

    Science.gov (United States)

    Vidal, Adriana C; Howard, Lauren E; Moreira, Daniel M; Castro-Santamaria, Ramiro; Andriole, Gerald L; Freedland, Stephen J

    2015-07-01

    Higher body mass index is linked to lower prostate specific antigen. This has given rise to concerns that prostate specific antigen may be less reliable for predicting prostate cancer among obese men. We tested the accuracy of prebiopsy prostate specific antigen for predicting prostate cancer across body mass index categories. We used the REDUCE study, which tested dutasteride for prostate cancer risk reduction in men with a prostate specific antigen of 2.5 to 10.0 ng/ml and a negative pre-study biopsy. All men were required to have a biopsy at 2 and 4 years independent of prostate specific antigen. We assessed the performance of prebiopsy prostate specific antigen to predict overall and high grade prostate cancer (Gleason sum 7 or greater) in each body mass index group using AUC. Of 6,103 men who had a 2-year biopsy 1,646 (27%) were normal weight, 3,209 (53%) were overweight and 1,248 (20%) were obese. Mean adjusted prostate specific antigen for normal weight, overweight and obese subjects on placebo was 7.73, 7.17 and 6.79 ng/ml (p-trend=0.192), and on dutasteride 3.16, 2.93 and 2.62 ng/ml (p=0.008). AUC analysis using raw prostate specific antigen data for predicting prostate cancer ranged from 0.60 to 0.64 in the placebo arm and 0.58 to 0.66 in the dutasteride arm with no difference across body mass index categories (p-interactions ≥0.212). Similar results were found for high grade prostate cancer with AUC ranging from 0.69 to 0.70 in the placebo arm and 0.65 to 0.75 in the dutasteride arm but no differences across body mass index categories (p-interactions ≥0.157). Among men with a previous negative biopsy the accuracy of prebiopsy prostate specific antigen to predict overall and high grade prostate cancer was independent of body mass index. Copyright © 2015 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  13. Repeated granitoid intrusions during the Neoproterozoic along the western boundary of the Saharan metacraton, Eastern Hoggar, Tuareg shield, Algeria: An AMS and U-Pb zircon age study

    Science.gov (United States)

    Henry, B.; Liégeois, J. P.; Nouar, O.; Derder, M. E. M.; Bayou, B.; Bruguier, O.; Ouabadi, A.; Belhai, D.; Amenna, M.; Hemmi, A.; Ayache, M.

    2009-09-01

    The N-S oriented Raghane shear zone (8°30') delineates the western boundary of the Saharan metacraton and is, with the 4°50' shear zone, the most important shear zone in the Tuareg shield. It can be followed on 1000 km in the basement from southern Aïr, Niger to NE Hoggar, Algeria. Large subhorizontal movements have occurred during the Pan-African orogeny and several groups of granitoids intruded during the Neoproterozoic. We report U-Pb zircon datings (laser ICP-MS) showing that three magmatic suites of granitoids emplaced close to the Raghane shear zone at c. 790 Ma, c. 590 and c. 550 Ma. A comprehensive and detailed (158 sites, more than 1000 cores) magnetic fabric study was performed on 8 plutons belonging to the three magmatic suites and distributed on 200 km along the Raghane shear zone. The main minerals in all the target plutons do not show visible preferential magmatic orientation except in narrow shear zones. The AMS study shows that all plutons have a magnetic lineation and foliation compatible with the deformed zones that are zones deformed lately in post-solidus conditions. These structures are related to the nearby mega-shear zones, the Raghane shear zone for most of them. The old c. 793 Ma Touffok granite preserved locally its original structures. The magnetic structures of the c. 593 Ma Ohergehem pluton, intruded in the Aouzegueur terrane, are related to thrust structures generated by the Raghane shear zone while it is not the case of the contemporaneous plutons in the Assodé-Issalane terrane whose structures are only related to the subvertical shear zones. Finally, the c. 550 Ma granite group has magnetic structure related to the N-S oriented Raghane shear zone and its associated NNE-SSW structures when close to them, but NW-SE oriented when further. These NW-SE oriented structures appear to be characteristic of the late Neoproterozoic evolution of the Saharan metacraton and are in relation to the convergence with the Murzuq craton. This

  14. Source coding model for repeated snapshot imaging

    CERN Document Server

    Li, Junhui; Yang, Dongyue; wu, Guohua; Yin, Longfei; Guo, Hong

    2016-01-01

    Imaging based on successive repeated snapshot measurement is modeled as a source coding process in information theory. The necessary number of measurement to maintain a certain level of error rate is depicted as the rate-distortion function of the source coding. Quantitative formula of the error rate versus measurement number relation is derived, based on the information capacity of imaging system. Second order fluctuation correlation imaging (SFCI) experiment with pseudo-thermal light verifies this formula, which paves the way for introducing information theory into the study of ghost imaging (GI), both conventional and computational.

  15. 47 CFR 97.205 - Repeater station.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Repeater station. 97.205 Section 97.205... SERVICE Special Operations § 97.205 Repeater station. (a) Any amateur station licensed to a holder of a Technician, General, Advanced or Amateur Extra Class operator license may be a repeater. A holder of...

  16. 47 CFR 22.1015 - Repeater operation.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false Repeater operation. 22.1015 Section 22.1015... Offshore Radiotelephone Service § 22.1015 Repeater operation. Offshore central stations may be used as repeater stations provided that the licensee is able to maintain control of the station, and in...

  17. Repeatedly Heading a Soccer Ball Does Not Increase Serum Levels of S-100B, a Biochemical Marker of Brain Tissue Damage: an Experimental Study.

    Science.gov (United States)

    Stålnacke, Britt-Marie; Sojka, Peter

    2008-02-29

    OBJECTIVES: The aim of the study was to analyse whether the controlled heading of soccer balls elicits increased serum concentrations of a biochemical marker of brain tissue damage S-100B. METHODS: Nineteen male soccer players were randomly divided into two groups, A and B. Group A headed a soccer ball falling from 18 m five times, while group B served as controls (no heading). Blood samples were taken before and 0.5 h, 2 h and 4 h after the heading for analysis of S-100B. RESULTS: No statistically significant (p > 0.05) increases in serum concentrations of S-100B were encountered in group A at 0.5 h (0.109 +/-0.024 mug/L), 2 h (0.098 +/- 0.026 mug/L), and 4 h (0.113 +/- 0.035 mug/L) when the blood samples obtained before and after the heading were compared (0.157 +/- 0.134 mug/L). No statistically significant difference was found when the serum concentrations of S-100B were compared between groups A and B either before or after heading. CONCLUSIONS: Heading a soccer ball dropped from a height of 18 m five times was not found to cause an increase in serum concentrations of S-100B, indicating that the impact was not sufficient to cause biochemically discernible damage of brain tissue.

  18. Repeatedly Heading a Soccer Ball Does Not Increase Serum Levels of S-100B, a Biochemical Marker of Brain Tissue Damage: an Experimental Study

    Directory of Open Access Journals (Sweden)

    Peter Sojka

    2008-01-01

    Full Text Available Objectives: The aim of the study was to analyse whether the controlled heading of soccer balls elicits increased serum concentrations of a biochemical marker of brain tissue damage S-100B.Methods: Nineteen male soccer players were randomly divided into two groups, A and B. Group A headed a soccer ball falling from 18 m five times, while group B served as controls (no heading. Blood samples were taken before and 0.5 h, 2 h and 4 h after the heading for analysis of S-100B.Results: No statistically significant (p > 0.05 increases in serum concentrations of S-100B were encountered in group A at 0.5 h (0.109 ± 0.024 μg/L, 2 h (0.098 ± 0.026 μg/L, and 4 h (0.113 ± 0.035 μg/L when the blood samples obtained before and after the heading were compared (0.157 ± 0.134 μg/L. No statistically significant difference was found when the serum concentrations of S-100B were compared between groups A and B either before or after heading.Conclusions: Heading a soccer ball dropped from a height of 18 m five times was not found to cause an increase in serum concentrations of S-100B, indicating that the impact was not sufficient to cause biochemically discernible damage of brain tissue.

  19. Biosynthesis of highly enriched 13C-lycopene for human metabolic studies using repeated batch tomato cell culturing with 13C-glucose.

    Science.gov (United States)

    Moran, Nancy Engelmann; Rogers, Randy B; Lu, Chi-Hua; Conlon, Lauren E; Lila, Mary Ann; Clinton, Steven K; Erdman, John W

    2013-08-15

    While putative disease-preventing lycopene metabolites are found in both tomato (Solanum lycopersicum) products and in their consumers, mammalian lycopene metabolism is poorly understood. Advances in tomato cell culturing techniques offer an economical tool for generation of highly-enriched (13)C-lycopene for human bioavailability and metabolism studies. To enhance the (13)C-enrichment and yields of labelled lycopene from the hp-1 tomato cell line, cultures were first grown in (13)C-glucose media for three serial batches and produced increasing proportions of uniformly labelled lycopene (14.3±1.2%, 39.6±0.5%, and 48.9±1.5%) with consistent yields (from 5.8 to 9 mg/L). An optimised 9-day-long (13)C-loading and 18-day-long labelling strategy developed based on glucose utilisation and lycopene yields, yielded (13)C-lycopene with 93% (13)C isotopic purity, and 55% of isotopomers were uniformly labelled. Furthermore, an optimised acetone and hexane extraction led to a fourfold increase in lycopene recovery from cultures compared to a standard extraction.

  20. Repeating earthquakes recorded by Liaoning Regional Seismograph Network

    Institute of Scientific and Technical Information of China (English)

    LI Yu-tong; WU Zhong-liang; JIANG Chang-sheng; LI Guang-ping

    2008-01-01

    In the list of 'repeating pairs' or 'doublets' of earthquakes in China identified by Schaff and Richards using tele-seismic waveform cross-correlation, there were 23 repeating pairs located in Liaoning Province. In this study the waveforms of these events were cross-correlated using records from Liaoning Regional Seismograph Network (LRSN), and the 'repeating events' in the sense of regional waveform cross-correlation were obtained. The result was compared with that of Schaff and Richards and was used for the assessment of the seismic phase picking and event location practice of LRSN. The result shows that 'repeating events' in the sense of teleseismic waveform cross-correlation and those in the sense of regional waveform cross-correlation have significant difference, al-though with some overlap. However, the overall assessment of the location accuracy and the phase pick errors of LRSN by using these two sets of 'repeating events', respectively, provides similar results, while 'repeating events' in the sense of regional waveform cross-correlation seem to be better performing in such an assessment. With the assumption that the separation between the 'repeaters' be less than 1 km, the uncertainty in routine earthquake location of LRSN is estimated to be below 5 km, with the average of 2 km. In the observational bulletins of LRSN the time error in phase picking is estimated to be within±Is for 94% Pg readings and for 88% Sg readings.

  1. Repeat breeding: Incidence, risk factors and diagnosis in buffaloes

    Directory of Open Access Journals (Sweden)

    Chandra Shekher Saraswat

    2016-04-01

    Full Text Available Repeat breeding in buffaloes was evaluated in terms of incidence, risk factors and diagnosis. The incidence of repeat breeding is low in buffaloes however in different studies the incidence varied from 0.70% to 30%. Because of seasonal suppression of fertility repeat breeding in buffaloes should be limited to the breeding season. Spring and winter calving, first parity, peri-parturient disease and lactation are significant risk factors for repeat breeding in buffaloes. The etiologies of repeat breeding in buffaloes can be failure of fertilization and early embryonic deaths. Only a few of causes of failure of fertilization have been identified in buffaloes. Ovulatory disturbances and ovarian cysts are uncommon in buffaloes and cysts have poor clinical manifestation. Endometritis is the common female cause of fertilization failures in buffaloes whereas poor semen quality and improper insemination are the bull side factors for fertilization failures. Early embryonic deaths are common in buffaloes mated/inseminated during the end of the breeding season due to a low luteal progesterone however embryonic deaths occur late (<25 days in buffaloes. Diagnostic approaches for repeat breeding include vaginoscopic and transrectal examination and uterine cytology for genital health. More precise evaluations of the ovarian and uterine function can be obtained by ultrasonographic and hysteroscopic examinations performed sequentially however, precise diagnosis of the cause of repeat breeding seems difficult.

  2. How do people with drug-resistant mesial temporal lobe epilepsy sleep? A clinical and video-EEG with EOG and submental EMG for sleep staging study

    Directory of Open Access Journals (Sweden)

    Aline Vieira Scarlatelli-Lima

    2016-09-01

    Full Text Available This study aimed to assess subjective and objective sleep parameters in a homogeneous group of drug-resistant mesial temporal lobe epilepsy (MTLE patients through internationally validated clinical questionnaires, video-electroencephalographic (VEEG and polysomnographic (PSG studies. Fifty-six patients with definite diagnosis of MTLE who were candidates for epilepsy surgery underwent a detailed clinical history, the Pittsburgh Sleep Quality Index (PSQI, Epworth Sleepiness Scale (ESS, Stanford Sleepiness Scale (SSS, neurological examination, 1.5 T brain magnetic resonance imaging, VEEG and PSG. Sixteen percent of patients reported significant daytime sleepiness as measured by ESS and 27% reported low levels of sleep quality as measured by PSQI. Patients with medically resistant epilepsy by MTLE showed increased wakefulness after sleep onset (WASO with mean ± standard deviation of 17.4 ± 15.6, longer non-rapid eye movement (NREM 1 (7.5 ± 4.6% and NREM3 sleep (26.6 ± 11.8%, abnormal rapid eye movement (REM latency in 30/56 patients, shorter REM sleep (16.7 ± 6.6%, and abnormal alpha delta patterns were observed in 41/56 patients. The analysis of interictal epileptic discharges (IEDs evidenced highest spiking rate during NREM3 sleep and higher concordance with imaging data when IEDs were recorded in sleep, mainly during REM sleep. We concluded that patients with MTLE showed disrupted sleep architecture that may result in daytime dysfunction and sleep complaints. Furthermore, NREM sleep activated focal IEDs and them - when recorded during sleep - had higher localizing value.

  3. Understanding repeated non-attendance in health services: a pilot analysis of administrative data and full study protocol for a national retrospective cohort

    Science.gov (United States)

    Williamson, Andrea E; Ellis, David A; Wilson, Philip; McQueenie, Ross; McConnachie, Alex

    2017-01-01

    Introduction Understanding the causes of low engagement in healthcare is a pre-requisite for improving health services’ contribution to tackling health inequalities. Low engagement includes missing healthcare appointments. Serially (having a pattern of) missing general practice (GP) appointments may provide a risk marker for vulnerability and poorer health outcomes. Methods and analysis A proof of concept pilot using GP appointment data and a focus group with GPs informed the development of missed appointment categories: patients can be classified based on the number of appointments missed each year. The full study, using a retrospective cohort design, will link routine health service and education data to determine the relationship between GP appointment attendance, health outcomes, healthcare usage, preventive health activity and social circumstances taking a life course approach and using data from the whole journey in the National Health Service (NHS) healthcare. 172 practices will be recruited (∼900 000 patients) across Scotland. The statistical analysis will focus on 2 key areas: factors that predict patients who serially miss appointments, and serial missed appointments as a predictor of future patient outcomes. Regression models will help understand how missed appointment patterns are associated with patient and practice characteristics. We shall identify key factors associated with serial missed appointments and potential interactions that might predict them. Ethics and dissemination The results of the project will inform debates concerning how best to reduce non-attendance and increase patient engagement within healthcare systems. Significant non-academic beneficiaries include governments, policymakers and medical practitioners. Results will be disseminated via a combination of academic outputs (papers, conferences), social media and through collaborative public health/policy fora. PMID:28196951

  4. A 13-week repeated dose study of three 3-monochloropropane-1,2-diol fatty acid esters in F344 rats.

    Science.gov (United States)

    Onami, Saeko; Cho, Young-Man; Toyoda, Takeshi; Mizuta, Yasuko; Yoshida, Midori; Nishikawa, Akiyoshi; Ogawa, Kumiko

    2014-04-01

    3-monochloropropane-1,2-diol (3-MCPD), a rat renal and testicular carcinogen, has been reported to occur in various foods and food ingredients as free or esterified forms. Since reports about toxicity of 3-MCPD esters are limited, we conducted a 13-week rat subchronic toxicity study of 3-MCPD esters (palmitate diester: CDP, palmitate monoester: CMP, oleate diester: CDO). We administered a carcinogenic dose (3.6 × 10(-4) mol/kg B.W./day) of 3-MCPD or these esters at equimolar concentrations and two 1/4 lower doses by gavage with olive oil as a vehicle five times a week for 13 weeks to F344 male and female rats. As a result, five out of ten 3-MCPD-treated females died from acute renal tubular necrosis, but none of the ester-treated rats. Decreased HGB was observed in all high-dose 3-MCPD fatty acid ester-treated rats, except CDO-treated males. The absolute and relative kidney weights were significantly increased in the ester-treated rats at medium and high doses. Relative liver weights were significantly increased in the esters-treated rat at high dose, except for CMP females. Significant increase in apoptotic epithelial cells in the initial segment of the epididymis of high-dose ester-treated males was also observed. The results suggested that although acute renal toxicity was lower than 3-MCPD, these three 3-MCPD fatty acid esters have the potential to exert subchronic toxicity to the rat kidneys and epididymis, to a similar degree as 3-MCPD under the present conditions. NOAELs (no-observed-adverse-effect levels) of CDP, CMP and CDO were suggested to be 14, 8 and 15 mg/kg B.W./day, respectively.

  5. Study of a long-term series of repeated quarry blasts using spectrograms, waveform cross-correlation and Principal Component Analysis

    Science.gov (United States)

    Yedlin, M. J.; Ben Horin, Y.; Kitov, I. O.; Margrave, G. F.; Rozhkov, M.

    2016-12-01

    the most effective detector for the studied quarry. When SVD is applied to each of three components separately, the level of coherency between vertical and horizontal components falls and the level of cross-correlation does not exceed that observed for the SVD for the Z-component only.

  6. Trends in resource utilization by children with neurological impairment in the United States inpatient health care system: a repeat cross-sectional study.

    Directory of Open Access Journals (Sweden)

    Jay G Berry

    2012-01-01

    Full Text Available BACKGROUND: Care advances in the United States (US have led to improved survival of children with neurological impairment (NI. Children with NI may account for an increasing proportion of hospital resources. However, this assumption has not been tested at a national level. METHODS AND FINDINGS: We conducted a study of 25,747,016 US hospitalizations of children recorded in the Kids' Inpatient Database (years 1997, 2000, 2003, and 2006. Children with NI were identified with International Classification of Diseases, 9th Revision, Clinical Modification diagnoses resulting in functional and/or intellectual impairment. We assessed trends in inpatient resource utilization for children with NI with a Mantel-Haenszel chi-square test using all 4 y of data combined. Across the 4 y combined, children with NI accounted for 5.2% (1,338,590 of all hospitalizations. Epilepsy (52.2% [n = 538,978] and cerebral palsy (15.9% [n = 164,665] were the most prevalent NI diagnoses. The proportion of hospitalizations attributable to children with NI did not change significantly (p = 0.32 over time. In 2006, children with NI accounted for 5.3% (n = 345,621 of all hospitalizations, 13.9% (n = 3.4 million of bed days, and 21.6% (US$17.7 billion of all hospital charges within all hospitals. Over time, the proportion of hospitalizations attributable to children with NI decreased within non-children's hospitals (3.0% [n = 146,324] in 1997 to 2.5% [n = 113,097] in 2006, p<.001 and increased within children's hospitals (11.7% [n = 179,324] in 1997 to 13.5% [n = 209,708] in 2006, p<0.001. In 2006, children with NI accounted for 24.7% (2.1 million of bed days and 29.0% (US$12.0 billion of hospital charges within children's hospitals. CONCLUSIONS: Children with NI account for a substantial proportion of inpatient resources utilized in the US. Their impact is growing within children's hospitals. We must ensure that the current health care system is staffed, educated, and equipped to

  7. Magma plumbing system at the beginning of repeated caldera eruption: A case study on Aso-1 erupted about 270 ky ago from Aso caldera, SW Japan

    Science.gov (United States)

    Miyagi, I.; Hoshizumi, H.; Miyabuchi, Y.

    2015-12-01

    In order to understand the commencement of magma plumbing system of a polygenetic caldera, we started petrological study on the earliest eruptive product of Aso caldera, SW Japan. Aso caldera is one of the active volcano in Japan which have produced four stages (Aso-1, -2, -3, -4) of large-scale pyroclastic flow deposits 270 to 90 ky. ago. A suite of samples were collected from the bottom of Aso-1 pyroclastic flow deposit and from the underlying tephra layer (Ono et al., 1979). The tephra comprises more than 10 pumice fall units inter-layered by dark gray volcanic ash. For whole rock chemistry, coarser pumice fragments were separated. For mineral and glass chemistry, phenocrysts and glass particles were handpicked from the sieved 500-1000 um fractions under a binocular microscope. This fraction consist of plagioclase, orthopyroxene, variably vesiculated volcanic glass fragments, and clinopyroxene phenocrysts. They were analyzed using an electron micro-probe. The suite of samples are similar and major temporal change is the chemical composition of orthopyroxenes; those from upper horizon are relatively Mg rich. Anorthite content of plagioclase phenocryst is bimodal 49-53 mol. % (major) and 57-70 mol. % (minor). Silica content of matrix glass fall in a narrow range 68-70 wt. %. Temperature and oxygen fugacity were estimated to be 865-905 deg-C and FMQ+2 log unit, respectively, using ILMAT (Lepage, 2003). Pressure and water content of the magma are estimated to be 5-7 kbar and 0.5-1 wt. % H2O, respectively, using rhyolite-MELTS (Gualda et al., 2012) on the most undifferentiated tholeiitic basalt of Aso 4KC-03 (Hunter, 1998) to reproduce the observed composition of matrix glass (68-70 wt. % SiO2) and plagioclase (An 49-53 mol. %). The calcic plagioclase (An 57-70 mol. %), however, suggest that the basalt was initially hydrous and require magma degassing before the differentiation. If we assume degassing by magma convection in a conduit (Kazahaya et al., 1994), the

  8. Pentatricopeptide repeat proteins in plants.

    Science.gov (United States)

    Barkan, Alice; Small, Ian

    2014-01-01

    Pentatricopeptide repeat (PPR) proteins constitute one of the largest protein families in land plants, with more than 400 members in most species. Over the past decade, much has been learned about the molecular functions of these proteins, where they act in the cell, and what physiological roles they play during plant growth and development. A typical PPR protein is targeted to mitochondria or chloroplasts, binds one or several organellar transcripts, and influences their expression by altering RNA sequence, turnover, processing, or translation. Their combined action has profound effects on organelle biogenesis and function and, consequently, on photosynthesis, respiration, plant development, and environmental responses. Recent breakthroughs in understanding how PPR proteins recognize RNA sequences through modular base-specific contacts will help match proteins to potential binding sites and provide a pathway toward designing synthetic RNA-binding proteins aimed at desired targets.

  9. Two-dimensional quantum repeaters

    Science.gov (United States)

    Wallnöfer, J.; Zwerger, M.; Muschik, C.; Sangouard, N.; Dür, W.

    2016-11-01

    The endeavor to develop quantum networks gave rise to a rapidly developing field with far-reaching applications such as secure communication and the realization of distributed computing tasks. This ultimately calls for the creation of flexible multiuser structures that allow for quantum communication between arbitrary pairs of parties in the network and facilitate also multiuser applications. To address this challenge, we propose a two-dimensional quantum repeater architecture to establish long-distance entanglement shared between multiple communication partners in the presence of channel noise and imperfect local control operations. The scheme is based on the creation of self-similar multiqubit entanglement structures at growing scale, where variants of entanglement swapping and multiparty entanglement purification are combined to create high-fidelity entangled states. We show how such networks can be implemented using trapped ions in cavities.

  10. General benchmarks for quantum repeaters

    CERN Document Server

    Pirandola, Stefano

    2015-01-01

    Using a technique based on quantum teleportation, we simplify the most general adaptive protocols for key distribution, entanglement distillation and quantum communication over a wide class of quantum channels in arbitrary dimension. Thanks to this method, we bound the ultimate rates for secret key generation and quantum communication through single-mode Gaussian channels and several discrete-variable channels. In particular, we derive exact formulas for the two-way assisted capacities of the bosonic quantum-limited amplifier and the dephasing channel in arbitrary dimension, as well as the secret key capacity of the qubit erasure channel. Our results establish the limits of quantum communication with arbitrary systems and set the most general and precise benchmarks for testing quantum repeaters in both discrete- and continuous-variable settings.

  11. Hungarian repeat station survey, 2010

    Directory of Open Access Journals (Sweden)

    Péter Kovács

    2013-03-01

    Full Text Available The last Hungarian repeat station survey was completed between October 2010 and February 2011. Declination, inclination and the total field were observed using one-axial DMI fluxgate magnetometer mounted on Zeiss20A theodolite and GSM 19 Overhauser magnetometer. The magnetic elements of the sites were reduced to the epoch of 2010.5 on the basis of the continuous recordings of Tihany Geophysical Observatory. In stations located far from the reference observatory, the observations were carried out in the morning and afternoon in order to decrease the effect of the distant temporal correction. To further increase the accuracy, on-site dIdD variometer has also been installed near the Aggtelek station, in the Baradla cave, during the survey of the easternmost sites. The paper presents the technical details and the results of our last campaign. The improvement of the accuracy of the temporal reduction by the use of the local variometer is also reported.

  12. Quality control during repeated fryings

    Directory of Open Access Journals (Sweden)

    Cuesta, C.

    1998-08-01

    Full Text Available Most of the debate ¡s about how the slow or frequent turnover of fresh fat affects the deterioration, of fat used in frying. Then, the modification of different oils used in repeated fryings of potatoes without or with turnover of fresh oil, under similar frying conditions, was evaluated by two criteria: by measuring the total polar component isolated by column chromatography and by the evaluation of the specific compounds related to thermoxidative and hydrolytic alteration by High Performance Size Exclusion Chromatography (HPSEC. The results indicate that with frequent turnover of fresh oil, the critical level of 25% of polar material is rarely reached, and there are fewer problems with fat deterioration because the frying tended to increase the level of polar material and thermoxidative compounds (polymers and dimers of triglycerides and oxidized triglycerides in the fryer oil during the first fryings, followed by minor changes and a tendency to reach a near-steady state in successive fryings. However, in repeated frying of potatoes using a null turnover the alteration rate was higher being linear the relationship found between polar material or the different thermoxidative compounds and the number of fryings. On the other hand chemical reactions produced during deep-fat frying can be minimized by using proper oils. In addition the increased level of consumers awareness toward fat composition and its impact on human health could had an impact on the selection of fats for snacks and for industry. In this way monoenic fats are the most adequate from a nutritional point of view and for its oxidative stability during frying.

  13. Triage of HR-HPV positive women with minor cytological abnormalities: a comparison of mRNA testing, HPV DNA testing, and repeat cytology using a 4-year follow-up of a population-based study.

    Directory of Open Access Journals (Sweden)

    Maria Persson

    Full Text Available OBJECTIVE: Expression of the viral E6/E7 oncogenes of high-risk human papillomaviruses (HR-HPV is necessary for malignant conversion and maintenance in cervical tissue. In order to determine whether HR-HPV E6/E7 mRNA testing more effectively predicts precancerous lesions and invasive cervical cancer than HR-HPV DNA testing, we aimed to compare triage using HR-HPV E6/E7 mRNA testing by APTIMA HPV Assay (APTIMA to HPV16 DNA testing, HPV16/18 DNA testing, and repeat cytology. METHODS: Liquid-based (PreservCyt cell samples were obtained from HR-HPV-positive women diagnosed with atypical squamous cells of undetermined significance (ASCUS and low-grade squamous intraepithelial lesions (LSIL within the framework of the population-based cervical cancer screening program in Stockholm, Sweden. Samples were tested for HR-HPV E6/E7 mRNA by APTIMA (Gene-Probe Inc., San Diego, CA, USA. Women were followed up for 4 years after the index cytology via medical and laboratory records, and the Stockholm Oncology Center. RESULTS: Nine of 25 (36% women in the ASCUS group, and 64 of 180 (36% women in the LSIL group developed cervical intraepithelial neoplasia (CIN grade 2 or worse during 4 years of follow-up. 162 (74% women were APTIMA-positive, and APTIMA had the highest sensitivity to predict CIN2 or worse and CIN3 or worse in the ASCUS (77.8% and 100% and LSIL (78.1 and 75.8% groups, although specificity was insufficient (<50%. HPV16 DNA testing and repeat cytology were more specific than APTIMA. CONCLUSION: The results of this population-based study with comprehensive follow-up support the use of APTIMA as a triage test for women with ASCUS. More focused investigation is required for women with LSIL.

  14. Memory-based quantum repeater in quantum information communication

    Institute of Scientific and Technical Information of China (English)

    Wu Xiang-Sheng

    2004-01-01

    This paper studies the quantum repeater in quantum information communication. We propose to introduce the photon buffer mechanism for storing photons, which uses fibre delay loops as photon memories and a programmable 1 × N switcher for distributing photon delay time. Meanwhile, we also consider entanglement purification and entanglement swapping restoration at an entanglement purification or entanglement swapping failure and introduce a protection link mechanism that allows the photonic quantum repeater of a broken connection to initiate a connection restoration process.

  15. Repeatability and Reproducibility of Virtual Subjective Refraction.

    Science.gov (United States)

    Perches, Sara; Collados, M Victoria; Ares, Jorge

    2016-10-01

    To establish the repeatability and reproducibility of a virtual refraction process using simulated retinal images. With simulation software, aberrated images corresponding with each step of the refraction process were calculated following the typical protocol of conventional subjective refraction. Fifty external examiners judged simulated retinal images until the best sphero-cylindrical refraction and the best visual acuity were achieved starting from the aberrometry data of three patients. Data analyses were performed to assess repeatability and reproducibility of the virtual refraction as a function of pupil size and aberrometric profile of different patients. SD values achieved in three components of refraction (M, J0, and J45) are lower than 0.25D in repeatability analysis. Regarding reproducibility, we found SD values lower than 0.25D in the most cases. When the results of virtual refraction with different pupil diameters (4 and 6 mm) were compared, the mean of differences (MoD) obtained were not clinically significant (less than 0.25D). Only one of the aberrometry profiles with high uncorrected astigmatism shows poor results for the M component in reproducibility and pupil size dependence analysis. In all cases, vision achieved was better than 0 logMAR. A comparison between the compensation obtained with virtual and conventional subjective refraction was made as an example of this application, showing good quality retinal images in both processes. The present study shows that virtual refraction has similar levels of precision as conventional subjective refraction. Moreover, virtual refraction has also shown that when high low order astigmatism is present, the refraction result is less precise and highly dependent on pupil size.

  16. Repeated measurement sampling in genetic association analysis with genotyping errors.

    Science.gov (United States)

    Lai, Renzhen; Zhang, Hong; Yang, Yaning

    2007-02-01

    Genotype misclassification occurs frequently in human genetic association studies. When cases and controls are subject to the same misclassification model, Pearson's chi-square test has the correct type I error but may lose power. Most current methods adjusting for genotyping errors assume that the misclassification model is known a priori or can be assessed by a gold standard instrument. But in practical applications, the misclassification probabilities may not be completely known or the gold standard method can be too costly to be available. The repeated measurement design provides an alternative approach for identifying misclassification probabilities. With this design, a proportion of the subjects are measured repeatedly (five or more repeats) for the genotypes when the error model is completely unknown. We investigate the applications of the repeated measurement method in genetic association analysis. Cost-effectiveness study shows that if the phenotyping-to-genotyping cost ratio or the misclassification rates are relatively large, the repeat sampling can gain power over the regular case-control design. We also show that the power gain is not sensitive to the genetic model, genetic relative risk and the population high-risk allele frequency, all of which are typically important ingredients in association studies. An important implication of this result is that whatever the genetic factors are, the repeated measurement method can be applied if the genotyping errors must be accounted for or the phenotyping cost is high.

  17. Repeat-induced gene silencing in mammals.

    Science.gov (United States)

    Garrick, D; Fiering, S; Martin, D I; Whitelaw, E

    1998-01-01

    In both plants and Drosophila melanogaster, expression from a transgenic locus may be silenced when repeated transgene copies are arranged as a concatameric array. This repeat-induced gene silencing is frequently manifested as a decrease in the proportion of cells that express the transgene, resulting in a variegated pattern of expression. There is also some indication that, in transgenic mammals, the number of transgene copies within an array can exert a repressive influence on expression, with several mouse studies reporting a decrease in the level of expression per copy as copy number increases. However, because these studies compare different sites of transgene integration as well as arrays with different numbers of copies, the expression levels observed may be subject to varying position effects as well as the influence of the multicopy array. Here we describe use of the lox/Cre system of site-specific recombination to generate transgenic mouse lines in which different numbers of a transgene are present at the same chromosomal location, thereby eliminating the contribution of position effects and allowing analysis of the effect of copy number alone on transgene silencing. Reduction in copy number results in a marked increase in expression of the transgene and is accompanied by decreased chromatin compaction and decreased methylation at the transgene locus. These findings establish that the presence of multiple homologous copies of a transgene within a concatameric array can have a repressive effect upon gene expression in mammalian systems.

  18. Evaluation of the repeated-dose liver and gastrointestinal tract micronucleus assays with 22 chemicals using young adult rats: summary of the collaborative study by the Collaborative Study Group for the Micronucleus Test (CSGMT)/The Japanese Environmental Mutagen Society (JEMS) - Mammalian Mutagenicity Study Group (MMS).

    Science.gov (United States)

    Hamada, Shuichi; Ohyama, Wakako; Takashima, Rie; Shimada, Keisuke; Matsumoto, Kazumi; Kawakami, Satoru; Uno, Fuyumi; Sui, Hajime; Shimada, Yasushi; Imamura, Tadashi; Matsumura, Shoji; Sanada, Hisakazu; Inoue, Kenji; Muto, Shigeharu; Ogawa, Izumi; Hayashi, Aya; Takayanagi, Tomomi; Ogiwara, Yosuke; Maeda, Akihisa; Okada, Emiko; Terashima, Yukari; Takasawa, Hironao; Narumi, Kazunori; Wako, Yumi; Kawasako, Kazufumi; Sano, Masaki; Ohashi, Nobuyuki; Morita, Takeshi; Kojima, Hajime; Honma, Masamitsu; Hayashi, Makoto

    2015-03-01

    The repeated-dose liver micronucleus (RDLMN) assay using young adult rats has the potential to detect hepatocarcinogens. We conducted a collaborative study to assess the performance of this assay and to evaluate the possibility of integrating it into general toxicological studies. Twenty-four testing laboratories belonging to the Mammalian Mutagenicity Study Group, a subgroup of the Japanese Environmental Mutagen Society, participated in this trial. Twenty-two model chemicals, including some hepatocarcinogens, were tested in 14- and/or 28-day RDLMN assays. As a result, 14 out of the 16 hepatocarcinogens were positive, including 9 genotoxic hepatocarcinogens, which were reported negative in the bone marrow/peripheral blood micronucleus (MN) assay by a single treatment. These outcomes show the high sensitivity of the RDLMN assay to hepatocarcinogens. Regarding the specificity, 4 out of the 6 non-liver targeted genotoxic carcinogens gave negative responses. This shows the high organ specificity of the RDLMN assay. In addition to the RDLMN assay, we simultaneously conducted gastrointestinal tract MN assays using 6 of the above carcinogens as an optional trial of the collaborative study. The MN assay using the glandular stomach, which is the first contact site of the test chemical when administered by oral gavage, was able to detect chromosomal aberrations with 3 test chemicals including a stomach-targeted carcinogen. The treatment regime was the 14- and/or 28-day repeated-dose, and the regime is sufficiently promising to incorporate these methods into repeated-dose toxicological studies. The outcomes of our collaborative study indicated that the new techniques to detect chromosomal aberrations in vivo in several tissues worked successfully.

  19. Are major repeater patients addicted to suicidal behavior?

    Science.gov (United States)

    Blasco-Fontecilla, Hilario; Artieda-Urrutia, Paula; Berenguer-Elias, Nuria; Garcia-Vega, Juan Manuel; Fernandez-Rodriguez, Monica; Rodriguez-Lomas, Cesar; Gonzalez-Villalobos, Isabel; Iruela-Cuadrado, Luis; de Leon, José

    2014-01-01

    The literature provides support for the hypothesis that some major repeaters (individuals with >=5 lifetime suicide attempts) are addicted to suicidal behavior (SB). This study explores whether major repeaters are addicted to SB or not using 7 criteria: tolerance (Criterion 1), withdrawal (Criterion 2), loss of control (Criterion 3), problems in quitting/cutting down (Criterion 4), much time spent using (Criterion 5), substantial reduction in activities (Criterion 6), and adverse physiological/physical consequences (Criterion 7). Total dependence on SB was indicated by the presence of 3 or more of the 7 criteria in the last 12 months. This cross-sectional study at Puerta de Hierro University Hospital (Madrid, Spain) recruited 118 suicide attempters including 8 major repeaters (7%, 8/118), who were all females. The association between each SB addiction criterion, physiological dependence and total dependence with major repeater status was tested for significance and for effect size with odds ratios (ORs) and their 95% confidence intervals. As hypothesized, major repeaters met significantly higher frequency of criteria for total dependence on SB, OR=62.9 (6.4-615). A backward stepwise logistic regression model was used to provide an OR between major repeater status and total dependence status corrected by confounding variables. Age, panic disorder without agoraphobia, borderline personality disorder, history of psychiatric inpatient admission, and total dependence on SB were introduced as independent variables with major repeater status as the dependent variable. The model selected total dependence and age as the remaining significant variables in the last step. Accordingly, major repeaters appear to be addicted to SB.

  20. Reduced CAG repeats length in androgen receptor gene is associated with violent criminal behavior.

    Science.gov (United States)

    Rajender, Singh; Pandu, Guguluth; Sharma, J D; Gandhi, K P C; Singh, Lalji; Thangaraj, Kumarasamy

    2008-09-01

    Androgens mediate their functions through androgen receptors (AR). The two triplet repeats in the AR gene (CAG and GGN) are highly polymorphic among various populations and have been extensively studied in diverse clinical conditions and antisocial personality disorders. Several studies have reported either higher levels of testosterone among rapists or the correlation of shorter CAG repeats with criminal activities. However, to date, no study has analyzed AR gene in rapists worldwide, and no study has been conducted on criminals from Indian subcontinent. Therefore, we have analyzed the AR-CAG repeat length in 645 men, of which 241 were convicted for rape, 107 for murder, 26 for both murder and rape, and 271 were control males. The aim was to explore if there was any correlation between CAG repeat length and criminal behavior. The study revealed significantly shorter CAG repeats in the rapists (mean 18.44 repeats) and murderers (mean 17.59 repeats) compared to the control men (mean 21.19 repeats). The criminals who committed murder after rape had a far shorter mean repeat length (mean 17.31 repeats) in comparison to the controls or those convicted of rape or murder alone. In short, our study suggests that the reduced CAG repeats in the AR gene are associated with criminal behavior. This, along with other studies, would help in understanding the biological factors associated with the antisocial or criminal activities.

  1. The Pathogenic Role of Low Range Repeats in SCA17.

    Directory of Open Access Journals (Sweden)

    Jung Hwan Shin

    Full Text Available SCA17 is an autosomal dominant cerebellar ataxia with expansion of the CAG/CAA trinucleotide repeats in the TATA-binding protein (TBP gene. SCA17 can have various clinical presentations including parkinsonism, ataxia, chorea and dystonia. SCA17 is diagnosed by detecting the expanded CAG repeats in the TBP gene; however, in the literature, pathologic repeat numbers as low as 41 overlap with normal repeat numbers.The subjects in this study included patients with involuntary movement disorders such as cerebellar ataxia, parkinsonism, chorea and dystonia who visited Seoul National University Hospital between Jan. 2006 and Apr. 2014 and were screened for SCA17. Those who were diagnosed with other genetic diseases or nondegenerative diseases were excluded. DNA from healthy subjects who did not have a family history of parkinsonism, ataxia, psychiatric symptoms, chorea or dystonia served as the control. In total, 5242 chromosomes from 2099 patients and 522 normal controls were analyzed.The total number of patients included in the analysis was 2099 (parkinsonism, 1706; ataxia, 345; chorea, 37; and dystonia, 11. In the normal control, up to 44 repeats were found. In the 44 repeat group, there were 7 (0.3% patients and 1 (0.2% normal control. In 43 repeat group, there were 8 (0.4% patients and 2 (0.4% normal controls. In the 42 repeat group, there were 16 (0.8% patients and 3 (0.6% normal controls. In 41 repeat group, there were 48 (2.3% patients and 8 (1.5% normal controls. Considering the overlaps and non-significant differences in allelic frequencies between the patients and the normal controls with low-expansions, we could not determine a definitive cutoff value for the pathologic CAG repeat number of SCA17.Because the statistical analysis between the normal controls and patients with low range expansions failed to show any differences so far, we must consider that clinical cases with low range expansions could be idiopathic movement disorders showing

  2. Chromosome-specific DNA Repeat Probes

    Energy Technology Data Exchange (ETDEWEB)

    Baumgartner, Adolf; Weier, Jingly Fung; Weier, Heinz-Ulrich G.

    2006-03-16

    In research as well as in clinical applications, fluorescence in situ hybridization (FISH) has gained increasing popularity as a highly sensitive technique to study cytogenetic changes. Today, hundreds of commercially available DNA probes serve the basic needs of the biomedical research community. Widespread applications, however, are often limited by the lack of appropriately labeled, specific nucleic acid probes. We describe two approaches for an expeditious preparation of chromosome-specific DNAs and the subsequent probe labeling with reporter molecules of choice. The described techniques allow the preparation of highly specific DNA repeat probes suitable for enumeration of chromosomes in interphase cell nuclei or tissue sections. In addition, there is no need for chromosome enrichment by flow cytometry and sorting or molecular cloning. Our PCR-based method uses either bacterial artificial chromosomes or human genomic DNA as templates with {alpha}-satellite-specific primers. Here we demonstrate the production of fluorochrome-labeled DNA repeat probes specific for human chromosomes 17 and 18 in just a few days without the need for highly specialized equipment and without the limitation to only a few fluorochrome labels.

  3. The evolution of filamin – A protein domain repeat perspective

    Science.gov (United States)

    Light, Sara; Sagit, Rauan; Ithychanda, Sujay S.; Qin, Jun; Elofsson, Arne

    2013-01-01

    Particularly in higher eukaryotes, some protein domains are found in tandem repeats, performing broad functions often related to cellular organization. For instance, the eukaryotic protein filamin interacts with many proteins and is crucial for the cytoskeleton. The functional properties of long repeat domains are governed by the specific properties of each individual domain as well as by the repeat copy number. To provide better understanding of the evolutionary and functional history of repeating domains, we investigated the mode of evolution of the filamin domain in some detail. Among the domains that are common in long repeat proteins, sushi and spectrin domains evolve primarily through cassette tandem duplications while scavenger and immunoglobulin repeats appear to evolve through clustered tandem duplications. Additionally, immunoglobulin and filamin repeats exhibit a unique pattern where every other domain shows high sequence similarity. This pattern may be the result of tandem duplications, serve to avert aggregation between adjacent domains or it is the result of functional constraints. In filamin, our studies confirm the presence of interspersed integrin binding domains in vertebrates, while invertebrates exhibit more varied patterns, including more clustered integrin binding domains. The most notable case is leech filamin, which contains a 20 repeat expansion and exhibits unique dimerization topology. Clearly, invertebrate filamins are varied and contain examples of similar adjacent integrin-binding domains. Given that invertebrate integrin shows more similarity to the weaker filamin binder, integrin β3, it is possible that the distance between integrin-binding domains is not as crucial for invertebrate filamins as for vertebrates. PMID:22414427

  4. The evolution of filamin-a protein domain repeat perspective.

    Science.gov (United States)

    Light, Sara; Sagit, Rauan; Ithychanda, Sujay S; Qin, Jun; Elofsson, Arne

    2012-09-01

    Particularly in higher eukaryotes, some protein domains are found in tandem repeats, performing broad functions often related to cellular organization. For instance, the eukaryotic protein filamin interacts with many proteins and is crucial for the cytoskeleton. The functional properties of long repeat domains are governed by the specific properties of each individual domain as well as by the repeat copy number. To provide better understanding of the evolutionary and functional history of repeating domains, we investigated the mode of evolution of the filamin domain in some detail. Among the domains that are common in long repeat proteins, sushi and spectrin domains evolve primarily through cassette tandem duplications while scavenger and immunoglobulin repeats appear to evolve through clustered tandem duplications. Additionally, immunoglobulin and filamin repeats exhibit a unique pattern where every other domain shows high sequence similarity. This pattern may be the result of tandem duplications, serve to avert aggregation between adjacent domains or it is the result of functional constraints. In filamin, our studies confirm the presence of interspersed integrin binding domains in vertebrates, while invertebrates exhibit more varied patterns, including more clustered integrin binding domains. The most notable case is leech filamin, which contains a 20 repeat expansion and exhibits unique dimerization topology. Clearly, invertebrate filamins are varied and contain examples of similar adjacent integrin-binding domains. Given that invertebrate integrin shows more similarity to the weaker filamin binder, integrin β3, it is possible that the distance between integrin-binding domains is not as crucial for invertebrate filamins as for vertebrates. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Repeated nondiagnostic result of thyroid fine-needle aspiration biopsy.

    Science.gov (United States)

    Ziemiańska, Klaudia; Kopczyński, Janusz; Kowalska, Aldona

    2016-01-01

    Fine-needle aspiration biopsy (FNAB) is the most accurate and cost-effective method to evaluate the risk of malignancy of thyroid nodules, but approximately 1-24% of FNABs generate a nondiagnostic result (ND-FNAB). The aim of this study was to determine the predictive factors of a repeated nondiagnostic result of FNAB. A total of 4018 FNABs performed in a territorial referral centre were analysed, of which 288 (7.17%) were nondiagnostic. Medical records were available for 245 biopsies performed in 228 patients. The retrospective analysis of factors that may influence a repeat ND-FNAB, including demographic, clinical and ultrasound characteristics, was performed. A repeat FNAB was performed in 159 nodules giving a diagnostic result in 79.2% of cases. The time between the biopsies ranged from 1 to 611 days (mean 154.4, median 119). The timing of a repeat FNAB did not significantly alter the diagnostic output (p = 0.29). In the univariate analysis, significant predictors of a repeat ND-FNAB were older patient age (p = 0.02), L-thyroxine supplementation (p = 0.05), and a history of (131)I therapy (p < 0.0001). In the multivariate analysis, only a history of (131)I therapy was a statistically significant risk factor for a repeat ND-FNAB (p = 0.002). Patients with a history of (131)I therapy and ND-FNAB should undergo periodic ultrasonographic assessment rather than a repeat biopsy. The interval between repeated FNABs recommended by guidelines does not affect the diagnostic output.

  6. Antidepressant-like effect of tetrahydroisoquinoline amines in the animal model of depressive disorder induced by repeated administration of a low dose of reserpine: behavioral and neurochemical studies in the rat.

    Science.gov (United States)

    Antkiewicz-Michaluk, Lucyna; Wąsik, Agnieszka; Możdżeń, Edyta; Romańska, Irena; Michaluk, Jerzy

    2014-07-01

    Animal models are widely used to study antidepressant-like effect in rodents. However, it should be mentioned that pharmacological models do not always take into account the complexity of the disease process. In the present paper, we demonstrated that repeated but not acute treatment with a low dose of reserpine (0.2 mg/kg i.p.) led to a pharmacological model of depression which was based on its inhibitory effect on the vesicular monoamine transporter 2, and monoamines depleting action in the brain. In fact, we observed that chronic treatment with a low dose of reserpine induced a distinct depressive-like behavior in the forced swim test (FST), and additionally, it produced a significant decrease in the level of dopamine, noradrenaline, and serotonin in the brain structures. 1,2,3,4-Tetrahydroisoquinoline (TIQ) and its close methyl derivative, 1-methyl-1,2,3,4-tetrahydroisoquinoline (1MeTIQ) are exo/endogenous amines present naturally in the mammalian brain which demonstrated a significant antidepressant-like effect in the FST and the reserpine model of depression in the rat. Both compounds, TIQ and 1MeTIQ, administered chronically in a dose of 25 mg/kg (i.p.) together with reserpine completely antagonized reserpine-produced depression as assessed by the immobility time and swimming time. Biochemical data were in agreement with behavioral experiments and demonstrated that chronic treatment with a low dose of reserpine in contrast to acute administration produced a significant depression of monoamines in the brain structures and impaired their metabolism. These neurochemical effects obtained after repeated reserpine (0.2 mg/kg i.p.) in the brain structures were completely antagonized by joint TIQ or 1MeTIQ (25 mg/kg i.p.) administration with chronic reserpine. A possible molecular mechanism of action of TIQ and 1MeTIQ responsible for their antidepressant action is discussed. On the basis of the presented behavioral and biochemical studies, we suggest that both

  7. Species- and dose-specific pancreatic responses and progression in single- and repeat-dose studies with GI181771X: a novel cholecystokinin 1 receptor agonist in mice, rats, and monkeys.

    Science.gov (United States)

    Myer, James R; Romach, Elizabeth H; Elangbam, Chandikumar S

    2014-01-01

    Compound-induced pancreatic injury is a serious liability in preclinical toxicity studies. However, its relevance to humans should be cautiously evaluated because of interspecies variations. To highlight such variations, we evaluated the species- and dose-specific pancreatic responses and progression caused by GI181771X, a novel cholecystokinin 1 receptor agonist investigated by GlaxoSmithKline for the treatment of obesity. Acute (up to 2,000 mg/kg GI181771X, as single dose) and repeat-dose studies in mice and/or rats (0.25-250 mg/kg/day for 7 days to 26 weeks) showed wide-ranging morphological changes in the pancreas that were dose and duration dependent, including necrotizing pancreatitis, acinar cell hypertrophy/atrophy, zymogen degranulation, focal acinar cell hyperplasia, and interstitial inflammation. In contrast to rodents, pancreatic changes were not observed in cynomolgus monkeys given GI181771X (1-500 mg/kg/day with higher systemic exposure than rats) for up to 52 weeks. Similarly, no GI181771X treatment-associated abnormalities in pancreatic structure were noted in a 24-week clinical trial with obese patients (body mass index >30 or >27 kg/m(2)) as assessed by abdominal ultrasound or by magnetic resonance imaging. Mechanisms for interspecies variations in the pancreatic response to CCK among rodents, monkeys, and humans and their relevance to human risk are discussed.

  8. Repeat concussions in the national football league.

    Science.gov (United States)

    Casson, Ira R; Viano, David C; Powell, John W; Pellman, Elliot J

    2011-01-01

    Repeat concussion is an important issue in the National Football League (NFL). An initial description of repeat injuries was published for 6 years (1996-2001). The characteristics and frequency of repeat concussion in the NFL have not changed in the subsequent 6 years (2002-2007). Case control. From 1996 to 2007, concussions were reported using a standardized form documenting signs and symptoms, loss of consciousness and medical action taken. Data on repeat concussions were analyzed for the 12 years and compared between the 2 periods. In 2002-2007, 152 players had repeat concussions (vs 160 in 1996-2001); 44 had 3+ head injuries (vs 52). The positions most often associated with repeat concussion in 2002-2007 were the defensive secondary, kick unit, running back, and linebacker. The odds for repeat concussion were elevated for wide receivers, tight ends, and linebackers but lower than in the earlier period. During 2002-2007, over half of players with repeat concussion were removed from play, and fewer immediately returned (vs 1996-2001). The average duration between concussions was 1.25 years for 2002-2007 and 1.65 years for the 12-year period. Over 12 years, 7.6% of all repeat concussions occurred within 2 weeks of the prior concussion. The defensive secondary, kick unit, running back, and linebacker have the highest incidence of repeat concussion. During 2002-2007, more than half of players with repeat concussion were removed from play, and only a fraction immediately returned. Although concussion was managed more conservatively by team physicians in the recent 6 years, repeat concussions occurred at similar rates during both periods.

  9. Short Tandem Repeat DNA Internet Database

    Science.gov (United States)

    SRD 130 Short Tandem Repeat DNA Internet Database (Web, free access)   Short Tandem Repeat DNA Internet Database is intended to benefit research and application of short tandem repeat DNA markers for human identity testing. Facts and sequence information on each STR system, population data, commonly used multiplex STR systems, PCR primers and conditions, and a review of various technologies for analysis of STR alleles have been included.

  10. Filamin repeat segments required for photosensory signalling in Dictyostelium discoideum

    Directory of Open Access Journals (Sweden)

    Ahmed Afsar U

    2007-11-01

    Full Text Available Abstract Background Filamin is an actin binding protein which is ubiquitous in eukaryotes and its basic structure is well conserved – an N-terminal actin binding domain followed by a series of repeated segments which vary in number in different organisms. D. discoideum is a well established model organism for the study of signalling pathways and the actin cytoskeleton and as such makes an excellent organism in which to study filamin. Ddfilamin plays a putative role as a scaffolding protein in a photosensory signalling pathway and this role is thought to be mediated by the unusual repeat segments in the rod domain. Results To study the role of filamin in phototaxis, a filamin null mutant, HG1264, was transformed with constructs each of which expressed wild type filamin or a mutant filamin with a deletion of one of the repeat segments. Transformants expressing the full length filamin to wild type levels completely rescued the phototaxis defect in HG1264, however if filamin was expressed at lower than wild type levels the phototaxis defect was not restored. The transformants lacking any one of the repeat segments 2–6 retained defective phototaxis and thermotaxis phenotypes, whereas transformants expressing filaminΔ1 exhibited a range of partial complementation of the phototaxis phenotype which was related to expression levels. Immunofluorescence microscopy showed that filamin lacking any of the repeat segments still localised to the same actin rich areas as wild type filamin. Ddfilamin interacts with RasD and IP experiments demonstrated that this interaction did not rely upon any single repeat segment or the actin binding domain. Conclusion This paper demonstrates that wild type levels of filamin expression are essential for the formation of functional photosensory signalling complexes and that each of the repeat segments 2–6 are essential for filamins role in phototaxis. By contrast, repeat segment 1 is not essential provided the mutated

  11. Studies on Effects of High-intensity and Repeated Superovulation in Wagyu-catalo%和牛杂交牛高强度重复超排效果的研究

    Institute of Scientific and Technical Information of China (English)

    韩伟; 余文莉; 李树静

    2012-01-01

    为研究和牛杂交牛短期内重复超排效果,自2011年6月至2011年8月对100头和牛杂交牛连续进行了3次重复超排.结果发现,3次超排获得回收胚平均数分别为11.65±8.96、13.28±7.69、13.2±8.39枚;可用胚平均数分别为7.52±7.16、8.51±6.94和8.92±6.59枚.试验结果表明,对和牛杂交牛进行间隔为33 d的连续3次超排,能够获得较好的超排效果,且个体差异是影响超排效果的主要因素;育成牛超排有效率稍高于经产牛(P>0.05),但可用胚平均数显著低于经产牛(P<0.05).%To study the repeated superovulation effect in brief period in wagyu-catalo,100 head of wagyu-catalo were super-ovulated continuously for three times from Jun in 2011 to Aug in 2011. The three times superovulation obtained the mean of embryo recovered were 11. 65±8. 96,13. 28±7. 69 and 13. 24±8. 39,respectively;the mean of usable embryos were 7. 52± 7. 16,8. 51±6. 94 and 8. 92±6. 59,respectively. The experimental results indicated that a good result could be obtained by proceeding consecutively three times repeated superovulation in 33 d interval in wagyu-catalo. There were obvious individual differences in the effect of superovulation. The superovulation efficiency of primiparous was a little better than multipara cow (P>0. 05) ,but the number of available embryos of multiparous was better than primiparous cow notablely(P<0. 05),

  12. Positive affective interactions: The role of repeated exposure and copresence

    NARCIS (Netherlands)

    Shahid, S.; Krahmer, E.; Neerincx, M.; Swerts, M.

    2013-01-01

    We describe and evaluate a new interface to induce positive emotions in users: a digital, interactive adaptive mirror. We study whether the induced affect is repeatable after a fixed interval (Study 1) and how copresence influences the emotion induction (Study 2). Results show that participants syst

  13. Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

    Science.gov (United States)

    Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

    2012-01-01

    Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr.

  14. Study on Sex Determination of Bovine Pre-implantation Embryos By Bovine Y Chromosome Repeated Sequence%利用牛Y染色体重复序列进行早期胚胎性别鉴定的研究

    Institute of Scientific and Technical Information of China (English)

    王世银; 张伟; 张兆旺; 赵兴绪

    2011-01-01

    本试验利用Y染色体重复序列作为雄性特异性引物,以肿瘤坏死因子(TNF-α) 内标引物建立多重PCR体系,进行牛早期胚胎性别鉴定.共设计四对引物一Y染色体重复序列外引物和内引物,其大小分别为534bp和480bp;肿瘤坏死因子外引物和内引物大小分别为357bp和272bp.试验结果表明,优化后的多重PCR体系的灵敏度分别达到3个胚胎细胞,准确率100%,可以满足早期胚胎性别鉴定的需要.%In this study, we designed four pairs of primers which the amplifiment products length were 534bp, 480bp, 357bp and 272bp respectively according to Y chromosome repeated sequence and tumor necrosis factor alpha(TNF-α) for sex determination of bovine embryo.The result shows that these four pairs of primers all have highly specificity and stability.The Multi-PCR need only 3 cells DNA to determine the sex of embryo, so it is more suitable for sex determination of bovine embryo.

  15. Long-Term Real-Life Efficacy and Safety of Repeated Ozurdex® Injections and Factors Associated with Macular Edema Resolution after Retinal Vein Occlusion: The REMIDO 2 Study.

    Science.gov (United States)

    Pommier, Stéphan; Meyer, Franck; Guigou, Sébastien; Barthelemy, Tony; Gobert, Fréderic; Hajjar, Christian; Merite, Pierre-Yves; Parrat, Eric; Rouhette, Hervé; Matonti, Fréderic

    2016-01-01

    The objective was to study long-term real-life efficacy and safety of repeated Ozurdex® injections and factors associated with macular edema (ME) resolution after retinal vein occlusion. Patients with ME after retinal vein occlusion, receiving Ozurdex®, were included to assess the following endpoints: visual acuity and central retinal thickness, retreatment, number of injections, side effects and ME resolution. ME resolution was defined as permanent discontinuation of intravitreal injections (IVTs) for at least 6 months after the last IVT. A total of 94 eyes were included with an average of 2.6 IVTs (max 6 IVTs). 58.6% of patients gained ≥15 letters and 51.1% of patients showed ME resolution. Among the resolved patients, 64.6% were treatment-naïve, 60.4% had branch retinal vein occlusion, and 78.1% gained ≥15 letters. Ozurdex® seemed to be a valuable treatment which may allow to achieve long-term anatomical and functional improvements and ME resolution with a minimum number of IVTs. © 2016 S. Karger AG, Basel.

  16. Statistical Properties of repeating FRB 121102

    CERN Document Server

    Wang, F Y

    2016-01-01

    Fast radio bursts (FRBs) are millisecond-duration radio signals possibly occurring at cosmological distances. However the physical model of FRBs is mystery, many models have been proposed. Here we study the frequency distributions of peak flux, fluence, duration and waiting time for repeating FRB 121102. The cumulative distributions of peak flux, fluence and duration show power-law forms. The waiting time distribution also shows power-law distribution, and is consistent with a non-stationary Poisson process. We also use the statistical results to test the proposed models for FRBs. Comparing with the model predications, we find that the theoretical models proposed by Dai et al. (2016) and Katz (2016) are favored. These distributions are consistent with the predications from avalanche models of driven systems.

  17. On the life time prediction of repeatedly impacted thermoplastic matrix composites

    Energy Technology Data Exchange (ETDEWEB)

    Bora, Mustafa Ozguer [Kocaeli University, Mechanical Engineering Department, Veziroglu Campus, 41040 Izmit (Turkey)], E-mail: ozgur_bora@yahoo.com; Coban, Onur [Kocaeli University, Mechanical Engineering Department, Veziroglu Campus, 41040 Izmit (Turkey); Sinmazcelik, Tamer [Kocaeli University, Mechanical Engineering Department, Veziroglu Campus, 41040 Izmit (Turkey); TUBITAK-MAM, Materials Institute, P.O. Box 21, 41470 Gebze (Turkey); Cuerguel, Ismail [Kocaeli University, Mechanical Engineering Department, Veziroglu Campus, 41040 Izmit (Turkey); Guenay, Volkan [TUBITAK-MAM, Materials Institute, P.O. Box 21, 41470 Gebze (Turkey)

    2009-01-15

    Impact-fatigue properties of unidirectional carbon fibre reinforced polyetherimide (PEI) composites were investigated. Low velocity repeated impacts were performed by using pendulum type instrumented impact tester (Ceast, Resil 25) at energy levels ranging 0.54-0.94 J. Samples were prepared according to ISO 180 and subjected to repeated low velocity impacts up to fracture by the hammer. Results of repeated impact study are reported in terms of peak load (F{sub max}), absorbed energy (E{sub max}) and number of repeated impacts. An analytical model to describe the life time of composite materials subjected to repeated impact loadings was presented.

  18. Hypoxic Repeat Sprint Training Improves Rugby Player's Repeated Sprint but Not Endurance Performance.

    Science.gov (United States)

    Hamlin, Michael J; Olsen, Peter D; Marshall, Helen C; Lizamore, Catherine A; Elliot, Catherine A

    2017-01-01

    This study aims to investigate the performance changes in 19 well-trained male rugby players after repeat-sprint training (six sessions of four sets of 5 × 5 s sprints with 25 s and 5 min of active recovery between reps and sets, respectively) in either normobaric hypoxia (HYP; n = 9; FIO2 = 14.5%) or normobaric normoxia (NORM; n = 10; FIO2 = 20.9%). Three weeks after the intervention, 2 additional repeat-sprint training sessions in hypoxia (FIO2 = 14.5%) was investigated in both groups to gauge the efficacy of using "top-up" sessions for previously hypoxic-trained subjects and whether a small hypoxic dose would be beneficial for the previously normoxic-trained group. Repeated sprint (8 × 20 m) and Yo-Yo Intermittent Recovery Level 1 (YYIR1) performances were tested twice at baseline (Pre 1 and Pre 2) and weekly after (Post 1-3) the initial intervention (intervention 1) and again weekly after the second "top-up" intervention (Post 4-5). After each training set, heart rate, oxygen saturation, and rate of perceived exertion were recorded. Compared to baseline (mean of Pre 1 and Pre 2), both the hypoxic and normoxic groups similarly lowered fatigue over the 8 sprints 1 week after the intervention (Post 1: -1.8 ± 1.6%, -1.5 ± 1.4%, mean change ± 90% CI in HYP and NORM groups, respectively). However, from Post 2 onwards, only the hypoxic group maintained the performance improvement compared to baseline (Post 2: -2.1 ± 1.8%, Post 3: -2.3 ± 1.7%, Post 4: -1.9 ± 1.8%, and Post 5: -1.2 ± 1.7%). Compared to the normoxic group, the hypoxic group was likely to have substantially less fatigue at Post 3-5 (-2.0 ± 2.4%, -2.2 ± 2.4%, -1.6 ± 2.4% Post 3, Post 4, Post 5, respectively). YYIR1 performances improved throughout the recovery period in both groups (13-37% compared to baseline) with unclear differences found between groups. The addition of two sessions of "top-up" training after intervention 1, had little effect on either group. Repeat-sprint training in

  19. Hypoxic Repeat Sprint Training Improves Rugby Player's Repeated Sprint but Not Endurance Performance

    Science.gov (United States)

    Hamlin, Michael J.; Olsen, Peter D.; Marshall, Helen C.; Lizamore, Catherine A.; Elliot, Catherine A.

    2017-01-01

    This study aims to investigate the performance changes in 19 well-trained male rugby players after repeat-sprint training (six sessions of four sets of 5 × 5 s sprints with 25 s and 5 min of active recovery between reps and sets, respectively) in either normobaric hypoxia (HYP; n = 9; FIO2 = 14.5%) or normobaric normoxia (NORM; n = 10; FIO2 = 20.9%). Three weeks after the intervention, 2 additional repeat-sprint training sessions in hypoxia (FIO2 = 14.5%) was investigated in both groups to gauge the efficacy of using “top-up” sessions for previously hypoxic-trained subjects and whether a small hypoxic dose would be beneficial for the previously normoxic-trained group. Repeated sprint (8 × 20 m) and Yo-Yo Intermittent Recovery Level 1 (YYIR1) performances were tested twice at baseline (Pre 1 and Pre 2) and weekly after (Post 1–3) the initial intervention (intervention 1) and again weekly after the second “top-up” intervention (Post 4–5). After each training set, heart rate, oxygen saturation, and rate of perceived exertion were recorded. Compared to baseline (mean of Pre 1 and Pre 2), both the hypoxic and normoxic groups similarly lowered fatigue over the 8 sprints 1 week after the intervention (Post 1: −1.8 ± 1.6%, −1.5 ± 1.4%, mean change ± 90% CI in HYP and NORM groups, respectively). However, from Post 2 onwards, only the hypoxic group maintained the performance improvement compared to baseline (Post 2: −2.1 ± 1.8%, Post 3: −2.3 ± 1.7%, Post 4: −1.9 ± 1.8%, and Post 5: −1.2 ± 1.7%). Compared to the normoxic group, the hypoxic group was likely to have substantially less fatigue at Post 3–5 (−2.0 ± 2.4%, −2.2 ± 2.4%, −1.6 ± 2.4% Post 3, Post 4, Post 5, respectively). YYIR1 performances improved throughout the recovery period in both groups (13–37% compared to baseline) with unclear differences found between groups. The addition of two sessions of “top-up” training after intervention 1, had little effect on either

  20. Repeatability & Workability Evaluation of SIGMOD 2009

    KAUST Repository

    Manegold, Stefan

    2010-12-15

    SIGMOD 2008 was the first database conference that offered to test submitters\\' programs against their data to verify the repeatability of the experiments published [1]. Given the positive feedback concerning the SIGMOD 2008 repeatability initiative, SIGMOD 2009 modified and expanded the initiative with a workability assessment.

  1. Efficacy and safety of guaifenesin for upper back, neck, and shoulder pain: a Phase II proof-of-concept, multicenter, placebo-controlled, repeat-dose, parallel-group study.

    Science.gov (United States)

    Collaku, Agron; Yue, Yong; Reed, Kenneth

    2017-01-01

    Guaifenesin, an over-the-counter (OTC) expectorant, has exhibited muscle relaxant effects preclinically and clinically. This proof-of-principle study explored whether OTC doses of guaifenesin can provide relief from acute upper back, neck, or shoulder muscle spasm and pain. This multicenter, placebo-controlled, repeat-dose, parallel study randomly assigned adults experiencing acute pain and muscle spasm in their upper back, neck, or shoulder to guaifenesin 600 or 1200 mg or matched placebo twice daily (BID) in a 2:2:1:1 ratio for 7 days. The primary end point was the change from baseline in muscle spasm relief, measured using an 11-point numeric rating scale (0=not present to 10=unbearable) recorded twice daily and averaged over the 7-day treatment period. Analyses were performed using a linear mixed model that included treatment as a fixed effect and site as a random effect. A total of 77 subjects were included in the 4 treatment groups. Least squares mean muscle spasm score over 7 days was 1.77 with guaifenesin 1200 mg, 1.42 with its matched placebo, 1.53 with guaifenesin 600 mg, and 1.74 with its matched placebo. Treatment with guaifenesin 1200 mg BID provided 25% greater reduction in mean muscle spasm over its matched placebo and 16% greater reduction than guaifenesin 600 mg BID. These differences were not statistically significant. Based on comparisons of absolute mean values, a consistent directional change in effect was observed, suggesting some benefit from placebo to lower-to-upper doses of guaifenesin with regard to muscle spasm, tension, pain, discomfort, and relaxation. No severe or serious adverse events were reported. Results suggest the potential for OTC dose of guaifenesin 1200 mg BID to provide symptomatic relief of upper back musculoskeletal pain and spasm. Confirmation of this preliminary result in a larger, adequately powered study is needed.

  2. Efficacy and safety of guaifenesin for upper back, neck, and shoulder pain: a Phase II proof-of-concept, multicenter, placebo-controlled, repeat-dose, parallel-group study

    Science.gov (United States)

    Collaku, Agron; Yue, Yong; Reed, Kenneth

    2017-01-01

    Background/objective Guaifenesin, an over-the-counter (OTC) expectorant, has exhibited muscle relaxant effects preclinically and clinically. This proof-of-principle study explored whether OTC doses of guaifenesin can provide relief from acute upper back, neck, or shoulder muscle spasm and pain. Methods This multicenter, placebo-controlled, repeat-dose, parallel study randomly assigned adults experiencing acute pain and muscle spasm in their upper back, neck, or shoulder to guaifenesin 600 or 1200 mg or matched placebo twice daily (BID) in a 2:2:1:1 ratio for 7 days. The primary end point was the change from baseline in muscle spasm relief, measured using an 11-point numeric rating scale (0=not present to 10=unbearable) recorded twice daily and averaged over the 7-day treatment period. Analyses were performed using a linear mixed model that included treatment as a fixed effect and site as a random effect. Results A total of 77 subjects were included in the 4 treatment groups. Least squares mean muscle spasm score over 7 days was 1.77 with guaifenesin 1200 mg, 1.42 with its matched placebo, 1.53 with guaifenesin 600 mg, and 1.74 with its matched placebo. Treatment with guaifenesin 1200 mg BID provided 25% greater reduction in mean muscle spasm over its matched placebo and 16% greater reduction than guaifenesin 600 mg BID. These differences were not statistically significant. Based on comparisons of absolute mean values, a consistent directional change in effect was observed, suggesting some benefit from placebo to lower-to-upper doses of guaifenesin with regard to muscle spasm, tension, pain, discomfort, and relaxation. No severe or serious adverse events were reported. Conclusion Results suggest the potential for OTC dose of guaifenesin 1200 mg BID to provide symptomatic relief of upper back musculoskeletal pain and spasm. Confirmation of this preliminary result in a larger, adequately powered study is needed. PMID:28356767

  3. A phase I study of combined docetaxel and repeated high activity {sup 186}Re-HEDP in castration-resistant prostate cancer (CRPC) metastatic to bone (the TAXIUM trial)

    Energy Technology Data Exchange (ETDEWEB)

    Dodewaard-de Jong, Joyce M. van; Bloemendal, Haiko J. [Meander Medical Centre, Department of Internal Medicine, Amersfoort (Netherlands); Klerk, John M.H. de; Haas, Marie J. de [Meander Medical Centre, Department of Nuclear Medicine, Amersfoort (Netherlands); Bezooijen, Bart P.J. van [Meander Medical Centre, Department of Urology, Amersfoort (Netherlands); Wilson, Richard H.; O' Sullivan, Joe M. [Queen' s University Belfast, Centre for Cancer Research and Cell Biology, Belfast, N. Ireland (United Kingdom)

    2011-11-15

    Bone-seeking radiopharmaceuticals have palliative benefit in castration-resistant prostate cancer (CRPC) metastatic to bone. Recent studies have shown improvement of survival and quality of life when radiopharmaceuticals were given repeatedly or in combination with chemotherapy. We designed a phase I study combining docetaxel and {sup 186}Re-labelled hydroxyethylidene diphosphonate (HEDP) in men with CRPC and bone metastases to evaluate toxicity. A dose escalation schedule was designed consisting of four dose levels with a standard dosage of docetaxel (75 mg/m{sup 2} 3-weekly). {sup 186}Re-HEDP was given in increasing activities (1,250 MBq up to 2,500 MBq) after the third and sixth cycle of docetaxel. Dose limiting toxicity (DLT) was defined as any grade 4 toxicity lasting more than 7 days or any grade 3 toxicity that did not recover within 10 days. Three patients were planned for each dose level expanding to six if a DLT occurred. Fourteen patients were recruited with a median age of 64.6 years. One DLT, grade 3 thrombocytopenia lasting >10 days, occurred at dose level 3 leading to expansion of this group to six. One of these patients had an episode of acute renal failure which resolved. Because of production problems of {sup 186}Re-HEDP dose level 4 was not started. Combined therapy with docetaxel and {sup 186}Re-HEDP is generally well tolerated in patients with CRPC metastatic to bone. We will conduct a randomized phase II study using three cycles of docetaxel 75 mg/m{sup 2} 3-weekly followed by {sup 188}Re-HEDP 40 MBq/kg body weight, followed by another three cycles of docetaxel 75 mg/m{sup 2}, followed by {sup 188}Re-HEDP 20 MBq/kg body weight. (orig.)

  4. Reward modulation of contextual cueing: Repeated context overshadows repeated target location.

    Science.gov (United States)

    Sharifian, Fariba; Contier, Oliver; Preuschhof, Claudia; Pollmann, Stefan

    2017-08-07

    Contextual cueing can be enhanced by reward. However, there is a debate if reward is associated with the repeated target-distractor configurations or with the repeated target locations that occur in both repeated and new displays. Based on neuroimaging evidence, we hypothesized that reward becomes associated with the target location only in new displays, but not in repeated displays, where the repeated target location is overshadowed by the more salient repeated target-distractor configuration. To test this hypothesis, we varied the reward value associated with the same target location in repeated and new displays. The results confirmed the overshadowing hypothesis in that search facilitation in repeated target-distractor configurations was modulated by the variable value associated with the target location. This effect was observed mainly in early learning.

  5. UK 2009-2010 repeat station report

    Directory of Open Access Journals (Sweden)

    Thomas J.G. Shanahan

    2013-03-01

    Full Text Available The British Geological Survey is responsible for conducting the UK geomagnetic repeat station programme. Measurements made at the UK repeat station sites are used in conjunction with the three UK magnetic observatories: Hartland, Eskdalemuir and Lerwick, to produce a regional model of the local field each year. The UK network of repeat stations comprises 41 stations which are occupied at approximately 3-4 year intervals. Practices for conducting repeat station measurements continue to evolve as advances are made in survey instrumentation and as the usage of the data continues to change. Here, a summary of the 2009 and 2010 UK repeat station surveys is presented, highlighting the measurement process and techniques, density of network, reduction process and recent results.

  6. Age, CAG repeat length, and clinical progression in Huntington's disease.

    Science.gov (United States)

    Rosenblatt, Adam; Kumar, Brahma V; Mo, Alisa; Welsh, Claire S; Margolis, Russell L; Ross, Christopher A

    2012-02-01

    The objective of this study was to further explore the effect of CAG repeat length on the rate of clinical progression in patients with Huntington's disease. The dataset included records for 569 subjects followed prospectively at the Baltimore Huntington's Disease Center. Participants were seen for a mean of 7.1 visits, with a mean follow-up of 8.2 years. Subjects were evaluated using the Quantified Neurologic Examination and its Motor Impairment subscale, the Mini-Mental State Examination, and the Huntington's disease Activities of Daily Living Scale. By itself, CAG repeat length showed a statistically significant but small effect on the progression of all clinical measures. Contrary to our previous expectations, controlling for age of onset increased the correlation between CAG repeat length and progression of all variables by 69% to 159%. Graphical models further supported the idea that individuals with smaller triplet expansions experience a more gradual decline. CAG repeat length becomes an important determinant of clinical prognosis when accounting for age of onset. This suggests that the aging process itself influences clinical outcomes in Huntington's disease. Inconsistent results in prior studies examining CAG repeat length and progression may indeed reflect a lack of age adjustment.

  7. Repeated high-intensity exercise in professional rugby union.

    Science.gov (United States)

    Austin, Damien; Gabbett, Tim; Jenkins, David

    2011-07-01

    The aim of the present study was to describe the frequency, duration, and nature of repeated high-intensity exercise in Super 14 rugby union. Time-motion analysis was used during seven competition matches over the 2008 and 2009 Super 14 seasons; five players from each of four positional groups (front row forwards, back row forwards, inside backs, and outside backs) were assessed (20 players in total). A repeated high-intensity exercise bout was considered to involve three or more sprints, and/or tackles and/or scrum/ruck/maul activities within 21 s during the same passage of play. The range of repeated high-intensity exercise bouts for each group in a match was as follows: 11-18 for front row forwards, 11-21 for back row forwards, 13-18 for inside backs, and 2-11 for outside backs. The durations of the most intense repeated high-intensity exercise bouts for each position ranged from 53 s to 165 s and the minimum recovery periods between repeated high-intensity exercise bouts ranged from 25 s for the back row forwards to 64 s for the front row forwards. The present results show that repeated high-intensity exercise bouts vary in duration and activities relative to position but all players in a game will average at least 10 changes in activity in the most demanding bouts and complete at least one tackle and two sprints. The most intense periods of activity are likely to last as long as 120 s and as little as 25 s recovery may separate consecutive repeated high-intensity exercise bouts. The present findings can be used by coaches to prepare their players for the most demanding passages of play likely to be experienced in elite rugby union.

  8. Exact Tandem Repeats Analyzer (E-TRA): A new program for DNA sequence mining

    Indian Academy of Sciences (India)

    Mehmet Karaca; Mehmet Bilgen; A. Naci Onus; Ayse Gul Ince; Safinaz Y. Elmasulu

    2005-04-01

    Exact Tandem Repeats Analyzer 1.0 (E-TRA) combines sequence motif searches with keywords such as ‘organs’, ‘tissues’, ‘cell lines’ and ‘development stages’ for finding simple exact tandem repeats as well as non-simple repeats. E-TRA has several advanced repeat search parameters/options compared to other repeat finder programs as it not only accepts GenBank, FASTA and expressed sequence tags (EST) sequence files, but also does analysis of multiple files with multiple sequences. The minimum and maximum tandem repeat motif lengths that E-TRA finds vary from one to one thousand. Advanced user defined parameters/options let the researchers use different minimum motif repeats search criteria for varying motif lengths simultaneously. One of the most interesting features of genomes is the presence of relatively short tandem repeats (TRs). These repeated DNA sequences are found in both prokaryotes and eukaryotes, distributed almost at random throughout the genome. Some of the tandem repeats play important roles in the regulation of gene expression whereas others do not have any known biological function as yet. Nevertheless, they have proven to be very beneficial in DNA profiling and genetic linkage analysis studies. To demonstrate the use of E-TRA, we used 5,465,605 human EST sequences derived from 18,814,550 GenBank EST sequences. Our results indicated that 12.44% (679,800) of the human EST sequences contained simple and non-simple repeat string patterns varying from one to 126 nucleotides in length. The results also revealed that human organs, tissues, cell lines and different developmental stages differed in number of repeats as well as repeat composition, indicating that the distribution of expressed tandem repeats among tissues or organs are not random, thus differing from the un-transcribed repeats found in genomes.

  9. Repeated Reading Intervention Effects in Kindergartners with Partial Letter Knowledge

    Science.gov (United States)

    van Gorp, Karly; Segers, Eliane; Verhoeven, Ludo

    2014-01-01

    The direct, transfer and retention effects of a repeated reading intervention study of single CVC (consonant in the onset and a vowel and consonant in the rime) words in kindergartners with partial letter knowledge were examined. A total of 26 second-year kindergartners participated in this study. Participants were divided over two feedback…

  10. Modeling and evaluating repeatability and reproducibility of ordinal classifications

    NARCIS (Netherlands)

    J. de Mast; W.N. van Wieringen

    2010-01-01

    This paper argues that currently available methods for the assessment of the repeatability and reproducibility of ordinal classifications are not satisfactory. The paper aims to study whether we can modify a class of models from Item Response Theory, well established for the study of the reliability

  11. Coevolution between simple sequence repeats (SSRs and virus genome size

    Directory of Open Access Journals (Sweden)

    Zhao Xiangyan

    2012-08-01

    Full Text Available Abstract Background Relationship between the level of repetitiveness in genomic sequence and genome size has been investigated by making use of complete prokaryotic and eukaryotic genomes, but relevant studies have been rarely made in virus genomes. Results In this study, a total of 257 viruses were examined, which cover 90% of genera. The results showed that simple sequence repeats (SSRs is strongly, positively and significantly correlated with genome size. Certain repeat class is distributed in a certain range of genome sequence length. Mono-, di- and tri- repeats are widely distributed in all virus genomes, tetra- SSRs as a common component consist in genomes which more than 100 kb in size; in the range of genome  Conclusions We conducted this research standing on the height of the whole virus. We concluded that genome size is an important factor in affecting the occurrence of SSRs; hosts are also responsible for the variances of SSRs content to a certain degree.

  12. Assessing agreement with repeated measures for random observers.

    Science.gov (United States)

    Chen, Chia-Cheng; Barnhart, Huiman X

    2011-12-30

    Agreement studies are often concerned with assessing whether different observers for measuring responses on the same subject or sample can produce similar results. The concordance correlation coefficient (CCC) is a popular index for assessing the closeness among observers for quantitative measurements. Usually, the CCC is used for data without and with replications based on subject and observer effects only. However, we cannot use this methodology if repeated measurements rather than replications are collected. Although there exist some CCC-type indices for assessing agreement with repeated measurements, there is no CCC for random observers and random time points. In this paper, we propose a new CCC for repeated measures where both observers and time points are treated as random effects. A simulation study demonstrates our proposed methodology, and we use vertebral body data and image data for illustrations.

  13. A family of DNA repeats in Aspergillus nidulans has assimilated degenerated retrotransposons

    DEFF Research Database (Denmark)

    Nielsen, M.L.; Hermansen, T.D.; Aleksenko, Alexei Y.

    2001-01-01

    In the course of a chromosomal walk towards the centromere of chromosome IV of Aspergillus nidulans, several cross- hybridizing genomic cosmid clones were isolated. Restriction mapping of two such clones revealed that their restriction patterns were similar in a region of at least 15 kb, indicati......) phenomenon, first described in Neurospora crassa, may have operated in A. nidulans. The data indicate that this family of repeats has assimilated mobile elements that subsequently degenerated but then underwent further duplications as a part of the host repeats....... the presence of a large repeat. The nature of the repeat was further investigated by sequencing and Southern analysis. The study revealed a family of long dispersed repeats with a high degree of sequence similarity. The number and location of the repeats vary between wild isolates. Two copies of the repeat...

  14. Intra-genomic variation in the ribosomal repeats of nematodes.

    Directory of Open Access Journals (Sweden)

    Holly M Bik

    Full Text Available Ribosomal loci represent a major tool for investigating environmental diversity and community structure via high-throughput marker gene studies of eukaryotes (e.g. 18S rRNA. Since the estimation of species' abundance is a major goal of environmental studies (by counting numbers of sequences, understanding the patterns of rRNA copy number across species will be critical for informing such high-throughput approaches. Such knowledge is critical, given that ribosomal RNA genes exist within multi-copy repeated arrays in a genome. Here we measured the repeat copy number for six nematode species by mapping the sequences from whole genome shotgun libraries against reference sequences for their rRNA repeat. This revealed a 6-fold variation in repeat copy number amongst taxa investigated, with levels of intragenomic variation ranging from 56 to 323 copies of the rRNA array. By applying the same approach to four C. elegans mutation accumulation lines propagated by repeated bottlenecking for an average of ~400 generations, we find on average a 2-fold increase in repeat copy number (rate of increase in rRNA estimated at 0.0285-0.3414 copies per generation, suggesting that rRNA repeat copy number is subject to selection. Within each Caenorhabditis species, the majority of intragenomic variation found across the rRNA repeat was observed within gene regions (18S, 28S, 5.8S, suggesting that such intragenomic variation is not a product of selection for rRNA coding function. We find that the dramatic variation in repeat copy number among these six nematode genomes would limit the use of rRNA in estimates of organismal abundance. In addition, the unique pattern of variation within a single genome was uncorrelated with patterns of divergence between species, reflecting a strong signature of natural selection for rRNA function. A better understanding of the factors that control or affect copy number in these arrays, as well as their rates and patterns of evolution

  15. Implementation of bipartite or remote unitary gates with repeater nodes

    Science.gov (United States)

    Yu, Li; Nemoto, Kae

    2016-08-01

    We propose some protocols to implement various classes of bipartite unitary operations on two remote parties with the help of repeater nodes in-between. We also present a protocol to implement a single-qubit unitary with parameters determined by a remote party with the help of up to three repeater nodes. It is assumed that the neighboring nodes are connected by noisy photonic channels, and the local gates can be performed quite accurately, while the decoherence of memories is significant. A unitary is often a part of a larger computation or communication task in a quantum network, and to reduce the amount of decoherence in other systems of the network, we focus on the goal of saving the total time for implementing a unitary including the time for entanglement preparation. We review some previously studied protocols that implement bipartite unitaries using local operations and classical communication and prior shared entanglement, and apply them to the situation with repeater nodes without prior entanglement. We find that the protocols using piecewise entanglement between neighboring nodes often require less total time compared to preparing entanglement between the two end nodes first and then performing the previously known protocols. For a generic bipartite unitary, as the number of repeater nodes increases, the total time could approach the time cost for direct signal transfer from one end node to the other. We also prove some lower bounds of the total time when there are a small number of repeater nodes. The application to position-based cryptography is discussed.

  16. Triage of HR-HPV Positive Women with Minor Cytological Abnormalities: A Comparison of mRNA Testing, HPV DNA Testing, and Repeat Cytology Using a 4-Year Follow-Up of a Population-Based Study

    Science.gov (United States)

    Persson, Maria; Elfström, K. Miriam; Brismar Wendel, Sophia; Weiderpass, Elisabete; Andersson, Sonia

    2014-01-01

    Objective Expression of the viral E6/E7 oncogenes of high-risk human papillomaviruses (HR-HPV) is necessary for malignant conversion and maintenance in cervical tissue. In order to determine whether HR-HPV E6/E7 mRNA testing more effectively predicts precancerous lesions and invasive cervical cancer than HR-HPV DNA testing, we aimed to compare triage using HR-HPV E6/E7 mRNA testing by APTIMA HPV Assay (APTIMA) to HPV16 DNA testing, HPV16/18 DNA testing, and repeat cytology. Methods Liquid-based (PreservCyt) cell samples were obtained from HR-HPV-positive women diagnosed with atypical squamous cells of undetermined significance (ASCUS) and low-grade squamous intraepithelial lesions (LSIL) within the framework of the population-based cervical cancer screening program in Stockholm, Sweden. Samples were tested for HR-HPV E6/E7 mRNA by APTIMA (Gene-Probe Inc., San Diego, CA, USA). Women were followed up for 4 years after the index cytology via medical and laboratory records, and the Stockholm Oncology Center. Results Nine of 25 (36%) women in the ASCUS group, and 64 of 180 (36%) women in the LSIL group developed cervical intraepithelial neoplasia (CIN) grade 2 or worse during 4 years of follow-up. 162 (74%) women were APTIMA-positive, and APTIMA had the highest sensitivity to predict CIN2 or worse and CIN3 or worse in the ASCUS (77.8% and 100%) and LSIL (78.1 and 75.8%) groups, although specificity was insufficient (cytology were more specific than APTIMA. Conclusion The results of this population-based study with comprehensive follow-up support the use of APTIMA as a triage test for women with ASCUS. More focused investigation is required for women with LSIL. PMID:24587193

  17. Triage of HR-HPV positive women with minor cytological abnormalities: a comparison of mRNA testing, HPV DNA testing, and repeat cytology using a 4-year follow-up of a population-based study.

    Science.gov (United States)

    Persson, Maria; Elfström, K Miriam; Brismar Wendel, Sophia; Weiderpass, Elisabete; Andersson, Sonia

    2014-01-01

    Expression of the viral E6/E7 oncogenes of high-risk human papillomaviruses (HR-HPV) is necessary for malignant conversion and maintenance in cervical tissue. In order to determine whether HR-HPV E6/E7 mRNA testing more effectively predicts precancerous lesions and invasive cervical cancer than HR-HPV DNA testing, we aimed to compare triage using HR-HPV E6/E7 mRNA testing by APTIMA HPV Assay (APTIMA) to HPV16 DNA testing, HPV16/18 DNA testing, and repeat cytology. Liquid-based (PreservCyt) cell samples were obtained from HR-HPV-positive women diagnosed with atypical squamous cells of undetermined significance (ASCUS) and low-grade squamous intraepithelial lesions (LSIL) within the framework of the population-based cervical cancer screening program in Stockholm, Sweden. Samples were tested for HR-HPV E6/E7 mRNA by APTIMA (Gene-Probe Inc., San Diego, CA, USA). Women were followed up for 4 years after the index cytology via medical and laboratory records, and the Stockholm Oncology Center. Nine of 25 (36%) women in the ASCUS group, and 64 of 180 (36%) women in the LSIL group developed cervical intraepithelial neoplasia (CIN) grade 2 or worse during 4 years of follow-up. 162 (74%) women were APTIMA-positive, and APTIMA had the highest sensitivity to predict CIN2 or worse and CIN3 or worse in the ASCUS (77.8% and 100%) and LSIL (78.1 and 75.8%) groups, although specificity was insufficient (cytology were more specific than APTIMA. The results of this population-based study with comprehensive follow-up support the use of APTIMA as a triage test for women with ASCUS. More focused investigation is required for women with LSIL.

  18. Cloning, characterization, and properties of seven triplet repeat DNA sequences.

    Science.gov (United States)

    Ohshima, K; Kang, S; Larson, J E; Wells, R D

    1996-07-12

    Several neuromuscular and neurodegenerative diseases are caused by genetically unstable triplet repeat sequences (CTG.CAG, CGG.CCG, or AAG.CTT) in or near the responsible genes. We implemented novel cloning strategies with chemically synthesized oligonucleotides to clone seven of the triplet repeat sequences (GTA.TAC, GAT.ATC, GTT.AAC, CAC.GTG, AGG.CCT, TCG.CGA, and AAG.CTT), and the adjoining paper (Ohshima, K., Kang, S., Larson, J. E., and Wells, R. D.(1996) J. Biol. Chem. 271, 16784-16791) describes studies on TTA.TAA. This approach in conjunction with in vivo expansion studies in Escherichia coli enabled the preparation of at least 81 plasmids containing the repeat sequences with lengths of approximately 16 up to 158 triplets in both orientations with varying extents of polymorphisms. The inserts were characterized by DNA sequencing as well as DNA polymerase pausings, two-dimensional agarose gel electrophoresis, and chemical probe analyses to evaluate the capacity to adopt negative supercoil induced non-B DNA conformations. AAG.CTT and AGG.CCT form intramolecular triplexes, and the other five repeat sequences do not form any previously characterized non-B structures. However, long tracts of TCG.CGA showed strong inhibition of DNA synthesis at specific loci in the repeats as seen in the cases of CTG.CAG and CGG.CCG (Kang, S., Ohshima, K., Shimizu, M., Amirhaeri, S., and Wells, R. D.(1995) J. Biol. Chem. 270, 27014-27021). This work along with other studies (Wells, R. D.(1996) J. Biol. Chem. 271, 2875-2878) on CTG.CAG, CGG.CCG, and TTA.TAA makes available long inserts of all 10 triplet repeat sequences for a variety of physical, molecular biological, genetic, and medical investigations. A model to explain the reduction in mRNA abundance in Friedreich's ataxia based on intermolecular triplex formation is proposed.

  19. The child accident repeater: a review.

    Science.gov (United States)

    Jones, J G

    1980-04-01

    The child accident repeater is defined as one who has at least three accidents that come to medical attention within a year. The accident situation has features in common with those of the child who has a single accident through simple "bad luck", but other factors predispose him to repeated injury. In the child who has a susceptible personality, a tendency for accident repetition may be due to a breakdown in adjustment to a stressful environment. Prevention of repeat accidents should involve the usual measures considered appropriate for all children as well as an attempt to provide treatment of significant maladjustment and modification of a stressful environment.

  20. Evaluating post-Katrina recovery in Mississippi using repeat photography.

    Science.gov (United States)

    Burton, Christopher; Mitchell, Jerry T; Cutter, Susan L

    2011-07-01

    Hurricane Katrina of August 2005 had extensive consequences for the state of Mississippi in the United States. Widespread infrastructure and property damage, massive social dislocation, and ecological loss remain among the many challenges faced by communities as they work towards 'normalcy'. This study employs repeat photography to understand differential recovery from Hurricane Katrina in Mississippi. Revealing change with conventional landscape photography, a process known as repeat photography, is common in the natural sciences. Simply stated, repeat photography is the practice of re-photographing the same scene as it appears in an earlier photograph. Photographs were taken at 131 sites every six months over a three-year period. Each photograph was assigned a recovery score and a spatially interpolated recovery surface was generated for each time period. The mapped and graphed results show disparities in the progression of recovery: some communities quickly entered the rebuilding process whereas others have lagged far behind.

  1. Repeated Games With Intervention: Theory and Applications in Communications

    CERN Document Server

    Xiao, Yuanzhang; van der Schaar, Mihaela

    2011-01-01

    In communication systems where users share common resources, users' selfish behavior usually results in suboptimal resource utilization. There have been extensive works that model communication systems with selfish users as one-shot games and propose incentive schemes to achieve Pareto optimal action profiles as non-cooperative equilibria. However, in many communication systems, due to strong negative externalities among users, the sets of feasible payoffs in one-shot games are nonconvex. Thus, it is possible to expand the set of feasible payoffs by having users choose convex combinations of different payoffs. In this paper, we propose a repeated game model generalized by intervention. First, we use repeated games to convexify the set of feasible payoffs in one-shot games. Second, we combine conventional repeated games with intervention, originally proposed for one-shot games, to achieve a larger set of equilibrium payoffs and loosen requirements for users' patience to achieve it. We study the problem of maxi...

  2. Archery performance level and repeatability of event-related EMG.

    Science.gov (United States)

    Soylu, A R; Ertan, H; Korkusuz, F

    2006-12-01

    The purpose of the current study was to compare the repeatability of electromyographic linear envelopes (LE) of archery groups. Surface electromyography (EMG) signals of musculus flexor digitorum superficialis (MFDS) and extensor digitorum (MED) of 23 participants (seven skilled, six beginner archers and ten non-archers) were recorded during archery shooting. Two-second periods (clicker falls at first second) of 12 shots' EMG data were recorded, full-wave rectified and filtered (60 ms moving-average filter) for each participant's drawing arm. Repeatability was investigated by using a statistical criterion, variance ratio (VR). Archers' performances were evaluated in terms of FITA scores. The results showed that FITA scores were significantly correlated to the VRs of MFDS and MED. EMG LEs were more repeatable among archers than non-archers. Therefore, we inferred that VRs of MFDS and MED might be important variables for (a) assessing shooting techniques, (b) evaluation of archers' progress, and (c) selection of talented archers.

  3. Plumb line deflection varied with time obtained by repeated gravimetry

    Institute of Scientific and Technical Information of China (English)

    李辉; 付广裕; 李正心

    2001-01-01

    In this paper, the plumb line deflection varied with time (PLV) are calculated with the Vening-Meinesz formula for Xiaguan and Beijing point based on the 28 and 39 campaigns of gravimetry at the local gravity networks in the Western Yunnan Earthquake Prediction Experiment Area and the North China, respectively. Based on the results, we conclude that: ① the maximum of PLV is under 0.12 and amplitudes of interannual variation are under 0.022.②PLV can be determined with the reliability of 0.012 by the modeling based on the precession of repeated gravimetry. This implies that repeated gravimetry could be used to determine the PLV. ③There exist some common and different characteristics for the different places and different components. It may provide a new approach for the study on the local or global geodynamic by using repeated gravimetry.

  4. Secondary immune response of rainbow trout following repeated immersion vaccination

    DEFF Research Database (Denmark)

    Jaafar, R. M.; Al-Jubury, Azmi; Chettri, Jiwan Kumar

    2017-01-01

    Teleosts are able to raise a protective immune response, comprising both innate and adaptive elements, against various pathogens. This is the basis for a widespread use of vaccines, administered as injection or immersion, in the aquaculture industry. It has been described that repeated injection...... vaccination of fish raises a secondary immune response, consisting of rapid, accelerated and increased antibody reaction. This study reports how rainbow trout responds to repeated immersion vaccination against yersiniosis (ERM) caused by the bacterial pathogen Yersinia ruckeri. It was found that rainbow trout...... does not raise a classical secondary response following repeated immersion vaccination. Serum antibody titres were merely slightly increased even after three immunizations, using 30-s immersion into a bacterin consisting of formalin-inactivated Y. ruckeri (serotype O1, biotypes 1 and 2), performed over...

  5. Schemes of Repeater Optimizing Distribution based on the MLC Application and CBLRD Simulation

    Directory of Open Access Journals (Sweden)

    Qian Qiuye

    2013-07-01

    Full Text Available The widely use of repeaters raises concern about their coordination among the public. Since repeaters may suffer interaction and limitation bearing capacity, designing a reasonable repeaters coordination method is of great significance. This study address the problem if repeater coordination in a circular flat area with minimal number of repeaters with seamless coverage theory, system simulation method. With 1,000 users, this study model the coverage, getting the minimal number of repeaters of different coverage radius based on extensive used regular hexagon coverage theory. A numerical example was given in this case. When the number of users increases to 10,000, this study simulate to get the signal density across the area according to the consideration of repeaters and the different distribution of users, which are divided into uniform distribution, linear distribution, normal distribution and lognormal distribution. Then, Multi-Layer Coverage (MLC and Coverage by Link Rate Density (CBLRD are created as the distribution scheme on the area where repeat service demand is large. Moreover, for solution on the distribution of the repeaters with barriers, distribution schemes are given considering the transmission of VHF spectrums and the distribution of users around the barrier. Additionally, Spring Comfortable Degree (SCD is used for evaluation of the results and the developing tends are given to improve the model. Due to the reasonable assumption, the solution of repeater distribution is of pivotal reference value based on the reasonable results.

  6. Mechanisms of trinucleotide repeat instability during human development.

    Science.gov (United States)

    McMurray, Cynthia T

    2010-11-01

    Trinucleotide expansion underlies several human diseases. Expansion occurs during multiple stages of human development in different cell types, and is sensitive to the gender of the parent who transmits the repeats. Repair and replication models for expansions have been described, but we do not know whether the pathway involved is the same under all conditions and for all repeat tract lengths, which differ among diseases. Currently, researchers rely on bacteria, yeast and mice to study expansion, but these models differ substantially from humans. We need now to connect the dots among human genetics, pathway biochemistry and the appropriate model systems to understand the mechanism of expansion as it occurs in human disease.

  7. Relationship between income and repeat criminal victimization in Brazil

    Directory of Open Access Journals (Sweden)

    Marcelo Justus

    2015-09-01

    Full Text Available This study analyzes the effect of income on repeat criminal victimization in Brazil using data from the 2009 National Household Sample Survey and its special supplement on victimization and access to justice. Two count-data models were estimated for four types of crime: theft, robbery, attempted theft/robbery, and physical assault. A positive nonlinear effect of income on repeat victimization for the three types of property crimes and a negative nonlinear effect of income on physical assault were observed.

  8. Repeat urine cultures in children with urinary tract infection

    Directory of Open Access Journals (Sweden)

    Risky Vitria Prasetyo

    2012-05-01

    Full Text Available Background Urinary tract infections (UTIs are the second leading cause of infection in children, following respiratory tract infections. Repeat urine cultures after antibiotic treatment are routinely obtained in clinical practice to verify proof of bacteriologic cure. The American Academy of Pediatrics does not recommended repeat cultures, due to increased cost and discomfort to patients. Objective To determine the frequency of positive repeat urine cultures after 3 days of antibiotics in children with UTIs. Methods We conducted a retrospective study on children with UTIs who visited the Division of Pediatric Nephrology, Department of Child Health at Dr. Soetomo Hospital, Surabaya from January 2006 to December 2011. Results of repeat urine cultures were obtained after 3 days of antibiotic treatment. Descriptive statistics were used to analyze the data. Results Of the 779 pediatric UTI cases, repeat urine cultures were performed in 264 (33.9% cases. Of the 264 patients who comprised our study, there were similar numbers of girls and boys (50.4% vs. 49.6%, respectively. The mean age of patients was 43.9 (SD 1.59 months and 35.5% of subjects were aged under 1 year. In the initial urine cultures of our subjects, Escherichia coli was the most common organism found, with 92 cases (34.8%, compared to 58 cases (21.9% of Klebsiella pneumoniae and 29 cases (10.9% of Pseudomonas aeruginosa. Rrepeat urine cultures showed no bacterial growth in 168 cases (63.6%. Conclusion Mostly negative repeat urine cultures will probably obviate the need of this test in daily routine practice. [Paediatr Indones. 2012;52:170-4].

  9. Efficacy and safety of guaifenesin for upper back, neck, and shoulder pain: a Phase II proof-of-concept, multicenter, placebo-controlled, repeat-dose, parallel-group study

    Directory of Open Access Journals (Sweden)

    Collaku A

    2017-03-01

    Full Text Available Agron Collaku, Yong Yue, Kenneth Reed GlaxoSmithKline Consumer Healthcare, Parsippany, NJ, USA Background/objective: Guaifenesin, an over-the-counter (OTC expectorant, has exhibited muscle relaxant effects preclinically and clinically. This proof-of-principle study explored whether OTC doses of guaifenesin can provide relief from acute upper back, neck, or shoulder muscle spasm and pain. Methods: This multicenter, placebo-controlled, repeat-dose, parallel study randomly assigned adults experiencing acute pain and muscle spasm in their upper back, neck, or shoulder to guaifenesin 600 or 1200 mg or matched placebo twice daily (BID in a 2:2:1:1 ratio for 7 days. The primary end point was the change from baseline in muscle spasm relief, measured using an 11-point numeric rating scale (0= not present to 10= unbearable recorded twice daily and averaged over the 7-day treatment period. Analyses were performed using a linear mixed model that included treatment as a fixed effect and site as a random effect. Results: A total of 77 subjects were included in the 4 treatment groups. Least squares mean muscle spasm score over 7 days was 1.77 with guaifenesin 1200 mg, 1.42 with its matched placebo, 1.53 with guaifenesin 600 mg, and 1.74 with its matched placebo. Treatment with guaifenesin 1200 mg BID provided 25% greater reduction in mean muscle spasm over its matched placebo and 16% greater reduction than guaifenesin 600 mg BID. These differences were not statistically significant. Based on comparisons of absolute mean values, a consistent directional change in effect was observed, suggesting some benefit from placebo to lower-to-upper doses of guaifenesin with regard to muscle spasm, tension, pain, discomfort, and relaxation. No severe or serious adverse events were reported. Conclusion: Results suggest the potential for OTC dose of guaifenesin 1200 mg BID to provide symptomatic relief of upper back musculoskeletal pain and spasm. Confirmation of

  10. The Moral Maturity of Repeater Delinquents.

    Science.gov (United States)

    Petronio, Richard J.

    1980-01-01

    Differences in moral development (as conceived by Kohlberg) were examined in a sample of delinquent teenagers. The repeater group was not found, as had been hypothesized, to be lower on moral maturity than those who engaged in less delinquency. (GC)

  11. A cross-sectional study on related risk factors of repeated induced abortion%重复人工流产相关危险因素的横向研究

    Institute of Scientific and Technical Information of China (English)

    朱勤芳; 陆新妹; 杨美芳; 沈芳荣; 冯亚红

    2012-01-01

    目的:探讨首次人工流产女性与重复人工流产女性之间不同的个体行为和社会经济差异,确定重复流产的相关危险因素.方法:调查2009年8月~2010年7月接受人工流产治疗服务女性1 132名,年龄20 ~49岁,采用回归分析方法研究重复流产的相关危险因素.结果:接受问卷调查女性的重复流产率为48.45%,调查一年间重复流产率为15.85%;重复流产的危险因素,包括生育史(OR =2.45),未婚或缺乏感情基础(OR=2.14),无业或失业(OR=1.66),吸烟或成瘾性药物使用(OR=1.43),低学历教育水平(OR=1.5).其中部分女性(n=135)认为在经济条件允许或者建立婚姻关系后愿意继续妊娠.还有部分女性认为流产后未能获得相关避孕咨询,或采取不恰当的避孕方法,是重复流产的重要原因.结论:较高的女性重复流产比例,使开展流产后计划生育服务成为提高女性健康和生育质量的重要手段.虽然可以确定一些重复流产的相关危险因素,但是女性受到身心侵害的几率较高,所以预防非意愿妊娠需要全社会关心和努力.%Objective: To explore individual behavioral differences and socio - economic differences between the women of induced abortion for the first time and the women of repeated induced abortion, and confirm the related risk f