WorldWideScience

Sample records for repeat nb-lrr receptors

  1. Structural Determinants at the Interface of the ARC2 and LRR Domains Control the Activation of the NB-LRR Plant Immune Receptors Rx1 and Gpa2

    NARCIS (Netherlands)

    Slootweg, E.J.; Spiridon, L.N.; Roosien, J.; Butterbach, P.B.E.; Pomp, H.; Westerhof, L.B.; Wilbers, R.H.P.; Bakker, E.H.; Bakker, J.; Petrescu, A.J.; Smant, G.; Goverse, A.

    2013-01-01

    Many plant and animal immune receptors have a modular NB-LRR architecture in which a nucleotide-binding switch domain (NB-ARC) is tethered to a leucine-rich repeat sensor domain (LRR). The cooperation between the switch and sensor domains, which regulates the activation of these proteins, is poorly

  2. Genetic requirements for signaling from an autoactive plant NB-LRR intracellular innate immune receptor.

    Directory of Open Access Journals (Sweden)

    Melinda Roberts

    Full Text Available Plants react to pathogen attack via recognition of, and response to, pathogen-specific molecules at the cell surface and inside the cell. Pathogen effectors (virulence factors are monitored by intracellular nucleotide-binding leucine-rich repeat (NB-LRR sensor proteins in plants and mammals. Here, we study the genetic requirements for defense responses of an autoactive mutant of ADR1-L2, an Arabidopsis coiled-coil (CC-NB-LRR protein. ADR1-L2 functions upstream of salicylic acid (SA accumulation in several defense contexts, and it can act in this context as a "helper" to transduce specific microbial activation signals from "sensor" NB-LRRs. This helper activity does not require an intact P-loop. ADR1-L2 and another of two closely related members of this small NB-LRR family are also required for propagation of unregulated runaway cell death (rcd in an lsd1 mutant. We demonstrate here that, in this particular context, ADR1-L2 function is P-loop dependent. We generated an autoactive missense mutation, ADR1-L2D484V, in a small homology motif termed MHD. Expression of ADR1-L2D848V leads to dwarfed plants that exhibit increased disease resistance and constitutively high SA levels. The morphological phenotype also requires an intact P-loop, suggesting that these ADR1-L2D484V phenotypes reflect canonical activation of this NB-LRR protein. We used ADR1-L2D484V to define genetic requirements for signaling. Signaling from ADR1-L2D484V does not require NADPH oxidase and is negatively regulated by EDS1 and AtMC1. Transcriptional regulation of ADR1-L2D484V is correlated with its phenotypic outputs; these outputs are both SA-dependent and -independent. The genetic requirements for ADR1-L2D484V activity resemble those that regulate an SA-gradient-dependent signal amplification of defense and cell death signaling initially observed in the absence of LSD1. Importantly, ADR1-L2D484V autoactivation signaling is controlled by both EDS1 and SA in separable, but linked

  3. Genetic requirements for signaling from an autoactive plant NB-LRR intracellular innate immune receptor.

    Science.gov (United States)

    Roberts, Melinda; Tang, Saijun; Stallmann, Anna; Dangl, Jeffery L; Bonardi, Vera

    2013-01-01

    Plants react to pathogen attack via recognition of, and response to, pathogen-specific molecules at the cell surface and inside the cell. Pathogen effectors (virulence factors) are monitored by intracellular nucleotide-binding leucine-rich repeat (NB-LRR) sensor proteins in plants and mammals. Here, we study the genetic requirements for defense responses of an autoactive mutant of ADR1-L2, an Arabidopsis coiled-coil (CC)-NB-LRR protein. ADR1-L2 functions upstream of salicylic acid (SA) accumulation in several defense contexts, and it can act in this context as a "helper" to transduce specific microbial activation signals from "sensor" NB-LRRs. This helper activity does not require an intact P-loop. ADR1-L2 and another of two closely related members of this small NB-LRR family are also required for propagation of unregulated runaway cell death (rcd) in an lsd1 mutant. We demonstrate here that, in this particular context, ADR1-L2 function is P-loop dependent. We generated an autoactive missense mutation, ADR1-L2D484V, in a small homology motif termed MHD. Expression of ADR1-L2D848V leads to dwarfed plants that exhibit increased disease resistance and constitutively high SA levels. The morphological phenotype also requires an intact P-loop, suggesting that these ADR1-L2D484V phenotypes reflect canonical activation of this NB-LRR protein. We used ADR1-L2D484V to define genetic requirements for signaling. Signaling from ADR1-L2D484V does not require NADPH oxidase and is negatively regulated by EDS1 and AtMC1. Transcriptional regulation of ADR1-L2D484V is correlated with its phenotypic outputs; these outputs are both SA-dependent and -independent. The genetic requirements for ADR1-L2D484V activity resemble those that regulate an SA-gradient-dependent signal amplification of defense and cell death signaling initially observed in the absence of LSD1. Importantly, ADR1-L2D484V autoactivation signaling is controlled by both EDS1 and SA in separable, but linked pathways

  4. Genetic requirements for signaling from an autoactive plant NB-LRR intracellular innate immune receptor.

    Directory of Open Access Journals (Sweden)

    Melinda Roberts

    Full Text Available Plants react to pathogen attack via recognition of, and response to, pathogen-specific molecules at the cell surface and inside the cell. Pathogen effectors (virulence factors are monitored by intracellular nucleotide-binding leucine-rich repeat (NB-LRR sensor proteins in plants and mammals. Here, we study the genetic requirements for defense responses of an autoactive mutant of ADR1-L2, an Arabidopsis coiled-coil (CC-NB-LRR protein. ADR1-L2 functions upstream of salicylic acid (SA accumulation in several defense contexts, and it can act in this context as a "helper" to transduce specific microbial activation signals from "sensor" NB-LRRs. This helper activity does not require an intact P-loop. ADR1-L2 and another of two closely related members of this small NB-LRR family are also required for propagation of unregulated runaway cell death (rcd in an lsd1 mutant. We demonstrate here that, in this particular context, ADR1-L2 function is P-loop dependent. We generated an autoactive missense mutation, ADR1-L2D484V, in a small homology motif termed MHD. Expression of ADR1-L2D848V leads to dwarfed plants that exhibit increased disease resistance and constitutively high SA levels. The morphological phenotype also requires an intact P-loop, suggesting that these ADR1-L2D484V phenotypes reflect canonical activation of this NB-LRR protein. We used ADR1-L2D484V to define genetic requirements for signaling. Signaling from ADR1-L2D484V does not require NADPH oxidase and is negatively regulated by EDS1 and AtMC1. Transcriptional regulation of ADR1-L2D484V is correlated with its phenotypic outputs; these outputs are both SA-dependent and -independent. The genetic requirements for ADR1-L2D484V activity resemble those that regulate an SA-gradient-dependent signal amplification of defense and cell death signaling initially observed in the absence of LSD1. Importantly, ADR1-L2D484V autoactivation signaling is controlled by both EDS1 and SA in separable, but linked

  5. Genetic Requirements for Signaling from an Autoactive Plant NB-LRR Intracellular Innate Immune Receptor

    Science.gov (United States)

    Stallmann, Anna; Dangl, Jeffery L.; Bonardi, Vera

    2013-01-01

    Plants react to pathogen attack via recognition of, and response to, pathogen-specific molecules at the cell surface and inside the cell. Pathogen effectors (virulence factors) are monitored by intracellular nucleotide-binding leucine-rich repeat (NB-LRR) sensor proteins in plants and mammals. Here, we study the genetic requirements for defense responses of an autoactive mutant of ADR1-L2, an Arabidopsis coiled-coil (CC)-NB-LRR protein. ADR1-L2 functions upstream of salicylic acid (SA) accumulation in several defense contexts, and it can act in this context as a “helper” to transduce specific microbial activation signals from “sensor” NB-LRRs. This helper activity does not require an intact P-loop. ADR1-L2 and another of two closely related members of this small NB-LRR family are also required for propagation of unregulated runaway cell death (rcd) in an lsd1 mutant. We demonstrate here that, in this particular context, ADR1-L2 function is P-loop dependent. We generated an autoactive missense mutation, ADR1-L2D484V, in a small homology motif termed MHD. Expression of ADR1-L2D848V leads to dwarfed plants that exhibit increased disease resistance and constitutively high SA levels. The morphological phenotype also requires an intact P-loop, suggesting that these ADR1-L2D484V phenotypes reflect canonical activation of this NB-LRR protein. We used ADR1-L2D484V to define genetic requirements for signaling. Signaling from ADR1-L2D484V does not require NADPH oxidase and is negatively regulated by EDS1 and AtMC1. Transcriptional regulation of ADR1-L2D484V is correlated with its phenotypic outputs; these outputs are both SA–dependent and –independent. The genetic requirements for ADR1-L2D484V activity resemble those that regulate an SA–gradient-dependent signal amplification of defense and cell death signaling initially observed in the absence of LSD1. Importantly, ADR1-L2D484V autoactivation signaling is controlled by both EDS1 and SA in separable, but linked

  6. Novel positive regulatory role for the SPL6 transcription factor in the N TIR-NB-LRR receptor-mediated plant innate immunity.

    Directory of Open Access Journals (Sweden)

    Meenu S Padmanabhan

    2013-03-01

    Full Text Available Following the recognition of pathogen-encoded effectors, plant TIR-NB-LRR immune receptors induce defense signaling by a largely unknown mechanism. We identify a novel and conserved role for the SQUAMOSA PROMOTER BINDING PROTEIN (SBP-domain transcription factor SPL6 in enabling the activation of the defense transcriptome following its association with a nuclear-localized immune receptor. During an active immune response, the Nicotiana TIR-NB-LRR N immune receptor associates with NbSPL6 within distinct nuclear compartments. NbSPL6 is essential for the N-mediated resistance to Tobacco mosaic virus. Similarly, the presumed Arabidopsis ortholog AtSPL6 is required for the resistance mediated by the TIR-NB-LRR RPS4 against Pseudomonas syringae carrying the avrRps4 effector. Transcriptome analysis indicates that AtSPL6 positively regulates a subset of defense genes. A pathogen-activated nuclear-localized TIR-NB-LRR like N can therefore regulate defense genes through SPL6 in a mechanism analogous to the induction of MHC genes by mammalian immune receptors like CIITA and NLRC5.

  7. Identification and localisation of the NB-LRR gene family within the potato genome

    Directory of Open Access Journals (Sweden)

    Jupe Florian

    2012-02-01

    Full Text Available Abstract Background The potato genome sequence derived from the Solanum tuberosum Group Phureja clone DM1-3 516 R44 provides unparalleled insight into the genome composition and organisation of this important crop. A key class of genes that comprises the vast majority of plant resistance (R genes contains a nucleotide-binding and leucine-rich repeat domain, and is collectively known as NB-LRRs. Results As part of an effort to accelerate the process of functional R gene isolation, we performed an amino acid motif based search of the annotated potato genome and identified 438 NB-LRR type genes among the ~39,000 potato gene models. Of the predicted genes, 77 contain an N-terminal toll/interleukin 1 receptor (TIR-like domain, and 107 of the remaining 361 non-TIR genes contain an N-terminal coiled-coil (CC domain. Physical map positions were established for 370 predicted NB-LRR genes across all 12 potato chromosomes. The majority of NB-LRRs are physically organised within 63 identified clusters, of which 50 are homogeneous in that they contain NB-LRRs derived from a recent common ancestor. Conclusions By establishing the phylogenetic and positional relationship of potato NB-LRRs, our analysis offers significant insight into the evolution of potato R genes. Furthermore, the data provide a blueprint for future efforts to identify and more rapidly clone functional NB-LRR genes from Solanum species.

  8. How to build a pathogen detector: structural basis of NB-LRR function

    NARCIS (Netherlands)

    Takken, F.L.W.; Goverse, A.

    2012-01-01

    Many plant disease resistance (R) proteins belong to the family of nucleotide-binding-leucine rich repeat (NB-LRR) proteins. NB-LRRs mediate recognition of pathogen-derived effector molecules and subsequently activate host defence. Their multi-domain structure allows these pathogen detectors to simu

  9. Natural variation in small molecule-induced TIR-NB-LRR signaling induces root growth arrest via EDS1- and PAD4-complexed R protein VICTR in Arabidopsis.

    Science.gov (United States)

    Kim, Tae-Houn; Kunz, Hans-Henning; Bhattacharjee, Saikat; Hauser, Felix; Park, Jiyoung; Engineer, Cawas; Liu, Amy; Ha, Tracy; Parker, Jane E; Gassmann, Walter; Schroeder, Julian I

    2012-12-01

    In a chemical genetics screen we identified the small-molecule [5-(3,4-dichlorophenyl)furan-2-yl]-piperidine-1-ylmethanethione (DFPM) that triggers rapid inhibition of early abscisic acid signal transduction via PHYTOALEXIN DEFICIENT4 (PAD4)- and ENHANCED DISEASE SUSCEPTIBILITY1 (EDS1)-dependent immune signaling mechanisms. However, mechanisms upstream of EDS1 and PAD4 in DFPM-mediated signaling remain unknown. Here, we report that DFPM generates an Arabidopsis thaliana accession-specific root growth arrest in Columbia-0 (Col-0) plants. The genetic locus responsible for this natural variant, VICTR (VARIATION IN COMPOUND TRIGGERED ROOT growth response), encodes a TIR-NB-LRR (for Toll-Interleukin1 Receptor-nucleotide binding-Leucine-rich repeat) protein. Analyses of T-DNA insertion victr alleles showed that VICTR is necessary for DFPM-induced root growth arrest and inhibition of abscisic acid-induced stomatal closing. Transgenic expression of the Col-0 VICTR allele in DFPM-insensitive Arabidopsis accessions recapitulated the DFPM-induced root growth arrest. EDS1 and PAD4, both central regulators of basal resistance and effector-triggered immunity, as well as HSP90 chaperones and their cochaperones RAR1 and SGT1B, are required for the DFPM-induced root growth arrest. Salicylic acid and jasmonic acid signaling pathway components are dispensable. We further demonstrate that VICTR associates with EDS1 and PAD4 in a nuclear protein complex. These findings show a previously unexplored association between a TIR-NB-LRR protein and PAD4 and identify functions of plant immune signaling components in the regulation of root meristematic zone-targeted growth arrest.

  10. The arabidopsis TIR-NB-LRR gene RAC1 confers resistance to Albugo candida (white rust) and is dependent on EDS1 but not PAD4.

    Science.gov (United States)

    Borhan, Mohammad H; Holub, Eric B; Beynon, Jim L; Rozwadowski, Kevin; Rimmer, S Roger

    2004-07-01

    Resistance to Albugo candida isolate Acem1 is conferred by a dominant gene, RAC1, in accession Ksk-1 of Arabidopsis thaliana. This gene was isolated by positional cloning and is a member of the Drosophila toll and mammalian interleukin-1 receptor (TIR) nucleotide-binding site leucine-rich repeat (NB-LRR) class of plant resistance genes. Strong identity of the TIR and NB domains was observed between the predicted proteins encoded by the Ksk-1 allele and the allele from an Acem1-susceptible accession Columbia (Col) (99 and 98%, respectively). However, major differences between the two predicted proteins occur within the LRR domain and mainly are confined to the beta-strand/beta-turn structure of the LRR. Both proteins contain 14 imperfect repeats. RAC1-mediated resistance was analyzed further using mutations in defense regulation, including: pad4-1, eds1-1, and NahG, in the presence of the RAC1 allele from Ksk-1. White rust resistance was completely abolished by eds1-1 but was not affected by either pad4-1 or NahG.

  11. WRR4, a broad-spectrum TIR-NB-LRR gene from Arabidopsis thaliana that confers white rust resistance in transgenic oilseed Brassica crops.

    Science.gov (United States)

    Borhan, Mohammad Hossein; Holub, Eric B; Kindrachuk, Colin; Omidi, Mansour; Bozorgmanesh-Frad, Ghazaleh; Rimmer, S Roger

    2010-03-01

    White blister rust caused by Albugo candida (Pers.) Kuntze is a common and often devastating disease of oilseed and vegetable brassica crops worldwide. Physiological races of the parasite have been described, including races 2, 7 and 9 from Brassica juncea, B. rapa and B. oleracea, respectively, and race 4 from Capsella bursa-pastoris (the type host). A gene named WRR4 has been characterized recently from polygenic resistance in the wild brassica relative Arabidopsis thaliana (accession Columbia) that confers broad-spectrum white rust resistance (WRR) to all four of the above Al. candida races. This gene encodes a TIR-NB-LRR (Toll-like/interleukin-1 receptor-nucleotide binding-leucine-rich repeat) protein which, as with other known functional members in this subclass of intracellular receptor-like proteins, requires the expression of the lipase-like defence regulator, enhanced disease susceptibility 1 (EDS1). Thus, we used RNA interference-mediated suppression of EDS1 in a white rust-resistant breeding line of B. napus (transformed with a construct designed from the A. thaliana EDS1 gene) to determine whether defence signalling via EDS1 is functionally intact in this oilseed brassica. The eds1-suppressed lines were fully susceptible following inoculation with either race 2 or 7 isolates of Al. candida. We then transformed white rust-susceptible cultivars of B. juncea (susceptible to race 2) and B. napus (susceptible to race 7) with the WRR4 gene from A. thaliana. The WRR4-transformed lines were resistant to the corresponding Al. candida race for each host species. The combined data indicate that WRR4 could potentially provide a novel source of white rust resistance in oilseed and vegetable brassica crops.

  12. Nuclear accumulation of the Arabidopsis immune receptor RPS4 is necessary for triggering EDS1-dependent defense.

    Science.gov (United States)

    Wirthmueller, Lennart; Zhang, Yan; Jones, Jonathan D G; Parker, Jane E

    2007-12-01

    Recognition of specific pathogen molecules inside the cell by nucleotide-binding domain and leucine-rich repeat (NB-LRR) receptors constitutes an important layer of innate immunity in plants. Receptor activation triggers host cellular reprogramming involving transcriptional potentiation of basal defenses and localized programmed cell death. The sites and modes of action of NB-LRR receptors are, however, poorly understood. Arabidopsis Toll/Interleukin-1 (TIR) type NB-LRR receptor RPS4 recognizes the bacterial type III effector AvrRps4. We show that epitope-tagged RPS4 expressed under its native regulatory sequences distributes between endomembranes and nuclei in healthy and AvrRps4-triggered tissues. RPS4 accumulation in the nucleus, mediated by a bipartite nuclear localization sequence (NLS) at its C terminus, is necessary for triggering immunity through authentic activation by AvrRps4 in Arabidopsis or as an effector-independent "deregulated" receptor in tobacco. A strikingly conserved feature of TIR-NB-LRR receptors is their recruitment of the nucleocytoplasmic basal-defense regulator EDS1 in resistance to diverse pathogens. We find that EDS1 is an indispensable component of RPS4 signaling and that it functions downstream of RPS4 activation but upstream of RPS4-mediated transcriptional reprogramming in the nucleus.

  13. The impact of polyploidy on the evolution of a complex NB-LRR resistance gene cluster in soybean

    Science.gov (United States)

    A comparative genomics approach was used to investigate the evolution of a complex NB-LRR gene cluster found in soybean (Glycine max), common bean (Phaseolus vulgaris), and other legumes. In soybean, the cluster is associated with several disease resistance (R) genes of known function including Rpg1...

  14. Expanded functions for a family of plant intracellular immune receptors beyond specific recognition of pathogen effectors.

    Science.gov (United States)

    Bonardi, Vera; Tang, Saijun; Stallmann, Anna; Roberts, Melinda; Cherkis, Karen; Dangl, Jeffery L

    2011-09-27

    Plants and animals deploy intracellular immune receptors that perceive specific pathogen effector proteins and microbial products delivered into the host cell. We demonstrate that the ADR1 family of Arabidopsis nucleotide-binding leucine-rich repeat (NB-LRR) receptors regulates accumulation of the defense hormone salicylic acid during three different types of immune response: (i) ADRs are required as "helper NB-LRRs" to transduce signals downstream of specific NB-LRR receptor activation during effector-triggered immunity; (ii) ADRs are required for basal defense against virulent pathogens; and (iii) ADRs regulate microbial-associated molecular pattern-dependent salicylic acid accumulation induced by infection with a disarmed pathogen. Remarkably, these functions do not require an intact P-loop motif for at least one ADR1 family member. Our results suggest that some NB-LRR proteins can serve additional functions beyond canonical, P-loop-dependent activation by specific virulence effectors, extending analogies between intracellular innate immune receptor function from plants and animals.

  15. Natural Variation in Small Molecule–Induced TIR-NB-LRR Signaling Induces Root Growth Arrest via EDS1- and PAD4-Complexed R Protein VICTR in Arabidopsis[C][W

    Science.gov (United States)

    Kim, Tae-Houn; Kunz, Hans-Henning; Bhattacharjee, Saikat; Hauser, Felix; Park, Jiyoung; Engineer, Cawas; Liu, Amy; Ha, Tracy; Parker, Jane E.; Gassmann, Walter; Schroeder, Julian I.

    2012-01-01

    In a chemical genetics screen we identified the small-molecule [5-(3,4-dichlorophenyl)furan-2-yl]-piperidine-1-ylmethanethione (DFPM) that triggers rapid inhibition of early abscisic acid signal transduction via PHYTOALEXIN DEFICIENT4 (PAD4)- and ENHANCED DISEASE SUSCEPTIBILITY1 (EDS1)-dependent immune signaling mechanisms. However, mechanisms upstream of EDS1 and PAD4 in DFPM-mediated signaling remain unknown. Here, we report that DFPM generates an Arabidopsis thaliana accession-specific root growth arrest in Columbia-0 (Col-0) plants. The genetic locus responsible for this natural variant, VICTR (VARIATION IN COMPOUND TRIGGERED ROOT growth response), encodes a TIR-NB-LRR (for Toll-Interleukin1 Receptor–nucleotide binding–Leucine-rich repeat) protein. Analyses of T-DNA insertion victr alleles showed that VICTR is necessary for DFPM-induced root growth arrest and inhibition of abscisic acid–induced stomatal closing. Transgenic expression of the Col-0 VICTR allele in DFPM-insensitive Arabidopsis accessions recapitulated the DFPM-induced root growth arrest. EDS1 and PAD4, both central regulators of basal resistance and effector-triggered immunity, as well as HSP90 chaperones and their cochaperones RAR1 and SGT1B, are required for the DFPM-induced root growth arrest. Salicylic acid and jasmonic acid signaling pathway components are dispensable. We further demonstrate that VICTR associates with EDS1 and PAD4 in a nuclear protein complex. These findings show a previously unexplored association between a TIR-NB-LRR protein and PAD4 and identify functions of plant immune signaling components in the regulation of root meristematic zone-targeted growth arrest. PMID:23275581

  16. Regulation of Transcription of Nucleotide-Binding Leucine-Rich Repeat-Encoding Genes SNC1 and RPP4 via H3K4 Trimethylation1[C][W][OA

    Science.gov (United States)

    Xia, Shitou; Cheng, Yu Ti; Huang, Shuai; Win, Joe; Soards, Avril; Jinn, Tsung-Luo; Jones, Jonathan D.G.; Kamoun, Sophien; Chen, She; Zhang, Yuelin; Li, Xin

    2013-01-01

    Plant nucleotide-binding leucine-rich repeat (NB-LRR) proteins serve as intracellular sensors to detect pathogen effectors and trigger immune responses. Transcription of the NB-LRR-encoding Resistance (R) genes needs to be tightly controlled to avoid inappropriate defense activation. How the expression of the NB-LRR R genes is regulated is poorly understood. The Arabidopsis (Arabidopsis thaliana) suppressor of npr1-1, constitutive 1 (snc1) mutant carries a gain-of-function mutation in a Toll/Interleukin1 receptor-like (TIR)-NB-LRR-encoding gene, resulting in the constitutive activation of plant defense responses. A snc1 suppressor screen identified modifier of snc1,9 (mos9), which partially suppresses the autoimmune phenotypes of snc1. Positional cloning revealed that MOS9 encodes a plant-specific protein of unknown function. Expression analysis showed that MOS9 is required for the full expression of TIR-NB-LRR protein-encoding RECOGNITION OF PERONOSPORA PARASITICA 4 (RPP4) and SNC1, both of which reside in the RPP4 cluster. Coimmunoprecipitation and mass spectrometry analyses revealed that MOS9 associates with the Set1 class lysine 4 of histone 3 (H3K4) methyltransferase Arabidopsis Trithorax-Related7 (ATXR7). Like MOS9, ATXR7 is also required for the full expression of SNC1 and the autoimmune phenotypes in the snc1 mutant. In atxr7 mutant plants, the expression of RPP4 is similarly reduced, and resistance against Hyaloperonospora arabidopsidis Emwa1 is compromised. Consistent with the attenuated expression of SNC1 and RPP4, trimethylated H3K4 marks are reduced around the promoters of SNC1 and RPP4 in mos9 plants. Our data suggest that MOS9 functions together with ATXR7 to regulate the expression of SNC1 and RPP4 through H3K4 methylation, which plays an important role in fine-tuning their transcription levels and functions in plant defense. PMID:23690534

  17. Role of intron-mediated enhancement on accumulation of an Arabidopsis NB-LRR class R-protein that confers resistance to Cucumber mosaic virus.

    Directory of Open Access Journals (Sweden)

    Yukiyo Sato

    Full Text Available The accumulation of RCY1 protein, which is encoded by RESISTANCE TO CMV(Y (RCY1, a CC-NB-LRR class R-gene, is tightly correlated with the strength of the resistance to a yellow strain of Cucumber mosaic virus [CMV(Y] in Arabidopsis thaliana. In order to enhance resistance to CMV by overexpression of RCY1, A. thaliana was transformed with intron-less RCY1 cDNA construct under the control of strong CaMV35S promoter. Remarkably, a relative amount of RCY1 protein accumulation in the transformants was much lower than that in plants expressing genomic RCY1 under the control of its native promoter. To identify a regulatory element of RCY1 that could cause such differential levels of RCY1 accumulation, a series of RCY1 cDNA and genomic RCY1 constructs were transiently expressed in Nicotiana benthamiana leaves by the Agrobacterium-mediated infiltration method. Comparative analysis of the level of RCY1 accumulation in the leaf tissues transiently expressing each construct indicated that the intron located in the RCY1-coding region of genomic RCY1, but not the native RCY1 genomic promoter or the 5'-and 3'-untranslated regions of RCY1, was indispensable for high level RCY1 accumulation. The increased levels of RCY1 accelerated plant disease defense reactions. Interestingly, such intron-mediated enhancement of RCY1 accumulation depended neither on the abundance of the RCY1 transcript nor on the RCY1 specific-intron sequence. Taken together, intron-mediated RCY1 expression seems to play a key role in the expression of complete resistance to CMV(Y by maintaining RCY1 accumulation at high levels.

  18. Host protein BSL1 associates with Phytophthora infestans RXLR effector AVR2 and the Solanum demissum Immune receptor R2 to mediate disease resistance.

    Science.gov (United States)

    Saunders, Diane G O; Breen, Susan; Win, Joe; Schornack, Sebastian; Hein, Ingo; Bozkurt, Tolga O; Champouret, Nicolas; Vleeshouwers, Vivianne G A A; Birch, Paul R J; Gilroy, Eleanor M; Kamoun, Sophien

    2012-08-01

    Plant pathogens secrete effector proteins to modulate plant immunity and promote host colonization. Plant nucleotide binding leucine-rich repeat (NB-LRR) immunoreceptors recognize specific pathogen effectors directly or indirectly. Little is known about how NB-LRR proteins recognize effectors of filamentous plant pathogens, such as Phytophthora infestans. AVR2 belongs to a family of 13 sequence-divergent P. infestans RXLR effectors that are differentially recognized by members of the R2 NB-LRR family in Solanum demissum. We report that the putative plant phosphatase BSU-LIKE PROTEIN1 (BSL1) is required for R2-mediated perception of AVR2 and resistance to P. infestans. AVR2 associates with BSL1 and mediates the interaction of BSL1 with R2 in planta, possibly through the formation of a ternary complex. Strains of P. infestans that are virulent on R2 potatoes express an unrecognized form, Avr2-like (referred to as A2l). A2L can still interact with BSL1 but does not promote the association of BSL1 with R2. Our findings show that recognition of the P. infestans AVR2 effector by the NB-LRR protein R2 requires the putative phosphatase BSL1. This reveals that, similar to effectors of phytopathogenic bacteria, recognition of filamentous pathogen effectors can be mediated via a host protein that interacts with both the effector and the NB-LRR immunoreceptor.

  19. Host Protein BSL1 Associates with Phytophthora infestans RXLR Effector AVR2 and the Solanum demissum Immune Receptor R2 to Mediate Disease Resistance[C][W

    Science.gov (United States)

    Saunders, Diane G.O.; Breen, Susan; Win, Joe; Schornack, Sebastian; Hein, Ingo; Bozkurt, Tolga O.; Champouret, Nicolas; Vleeshouwers, Vivianne G.A.A.; Birch, Paul R.J.; Gilroy, Eleanor M.; Kamoun, Sophien

    2012-01-01

    Plant pathogens secrete effector proteins to modulate plant immunity and promote host colonization. Plant nucleotide binding leucine-rich repeat (NB-LRR) immunoreceptors recognize specific pathogen effectors directly or indirectly. Little is known about how NB-LRR proteins recognize effectors of filamentous plant pathogens, such as Phytophthora infestans. AVR2 belongs to a family of 13 sequence-divergent P. infestans RXLR effectors that are differentially recognized by members of the R2 NB-LRR family in Solanum demissum. We report that the putative plant phosphatase BSU-LIKE PROTEIN1 (BSL1) is required for R2-mediated perception of AVR2 and resistance to P. infestans. AVR2 associates with BSL1 and mediates the interaction of BSL1 with R2 in planta, possibly through the formation of a ternary complex. Strains of P. infestans that are virulent on R2 potatoes express an unrecognized form, Avr2-like (referred to as A2l). A2L can still interact with BSL1 but does not promote the association of BSL1 with R2. Our findings show that recognition of the P. infestans AVR2 effector by the NB-LRR protein R2 requires the putative phosphatase BSL1. This reveals that, similar to effectors of phytopathogenic bacteria, recognition of filamentous pathogen effectors can be mediated via a host protein that interacts with both the effector and the NB-LRR immunoreceptor. PMID:22885736

  20. Genetic dissection of a TIR-NB-LRR locus from the wild North American grapevine species Muscadinia rotundifolia identifies paralogous genes conferring resistance to major fungal and oomycete pathogens in cultivated grapevine.

    Science.gov (United States)

    Feechan, Angela; Anderson, Claire; Torregrosa, Laurent; Jermakow, Angelica; Mestre, Pere; Wiedemann-Merdinoglu, Sabine; Merdinoglu, Didier; Walker, Amanda R; Cadle-Davidson, Lance; Reisch, Bruce; Aubourg, Sebastien; Bentahar, Nadia; Shrestha, Bipna; Bouquet, Alain; Adam-Blondon, Anne-Françoise; Thomas, Mark R; Dry, Ian B

    2013-11-01

    The most economically important diseases of grapevine cultivation worldwide are caused by the fungal pathogen powdery mildew (Erysiphe necator syn. Uncinula necator) and the oomycete pathogen downy mildew (Plasmopara viticola). Currently, grapegrowers rely heavily on the use of agrochemicals to minimize the potentially devastating impact of these pathogens on grape yield and quality. The wild North American grapevine species Muscadinia rotundifolia was recognized as early as 1889 to be resistant to both powdery and downy mildew. We have now mapped resistance to these two mildew pathogens in M. rotundifolia to a single locus on chromosome 12 that contains a family of seven TIR-NB-LRR genes. We further demonstrate that two highly homologous (86% amino acid identity) members of this gene family confer strong resistance to these unrelated pathogens following genetic transformation into susceptible Vitis vinifera winegrape cultivars. These two genes, designated resistance to Uncinula necator (MrRUN1) and resistance to Plasmopara viticola (MrRPV1) are the first resistance genes to be cloned from a grapevine species. Both MrRUN1 and MrRPV1 were found to confer resistance to multiple powdery and downy mildew isolates from France, North America and Australia; however, a single powdery mildew isolate collected from the south-eastern region of North America, to which M. rotundifolia is native, was capable of breaking MrRUN1-mediated resistance. Comparisons of gene organization and coding sequences between M. rotundifolia and the cultivated grapevine V. vinifera at the MrRUN1/MrRPV1 locus revealed a high level of synteny, suggesting that the TIR-NB-LRR genes at this locus share a common ancestor. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  1. Crystallization and preliminary X-ray diffraction analyses of the TIR domains of three TIR-NB-LRR proteins that are involved in disease resistance in Arabidopsis thaliana.

    Science.gov (United States)

    Wan, Li; Zhang, Xiaoxiao; Williams, Simon J; Ve, Thomas; Bernoux, Maud; Sohn, Kee Hoon; Jones, Jonathan D G; Dodds, Peter N; Kobe, Bostjan

    2013-11-01

    The Toll/interleukin-1 receptor (TIR) domain is a protein-protein interaction domain that is found in both animal and plant immune receptors. The N-terminal TIR domain from the nucleotide-binding (NB)-leucine-rich repeat (LRR) class of plant disease-resistance (R) proteins has been shown to play an important role in defence signalling. Recently, the crystal structure of the TIR domain from flax R protein L6 was determined and this structure, combined with functional studies, demonstrated that TIR-domain homodimerization is a requirement for function of the R protein L6. To advance the molecular understanding of the function of TIR domains in R-protein signalling, the protein expression, purification, crystallization and X-ray diffraction analyses of the TIR domains of the Arabidopsis thaliana R proteins RPS4 (resistance to Pseudomonas syringae 4) and RRS1 (resistance to Ralstonia solanacearum 1) and the resistance-like protein SNC1 (suppressor of npr1-1, constitutive 1) are reported here. RPS4 and RRS1 function cooperatively as a dual resistance-protein system that prevents infection by three distinct pathogens. SNC1 is implicated in resistance pathways in Arabidopsis and is believed to be involved in transcriptional regulation through its interaction with the transcriptional corepressor TPR1 (Topless-related 1). The TIR domains of all three proteins have successfully been expressed and purified as soluble proteins in Escherichia coli. Plate-like crystals of the RPS4 TIR domain were obtained using PEG 3350 as a precipitant; they diffracted X-rays to 2.05 Å resolution, had the symmetry of space group P1 and analysis of the Matthews coefficient suggested that there were four molecules per asymmetric unit. Tetragonal crystals of the RRS1 TIR domain were obtained using ammonium sulfate as a precipitant; they diffracted X-rays to 1.75 Å resolution, had the symmetry of space group P4(1)2(1)2 or P4(3)2(1)2 and were most likely to contain one molecule per asymmetric

  2. Repeated swim stress alters brain benzodiazepine receptors measured in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Weizman, R.; Weizman, A.; Kook, K.A.; Vocci, F.; Deutsch, S.I.; Paul, S.M.

    1989-06-01

    The effects of repeated swim stress on brain benzodiazepine receptors were examined in the mouse using both an in vivo and in vitro binding method. Specific in vivo binding of (/sup 3/H)Ro15-1788 to benzodiazepine receptors was decreased in the hippocampus, cerebral cortex, hypothalamus, midbrain and striatum after repeated swim stress (7 consecutive days of daily swim stress) when compared to nonstressed mice. In vivo benzodiazepine receptor binding was unaltered after repeated swim stress in the cerebellum and pons medulla. The stress-induced reduction in in vivo benzodiazepine receptor binding did not appear to be due to altered cerebral blood flow or to an alteration in benzodiazepine metabolism or biodistribution because there was no difference in (14C)iodoantipyrine distribution or whole brain concentrations of clonazepam after repeated swim stress. Saturation binding experiments revealed a change in both apparent maximal binding capacity and affinity after repeated swim stress. Moreover, a reduction in clonazepam's anticonvulsant potency was also observed after repeated swim stress (an increase in the ED50 dose for protection against pentylenetetrazol-induced seizures), although there was no difference in pentylenetetrazol-induced seizure threshold between the two groups. In contrast to the results obtained in vivo, no change in benzodiazepine receptor binding kinetics was observed using the in vitro binding method. These data suggest that environmental stress can alter the binding parameters of the benzodiazepine receptor and that the in vivo and in vitro binding methods can yield substantially different results.

  3. The relationship between anogenital distance and the androgen receptor CAG repeat length

    OpenAIRE

    Eisenberg, Michael L.; Hsieh, Tung-Chin; Pastuszak, Alexander W; McIntyre, Matthew G.; Walters, Rustin C; Lamb, Dolores J.; Lipshultz, Larry I

    2013-01-01

    Anogenital distance (AGD) is used to define degree of virilization of genital development, with shorter length being associated with feminization and male infertility. The first exon of the androgen receptor (AR) consists of a polymorphic sequence of cytosine–adenine–guanine (CAG) repeats, with longer CAG repeat lengths being associated with decreased receptor function. We sought to determine if there is an association between AGD and AR CAG repeat length. A cross-sectional, prospective cohor...

  4. The Arabidopsis lectin receptor kinase LecRK-I.9 enhances resistance to Phytophthora infestans in Solanaceous plants.

    Science.gov (United States)

    Bouwmeester, Klaas; Han, Miao; Blanco-Portales, Rosario; Song, Wei; Weide, Rob; Guo, Li-Yun; van der Vossen, Edwin A G; Govers, Francine

    2014-01-01

    Late blight caused by the plant pathogenic oomycete Phytophthora infestans is known as one of the most destructive potato diseases. Plant breeders tend to employ NB-LRR-based resistance for introducing genetically controlled late blight resistance in their breeding lines. However, P. infestans is able to rapidly escape this type of resistance, and hence, NB-LRR-based resistance in potato cultivars is often not durable. Previously, we identified a novel type of Phytophthora resistance in Arabidopsis. This resistance is mediated by the cell surface receptor LecRK-I.9, which belongs to the family of L-type lectin receptor kinases. In this study, we report that expression of the Arabidopsis LecRK-I.9 gene in potato and Nicotiana benthamiana results in significantly enhanced late blight resistance. Transcriptional profiling showed strong reduction in salicylic acid (SA)-mediated defence gene expression in LecRK-I.9 transgenic potato lines (TPLs). In contrast, transcripts of two protease inhibitor genes accumulated to extreme high levels, suggesting that LecRK-I.9-mediated late blight resistance is relying on a defence response that includes activation of protease inhibitors. These results demonstrate that the functionality of LecRK-I.9 in Phytophthora resistance is maintained after interfamily transfer to potato and N. benthamiana and suggest that this novel type of LecRK-based resistance can be exploited in breeding strategies to improve durable late blight resistance in Solanaceous crops.

  5. Androgen insensitivity syndrome: do trinucleotide repeats in androgen receptor gene have any role?

    Institute of Scientific and Technical Information of China (English)

    Singh Rajender; Nalini J. Gupta; Baidyanath Chakravarty; Lalji Singh; Kumarasamy Thangaraj

    2008-01-01

    Aim: To investigate the role of CAG and GGN repeats as genetic background affecting androgen insensitivity syn- drome (AIS) phenotype. Methods: We analyzed lengths of androgen receptor (AR)-CAG and GGN repeats in 69 AIS cases, along with 136 unrelated normal male individuals. The lengths of repeats were analyzed using polymerase chain reaction (PCR) amplification followed by allelic genotyping to determine allele length. Results: Our study revealed significantly shorter mean lengths of CAG repeats in patients (mean 18.25 repeats, range 14-26 repeats) in comparison to the controls (mean 22.57 repeats, range 12-39 repeats) (two-tailed P < 0.0001). GGN repeats, however, did not differ significantly between patients (mean 21.48 repeats) and controls (mean 21.21 repeats) (two- tailed P = 0.474). Among patients' groups, the mean number of CAG repeats in partial androgen insensitivity cases (mean 15.83 repeats) was significantly less than in complete androgen insensitivity cases (mean 19.46 repeats) (two- tailed P < 0.0001). Conclusion: The findings suggest that shorter lengths of repeats in the AR gene might act as low penetrance genetic background in varying manifestation of androgen insensitivity. (Asian J Androl 2008 Jul; 10: 616-624)

  6. Repeated stressful experiences differently affect brain dopamine receptor subtypes

    Energy Technology Data Exchange (ETDEWEB)

    Puglisi-Allegra, S.; Cabib, S. (Istituto di Psicobiologia e Psicofarmacologia (CNR), Roma (Italy)); Kempf, E.; Schleef, C. (Centre de Neurochimi, Strasbourg (Italy))

    1991-01-01

    The binding of tritiated spiperone (D2 antagonist) and tritiated SCH 23390 (D1 antagonist), in vivo, was investigated in the caudatus putamen (CP) and nucleus accumbens septi (NAS) of mice submitted to ten daily restraint stress sessions. Mice sacrificed 24 hr after the last stressful experience presented a 64% decrease of D2 receptor density (Bmax) but no changes in D1 receptor density in the NAS. In the CP a much smaller (11%) reduction of D2 receptor density was accompanied by a 10% increase of D1 receptors. These results show that the two types of dopamine (DA) receptors adapt in different or even opposite ways to environmental pressure, leading to imbalance between them.

  7. Strategies for Amplification of Trinucleotide Repeats: Optimization of Fragile X and Androgen Receptor PCR.

    Science.gov (United States)

    Papp; Snyder; Sedra; Guida; Prior

    1996-06-01

    Background: Trinucleotide repeat regions are heritable unstable elements that change in copy number from generation to generation. Amplification of these triplet repeats is an important diagnostic tool for molecular medicine. However, these repeats are often difficult to amplify and may require the use of different cosolvents or amplification strategies. Methods and Results: We used the fragile X and androgen receptor triplet repeat regions to demonstrate a series of conditions that may be used to optimize the amplification of repeat sequences. Conclusions: For androgen receptor, we show that predigestion of the template DNA was sufficient to generate consistent amplification. In the case of fragile X we found that predigestion, when combined with use of betaine as a destabilizing additive, was superior to other methods and yielded consistent amplification of normal and premutation alleles in both isotopic and nonisotopic reactions.

  8. Arabidopsis EDS1 connects pathogen effector recognition to cell compartment-specific immune responses.

    Science.gov (United States)

    Heidrich, Katharina; Wirthmueller, Lennart; Tasset, Céline; Pouzet, Cécile; Deslandes, Laurent; Parker, Jane E

    2011-12-01

    Pathogen effectors are intercepted by plant intracellular nucleotide binding-leucine-rich repeat (NB-LRR) receptors. However, processes linking receptor activation to downstream defenses remain obscure. Nucleo-cytoplasmic basal resistance regulator EDS1 (ENHANCED DISEASE SUSCEPTIBILITY1) is indispensible for immunity mediated by TIR (Toll-interleukin-1 receptor)-NB-LRR receptors. We show that Arabidopsis EDS1 molecularly connects TIR-NB-LRR disease resistance protein RPS4 recognition of bacterial effector AvrRps4 to defense pathways. RPS4-EDS1 and AvrRps4-EDS1 complexes are detected inside nuclei of living tobacco cells after transient coexpression and in Arabidopsis soluble leaf extracts after resistance activation. Forced AvrRps4 localization to the host cytoplasm or nucleus reveals cell compartment-specific RPS4-EDS1 defense branches. Although nuclear processes restrict bacterial growth, programmed cell death and transcriptional resistance reinforcement require nucleo-cytoplasmic coordination. Thus, EDS1 behaves as an effector target and activated TIR-NB-LRR signal transducer for defenses across cell compartments.

  9. Reduced CAG repeats length in androgen receptor gene is associated with violent criminal behavior.

    Science.gov (United States)

    Rajender, Singh; Pandu, Guguluth; Sharma, J D; Gandhi, K P C; Singh, Lalji; Thangaraj, Kumarasamy

    2008-09-01

    Androgens mediate their functions through androgen receptors (AR). The two triplet repeats in the AR gene (CAG and GGN) are highly polymorphic among various populations and have been extensively studied in diverse clinical conditions and antisocial personality disorders. Several studies have reported either higher levels of testosterone among rapists or the correlation of shorter CAG repeats with criminal activities. However, to date, no study has analyzed AR gene in rapists worldwide, and no study has been conducted on criminals from Indian subcontinent. Therefore, we have analyzed the AR-CAG repeat length in 645 men, of which 241 were convicted for rape, 107 for murder, 26 for both murder and rape, and 271 were control males. The aim was to explore if there was any correlation between CAG repeat length and criminal behavior. The study revealed significantly shorter CAG repeats in the rapists (mean 18.44 repeats) and murderers (mean 17.59 repeats) compared to the control men (mean 21.19 repeats). The criminals who committed murder after rape had a far shorter mean repeat length (mean 17.31 repeats) in comparison to the controls or those convicted of rape or murder alone. In short, our study suggests that the reduced CAG repeats in the AR gene are associated with criminal behavior. This, along with other studies, would help in understanding the biological factors associated with the antisocial or criminal activities.

  10. CAG Repeat Number in the Androgen Receptor Gene and Prostate Cancer.

    Science.gov (United States)

    Madjunkova, S; Eftimov, A; Georgiev, V; Petrovski, D; Dimovski, Aj; Plaseska-Karanfilska, D

    2012-06-01

    Prostate cancer (PC) is the second leading cause of cancer deaths in men. The effects of androgens on prostatic tissue are mediated by the androgen receptor (AR) gene. The 5' end of exon 1 of the AR gene includes a polymorphic CAG triplet repeat that numbers between 10 to 36 in the normal population. The length of the CAG repeats is inversely related to the transactivation function of the AR gene. There is controversy over association between short CAG repeat numbers in the AR gene and PC. This retrospective case-control study evaluates the possible effect of short CAG repeats on the AR gene in prostate cancer risk in Macedonian males. A total of 392 male subjects, 134 PC patients, 106 patients with benign prostatic hyperplasia (BPH) and 152 males from the general Macedonian population were enrolled in this study. The CAG repeat length was determined by fluorescent polymerase chain reaction (PCR) amplification of exon1 of the AR gene followed by capillary electrophoresis (CE) on a genetic analyzer. The mean repeat length in PC patients was 21.5 ± 2.65, in controls 22.28 ± 2.86 (p = 0.009) and in BPH patients 22.1 ± 2.52 (p = 0.038). Short CAG repeats (CAG repeat (CAG repeat length. These results suggest that reduced CAG repeat length may be associated with increased prostate cancer risk in Macedonian men.

  11. The relationship between anogenital distance and the androgen receptor CAG repeat length

    Institute of Scientific and Technical Information of China (English)

    Michael L Eisenberg; Tung-Chin Hsieh; Alexander W Pastuszak; Matthew G McIntyre; Rustin C Walters; Dolores J Lamb; Larry I Lipshultz

    2013-01-01

    Anogenital distance (AGD) is used to define degree of virilization of genital development,with shorter length being associated with feminization and male infertility.The first exon of the androgen receptor (AR) consists of a polymorphic sequence of cytosine-adenine-guanine (CAG) repeats,with longer CAG repeat lengths being associated with decreased receptor function.We sought to determine if there is an association between AGD and AR CAG repeat length.A cross-sectional,prospective cohort of men evaluated at a urology clinic at a single institution was recruited.AGD (the distance from the posterior scrotum to the anal verge) and penile length (PL) were measured.Sanger DNA sequence analysis was used to define CAG repeat length.AGD and CAG repeat lengths in 195 men were determined.On unadjusted analysis,there was no linear relationship between CAG repeat length and PL (P=0.17) or AGD (P=0.31).However,on sub-population analyses,those men with longer CAG repeat lengths (>26) had significantly shorter AGDs compared to men with shorter CAG repeat lengths.For example,the mean AGD was 41.9 vs.32.4 mm with a CAG repeat length ≤ 26 vs.>26 (P=0.01).In addition,when stratifying the cohort based on AGD,those with AGD less than the median (i.e.40 mm) had a longer CAG repeat length compared to men with an AGD >40 mm (P=0.02).In summary,no linear relationship was found between AGD and AR CAG repeat length overall.

  12. The relationship between anogenital distance and the androgen receptor CAG repeat length.

    Science.gov (United States)

    Eisenberg, Michael L; Hsieh, Tung-Chin; Pastuszak, Alexander W; McIntyre, Matthew G; Walters, Rustin C; Lamb, Dolores J; Lipshultz, Larry I

    2013-03-01

    Anogenital distance (AGD) is used to define degree of virilization of genital development, with shorter length being associated with feminization and male infertility. The first exon of the androgen receptor (AR) consists of a polymorphic sequence of cytosine-adenine-guanine (CAG) repeats, with longer CAG repeat lengths being associated with decreased receptor function. We sought to determine if there is an association between AGD and AR CAG repeat length. A cross-sectional, prospective cohort of men evaluated at a urology clinic at a single institution was recruited. AGD (the distance from the posterior scrotum to the anal verge) and penile length (PL) were measured. Sanger DNA sequence analysis was used to define CAG repeat length. AGD and CAG repeat lengths in 195 men were determined. On unadjusted analysis, there was no linear relationship between CAG repeat length and PL (P=0.17) or AGD (P=0.31). However, on sub-population analyses, those men with longer CAG repeat lengths (>26) had significantly shorter AGDs compared to men with shorter CAG repeat lengths. For example, the mean AGD was 41.9 vs. 32.4 mm with a CAG repeat length ≤26 vs. >26 (P=0.01). In addition, when stratifying the cohort based on AGD, those with AGD less than the median (i.e. 40 mm) had a longer CAG repeat length compared to men with an AGD >40 mm (P=0.02). In summary, no linear relationship was found between AGD and AR CAG repeat length overall.

  13. CAG Repeat Number in the Androgen Receptor Gene and Prostate Cancer

    OpenAIRE

    Madjunkova, S.; Eftimov, A.; Georgiev, V.; Petrovski, D; Dimovski, AJ; Plaseska-Karanfilska, D

    2012-01-01

    Prostate cancer (PC) is the second leading cause of cancer deaths in men. The effects of androgens on prostatic tissue are mediated by the androgen receptor (AR) gene. The 5′ end of exon 1 of the AR gene includes a polymorphic CAG triplet repeat that numbers between 10 to 36 in the normal population. The length of the CAG repeats is inversely related to the transactivation function of the AR gene. There is controversy over association between short CAG repeat numbers in the AR gene and PC. Th...

  14. CAG repeat polymorphism in the androgen receptor (AR) gene of SBMA patients and a control group.

    Science.gov (United States)

    Sułek, Anna; Hoffman-Zacharska, Dorota; Krysa, Wioletta; Szirkowiec, Walentyna; Fidziańska, Elzbieta; Zaremba, Jacek

    2005-01-01

    Spinobulbar muscular atrophy (SBMA) is an X-linked form of motor neuron disease characterized by progressive atrophy of the muscles, dysphagia, dysarthria and mild androgen insensitivity. SBMA is caused by CAG repeat expansion in the androgen receptor gene. CAG repeat polymorphism was analysed in a Polish control group (n = 150) and patients suspected of SBMA (n = 60). Normal and abnormal ranges of CAG repeats were established in the control group and in 21 patients whose clinical diagnosis of SBMA was molecularly confirmed. The ranges are similar to those reported for other populations.

  15. Repeated blockade of mineralocorticoid receptors, but not of glucocorticoid receptors impairs food rewarded spatial learning

    NARCIS (Netherlands)

    Douma, BRK; Korte, SM; Buwalda, B; la Fleur, SE; Bohus, B; Luiten, PGM

    1998-01-01

    Corticosteroids from the adrenal cortex influence a variety of behaviours including cognition, learning and memory. These hormones act via two intracellular receptors, the mineralo-corticoid receptor (MR) and the glucocorticoid receptor (GR). These two receptor types display a high concentration and

  16. Repeated blockade of mineralocorticoid receptors, but not of glucocorticoid receptors impairs food rewarded spatial learning

    NARCIS (Netherlands)

    Douma, B.R.; Korte, S.M.; Buwalda, B.; Fleur, la S.E.; Bohus, B.; Luiten, P.G.

    1998-01-01

    Corticosteroids from the adrenal cortex influence a variety of behaviours including cognition, learning and memory. These hormones act via two intracellular receptors, the mineralo-corticoid receptor (MR) and the glucocorticoid receptor (GR). These two receptor types display a high concentration and

  17. CAG repeat length in androgen receptor gene and male infertility in Egyptian patients.

    Science.gov (United States)

    Mosaad, Y M; Shahin, D; Elkholy, A A-M; Mosbah, A; Badawy, W

    2012-02-01

    The CAG repeat and its association with infertility has been debatable. Therefore, this study was planned to assess the distribution of CAG repeat expansion in Egyptian patients and to investigate its association with male infertility. Forty-five infertile men were eligible for the study in addition to 20 aged-matched fertile males as control. Semen analysis, scrotal sonography, assay of serum testosterone, follicle-stimulating hormone (FSH) and luteinising hormone (LH), and determination of the CAG repeat number within exon 1 of the androgen receptor (AR) gene were carried out. Statistically significant difference was found between infertile and control groups regarding sperm count, sperm motility, serum FSH level and CAG repeats (P CAG repeats (P = 1.0) was found between oligozoospermic and asthenospermic groups; negative correlation was found between CAG repeat length and sperm count, and a positive correlation was found between CAG repeat length and serum FSH (P CAG repeat may be associated with lower AR function with derangement of sperm production, and this may contribute to male infertility in Egyptian men.

  18. Pathogen effectors target Arabidopsis EDS1 and alter its interactions with immune regulators.

    Science.gov (United States)

    Bhattacharjee, Saikat; Halane, Morgan K; Kim, Sang Hee; Gassmann, Walter

    2011-12-01

    Plant resistance proteins detect the presence of specific pathogen effectors and initiate effector-triggered immunity. Few immune regulators downstream of resistance proteins have been identified, none of which are known virulence targets of effectors. We show that Arabidopsis ENHANCED DISEASE SUSCEPTIBILITY1 (EDS1), a positive regulator of basal resistance and of effector-triggered immunity specifically mediated by Toll-interleukin-1 receptor-nucleotide binding-leucine-rich repeat (TIR-NB-LRR) resistance proteins, forms protein complexes with the TIR-NB-LRR disease resistance proteins RPS4 and RPS6 and with the negative immune regulator SRFR1 at a cytoplasmic membrane. Further, the cognate bacterial effectors AvrRps4 and HopA1 disrupt these EDS1 complexes. Tight association of EDS1 with TIR-NB-LRR-mediated immunity may therefore derive mainly from being guarded by TIR-NB-LRR proteins, and activation of this branch of effector-triggered immunity may directly connect to the basal resistance signaling pathway via EDS1.

  19. The CAG repeat polymorphism of androgen receptor gene and prostate cancer: a meta-analysis.

    Science.gov (United States)

    Gu, Mingliang; Dong, Xiaoqun; Zhang, Xuezhi; Niu, Wenquan

    2012-03-01

    The association between the polymorphic CAG repeat in androgen receptor gene (AR) and prostate cancer susceptibility has been studied extensively. However, the results are contradictory. The purpose of our meta-analysis was to investigate whether CAG repeat related to prostate cancer risk and had genetic heterogeneity across different geographic regions and study designs. Random-effects model was performed irrespective of between-study heterogeneity. Data and study quality were assessed in duplicate. Publication bias was assessed by the fail-safe number and Egger's test. There were 16 (patients/controls: 2972/3792), 19 (3835/4908) and 12 (3372/2631) study groups for comparisons of ≥ 20, 22 and 23 repeats of CAG sequence, respectively. Compared with CAG repeat repeats had 21% (95% CI: 0.61-1.02; P = 0.076), 5% (95% CI: 0.81-1.11; P = 0.508) and 5% (95% CI: 0.76-1.20; P = 0.681) decreased risk of prostate cancer. After classifying studies by geographic areas, carriers of ≥ 20 repeats had 11% decreased risk in populations from USA, 53% from Europe, and 20% from Asia (P > 0.05), whereas comparison of ≥ 23 repeats with others generated a significant prediction in European populations (OR = 1.17; P = 0.039). Stratification by study designs revealed no material changes in risk estimation. Meta-regression analysis found no significant sources of between-study heterogeneity for age, study design and geographic region for all comparisons. There was no identified publication bias. Taken together, our results demonstrated that AR CAG repeat polymorphism with ≥ 20 repeats might confer a protective effect among the prostate cancer patients with 45 years older but not all the prostate cancer patients.

  20. Polymorphic CAG Repeat and Protein Expression of Androgen Receptor Gene in Colorectal Cancer.

    Science.gov (United States)

    Huang, Rui; Wang, Guiyu; Song, Yanni; Wang, Feng; Zhu, Bing; Tang, Qingchao; Liu, Zheng; Chen, Yinggang; Zhang, Qian; Muhammad, Shan; Wang, Xishan

    2015-04-01

    Although somatic alterations in CAG repeats in the androgen receptor (AR) gene have been suggested to predispose to colorectal cancer, less is known about AR in colorectal cancer carcinogenesis. Because of lack of relevant analysis on CAG repeat length and AR expression in colorectal cancer, we aimed to investigate the prognostic value of polymorphic CAG and protein expression of the AR gene in patients with colorectal cancer. A case-control study was carried out on 550 patients with colorectal cancer and 540 healthy controls to investigate whether polymorphic CAG within the AR gene is linked to increased risk for colorectal cancer. Polymorphic CAG and AR expression were analyzed to clarify their relationship with clinicopathologic and prognostic factors in patients with colorectal cancer. The study showed that the AR gene in patients with colorectal cancer had a longer CAG repeat sequence than those in the control group, as well as increased risk for colorectal cancer among females (P = 0.013), males (P = 0.002), and total colorectal cancer population (P CAG repeat sequence among males (P CAG repeat sequence and negative AR expression were associated with a short 5-year overall survival (OS) rate in colorectal cancer. Long CAG repeat sequences and the absence of AR expression were closely related to the development of colorectal cancer. Both long CAG and decreased AR expression were correlated with the poor 5-year OS in patients with colorectal cancer.

  1. PCR bias in amplification of androgen receptor alleles, a trinucleotide repeat marker used in clonality studies.

    OpenAIRE

    Mutter, G L; Boynton, K A

    1995-01-01

    Trinucleotide CAG repeats in the X-linked human androgen receptor gene (HUMARA) have proved a useful means of determining X chromosome haplotypes, and when combined with methylation analysis of nearby cytosine residues permits identification of non-random X inactivation in tumors of women. Co-amplification of two alleles in a heterozygote generates PCR products which differ in the number of CAG units, and thus their melting and secondary structure characteristics. We have shown that under opt...

  2. Mental rotation in intellectually gifted boys is affected by the androgen receptor CAG repeat polymorphism.

    Science.gov (United States)

    Durdiaková, Jaroslava; Lakatošová, Silvia; Kubranská, Aneta; Laznibatová, Jolana; Ficek, Andrej; Ostatníková, Daniela; Celec, Peter

    2013-08-01

    Testosterone was shown to organize brain and modulate cognitive functions. It is currently unknown whether mental rotation is also associated with prenatal testosterone exposure and testosterone-related genetic polymorphisms. The aim of our study was to analyze associations between mental rotation performance, the actual testosterone levels, the prenatal testosterone level (expressed as 2D:4D ratio) and the androgen receptor CAG repeat polymorphism in intellectually gifted boys. One hundred forty-seven boys aged 10-18 years with IQ>130 were enrolled. Saliva samples were collected and used for ELISA of actual levels of salivary testosterone. The 2D:4D finger length ratio as an indicator of prenatal testosterone was measured on both hands and averaged. Amthauer mental rotation test was used for the assessment of this spatial ability. The CAG repeat polymorphism in the androgen receptor gene was analyzed using PCR and capillary electrophoresis. Linear regression revealed that 2D:4D finger length ratio and the number of CAG repeats in the androgen receptor gene were associated with mental rotation. Actual levels of testosterone did not correlate significantly with mental rotation. Multivariate analysis of covariance revealed that after adjustment of age as a confounding variable, only the effect of the genetic polymorphism was significant. The results are in line with our previous genetic analysis of intellectually gifted boys showing the importance of CAG repeat polymorphism in the androgen receptor gene. Details of the interactions between androgen signaling, testosterone levels and its metabolism especially during the prenatal development of brain function remain to be elucidated. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Larger trinucleotide repeat size in the androgen receptor gene of infertile men with extremely severe oligozoospermia.

    Science.gov (United States)

    Patrizio, P; Leonard, D G; Chen, K L; Hernandez-Ayup, S; Trounson, A O

    2001-01-01

    Androgens are significant regulators of human spermatogenesis. Their action is mediated through the androgen receptor (AR), which binds to the androgen responsive element on DNA and regulates gene transcription. Men become infertile with spinobulbar muscular atrophy (Kennedy disease) caused by a trinucleotide repeat expansion, > or = 40 CAG repeats, in the AR gene located on the X chromosome. In this prospective study, we investigated whether the variable size, larger repeats, of this trinucleotide could alter AR function and result in impaired spermatogenesis. A total of 69 infertile men were studied. Clinical and laboratory analysis showed idiopathic, nonobstructive azoospermia in 16 men, extremely severe oligozoospermia in 27 men (PCR) amplification across the AR repeat region. Accurate size determination of the PCR product using an ABI 373 DNA sequencer allowed precise calculation of CAG repeat sizes. The AR gene was not analyzed for other types of mutations. The difference in CAG repeat size between infertile men and proven fertile controls was statistically significant, P = .03. Patients with extremely severe oligozoospermia had significantly longer CAG repeat tracts (mean, 25.4 +/- 4.0; P = .0005; range 20-39) than controls (mean, 22 +/- 2.8; range 12-30) or patients with severe oligozoospermia (mean, 22.2 +/- 2.3; range 18-26). None of the 26 infertile men with sperm counts CAG repeats compared with 6 out of 45 controls (13%; P = .06). This study suggests that some men with severe impairment of spermatogenesis have longer trinucleotide repeats in the AR gene. Although direct evidence is missing, lower affinity between androgen and the AR protein or decreased AR protein availability with longer repeats could be responsible for a diminished androgen effect on spermatogenesis. Two of the patients in the extremely severe oligozoospermia group had 35 and 39 CAG repeats, respectively (normal range is 11 to 33). Although not yet considered a mutation, longer

  4. CAG repeat length in androgen receptor gene is not associated with amyotrophic lateral sclerosis.

    Science.gov (United States)

    Bruson, A; Sambataro, F; Querin, G; D'Ascenzo, C; Palmieri, A; Agostini, J; Gaiani, A; Angelini, C; Galbiati, M; Poletti, A; Pennuto, M; Pegoraro, E; Clementi, M; Soraru, G

    2012-10-01

    Epidemiological and clinical studies show higher prevalence of amyotrophic lateral sclerosis (ALS) in males than in females and more severe lesions in androgen receptor (AR)-expressing tissues. The AR gene contains a polymorphic CAG trinucleotide repeat, whose expansion over a certain threshold is toxic to motor neurons, causing spinal and bulbar muscular atrophy (SBMA). We tested the hypothesis that the AR CAG repeat linked to SBMA is a risk factor for ALS. We analyzed AR CAG expansions in 336 patients with ALS and 100 controls. We found a negative association of AR CAG expansions with ALS susceptibility, clinical presentation, and survival. Our findings do not support a role of the AR CAG repeat length in ALS. © 2012 The Author(s) European Journal of Neurology © 2012 EFNS.

  5. Androgen receptor gene CAG repeat polymorphism and ovarian cancer risk: A meta-analysis.

    Science.gov (United States)

    Deng, Yang; Wang, Jue; Wang, Ling; Du, Yan

    2017-02-28

    Ovarian cancer is one of the common gynecological malignancies worldwide. It is usually diagnosed at a later stage, thus missing the best opportunity for treatment. Despite the advancement of ovarian cancer treatment, the prognosis is still poor. Androgen receptor (AR) may play a role in ovarian carcinogenesis. Previous studies regarding the association between AR CAG repeat length and ovarian cancer risk reported inconsistent results. Therefore, we conducted a meta-analysis to evaluate the association between AR CAG repeat length and ovarian cancer risk following the MOOSE guidelines. PubMed, Web of Science, EBSCO and other databases were searched up to September 15(th) 2016. Case control studies with clear definition of CAG repeat length and detailed genotype information were included. Two authors independently reviewed and extracted data. Pooled analysis and subgroup analysis stratified by ethnicity were performed for different genetic models. Begg's funnel plot and Egger's test were performed for publication bias estimation. Overall, there was no association between the AR CAG repeat polymorphism and ovarian cancer risk. However, short CAG repeat polymorphism was associated with increased ovarian cancer risk in African Americans and Chinese under the dominant model, whereas a reverse association was observed in Caucasians and Italians under the other three models. Our study results should be interpreted with caution. Further well-designed epidemiological and functional studies are needed to elucidate the role of AR in ovarian carcinogenesis.

  6. Effects of Repeated Ethanol Exposures on NMDA Receptor Expression and Locomotor Sensitization in Mice Expressing Ethanol Resistant NMDA Receptors

    Science.gov (United States)

    den Hartog, Carolina R.; Gilstrap, Meghin; Eaton, Bethany; Lench, Daniel H.; Mulholland, Patrick J.; Homanics, Gregg. E.; Woodward, John J.

    2017-01-01

    Evidence from a large number of preclinical studies suggests that chronic exposure to drugs of abuse, such as psychostimulants or ethanol induces changes in glutamatergic transmission in key brain areas associated with reward and control of behavior. These changes include alterations in the expression of ionotropic glutamate receptors including N-methyl-D-aspartate receptors (NMDAR) that are important for regulating neuronal activity and synaptic plasticity. NMDA receptors are inhibited by ethanol and reductions in NMDA-mediated signaling are thought to trigger homestatic responses that limit ethanol's effects on glutamatergic transmission. Following repeated exposures to ethanol, these homeostatic responses may become unstable leading to an altered glutamatergic state that contributes to the escalations in drinking and cognitive deficits observed in alcohol-dependent subjects. An important unanswered question is whether ethanol-induced changes in NMDAR expression are modulated by the intrinsic sensitivity of the receptor to ethanol. In this study, we examined the effects of ethanol on NMDAR subunit expression in cortical (orbitofrontal, medial prefrontal), striatal (dorsal and ventral striatum) and limbic (dorsal hippocampus, basolateral amygdala) areas in mice genetically modified to express ethanol-resistant receptors (F639A mice). These mice have been previously shown to drink more ethanol than their wild-type counterparts and have altered behavioral responses to certain actions of ethanol. Following long-term voluntary drinking, F639A mice showed elevations in GluN2A but not GluN1 or GluN2B expression as compared to wild-type mice. Mice treated with repeated injections with ethanol (2–3.5 g/kg; i.p.) showed changes in NMDAR expression that varied in a complex manner with genotype, brain region, subunit type and exposure protocol all contributing to the observed response. F639A mice, but not wild-type mice, showed enhanced motor activity following repeated

  7. Diversity in the androgen receptor CAG repeat has been shaped by a multistep mutational mechanism.

    Science.gov (United States)

    Santos, Diana; Pimenta, João; Wong, Virginia C N; Amorim, António; Martins, Sandra

    2014-10-01

    The androgen receptor (AR) gene encodes a type of nuclear receptor that functions as a steroid-hormone activated transcription factor. In its coding region, AR includes a CAG repeat, which has been intensely studied due to the inverse correlation between repeat size and AR transcriptional activity. Several studies have reported different (CAG)n sizes associated with the risk of androgen-linked diseases. We aimed at clarifying the mechanisms on the origin of newly CAG sized alleles through a strategy involving the analysis of the associated haplotype diversity. We genotyped 374 control individuals of European and Asian ancestry, and reconstructed the haplotypes associated with the CAG repeat, defined by 10 SNPs and 6 flanking STRs. The most powerful SNPs to tag AR lineages are rs7061037-rs12012620 and rs34191540-rs6625187-rs2768578 in Europeans and Asians, respectively. In the most frequent AR lineage, (CAG)18 alleles seem to have been generated by a multistep mutation mechanism, most probably from longer alleles. We further noticed that the DXS1194-DXS1111 haplotype, in linkage disequilibrium with AR-(CAG)n expanded alleles responsible for spinal bulbar muscular atrophy (SBMA), is rare among our controls; however, the haplotype strategy here described may be used to clarify the origin of expansions in other populations, as in future association studies.

  8. Low Density Lipoprotein Receptor Class A Repeats Are O-Glycosylated in Linker Regions

    DEFF Research Database (Denmark)

    Pedersen, Nis Borbye; Wang, Shengjun; Narimatsu, Yoshiki;

    2014-01-01

    , which in wild-type CHO cells is glycosylated with the typical sialylated core 1 structure. The glycosites in linker regions of LDLR class A repeats are conserved in LDLR from man to Xenopus and found in other homologous receptors. O-Glycosylation is controlled by a large family of polypeptide GalNAc...... transferases. Probing into which isoform(s) contributed to glycosylation of the linker regions of the LDLR class A repeats by in vitro enzyme assays suggested a major role of GalNAc-T11. This was supported by expression of LDLR in HEK293 cells, where knock-out of the GalNAc-T11 isoform resulted in the loss...

  9. Androgen receptor gene CAG and GGN repeat polymorphisms in Chilean men with primary severe spermatogenic failure.

    Science.gov (United States)

    Castro-Nallar, Eduardo; Bacallao, Ketty; Parada-Bustamante, Alexis; Lardone, María C; López, Patricia V; Madariaga, Marcia; Valdevenito, Raúl; Piottante, Antonio; Ebensperger, Mauricio; Castro, Andrea

    2010-01-01

    There is ample documentation supporting the fact that androgens are required for normal spermatogenesis. A minority of infertile men have abnormal testosterone blood levels or mild androgen receptor mutations. We investigated the androgen receptor CAG and GGN repeat lengths in Chilean men with spermatogenic impairment. We studied 117 secretory azoospermic/oligozoospermic men (93 idiopathic and 24 excryptorchidic), without Y-chromosome microdeletions, and 121 controls with normal spermatogenesis (42 obstructive and 79 normozoospermic men). Peripheral blood was drawn to obtain genomic DNA for polymerase chain reaction and automated sequencing of CAG and GGN repeats. Testicular characterization included hormonal studies, physical evaluation, and seminal and biopsy analysis. The CAG and GGN polymorphism distributions were similar among idiopathic men, excryptorchidic men, and controls and among the different types of spermatogenic impairment. However, the proportion of the CAG 21 allele was significantly increased in idiopathic cases compared to controls (P = .012 by Bonferroni test, odds ratio = 2.99, 95% confidence interval, 1.27-7.0) and the CAG 32 allele only was observed in excryptorchidic patients (P CAG 21 allele (P = .024, χ(2) test). On the other hand, in idiopathic cases and controls the most common GGN allele was 23, followed by 24, but an inverse relation was found among excryptorchidic cases. The joint distribution of CAG and GGN in control, idiopathic, and excryptorchidic groups did not show an association between the 2 allele repeat polymorphisms (P > 0.05, χ(2) test). Our results suggest that the CAG 21 allele seems to increase the risk of idiopathic Sertoli cell-only syndrome. Moreover, the GGN 24 allele could be contributing to deranged androgen receptor function, associated with cryptorchidism and spermatogenic failure.

  10. Long CAG Repeat Sequence and Protein Expression of Androgen Receptor Considered as Prognostic Indicators in Male Breast Carcinoma

    OpenAIRE

    Yan-Ni Song; Jing-Shu Geng; Tong Liu; Zhen-Bin Zhong; Yang Liu; Bing-Shu Xia; Hong-Fei Ji; Xiao-Mei Li; Guo-Qiang Zhang; Yan-Lv Ren; Zhi-Gao Li; Da Pang

    2012-01-01

    BACKGROUND: The androgen receptor (AR) expression and the CAG repeat length within the AR gene appear to be involved in the carcinogenesis of male breast carcinoma (MBC). Although phenotypic differences have been observed between MBC and normal control group in AR gene, there is lack of correlation analysis between AR expression and CAG repeat length in MBC. The purpose of the study was to investigate the prognostic value of CAG repeat lengths and AR protein expression. METHODS: 81 tumor tiss...

  11. Molecular diversity at the plant-pathogen interface.

    Science.gov (United States)

    McDowell, John M; Simon, Stacey A

    2008-01-01

    Plants have evolved a robust innate immune system that exhibits striking similarities as well as significant differences with various metazoan innate immune systems. For example, plants are capable of perceiving pathogen-associated molecular patterns through pattern recognition receptors that bear structural similarities to animal Toll-like receptors. In addition, plants have evolved a second surveillance system based on cytoplasmic "NB-LRR" proteins (nucleotide-binding, leucine-rich repeat) that are structurally similar to animal nucleotide-binding and oligomerization domain (NOD)-like receptors. Plant NB-LRR proteins do not detect PAMPs; rather, they perceive effector proteins that pathogens secrete into plant cells to promote virulence. This review summarizes the current state of knowledge about the molecular functionality and evolution of these immune surveillance genes.

  12. Structure-function Aspects of Extracellular Leucine-rich Repeat-containing Cell Surface Receptors in Plants

    Institute of Scientific and Technical Information of China (English)

    Zhao Zhang; Bart PHJ Thomma

    2013-01-01

    Plants exploit several types of cell surface receptors for perception of extracellular signals, of which the extracellular leucine-rich repeat (eLRR)-containing receptors form the major class. Although the function of most plant eLRR receptors remains unclear, an increasing number of these receptors are shown to play roles in innate immunity and a wide variety of developmental processes. Recent efforts using domain swaps, gene shuffling analyses, site-directed mutagenesis, interaction studies, and crystallographic analyses resulted in the current knowledge on ligand binding and the mechanism of activation of plant eLRR receptors. This review provides an overview of eLRR receptor research, specifically summarizing the recent understanding of interactions among plant eLRR receptors, their co-receptors and corresponding ligands. The functions of distinct eLRR receptor domains, and their role in structure, ligand perception and multimeric complex formation are discussed.

  13. Nuclear Receptor HNF4α Binding Sequences are Widespread in Alu Repeats

    Directory of Open Access Journals (Sweden)

    Bolotin Eugene

    2011-11-01

    Full Text Available Abstract Background Alu repeats, which account for ~10% of the human genome, were originally considered to be junk DNA. Recent studies, however, suggest that they may contain transcription factor binding sites and hence possibly play a role in regulating gene expression. Results Here, we show that binding sites for a highly conserved member of the nuclear receptor superfamily of ligand-dependent transcription factors, hepatocyte nuclear factor 4alpha (HNF4α, NR2A1, are highly prevalent in Alu repeats. We employ high throughput protein binding microarrays (PBMs to show that HNF4α binds > 66 unique sequences in Alu repeats that are present in ~1.2 million locations in the human genome. We use chromatin immunoprecipitation (ChIP to demonstrate that HNF4α binds Alu elements in the promoters of target genes (ABCC3, APOA4, APOM, ATPIF1, CANX, FEMT1A, GSTM4, IL32, IP6K2, PRLR, PRODH2, SOCS2, TTR and luciferase assays to show that at least some of those Alu elements can modulate HNF4α-mediated transactivation in vivo (APOM, PRODH2, TTR, APOA4. HNF4α-Alu elements are enriched in promoters of genes involved in RNA processing and a sizeable fraction are in regions of accessible chromatin. Comparative genomics analysis suggests that there may have been a gain in HNF4α binding sites in Alu elements during evolution and that non Alu repeats, such as Tiggers, also contain HNF4α sites. Conclusions Our findings suggest that HNF4α, in addition to regulating gene expression via high affinity binding sites, may also modulate transcription via low affinity sites in Alu repeats.

  14. Leucine-rich repeat-containing G-protein-coupled receptors as markers of adult stem cells

    NARCIS (Netherlands)

    Barker, N.; Clevers, H.

    2010-01-01

    Molecular markers are used to characterize and track adult stem cells. Colon cancer research has led to the identification of 2 related receptors, leucine-rich repeat-containing, G-protein-coupled receptors (Lgr)5 and Lgr6, that are expressed by small populations of cells in a variety of adult organ

  15. Polymorphic CAG and GGC repeat lengths in the androgen receptor gene and prostate cancer risk: analysis of a Brazilian population.

    Science.gov (United States)

    Silva Neto, Brasil; Koff, Walter J; Biolchi, Vanderlei; Brenner, Cleber; Biolo, Karlo D; Spritzer, Poli Mara; Brum, Ilma S

    2008-02-01

    Variations in transcriptional activity of the androgen receptor (AR) are related to polymorphic CAG and GGC repeats in exon 1 of the AR gene. We investigated the association between CAG and GGC repeat length and the risk of prostate cancer in a case-control study from a Brazilian population. We evaluated 49 patients and 51 healthy controls. DNA was extracted from peripheral leukocytes and the AR gene was analyzed by fragment analysis (GeneMapper software, Applied Biosystems, Foster City, California, USA). CAG and GGC mean lengths were not different between cases and controls. The risk for prostate cancer was higher for CAG repeats repeat lengths (CAG + GGC) repeats ( 17) were not associated with risk for prostate cancer (OR = 1.13 [95% CI 0.47-2.75]). In conclusion, fewer number of CAG repeats and total repeats (CAG + GGC) in the AR gene may be associated with increased risk for prostate cancer.

  16. Elimination of progressive mammary cancer by repeated administrations of chimeric antigen receptor-modified T cells.

    Science.gov (United States)

    Globerson-Levin, Anat; Waks, Tova; Eshhar, Zelig

    2014-05-01

    Continuous oncogenic processes that generate cancer require an on-going treatment approach to eliminate the transformed cells, and prevent their further development. Here, we studied the ability of T cells expressing a chimeric antibody-based receptor (CAR) to offer a therapeutic benefit for breast cancer induced by erbB-2. We tested CAR-modified T cells (T-bodies) specific to erbB-2 for their antitumor potential in a mouse model overexpressing a human erbB-2 transgene that develops mammary tumors. Comparing the antitumor reactivity of CAR-modified T cells under various therapeutic settings, either prophylactic, prior to tumor development, or therapeutically. We found that repeated administration of CAR-modified T cells is required to eliminate spontaneously developing mammary cancer. Systemic, as well as intratumoral administered CAR-modified T cells accumulated at tumor sites and eventually eliminated the malignant cells. Interestingly, within a few weeks after a single CAR T cells' administration, and rejection of primary lesion, tumors usually relapsed both in treated mammary gland and at remote sites; however, repeated injections of CAR-modified T cells were able to control the secondary tumors. Since spontaneous tumors can arise repeatedly, especially in the case of syndromes characterized by specific susceptibility to cancer, multiple administrations of CAR-modified T cells can serve to control relapsing disease.

  17. Comparative sequence analysis of leucine-rich repeats (LRRs within vertebrate toll-like receptors

    Directory of Open Access Journals (Sweden)

    Taga Masae

    2007-05-01

    Full Text Available Abstract Background Toll-like receptors (TLRs play a central role in innate immunity. TLRs are membrane glycoproteins and contain leucine rich repeat (LRR motif in the ectodomain. TLRs recognize and respond to molecules such as lipopolysaccharide, peptidoglycan, flagellin, and RNA from bacteria or viruses. The LRR domains in TLRs have been inferred to be responsible for molecular recognition. All LRRs include the highly conserved segment, LxxLxLxxNxL, in which "L" is Leu, Ile, Val, or Phe and "N" is Asn, Thr, Ser, or Cys and "x" is any amino acid. There are seven classes of LRRs including "typical" ("T" and "bacterial" ("S". All known domain structures adopt an arc or horseshoe shape. Vertebrate TLRs form six major families. The repeat numbers of LRRs and their "phasing" in TLRs differ with isoforms and species; they are aligned differently in various databases. We identified and aligned LRRs in TLRs by a new method described here. Results The new method utilizes known LRR structures to recognize and align new LRR motifs in TLRs and incorporates multiple sequence alignments and secondary structure predictions. TLRs from thirty-four vertebrate were analyzed. The repeat numbers of the LRRs ranges from 16 to 28. The LRRs found in TLRs frequently consists of LxxLxLxxNxLxxLxxxxF/LxxLxx ("T" and sometimes short motifs including LxxLxLxxNxLxxLPx(xLPxx ("S". The TLR7 family (TLR7, TLR8, and TLR9 contain 27 LRRs. The LRRs at the N-terminal part have a super-motif of STT with about 80 residues. The super-repeat is represented by STTSTTSTT or _TTSTTSTT. The LRRs in TLRs form one or two horseshoe domains and are mostly flanked by two cysteine clusters including two or four cysteine residue. Conclusion Each of the six major TLR families is characterized by their constituent LRR motifs, their repeat numbers, and their patterns of cysteine clusters. The central parts of the TLR1 and TLR7 families and of TLR4 have more irregular or longer LRR motifs. These

  18. alpha(7) Nicotinic acetylcholine receptor activation prevents behavioral and molecular changes induced by repeated phencyclidine treatment

    DEFF Research Database (Denmark)

    Thomsen, Morten Skøtt; Christensen, Ditte Z; Hansen, Henrik H;

    2009-01-01

    , and administration of the NMDA-antagonist phencyclidine (PCP) in rodents is a well validated model of such cognitive deficits. Here we show that repeated PCP treatment (10 mg/kg/day for 10 days) decreased the expression of parvalbumin and synaptophysin mRNA in the mouse PFC, which corresponds to changes seen...... in patients with schizophrenia. In addition, PCP increased the basal mRNA expression in the PFC of the activity-regulated cytoskeleton-associated protein (Arc), a molecule involved in synaptic plasticity. These molecular changes produced by PCP were accompanied by a behavioral impairment as determined...... in a modified Y-maze test. Polymorphisms in the alpha(7) nicotinic acetylcholine receptor (nAChR) gene have been linked to schizophrenia. Here we demonstrate that acute administration of the selective alpha(7) nAChR partial agonist SSR180711 dose-dependently reversed the behavioral impairment induced by PCP...

  19. Estrogen receptor alpha dinucleotide repeat polymorphism in Japanese patients with autoimmune thyroid diseases

    Directory of Open Access Journals (Sweden)

    Tozaki Teruaki

    2000-11-01

    Full Text Available Abstract Background The autoimmune thyroid diseases (AITDs, comprising Graves' disease (GD and Hashimoto's thyroiditis (HT, appear to develop as a result of complex interactions between predisposing genes and environmental triggers. Susceptibility to AITDs is conferred by genes in the human leukocyte antigen (HLA and genes unlinked to HLA, including the CTLA-4 gene. Recently, an association to some estrogen receptor (ERα genotypes with breast cancer, hypertension, osteoporosis, generalized osteoarthritis, and some autoimmune diseases such as rheumatoid arthritis has been reported. We have analyzed a dinucleotide (TAn repeat polymorphism lying upstream of the human ERα gene in patients with AITDs and in normal subjects. Results Seventeen different alleles were found in 130 patients with GD, 93 patients with HT, and 190 control subjects. There was no significant difference in the distributions of ERα alleles between patients and controls. Conclusions The present results do not support an association between the ERα gene and AITD in the Japanese population.

  20. Genetic Association Between Androgen Receptor Gene CAG Repeat Length Polymorphism and Male Infertility: A Meta-Analysis.

    Science.gov (United States)

    Pan, Bihui; Li, Rui; Chen, Yao; Tang, Qiuqin; Wu, Wei; Chen, Liping; Lu, Chuncheng; Pan, Feng; Ding, Hongjuan; Xia, Yankai; Hu, Lingqing; Chen, Daozhen; Sha, Jiahao; Wang, Xinru

    2016-03-01

    The association between polymorphism of androgen receptor gene CAG (AR-CAG) and male infertility in several studies was controversial. Based on studies on association between AR-CAG repeat length and male infertility in recent years, an updated meta-analysis is needed. We aimed to evaluate the association between AR-CAG repeat length and male infertility in advantage of the data in all published reports.We searched for reports published before August 2015 using PubMed, CNKI, VIP, and WanFang. Data on sample size, mean, and standard deviation (SD) of AR-CAG repeat length were extracted independently by 3 investigators.Forty-four reports were selected based on criteria. The overall infertile patients and azoospermic patients were found to have longer AR-CAG repeat length (standard mean difference (SMD) = 0.19, 95% confidence interval (CI): 0.10-0.28, P CAG repeat length was longer in infertile men in Asian, Caucasian, and mixed races (SMD = 0.25, 95% CI: 0.08-0.43, P CAG repeat length was associated with male infertility. The subgroup study on races shows that increased AR-CAG repeat length was associated with male infertility in Asian, Caucasian, and mixed races. Increased AR-CAG repeat length was also associated with azoospermia.This meta-analysis supports that increased androgen receptor CAG length is capable of causing male infertility susceptibility.

  1. Long CAG repeat sequence and protein expression of androgen receptor considered as prognostic indicators in male breast carcinoma.

    Directory of Open Access Journals (Sweden)

    Yan-Ni Song

    Full Text Available BACKGROUND: The androgen receptor (AR expression and the CAG repeat length within the AR gene appear to be involved in the carcinogenesis of male breast carcinoma (MBC. Although phenotypic differences have been observed between MBC and normal control group in AR gene, there is lack of correlation analysis between AR expression and CAG repeat length in MBC. The purpose of the study was to investigate the prognostic value of CAG repeat lengths and AR protein expression. METHODS: 81 tumor tissues were used for immunostaining for AR expression and CAG repeat length determination and 80 normal controls were analyzed with CAG repeat length in AR gene. The CAG repeat length and AR expression were analyzed in relation to clinicopathological factors and prognostic indicators. RESULTS: AR gene in many MBCs has long CAG repeat sequence compared with that in control group (P = 0.001 and controls are more likely to exhibit short CAG repeat sequence than MBCs. There was statistically significant difference in long CAG repeat sequence between AR status for MBC patients (P = 0.004. The presence of long CAG repeat sequence and AR-positive expression were associated with shorter survival of MBC patients (CAG repeat: P = 0.050 for 5y-OS; P = 0.035 for 5y-DFS AR status: P = 0.048 for 5y-OS; P = 0.029 for 5y-DFS, respectively. CONCLUSION: The CAG repeat length within the AR gene might be one useful molecular biomarker to identify males at increased risk of breast cancer development. The presence of long CAG repeat sequence and AR protein expression were in relation to survival of MBC patients. The CAG repeat length and AR expression were two independent prognostic indicators in MBC patients.

  2. Genetic screening in infertile Mexican men: chromosomal abnormalities, Y chromosome deletions, and androgen receptor CAG repeat length.

    Science.gov (United States)

    Martínez-Garza, Sandra Guadalupe; Gallegos-Rivas, Mayra Celina; Vargas-Maciel, Marcos; Rubio-Rubio, Juan Manuel; de Los Monteros-Rodríguez, Mario Espinosa; González-Ortega, Claudia; Cancino-Villarreal, Patricia; de Lara, Luis G Vazquez; Gutiérrez-Gutiérrez, Antonio Martín

    2008-01-01

    In our study, we analyzed chromosomal abnormalities, Y chromosome deletions, androgen receptor CAG repeat length and their association with defective spermatogenesis in infertile Mexican men. Eighty-two infertile patients and 40 controls were screened for karyotypic abnormalities, Y chromosome microdeletions, and CAG repeats. Nine infertile males (11%) carried chromosomal abnormalities and 10 (12.2%) presented Y chromosome microdeletions. The mean CAG repeat length was 21.6 and 20.88 base pairs in idiopathic infertile males and controls, respectively. Our results suggest that chromosomal aberrations and Y-chromosomal microdeletions are related to male infertility in Mexican men. In addition, expansion of the CAG repeat segments of the androgen receptor is not correlated with male idiopathic infertility.

  3. Repeat length variation in the dopamine D4 receptor gene shows no evidence of association with schizophrenia

    Energy Technology Data Exchange (ETDEWEB)

    Daniels, J.; Williams, J.; Asherson, P. [Univ. of Wales College of Medicine, Cardiff (United Kingdom)] [and others

    1994-09-15

    The D4 receptor has been shown to exist in several allelic forms reflecting variation in the number of 48 base-pair sequence repeats in the putative cytoplasmic loop. We report a comparison of repeat length variation between schizophrenic patients and controls. Our sample of 106 unrelated schizophrenic cases and 119 controls showed no significant differences in allele or genotype distribution between patients and controls. In particular, we were unable to support the previous observation of an excess of 4-repeat homozygotes in patients. 16 refs., 2 tabs.

  4. Impact of CAG repeat length in the androgen receptor gene on male infertility - a meta-analysis.

    Science.gov (United States)

    Xiao, Feifan; Lan, Aihua; Lin, Zhidi; Song, Jianfei; Zhang, Yuening; Li, Jiatong; Gu, Kailong; Lv, Baihao; Zhao, Dong; Zeng, Siping; Zhang, Ruoheng; Zhao, Wei; Pan, Zhengyan; Deng, Xiaozhen; Yang, Xiaoli

    2016-07-01

    CAG repeats are polymorphic nucleotide repeats present in the androgen receptor gene. Many studies have estimated the association between CAG repeat length and male infertility, but the conclusions are controversial. Previous meta-analyses have come to different conclusions; however, new studies have been published. An updated meta-analysis was conducted. PubMed, CBM, CNKI and Web of Science databases were systematically searched for studies published from 1 January 2000 to 1 October 2015. Case-control studies on the association between CAG repeat length and male infertility using appropriate methodology were included. Forty studies were selected, including 3858 cases and 3161 controls. Results showed statistically significantly longer CAG repeat length among cases compared with controls (SMD = 0.14; 95% CI, 0.02-0.26). Shorter repeat length was associated with a lower risk of male infertility compared with a longer repeat length in the overall analysis (OR = 0.79, 95% CI: 0.66-0.95). Moreover, CAG repeat length was associated with male infertility in Caucasian populations, but not Asian or Egyptian populations. Subgroup analysis revealed no significant difference in German populations, but CAG repeat length was associated with male infertility in China and the USA. There were no significant differences between cases and controls in azoospermia and severe oligozoospermia.

  5. Predictive value of GGN and CAG repeat polymorphisms of androgen receptors in testicular cancer: a meta-analysis.

    Science.gov (United States)

    Jiang, Weijun; Zhang, Jing; Zhou, Qing; Liu, Shuaimei; Ni, Mengxia; Zhu, Peiran; Wu, Qiuyue; Li, Weiwei; Zhang, Mingchao; Xia, Xinyi

    2016-03-22

    The risk of testicular cancer (TC) is markedly increased in subjects with androgen insensitivity, and previous studies have proposed that GGN and CAG repeats in androgen receptors (AR) could be related to the risk of TC. To evaluate the association between the length of GGN and CAG repeats in AR and TC, a meta-analysis involving 3255 TC cases and 2804 controls was performed. The results suggested that long GGN repeats are associated with an increased risk of TC compared with those analysis revealed that this association occurred in studies with case sizes > 200, and in the mid-latitude, and seminoma subgroups. The subgroup analysis based on populations, high-latitude, and seminomas/non-seminomas suggested that AR CAG repeat polymorphisms with > 25 and 25 repeats might confer a protective effect to the patients with TC (in the high-latitude subgroup analysis, for > 25 vs. 21-25: OR = 0.54, 95% CI = 0.41-0.70). In contrast, an increased risk of TC was observed for AR CAG repeat polymorphisms with > 25 and 25 repeats in the mid-latitude subgroup (for > 25 vs. 21-25: OR = 1.65, 95% CI = 1.09-2.50). In addition, no associations between the remaining subgroups and male infertility were observed. In short, this meta-analysis suggested that AR GGN and CAG repeat polymorphisms may be involved in the etiology of TC.

  6. Androgen receptor CAG repeats length polymorphism and the risk of polycystic ovarian syndrome (PCOS.

    Directory of Open Access Journals (Sweden)

    Singh Rajender

    Full Text Available OBJECTIVE: Polycystic ovarian syndrome (PCOS refers to an inheritable androgen excess disorder characterized by multiple small follicles located at the ovarian periphery. Hyperandrogenism in PCOS, and inverse correlation between androgen receptor (AR CAG numbers and AR function, led us to hypothesize that CAG length variations may affect PCOS risk. METHODS: CAG repeat region of 169 patients recruited following strictly defined Rotterdam (2003 inclusion criteria and that of 175 ethnically similar control samples, were analyzed. We also conducted a meta-analysis on the data taken from published studies, to generate a pooled estimate on 2194 cases and 2242 controls. RESULTS: CAG bi-allelic mean length was between 8.5 and 24.5 (mean = 17.43, SD = 2.43 repeats in the controls and between 11 and 24 (mean = 17.39, SD = 2.29 repeats in the cases, without any significant difference between the two groups. Further, comparison of bi-allelic mean and its frequency distribution in three categories (short, moderate and long alleles did not show any significant difference between controls and various case subgroups. Frequency distribution of bi-allelic mean in two categories (extreme and moderate alleles showed over-representation of extreme sized alleles in the cases with marginally significant value (50.3% vs. 61.5%, χ(2 = 4.41; P = 0.036, which turned insignificant upon applying Bonferroni correction for multiple comparisons. X-chromosome inactivation analysis showed no significant difference in the inactivation pattern of CAG alleles or in the comparison of weighed bi-allelic mean between cases and controls. Meta-analysis also showed no significant correlation between CAG length and PCOS risk, except a minor over-representation of short CAG alleles in the cases. CONCLUSION: CAG bi-allelic mean length did not differ between controls and cases/case sub-groups nor did the allele distribution. Over-representation of short

  7. Responsiveness of 5-HT2C receptors in repeatedly diazepam-injected rats: a behavioral and neurochemical study.

    Science.gov (United States)

    Khan, Asma; Haleem, Darakhshan J

    2008-01-01

    The role of 5-hydroxytryptamine (serotonin; 5-HT)2C receptors in anxiety and the anxiolytic effects of drugs is well documented. In view of the withdrawal anxiety associated with repeated diazepam intake, the present study concerns the efficacy of 5-HT2C receptors in rats treated with diazepam. Results show that diazepam injections at a dose of 2 mg/kg daily for two weeks increased weekly food intake and growth rate. Anxiolytic effects of the drug monitored in a light/dark activity box were not significant after single administration. One week and two weeks of administration elicited anxiolytic effects, which were smaller after two weeks of administration as compared to one week, suggesting the development of tolerance to the anxiolytic profile of diazepam. Moreover, three days' withdrawal from repeated administration elicited anxiogenic behavior in the light/dark activity box. The behavioral and neurochemical effects of 1-(m-chlorophenyl)piperazine (m-CPP) (3 mg/kg), a 5-HT2C agonist, were monitored following withdrawal (three days) from two weeks of diazepam administration. Results showed that hypophagic as well as anxiogenic-like effects of m-CPP were not different from repeated saline or repeated diazepam-injected animals. Administration of m-CPP increased 5-HT metabolism in repeated saline as well as repeated diazepam-injected animals. However, m-CPP-induced increases in 5-HT metabolism were greater in repeated diazepam-injected animals. Results are discussed in the context of the role of 5-HT2C receptors in the precipitation of withdrawal anxiety.

  8. Repeated potentiation of the metabotropic glutamate receptor 5 and the alpha 7 nicotinic acetylcholine receptor modulates behavioural and GABAergic deficits induced by early postnatal phencyclidine (PCP) treatment

    DEFF Research Database (Denmark)

    Kjaerby, Celia; Bundgaard, Christoffer; Fejgin, Kim;

    2013-01-01

    treatment, pyramidal neurons displayed a reduced mIPSC frequency and up-regulation of extrasynaptic THIP-induced current. ADX47273 treatment restored this up-regulation of THIP-induced current. Reduced receptor function seems to be the underlying cause of the reported changes, since repeated treatment...

  9. PCR bias in amplification of androgen receptor alleles, a trinucleotide repeat marker used in clonality studies.

    Science.gov (United States)

    Mutter, G L; Boynton, K A

    1995-04-25

    Trinucleotide CAG repeats in the X-linked human androgen receptor gene (HUMARA) have proved a useful means of determining X chromosome haplotypes, and when combined with methylation analysis of nearby cytosine residues permits identification of non-random X inactivation in tumors of women. Co-amplification of two alleles in a heterozygote generates PCR products which differ in the number of CAG units, and thus their melting and secondary structure characteristics. We have shown that under optimal conditions amplification efficiency of two HUMARA alleles is near-equivalent, generating PCR products in a ratio proportional to that of the genomic template. In contrast, reduction of template quantity, damage of template by ultraviolet irradiation or addition of monovalent salts (sodium chloride, sodium acetate or ammonium acetate) produces highly variable imbalances of allelic PCR products, with a strong tendency to preferentially amplify lower molecular weight alleles. Variability and biasing was diminished by substitution of 7-deaza-2'-dGTP for dGTP during amplification, an intervention which reduces stability of intramolecular and intermolecular GC base pairing. We conclude that DNA which is scanty, damaged or salt contaminated may display amplification bias of GC-rich PCR targets, potentially confounding accurate interpretation or reproducibility of assays which require co-amplification of alleles.

  10. CAG repeat polymorphisms in the androgen receptor and breast cancer risk in women: a meta-analysis of 17 studies.

    Science.gov (United States)

    Mao, Qixing; Qiu, Mantang; Dong, Gaochao; Xia, Wenjie; Zhang, Shuai; Xu, Youtao; Wang, Jie; Rong, Yin; Xu, Lin; Jiang, Feng

    2015-01-01

    The association between polymorphic CAG repeats in the androgen receptor gene in women and breast cancer susceptibility has been studied extensively. However, the conclusions regarding this relationship remain conflicting. The purpose of this meta-analysis was to identify whether androgen receptor CAG repeat lengths were related to breast cancer susceptibility. The MEDLINE, PubMed, and EMBASE databases were searched through to December 2014 to identify eligible studies. Data and study quality were rigorously assessed by two investigators according to the Newcastle-Ottawa Quality Assessment Scale. The publication bias was assessed by the Begg's test. Seventeen eligible studies were included in this meta-analysis. The overall analysis suggested no association between CAG polymorphisms and breast cancer risk (odds ratio [OR] 1.031, 95% confidence interval [CI] 0.855-1.245). However, in the subgroup analysis, we observed that long CAG repeats significantly increased the risk of breast cancer in the Caucasian population (OR 1.447, 95% CI 1.089-1.992). Additionally, the risk was significantly increased in Caucasian women carrying two alleles with CAG repeats ≥22 units compared with those with two shorter alleles (OR 1.315, 95% CI 1.014-1.707). These findings suggest that long CAG repeats increase the risk of breast cancer in Caucasian women. However, larger scale case-control studies are needed to validate our results.

  11. Genetic Association Between Androgen Receptor Gene CAG Repeat Length Polymorphism and Male Infertility: A Meta-Analysis

    OpenAIRE

    Pan, Bihui; Li, Rui; CHEN, YAO; Tang, Qiuqin; Wu, Wei; Chen, Liping; Lu, Chuncheng; Pan, Feng; Hongjuan DING; Xia,Yankai; Hu, Lingqing; Chen, Daozhen; Sha, Jiahao; Wang, Xinru

    2016-01-01

    Abstract The association between polymorphism of androgen receptor gene CAG (AR-CAG) and male infertility in several studies was controversial. Based on studies on association between AR-CAG repeat length and male infertility in recent years, an updated meta-analysis is needed. We aimed to evaluate the association between AR-CAG repeat length and male infertility in advantage of the data in all published reports. We searched for reports published before August 2015 using PubMed, CNKI, VIP, an...

  12. The relationship between the L1 and L2 domains of the insulin and epidermal growth factor receptors and leucine-rich repeat modules

    Directory of Open Access Journals (Sweden)

    Ward Colin W

    2001-07-01

    Full Text Available Abstract Background Leucine-rich repeats are one of the more common modules found in proteins. The leucine-rich repeat consensus motif is LxxLxLxxNxLxxLxxLxxLxx- where the first 11–12 residues are highly conserved and the remainder of the repeat can vary in size Leucine-rich repeat proteins have been subdivided into seven subfamilies, none of which include members of the epidermal growth factor receptor or insulin receptor families despite the similarity between the 3D structure of the L domains of the type I insulin-like growth factor receptor and some leucine-rich repeat proteins. Results Here we have used profile searches and multiple sequence alignments to identify the repeat motif Ixx-LxIxx-Nx-Lxx-Lxx-Lxx-Lxx- in the L1 and L2 domains of the insulin receptor and epidermal growth factor receptors. These analyses were aided by reference to the known three dimensional structures of the insulin-like growth factor type I receptor L domains and two members of the leucine rich repeat family, porcine ribonuclease inhibitor and internalin 1B. Pectate lyase, another beta helix protein, can also be seen to contain the sequence motif and much of the structural features characteristic of leucine-rich repeat proteins, despite the existence of major insertions in some of its repeats. Conclusion Multiple sequence alignments and comparisons of the 3D structures has shown that right-handed beta helix proteins such as pectate lyase and the L domains of members of the insulin receptor and epidermal growth factor receptor families, are members of the leucine-rich repeat superfamily.

  13. The CAG repeat polymorphism in the androgen receptor gene (AR) and its relationship to head and neck cancer.

    Science.gov (United States)

    dos Santos, M L; Sibov, T T; Nishimoto, I N; Kowalski, L P; Miracca, E C; Nagai, M A

    2004-02-01

    Sex hormones may play an important role in the tumorigenic process of the head and neck. The aim of our work was to investigate whether the androgen receptor (AR) CAG repeat polymorphism is associated with an increased relative risk for head and neck cancer. Genomic DNA from 103 male patients with head and neck carcinomas and 100 male controls were analyzed for the AR CAG polymorphism by PCR amplification and direct sequencing or denaturing polyacrilamide gel electrophoresis. Logistic regression analysis showed a significant association between CAG repeat length and risk of head and neck cancer in individuals with more than 20 CAG repeats [OR=2.54 (95% CI, 1.3-4.8)]. For the group of individuals with oral and laryngeal cancer the estimated relative risk was increased to 2.79 (95% CI, 1.2-6.3) and 3.06 (95% CI, 1.0-9.6), respectively, in men with CAG repeat length >20. These results suggest, for the first time, that shorter AR CAG repeat alleles have a protective effect for head and neck cancer development.

  14. CAG repeat polymorphism in androgen receptor gene is not directly associated with polycystic ovary syndrome but influences serum testosterone levels.

    Science.gov (United States)

    Skrgatic, L; Baldani, D Pavicic; Cerne, J Z; Ferk, P; Gersak, K

    2012-02-01

    Hyperandrogenemia has been the most consistent feature of polycystic ovary syndrome (PCOS). Androgens exert their effects through androgen receptors (ARs). The expansion of the codon CAG trinucleotide repeat polymorphism in exon 1 of the AR gene represents a type of genetic alteration associated with changes in the AR gene function. The purpose of this study was to establish a possible association of the AR gene CAG repeat length polymorphism with PCOS, and its influence on clinical and biochemical androgen traits. Two hundred and fourteen Croatian women with PCOS and 209 healthy control women of reproductive age were enrolled. Phenotypic hyperandrogenism, BMI and waist to hip ratio were recorded. Hormonal profiles, fasting insulin and glucose levels were measured on cycle days 3-5. Genotyping of the CAG repeat polymorphism in the AR gene was performed. We found no significant difference in the mean CAG repeat number between the PCOS patients and controls (22.1±3.4 vs. 21.9±3.2, P=0.286). There was a positive correlation between the CAG repeat length and total testosterone (TT) in the PCOS group (R=0.225, P=0.015). A multiple linear regression model using mean CAG repeat length, BMI, age and HOMA-IR as predictors explained 8.5% (adjusted R²) of the variability in serum TT levels. In this model the CAG repeat polymorphism was found to be a significant predictor of serum TT levels in PCOS patients (P=0.015). The logistic regression analysis revealed that the CAG repeat length is not a significant predictor of hirsutism and acne status (P=0.921 and P=0.437, respectively). The model was adjusted for serum TT, free testosterone, androstendione and DHEAS levels as independent variables, which were also not found to be significant predictors of hirsutism (P=0.687, P=0.194, P=0.675 and P=0.938, respectively) or acne status (P=0.594, P=0.095, P=0.290 and P=0.151, respectively). In conclusion, the AR CAG repeat polymorphism is not a major determinant of PCOS in the

  15. Tandem CAG repeats of the androgen receptor gene and prostate cancer risk in black and white men.

    Science.gov (United States)

    Panz, V R; Joffe, B I; Spitz, I; Lindenberg, T; Farkas, A; Haffejee, M

    2001-07-01

    The most common malignancy in men worldwide is cancer of the prostate. Androgens play a direct role in normal and malignant growth of prostate cells via the androgen receptor (AR). This study analyzed the polymorphic CAG repeat sequence in exon 1 of the AR gene to determine if the number of repeats might be an indicator of prostate cancer risk or aggressive disease. DNA was extracted from blood samples of 20 black and 20 white men with well-documented prostate cancer and 40 healthy controls (20 blacks and 20 whites). PCR amplification was followed by gel electrophoresis and DNA sequencing. This region normally contains between 9 and 29 repeats. Patients and controls both had minor variations in the number of repeats, which ranged from 13 to 27 with 21 being the most frequent allele. Black controls and patients both had a mean of 20 +/- 3 repeats; in whites the mean was significantly lower in patients than controls (21 +/- 2 versus 23 +/- 2; p = 0.004). Combined black and white patients also had a lower number than the combined group of controls (20 +/- 3 versus 22 +/- 3; p = 0.02). Similarly, black and white patients with aggressive disease had a lower number than patients whose disease was more slowly progressive (19 +/- 2 versus 22 +/- 3; p = 0.02). We conclude that the small differences in the number of CAG repeats in both black and white patients do not appear to be a strong indicator of risk or aggressive disease but that this size polymorphism may be one of many genetic and environmental risk factors involved in prostate cancer.

  16. Evolutionary Dynamics of the Leucine-Rich Repeat Receptor-Like Kinase (LRR-RLK) Subfamily in Angiosperms.

    Science.gov (United States)

    Fischer, Iris; Diévart, Anne; Droc, Gaetan; Dufayard, Jean-François; Chantret, Nathalie

    2016-03-01

    Gene duplications are an important factor in plant evolution, and lineage-specific expanded (LSE) genes are of particular interest. Receptor-like kinases expanded massively in land plants, and leucine-rich repeat receptor-like kinases (LRR-RLK) constitute the largest receptor-like kinases family. Based on the phylogeny of 7,554 LRR-RLK genes from 31 fully sequenced flowering plant genomes, the complex evolutionary dynamics of this family was characterized in depth. We studied the involvement of selection during the expansion of this family among angiosperms. LRR-RLK subgroups harbor extremely contrasting rates of duplication, retention, or loss, and LSE copies are predominantly found in subgroups involved in environmental interactions. Expansion rates also differ significantly depending on the time when rounds of expansion or loss occurred on the angiosperm phylogenetic tree. Finally, using a dN/dS-based test in a phylogenetic framework, we searched for selection footprints on LSE and single-copy LRR-RLK genes. Selective constraint appeared to be globally relaxed at LSE genes, and codons under positive selection were detected in 50% of them. Moreover, the leucine-rich repeat domains, and specifically four amino acids in them, were found to be the main targets of positive selection. Here, we provide an extensive overview of the expansion and evolution of this very large gene family. © 2016 American Society of Plant Biologists. All Rights Reserved.

  17. Evolutionary Dynamics of the Leucine-Rich Repeat Receptor-Like Kinase (LRR-RLK) Subfamily in Angiosperms1[OPEN

    Science.gov (United States)

    Dufayard, Jean-François; Chantret, Nathalie

    2016-01-01

    Gene duplications are an important factor in plant evolution, and lineage-specific expanded (LSE) genes are of particular interest. Receptor-like kinases expanded massively in land plants, and leucine-rich repeat receptor-like kinases (LRR-RLK) constitute the largest receptor-like kinases family. Based on the phylogeny of 7,554 LRR-RLK genes from 31 fully sequenced flowering plant genomes, the complex evolutionary dynamics of this family was characterized in depth. We studied the involvement of selection during the expansion of this family among angiosperms. LRR-RLK subgroups harbor extremely contrasting rates of duplication, retention, or loss, and LSE copies are predominantly found in subgroups involved in environmental interactions. Expansion rates also differ significantly depending on the time when rounds of expansion or loss occurred on the angiosperm phylogenetic tree. Finally, using a dN/dS-based test in a phylogenetic framework, we searched for selection footprints on LSE and single-copy LRR-RLK genes. Selective constraint appeared to be globally relaxed at LSE genes, and codons under positive selection were detected in 50% of them. Moreover, the leucine-rich repeat domains, and specifically four amino acids in them, were found to be the main targets of positive selection. Here, we provide an extensive overview of the expansion and evolution of this very large gene family. PMID:26773008

  18. Cytogenetic and molecular analysis of infertile Chinese men: karyotypic abnormalities, Y-chromosome microdeletions, and CAG and GGN repeat polymorphisms in the androgen receptor gene.

    Science.gov (United States)

    Han, T T; Ran, J; Ding, X P; Li, L J; Zhang, L Y; Zhang, Y P; Nie, S S; Chen, L

    2013-07-08

    Chromosome abnormalities, Y-chromosome microdeletions, and androgen receptor gene CAG and GGN repeat polymorphisms in infertile Chinese men featuring severe oligospermia and azoospermia were analyzed. Ninety-six fertile men and 189 non-obstructive infertile men, including 125 patients with azoospermia and 64 with severe oligozoospermia, were studied. Seventeen infertile men (9.0%) carried a chromosome abnormality. Twenty (10.6%) carried a Y-chromosome microdeletion. In the remainder of the patients and controls, GGN and CAG repeats were sequenced. Short GGN repeats (n repeats strongly correlated with sperm counts. No significant difference in CAG repeats was found between patients and controls, nor were CAG repeats correlated with sperm counts. However, for CAG repeats ranging between 24 and 25, there was a >2.5-fold risk (OR = 2.539, 95%CI = 1.206-5.344, P repeats in Chinese male infertility.

  19. Androgen receptor gene CAG repeat polymorphism and risk of isolated hypospadias: results from a meta-analysis.

    Science.gov (United States)

    Huang, G; Shan, W; Zeng, L; Huang, L

    2015-03-06

    Studies investigating the association between the CAG repeat polymorphism and the risk of isolated hypospadias have reported conflicting results. The aim of this study was to quantitatively summarize the evidence for such a relationship. Two investigators independently searched the Medline, Embase, CNKI, and Wanfang databases. Weighted mean difference and 95% confidence intervals for the CAG repeat polymorphism and isolated hypospadias were calculated using a random-effects model. Subgroup analyses were performed by race, study design, sample for DNA extraction, and hypospadias classifications. This meta-analysis included 6 case-control studies, including 444 isolated hypospadias cases and 727 controls. The results showed that patients with isolated hypospadias had longer CAG repeats in their androgen receptor gene sequence (weighted mean difference = 1.36, 95% confidence interval = 0.60-2.13; P = 0.0005). Similarly, stratified analyses also detected significant associations in all subgroups, excluding the group with severe hypospadias (weighted mean difference = 0.35, 95% confidence interval = -0.42-1.12; P = 0.38). This meta-analysis indicated that longer CAG repeats were associated with the risk of isolated hypospadias, and that longer CAG polymorphisms may be related to the etiology of isolated hypospadias. Future studies based on Asian and African-American patients should be performed to re-evaluate this association.

  20. No relationship exists between itai-itai disease and TA repeat polymorphisms of the estrogen receptor alpha gene.

    Science.gov (United States)

    Sadewa, Hamim Ahmad; Miyabe, Yuri; Nishio, Hisahide; Hayashi, Chiyo; Sutomo, Retno; Lee, Myeong Jin; Ayaki, Hitoshi; Koizumi, Naoko; Sumino, Kimiaki

    2002-08-01

    Itai-itai (ouch-ouch) disease is a syndrome accompanied by bone mineral disorders that may be related to oral cadmium exposure. Itai-itai predominantly affects postmenopausal women with a history of multiple childbirth. In a previous study we have examined the genotype distributions of PvuII and XbaI restriction fragment length polymorphisms of the estrogen receptor alpha (ER alpha) gene in patients with itai-itai disease and compared them with those of controls. However, no significant differences were shown between the genotype distributions of the patients and controls. In the present study, we determined the TA repeat polymorphisms of the patients and controls. The distributions of the patients were: HH 25.0%, HL 50.0%, and LL 25.0%; where HH includes two alleles with a high number of TA repeats (TA> or =16), HL includes one high number allele and one low number allele (TAitai-itai disease.

  1. CAG repeat polymorphisms in the androgen receptor and breast cancer risk in women: a meta-analysis of 17 studies

    Directory of Open Access Journals (Sweden)

    Mao Q

    2015-08-01

    Full Text Available Qixing Mao,1–3,* Mantang Qiu,1–3,* Gaochao Dong,3 Wenjie Xia,1–3 Shuai Zhang,1,3 Youtao Xu,1,3 Jie Wang,3 Yin Rong,1,3 Lin Xu,1,3 Feng Jiang1,3 1Department of Thoracic Surgery, Nanjing Medical University Affiliated Cancer Institute of Jiangsu Province, 2Fourth Clinical College of Nanjing Medical University, 3Jiangsu Key Laboratory of Molecular and Translational Cancer Research, Nanjing, People’s Republic of China *These authors contributed equally to this work Abstract: The association between polymorphic CAG repeats in the androgen receptor gene in women and breast cancer susceptibility has been studied extensively. However, the conclusions regarding this relationship remain conflicting. The purpose of this meta-analysis was to identify whether androgen receptor CAG repeat lengths were related to breast cancer susceptibility. The MEDLINE, PubMed, and EMBASE databases were searched through to December 2014 to identify eligible studies. Data and study quality were rigorously assessed by two investigators according to the Newcastle-Ottawa Quality Assessment Scale. The publication bias was assessed by the Begg’s test. Seventeen eligible studies were included in this meta-analysis. The overall analysis suggested no association between CAG polymorphisms and breast cancer risk (odds ratio [OR] 1.031, 95% confidence interval [CI] 0.855–1.245. However, in the subgroup analysis, we observed that long CAG repeats significantly increased the risk of breast cancer in the Caucasian population (OR 1.447, 95% CI 1.089–1.992. Additionally, the risk was significantly increased in Caucasian women carrying two alleles with CAG repeats ≥22 units compared with those with two shorter alleles (OR 1.315, 95% CI 1.014–1.707. These findings suggest that long CAG repeats increase the risk of breast cancer in Caucasian women. However, larger scale case-control studies are needed to validate our results. Keywords: androgen, CAG repeat polymorphism, women

  2. Bispecific designed ankyrin repeat proteins (DARPins) targeting epidermal growth factor receptor inhibit A431 cell proliferation and receptor recycling

    NARCIS (Netherlands)

    Boersma, Ykelien L; Chao, Ginger; Steiner, Daniel; Wittrup, K Dane; Plückthun, Andreas

    2011-01-01

    The EGF receptor (EGFR) has been implicated in the development and progression of many tumors. Although monoclonal antibodies directed against EGFR have been approved for the treatment of cancer in combination with chemotherapy, there are limitations in their clinical efficacy, necessitating the

  3. Bispecific designed ankyrin repeat proteins (DARPins) targeting epidermal growth factor receptor inhibit A431 cell proliferation and receptor recycling

    NARCIS (Netherlands)

    Boersma, Ykelien L; Chao, Ginger; Steiner, Daniel; Wittrup, K Dane; Plückthun, Andreas

    2011-01-01

    The EGF receptor (EGFR) has been implicated in the development and progression of many tumors. Although monoclonal antibodies directed against EGFR have been approved for the treatment of cancer in combination with chemotherapy, there are limitations in their clinical efficacy, necessitating the sea

  4. Androgen Receptor CAG Repeat Length Is Associated With Body Fat and Serum SHBG in Boys

    DEFF Research Database (Denmark)

    Mouritsen, Annette; Hagen, Casper P; Sørensen, Kaspar

    2013-01-01

    ) had lower levels of SHBG (88 vs 125 nmol/L) (P skinfold thickness (41 vs 31 mm) (P = .06) compared with boys with an average number of CAG repeats (CAG 21-23). In contrast, the inverse association was observed at puberty (at 12 years of age...

  5. Corepressor effect on androgen receptor activity varies with the length of the CAG encoded polyglutamine repeat and is dependent on receptor/corepressor ratio in prostate cancer cells.

    Science.gov (United States)

    Buchanan, Grant; Need, Eleanor F; Barrett, Jeffrey M; Bianco-Miotto, Tina; Thompson, Vanessa C; Butler, Lisa M; Marshall, Villis R; Tilley, Wayne D; Coetzee, Gerhard A

    2011-08-01

    The response of prostate cells to androgens reflects a combination of androgen receptor (AR) transactivation and transrepression, but how these two processes differ mechanistically and influence prostate cancer risk and disease outcome remain elusive. Given recent interest in targeting AR transrepressive processes, a better understanding of AR/corepressor interaction and responses is warranted. Here, we used transactivation and interaction assays with wild-type and mutant ARs, and deletion AR fragments, to dissect the relationship between AR and the corepressor, silencing mediator for retinoic acid and thyroid hormone receptors (SMRT). We additionally tested how these processes are influenced by AR agonist and antagonist ligands, as well as by variation in the polyglutamine tract in the AR amino terminal domain (NTD), which is encoded by a polymorphic CAG repeat in the gene. SMRT was recruited to the AR ligand binding domain by agonist ligand, and as determined by the effect of strategic mutations in activation function 2 (AF-2), requires a precise conformation of that domain. A distinct region of SMRT also mediated interaction with the AR-NTD via the transactivation unit 5 (TAU5; residues 315-538) region. The degree to which SMRT was able to repress AR increased from 17% to 56% as the AR polyglutamine repeat length was increased from 9 to 42 residues, but critically this effect could be abolished by increasing the SMRT:AR molar ratio. These data suggest that the extent to which the CAG encoded polyglutamine repeat influences AR activity represents a balance between corepressor and coactivator occupancy of the same ligand-dependent and independent AR interaction surfaces. Changes in the homeostatic relationship of AR to these molecules, including SMRT, may explain the variable penetrance of the CAG repeat and the loss of AR signaling flexibility in prostate cancer progression.

  6. Tolerance in the anxiolytic profile following repeated administration of diazepam but not buspirone is associated with a decrease in the responsiveness of postsynaptic 5-HT-1A receptors.

    Science.gov (United States)

    Khan, Asma; Haleem, D J

    2007-12-01

    To understand the role of serotonin (5-hydroxytryptamine; 5-HT)-1A receptors in the treatment of anxiety and the development of tolerance to benzodiazepines the present study was designed to monitor the responsiveness of postsynaptic 5-HT-1A receptors following repeated administration of diazepam and buspirone. Results show that tolerance in the anxiolytic profile is produced following repeated administration (2 weeks) of diazepam (2 mg/kg) but not buspirone (0.5 mg/kg). The behavioral effects of 8-OH-DPAT at a dose of 0.25 mg/kg were monitored 3 days after repeated administration of saline or buspirone or diazepam. The results show that 8-OH-DPAT elicited forepaw treading was smaller in repeated diazepam but not repeated buspirone injected rats, while hyperlocomotive effects of 8-OH-DPAT were smaller in both repeated buspirone and repeated diazepam injected rats. The results suggest that postsynaptic 5-HT-1A receptor-dependent responses were attenuated following long-term administration of diazepam but not buspirone. Role of 5-HT-1A receptors in the development of tolerance to the anxiolytic effects of diazepam but not buspirone is discussed.

  7. Nociceptor interleukin 10 receptor 1 is critical for muscle analgesia induced by repeated bouts of eccentric exercise in the rat.

    Science.gov (United States)

    Alvarez, Pedro; Bogen, Oliver; Green, Paul G; Levine, Jon D

    2017-08-01

    Delayed-onset muscle soreness is typically observed after strenuous or unaccustomed eccentric exercise. Soon after recovery, blunted muscle soreness is observed on repeated eccentric exercise, a phenomenon known as repeated bout effect (RBE). Although regular physical activity decreases muscle hyperalgesia, likely because of increased production of the anti-inflammatory cytokine interleukin-10 (IL-10) in the skeletal muscle, whether IL-10 also contributes to the antinociceptive effect of RBE is unknown. Furthermore, whether IL-10 attenuates muscle hyperalgesia by acting on muscle nociceptors remains to be established. Here, we explored the hypothesis that blunted muscle nociception observed in RBE depends on a local effect of IL-10, acting on IL-10 receptor 1 (IL-10R1) expressed by muscle nociceptors. Results show that after a second bout of eccentric exercise, rats exhibited decreased muscle hyperalgesia, indicative of RBE, and increased expression of IL-10 in the exercised gastrocnemius muscle. Although knockdown of IL-10R1 protein in nociceptors innervating the gastrocnemius muscle by intrathecal antisense oligodeoxynucleotide did not change nociceptive threshold in naive rats, it unveiled latent muscle hyperalgesia in rats submitted to eccentric exercise 12 days ago. Furthermore, antisense also prevented the reduction of muscle hyperalgesia observed after a second bout of eccentric exercise. These data indicate that recovery of nociceptive threshold after eccentric exercise and RBE-induced analgesia depend on a local effect of IL-10, acting on its canonical receptor in muscle nociceptors.

  8. Assessment of Correlation between Androgen Receptor CAG Repeat Length and Infertility in Infertile Men Living in Khuzestan, Iran

    Directory of Open Access Journals (Sweden)

    Saeid Reza Khatami

    2015-02-01

    Full Text Available Background: The androgen receptor (AR gene contains a polymorphic trinucleotide repeat that encodes a polyglutamine tract in its N-terminal transactivation domain (NTAD. We aimed to find a correlation between the length of this polymorphic tract and azoospermia or oligozoospermia in infertile men living in Khuzestan, Iran. Materials and Methods: In this case-control study during two years till 2010, we searched for microdeletions in the Y chromosome in 84 infertile male patients with normal karyotype who lived in Khuzestan Province, Southwest of Iran. All cases (n=12 of azoospermia or oligozoospermia resulting from Y chromosome microdeletions were excluded from our study. The number of CAG repeats in exon 1 of the AR gene was determined in 72 patients with azoospermia or oligozoospermia and in 72 fertile controls, using the polymerase chain reaction (PCR and polyacrylamide gel electrophoresis. Results: Microdeletions were detected in 14.3% (n=12 patients suffering severe oligozoospermia. The mean CAG repeat length was 18.99 ± 0.35 (range, 11-26 and 19.96 ± 0.54 (range, 12-25 in infertile males and controls, respectively. Also in the infertile group, the most common allele was 19 (26.38%, while in controls, it was 25 (22.22%. Conclusion: Y chromosome microdeletions could be one of the main reasons of male infertility living in Khuzestan Province, while there was no correlation between CAG length in AR gene with azoospermia or oligozoospermia in infertile men living in Khuzestan, Iran.

  9. Non-linear association between androgen receptor CAG repeat length and risk of male subfertility--a meta-analysis.

    Science.gov (United States)

    Nenonen, H A; Giwercman, A; Hallengren, E; Giwercman, Y L

    2011-08-01

    The CAG repeat in the androgen receptor (AR) has been widely studied in association with male infertility, but the results are conflicting. In a recent meta-analysis, infertile men had repeat longer CAG stretch than fertile men when analysed in a linear regression model assuming that AR function diminishes with increasing CAG length. However, in vitro, a non-linear activity pattern was recently demonstrated so that ARs containing short and long stretches, respectively, displayed lower activity than the AR of median length. These results prompted us to explore the possible association between CAG number and male infertility risk in a stratified manner on the basis of data from the mentioned meta-analysis and subjects from our clinical unit. The study population included 3915 men, 1831 fertile and 2084 infertile. Data were divided into three categories: CAGCAG 22-23 (reference) and CAG>23 and analysed in a binary logistic regression model. Men with CAGCAG>23 had 20% increased odds ratio of infertility compared with carriers of the median lengths [for CAGCAG>23: p=0.02, 95% CI: 1.03-1.44]. These results show that an alternative model to a linear one for the genotype-phenotype association in relation to AR CAG repeats is likely, as lengths close to the median confine lowest risk of infertility.

  10. Baldness and the androgen receptor: the AR polyglycine repeat polymorphism does not confer susceptibility to androgenetic alopecia.

    Science.gov (United States)

    Ellis, Justine A; Scurrah, Katrina J; Cobb, Joanna E; Zaloumis, Sophie G; Duncan, Anna E; Harrap, Stephen B

    2007-05-01

    Androgenetic alopecia, or male pattern baldness, is a complex condition with a strong heritable component. In 2001, we published the first significant evidence of a genetic association between baldness and a synonymous coding SNP (rs6152) in the androgen receptor gene, AR. Recently, this finding was replicated in three independent studies, confirming an important role for AR in the baldness phenotype. In one such replication study, it was claimed that the causative variant underlying the association was likely to be the polyglycine (GGN) repeat polymorphism, one of two apparently functional triplet repeat polymorphisms located in the exon 1 transactivating domain of the gene. Here, we extend our original association finding and present comprehensive evidence from approximately 1,200 fathers and sons drawn from 703 families of the Victorian Family Heart Study, a general population Caucasian cohort, that neither exon 1 triplet repeat polymorphism is causative in this condition. Seventy-eight percent of fathers (531/683) and 30% of sons (157/520) were affected to some degree with AGA. We utilised statistical methods appropriate for the categorical nature of the phenotype and familial structure of the cohort, and determined that whilst SNP rs6152 was strongly associated with baldness (P baldness, but also for the many other complex conditions that have thus far been linked to AR.

  11. Evolutionary dynamics of leucine-rich repeat receptor-like kinases and related genes in plants:A phylogenomic approach

    Institute of Scientific and Technical Information of China (English)

    Tao Shi; Hongwen Huang; Michael J.Sanderson; Frans E.Tax

    2014-01-01

    Leucine-rich repeat (LRR) receptor-like kinases (RLKs), evolutionarily related LRR receptor-like proteins (RLPs) and receptor-like cytoplasmic kinases (RLCKs) have important roles in plant signaling, and their gene subfamilies are large with a complicated history of gene duplication and loss. In three pairs of closely related lineages, including Arabidopsis thaliana and A. lyrata (Arabidopsis), Lotus japonicus, and Medicago truncatula (Legumes), Oryza sativa ssp. japonica, and O. sativa ssp. indica (Rice), we find that LRR RLKs comprise the largest group of these LRR-related subfamilies, while the related RLCKs represent the smal est group. In addition, comparison of orthologs indicates a high frequency of reciprocal gene loss of the LRR RLK/LRR RLP/RLCK subfamilies. Furthermore, pairwise comparisons show that reciprocal gene loss is often associated with lineage-specific duplication(s) in the alternative lineage. Last, analysis of genes in A. thaliana involved in development revealed that most are highly conserved orthologs without species-specific duplication in the two Arabidopsis species and originated from older Arabidopsis-specific or rosid-specific duplications. We discuss potential pitfal s related to functional prediction for genes that have undergone frequent turnover (duplications, losses, and domain architecture changes), and conclude that prediction based on phylogenetic relationships wil likely outperform that based on sequence similarity alone.

  12. The hypersensitive induced reaction and leucine-rich repeat proteins regulate plant cell death associated with disease and plant immunity.

    Science.gov (United States)

    Choi, Hyong Woo; Kim, Young Jin; Hwang, Byung Kook

    2011-01-01

    Pathogen-induced programmed cell death (PCD) is intimately linked with disease resistance and susceptibility. However, the molecular components regulating PCD, including hypersensitive and susceptible cell death, are largely unknown in plants. In this study, we show that pathogen-induced Capsicum annuum hypersensitive induced reaction 1 (CaHIR1) and leucine-rich repeat 1 (CaLRR1) function as distinct plant PCD regulators in pepper plants during Xanthomonas campestris pv. vesicatoria infection. Confocal microscopy and protein gel blot analyses revealed that CaLRR1 and CaHIR1 localize to the extracellular matrix and plasma membrane (PM), respectively. Bimolecular fluorescent complementation and coimmunoprecipitation assays showed that the extracellular CaLRR1 specifically binds to the PM-located CaHIR1 in pepper leaves. Overexpression of CaHIR1 triggered pathogen-independent cell death in pepper and Nicotiana benthamiana plants but not in yeast cells. Virus-induced gene silencing (VIGS) of CaLRR1 and CaHIR1 distinctly strengthened and compromised hypersensitive and susceptible cell death in pepper plants, respectively. Endogenous salicylic acid levels and pathogenesis-related gene transcripts were elevated in CaHIR1-silenced plants. VIGS of NbLRR1 and NbHIR1, the N. benthamiana orthologs of CaLRR1 and CaHIR1, regulated Bax- and avrPto-/Pto-induced PCD. Taken together, these results suggest that leucine-rich repeat and hypersensitive induced reaction proteins may act as cell-death regulators associated with plant immunity and disease.

  13. Negative association between androgen receptor gene CAG repeat polymorphism and polycystic ovary syndrome? A systematic review and meta-analysis.

    Science.gov (United States)

    Wang, Rui; Goodarzi, Mark O; Xiong, Ting; Wang, Di; Azziz, Ricardo; Zhang, Hanwang

    2012-10-01

    A number of studies focusing on the association between the exon 1 CAG repeat polymorphism of the androgen receptor (AR) gene and polycystic ovary syndrome (PCOS) have revealed conflicting results. The current systematic review and meta-analysis was conducted to quantify the strength of the association and to explore potential sources of heterogeneity that may have influenced the results. Studies matched to search terms from PubMed, EMBASE and HuGE Navigator published through to 31 January 2012 were retrieved. Data extraction from the included studies was carried out by two authors independently. Weighted mean differences (WMDs) of biallelic mean and odds ratios (ORs) of alleles and genotypes were pooled for meta-analysis. Sixteen articles reporting on 17 studies were included. In continuous data analysis, the summary WMD was -0.06 (95% confidence interval -0.29 to 0.16). In dichotomous data analysis, we divided the alleles into short and long alleles and calculated the summary ORs. No statistically significant results were identified by different comparison models or different cut-off point definitions. No publication bias was observed in continuous and dichotomous data analysis. In summary, the current systematic review and meta-analysis found that the AR CAG microsatellite repeat polymorphism is unlikely to be a major determining factor in the development of PCOS.

  14. Androgen receptor gene methylation and exon one CAG repeat length in ovarian cancer: differences from breast cancer.

    Science.gov (United States)

    Kassim, Samar; Zoheiry, Nivan M; Hamed, Wael M; Going, James J; Craft, John A

    2004-07-01

    More than one neoplastic founder clone can exist in benign epithelial tumours. Although theories of clonal selection make pluriclonality appear unlikely in carcinomas, published data do not exclude this possibility. This study looked for evidence of multiclonal X inactivation in ovarian carcinoma using AR methylation as a marker. Fifteen unifocal ovarian carcinomas and 14 multifocal carcinomas all in Scottish patients were studied. One representative formalin-fixed paraffin-embedded tumour block was chosen for each of the former and two for the latter. From each of these 43 tumour blocks three samples each of approximately 10(4) carcinoma cells were obtained by microdissection (129 in all). DNA released by proteinase K digestion was subjected to PCR amplification of the androgen receptor gene AR exon I CAG repeat polymorphism with and without prior digestion with methylation-sensitive restriction enzymes HpaII and HhaI. Complex amplification patterns were consistent with mosaic X inactivation in some ovarian carcinomas but acquired anomalies of AR methylation cannot be excluded. Parallel analysis of other X-linked polymorphic loci would strengthen the inference of clonality status from DNA methylation data in tumour X studies. Strikingly, the number of CAG repeats in the 29 ovarian tumour patients (median 16, range 11 - 20) was substantially fewer than in 34 previously studied breast cancer patients from the same scottish population (median 21, range 14 - 26; P CAG repeat were over-represented in the ovarian cancer patients but not in the breast cancer series. These findings reinforce recent suggestions that AR may have a role in ovarian carcinogenesis.

  15. Interleukin-1 Receptor Antagonist and Interleukin-4 Genes Variable Number Tandem Repeats Are Associated with Adiposity in Malaysian Subjects

    Science.gov (United States)

    Kok, Yung-Yean; Ong, Hing-Huat

    2017-01-01

    Interleukin-1 receptor antagonist (IL1RA) intron 2 86 bp repeat and interleukin-4 (IL4) intron 3 70 bp repeat are variable number tandem repeats (VNTRs) that have been associated with various diseases, but their role in obesity is elusive. The objective of this study was to investigate the association of IL1RA and IL4 VNTRs with obesity and adiposity in 315 Malaysian subjects (128 M/187 F; 23 Malays/251 ethnic Chinese/41 ethnic Indians). The allelic distributions of IL1RA and IL4 were significantly different among ethnicities, and the alleles were associated with total body fat (TBF) classes. Individuals with IL1RA I/II genotype or allele II had greater risk of having higher overall adiposity, relative to those having the I/I genotype or I allele, respectively, even after controlling for ethnicity [Odds Ratio (OR) of I/II genotype = 12.21 (CI = 2.54, 58.79; p = 0.002); II allele = 5.78 (CI = 1.73, 19.29; p = 0.004)]. However, IL4 VNTR B2 allele was only significantly associated with overall adiposity status before adjusting for ethnicity [OR = 1.53 (CI = 1.04, 2.23; p = 0.03)]. Individuals with IL1RA II allele had significantly higher TBF than those with I allele (31.79 ± 2.52 versus 23.51 ± 0.40; p = 0.005). Taken together, IL1RA intron 2 VNTR seems to be a genetic marker for overall adiposity status in Malaysian subjects. PMID:28293435

  16. Effect of repeated nicotine exposure on high-affinity nicotinic acetylcholine receptor density in spontaneously hypertensive rats.

    Science.gov (United States)

    Hohnadel, Elizabeth J; Hernandez, Caterina M; Gearhart, Debra A; Terry, Alvin V

    Spontaneously hypertensive rats (SHRs) are often used as a model of attention deficit hyperactivity disorder (ADHD) and to investigate the effects of hypertension on cognitive function. Further, they appear to have reduced numbers of central nicotinic acetylcholine receptors (nAChRs) and, therefore, may be useful to model certain aspects of Alzheimer's disease (AD) and other forms of dementia given that a decrease in nAChRs is thought to contribute to cognitive decline in these disorders. In the present study, based on reports that chronic nicotine exposure increases nAChRs in several mammalian models, we tested the hypothesis that repeated exposures to a relatively low dose of the alkaloid would ameliorate the receptor deficits in SHR. Thus, young-adult SHRs and age-matched Wistar-Kyoto (WKY) control rats were treated with either saline or nicotine twice a day for 14 days (total daily dose = 0.7 mg/kg nicotine base) and then sacrificed. Quantitative receptor autoradiography with [125I]-IPH, an epibatidine analog, revealed: (1) that high-affinity nAChRs were higher in saline-treated WKY (control) rats compared to saline-treated SHRs in 18 of the 19 brain region measured, although statistically different only in the mediodorsal thalamic nuclei, (2) that nicotine significantly increased nAChR binding in WKY rats in six brain areas including cortical regions and the anterior thalamic nucleus, (3) that there were no cases where nicotine significantly increased nAChR binding in SHRs. These results indicate that subjects deficient in nAChRs may be less sensitive to nAChR upregulation with nicotine than normal subjects and require higher doses or longer periods of exposure.

  17. ANDROGEN RECEPTOR CAG AND GGN REPEAT POLYMORPHISMS AND BONE MASS IN BOYS AND GIRLS.

    Science.gov (United States)

    Rodríguez-Garcia, Lorena; Ponce-Gonzalez, Jesus G; González-Henriquez, Juan J; Rodriguez-Gonzalez, Francisco G; Díaz-Chico, Bonifacio N; Calbet, Jose A L; Serrano-Sanchez, José A; Dorado, Cecilia; Guadalupe-Grau, Amelia

    2015-12-01

    Introducción: el gen humano del receptor de androgenos (AR) posee dos repeticiones polimorficas de trinucleotidos (CAG y GGN) que afectan a la cantidad de proteina AR traducida. En este estudio, genotipamos esos tractos polimorficos en una muestra representativa de ninos caucasicos espanoles (Tanner ≤ 5), compuesta por 152 ninos (11.5 } 2.6 anos) y 116 ninas (10.1 } 3.2 anos) e investigamos su asociacion con la masa osea. Métodos: la longitud de las repeticiones CAG y GGN se determino mediante PCR y analisis de fragmentos. La composicion corporal se midio mediante absorciometria dual de rayos X (DXA). Los participantes fueron agrupados como CAG cortos (CAGS) si poseian una longitud de repeticiones ≤ 21 y CAG largos si esta era > 21. Ademas, los participantes se agruparon como GGN cortos (GGNS) si poseian una longitud de repeticiones ≤ 23 y GGN largos (GGNL) si esta era > 23. Resultados: en los ninos se encontraron diferencias en talla, peso corporal, densidad mineral osea (BMD) y contenido mineral oseo (BMC) del cuerpo entero, BMC de las extremidades superiores e inferiores, BMD del cuello del femur, BMC y BMD del triangulo de Ward’s y BMD de la espina lumbar entre los grupos CAGS y CAGL (P osea en las ninas. Conclusiones: nuestros resultados apoyan la hipotesis de que los alelos largos de los polimorfismos CAG y GGN del AR estan asociados con una mayor masa osea en ninos prepuberes.

  18. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China: a cross-sectional study

    OpenAIRE

    Yan-Min Ma; Kai-Jie Wu; Liang Ning; Jin Zeng; Bo Kou; Hong-Jun Xie; Zhen-Kun Ma; Xin-Yang Wang; Yong-Guang Gong; Da-Lin He

    2014-01-01

    This study aimed to investigate the correlations among androgen receptor (AR) CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and fifty-three healthy men (aged 22.8 ± 3.1 years) were enrolled. The individuals were grouped as CAG short (CAG S ) if they harbored repeat length of ≤20 or as CAG long (CAG L ) if their CAG repeat length was >20. Body height/weight, penile length and other parameters were examined and recorded by the specified ...

  19. Lack of association between estrogen receptor β dinucleotide repeat polymorphism and autoimmune thyroid diseases in Japanese patients

    Directory of Open Access Journals (Sweden)

    Tomita Motowo

    2001-01-01

    Full Text Available Abstract Background The autoimmune thyroid diseases (AITDs, such as Graves' disease (GD and Hashimoto's thyroiditis (HT, appear to develop as a result of complex interactions between predisposing genes and environmental triggers. Susceptibility to AITDs is conferred by genes in the human leukocyte antigen (HLA and genes unlinked to HLA, including the CTLA-4 gene. Recently, estrogen receptor (ER β, located at human chromosome 14q23-24.1, was identifed. We analyzed a dinucleotide (CAn repeat polymorphism located in the flanking region of ERβ gene in patients with AITDs and in normal subjects. High heterozygosity makes this polymorphism a useful marker in the genetic study of disorders affecting female endocrine systems. We also correlated a ERβ gene microsatellite polymorphism with bone mineral density (BMD in the distal radius and biochemical markers of bone turnover in patients with GD in remission. Results Fourteen different alleles were found in 133 patients with GD, 114 patients with HT, and 179 controls subjects. The various alleles were designated as allele*1 through allele*14 according to the number of the repeats, from 18 to 30. There was no significant difference in the distributions of ERβ alleles between patient groups and controls. Although recent study demonstrated a significant relation between a allele*9 in the ERβ gene and BMD in postmenopausal Japanese women, there were no statistically significant interaction between this allele and BMD in the distal radius, nor biochemical markers in patients with GD in remission. Conclusions The present results do not support an association between the ERβ microsatellite marker and AITD in the Japanese population. We also suggest that the ERβ microsatellite polymorphism has at most a minor pathogenic importance in predicting the risk of osteoporosis as a complication of GD.

  20. The Dopamine Receptor D4 7-Repeat Allele and Prenatal Smoking in ADHD-Affected Children and Their Unaffected Siblings: No Gene-Environment Interaction

    Science.gov (United States)

    Altink, Marieke E.; Arias-Vasquez, Alejandro; Franke, Barbara; Slaats-Willemse, Dorine I. E.; Buschgens, Cathelijne J. M.; Rommelse, Nanda N. J.; Fliers, Ellen A.; Anney, Richard; Brookes, Keeley-Joanne; Chen, Wai; Gill, Michael; Mulligan, Aisling; Sonuga-Barke, Edmund; Thompson, Margaret; Sergeant, Joseph A.; Faraone, Stephen V.; Asherson, Philip; Buitelaar, Jan K.

    2008-01-01

    Background: The dopamine receptor D4 ("DRD4") 7-repeat allele and maternal smoking during pregnancy are both considered as risk factors in the aetiology of attention deficit hyperactivity disorder (ADHD), but few studies have been conducted on their interactive effects in causing ADHD. The purpose of this study is to examine the gene by…

  1. Molecular chaperones enhance the degradation of expanded polyglutamine repeat androgen receptor in a cellular model of spinal and bulbar muscular atrophy

    NARCIS (Netherlands)

    Bailey, CK; Andriola, IFM; Kampinga, HH; Merry, DE

    2002-01-01

    Spinal and bulbar muscular atrophy (SBMA) is one of a growing number of neurodegenerative diseases caused by a polyglutamine-encoding CAG trinucleotide repeat expansion, and is caused by an expansion within exon 1 of the androgen receptor (AR) gene. The family of polyglutamine diseases is characteri

  2. Molecular chaperones enhance the degradation of expanded polyglutamine repeat androgen receptor in a cellular model of spinal and bulbar muscular atrophy

    NARCIS (Netherlands)

    Bailey, CK; Andriola, IFM; Kampinga, HH; Merry, DE

    2002-01-01

    Spinal and bulbar muscular atrophy (SBMA) is one of a growing number of neurodegenerative diseases caused by a polyglutamine-encoding CAG trinucleotide repeat expansion, and is caused by an expansion within exon 1 of the androgen receptor (AR) gene. The family of polyglutamine diseases is

  3. Analysis of the CAG repeat number in exon 1 of the androgen receptor gene in Slovene men with idiopathic azoospermia and oligoasthenoteratozoospermia

    Institute of Scientific and Technical Information of China (English)

    Borut Peterlin; Branko Zorn; Natasa Teran; Tanja Kunej

    2007-01-01

    @@ Dear Sir, I am Borut Peterlin, from Division of Medical Genetics,Department of Obstetrics and Gynaecology, University Medical Center, Ljubljana, Slovenia. We write to you to discuss if the number of CAG repeats in the androgen receptor (AR) gene is associated with male infertility in a group of 190 Slovene infertile men compared to 137 men with proven fertility.

  4. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Yan-Min Ma

    2014-06-01

    Full Text Available This study aimed to investigate the correlations among androgen receptor (AR CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and fifty-three healthy men (aged 22.8 ± 3.1 years were enrolled. The individuals were grouped as CAG short (CAG S if they harbored repeat length of ≤20 or as CAG long (CAG L if their CAG repeat length was >20. Body height/weight, penile length and other parameters were examined and recorded by the specified physicians; CAG repeat polymorphism was determined by the polymerase chain reaction (PCR method; and the serum levels of the sex hormones were detected by radioimmunoassay. Student's t-test or linear regression analysis was used to assess the associations among AR CAG repeat polymorphism, sex hormones and penile length. This investigation showed that the serum total testosterone (T level was positively associated with the AR CAG repeat length (P = 0.01; whereas, no significant correlation of T or AR CAG repeat polymorphism with the penile length was found (P = 0.593. Interestingly, an inverse association was observed between serum prolactin (PRL levels and penile length by linear regression analyses (β= −0.024, P = 0.039, 95% confidence interval (CI: −0.047, 0. Collectively, this study provides the first evidence that serum PRL, but not T or AR CAG repeat polymorphism, is correlated with penile length in the Han adult population from northwestern China.

  5. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China: a cross-sectional study.

    Science.gov (United States)

    Ma, Yan-Min; Wu, Kai-Jie; Ning, Liang; Zeng, Jin; Kou, Bo; Xie, Hong-Jun; Ma, Zhen-Kun; Wang, Xin-Yang; Gong, Yong-Guang; He, Da-Lin

    2014-01-01

    This study aimed to investigate the correlations among androgen receptor (AR) CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and fifty-three healthy men (aged 22.8 ± 3.1 years) were enrolled. The individuals were grouped as CAG short (CAG S ) if they harbored repeat length of ≤ 20 or as CAG long (CAG L ) if their CAG repeat length was >20. Body height/weight, penile length and other parameters were examined and recorded by the specified physicians; CAG repeat polymorphism was determined by the polymerase chain reaction (PCR) method; and the serum levels of the sex hormones were detected by radioimmunoassay. Student's t-test or linear regression analysis was used to assess the associations among AR CAG repeat polymorphism, sex hormones and penile length. This investigation showed that the serum total testosterone (T) level was positively associated with the AR CAG repeat length (P = 0.01); whereas, no significant correlation of T or AR CAG repeat polymorphism with the penile length was found (P = 0.593). Interestingly, an inverse association was observed between serum prolactin (PRL) levels and penile length by linear regression analyses (β= -0.024, P = 0.039, 95% confidence interval (CI): -0.047, 0). Collectively, this study provides the first evidence that serum PRL, but not T or AR CAG repeat polymorphism, is correlated with penile length in the Han adult population from northwestern China.

  6. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China:a cross-sectional study

    Institute of Scientific and Technical Information of China (English)

    YanMin Ma; DaLin He; KaiJie Wu; Liang Ning; Jin Zeng; Bo Kou; HongJun Xie; ZhenKun Ma; XinYang Wang; YongGuang Gong

    2014-01-01

    This study aimed to investigate the correlations among androgen receptor (AR) CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and iffty-three healthy men (aged 22.8 ± 3.1 years) were enrolled. The individuals were grouped as CAG short (CAGS) if they harbored repeat length of≤20 or as CAG long (CAGL) if their CAG repeat length was>20. Body height/weight, penile length and other parameters were examined and recorded by the speciifed physicians;CAG repeat polymorphism was determined by the polymerase chain reaction (PCR) method;and the serum levels of the sex hormones were detected by radioimmunoassay. Student’s t-test or linear regression analysis was used to assess the associations among AR CAG repeat polymorphism, sex hormones and penile length. This investigation showed that the serum total testosterone (T) level was positively associated with the AR CAG repeat length (P= 0.01); whereas, no signiifcant correlation of T or AR CAG repeat polymorphism with the penile length was found (P= 0.593). Interestingly, an inverse association was observed between serum prolactin (PRL) levels and penile length by linear regression analyses (b=-0.024, P= 0.039, 95%conifdence interval (CI):-0.047, 0). Collectively, this study provides the ifrst evidence that serum PRL, but not T or AR CAG repeat polymorphism, is correlated with penile length in the Han adult population from northwestern China.

  7. Changes in the expression of estrogen receptor mRNA in the utero-vaginal junction containing sperm storage tubules in laying hens after repeated artificial insemination.

    Science.gov (United States)

    Das, Shubash Chandra; Nagasaka, Naohiro; Yoshimura, Yukinori

    2006-03-01

    The objective was to determine whether expression of estrogen receptor (ER) mRNA in the utero-vaginal junction (UVJ) of laying hens was altered after repeated artificial insemination (AI). Semi-quantitative RT-PCR was used to determine the expression of mRNA of the two types of receptor, ERalpha and ERbeta. Only ERalpha mRNA was expressed in all segments of the oviducts of both virgin and artificially inseminated birds, whereas ERbeta mRNA was expressed in ovarian follicles but not in the oviduct. The expression of ERalpha mRNA in the UVJ was significantly decreased after repeated AI, whereas that in the uterus was not significantly different between virgin and inseminated birds. Since estrogen may be involved in maintaining the sperm storage function of sperm storage tubules, the decreased expression of ERalpha mRNA in the UVJ after repeated AI may contribute to reduced fertility in these birds.

  8. Genomic Dissection and Expression Profiling Revealed Functional Divergence in Triticum aestivum Leucine Rich Repeat Receptor Like Kinases (TaLRRKs)

    Science.gov (United States)

    Shumayla; Sharma, Shailesh; Kumar, Rohit; Mendu, Venugopal; Singh, Kashmir; Upadhyay, Santosh K.

    2016-01-01

    The leucine rich repeat receptor like kinases (LRRK) constitute the largest subfamily of receptor like kinases (RLK), which play critical roles in plant development and stress responses. Herein, we identified 531 TaLRRK genes in Triticum aestivum (bread wheat), which were distributed throughout the A, B, and D sub-genomes and chromosomes. These were clustered into 233 homologous groups, which were mostly located on either homeologous chromosomes from various sub-genomes or in proximity on the same chromosome. A total of 255 paralogous genes were predicted which depicted the role of duplication events in expansion of this gene family. Majority of TaLRRKs consisted of trans-membrane region and localized on plasma-membrane. The TaLRRKs were further categorized into eight phylogenetic groups with numerous subgroups on the basis of sequence homology. The gene and protein structure in terms of exon/intron ratio, domains, and motifs organization were found to be variably conserved across the different phylogenetic groups/subgroups, which indicated a potential divergence and neofunctionalization during evolution. High-throughput transcriptome data and quantitative real time PCR analyses in various developmental stages, and biotic and abiotic (heat, drought, and salt) stresses provided insight into modus operandi of TaLRRKs during these conditions. Distinct expression of majority of stress responsive TaLRRKs homologous genes suggested their specified role in a particular condition. These results provided a comprehensive analysis of various characteristic features including functional divergence, which may provide the way for future functional characterization of this important gene family in bread wheat.

  9. Genomic Dissection and Expression Profiling Revealed Functional Divergence in Triticum aestivum Leucine Rich Repeat Receptor Like Kinases (TaLRRKs).

    Science.gov (United States)

    Shumayla; Sharma, Shailesh; Kumar, Rohit; Mendu, Venugopal; Singh, Kashmir; Upadhyay, Santosh K

    2016-01-01

    The leucine rich repeat receptor like kinases (LRRK) constitute the largest subfamily of receptor like kinases (RLK), which play critical roles in plant development and stress responses. Herein, we identified 531 TaLRRK genes in Triticum aestivum (bread wheat), which were distributed throughout the A, B, and D sub-genomes and chromosomes. These were clustered into 233 homologous groups, which were mostly located on either homeologous chromosomes from various sub-genomes or in proximity on the same chromosome. A total of 255 paralogous genes were predicted which depicted the role of duplication events in expansion of this gene family. Majority of TaLRRKs consisted of trans-membrane region and localized on plasma-membrane. The TaLRRKs were further categorized into eight phylogenetic groups with numerous subgroups on the basis of sequence homology. The gene and protein structure in terms of exon/intron ratio, domains, and motifs organization were found to be variably conserved across the different phylogenetic groups/subgroups, which indicated a potential divergence and neofunctionalization during evolution. High-throughput transcriptome data and quantitative real time PCR analyses in various developmental stages, and biotic and abiotic (heat, drought, and salt) stresses provided insight into modus operandi of TaLRRKs during these conditions. Distinct expression of majority of stress responsive TaLRRKs homologous genes suggested their specified role in a particular condition. These results provided a comprehensive analysis of various characteristic features including functional divergence, which may provide the way for future functional characterization of this important gene family in bread wheat.

  10. Genomic dissection and expression profiling revealed functional divergence in Triticum aestivum leucine rich repeat receptor like kinases (TaLRRKs

    Directory of Open Access Journals (Sweden)

    Shumayla .

    2016-09-01

    Full Text Available The leucine rich repeat receptor like kinases (LRRK constitute the largest subfamily of receptor like kinases (RLK, which play critical roles in plant development and stress responses. Herein, we identified 531 TaLRRK genes in Triticum aestivum (bread wheat, which were distributed throughout the A, B, and D sub-genomes and chromosomes. These were clustered into 233 homologous groups, which were mostly located on either homeologous chromosomes from various sub-genomes or in proximity on the same chromosome. A total of 255 paralogous genes were predicted which depicted the role of duplication events in expansion of this gene family. Majority of TaLRRKs consisted of trans-membrane region and localized on plasma-membrane. The TaLRRKs were further categorized into eight phylogenetic groups with numerous subgroups on the basis of sequence homology. The gene and protein structure in terms of exon/intron ratio, domains and motifs organization were found to be variably conserved across the different phylogenetic groups/subgroups, which indicated a potential divergence and neofunctionalization during evolution. High-throughput transcriptome data and quantitative real time PCR analyses in various developmental stages, and biotic and abiotic (heat, drought and salt stresses provided insight into modus operandi of TaLRRKs during these conditions. Distinct expression of majority of stress responsive TaLRRKs homologous genes suggested their specified role in a particular condition. These results provided a comprehensive analysis of various characteristic features including functional divergence, which may provide the way for future functional characterization of this important gene family in bread wheat.

  11. Origin and diversification of leucine-rich repeat receptor-like protein kinase (LRR-RLK) genes in plants.

    Science.gov (United States)

    Liu, Ping-Li; Du, Liang; Huang, Yuan; Gao, Shu-Min; Yu, Meng

    2017-02-07

    Leucine-rich repeat receptor-like protein kinases (LRR-RLKs) are the largest group of receptor-like kinases in plants and play crucial roles in development and stress responses. The evolutionary relationships among LRR-RLK genes have been investigated in flowering plants; however, no comprehensive studies have been performed for these genes in more ancestral groups. The subfamily classification of LRR-RLK genes in plants, the evolutionary history and driving force for the evolution of each LRR-RLK subfamily remain to be understood. We identified 119 LRR-RLK genes in the Physcomitrella patens moss genome, 67 LRR-RLK genes in the Selaginella moellendorffii lycophyte genome, and no LRR-RLK genes in five green algae genomes. Furthermore, these LRR-RLK sequences, along with previously reported LRR-RLK sequences from Arabidopsis thaliana and Oryza sativa, were subjected to evolutionary analyses. Phylogenetic analyses revealed that plant LRR-RLKs belong to 19 subfamilies, eighteen of which were established in early land plants, and one of which evolved in flowering plants. More importantly, we found that the basic structures of LRR-RLK genes for most subfamilies are established in early land plants and conserved within subfamilies and across different plant lineages, but divergent among subfamilies. In addition, most members of the same subfamily had common protein motif compositions, whereas members of different subfamilies showed variations in protein motif compositions. The unique gene structure and protein motif compositions of each subfamily differentiate the subfamily classifications and, more importantly, provide evidence for functional divergence among LRR-RLK subfamilies. Maximum likelihood analyses showed that some sites within four subfamilies were under positive selection. Much of the diversity of plant LRR-RLK genes was established in early land plants. Positive selection contributed to the evolution of a few LRR-RLK subfamilies.

  12. Enhanced central serotonin release from slices of rat hypothalamus following repeated nialamide administration: evidence supporting the overactive serotonin receptor theory of depression

    Energy Technology Data Exchange (ETDEWEB)

    Offord, S.J.

    1986-01-01

    Researchers are suggesting unipolar affective disorders may be related to an abnormality in biogenic amine receptor-sensitivity. This abnormality may be a result of a dysfunction in central serotonin (5-HT) release mechanisms. 5-HT neurotransmission is modulated by presynaptic autoreceptors, which are members of the 5-HT/sub 1/ receptor subtype. The autoreceptor is thought to play an important role in the homeostasis of the central 5-HT synapse and could be a site at which some antidepressants mediate their therapeutic effect. The number of 5-HT/sub 1/ type receptor binding sites are reduced and behavior mediated by this receptor is abolished following repeated injections of monoamine oxidase inhibitor type antidepressants. These changes did not occur following a single injection. It was hypothesized that repeated treatment with a monoamine oxidase inhibitor would reduce the sensitivity of 5-HT autoreceptors and enhance 5-HT release. Rats were pretreated with single or repeated (twice daily for 7 days) intraperitoneal injections of nialamide (40 mg/kg) or chlorimipramine (10 mg/kg) and the ability of the autoreceptor agonist to inhibit potassium-induced /sup 3/H-5-HT release was evaluated using an in vitro superfusion system. These changes in 5-HT autoreceptor activity are consistent with other reports evaluating monoamine oxidase inhibitors on 5-HT/sub 1/ type receptors. It is hypothesized that the changes in 5-HT neurotransmission are related to the antidepressant mechanism of monoamine oxidase inhibitors.

  13. Repeated cocaine enhances ventral hippocampal-stimulated dopamine efflux in the nucleus accumbens and alters ventral hippocampal NMDA receptor subunit expression.

    Science.gov (United States)

    Barr, Jeffrey L; Forster, Gina L; Unterwald, Ellen M

    2014-08-01

    Dopaminergic neurotransmission in the nucleus accumbens is important for various reward-related cognitive processes including reinforcement learning. Repeated cocaine enhances hippocampal synaptic plasticity, and phasic elevations of accumbal dopamine evoked by unconditioned stimuli are dependent on impulse flow from the ventral hippocampus. Therefore, sensitized hippocampal activity may be one mechanism by which drugs of abuse enhance limbic dopaminergic activity. In this study, in vivo microdialysis in freely moving adult male Sprague-Dawley rats was used to investigate the effect of repeated cocaine on ventral hippocampus-mediated dopaminergic transmission within the medial shell of the nucleus accumbens. Following seven daily injections of saline or cocaine (20 mg/kg, ip), unilateral infusion of N-methyl-d-aspartate (NMDA, 0.5 μg) into the ventral hippocampus transiently increased both motoric activity and ipsilateral dopamine efflux in the medial shell of the nucleus accumbens, and this effect was greater in rats that received repeated cocaine compared to controls that received repeated saline. In addition, repeated cocaine altered NMDA receptor subunit expression in the ventral hippocampus, reducing the NR2A : NR2B subunit ratio. Together, these results suggest that repeated exposure to cocaine produces maladaptive ventral hippocampal-nucleus accumbens communication, in part through changes in glutamate receptor composition. A behaviorally sensitizing regimen of cocaine (20 mg/kg, ip 7 days) also sensitized ventral hippocampus (hipp)-mediated dopaminergic transmission within the nucleus accumbens (Nac) to NMDA stimulation (bolts). This was associated with reduced ventral hippocampal NR2A:NR2B subunit ratio, suggesting that repeated exposure to cocaine produces changes in hippocampal NMDA receptor composition that lead to enhanced ventral hippocampus-nucleus accumbens communication.

  14. Structural model for the interaction of a designed Ankyrin Repeat Protein with the human epidermal growth factor receptor 2.

    Directory of Open Access Journals (Sweden)

    V Chandana Epa

    Full Text Available Designed Ankyrin Repeat Proteins are a class of novel binding proteins that can be selected and evolved to bind to targets with high affinity and specificity. We are interested in the DARPin H10-2-G3, which has been evolved to bind with very high affinity to the human epidermal growth factor receptor 2 (HER2. HER2 is found to be over-expressed in 30% of breast cancers, and is the target for the FDA-approved therapeutic monoclonal antibodies trastuzumab and pertuzumab and small molecule tyrosine kinase inhibitors. Here, we use computational macromolecular docking, coupled with several interface metrics such as shape complementarity, interaction energy, and electrostatic complementarity, to model the structure of the complex between the DARPin H10-2-G3 and HER2. We analyzed the interface between the two proteins and then validated the structural model by showing that selected HER2 point mutations at the putative interface with H10-2-G3 reduce the affinity of binding up to 100-fold without affecting the binding of trastuzumab. Comparisons made with a subsequently solved X-ray crystal structure of the complex yielded a backbone atom root mean square deviation of 0.84-1.14 Ångstroms. The study presented here demonstrates the capability of the computational techniques of structural bioinformatics in generating useful structural models of protein-protein interactions.

  15. Crystal structures of ryanodine receptor SPRY1 and tandem-repeat domains reveal a critical FKBP12 binding determinant.

    Science.gov (United States)

    Yuchi, Zhiguang; Yuen, Siobhan M Wong King; Lau, Kelvin; Underhill, Ainsley Q; Cornea, Razvan L; Fessenden, James D; Van Petegem, Filip

    2015-08-06

    Ryanodine receptors (RyRs) form calcium release channels located in the membranes of the sarcoplasmic and endoplasmic reticulum. RyRs play a major role in excitation-contraction coupling and other Ca(2+)-dependent signalling events, and consist of several globular domains that together form a large assembly. Here we describe the crystal structures of the SPRY1 and tandem-repeat domains at 1.2-1.5 Å resolution, which reveal several structural elements not detected in recent cryo-EM reconstructions of RyRs. The cryo-EM studies disagree on the position of SPRY domains, which had been proposed based on homology modelling. Computational docking of the crystal structures, combined with FRET studies, show that the SPRY1 domain is located next to FK506-binding protein (FKBP). Molecular dynamics flexible fitting and mutagenesis experiments suggest a hydrophobic cluster within SPRY1 that is crucial for FKBP binding. A RyR1 disease mutation, N760D, appears to directly impact FKBP binding through interfering with SPRY1 folding.

  16. [Tissue variability of androgen receptor gene in bulbospinal muscular atrophy--comparison of the number of CAG repeats between muscles and peripheral blood leukocytes].

    Science.gov (United States)

    Nakajima, H; Kimura, F; Shinoda, K; Ohsawa, N; Nakagawa, T; Shimizu, A

    1993-10-01

    We investigated an expansion of CAG repeats in exon 1 of androgen receptor gene in skeletal muscle tissue obtained from the patients with various neuro-muscular disorders (5 BSMA, 33 patients with amyotrophic lateral sclerosis, 3 patients with spinal progressive muscular atrophy and 2 patients with hereditary motor sensory neuropathy), by polymerase chain reaction (PCR) amplification according to LaSpadas' description. These muscle tissues had been stored at -70 degrees C freezer during 7 years. We also studied the tissue variation of CAG repeats size between muscles and peripheral blood leukocytes in 4 patients with BSMA. And we confirmed the increased number of CAG repeats in all 5 BSMA except for other patients with neurogenic muscular atrophy. In the 4 BSMA patients, we subcloned the PCR products from muscles tissues and peripheral blood leukocytes, and we determined the number of CAG repeats by sequencing. The repeats of them were 43-51, and all BSMA patients showed the same number of CAG repeats in muscles tissues and peripheral blood leukocytes. The CAG repeats fragment of BSMA may be stable region in frozen storage state for 7 years, and we didn't recognized the somatic variation at least between muscles tissues and peripheral blood leukocytes.

  17. Variation in CAG and GGN repeat lengths and CAG/GGN haplotype in androgen receptor gene polymorphism and prostate carcinoma in Nigerians.

    Science.gov (United States)

    Akinloye, O; Gromoll, J; Simoni, M

    2011-01-01

    Prostate cancer has become the most common cancer in Nigerian men. The growth of the prostate gland depends on circulating androgens and intracellular steroid signalling pathways. The effects of androgens are mediated through the androgen receptor (AR), a nuclear transcription factor encoded by the AR gene. The common polymorphisms, CAG and GGN repeats, in exon 1 of this gene have been implicated as possible risk factors. Thus far, existing supporting data are scanty and none are from sub-Saharan African populations. Therefore, this study investigates the possible association between AR polymorphism repeat length (CAG and GGN) and prostate cancer in Nigerians. A total of 261 subjects (70 with prostate cancer, 68 with benign prostate hyperplasia [BPH], 123 age-matched apparently normal subjects as controls) were studied. CAG and GGN repeats length were determined by fragment length analysis using GeneScan. The CAG repeat length in prostate cancer and in BPH compared to the controls was significantly different (P CAG repeats showing a significant odds ratio (OR) in both cases. However, this was not observed in GGN repeat length, which showed no significant difference between cases and controls (P > 0.05). CAG and GGN haplotype variation showed no significant difference between cases and controls (P > 0.05), except that the haplotypes CAG > or =21 and GGN CAG repeat length is a risk factor for prostate cancer, and also suggests an association with BPH.

  18. Balanced nuclear and cytoplasmic activities of EDS1 are required for a complete plant innate immune response.

    Directory of Open Access Journals (Sweden)

    Ana V García

    Full Text Available An important layer of plant innate immunity to host-adapted pathogens is conferred by intracellular nucleotide-binding/oligomerization domain-leucine rich repeat (NB-LRR receptors recognizing specific microbial effectors. Signaling from activated receptors of the TIR (Toll/Interleukin-1 Receptor-NB-LRR class converges on the nucleo-cytoplasmic immune regulator EDS1 (Enhanced Disease Susceptibility1. In this report we show that a receptor-stimulated increase in accumulation of nuclear EDS1 precedes or coincides with the EDS1-dependent induction and repression of defense-related genes. EDS1 is capable of nuclear transport receptor-mediated shuttling between the cytoplasm and nucleus. By enhancing EDS1 export from inside nuclei (through attachment of an additional nuclear export sequence (NES or conditionally releasing EDS1 to the nucleus (by fusion to a glucocorticoid receptor (GR in transgenic Arabidopsis we establish that the EDS1 nuclear pool is essential for resistance to biotrophic and hemi-biotrophic pathogens and for transcriptional reprogramming. Evidence points to post-transcriptional processes regulating receptor-triggered accumulation of EDS1 in nuclei. Changes in nuclear EDS1 levels become equilibrated with the cytoplasmic EDS1 pool and cytoplasmic EDS1 is needed for complete resistance and restriction of host cell death at infection sites. We propose that coordinated nuclear and cytoplasmic activities of EDS1 enable the plant to mount an appropriately balanced immune response to pathogen attack.

  19. Balanced nuclear and cytoplasmic activities of EDS1 are required for a complete plant innate immune response.

    Science.gov (United States)

    García, Ana V; Blanvillain-Baufumé, Servane; Huibers, Robin P; Wiermer, Marcel; Li, Guangyong; Gobbato, Enrico; Rietz, Steffen; Parker, Jane E

    2010-07-01

    An important layer of plant innate immunity to host-adapted pathogens is conferred by intracellular nucleotide-binding/oligomerization domain-leucine rich repeat (NB-LRR) receptors recognizing specific microbial effectors. Signaling from activated receptors of the TIR (Toll/Interleukin-1 Receptor)-NB-LRR class converges on the nucleo-cytoplasmic immune regulator EDS1 (Enhanced Disease Susceptibility1). In this report we show that a receptor-stimulated increase in accumulation of nuclear EDS1 precedes or coincides with the EDS1-dependent induction and repression of defense-related genes. EDS1 is capable of nuclear transport receptor-mediated shuttling between the cytoplasm and nucleus. By enhancing EDS1 export from inside nuclei (through attachment of an additional nuclear export sequence (NES)) or conditionally releasing EDS1 to the nucleus (by fusion to a glucocorticoid receptor (GR)) in transgenic Arabidopsis we establish that the EDS1 nuclear pool is essential for resistance to biotrophic and hemi-biotrophic pathogens and for transcriptional reprogramming. Evidence points to post-transcriptional processes regulating receptor-triggered accumulation of EDS1 in nuclei. Changes in nuclear EDS1 levels become equilibrated with the cytoplasmic EDS1 pool and cytoplasmic EDS1 is needed for complete resistance and restriction of host cell death at infection sites. We propose that coordinated nuclear and cytoplasmic activities of EDS1 enable the plant to mount an appropriately balanced immune response to pathogen attack.

  20. Analysis of the CAG repeat region of the androgen receptor gene in a kindred with X-linked spinal and bulbar muscular atrophy.

    Science.gov (United States)

    Belsham, D D; Yee, W C; Greenberg, C R; Wrogemann, K

    1992-10-01

    Herein we describe a family with X-linked spinal and bulbar muscular atrophy (SBMA or Kennedy's disease), an adult onset neuromuscular disease characterized by slow progression, predominant proximal and bulbar muscle weakness. One frequent association is the appearance of gynecomastia. This disorder was previously shown to be linked to the locus DXYS1 on the proximal long arm of the X chromosome. Recently, a report implicated a mutation at the N-terminus of the androgen receptor gene involving amplification of CAG repeats as the cause of X-linked SBMA. We studied this region of the androgen receptor in a kindred clinically suspected but not confirmed of having X-linked SBMA by the polymerase chain reaction (PCR) followed by Southern analysis and DNA sequencing. The mutated allele was found to have an increased number of 51 CAG repeats confirming the clinical diagnosis of SBMA. Normal individuals revealed 23 repeat numbers within the normal range, while another unrelated X-linked SBMA patient had an enlarged CAG repeat region. The carrier or disease status could be established or confirmed in 12 individuals of this family on the basis of detecting normal and disease alleles reflected by the number of CAG repeats.

  1. A structural model for binding of the serine-rich repeat adhesin GspB to host carbohydrate receptors.

    Directory of Open Access Journals (Sweden)

    Tasia M Pyburn

    2011-07-01

    Full Text Available GspB is a serine-rich repeat (SRR adhesin of Streptococcus gordonii that mediates binding of this organism to human platelets via its interaction with sialyl-T antigen on the receptor GPIbα. This interaction appears to be a major virulence determinant in the pathogenesis of infective endocarditis. To address the mechanism by which GspB recognizes its carbohydrate ligand, we determined the high-resolution x-ray crystal structure of the GspB binding region (GspB(BR, both alone and in complex with a disaccharide precursor to sialyl-T antigen. Analysis of the GspB(BR structure revealed that it is comprised of three independently folded subdomains or modules: 1 an Ig-fold resembling a CnaA domain from prokaryotic pathogens; 2 a second Ig-fold resembling the binding region of mammalian Siglecs; 3 a subdomain of unique fold. The disaccharide was found to bind in a pocket within the Siglec subdomain, but at a site distinct from that observed in mammalian Siglecs. Confirming the biological relevance of this binding pocket, we produced three isogenic variants of S. gordonii, each containing a single point mutation of a residue lining this binding pocket. These variants have reduced binding to carbohydrates of GPIbα. Further examination of purified GspB(BR-R484E showed reduced binding to sialyl-T antigen while S. gordonii harboring this mutation did not efficiently bind platelets and showed a significant reduction in virulence, as measured by an animal model of endocarditis. Analysis of other SRR proteins revealed that the predicted binding regions of these adhesins also had a modular organization, with those known to bind carbohydrate receptors having modules homologous to the Siglec and Unique subdomains of GspB(BR. This suggests that the binding specificity of the SRR family of adhesins is determined by the type and organization of discrete modules within the binding domains, which may affect the tropism of organisms for different tissues.

  2. A Structural Model for Binding of the Serine-Rich Repeat Adhesin GspB to Host Carbohydrate Receptors

    Energy Technology Data Exchange (ETDEWEB)

    Pyburn, Tasia M.; Bensing, Barbara A.; Xiong, Yan Q.; Melancon, Bruce J.; Tomasiak, Thomas M.; Ward, Nicholas J.; Yankovskaya, Victoria; Oliver, Kevin M.; Cecchini, Gary; Sulikowski, Gary A.; Tyska, Matthew J.; Sullam, Paul M.; Iverson, T.M. (VA); (UCLA); (Vanderbilt); (UCSF)

    2014-10-02

    GspB is a serine-rich repeat (SRR) adhesin of Streptococcus gordonii that mediates binding of this organism to human platelets via its interaction with sialyl-T antigen on the receptor GPIb{alpha}. This interaction appears to be a major virulence determinant in the pathogenesis of infective endocarditis. To address the mechanism by which GspB recognizes its carbohydrate ligand, we determined the high-resolution x-ray crystal structure of the GspB binding region (GspB{sub BR}), both alone and in complex with a disaccharide precursor to sialyl-T antigen. Analysis of the GspB{sub BR} structure revealed that it is comprised of three independently folded subdomains or modules: (1) an Ig-fold resembling a CnaA domain from prokaryotic pathogens; (2) a second Ig-fold resembling the binding region of mammalian Siglecs; (3) a subdomain of unique fold. The disaccharide was found to bind in a pocket within the Siglec subdomain, but at a site distinct from that observed in mammalian Siglecs. Confirming the biological relevance of this binding pocket, we produced three isogenic variants of S. gordonii, each containing a single point mutation of a residue lining this binding pocket. These variants have reduced binding to carbohydrates of GPIb{alpha}. Further examination of purified GspB{sub BR}-R484E showed reduced binding to sialyl-T antigen while S. gordonii harboring this mutation did not efficiently bind platelets and showed a significant reduction in virulence, as measured by an animal model of endocarditis. Analysis of other SRR proteins revealed that the predicted binding regions of these adhesins also had a modular organization, with those known to bind carbohydrate receptors having modules homologous to the Siglec and Unique subdomains of GspBBR. This suggests that the binding specificity of the SRR family of adhesins is determined by the type and organization of discrete modules within the binding domains, which may affect the tropism of organisms for different tissues.

  3. Intronic mutations outside of Alu-repeat-rich domains of the LDL receptor gene are a cause of familial hypercholesterolemia.

    Science.gov (United States)

    Amsellem, Sabine; Briffaut, Dorothée; Carrié, Alain; Rabès, Jean Pierre; Girardet, Jean Philippe; Fredenrich, Alexandre; Moulin, Philippe; Krempf, Michel; Reznik, Yves; Vialettes, Bernard; de Gennes, Jean Luc; Brukert, Eric; Benlian, Pascale

    2002-12-01

    Familial hypercholesterolemia (FH), a frequent monogenic condition complicated by premature cardiovascular disease, is characterized by high allelic heterogeneity at the low-density lipoprotein receptor ( LDLR) locus. Despite more than a decade of genetic testing, knowledge about intronic disease-causing mutations has remained limited because of lack of available genomic sequences. Based on the finding from bioinformatic analysis that Alu repeats represent 85% of LDLR intronic sequences outside exon-intron junctions, we designed a strategy to improve the exploration of genomic regions in the vicinity of exons in 110 FH subjects from an admixed population. In the first group of 42 patients of negative mutation carriers, as previously established by former screening strategies (denaturing gradient gel electrophoresis, DNA sequencing with former primers overlapping splice-sites, Southern Blotting), about half ( n=22) were found to be carriers of at least one heterozygous mutation. Among a second group of 68 newly recruited patients, 27% of mutation carriers ( n=37) had a splicing regulatory mutation. Overall, out of the 54 mutations identified, 13 were intronic, and 18 were novel, out of which nearly half were intronic. Two novel intronic mutations (IVS8-10G-->A within the polypyrimidine tract and IVS7+10G-->A downstream of donor site) might create potential aberrant splice sites according to neural-network computed estimation, contrary to 31 common single nucleotide variations also identified at exon-intron junctions. This new strategy of detecting the most likely disease-causing LDLR mutations outside of Alu-rich genomic regions reveals that intronic mutations may have a greater impact than previously reported on the molecular basis of FH.

  4. Role of androgen receptor CAG repeat polymorphism and X-inactivation in the manifestation of recurrent spontaneous abortions in Indian women.

    Directory of Open Access Journals (Sweden)

    Meka Aruna

    Full Text Available The aim of the present study was to investigate the role of CAG repeat polymorphism and X-chromosome Inactivation (XCI pattern in Recurrent Spontaneous Abortions among Indian women which has not been hitherto explored. 117 RSA cases and 224 Controls were included in the study. Cases were recruited from two different hospitals--Lakshmi Fertility Clinic, Nellore and Fernandez Maternity Hospital, Hyderabad. Controls were roughly matched for age, ethnicity and socioeconomic status. The CAG repeats of the Androgen Receptor gene were genotyped using a PCR-based assay and were analysed using the GeneMapper software to determine the CAG repeat length. XCI analysis was also carried out to assess the inactivation percentages. RSA cases had a significantly greater frequency of allele sizes in the polymorphic range above 19 repeats (p = 0.006, which is the median value of the controls, and in the biallelic mean range above 21 repeats (p = 0.002. We found no evidence of abnormal incidence of skewed X-inactivation. We conclude that longer CAG repeat lengths are associated with increased odds for RSA with statistical power estimated to be ∼90%.

  5. Decreased infiltration of macrophage scavenger receptor-positive cells in initial negative biopsy specimens is correlated with positive repeat biopsies of the prostate.

    Science.gov (United States)

    Nonomura, Norio; Takayama, Hitoshi; Kawashima, Atsunari; Mukai, Masatoshi; Nagahara, Akira; Nakai, Yasutomo; Nakayama, Masashi; Tsujimura, Akira; Nishimura, Kazuo; Aozasa, Katsuyuki; Okuyama, Akihiko

    2010-06-01

    Macrophage scavenger receptor (MSR)-positive inflammatory cells and tumor-associated macrophages (TAMs) have been reported to regulate the growth of various cancers. In this study, the infiltration of MSR-positive cells and TAMs was analyzed to predict the outcome of repeat biopsy in men diagnosed as having no malignancy at the first prostate biopsy. Repeat biopsy of the prostate was carried out in 92 patients who were diagnosed as having no malignancy at the first biopsy. Of these, 30 patients (32.6%) were positive for prostate cancer at the repeat biopsy. Tumor-associated macrophages and MSR-positive cells were immunohistochemically stained with mAbs CD68 and CD204, respectively. Six ocular measuring fields were chosen randomly under a microscope at x400 power in the initial negative biopsy specimens, and the mean TAM and MSR counts for each case were determined. No difference in TAM count was found between the cases with or without prostate cancer. By contrast, the MSR count in patients with cancer was significantly lower than that in patients without cancer at the repeat biopsy (P biopsies, or TAM count. Decreased infiltration of MSR-positive cells in negative first biopsy specimens was correlated with positive findings in the repeat biopsy. The MSR count might be a good indicator for avoiding unnecessary repeat biopsies.

  6. Comparative Geometrical Analysis of Leucine-Rich Repeat Structures in the Nod-Like and Toll-Like Receptors in Vertebrate Innate Immunity

    Directory of Open Access Journals (Sweden)

    Norio Matsushima

    2015-08-01

    Full Text Available The NOD-like receptors (NLRs and Toll-like receptors (TLRs are pattern recognition receptors that are involved in the innate, pathogen pattern recognition system. The TLR and NLR receptors contain leucine-rich repeats (LRRs that are responsible for ligand interactions. In LRRs short β-strands stack parallel and then the LRRs form a super helical arrangement of repeating structural units (called a coil of solenoids. The structures of the LRR domains of NLRC4, NLRP1, and NLRX1 in NLRs and of TLR1-5, TLR6, TLR8, TLR9 in TLRs have been determined. Here we report nine geometrical parameters that characterize the LRR domains; these include four helical parameters from HELFIT analysis. These nine parameters characterize well the LRR structures in NLRs and TLRs; the LRRs of NLR adopts a right-handed helix. In contrast, the TLR LRRs adopt either a left-handed helix or are nearly flat; RP105 and CD14 also adopt a left-handed helix. This geometrical analysis subdivides TLRs into four groups consisting of TLR3/TLR8/TLR9, TLR1/TLR2/TRR6, TLR4, and TLR5; these correspond to the phylogenetic tree based on amino acid sequences. In the TLRs an ascending lateral surface that consists of loops connecting the β-strand at the C-terminal side is involved in protein, protein/ligand interactions, but not the descending lateral surface on the opposite side.

  7. Repeated ketamine administration alters N-methyl-d-aspartic acid receptor subunit gene expression: Implication of genetic vulnerability for ketamine abuse and ketamine psychosis in humans

    Science.gov (United States)

    Lipsky, Robert H

    2015-01-01

    For more than 40 years following its approval by the Food and Drug Administration (FDA) as an anesthetic, ketamine, a non-competitive N-methyl-d-aspartic acid (NMDA) receptor antagonist, has been used as a tool of psychiatric research. As a psychedelic drug, ketamine induces psychotic symptoms, cognitive impairment, and mood elevation, which resemble some symptoms of schizophrenia. Recreational use of ketamine has been increasing in recent years. However, little is known of the underlying molecular mechanisms responsible for ketamine-associated psychosis. Recent animal studies have shown that repeated ketamine administration significantly increases NMDA receptor subunit gene expression, in particular subunit 1 (NR1 or GluN1) levels. This results in neurodegeneration, supporting a potential mechanism where up-regulation of NMDA receptors could produce cognitive deficits in chronic ketamine abuse patients. In other studies, NMDA receptor gene variants are associated with addictive behavior. Here, we focus on the roles of NMDA receptor gene subunits in ketamine abuse and ketamine psychosis and propose that full sequencing of NMDA receptor genes may help explain individual vulnerability to ketamine abuse and ketamine-associated psychosis. PMID:25245072

  8. Contributions by the CAG-repeat Polymorphism of the Androgen Receptor Gene and Circulating Androgens to Muscle Size. Odense Androgen Study - A Population-based Study of 20-29 Year-old Danish Men

    DEFF Research Database (Denmark)

    Nielsen, Torben Leo; Hagen, Claus; Wraae, Kristian;

    2007-01-01

    Context: The number of CAG-repeats within the CAG-repeat polymorphism of the androgen receptor gene is inversely correlated with the transcriptional activity of the androgen receptor. Objective: To study the effect of the CAG-repeat number and circulating androgens on muscle size, to examine......-repeat number correlated inversely with thigh and axial muscle area and with lower and upper extremity lean body mass. Except for upper extremity lean body mass, these findings remained significant in multivariate analyses controlling for circulating androgens, physical activity, smoking, alcohol intake...

  9. Evidence against a critical role of CB1 receptors in adaptation of the hypothalamic-pituitary-adrenal axis and other consequences of daily repeated stress.

    Science.gov (United States)

    Rabasa, Cristina; Pastor-Ciurana, Jordi; Delgado-Morales, Raúl; Gómez-Román, Almudena; Carrasco, Javier; Gagliano, Humberto; García-Gutiérrez, María S; Manzanares, Jorge; Armario, Antonio

    2015-08-01

    There is evidence that endogenous cannabinoids (eCBs) play a role in the control of the hypothalamic-pituitary-adrenal (HPA) axis, although they appear to have dual, stimulatory and inhibitory, effects. Recent data in rats suggest that eCBs, acting through CB1 receptors (CB1R), may be involved in adaptation of the HPA axis to daily repeated stress. In the present study we analyze this issue in male mice and rats. Using a knock-out mice for the CB1 receptor (CB1-/-) we showed that mutant mice presented similar adrenocorticotropic hormone (ACTH) response to the first IMO as wild-type mice. Daily repeated exposure to 1h of immobilization reduced the ACTH response to the stressor, regardless of the genotype, demonstrating that adaptation occurred to the same extent in absence of CB1R. Prototypical changes observed after repeated stress such as enhanced corticotropin releasing factor (CRH) gene expression in the paraventricular nucleus of the hypothalamus, impaired body weight gain and reduced thymus weight were similarly observed in both genotypes. The lack of effect of CB1R in the expression of HPA adaptation to another similar stressor (restraint) was confirmed in wild-type CD1 mice by the lack of effect of the CB1R antagonist AM251 just before the last exposure to stress. Finally, the latter drug did not blunt the HPA, glucose and behavioral adaptation to daily repeated forced swim in rats. Thus, the present results indicate that CB1R is not critical for overall effects of daily repeated stress or proper adaptation of the HPA axis in mice and rats.

  10. Analysis of the androgen receptor CAG repeats length in Iranian patients with idiopathic non-obstructive azoospermia

    Directory of Open Access Journals (Sweden)

    Sohreh Zare-Karizi

    2016-03-01

    Conclusion: Although our results indicate a significant negative correlation between the length of CAG repeat and male infertility, however, other genetic modifiers may be required in order to cause male infertility.

  11. Non-linear association between androgen receptor CAG and GGN repeat lengths and reproductive parameters in fertile European and Inuit men.

    Science.gov (United States)

    Brokken, L J S; Rylander, L; Jönsson, B A; Spanò, M; Pedersen, H S; Ludwicki, J K; Zviezdai, V; Bizzaro, D; Manicardi, G C; Toft, G; Bonde, J P; Giwercman, A; Lundberg Giwercman, Y

    2013-05-06

    Recently the dogma that there is an inverse linear association between androgen receptor (AR) CAG and GGN polymorphisms and receptor activity has been challenged. We analysed the pattern of association between 21 male reproductive phenotypes and AR CAG/GGN repeat lengths in 557 proven-fertile men. A linear association was only found between sperm DNA fragmentation index (DFI) and CAG length, and between inhibin B and GGN length. Men with longer CAG then the reference (22-24), had higher oestradiol levels, whereas men with shorter CAG stretches had a higher DFI and a higher proportion of Fas-positive germ cells. Subjects with either short or long CAG had increased seminal levels of prostate-specific antigen and neutral α-glucosidase activity. Compared to men with the median GGN length of 23, those with shorter GGN repeats had higher levels of inhibin B, higher proportions of normal and progressive sperm, and a higher fraction of Fas-positive sperm, while men with longer GGN had higher oestradiol levels. These data indicate that at least for some markers of male reproductive function the association with CAG or GGN repeat length is curvilinear.

  12. Increased risk of breast cancer in women bearing a combination of large CAG and GGN repeats in the exon 1 of the androgen receptor gene.

    Science.gov (United States)

    González, Ana; Javier Dorta, F; Rodriguez, Germán; Brito, Buenaventura; Rodríguez, M A Del Cristo; Cabrera, Antonio; Díaz-Chico, Juan C; Reyes, Ricardo; Aguirre-Jaime, Armando; Nicolás Díaz-Chico, B

    2007-11-01

    The exon 1 of the human androgen receptor gene (AR) contains both CAG (polyglutamine) and GGN (polyglycine) repeat length polymorphisms. Large CAG repeats have been related to an increased risk of breast cancer (BC), whereas the influence of the GGN repeats is still unclear. Here, we have studied how the length of CAG and GGN repeats is associated with the risk of BC in a population from Tenerife (Canary Islands, Spain). The study was carried out on 257 woman diagnosed with BC and 393 controls, nesting in the 'CDC of the Canary Islands' cohort study. The AR CAG and GGN genotyping was performed by means of PCR amplification with specific fluorescently labelled primers followed by a capillary electrophoresis. The allelic distribution of CAG and GGN polymorphisms was similar in cases and controls. The mean of short and long CAG and GGN alleles did not show differences between cases and controls and the same was true when the average length of both CAG alleles (CAG(n)) and GGN alleles (GGN(n)) was considered. However, when CAG(n) and GGN(n) were categorised using 22 and 24 repeats as the cut-off point, respectively, significant differences between cases and controls were observed. The CAG(n)>22 repeats were more frequent in cases than in controls, being associated with an increased risk of BC (OR=1.49; CI(95%)=1.06-2.09; p=0.021). No significant differences were found for categorised GGN(n). For CAG(n)/GGN(n) combinations, the highest BC risk was found to be associated with the CAG(n)>22/GGN(n)24 combination (OR=2.47; CI(95%)=1.37-4.46; p=0.003). In conclusion, our results indicate that longer CAG(n)/GGN(n) combinations increase the risk of BC and suggest that CAG and GGN AR polymorphisms should be considered in order to assess the BC risk.

  13. Multiple processing of Ig-Hepta/GPR116, a G protein-coupled receptor with immunoglobulin (Ig)-like repeats, and generation of EGF2-like fragment.

    Science.gov (United States)

    Fukuzawa, Taku; Hirose, Shigehisa

    2006-09-01

    Ig-Hepta/GPR116 is a member of the LNB-TM7 subfamily of G protein-coupled receptors (GPCRs), also termed the adhesion GPCRs, whose members have EGF, cadherin, lectin, thrombospondin, or Ig repeats in their long N-terminus. In this study, we established that Ig-Hepta is processed at multiple sites yielding the following four fragments: (i) presequence (amino acid residues 1-24), (ii) proEGF2 (25-223, alpha-fragment), (iii) Ig repeats (224-993, beta-chain), and (iv) TM7 (994-1349, gamma-chain). The proEGF2 region is converted to EGF2 (52-223) by the processing enzyme furin and remains attached to the beta- and gamma-chains. Expression of some mRNA species was affected by the presence of alpha-fragment. These results suggest that the furin-processed alpha-fragment is involved in cellular signaling.

  14. Androgen receptor CAG repeat length and TMPRSS2:ETS prostate cancer risk: results From the Prostate Cancer Prevention Trial.

    Science.gov (United States)

    Figg, William D; Chau, Cindy H; Price, Douglas K; Till, Cathee; Goodman, Phyllis J; Cho, Yonggon; Varella-Garcia, Marileila; Reichardt, Juergen K V; Tangen, Catherine M; Leach, Robin J; van Bokhoven, Adrie; Thompson, Ian M; Lucia, M Scott

    2014-07-01

    To investigate the association between the length of the polymorphic trinucleotide CAG microsatellite repeats in exon 1 of the AR gene and the risk of prostate cancer containing TMPRSS2:ETS fusion genes. This nested case-control study came from subjects enrolled in the Prostate Cancer Prevention Trial and included 195 biopsy-proven prostate cancer cases with a known TMPRSS2:ETS status and 1344 matched controls. There was no association between the CAG repeat length and the risk of TMPRSS2:ETS-positive (odds ratio, 0.97; 95% confidence interval, 0.91-1.04) or TMPRSS2:ETS-negative prostate cancer (odds ratio, 1.04; 95% confidence interval, 0.97-1.11) and in patients with low- or high-grade disease. Our findings suggested that AR CAG repeats are not associated with TMPRSS2:ETS formation in prostate cancer. Published by Elsevier Inc.

  15. Involvement of δ-and μ-opioid receptors in the delayed cerebral ischemic tolerance induced by repeated electroacupuncture preconditioning in rats

    Institute of Scientific and Technical Information of China (English)

    XIONG Li-ze; YANG Jing; WANG Qiang; LU Zhi-hong

    2007-01-01

    Background Preconditioning with repeated electroacupuncture (EA) could mimic ischemic preconditioning to induce cerebral ischemic tolerance in rats. The present study was designed to investigate whether mu(μ)-, delta(δ)- or kappa(κ)-opioid receptors are involved in the neuroprotection induced by repeated EA preconditioning.Methods The rats were pretreated with naltrindole (NTI), nor-binaltorphimine (nor-BNI) or D-Phe-Cys-Tyr-D-Trp-Orn-Thr-Pen-Thr-NH2 (CTOP), which is a highly selective δ-, κ- or μ-opioid receptor antagonist respectively, before each EA preconditioning (30 minutes per day, 5 days). Twenty-four hours after the last EA treatment, the middle cerebral artery occlusion (MCAO) was induced for 120 minutes. The brain infarct volume was determined with 2,3,5-triphenyltetrazolium chloride staining at 24 hours after MCAO and compared with that in rats which only received EA preconditioning. In another experiment, the met-enkephalin-like immunoreactivity in rat brain was investigated by immunohistochemistry in both EA preconditioning and control rats.Results The EA preconditioning reduced brain infarct volume compared with the control rats (P=0.000). Administration of both NTI and CTOP attenuated the brain infarct volume reduction induced by EA preconditioning, presenting with larger infarct volume than that in the EA preconditioning rats (P<0.001). But nor-BNI administration did not block the infarct volume reduction induced by EA preconditioning, presenting with smaller infarct volume than the control group rats(P=0.000). The number of met-enkephalin-like immunoreactivity positive neurons in the EA preconditioning rats was more than that of the control rats (P=0.000).Conclusion Repeated EA preconditioning stimulates the release of enkephalins, which may bind δ- and μ-opioid receptors to induce the tolerance against focal cerebral ischemia.

  16. Androgen receptor gene CAG repeat length as modifier of the association between Persistent Organohalogen Pollutant exposure markers and semen characteristics

    DEFF Research Database (Denmark)

    Giwercman, Aleksander; Rylander, Lars; Rignell-Hydbom, Anna;

    2007-01-01

    OBJECTIVES: Exposure to persistent organohalogen pollutants was suggested to impair male reproductive function. A gene-environment interaction has been proposed. No genes modifying the effect of persistent organohalogen pollutants on reproductive organs have yet been identified. We aimed...... and morphology) and DNA fragmentation index (DFI) were determined. CAG and GGN repeat lengths were determined by direct sequencing of leukocyte DNA. RESULTS: A statistically significant interaction was found between the CB-153 group and CAG repeat category in relation to sperm concentration and total sperm count...

  17. Repeated administration of Yokukansan inhibits DOI-induced head-twitch response and decreases expression of 5-hydroxytryptamine (5-HT)2A receptors in the prefrontal cortex.

    Science.gov (United States)

    Egashira, Nobuaki; Iwasaki, Katsunori; Ishibashi, Ayumi; Hayakawa, Kazuhide; Okuno, Ryoko; Abe, Moe; Uchida, Naoki; Mishima, Kenichi; Takasaki, Kotaro; Nishimura, Ryoji; Oishi, Ryozo; Fujiwara, Michihiro

    2008-08-01

    Behavioral and psychological symptoms of dementia (BPSD) are commonly seen in patients with Alzheimer's disease (AD) and other forms of senile dementia. BPSD have a serious impact on the quality of life of dementia patients, as well as their caregivers. However, an effective drug therapy for BPSD has not been established. Recently, the traditional Japanese medicine Yokukansan (YKS, Yi-gan san in Chinese) has been reported to improve BPSD in a randomized, single-blind, placebo-controlled study. Moreover, abnormalities of the serotonin (5-HT) system such as 5-HT2A receptors have been reported to be associated with BPSD of AD patients. In the present study, we investigated the effect of YKS on head-twitch response induced by 2,5-dimethoxy-4-iodoamphetamine (DOI, 5 mg/kg, i.p.) in mice, a behavioral response that is mediated, in part, by 5-HT2A receptors. Acute treatment with YKS (100 and 300 mg/kg, p.o.) had no effect on the DOI-induced head-twitch response, whilst 14 days repeated treatment with YKS (300 mg/kg, p.o.) significantly inhibited this response. Moreover, repeated treatment with YKS (300 mg/kg, p.o.) decreased expression of 5-HT2A receptors in the prefrontal cortex, which is part of the circuitry mediating the head-twitch response. These findings suggest that the inhibition of DOI-induced head-twitch response by YKS may be mediated, in part, by altered expression of 5-HT2A receptors in the prefrontal cortex, which suggests the involvement of the 5-HT system in psychopharmacological effects of YKS.

  18. Heterogenous effect of androgen receptor CAG tract length on testicular germ cell tumor risk: shorter repeats associated with seminoma but not other histologic types

    Science.gov (United States)

    Davis-Dao, Carol A.; Siegmund, Kimberly D.; Vandenberg, David J.; Skinner, Eila C.; Coetzee, Gerhard A.; Thomas, Duncan C.; Pike, Malcolm C.; Cortessis, Victoria K.

    2011-01-01

    Increasing rates of testicular germ cells tumors (TGCTs) overtime suggest that environmental factors are involved in disease etiology, but familial risk and genome-wide association studies implicate genetic factors as well. We investigated whether variation in the functional CAGn polymorphism in the androgen receptor (AR) gene is associated with TGCT risk, using data from a population-based family study. We estimated odds ratios (OR) and 95% confidence intervals (CI) for the association of CAG repeat length and TGCT risk using matched pairs logistic regression. Analyses of 273 TGCT case–mother pairs revealed no association between AR CAG repeat length and overall TGCT risk. However, risk of seminoma was significantly associated with shorter CAG repeat length [CAG 20–21 versus CAG ≤ 19: OR = 0.82 (95% CI: 0.43–1.58), CAG 22–23 versus CAG ≤ 19: OR = 0.39 (95% CI: 0.19–0.83) and CAG ≥ 24 versus CAG ≤ 19: OR = 0.42 (95% CI: 0.20–0.86)], with a highly significant trend over these four categories of decreasing CAG repeat length (Ptrend = 0.0030). This is the first report of a statistically significant association between AR CAG repeat length and seminoma risk, suggesting that increased AR transactivation may be involved in development of seminoma and/or progression of carcinoma in situ/intratubular germ cell neoplasia unclassified to seminoma. This result provides a rationale whereby androgenic environmental compounds could contribute to increases in TGCT incidence, and identifies for the first time a potential biological pathway influencing whether TGCTs achieve seminomatous versus nonseminomatous histology, a clinically and biologically important distinction. PMID:21642359

  19. Heterogenous effect of androgen receptor CAG tract length on testicular germ cell tumor risk: shorter repeats associated with seminoma but not other histologic types.

    Science.gov (United States)

    Davis-Dao, Carol A; Siegmund, Kimberly D; Vandenberg, David J; Skinner, Eila C; Coetzee, Gerhard A; Thomas, Duncan C; Pike, Malcolm C; Cortessis, Victoria K

    2011-08-01

    Increasing rates of testicular germ cells tumors (TGCTs) overtime suggest that environmental factors are involved in disease etiology, but familial risk and genome-wide association studies implicate genetic factors as well. We investigated whether variation in the functional CAG(n) polymorphism in the androgen receptor (AR) gene is associated with TGCT risk, using data from a population-based family study. We estimated odds ratios (OR) and 95% confidence intervals (CI) for the association of CAG repeat length and TGCT risk using matched pairs logistic regression. Analyses of 273 TGCT case-mother pairs revealed no association between AR CAG repeat length and overall TGCT risk. However, risk of seminoma was significantly associated with shorter CAG repeat length [CAG 20-21 versus CAG ≤ 19: OR = 0.82 (95% CI: 0.43-1.58), CAG 22-23 versus CAG ≤ 19: OR = 0.39 (95% CI: 0.19-0.83) and CAG ≥ 24 versus CAG ≤ 19: OR = 0.42 (95% CI: 0.20-0.86)], with a highly significant trend over these four categories of decreasing CAG repeat length (P(trend) = 0.0030). This is the first report of a statistically significant association between AR CAG repeat length and seminoma risk, suggesting that increased AR transactivation may be involved in development of seminoma and/or progression of carcinoma in situ/intratubular germ cell neoplasia unclassified to seminoma. This result provides a rationale whereby androgenic environmental compounds could contribute to increases in TGCT incidence, and identifies for the first time a potential biological pathway influencing whether TGCTs achieve seminomatous versus nonseminomatous histology, a clinically and biologically important distinction.

  20. Arabidopsis leucine-rich repeat receptor-like kinase NILR1 is required for induction of innate immunity to parasitic nematodes.

    Science.gov (United States)

    Mendy, Badou; Wang'ombe, Mary Wanjiku; Radakovic, Zoran S; Holbein, Julia; Ilyas, Muhammad; Chopra, Divykriti; Holton, Nick; Zipfel, Cyril; Grundler, Florian M W; Siddique, Shahid

    2017-04-01

    Plant-parasitic nematodes are destructive pests causing losses of billions of dollars annually. An effective plant defence against pathogens relies on the recognition of pathogen-associated molecular patterns (PAMPs) by surface-localised receptors leading to the activation of PAMP-triggered immunity (PTI). Extensive studies have been conducted to characterise the role of PTI in various models of plant-pathogen interactions. However, far less is known about the role of PTI in roots in general and in plant-nematode interactions in particular. Here we show that nematode-derived proteinaceous elicitor/s is/are capable of inducing PTI in Arabidopsis in a manner dependent on the common immune co-receptor BAK1. Consistent with the role played by BAK1, we identified a leucine-rich repeat receptor-like kinase, termed NILR1 that is specifically regulated upon infection by nematodes. We show that NILR1 is essential for PTI responses initiated by nematodes and nilr1 loss-of-function mutants are hypersusceptible to a broad category of nematodes. To our knowledge, NILR1 is the first example of an immune receptor that is involved in induction of basal immunity (PTI) in plants or in animals in response to nematodes. Manipulation of NILR1 will provide new options for nematode control in crop plants in future.

  1. The Effector SPRYSEC-19 of Globodera rostochiensis Suppresses CC-NB-LRR-Mediated Disease Resistance in Plants

    NARCIS (Netherlands)

    Postma, W.J.; Slootweg, E.J.; Rehman, S.; Finkers-Tomczak, A.M.; Tytgat, T.O.G.; Gelderen, van K.; Lozano Torres, J.L.; Roosien, J.; Pomp, H.; Schaik, van C.C.; Bakker, J.; Goverse, A.; Smant, G.

    2012-01-01

    The potato cyst nematode Globodera rostochiensis invades roots of host plants where it transforms cells near the vascular cylinder into a permanent feeding site. The host cell modifications are most likely induced by a complex mixture of proteins in the stylet secretions of the nematodes. Resistance

  2. An NB-LRR protein required for HR signalling mediated by both extra- and intracellular resistance proteins.

    NARCIS (Netherlands)

    S.H.E.J. Gabriels; J.H. Vossen; S.K. Ekengren; G. van Ooijen; A.M. Abd-El-Haliem; G.C.M. van den Berg; D.Y. Rainey; G.B. Martin; F.L.W. Takken; P.J.G.M. de Wit; M.H.A.J. Joosten

    2007-01-01

    Tomato (Solanum lycopersicum) Cf resistance genes confer hypersensitive response (HR)-associated resistance to strains of the pathogenic fungus Cladosporium fulvum that express the matching avirulence (Avr) gene. Previously, we identified an Avr4-responsive tomato (ART) gene that is required for Cf-

  3. An NB-LRR protein required for HR signalling mediated by both extra- and intracellular resistance proteins

    NARCIS (Netherlands)

    Gabriëls, S.H.E.J.; Vossen, J.H.; Ekengren, S.K.; Ooijen, van G.; Abd-El-Haliem, A.M.; Berg, van den G.C.M.; Rainey, D.Y.; Martin, G.B.; Takken, F.L.W.; Wit, de P.J.G.M.; Joosten, M.H.A.J.

    2007-01-01

    Tomato (Solanum lycopersicum) Cf resistance genes confer hypersensitive response (HR)-associated resistance to strains of the pathogenic fungus Cladosporium fulvum that express the matching avirulence (Avr) gene. Previously, we identified an Avr4-responsive tomato (ART) gene that is required for Cf-

  4. Molecular cloning, genomic organization, developmental regulation, and a knock-out mutant of a novel leu-rich repeats-containing G protein-coupled receptor (DLGR-2) from Drosophila melanogaster

    DEFF Research Database (Denmark)

    Eriksen, Kathrine Krageskov; Hauser, Frank; Schiøtt, Morten

    2000-01-01

    After screening the Berkeley Drosophila Genome Project database with sequences from a recently characterized Leu-rich repeats-containing G protein-coupled receptor (LGR) fromDrosophila (DLGR-1), we identified a second gene for a different LGR (DLGR-2) and cloned its cDNA. DLGR-2 is 1360 amino acid...... LGRs (LGR-4 and LGR-5). This homology includes the seven transmembrane region (e.g., 49% amino acid identity with the human TSH receptor) and the very large extracellular amino terminus. This amino terminus contains 18 Leu-rich repeats-in contrast with the 3 mammalian glycoprotein hormone receptors...

  5. D1 and D2 dopamine receptor antagonists decrease behavioral bout duration, without altering the bout's repeated behavioral components, in a naturalistic model of repetitive and compulsive behavior.

    Science.gov (United States)

    Hoffman, Kurt L; Rueda Morales, Rafael I

    2012-04-21

    Nest building behavior in the pregnant female rabbit (Oryctolagus cuniculus) is a model for compulsive behavior in Obsessive Compulsive Disorder (OCD). This behavior comprises a cycle of repeated, stereotyped components (collecting straw, entering nest box and depositing the straw there, returning to collect more straw), which itself is repeated 80+ times in a single bout that lasts approximately 50min. The bout, in turn, is repeated if necessary, according to the rabbit's perception of whether or not the nest is finished. We administered SCH23390 (5-100μg/kg; D1/D5 antagonist) or raclopride (0.05-1.0mg/kg; D2/D3 antagonist), subcutaneously to day 28 pregnant female rabbits, 30 or 60min before placing straw inside their home cage. At doses that minimally affected ambulatory behavior in open field (5-12.5μg/kg SCH23390, 0.5-1.0mg/kg raclopride), both antagonists dramatically reduced bout duration while not significantly affecting the initiation of straw carrying behavior, the sequential performance of the individual cycle components, maximum cycle frequency, or the total number of bouts performed. These results point to an important role for dopamine neurotransmission for the prolonged expression of a normal, repetitive and compulsive-like behavior. Moreover, the finding that dopamine receptor antagonists decrease the time spent engaged in repetitive behavior (without significantly altering the form of the repetitive behavior itself) suggests a possible explanation for why neuroleptics can be clinically effective for treating OCD.

  6. A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene.

    Science.gov (United States)

    Leonova, J; Hanson, C

    1999-01-01

    This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.

  7. Association between the dopamine D4 receptor gene exon III variable number of tandem repeats and political attitudes in female Han Chinese

    Science.gov (United States)

    Ebstein, Richard P.; Monakhov, Mikhail V.; Lu, Yunfeng; Jiang, Yushi; Lai, Poh San; Chew, Soo Hong

    2015-01-01

    Twin and family studies suggest that political attitudes are partially determined by an individual's genotype. The dopamine D4 receptor gene (DRD4) exon III repeat region that has been extensively studied in connection with human behaviour, is a plausible candidate to contribute to individual differences in political attitudes. A first United States study provisionally identified this gene with political attitude along a liberal–conservative axis albeit contingent upon number of friends. In a large sample of 1771 Han Chinese university students in Singapore, we observed a significant main effect of association between the DRD4 exon III variable number of tandem repeats and political attitude. Subjects with two copies of the 4-repeat allele (4R/4R) were significantly more conservative. Our results provided evidence for a role of the DRD4 gene variants in contributing to individual differences in political attitude particularly in females and more generally suggested that associations between individual genes, and neurochemical pathways, contributing to traits relevant to the social sciences can be provisionally identified. PMID:26246555

  8. The Plant Leucine-Rich Repeat Receptor-Like Kinase PSY1R from Head to Toe

    DEFF Research Database (Denmark)

    Oehlenschlæger, Christian Berg

    with a Kd of approximately 17 nM which is physiologically relevant. The activation mechanism of PSY1R was also studied. Full length PSY1R forms homodimers and interacts with members of the SERK co-receptor family in planta. An intact PSY1R C-terminal domain was shown to be required for these interactions...

  9. Androgen receptor gene CAG repeat polymorphism independently influences recovery of male sexual function after testosterone replacement therapy in postsurgical hypogonadotropic hypogonadism.

    Science.gov (United States)

    Tirabassi, Giacomo; Delli Muti, Nicola; Corona, Giovanni; Maggi, Mario; Balercia, Giancarlo

    2014-05-01

    Few and contradictory studies have evaluated the possible influence of androgen receptor (AR) gene CAG repeat polymorphism on male sexual function. In this study we evaluated the role of AR gene CAG repeat polymorphism in the recovery of sexual function after testosterone replacement therapy (TRT) in men affected by postsurgical hypogonadotropic hypogonadism, a condition which is often associated with hypopituitarism and in which the sexual benefits of TRT must be distinguished from those of pituitary-function replacement therapies. Fifteen men affected by postsurgical hypogonadotropic hypogonadism were retrospectively assessed before and after TRT. Main outcome measures included sexual parameters as assessed by the International Index of Erectile Function questionnaire, levels of pituitary dependent hormones (total testosterone, free T3, free T4, cortisol, insulin-like growth factor-1 [IGF-1], prolactin), and results of genetic analysis (AR gene CAG repeat number). Plasma concentrations of free T3, free T4, cortisol, and prolactin did not vary significantly between the two phases, while testosterone and IGF-1 increased significantly after TRT. A significant improvement in all sexual parameters studied was found. The number of CAG triplets was negatively and significantly correlated with changes in all the sexual parameters, while opposite correlations were found between changes in sexual parameters and changes in testosterone levels; no correlation of change in IGF1 with change in sexual parameters was reported. On multiple linear regression analysis, after correction for changes in testosterone, nearly all the associations between the number of CAG triplets and changes in sexual parameters were confirmed. Shorter length AR gene CAG repeat number is associated with the recovery of sexual function after TRT in postsurgical male hypogonadotropic hypogonadism, independently of the effects of concomitant pituitary-replacement therapies. © 2014 International Society

  10. Expression of a gibberellin-induced leucine-rich repeat receptor-like protein kinase in deepwater rice and its interaction with kinase-associated protein phosphatase

    Energy Technology Data Exchange (ETDEWEB)

    Knaap, E. van der; Sauter, M.; Kende, H. (Michigan State Univ., East Lansing, MI (United States). DOE Plant Research Lab.); Song, W.Y.; Ruan, D.L.; Ronald, P.C. (Univ. of California, Davis, CA (United States). Dept. of Plant Pathology)

    1999-06-01

    The authors identified in deepwater rice (Oryza sativa L.) a gene encoding a leucine-rich repeat receptor-like transmembrane protein kinase, OsTMK (O. sativa transmembrane kinase). The transcript levels of OsTMK increased in the rice internode in response to gibberellin. Expression of OsTMK was especially high in regions undergoing cell division and elongation. The kinase domain of OsTMK was enzymatically active autophosphorylating on serine and threonine residues. A cDNA encoding a rice ortholog of a kinase-associated type 2C protein phosphatase (OsKAPP) was cloned. KAPPs are putative downstream components in kinase-mediated signal transduction pathways. The kinase interaction domain of OsKAPP was phosphorylated in vitro by the kinase domain of OsTMK. RNA gel-blot analysis indicated that the expression of OsTMK and OsKAPP was similar in different tissues of the rice plant. In protein-binding assays, OsKAPP interacted with a receptor-like protein kinase, RLK5 of Arabidopsis, but not with the protein kinase domains of the rice and maize receptor-like protein kinases Xa21 and ZmPK1, respectively.

  11. Structure-function analysis of barley NLR immune receptor MLA10 reveals its cell compartment specific activity in cell death and disease resistance.

    Directory of Open Access Journals (Sweden)

    Shiwei Bai

    Full Text Available Plant intracellular immune receptors comprise a large number of multi-domain proteins resembling animal NOD-like receptors (NLRs. Plant NLRs typically recognize isolate-specific pathogen-derived effectors, encoded by avirulence (AVR genes, and trigger defense responses often associated with localized host cell death. The barley MLA gene is polymorphic in nature and encodes NLRs of the coiled-coil (CC-NB-LRR type that each detects a cognate isolate-specific effector of the barley powdery mildew fungus. We report the systematic analyses of MLA10 activity in disease resistance and cell death signaling in barley and Nicotiana benthamiana. MLA10 CC domain-triggered cell death is regulated by highly conserved motifs in the CC and the NB-ARC domains and by the C-terminal LRR of the receptor. Enforced MLA10 subcellular localization, by tagging with a nuclear localization sequence (NLS or a nuclear export sequence (NES, shows that MLA10 activity in cell death signaling is suppressed in the nucleus but enhanced in the cytoplasm. By contrast, nuclear localized MLA10 is sufficient to mediate disease resistance against powdery mildew fungus. MLA10 retention in the cytoplasm was achieved through attachment of a glucocorticoid receptor hormone-binding domain (GR, by which we reinforced the role of cytoplasmic MLA10 in cell death signaling. Together with our data showing an essential and sufficient nuclear MLA10 activity in disease resistance, this suggests a bifurcation of MLA10-triggered cell death and disease resistance signaling in a compartment-dependent manner.

  12. Characterization of Ethylene Receptors and Their Interactions with GmTPR-A Novel Tetratricopeptide Repeat Protein (TPR) in Soybean (Glycine max L.)

    Institute of Scientific and Technical Information of China (English)

    NIU Yan-yan; CHEN Ming; XU Zhao-shi; LI Lian-cheng; CHEN Xue-ping; MA You-zhi

    2013-01-01

    Ethylene receptors play important roles not only in regulation of growth and development but also in response to environmental stimuli of plants. However, there are few reports on ethylene receptors in soybean. In this article, putative ethylene receptors of soybean were searched from soybean genomic database (http://www.phytozome.net/search.php) and analyzed. The ethylene receptor gene family in soybean comprising eight members, designated as GmERS1-1, GmERS1-2, GmETR1-1, GmETR1-2, GmETR2-1, GmETR2-2, GmEIN4-1, and GmEIN4-2 corresponding with their homologous genes in Arabidopsis, were isolated and analyzed. Phylogenetic analysis indicated that the eight soybean ethylene receptors (SERs) were in two subfamilies and further divided into four groups, viz., groups I (GmERS1-1 and GmERS1-2), II (GmETR1-1 and GmETR1-2), VI (GmETR2-1 and GmETR2-2), and VII (GmEIN4-1 and GmEIN4-2). Protein structure of the members in groups I and II from subfamily I were more conserved than the members in other two groups from subfamily II. Expression patterns of the SERs were compared with the homologous genes in Arabidopsis. The results demonstrated that expression patterns of the SERs differed from Arabidopsis members in the same group, suggesting that SERs are involved in different signal pathways compared to ethylene receptors in Arabidopsis. Promoter analysis showed that the sequences of the members in each group were different from each other, and some specific binding elements of transcription factors detected in promoter sequences might explain the differences between the members in the same group. A novel soybean TPR protein (tetratricopeptide repeat protein), GmTPR, was identified to interact with GmETR1-1, apparently an important ethylene receptor in ethylene signaling pathway in soybean. This suggested that GmTPR might be a novel downstream component of the ethylene signaling pathway.

  13. New Repeat Polymorphism in the AKT1 Gene Predicts Striatal Dopamine D2/D3 Receptor Availability and Stimulant-Induced Dopamine Release in the Healthy Human Brain.

    Science.gov (United States)

    Shumay, Elena; Wiers, Corinde E; Shokri-Kojori, Ehsan; Kim, Sung Won; Hodgkinson, Colin A; Sun, Hui; Tomasi, Dardo; Wong, Christopher T; Weinberger, Daniel R; Wang, Gene-Jack; Fowler, Joanna S; Volkow, Nora D

    2017-05-10

    The role of the protein kinase Akt1 in dopamine neurotransmission is well recognized and has been implicated in schizophrenia and psychosis. However, the extent to which variants in the AKT1 gene influence dopamine neurotransmission is not well understood. Here we investigated the effect of a newly characterized variant number tandem repeat (VNTR) polymorphism in AKT1 [major alleles: L- (eight repeats) and H- (nine repeats)] on striatal dopamine D2/D3 receptor (DRD2) availability and on dopamine release in healthy volunteers. We used PET and [(11)C]raclopride to assess baseline DRD2 availability in 91 participants. In 54 of these participants, we also measured intravenous methylphenidate-induced dopamine release to measure dopamine release. Dopamine release was quantified as the difference in specific binding of [(11)C]raclopride (nondisplaceable binding potential) between baseline values and values following methylphenidate injection. There was an effect of AKT1 genotype on DRD2 availability at baseline for the caudate (F(2,90) = 8.2, p = 0.001) and putamen (F(2,90) = 6.6, p = 0.002), but not the ventral striatum (p = 0.3). For the caudate and putamen, LL showed higher DRD2 availability than HH; HL were in between. There was also a significant effect of AKT1 genotype on dopamine increases in the ventral striatum (F(2,53) = 5.3, p = 0.009), with increases being stronger in HH > HL > LL. However, no dopamine increases were observed in the caudate (p = 0.1) or putamen (p = 0.8) following methylphenidate injection. Our results provide evidence that the AKT1 gene modulates both striatal DRD2 availability and dopamine release in the human brain, which could account for its association with schizophrenia and psychosis. The clinical relevance of the newly characterized AKT1 VNTR merits investigation.SIGNIFICANCE STATEMENT The AKT1 gene has been implicated in schizophrenia and psychosis. This association is likely to reflect modulation of dopamine signaling by Akt1 kinase

  14. Emerging role for leucine-rich repeat-containing G-protein-coupled receptors LGR5 and LGR4 in cancer stem cells

    Directory of Open Access Journals (Sweden)

    Nakata S

    2014-03-01

    Full Text Available Susumu Nakata,1 Emma Phillips,2 Violaine Goidts21Division of Oncological Pathology, Aichi Cancer Center Research Institute, Nagoya, Japan; 2Division of Molecular Genetics, German Cancer Research Center, Heidelberg, GermanyAbstract: The concept of cancer stem cells has gained considerable interest in the last few decades, partly because of their potential implication in therapy resistance. However, the lack of specific cellular surface markers for these cells has impeded their isolation, making the characterization of this cellular subpopulation technically challenging. Recent studies have indicated that leucine-rich repeat-containing G-protein-coupled receptor 4 and 5 (LGR4 and LGR5 expression in multiple organs may represent a global marker of adult stem cells. This review aims to give an overview of LGR4 and LGR5 as cancer stem cell markers and their function in development.Keywords: glioblastoma, colorectal cancer, tissue stem cell marker

  15. Contributions by the CAG-repeat Polymorphism of the Androgen Receptor Gene and Circulating Androgens to Muscle Size. Odense Androgen Study - A Population-based Study of 20-29 Year-old Danish Men

    DEFF Research Database (Denmark)

    Nielsen, Torben Leo; Hagen, Claus; Wraae, Kristian

    2007-01-01

    Context: The number of CAG-repeats within the CAG-repeat polymorphism of the androgen receptor gene is inversely correlated with the transcriptional activity of the androgen receptor. Objective: To study the effect of the CAG-repeat number and circulating androgens on muscle size, to examine the ...... muscle size increased exponentially with decreasing androgen levels and was tripled at total testosterone levels...... the CAG-repeat number in relation to body fat mass and circulating androgens, and to identify the best hormonal marker of low muscle size amongst total testosterone, bioavailable testosterone, and dihydrotestosterone. Design, Setting, and Participants: Population-based study of 783 Danish men aged 20...... continuous outcomes (thigh and axial muscle area, lower extremity, upper extremity, and trunk lean body mass, and total body fat mass) and five binary outcomes of low muscle size defined as men with muscle size below the lower 10 percentile of each continuous outcome of muscle size. Results: The CAG...

  16. Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X chromosome inactivation

    Energy Technology Data Exchange (ETDEWEB)

    Allen, R.C.; Zoghbi, H.Y.; Moseley, A.B.; Rosenblatt, H.M.; Belmont, J.W. (Baylor College of Medicine, Houston (United States))

    1992-12-01

    The human androgen-receptor gene (HUMARA; GenBank) contains a highly polymorphic trinucleotide repeat in the first exon. The authors have found that the methylation of HpaII and HhaI sites less than 100 pb away from this polymorphic short tandem repeat (STR) correlates with X inactivation. The close proximity of the restriction-enzyme sites to the STR allows the development of a PCR assay that distinguishes between the maternal and paternal alleles and identifies their methylation status. The accuracy of this assay was tested on (a) DNA from hamster/human hybrid cell lines containing either an active or inactive human X chromosome; (b) DNA from normal males and females; and (c) DNA from females showing nonrandom patterns of X inactivation. Data obtained using this assay correlated substantially with those obtained using the PGK, HPRT, and M27[beta] probes, which detect X inactivation patterns by Southern blot analysis. In order to demonstrate one application of this assay, the authors examined X inactivation patterns in the B lymphocytes of potential and obligate carriers of X-linked agammaglobulinemia. 42 refs., 5 figs., 1 tab.

  17. No evidence that 2D:4D is related to the number of CAG repeats in the androgen receptor gene

    Directory of Open Access Journals (Sweden)

    Johannes eHönekopp

    2013-12-01

    Full Text Available The length ratio of the second to the fourth digit (2D:4D is a putative marker of prenatal testosterone (T effects. The number of CAG repeats (CAGn in the AR gene is negatively correlated with T sensitivity in vitro. Results regarding the relationship between 2D:4D and CAGn are mixed but have featured prominently in arguments for and against the validity of 2D:4D. Here, I present random-effects meta-analyses on 14 relevant samples with altogether 1,904 subjects. Results were homogeneous across studies. Even liberal estimates (upper limit of the 95% CI were close to zero and therefore suggested no substantial relationship of CAGn with either right-hand 2D:4D, left-hand 2D:4D, or the difference between the two. However, closer analysis of the effects of CAGn on T dependent gene activation in vitro and of relationships between CAGn and T dependent phenotypic characteristics suggest that normal variability of CAGn has mostly no, very small, or inconsistent effects. Therefore, the lack of a clear association between CAGn and 2D:4D has no negative implications for the latter’s validity as a marker of prenatal T effects.

  18. Repeated administration of alpha7 nicotinic acetylcholine receptor (nAChR) agonists, but not positive allosteric modulators, increases alpha7 nAChR levels in the brain

    DEFF Research Database (Denmark)

    Christensen, Ditte Z; Mikkelsen, Jens D; Hansen, Henrik H;

    2010-01-01

    -induced phosphorylation of Erk2 in the prefrontal cortex occurs following acute, but not repeated administration. Our results demonstrate that repeated agonist administration increases the number of alpha7 nAChRs in the brain, and leads to coupling versus uncoupling of specific intracellular signaling....... Here we investigate the effects of repeated agonism on alpha7 nAChR receptor levels and responsiveness in vivo in rats. Using [(125)I]-alpha-bungarotoxin (BTX) autoradiography we show that acute or repeated administration with the selective alpha7 nAChR agonist A-582941 increases the number of alpha7 n......-120596 and NS1738 do not increase [(125)I]-BTX binding. Furthermore, A-582941-induced increase in Arc and c-fos mRNA expression in the prefrontal cortex is enhanced and unaltered, respectively, after repeated administration, demonstrating that the alpha7 nAChRs remain responsive. Contrarily, A-582941...

  19. Identification and characterization of tandem repeats in exon III of dopamine receptor D4 (DRD4) genes from different mammalian species

    DEFF Research Database (Denmark)

    Larsen, Svend Arild; Mogensen, Line; Dietz, Rune

    2005-01-01

    tandem repeat, while a tandem repeat consisting of 27-bp modules was identified in a sequence from European badger. Both these tandem repeats were composed of 9-bp basic units, which were closely related with the 9-bp repeat modules identified in the mink and ferret. Tandem repeats could...... repeat being found. In the domestic cow and gray seal we identified tandem repeats composed of 36-bp modules, each consisting of two closely related 18-bp basic units. A tandem repeat consisting of 9-bp modules was identified in sequences from mink and ferret. In the European otter we detected an 18-bp...

  20. Repeated Forced Swim Exacerbates Methamphetamine-Induced Neurotoxicity: Neuroprotective Effects of Nanowired Delivery of 5-HT3-Receptor Antagonist Ondansetron.

    Science.gov (United States)

    Lafuente, José Vicente; Sharma, Aruna; Muresanu, Dafin F; Ozkizilcik, Asya; Tian, Z Ryan; Patnaik, Ranjana; Sharma, Hari S

    2017-08-31

    The possibility that stress associated with chronic forced swim (FS) may exacerbate methamphetamine (METH) neurotoxicity was examined in a rat model. Rats were subjected to FS in a pool (30 °C) for 15 min daily for 8 days. Control rats were kept at room temperature. METH was administered (9 mg/kg, s.c.) in both control and FS rats and allowed to survive 4 h after the drug injection. METH in FS rats exacerbated BBB breakdown to Evans blue albumin (EBA) by 150 to 220% and ([131])-Iodine by 250 to 380% as compared to naive rats after METH. The METH-induced BBB leakage was most pronounced in the cerebral cortex followed by the hippocampus, cerebellum, thalamus, and hypothalamus in both FS and naive rats. The regional BBB changes were associated with a reduction in the local cerebral blood flow (CBF). Brain edema was also higher by 2 to 4% in FS rats after METH than in naive animals. Neuronal and glial cell injuries were aggravated by threefold to fivefold after METH in FS than the control group. Pretreatment with ondansetron (1 mg/kg, i.p.) 30 min before METH injection in naive rats reduced the brain pathology and improved the CBF. However, TiO2-nanowired delivery of ondansetron (1 mg/kg, i.p.) was needed to reduce METH-induced brain damage, BBB leakage, reduction in CBF, and edema formation in FS. Taken together, these observations are the first to show that METH exacerbates BBB breakdown leading to neurotoxicity in FS animals. This effect of METH-induced BBB breakdown and brain pathology in naive and FS rats is attenuated by ondansetron treatment indicating an involvement of 5-HT3 receptors, not reported earlier.

  1. The impact of the CAG repeat polymorphism of the androgen receptor gene on muscle and adipose tissues in 20-29-year-old Danish men: Odense Androgen Study

    DEFF Research Database (Denmark)

    Nielsen, Torben Leo; Hagen, Claus; Wraae, Kristian

    2010-01-01

    not correlate with any circulating androgen. Conclusions: The CAG repeat polymorphism affects body composition in young men: absolute musclethigh and absolute musclelower trunk increase as CAGn decreases. Expressed relatively, muscle areas and LBM increase, while SAT and FM decrease as CAGn decreases......Background: The number of CAG repeats (CAGn) within the CAG repeat polymorphism of the androgen receptor gene correlates inversely with the transactivation of the receptor. Objective: To examine the impact of CAGn on muscle, fat distribution, and circulating androgen levels. Design, settings...... and participants: Population-based, cross-sectional study of 783 Danish men aged 20–29 years. Methods: Genotyping was performed in 767 men. Areas of thigh and lower trunk muscle (musclethigh and musclelower trunk), subcutaneous adipose tissues (SATthigh and SATlower trunk), and deep adipose tissues (i...

  2. Genome-wide cloning and sequence analysis of leucine-rich repeat receptor-like protein kinase genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Yuan Tong

    2010-01-01

    Full Text Available Abstract Background Transmembrane receptor kinases play critical roles in both animal and plant signaling pathways regulating growth, development, differentiation, cell death, and pathogenic defense responses. In Arabidopsis thaliana, there are at least 223 Leucine-rich repeat receptor-like kinases (LRR-RLKs, representing one of the largest protein families. Although functional roles for a handful of LRR-RLKs have been revealed, the functions of the majority of members in this protein family have not been elucidated. Results As a resource for the in-depth analysis of this important protein family, the complementary DNA sequences (cDNAs of 194 LRR-RLKs were cloned into the GatewayR donor vector pDONR/ZeoR and analyzed by DNA sequencing. Among them, 157 clones showed sequences identical to the predictions in the Arabidopsis sequence resource, TAIR8. The other 37 cDNAs showed gene structures distinct from the predictions of TAIR8, which was mainly caused by alternative splicing of pre-mRNA. Most of the genes have been further cloned into GatewayR destination vectors with GFP or FLAG epitope tags and have been transformed into Arabidopsis for in planta functional analysis. All clones from this study have been submitted to the Arabidopsis Biological Resource Center (ABRC at Ohio State University for full accessibility by the Arabidopsis research community. Conclusions Most of the Arabidopsis LRR-RLK genes have been isolated and the sequence analysis showed a number of alternatively spliced variants. The generated resources, including cDNA entry clones, expression constructs and transgenic plants, will facilitate further functional analysis of the members of this important gene family.

  3. Aryl hydrocarbon receptor knockout rats are insensitive to the pathological effects of repeated oral exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin.

    Science.gov (United States)

    Harrill, Joshua A; Layko, Debra; Nyska, Abraham; Hukkanen, Renee R; Manno, Rosa Anna; Grassetti, Andrea; Lawson, Marie; Martin, Greg; Budinsky, Robert A; Rowlands, J Craig; Thomas, Russell S

    2016-06-01

    Sustained activation of the aryl hydrocarbon receptor (AHR) is believed to be the initial key event in AHR receptor-mediated tumorigenesis in the rat liver. The role of AHR in mediating pathological changes in the liver prior to tumor formation was investigated in a 4-week, repeated-dose study using adult female wild-type (WT) and AHR knockout (AHR-KO) rats treated with 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Beginning at 8 weeks of age, AHR-KO and WT rats were dosed by oral gavage with varying concentrations of TCDD (0, 3, 22, 100, 300 and 1000 ng kg(-1)  day(-1) ). Lung, liver and thymus histopathology, hematology, serum chemistry and the distribution of TCDD in liver and adipose tissue were examined. Treatment-related increases in the severity of liver and thymus pathology were observed in WT, but not AHR-KO rats. In the liver, these included hepatocellular hypertrophy, bile duct hyperplasia, multinucleated hepatocytes and inflammatory cell foci. A loss of cellularity in the thymic cortex and thymic atrophy was observed. Treatment-related changes in serum chemistry parameters were also observed in WT, but not AHR-KO rats. Finally, dose-dependent accumulation of TCDD was observed primarily in the liver of WT rats and primarily in the adipose tissue of AHR-KO rats. The results suggest that AHR activation is the initial key event underlying the progression of histological effects leading to liver tumorigenesis following TCDD treatment. Copyright © 2015 John Wiley & Sons, Ltd.

  4. The phenome analysis of mutant alleles in Leucine-Rich Repeat Receptor-Like Kinase genes in rice reveals new potential targets for stress tolerant cereals.

    Science.gov (United States)

    Dievart, Anne; Perin, Christophe; Hirsch, Judith; Bettembourg, Mathilde; Lanau, Nadège; Artus, Florence; Bureau, Charlotte; Noel, Nicolas; Droc, Gaétan; Peyramard, Matthieu; Pereira, Serge; Courtois, Brigitte; Morel, Jean-Benoit; Guiderdoni, Emmanuel

    2016-01-01

    Plants are constantly exposed to a variety of biotic and abiotic stresses that reduce their fitness and performance. At the molecular level, the perception of extracellular stimuli and the subsequent activation of defense responses require a complex interplay of signaling cascades, in which protein phosphorylation plays a central role. Several studies have shown that some members of the Leucine-Rich Repeat Receptor-Like Kinase (LRR-RLK) family are involved in stress and developmental pathways. We report here a systematic analysis of the role of the members of this gene family by mutant phenotyping in the monocotyledon model plant rice, Oryza sativa. We have then targeted 176 of the ∼320 LRR-RLK genes (55.7%) and genotyped 288 mutant lines. Position of the insertion was confirmed in 128 lines corresponding to 100 LRR-RLK genes (31.6% of the entire family). All mutant lines harboring homozygous insertions have been screened for phenotypes under normal conditions and under various abiotic stresses. Mutant plants have been observed at several stages of growth, from seedlings in Petri dishes to flowering and grain filling under greenhouse conditions. Our results show that 37 of the LRR-RLK rice genes are potential targets for improvement especially in the generation of abiotic stress tolerant cereals.

  5. Genetic analysis of the leucine-rich repeat and lg domain containing Nogo receptor-interacting protein 1 gene in essential tremor.

    Science.gov (United States)

    Liang, Hui; Song, Zhi; Deng, Xiong; Xu, Hongbo; Zhu, Anding; Zheng, Wen; Zhao, Yongxiang; Deng, Hao

    2013-10-01

    Variants in the leucine-rich repeat and lg domain containing nogo receptor-interacting protein 1 gene (LINGO1) have been identified to be associated with the increased risk of essential tremor (ET), especially among Caucasians. To explore whether the LINGO1 gene plays a role in ET susceptibility, we performed a systematic genetic analysis of the coding region in the LINGO1 gene. Four nucleotide variants have been genotyped, including three known variants (rs2271398, rs2271397, and rs3743481), and a novel G → C transition (ss491228439). Extended analysis showed no significant difference in genotypic and allelic distributions between 151 patients and 301 control subjects for these four variants (all P > 0.05). However, further sex-stratified analysis revealed that the C allele of rs2271397 and ss491228439 contributed the risk of ET in female (P = 0.017, OR = 2.139, 95 % CI 1.135 ~ 4.030 for rs2271397 and P = 0.038, OR = 1.812, 95 % CI 1.027 ~ 3.194 for ss491228439). Haplotype analysis indicated that A465-C474-C714 haplotype was significantly associated with increased risk of ET in female (P = 0.041, OR = 1.800, 95 % CI 1.020 ~ 3.178). Our results indicate that the LINGO1 variants are associated with ET in Chinese Han female patients.

  6. Toll-like receptor 2-mediated interleukin-8 expression in gingival epithelial cells by the Tannerella forsythia leucine-rich repeat protein BspA.

    Science.gov (United States)

    Onishi, Shinsuke; Honma, Kiyonobu; Liang, Shuang; Stathopoulou, Panagiota; Kinane, Denis; Hajishengallis, George; Sharma, Ashu

    2008-01-01

    Tannerella forsythia is a gram-negative anaerobe strongly associated with chronic human periodontitis. This bacterium expresses a cell surface-associated and secreted protein, designated BspA, which has been recognized as an important virulence factor. The BspA protein belongs to the leucine-rich repeat (LRR) and bacterial immunoglobulin-like protein families. BspA is, moreover, a multifunctional protein which interacts with a variety of host cells, including monocytes which appear to respond to BspA through Toll-like receptor (TLR) signaling. Since gingival epithelium forms a barrier against periodontal pathogens, this study was undertaken to determine if gingival epithelial cells respond to BspA challenge and if TLRs play any role in BspA recognition. This study was also directed towards identifying the BspA domains responsible for cellular activation. We provide direct evidence for BspA binding to TLR2 and demonstrate that the release of the chemokine interleukin-8 from human gingival epithelial cells by BspA is TLR2 dependent. Furthermore, the LRR domain of BspA is involved in activation of TLR2, while TLR1 serves as a signaling partner. Thus, our findings suggest that BspA is an important modulator of host innate immune responses through activation of TLR2 in cooperation with TLR1.

  7. Leucine-rich repeat-containing G-protein-coupled receptor 5-positive cells in the endometrial stem cell niche.

    Science.gov (United States)

    Cervelló, Irene; Gil-Sanchis, Claudia; Santamaría, Xavier; Faus, Amparo; Vallvé-Juanico, Julia; Díaz-Gimeno, Patricia; Genolet, Oriana; Pellicer, Antonio; Simón, Carlos

    2017-02-01

    To study, isolate and characterize leucine-rich repeat-containing heterotrimeric guanine nucleotide-binding protein-coupled receptor 5 (LGR5)-positive cells from human endometrium to determine their functional relevance. Prospective experimental animal study. University research laboratories. Nonobese diabetic mice (NOD-SCID) (strain code 394; NOD.CB17-Prkdc(scid)/NcrCrl). Human LGR5(+) cells were labeled with superparamagnetic iron oxide nanoparticles (SPIOs) and injected under the kidney capsule in immunocompromised mice. Epithelial and stromal LGR5(+) cells were isolated from human endometrium by means of fluorescence-activated cell sorting, and phenotypic characterization was performed by means of flow cytometry with the use of hematopoietic and mesenchymal markers. Engrafted SPIO-labeled LGR5(+) cells were localized with the use of Prussian blue staining and immunohistochemistry against CD9 and Vimentin. Deep transcriptomic profiling of LGR5(+) cells was performed with the use of microarrays and RNA sequencing. The percentage of LGR5(+) cells in human endometrium represented 1.08 ± 0.73% and 0.82 ± 0.76% of total cells in the epithelial and stromal compartments, respectively. LGR5(+) cells were phenotypically characterized by abundant expression of CD45 hematopoietic marker and no expression of surface markers CD31, CD34, CD133, CD73, and CD90. Coexpression with the macrophage marker CD163 was detected. Xenotransplantation of labeled LGR5(+) cells into the kidney capsules of immunocompromised mice resulted in a weak endometrial reconstitution from this cell of origin. Transcriptomic profiling revealed new attributes for LGR5(+) cells related to their putative hematopoietic origin. These data suggest that endometrial LGR5 is not an endogenous stem cell marker. Instead, LGR5(+) cells appear to be recruited from blood to be part of the stem cell niche at the perivascular microenvironment to activate the endogenous niche. Copyright © 2016 American Society for

  8. The Effects of Repeated Low-Level Sarin Exposure on Muscarinic M1 Receptor Binding, Amyloid Precursor Protein Levels and Neuropathology

    Science.gov (United States)

    2005-08-01

    Muscarinic; Nerve agents; Organophosphorus; Pirenzepine ; Receptor Binding; Sarin 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT...either Bmax (receptor density) or Kd (receptor affinity) following cortical M1 muscarinic receptor binding using [3H]- Pirenzepine , across all five...binding assays using [3H]- Pirenzepine (m1AChR ligand; Hammer et al., 1980), Western blotting using an antibody to APP in cortex, and neuropathological

  9. Identification and characterization of a tandem repeat in exon III of the dopamine receptor D4 (DRD4) gene in cetaceans

    DEFF Research Database (Denmark)

    Mogensen, Line; Kinze, Carl Christian; Werge, Thomas

    2006-01-01

    in exon III of their DRD4 gene. Consequently, the 18-bp tandem repeat appears to have originated prior to the differentiation of hoofed mammals into odd-toed and even-toed ungulates. The composition of the tandem repeat in cetaceans differed markedly from that in primates, which is composed of 48-bp...

  10. Variable number of tandem repeat polymorphisms of the interleukin-1 receptor antagonist gene IL-1RN: a novel association with the athlete status

    Directory of Open Access Journals (Sweden)

    Ryckman Kelli K

    2010-02-01

    Full Text Available Abstract Background The interleukin-1 (IL-1 family of cytokines is involved in the inflammatory and repair reactions of skeletal muscle during and after exercise. Specifically, plasma levels of the IL-1 receptor antagonist (IL-1ra increase dramatically after intense exercise, and accumulating evidence points to an effect of genetic polymorphisms on athletic phenotypes. Therefore, the IL-1 family cytokine genes are plausible candidate genes for athleticism. We explored whether IL-1 polymorphisms are associated with athlete status in European subjects. Methods Genomic DNA was obtained from 205 (53 professional and 152 competitive non-professional Italian athletes and 458 non-athlete controls. Two diallelic polymorphisms in the IL-1β gene (IL-1B at -511 and +3954 positions, and a variable number tandem repeats (VNTR in intron 2 of the IL-1ra gene (IL-1RN were assessed. Results We found a 2-fold higher frequency of the IL-1RN 1/2 genotype in athletes compared to non-athlete controls (OR = 1.93, 95% CI = 1.37-2.74, 41.0% vs. 26.4%, and a lower frequency of the 1/1 genotype (OR = 0.55, 95% CI = 0.40-0.77, 43.9% vs. 58.5%. Frequency of the IL-1RN 2/2 genotype did not differ between groups. No significant differences between athletes and controls were found for either -511 or +3954 IL-1B polymorphisms. However, the haplotype (-511C-(+3954T-(VNTR2 was 3-fold more frequent in athletes than in non-athletes (OR = 3.02, 95% CI = 1.16-7.87. Interestingly, the IL-1RN 1/2 genotype was more frequent in professional than in non-professional athletes (OR = 1.92, 95% CI = 1.02-3.61, 52.8% vs. 36.8%. Conclusions Our study found that variants at the IL-1ra gene associate with athletic status. This confirms the crucial role that cytokine IL-1ra plays in human physical exercise. The VNTR IL-1RN polymorphism may have implications for muscle health, performance, and/or recovery capacities. Further studies are needed to assess these specific issues. As VNTR IL-1RN

  11. The Arabidopsis leucine-rich repeat receptor-like kinases BAK1/SERK3 and BKK1/SERK4 are required for innate immunity to hemibiotrophic and biotrophic pathogens

    DEFF Research Database (Denmark)

    Roux, Milena Edna; Schwessinger, Benjamin; Albrecht, Catherine;

    2011-01-01

    Recognition of pathogen-associated molecular patterns (PAMPs) by surface-localized pattern recognition receptors (PRRs) constitutes an important layer of innate immunity in plants. The leucine-rich repeat (LRR) receptor kinases EF-TU RECEPTOR (EFR) and FLAGELLIN SENSING2 (FLS2) are the PRRs...... and BKK1 cooperate genetically to achieve full signaling capability in response to elf18 and flg22 and to the damage-associated molecular pattern AtPep1. Furthermore, we demonstrated that BAK1 and BKK1 contribute to disease resistance against the hemibiotrophic bacterium Pseudomonas syringae...... and the obligate biotrophic oomycete Hyaloperonospora arabidopsidis. Our work reveals that the establishment of PAMP-triggered immunity (PTI) relies on the rapid ligand-induced recruitment of multiple SERKs within PRR complexes and provides insight into the early PTI signaling events underlying this important...

  12. Organization of a resistance gene cluster linked to rhizomania resistance in sugar beet

    Science.gov (United States)

    Genetic resistance to rhizomania has been in use for over 40 years. Characterization of the molecular basis for susceptibility and resistance has proved challenging. Nucleotide-binding leucine-rich-repeat-containing (NB-LRR) genes have been implicated in numerous gene-for-gene resistance interaction...

  13. Gentamicin binds to the megalin receptor as a competitive inhibitor using the common ligand binding motif of complement type repeats: insight from the nmr structure of the 10th complement type repeat domain alone and in complex with gentamicin

    NARCIS (Netherlands)

    Dagil, R.; O'Shea, C.; Nykjaer, A.; Bonvin, A.M.J.J.; Kragelund, B.B.

    2013-01-01

    Gentamicin is an aminoglycoside widely used in treatments of, in particular, enterococcal, mycobacterial, and severe Gram-negative bacterial infections. Large doses of gentamicin cause nephrotoxicity and ototoxicity, entering the cell via the receptor megalin. Until now, no structural information ha

  14. Identification and characterization of a tandem repeat in exon III of the dopamine receptor D4 (DRD4) gene in cetaceans

    DEFF Research Database (Denmark)

    Mogensen, Line; Kinze, Carl Christian; Werge, Thomas

    2006-01-01

    , and these sequences differed by a maximum of two changes when compared to the remaining species. There was a high degree of similarity between the cetacean basic unit consensus sequences and those from members of the horse family and domestic cow, which also harbor a tandem repeat composed of 18-bp basic units...... in exon III of their DRD4 gene. Consequently, the 18-bp tandem repeat appears to have originated prior to the differentiation of hoofed mammals into odd-toed and even-toed ungulates. The composition of the tandem repeat in cetaceans differed markedly from that in primates, which is composed of 48-bp...

  15. Deployment Repeatability

    Science.gov (United States)

    2016-04-01

    controlled to great precision, but in a Cubesat , there may be no attitude determination at all. Such a Cubesat might treat sun angle and tumbling rates as...could be sensitive to small differences in motor controller timing. In these cases, the analyst might choose to model the entire deployment path, with...knowledge of the material damage model or motor controller timing precision. On the other hand, if many repeated and environmentally representative

  16. Identification and characterization of tandem repeats in exon III of dopamine receptor D4 (DRD4) genes from different mammalian species

    DEFF Research Database (Denmark)

    Larsen, Svend Arild; Mogensen, Line; Dietz, Rune;

    2005-01-01

    composed of 15- and 12- bp modules. Tandem repeats composed of 18-bp modules were found in sequences from the horse, zebra, onager, and donkey, Asiatic bear, polar bear, common raccoon, dolphin, harbor porpoise, and domestic cat. Several of these sequences have been analyzed previously without a tandem...

  17. Novel Approach to Repeated Arterial Blood Sampling in Small Animal PET : Application in a Test-Retest Study with the Adenosine A1 Receptor Ligand [C-11]MPDX

    NARCIS (Netherlands)

    Sijbesma, Jürgen W A; Zhou, Xiaoyun; Vállez García, David; Houwertjes, Martin C; Doorduin, Janine; Kwizera, Chantal; Maas, Bram; Meerlo, Peter; Dierckx, Rudi A; Slart, Riemer H J A; Elsinga, Philip H; van Waarde, Aren

    2016-01-01

    Small animal positron emission tomography (PET) can be used to detect small changes in neuroreceptor availability. This often requires rapid arterial blood sampling. However, current catheterization procedures do not allow repeated blood sampling. We have developed a procedure which allows arterial

  18. Cytogenetic and molecular analysis of the Y chromosome: absence of a significant relationship between CAG repeat length in exon 1 of the androgen receptor gene and infertility in Indian men.

    Science.gov (United States)

    Dhillon, Varinderpal S; Husain, Syed A

    2003-10-01

    The genetic basis of male infertility remains unclear in the majority of cases. Recent studies have indicated an association between microdeletions of the azoospermia factor a (AZFa)-AZFc regions of Yq and severe oligospermia or azoospermia. Increased (CAG)n repeat lengths in the androgen receptor (AR) gene have also been reported in infertile men. Therefore, in order to assess the prevalence of these genetic defects to male infertility, 183 men with non-obstructive azoospermia (n = 70), obstructive azoospermia (n = 33), severe oligospermia (n = 80) and 59 fertile men were examined cytogenetically and at molecular level for Yq deletions, microdeletions, and AR-CAG repeat lengths along with hormonal profiles [luteinizing hormone (LH), follicle-stimulating hormone (FSH) and testosterone (T)]. We used high resolution cytogenetics to detect chromosome deletions and multiplex polymerase chain reaction (PCR) involving 27 sequence-tagged site (STS) markers on Yq to determine the rate and extent of Yq microdeletions. PCR amplification with primers flanking exon 1 of AR gene was used to determine the AR-(CAG)n repeat lengths. Hormonal profiles (LH, FSH and T levels) were also analysed in infertile and fertile men. Testicular biopsies showed Sertoli cell only (SCO) morphology, maturation arrests (MA) and hypospermatogenesis. No chromosome aberrations were found in infertile men but there was a significant increase (p CAG repeats in AR gene was observed between infertile and fertile men (22.2 +/- 1.5 and 21.5 +/- 1.4 respectively). No significant increase or decrease in levels of LH, FSH and T was observed in infertile and fertile men. In some infertile men, significantly elevated levels of FSH alone or in combination with LH were found to be indicative of failure of spermatogenesis and/or suggestive of testicular failure. Y-chromosome microdeletions contribute to infertility in some patients but no relationship could be established with the (CAG)n repeat lengths in exon 1 of

  19. The past, present and future of breeding rust resistant wheat

    Directory of Open Access Journals (Sweden)

    Jeffrey G Ellis

    2014-11-01

    Full Text Available Two classes of genes are used for breeding rust resistant wheat. The first class, called R (for resistance genes, are pathogen race-specific in their action, effective at all plant growth stages and probably mostly encode immune receptors of the nucleotide binding leucine rich repeat (NB-LRR class. The second class called Adult Plant Resistance genes (APR because resistance is usually functional only in adult plants, and, in contrast to most R genes, the levels of resistance conferred by single APR genes are only partial and allow considerable disease development. Some but not all APR genes provide resistance to all isolates of a rust pathogen species and a subclass of these provides resistance to several fungal pathogen species. Initial indications are that APR genes encode a more heterogeneous range of proteins than R proteins. Two APR genes, Lr34 and Yr36, have been cloned from wheat and their products are an ABC transporter and a protein kinase, respectively. Lr34 and Sr2 have provided long lasting and widely used (durable partial resistance and are mainly used in conjunction with other R and APR genes to obtain adequate rust resistance. We caution that some APR genes indeed include race-specific, weak R genes which may be of the NB-LRR class. A research priority to better inform rust resistance breeding is to characterize further APR genes in wheat and to understand how they function and how they interact when multiple APR and R genes are stacked in a single genotype by conventional and GM breeding. An important message is do not be complacent about the general durability of all APR genes.

  20. Co-evolution between Globodera rostochiensis and potato driving sequence diversity of NB-LRR resistance loci and nematode suppressors of plant immunity

    NARCIS (Netherlands)

    Finkers-Tomczak, A.M.

    2011-01-01

    Sedentary plant parasitic nematodes have evolved sophisticated strategies that allow them to transform host cells in the roots of host plants into feeding structures. These complex structures enable the nematodes to complete their life cycle inside a single host plant. Feeding structure initiation a

  1. Flor Revisited (Again):eQTL and Mutational Analysis of NB-LRR Mediated Immunity to Powdery Mildew in Barley

    Institute of Scientific and Technical Information of China (English)

    Roger Wise; Priyanka Surana; Greg Fuerst; Ruo Xu; Divya Mistry; Julie Dickerson; Dan Nettleton

    2014-01-01

    Genes encoding early signaling events in pathogen defense often are identiifed only by their phenotype. Such genes involved in barley-powdery mildew interactions includeMla, specifying race-speciifc resistance;Rar1(Required for Mla12-speciifed resistance1), andRom1 (Restoration of Mla-speciifed resistance1). The HSP90-SGT1-RAR1 complex appears to function as chaperone in MLA-speciifed resistance, however, much remains to be discovered regarding the precise signaling underlying plant immunity. Genetic analyses of fast-neutron mutants derived from CI 16151 (Mla6) uncovered a novel locus, designated Rar3(Required for Mla6-specified resistance3).Rar3 segregates independent ofMla6 andRar1, andrar3 mutants are susceptible toBlumeria graminis f. sp.hordei (Bgh) isolate 5874 (AVRa6), whereas, wild-type progenitor plants are resistant. Comparative expression analyses of therar3 mutantvs. its wild-type progenitor were conductedvia Barley1 GeneChip and GAIIx paired-end RNA-Seq. Whereas Rar1affects transcription of relatively few genes; Rar3appearstoinlfuence thousands, notably in genes controlling ATP binding, catalytic activity, transcription, and phosphorylation; possibly membrane bound or in the nucleus. eQTL analysis of a segregating doubled haploid population identiifed over two-thousand genes as being regulated byMla(q value/FDR=0.00001), a subset of which are signiifcant inRar3 interactions. The intersection of datasets derived frommla-loss-of-function mutants,Mla-associated eQTL, andrar3-mediated transcriptome reprogramming are narrowing the focus on essential genes required forMla-speciifed immunity.

  2. Co-evolution between Globodera rostochiensis and potato driving sequence diversity of NB-LRR resistance loci and nematode suppressors of plant immunity

    NARCIS (Netherlands)

    Finkers-Tomczak, A.M.

    2011-01-01

    Sedentary plant parasitic nematodes have evolved sophisticated strategies that allow them to transform host cells in the roots of host plants into feeding structures. These complex structures enable the nematodes to complete their life cycle inside a single host plant. Feeding structure initiation a

  3. Repeated morphine treatment-mediated hyperalgesia, allodynia and spinal glial activation are blocked by co-administration of a selective cannabinoid receptor type-2 agonist

    OpenAIRE

    Tumati, Suneeta; Largent-Milnes, Tally M.; Keresztes, Attila; Ren, Jiyang; Roeske, William R.; Vanderah, Todd W; Varga, Eva V.

    2012-01-01

    Spinal glial activation has been implicated in sustained morphine-mediated paradoxical pain sensitization. Since activation of glial CB2 cannabinoid receptors attenuates spinal glial activation in neuropathies, we hypothesized that CB2 agonists may also attenuate sustained morphine–mediated spinal glial activation and pain sensitization. Our data indicate that co-administration of a CB2-selective agonist (AM 1241) attenuates morphine (intraperitoneal; twice daily; 6 days)-mediated thermal hyp...

  4. A novel approach for multi-domain and multi-gene family identification provides insights into evolutionary dynamics of disease resistance genes in core eudicot plants.

    Science.gov (United States)

    Hofberger, Johannes A; Zhou, Beifei; Tang, Haibao; Jones, Jonathan D G; Schranz, M Eric

    2014-11-08

    Recent advances in DNA sequencing techniques resulted in more than forty sequenced plant genomes representing a diverse set of taxa of agricultural, energy, medicinal and ecological importance. However, gene family curation is often only inferred from DNA sequence homology and lacks insights into evolutionary processes contributing to gene family dynamics. In a comparative genomics framework, we integrated multiple lines of evidence provided by gene synteny, sequence homology and protein-based Hidden Markov Modelling to extract homologous super-clusters composed of multi-domain resistance (R)-proteins of the NB-LRR type (for NUCLEOTIDE BINDING/LEUCINE-RICH REPEATS), that are involved in plant innate immunity. To assess the diversity of R-proteins within and between species, we screened twelve eudicot plant genomes including six major crops and found a total of 2,363 NB-LRR genes. Our curated R-proteins set shows a 50% average for tandem duplicates and a 22% fraction of gene copies retained from ancient polyploidy events (ohnologs). We provide evidence for strong positive selection and show significant differences in molecular evolution rates (Ka/Ks-ratio) among tandem- (mean = 1.59), ohnolog (mean = 1.36) and singleton (mean = 1.22) R-gene duplicates. To foster the process of gene-edited plant breeding, we report species-specific presence/absence of all 140 NB-LRR genes present in the model plant Arabidopsis and describe four distinct clusters of NB-LRR "gatekeeper" loci sharing syntenic orthologs across all analyzed genomes. By curating a near-complete set of multi-domain R-protein clusters in an eudicot-wide scale, our analysis offers significant insight into evolutionary dynamics underlying diversification of the plant innate immune system. Furthermore, our methods provide a blueprint for future efforts to identify and more rapidly clone functional NB-LRR genes from any plant species.

  5. The human [gamma]-aminobutyric acid receptor subunit [beta]3 and [alpha]5 gene cluster in chromosome 15q11-q13 is rich in highly polymorphic (CA)[sub n] repeats

    Energy Technology Data Exchange (ETDEWEB)

    Glatt, K.; Lalande, M. (Howard Hughes Medical Institute, Boston, MA (United States)); Sinnett, D. (Harvard Medical School, Boston, MA (United States))

    1994-01-01

    The [gamma]-aminobutyric acid (GABA[sub A]) receptor [beta]33 (GABRB3) and [alpha]5 (GABRA5) subunit genes have been localized to the Angelman and Prader-Willi syndrome region of chromosome 15q11-q13. GABRB3, which encompasses 250 kb, is located 100 kb proximal of GABRA5, with the two genes arranged in head-to-head transcriptional orientation. In screening 135 kb of cloned DNA within a 260-kb interval extending from within GABRB3 to the 5[prime] end of GABRA5, 10 new (CA), repeats have been identified. Five of these have been analyzed in detail and found to be highly polymorphic, with the polymorphism information content (PIC) ranging from 0.7 to 0.85 and with heterozygosities of 67 to 94%. In the clones from GABRB3/GABRA5 region, therefore, the frequency of (CA)[sub n] with PICs [ge] 0.7 is 1 per 27 kb. Previous estimates of the density of (CA)[sub n] with PICs [ge] 0.7 in the human genome have been approximately 10-fold lower. The GABRB3/GABRA5 region appears, therefore, to be enriched for highly informative (CA)[sub n]. This set of closely spaced, short tandem repeat polymorphisms will be useful in the molecular analyses of Prader-Willi and Angelman syndromes and in high-resolution studies of genetic recombination within this region. 21 refs., 2 figs., 1 tab.

  6. receptores

    Directory of Open Access Journals (Sweden)

    Salete Regina Daronco Benetti

    2006-01-01

    Full Text Available Se trata de un estudio etnográfico, que tuvo lo objetivo de interpretar el sistema de conocimiento y del significado atribuidos a la sangre referente a la transfusión sanguínea por los donadores y receptores de un banco de sangre. Para la colecta de las informaciones se observaron los participantes y la entrevista etnográfica se realizó el análisis de dominio, taxonómicos y temáticos. Los dominios culturales fueron: la sangre es vida: fuente de vida y alimento valioso; creencias religiosas: fuentes simbólicas de apoyos; donación sanguínea: un gesto colaborador que exige cuidarse, gratifica y trae felicidad; donación sanguínea: fuente simbólica de inseguridad; estar enfermo es una condición para realizar transfusión sanguínea; transfusión sanguínea: esperanza de vida; Creencias populares: transfusión sanguínea como riesgo para la salud; donadores de sangre: personas benditas; donar y recibir sangre: como significado de felicidad. Temática: “líquido precioso que origina, sostiene, modifica la vida, provoca miedo e inseguridad”.

  7. Dopamine Receptor Gene DRD4 7-Repeat Allele X Maternal Sensitivity Interaction on Child Externalizing Behavior Problems: Independent Replication of Effects at 18 Months.

    Science.gov (United States)

    King, Anthony P; Muzik, Maria; Hamilton, Lindsay; Taylor, Alexander B; Rosenblum, Katherine L; Liberzon, Israel

    2016-01-01

    The DRD4 VNTR has been associated with child behavior problems in interaction with maternal insensitivity in European and American cohorts of preschoolers, with the 7-repeat (7R) allele associated with greater problems. We sought to replicate and expand these findings by examining effects on reports of child behavior problems at 18 months. A 63 family sample with data for observed maternal sensitivity ratings, DRD4 VNTR genotype, and maternal report of child behavior problems at 18-months was used in this preliminary analysis. Maternal sensitivity was measured at 6-months of age using laboratory observational measures (free-play and a teaching task). Maternal report of toddler behavior was obtained at 18-months via the standard Child Behavior Checklist, and infant genotype on the DRD4 VNTR was obtained using PCR. Infants carrying the DRD4 7R allele showed greater effects of maternal insensitivity than non-carriers for behavioral problems at 18-months. We replicated previous findings of association of infant DRD4 x maternal sensitivity interactions with child Externalizing problems in the European-ancestry sample (N = 42) in a median split of maternal sensitivity (p = .00011, eta2 = .329) and in regression analyses controlling for maternal age, maternal depression, and child gender in European ancestry (B = -3.4, SE 1.33, p = .01) and the total sample (B = -2.2, SE 1.02, p = .02). Exploratory analyses also found evidence of DRD4 x maternal sensitivity interaction with the CBCL ADHD scale. These findings replicate in an independent cohort DRD4 x maternal insensitivity interaction effect on child externalizing behavior problems at 18 months, further supporting the role of the DRD4 genotype in differential sensitivity to parenting.

  8. XYLEM INTERMIXED WITH PHLOEM1, a leucine-rich repeat receptor-like kinase required for stem growth and vascular development in Arabidopsis thaliana.

    Science.gov (United States)

    Bryan, Anthony C; Obaidi, Adam; Wierzba, Michael; Tax, Frans E

    2012-01-01

    The regulation of cell specification in plants is particularly important in vascular development. The vascular system is comprised two differentiated tissue types, the xylem and phloem, which form conductive elements for the transport of water, nutrients and signaling molecules. A meristematic layer, the procambium, is located between these two differentiated cell types and divides to initiate vascular growth. We report the identification of a receptor-like kinase (RLK) that is expressed in the vasculature. Histochemical analyses of mutants in this kinase display an aberrant accumulation of highly lignified cells, typical of xylem or fiber cells, within the phloem. In addition, phloem cells are sometimes located adjacent to xylem cells in these mutants. We, therefore, named this RLK XYLEM INTERMIXED WITH PHLOEM 1 (XIP1). Analyses of longitudinal profiles of xip1 mutant stems show malformed cell files, indicating defects in oriented cell divisions or cell morphology. We propose that XIP1 prevents ectopic lignification in phloem cells and is necessary to maintain the organization of cell files or cell morphology in conductive elements.

  9. Repeat-until-success quantum repeaters

    Science.gov (United States)

    Bruschi, David Edward; Barlow, Thomas M.; Razavi, Mohsen; Beige, Almut

    2014-09-01

    We propose a repeat-until-success protocol to improve the performance of probabilistic quantum repeaters. Conventionally, these rely on passive static linear-optics elements and photodetectors to perform Bell-state measurements (BSMs) with a maximum success rate of 50%. This is a strong impediment for entanglement swapping between distant quantum memories. Every time a BSM fails, entanglement needs to be redistributed between the corresponding memories in the repeater link. The key ingredients of our scheme are repeatable BSMs. Under ideal conditions, these turn probabilistic quantum repeaters into deterministic ones. Under realistic conditions, our protocol too might fail. However, using additional threshold detectors now allows us to improve the entanglement generation rate by almost orders of magnitude, at a nominal distance of 1000 km, compared to schemes that rely on conventional BSMs. This improvement is sufficient to make the performance of our scheme comparable to the expected performance of some deterministic quantum repeaters.

  10. PnLRR-RLK27, a novel leucine-rich repeats receptor-like protein kinase from the Antarctic moss Pohlia nutans, positively regulates salinity and oxidation-stress tolerance

    Science.gov (United States)

    Wang, Jing; Liu, Shenghao; Li, Chengcheng; Wang, Tailin; Chen, Kaoshan

    2017-01-01

    Leucine-rich repeats receptor-like kinases (LRR-RLKs) play important roles in plant growth and development as well as stress responses. Here, 56 LRR-RLK genes were identified in the Antarctic moss Pohlia nutans transcriptome, which were further classified into 11 subgroups based on their extracellular domain. Of them, PnLRR-RLK27 belongs to the LRR II subgroup and its expression was significantly induced by abiotic stresses. Subcellular localization analysis showed that PnLRR-RLK27 was a plasma membrane protein. The overexpression of PnLRR-RLK27 in Physcomitrella significantly enhanced the salinity and ABA tolerance in their gametophyte growth. Similarly, PnLRR-RLK27 heterologous expression in Arabidopsis increased the salinity and ABA tolerance in their seed germination and early root growth as well as the tolerance to oxidative stress. PnLRR-RLK27 overproduction in these transgenic plants increased the expression of salt stress/ABA-related genes. Furthermore, PnLRR-RLK27 increased the activities of reactive oxygen species (ROS) scavengers and reduced the levels of malondialdehyde (MDA) and ROS. Taken together, these results suggested that PnLRR-RLK27 as a signaling regulator confer abiotic stress response associated with the regulation of the stress- and ABA-mediated signaling network. PMID:28241081

  11. Species- and dose-specific pancreatic responses and progression in single- and repeat-dose studies with GI181771X: a novel cholecystokinin 1 receptor agonist in mice, rats, and monkeys.

    Science.gov (United States)

    Myer, James R; Romach, Elizabeth H; Elangbam, Chandikumar S

    2014-01-01

    Compound-induced pancreatic injury is a serious liability in preclinical toxicity studies. However, its relevance to humans should be cautiously evaluated because of interspecies variations. To highlight such variations, we evaluated the species- and dose-specific pancreatic responses and progression caused by GI181771X, a novel cholecystokinin 1 receptor agonist investigated by GlaxoSmithKline for the treatment of obesity. Acute (up to 2,000 mg/kg GI181771X, as single dose) and repeat-dose studies in mice and/or rats (0.25-250 mg/kg/day for 7 days to 26 weeks) showed wide-ranging morphological changes in the pancreas that were dose and duration dependent, including necrotizing pancreatitis, acinar cell hypertrophy/atrophy, zymogen degranulation, focal acinar cell hyperplasia, and interstitial inflammation. In contrast to rodents, pancreatic changes were not observed in cynomolgus monkeys given GI181771X (1-500 mg/kg/day with higher systemic exposure than rats) for up to 52 weeks. Similarly, no GI181771X treatment-associated abnormalities in pancreatic structure were noted in a 24-week clinical trial with obese patients (body mass index >30 or >27 kg/m(2)) as assessed by abdominal ultrasound or by magnetic resonance imaging. Mechanisms for interspecies variations in the pancreatic response to CCK among rodents, monkeys, and humans and their relevance to human risk are discussed.

  12. Rat dams exposed repeatedly to a daily brief separation from the pups exhibit increased maternal behavior, decreased anxiety and altered levels of receptors for estrogens (ERα, ERβ), oxytocin and serotonin (5-HT1A) in their brain.

    Science.gov (United States)

    Stamatakis, Antonios; Kalpachidou, Theodora; Raftogianni, Androniki; Zografou, Efstratia; Tzanou, Athanasia; Pondiki, Stavroula; Stylianopoulou, Fotini

    2015-02-01

    In the present study we investigated the neurobiological mechanisms underlying expression of maternal behavior. Increased maternal behavior was experimentally induced by a brief 15-min separation between the mother and the pups during postnatal days 1 to 22. On postnatal days (PND) 12 and 22, we determined in experimental and control dams levels of anxiety in the elevated plus maze (EPM) as well as the levels of receptors for estrogens (ERα, ERβ), oxytocin (OTR) and serotonin (5-HT1AR) in areas of the limbic system (prefrontal cortex-PFC, hippocampus, lateral septum-SL, medial preoptic area-MPOA, shell of nucleus accumbens-nAc-Sh, central-CeA and basolateral-BLA amygdala), involved in the regulation of maternal behavior. Experimental dams, which showed increased maternal behavior towards their offspring, displayed reduced anxiety in the EPM on both PND12 and PND22. These behavioral differences could be attributed to neurochemical alterations in their brain: On both PND12 and PND22, experimental mothers had higher levels of ERα and OTRs in the PFC, hippocampus, CeA, SL, MPOA and nAc-Sh. The experimental manipulation-induced increase in ERβ levels was less widespread, being localized in PFC, the hippocampal CA2 area, MPOA and nAc-Sh. In addition, 5-HT1ARs were reduced in the PFC, hippocampus, CeA, MPOA and nAc-Sh of the experimental mothers. Our results show that the experience of the daily repeated brief separation from the pups results in increased brain ERs and OTRs, as well as decreased 5-HT1ARs in the dam's brain; these neurochemical changes could underlie the observed increase in maternal behavior and the reduction of anxiety.

  13. Repeated intermittent alcohol exposure during the third trimester-equivalent increases expression of the GABA(A) receptor δ subunit in cerebellar granule neurons and delays motor development in rats.

    Science.gov (United States)

    Diaz, Marvin R; Vollmer, Cyndel C; Zamudio-Bulcock, Paula A; Vollmer, William; Blomquist, Samantha L; Morton, Russell A; Everett, Julie C; Zurek, Agnieszka A; Yu, Jieying; Orser, Beverley A; Valenzuela, C Fernando

    2014-04-01

    Exposure to ethanol (EtOH) during fetal development can lead to long-lasting alterations, including deficits in fine motor skills and motor learning. Studies suggest that these are, in part, a consequence of cerebellar damage. Cerebellar granule neurons (CGNs) are the gateway of information into the cerebellar cortex. Functionally, CGNs are heavily regulated by phasic and tonic GABAergic inhibition from Golgi cell interneurons; however, the effect of EtOH exposure on the development of GABAergic transmission in immature CGNs has not been investigated. To model EtOH exposure during the 3rd trimester-equivalent of human pregnancy, neonatal pups were exposed intermittently to high levels of vaporized EtOH from postnatal day (P) 2 to P12. This exposure gradually increased pup serum EtOH concentrations (SECs) to ∼60 mM (∼0.28 g/dl) during the 4 h of exposure. EtOH levels gradually decreased to baseline 8 h after the end of exposure. Surprisingly, basal tonic and phasic GABAergic currents in CGNs were not significantly affected by postnatal alcohol exposure (PAE). However, PAE increased δ subunit expression at P28 as detected by immunohistochemical and western blot analyses. Also, electrophysiological studies with an agonist that is highly selective for δ-containing GABA(A) receptors, 4,5,6,7-tetrahydroisoxazolo[4,5-c]pyridine-3-ol (THIP), showed an increase in THIP-induced tonic current. Behavioral studies of PAE rats did not reveal any deficits in motor coordination, except for a delay in the acquisition of the mid-air righting reflex that was apparent at P15 to P18. These findings demonstrate that repeated intermittent exposure to high levels of EtOH during the equivalent of the last trimester of human pregnancy has significant but relatively subtle effects on motor coordination and GABAergic transmission in CGNs in rats.

  14. Quantum repeated games revisited

    CERN Document Server

    Frackiewicz, Piotr

    2011-01-01

    We present a scheme for playing quantum repeated 2x2 games based on the Marinatto and Weber's approach to quantum games. As a potential application, we study twice repeated Prisoner's Dilemma game. We show that results not available in classical game can be obtained when the game is played in the quantum way. Before we present our idea, we comment on the previous scheme of playing quantum repeated games.

  15. Research Progress of Leucine-Rich Repeat Containing G Protein Coupled Receptor 5 Positive Cells in Gastrointestinal Mucosa%胃肠黏膜G蛋白偶联受体5阳性细胞研究进展

    Institute of Scientific and Technical Information of China (English)

    李毅; 孙涛

    2013-01-01

      干细胞和再生医学的研究已成为自然科学中最为引人注目的领,人类已在胚胎干细胞、部分成体干细胞如骨髓造血干细胞方面取得进展,但在其他成体干细胞研究,特别是胃肠黏膜干细胞研究领进展甚少.富含亮氨酸重复序列的 G 蛋白偶联受体5(LGR5)是 G 蛋白偶联受体超家族的成,在胃肠黏膜隐窝基底有少量表达,其阳性细胞可在体内分化为胃肠黏膜所有类型的细胞,被认为是可能的胃肠黏膜成体干细胞.LGR5阳性细胞的研究,对组织工程、消化道疾病发病机制研究、干细胞治疗、肿瘤治疗等方面有重要意义.%Stem cell researchs and regenerative medicine have become the most spectacular areas of natural sci⁃ences. Research progresses of human embryonic stem cells, as well as part of adult stem cells such as bone mar⁃row hematopoietic stem-cell has developed obviously. But little progress in the field of other adult stem cell, espe⁃cially the gastrointestinal mucosa stem cell has been made. Leucine-rich repeat sequences of G-protein coupled re⁃ceptor 5(LGR5) is a member of the G-protein coupled receptor superfamily. They are expressed by a small amount of cells in the crypt base of gastrointestinal mucosa. LGR5 positive cells are considered as possible gastro⁃intestinal mucosa stem cells, because they can differente into all cell types of the gastrointestinal mucosa. Re⁃searchs on LGR5 positive cells are important for researchs of tissue engineering, pathogenesis of gastrointestinal disease, stem cell therapy, cancer treatment.

  16. Reconfigurable multiport EPON repeater

    Science.gov (United States)

    Oishi, Masayuki; Inohara, Ryo; Agata, Akira; Horiuchi, Yukio

    2009-11-01

    An extended reach EPON repeater is one of the solutions to effectively expand FTTH service areas. In this paper, we propose a reconfigurable multi-port EPON repeater for effective accommodation of multiple ODNs with a single OLT line card. The proposed repeater, which has multi-ports in both OLT and ODN sides, consists of TRs, BTRs with the CDR function and a reconfigurable electrical matrix switch, can accommodate multiple ODNs to a single OLT line card by controlling the connection of the matrix switch. Although conventional EPON repeaters require full OLT line cards to accommodate subscribers from the initial installation stage, the proposed repeater can dramatically reduce the number of required line cards especially when the number of subscribers is less than a half of the maximum registerable users per OLT. Numerical calculation results show that the extended reach EPON system with the proposed EPON repeater can save 17.5% of the initial installation cost compared with a conventional repeater, and can be less expensive than conventional systems up to the maximum subscribers especially when the percentage of ODNs in lightly-populated areas is higher.

  17. Revisiting the TALE repeat.

    Science.gov (United States)

    Deng, Dong; Yan, Chuangye; Wu, Jianping; Pan, Xiaojing; Yan, Nieng

    2014-04-01

    Transcription activator-like (TAL) effectors specifically bind to double stranded (ds) DNA through a central domain of tandem repeats. Each TAL effector (TALE) repeat comprises 33-35 amino acids and recognizes one specific DNA base through a highly variable residue at a fixed position in the repeat. Structural studies have revealed the molecular basis of DNA recognition by TALE repeats. Examination of the overall structure reveals that the basic building block of TALE protein, namely a helical hairpin, is one-helix shifted from the previously defined TALE motif. Here we wish to suggest a structure-based re-demarcation of the TALE repeat which starts with the residues that bind to the DNA backbone phosphate and concludes with the base-recognition hyper-variable residue. This new numbering system is consistent with the α-solenoid superfamily to which TALE belongs, and reflects the structural integrity of TAL effectors. In addition, it confers integral number of TALE repeats that matches the number of bound DNA bases. We then present fifteen crystal structures of engineered dHax3 variants in complex with target DNA molecules, which elucidate the structural basis for the recognition of bases adenine (A) and guanine (G) by reported or uncharacterized TALE codes. Finally, we analyzed the sequence-structure correlation of the amino acid residues within a TALE repeat. The structural analyses reported here may advance the mechanistic understanding of TALE proteins and facilitate the design of TALEN with improved affinity and specificity.

  18. Artificial leucine rich repeats as new scaffolds for protein design.

    Science.gov (United States)

    Baabur-Cohen, Hemda; Dayalan, Subashini; Shumacher, Inbal; Cohen-Luria, Rivka; Ashkenasy, Gonen

    2011-04-15

    The leucine rich repeat (LRR) motif that participates in many biomolecular recognition events in cells was suggested as a general scaffold for producing artificial receptors. We describe here the design and first total chemical synthesis of small LRR proteins, and their structural analysis. When evaluating the tertiary structure as a function of different number of repeating units (1-3), we were able to find that the 3-repeats sequence, containing 90 amino acids, folds into the expected structure.

  19. Recursive quantum repeater networks

    CERN Document Server

    Van Meter, Rodney; Horsman, Clare

    2011-01-01

    Internet-scale quantum repeater networks will be heterogeneous in physical technology, repeater functionality, and management. The classical control necessary to use the network will therefore face similar issues as Internet data transmission. Many scalability and management problems that arose during the development of the Internet might have been solved in a more uniform fashion, improving flexibility and reducing redundant engineering effort. Quantum repeater network development is currently at the stage where we risk similar duplication when separate systems are combined. We propose a unifying framework that can be used with all existing repeater designs. We introduce the notion of a Quantum Recursive Network Architecture, developed from the emerging classical concept of 'recursive networks', extending recursive mechanisms from a focus on data forwarding to a more general distributed computing request framework. Recursion abstracts independent transit networks as single relay nodes, unifies software layer...

  20. Repeated administration of alpha7 nicotinic acetylcholine receptor (nAChR) agonists, but not positive allosteric modulators, increases alpha7 nAChR levels in the brain

    DEFF Research Database (Denmark)

    Christensen, Ditte Z; Mikkelsen, Jens D; Hansen, Henrik H;

    2010-01-01

    The alpha7 nicotinic acetylcholine receptor (nAChR) is an important target for treatment of cognitive deficits in schizophrenia and Alzheimer's disease. However, the receptor desensitizes rapidly in vitro, which has led to concern regarding its applicability as a clinically relevant drug target...

  1. Remarkable selective constraints on exonic dinucleotide repeats.

    Science.gov (United States)

    Haasl, Ryan J; Payseur, Bret A

    2014-09-01

    Long dinucleotide repeats found in exons present a substantial mutational hazard: mutations at these loci occur often and generate frameshifts. Here, we provide clear and compelling evidence that exonic dinucleotides experience strong selective constraint. In humans, only 18 exonic dinucleotides have repeat lengths greater than six, which contrasts sharply with the genome-wide distribution of dinucleotides. We genotyped each of these dinucleotides in 200 humans from eight 1000 Genomes Project populations and found a near-absence of polymorphism. More remarkably, divergence data demonstrate that repeat lengths have been conserved across the primate phylogeny in spite of what is likely considerable mutational pressure. Coalescent simulations show that even a very low mutation rate at these loci fails to explain the anomalous patterns of polymorphism and divergence. Our data support two related selective constraints on the evolution of exonic dinucleotides: a short-term intolerance for any change to repeat length and a long-term prevention of increases to repeat length. In general, our results implicate purifying selection as the force that eliminates new, deleterious mutants at exonic dinucleotides. We briefly discuss the evolution of the longest exonic dinucleotide in the human genome--a 10 x CA repeat in fibroblast growth factor receptor-like 1 (FGFRL1)--that should possess a considerably greater mutation rate than any other exonic dinucleotide and therefore generate a large number of deleterious variants. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

  2. The Pentapeptide Repeat Proteins

    Energy Technology Data Exchange (ETDEWEB)

    Vetting,M.; Hegde, S.; Fajardo, J.; Fiser, A.; Roderick, S.; Takiff, H.; Blanchard, J.

    2006-01-01

    The Pentapeptide Repeat Protein (PRP) family has over 500 members in the prokaryotic and eukaryotic kingdoms. These proteins are composed of, or contain domains composed of, tandemly repeated amino acid sequences with a consensus sequence of [S, T,A, V][D, N][L, F]-[S, T,R][G]. The biochemical function of the vast majority of PRP family members is unknown. The three-dimensional structure of the first member of the PRP family was determined for the fluoroquinolone resistance protein (MfpA) from Mycobacterium tuberculosis. The structure revealed that the pentapeptide repeats encode the folding of a novel right-handed quadrilateral {beta}-helix. MfpA binds to DNA gyrase and inhibits its activity. The rod-shaped, dimeric protein exhibits remarkable size, shape and electrostatic similarity to DNA.

  3. Repeating the Past

    Science.gov (United States)

    Moore, John W.

    1998-05-01

    As part of the celebration of the Journal 's 75th year, we are scanning each Journal issue from 25, 50, and 74 years ago. Many of the ideas and practices described are so similar to present-day "innovations" that George Santayana's adage (1) "Those who cannot remember the past are condemned to repeat it" comes to mind. But perhaps "condemned" is too strong - sometimes it may be valuable to repeat something that was done long ago. One example comes from the earliest days of the Division of Chemical Education and of the Journal.

  4. Monitoring of beta-receptor sensitivity in cardiac surgery

    DEFF Research Database (Denmark)

    Yndgaard, S; Lippert, F K; Bigler, Dennis Richard

    1999-01-01

    To determine the repeatability of the hemodynamic response to repeated isoproterenol challenge doses to validate the standardized isoproterenol sensitivity test as an index of cardiovascular beta-receptor function.......To determine the repeatability of the hemodynamic response to repeated isoproterenol challenge doses to validate the standardized isoproterenol sensitivity test as an index of cardiovascular beta-receptor function....

  5. All-optical repeater.

    Science.gov (United States)

    Silberberg, Y

    1986-06-01

    An all-optical device containing saturable gain, saturable loss, and unsaturable loss is shown to transform weak, distorted optical pulses into uniform standard-shape pulses. The proposed device performs thresholding, amplification, and pulse shaping as required from an optical repeater. It is shown that such a device could be realized by existing semiconductor technology.

  6. Bidirectional Manchester repeater

    Science.gov (United States)

    Ferguson, J.

    1980-01-01

    Bidirectional Manchester repeater is inserted at periodic intervals along single bidirectional twisted pair transmission line to detect, amplify, and transmit bidirectional Manchester 11 code signals. Requiring only 18 TTL 7400 series IC's, some line receivers and drivers, and handful of passive components, circuit is simple and relatively inexpensive to build.

  7. Small Molecule DFPM Derivative-Activated Plant Resistance Protein Signaling in Roots Is Unaffected by EDS1 Subcellular Targeting Signal and Chemical Genetic Isolation of victr R-Protein Mutants.

    Directory of Open Access Journals (Sweden)

    Hans-Henning Kunz

    Full Text Available The small molecule DFPM ([5-(3,4-dichlorophenylfuran-2-yl]-piperidine-1-ylmethanethione was recently shown to trigger signal transduction via early effector-triggered immunity signaling genes including EDS1 and PAD4 in Arabidopsis thaliana accession Col-0. Chemical genetic analyses of A. thaliana natural variants identified the plant Resistance protein-like Toll/Interleukin1 Receptor (TIR-Nucleotide Binding (NB-Leucine-Rich Repeat (LRR protein VICTR as required for DFPM-mediated root growth arrest. Here a chemical genetic screen for mutants which disrupt DFPM-mediated root growth arrest in the Col-0 accession identified new mutant alleles of the TIR-NB-LRR gene VICTR. One allele, victr-6, carries a Gly216-to-Asp mutation in the Walker A domain supporting an important function of the VICTR nucleotide binding domain in DFPM responses consistent with VICTR acting as a canonical Resistance protein. The essential nucleo-cytoplasmic regulator of TIR-NB-LRR-mediated effector-triggered immunity, EDS1, was reported to have both nuclear and cytoplasmic actions in pathogen resistance. DFPM was used to investigate the requirements for subcellular EDS1 localization in DFPM-mediated root growth arrest. EDS1-YFP fusions engineered to localize mainly in the cytoplasm or the nucleus by tagging with a nuclear export signal (NES or a nuclear localization signal (NLS, respectively, were tested. We found that wild-type EDS1-YFP and both the NES and NLS-tagged EDS1 variants were induced by DFPM treatments and fully complemented eds1 mutant plants in root responses to DFPM, suggesting that enrichment of EDS1 in either compartment could confer DFPM-mediated root growth arrest. We further found that a light and O2-dependent modification of DFPM is necessary to mediate DFPM signaling in roots. Chemical analyses including Liquid Chromatography-Mass Spectrometry and High-Resolution Atmospheric Pressure Chemical Ionization Mass Spectrometry identified a DFPM modification

  8. Small Molecule DFPM Derivative-Activated Plant Resistance Protein Signaling in Roots Is Unaffected by EDS1 Subcellular Targeting Signal and Chemical Genetic Isolation of victr R-Protein Mutants.

    Science.gov (United States)

    Kunz, Hans-Henning; Park, Jiyoung; Mevers, Emily; García, Ana V; Highhouse, Samantha; Gerwick, William H; Parker, Jane E; Schroeder, Julian I

    2016-01-01

    The small molecule DFPM ([5-(3,4-dichlorophenyl)furan-2-yl]-piperidine-1-ylmethanethione) was recently shown to trigger signal transduction via early effector-triggered immunity signaling genes including EDS1 and PAD4 in Arabidopsis thaliana accession Col-0. Chemical genetic analyses of A. thaliana natural variants identified the plant Resistance protein-like Toll/Interleukin1 Receptor (TIR)-Nucleotide Binding (NB)-Leucine-Rich Repeat (LRR) protein VICTR as required for DFPM-mediated root growth arrest. Here a chemical genetic screen for mutants which disrupt DFPM-mediated root growth arrest in the Col-0 accession identified new mutant alleles of the TIR-NB-LRR gene VICTR. One allele, victr-6, carries a Gly216-to-Asp mutation in the Walker A domain supporting an important function of the VICTR nucleotide binding domain in DFPM responses consistent with VICTR acting as a canonical Resistance protein. The essential nucleo-cytoplasmic regulator of TIR-NB-LRR-mediated effector-triggered immunity, EDS1, was reported to have both nuclear and cytoplasmic actions in pathogen resistance. DFPM was used to investigate the requirements for subcellular EDS1 localization in DFPM-mediated root growth arrest. EDS1-YFP fusions engineered to localize mainly in the cytoplasm or the nucleus by tagging with a nuclear export signal (NES) or a nuclear localization signal (NLS), respectively, were tested. We found that wild-type EDS1-YFP and both the NES and NLS-tagged EDS1 variants were induced by DFPM treatments and fully complemented eds1 mutant plants in root responses to DFPM, suggesting that enrichment of EDS1 in either compartment could confer DFPM-mediated root growth arrest. We further found that a light and O2-dependent modification of DFPM is necessary to mediate DFPM signaling in roots. Chemical analyses including Liquid Chromatography-Mass Spectrometry and High-Resolution Atmospheric Pressure Chemical Ionization Mass Spectrometry identified a DFPM modification product that is

  9. Studies of an expanded trinucleotide repeat in transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Bingham, P.; Wang, S.; Merry, D. [Univ. of Pennsylvania, Philadelphia, PA (United States)

    1994-09-01

    Spinal and bulbar muscular atrophy (SBMA) is a progressive motor neuron disease caused by expansion of a trinucleotide repeat in the androgen receptor gene (AR{sup exp}). AR{sup exp} repeats expand further or contract in approximately 25% of transmissions. Analogous {open_quotes}dynamic mutations{close_quotes} have been reported in other expanded trinucleotide repeat disorders. We have been developing a mouse model of this disease using a transgenic approach. Expression of the SBMA AR was documented in transgenic mice with an inducible promoter. No phenotypic effects of transgene expression were observed. We have extended our previous results on stability of the expanded trinucleotide repeat in transgenic mice in two lines carrying AR{sup exp}. Tail DNA was amplified by PCR using primers spanning the repeat on 60 AR{sup exp} transgenic mice from four different transgenic lines. Migration of the PCR product through an acrylamide gel showed no change of the 45 CAG repeat length in any progeny. Similarly, PCR products from 23 normal repeat transgenics showed no change from the repeat length of the original construct. Unlike the disease allele in humans, the expanded repeat AR cDNA in transgenic mice showed no change in repeat length with transmission. The relative stability of CAG repeats seen in the transgenic mice may indicate either differences in the fidelity of replicative enzymes, or differences in error identification and repair between mice and humans. Integration site or structural properties of the transgene itself might also play a role.

  10. Long-term, repeated dose in vitro neurotoxicity of the glutamate receptor antagonist L-AP3, demonstrated in rat hippocampal slice cultures by using continuous propidium iodide incubation

    DEFF Research Database (Denmark)

    Kristensen, Bjarne W; Blaabjerg, Morten; Noraberg, Jens

    2007-01-01

    Most in vitro models are only used to assess short-term effects of test compounds. However, as demonstrated here, hippocampal slice cultures can be used for long-term studies. The test compound used was the metabotropic glutamate receptor antagonist, L(+)-2-amino-3-phosphonopropionic acid (L-AP3...

  11. Duct Leakage Repeatability Testing

    Energy Technology Data Exchange (ETDEWEB)

    Walker, Iain [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Sherman, Max [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2014-01-01

    Duct leakage often needs to be measured to demonstrate compliance with requirements or to determine energy or Indoor Air Quality (IAQ) impacts. Testing is often done using standards such as ASTM E1554 (ASTM 2013) or California Title 24 (California Energy Commission 2013 & 2013b), but there are several choices of methods available within the accepted standards. Determining which method to use or not use requires an evaluation of those methods in the context of the particular needs. Three factors that are important considerations are the cost of the measurement, the accuracy of the measurement and the repeatability of the measurement. The purpose of this report is to evaluate the repeatability of the three most significant measurement techniques using data from the literature and recently obtained field data. We will also briefly discuss the first two factors. The main question to be answered by this study is to determine if differences in the repeatability of these tests methods is sufficient to indicate that any of these methods is so poor that it should be excluded from consideration as an allowed procedure in codes and standards.

  12. Plant immunity: the EDS1 regulatory node.

    Science.gov (United States)

    Wiermer, Marcel; Feys, Bart J; Parker, Jane E

    2005-08-01

    ENHANCED DISEASE SUSCEPTIBILITY 1 (EDS1) and its interacting partner, PHYTOALEXIN DEFICIENT 4 (PAD4), constitute a regulatory hub that is essential for basal resistance to invasive biotrophic and hemi-biotrophic pathogens. EDS1 and PAD4 are also recruited by Toll-Interleukin-1 receptor (TIR)-type nucleotide binding-leucine rich repeat (NB-LRR) proteins to signal isolate-specific pathogen recognition. Recent work points to a fundamental role of EDS1 and PAD4 in transducing redox signals in response to certain biotic and abiotic stresses. These intracellular proteins are important activators of salicylic acid (SA) signaling and also mediate antagonism between the jasmonic acid (JA) and ethylene (ET) defense response pathways. EDS1 forms several molecularly and spatially distinct complexes with PAD4 and a newly discovered in vivo signaling partner, SENESCENCE ASSOCIATED GENE 101 (SAG101). Together, EDS1, PAD4 and SAG101 provide a major barrier to infection by both host-adapted and non-host pathogens.

  13. Expression of RPS4 in tobacco induces an AvrRps4-independent HR that requires EDS1, SGT1 and HSP90.

    Science.gov (United States)

    Zhang, Yan; Dorey, Stephan; Swiderski, Michal; Jones, Jonathan D G

    2004-10-01

    The Arabidopsis RPS4 gene belongs to the Toll/interleukin-1 receptor/nucleotide-binding site/leucine-rich repeat (TIR-NB-LRR) class of plant resistance (R) genes. It confers resistance to Pseudomonas syringae carrying the avirulence gene avrRps4. Transient expression of genomic RPS4 driven by the 35S promoter in tobacco leaves induces an AvrRps4-independent hypersensitive response (HR). The same phenotype is seen after expression of a full-length RPS4 cDNA. This indicates that alternative splicing of RPS4 is not involved in this HR. The extent of HR is correlated with RPS4 protein levels. Deletion analyses of RPS4 domains show the TIR domain is required for the HR phenotype. Mutations in the P-loop motif of the NB domain abolish the HR. Using virus-induced gene silencing, we found that the cell death resulting from RPS4 expression is dependent on the three plant signalling components EDS1, SGT1 and HSP90. All these data suggest that heterologous expression of an R gene can result in activation of cell death even in the absence of its cognate avirulence product, and provides a system for studying the RPS4 domains required for HR.

  14. IBR5 Modulates Temperature-Dependent, R Protein CHS3-Mediated Defense Responses in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Jingyan Liu

    2015-10-01

    Full Text Available Plant responses to low temperature are tightly associated with defense responses. We previously characterized the chilling-sensitive mutant chs3-1 resulting from the activation of the Toll and interleukin 1 receptor-nucleotide binding-leucine-rich repeat (TIR-NB-LRR-type resistance (R protein harboring a C-terminal LIM (Lin-11, Isl-1 and Mec-3 domains domain. Here we report the identification of a suppressor of chs3, ibr5-7 (indole-3-butyric acid response 5, which largely suppresses chilling-activated defense responses. IBR5 encodes a putative dual-specificity protein phosphatase. The accumulation of CHS3 protein at chilling temperatures is inhibited by the IBR5 mutation. Moreover, chs3-conferred defense phenotypes were synergistically suppressed by mutations in HSP90 and IBR5. Further analysis showed that IBR5, with holdase activity, physically associates with CHS3, HSP90 and SGT1b (Suppressor of the G2 allele of skp1 to form a complex that protects CHS3. In addition to the positive role of IBR5 in regulating CHS3, IBR5 is also involved in defense responses mediated by R genes, including SNC1 (Suppressor of npr1-1, Constitutive 1, RPS4 (Resistance to P. syringae 4 and RPM1 (Resistance to Pseudomonas syringae pv. maculicola 1. Thus, the results of the present study reveal a role for IBR5 in the regulation of multiple R protein-mediated defense responses.

  15. Repeatability of Cryogenic Multilayer Insulation

    Science.gov (United States)

    Johnson, W. L.; Vanderlaan, M.; Wood, J. J.; Rhys, N. O.; Guo, W.; Van Sciver, S.; Chato, D. J.

    2017-01-01

    Due to the variety of requirements across aerospace platforms, and one off projects, the repeatability of cryogenic multilayer insulation has never been fully established. The objective of this test program is to provide a more basic understanding of the thermal performance repeatability of MLI systems that are applicable to large scale tanks. There are several different types of repeatability that can be accounted for: these include repeatability between multiple identical blankets, repeatability of installation of the same blanket, and repeatability of a test apparatus. The focus of the work in this report is on the first two types of repeatability. Statistically, repeatability can mean many different things. In simplest form, it refers to the range of performance that a population exhibits and the average of the population. However, as more and more identical components are made (i.e. the population of concern grows), the simple range morphs into a standard deviation from an average performance. Initial repeatability testing on MLI blankets has been completed at Florida State University. Repeatability of five GRC provided coupons with 25 layers was shown to be +/- 8.4 whereas repeatability of repeatedly installing a single coupon was shown to be +/- 8.0. A second group of 10 coupons have been fabricated by Yetispace and tested by Florida State University, through the first 4 tests, the repeatability has been shown to be +/- 16. Based on detailed statistical analysis, the data has been shown to be statistically significant.

  16. Repeated administration of adenosine increases its cardiovascular effects in rats.

    Science.gov (United States)

    Vidrio, H; García-Márquez, F; Magos, G A

    1987-01-20

    Hypotensive and negative chronotropic responses to adenosine in anesthetized rats increased after previous administration of the nucleoside. Bradycardia after adenosine in the isolated perfused rat heart was also potentiated after repeated administration at short intervals. This self-potentiation could be due to extracellular accumulation of adenosine and persistent stimulation of receptors caused by saturation or inhibition of cellular uptake of adenosine.

  17. Expansion of protein domain repeats.

    Directory of Open Access Journals (Sweden)

    Asa K Björklund

    2006-08-01

    Full Text Available Many proteins, especially in eukaryotes, contain tandem repeats of several domains from the same family. These repeats have a variety of binding properties and are involved in protein-protein interactions as well as binding to other ligands such as DNA and RNA. The rapid expansion of protein domain repeats is assumed to have evolved through internal tandem duplications. However, the exact mechanisms behind these tandem duplications are not well-understood. Here, we have studied the evolution, function, protein structure, gene structure, and phylogenetic distribution of domain repeats. For this purpose we have assigned Pfam-A domain families to 24 proteomes with more sensitive domain assignments in the repeat regions. These assignments confirmed previous findings that eukaryotes, and in particular vertebrates, contain a much higher fraction of proteins with repeats compared with prokaryotes. The internal sequence similarity in each protein revealed that the domain repeats are often expanded through duplications of several domains at a time, while the duplication of one domain is less common. Many of the repeats appear to have been duplicated in the middle of the repeat region. This is in strong contrast to the evolution of other proteins that mainly works through additions of single domains at either terminus. Further, we found that some domain families show distinct duplication patterns, e.g., nebulin domains have mainly been expanded with a unit of seven domains at a time, while duplications of other domain families involve varying numbers of domains. Finally, no common mechanism for the expansion of all repeats could be detected. We found that the duplication patterns show no dependence on the size of the domains. Further, repeat expansion in some families can possibly be explained by shuffling of exons. However, exon shuffling could not have created all repeats.

  18. DWI Repeaters and Non-Repeaters: A Comparison.

    Science.gov (United States)

    Weeber, Stan

    1981-01-01

    Discussed how driving-while-intoxicated (DWI) repeaters differed signigicantly from nonrepeaters on 4 of 23 variables tested. Repeaters were more likely to have zero or two dependent children, attend church frequently, drink occasionally and have one or more arrests for public intoxication. (Author)

  19. To Repeat or Not to Repeat a Course

    Science.gov (United States)

    Armstrong, Michael J.; Biktimirov, Ernest N.

    2013-01-01

    The difficult transition from high school to university means that many students need to repeat (retake) 1 or more of their university courses. The authors examine the performance of students repeating first-year core courses in an undergraduate business program. They used data from university records for 116 students who took a total of 232…

  20. Nifty Nines and Repeating Decimals

    Science.gov (United States)

    Brown, Scott A.

    2016-01-01

    The traditional technique for converting repeating decimals to common fractions can be found in nearly every algebra textbook that has been published, as well as in many precalculus texts. However, students generally encounter repeating decimal numerals earlier than high school when they study rational numbers in prealgebra classes. Therefore, how…

  1. Nifty Nines and Repeating Decimals

    Science.gov (United States)

    Brown, Scott A.

    2016-01-01

    The traditional technique for converting repeating decimals to common fractions can be found in nearly every algebra textbook that has been published, as well as in many precalculus texts. However, students generally encounter repeating decimal numerals earlier than high school when they study rational numbers in prealgebra classes. Therefore, how…

  2. All-photonic quantum repeaters

    Science.gov (United States)

    Azuma, Koji; Tamaki, Kiyoshi; Lo, Hoi-Kwong

    2015-01-01

    Quantum communication holds promise for unconditionally secure transmission of secret messages and faithful transfer of unknown quantum states. Photons appear to be the medium of choice for quantum communication. Owing to photon losses, robust quantum communication over long lossy channels requires quantum repeaters. It is widely believed that a necessary and highly demanding requirement for quantum repeaters is the existence of matter quantum memories. Here we show that such a requirement is, in fact, unnecessary by introducing the concept of all-photonic quantum repeaters based on flying qubits. In particular, we present a protocol based on photonic cluster-state machine guns and a loss-tolerant measurement equipped with local high-speed active feedforwards. We show that, with such all-photonic quantum repeaters, the communication efficiency scales polynomially with the channel distance. Our result paves a new route towards quantum repeaters with efficient single-photon sources rather than matter quantum memories. PMID:25873153

  3. Length of CAG repeat in exon 1 of the androgen receptor gene is associated with the development of acne%雄激素受体基因第一外显子CAG重复序列长度多态性与痤疮的相关性

    Institute of Scientific and Technical Information of China (English)

    庞莹; 姜弈; 魏华臣; 陈洪铎; 何春涤; 刘勇; 朱红; 魏彬; 王凯波; 赵宁; 王雅坤; 肖汀

    2008-01-01

    目的 探讨人雄激素受体基因第一外显子CAG重复序列长度多态性与痤疮发生之间的关系.方法 研究对象为中国东北地区238例痤疮患者和207例健康对照,抽取外周血后分离纯化出基因组DNA,采用微卫星扫描(STRs)方法分析CAG重复序列的多态性.结果 男性病例组和对照组的CAG重复均数分别为22.70±3.09和23.48±2.83,两组之间差异有统计学意义(P=0.046);将对照组中CAG重复次数的中位数23作为分割点分组比较,长/短CAG片段在男性病例和对照中的分布差异有统计学意义,携带有CAG短片段的男性较携带CAG长片段的男性患痤疮的风险性明显增加(OR值2.07;95%可信限为1.21~3.54).女性病例组和对照组的CAG重复均数分别为23.41±2.87和23.85±0.21,两组之间差异无统计学意义(P=0.115);按中位数分组比较长/短CAG片段在女性病例和对照中的分布差异有统计学意义,携带有CAG短片段的女性患痤疮的风险性明显增加(P=0.013,OR值2.05;95%可信限为1.18~3.56).结论 雄激素受体基因第一外显子CAG的重复次数与中国东北地区痤疮的发生有关,CAG重复次数少的男性个体患痤疮的风险性增加,雄激素受体基因第一外显子CAG的重复次数可作为痤疮的遗传易感标志之一.%Objective To investigate the relationship of CAG repeat length polymorphism in the androgen receptor(AR)gene to the development of acne.Methods A total of 238 patients with ache vulgaris and 207 healthy human controls in Northeast China were included in this study.Genomic DNA was isolated and purified from the blood of these subjects.The CAG repeat lengths in the AR gene were analyzed by somatic microsatellites (STRs).Results A significant difference was found in the CAG repeat number between the male acne Patients(22.70±3.09)and male controls(23.48±2.83,P=0.046),but not between the female cases and controls(23.41±2.87 versus 23.85±0.21.P=0.12).In order to assess the

  4. Analysis of repeated measures data

    CERN Document Server

    Islam, M Ataharul

    2017-01-01

    This book presents a broad range of statistical techniques to address emerging needs in the field of repeated measures. It also provides a comprehensive overview of extensions of generalized linear models for the bivariate exponential family of distributions, which represent a new development in analysing repeated measures data. The demand for statistical models for correlated outcomes has grown rapidly recently, mainly due to presence of two types of underlying associations: associations between outcomes, and associations between explanatory variables and outcomes. The book systematically addresses key problems arising in the modelling of repeated measures data, bearing in mind those factors that play a major role in estimating the underlying relationships between covariates and outcome variables for correlated outcome data. In addition, it presents new approaches to addressing current challenges in the field of repeated measures and models based on conditional and joint probabilities. Markov models of first...

  5. Effects of Repeated Electroacupuncture on Gene Expression of Cannabinoid Receptor-1 and Dopamine 1 Receptor in Nucleus Accumbens-Caudate Nucleus Region in Inflammatory-pain Rats%反复电针对佐剂性关节炎大鼠伏隔核-尾状核区大麻素CB1受体与多巴胺Dl受体基因表达的影响

    Institute of Scientific and Technical Information of China (English)

    寿鉴; 赵颖倩; 徐鸣曙; 葛林宝

    2011-01-01

    Objective To observe the effect of repeated electroacupuncture (EA) on the expression of cannabinoid receptor-1 (CB 1 ) mRNA and dopamine 1 receptor (D 1 ) mRNA in Nucleus Accumbens (NAC)-Caudate Nucleus (CN) region in inflammatory-pain rats, so as to study its underlying mechanism in analgesia. Methods A total of 30 SD rats were randomized into normal control, model, EA, EA + AM 251 and WIN 552 12-2 groups, with 6 cases in each group. EA (2 Hz/100 Hz, 1 - 3 mA)was applied to "Zusanli"(ST 36) and "Kunlun"(BL 60) for 30 min, once every other day, and 4 sessions all together. Arthritis model was established by injection of Freund's complete adjuvant 0.05 mL in the rat's left ankle. Thermal pain threshold (paw withdrawal latency, PWL) was detected before and after modeling and after repeated EA and/or intraperitoneal injection of AM 251 (an inverse antagonist at the CB 1 cannabinoid receptor, 0. 1 mg/1 00 g) and WIN 55212-2 (a potent cannabinoid receptor agonist, 0.2 mg/100 g). The expression of CB 1 receptor mRNA and D 1 receptor mRNA in the NAC-CN region was measured by real time fluorescence quantitative-polymerase chain reaction. Results Compared with the control group, the pain threshold values of the model group was decreased significantly (P<0.01). In comparison with the model group, the pain threshold values of the EA group and WIN 55212-2 group were increased considerably on day 10 (P<0.01). No significant differences were found between the EA+AM 251 and model groups and between the EA and WIN 55212-2 groups in PWL after the treatment (P>0.05).Compared with the control group, both CB 1 R mRNA and D 1 R mRNA expression levels in the model group were increased slightly, while in comparison with the model group and EA+ AM 251 group, CB 1 R mRNA and D 1 R mRNA expression levels in the EAgroup and WIN 55212-2 group were upregulated obviously. No significant differences were found between the EA+ AM 251 and model groups and between the EA and WIN 55212

  6. Role of androgen receptor CAG repeat polymorphism in pathogenesis of coronary artery disease in elderly men%雄激素受体基因CAG重复数多态性与老年男性冠心病的关系及可能机制

    Institute of Scientific and Technical Information of China (English)

    张秀锦; 李小鹰; 曹甜甜; 叶玲

    2013-01-01

    Objective To investigate the relationship of androgen receptor (AR) CAG repeat polymorphism and coronary artery disease (CAD) in elderly men and its potential mechanism.Methods Totally 296 elderly men undergoing coronary angiography were enrolled in this study.Serum total testosterone (TT) and free testosterone (FT) levels were measured.Androgen receptors (ARs) in peripheral lymphocytes were determined by flow cytometry.Genome DNA was extracted from peripheral leucocytes using standard techniques.Gene fragments containing AR CAG repeats were amplified by PCR with specific fluorescent labeled primers.PCR products were separated with agarose gels.CAG repeat number of each sample was obtained by genotyping.Results AR CAG repeats varied from 11 to 28 (P25-P75:18-22; median:20) in elderly male patients.They were divided into the long AR group (CAG repeats≥22,n=82) and the short AR group (CAG repeats<22,n=214).Compared with the long AR group,serum FT level was much lower in the short AR group [(24.1±23.1) ×10-6mmol/L vs.(31.2±27.8)×10-6mmol/L,P<0.05].The prevalence of coronary artery disease was higher in the short AR group than in the long AR group [84.1% (180 cases) vs.69.5%(57 cases),P<0.05].The FT level was lower in the short AR group combined with CAD than in the control group [(22.4±20.5) ×10-6mmol/L vs.(33.6±32.4)×10 6mmol/L,P<0.01].There were no significant differences in serum TT and AR levels between the long and short AR groups.No significant correlations were found in the AR CAG repeats polymorphism with FT,TT or AR levels.Age was the main risk factor for FT and AR levels.Logistic regression analysis showed that FT level was negatively correlated with CAD (OR=0.98,95 % CI:0.973-0.998,P=0.01),and short AR increased the risk of CAD in elderly male patients (OR=3.44,95%CI:1.887-6.264,P<0.01).Conclusions Serum FT level is correlated with age and is significantly decreased in elderly male patients with short AR repeats,which may

  7. Limitations on quantum key repeaters.

    Science.gov (United States)

    Bäuml, Stefan; Christandl, Matthias; Horodecki, Karol; Winter, Andreas

    2015-04-23

    A major application of quantum communication is the distribution of entangled particles for use in quantum key distribution. Owing to noise in the communication line, quantum key distribution is, in practice, limited to a distance of a few hundred kilometres, and can only be extended to longer distances by use of a quantum repeater, a device that performs entanglement distillation and quantum teleportation. The existence of noisy entangled states that are undistillable but nevertheless useful for quantum key distribution raises the question of the feasibility of a quantum key repeater, which would work beyond the limits of entanglement distillation, hence possibly tolerating higher noise levels than existing protocols. Here we exhibit fundamental limits on such a device in the form of bounds on the rate at which it may extract secure key. As a consequence, we give examples of states suitable for quantum key distribution but unsuitable for the most general quantum key repeater protocol.

  8. Hysteresis of magnetostructural transitions: Repeatable and non-repeatable processes

    Energy Technology Data Exchange (ETDEWEB)

    Provenzano, Virgil [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States); Della Torre, Edward; Bennett, Lawrence H. [Department of Electrical and Computer Engineering, The George Washington University, Washington, DC 20052 (United States); ElBidweihy, Hatem, E-mail: Hatem@gwmail.gwu.edu [Department of Electrical and Computer Engineering, The George Washington University, Washington, DC 20052 (United States)

    2014-02-15

    The Gd{sub 5}Ge{sub 2}Si{sub 2} alloy and the off-stoichiometric Ni{sub 50}Mn{sub 35}In{sub 15} Heusler alloy belong to a special class of metallic materials that exhibit first-order magnetostructural transitions near room temperature. The magnetic properties of this class of materials have been extensively studied due to their interesting magnetic behavior and their potential for a number of technological applications such as refrigerants for near-room-temperature magnetic refrigeration. The thermally driven first-order transitions in these materials can be field-induced in the reverse order by applying a strong enough field. The field-induced transitions are typically accompanied by the presence of large magnetic hysteresis, the characteristics of which are a complicated function of temperature, field, and magneto-thermal history. In this study we show that the virgin curve, the major loop, and sequentially measured MH loops are the results of both repeatable and non-repeatable processes, in which the starting magnetostructural state, prior to the cycling of field, plays a major role. Using the Gd{sub 5}Ge{sub 2}Si{sub 2} and Ni{sub 50}Mn{sub 35}In{sub 15} alloys, as model materials, we show that a starting single phase state results in fully repeatable processes and large magnetic hysteresis, whereas a mixed phase starting state results in non-repeatable processes and smaller hysteresis.

  9. EAMJ Dec. Repeatability.indd

    African Journals Online (AJOL)

    2008-12-12

    Dec 12, 2008 ... Results:Kappa values for four-week repeatability for the wheeze and asthma questions were 0.61 ... for logistic, cultural and ethical reasons, to use ... individual with baseline forced expiratory volume in .... period is likely to also include the effects of true ... data, the writing of the manuscript or the decision.

  10. Association between CAG repeat polymorphisms and the risk of prostate cancer: a meta-analysis by race, study design and the number of (CAG)n repeat polymorphisms.

    Science.gov (United States)

    Sun, Jun-Hyun; Lee, Sang-Ah

    2013-11-01

    Although a number of studies have been conducted on the association between prostate cancer and CAG repeat polymorphisms of the androgen receptor gene, this association remains elusive and controversial. In this meta-analysis, we aimed to evaluate the effects of (CAG)n repeat genetic polymorphisms on the incidence of prostate cancer, particularly as regards race, study design and the number of (CAG)n repeats. To collect articles published on the association between CAG repeats and prostate cancer, publications were identified from the National Center for Biotechnology Information (NCBI) database of epidemiological studies published up to October 2011; our identification of publications was not limited by a language barrier. The following search keywords were used: prostate cancer risk, CAG repeat polymorphism, androgen receptor gene and human. Stata version 10 was used for the meta-analysis and the publication bias was measured through the Begg's test and Egger's test. This meta-analysis included 47 studies with 13,346 cases and 15,172 control or non-cases and consisted of 31 reports based on Caucasians, ten on Asians, one on Hispanics and four on combined ethnic groups. The carriers of a shorter CAG repeat sequence had an increased risk of prostate cancer (OR 1.21, 95% CI 1.10-1.34 for all subjects; OR 1.21, 95% CI 1.10-1.34 for prospective studies; OR 1.32, 95% CI 1.15-1.51 for retrospective studies) regardless of the exact length of the CAG repeat, compared with carriers of a longer repeat sequence. In terms of race, the risk of carrying a shorter CAG repeat sequence was 1.10- and 1.83-fold higher than that of a longer repeat sequence in Caucasians and Asians, respectively. For the specific number of CAG repeat polymorphisms, carriers of repeats were observed to have a higher risk of prostate cancer (OR 1.16, 95% CI 1.04-1.29) compared with carriers with ≥ 22 CAG repeat polymorphisms, particularly for Asians (OR 2.06, 95% CI 1.00-4.24). This meta

  11. Directionality switchable gain stabilized linear repeater

    Science.gov (United States)

    Ota, Takayuki; Ohmachi, Tadashi; Aida, Kazuo

    2004-10-01

    We propose a new approach to realize a bidirectional linear repeater suitable for future optical internet networks and fault location in repeater chain with OTDR. The proposed approach is the linear repeater of simple configuration whose directionality is rearranged dynamically by electrical control signal. The repeater is composed of a magneto-optical switch, a circulator, a dynamically gain stabilized unidirectional EDFA, and control circuits. The repeater directionality is rearranged as fast as 0.1ms by an electrical control pulse. It is experimentally confirmed that OTDR with the directionality switchable repeater is feasible for repeater chain. The detailed design and performance of the repeater are also discussed, including the multi-pass interference (MPI) which may arise in the proposed repeater, the effect of the MPI on SNR degradation of the repeater chain and the feed-forward EDFA gain control circuit.

  12. Measurement-based quantum repeaters

    CERN Document Server

    Zwerger, M; Briegel, H J

    2012-01-01

    We introduce measurement-based quantum repeaters, where small-scale measurement-based quantum processors are used to perform entanglement purification and entanglement swapping in a long-range quantum communication protocol. In the scheme, pre-prepared entangled states stored at intermediate repeater stations are coupled with incoming photons by simple Bell-measurements, without the need of performing additional quantum gates or measurements. We show how to construct the required resource states, and how to minimize their size. We analyze the performance of the scheme under noise and imperfections, with focus on small-scale implementations involving entangled states of few qubits. We find measurement-based purification protocols with significantly improved noise thresholds. Furthermore we show that already resource states of small size suffice to significantly increase the maximal communication distance. We also discuss possible advantages of our scheme for different set-ups.

  13. A Repeating Fast Radio Burst

    CERN Document Server

    Spitler, L G; Hessels, J W T; Bogdanov, S; Brazier, A; Camilo, F; Chatterjee, S; Cordes, J M; Crawford, F; Deneva, J; Ferdman, R D; Freire, P C C; Kaspi, V M; Lazarus, P; Lynch, R; Madsen, E C; McLaughlin, M A; Patel, C; Ransom, S M; Seymour, A; Stairs, I H; Stappers, B W; van Leeuwen, J; Zhu, W W

    2016-01-01

    Fast Radio Bursts are millisecond-duration astronomical radio pulses of unknown physical origin that appear to come from extragalactic distances. Previous follow-up observations have failed to find additional bursts at the same dispersion measures (i.e. integrated column density of free electrons between source and telescope) and sky position as the original detections. The apparent non-repeating nature of the fast radio bursts has led several authors to hypothesise that they originate in cataclysmic astrophysical events. Here we report the detection of ten additional bursts from the direction of FRB121102, using the 305-m Arecibo telescope. These new bursts have dispersion measures and sky positions consistent with the original burst. This unambiguously identifies FRB121102 as repeating and demonstrates that its source survives the energetic events that cause the bursts. Additionally, the bursts from FRB121102 show a wide range of spectral shapes that appear to be predominantly intrinsic to the source and wh...

  14. Repeatability of Harris Corner Detector

    Institute of Scientific and Technical Information of China (English)

    HU Lili

    2003-01-01

    Interest point detectors are commonly employed to reduce the amount of data to be processed. The ideal interest point detector would robustly select those features which are most appropriate or salient for the application and data at hand. This paper shows that interest points are geometrically stable under different transformations.This property makes interest points very successful in the context of image matching. To measure this property quantatively, we introduce a evaluation criterion: repeatability rate.

  15. Origin and fate of repeats in bacteria.

    Science.gov (United States)

    Achaz, G; Rocha, E P C; Netter, P; Coissac, E

    2002-07-01

    We investigated 53 complete bacterial chromosomes for intrachromosomal repeats. In previous studies on eukaryote chromosomes, we proposed a model for the dynamics of repeats based on the continuous genesis of tandem repeats, followed by an active process of high deletion rate, counteracted by rearrangement events that may prevent the repeats from being deleted. The present study of long repeats in the genomes of Bacteria and Archaea suggests that our model of interspersed repeats dynamics may apply to them. Thus the duplication process might be a consequence of very ancient mechanisms shared by all three domains. Moreover, we show that there is a strong negative correlation between nucleotide composition bias and the repeat density of genomes. We hypothesise that in highly biased genomes, non-duplicated small repeats arise more frequently by random effects and are used as primers for duplication mechanisms, leading to a higher density of large repeats.

  16. Improving repeatability by improving quality

    Energy Technology Data Exchange (ETDEWEB)

    Ronen, Shuki; Ackers, Mark; Schlumberger, Geco-Prakla; Brink, Mundy

    1998-12-31

    Time lapse (4-D) seismic is a promising tool for reservoir characterization and monitoring. The method is apparently simple: to acquire data repeatedly over the same reservoir, process and interpret the data sets, then changes between the data sets indicate changes in the reservoir. A problem with time lapse seismic data is that reservoirs are a relatively small part of the earth and important reservoir changes may cause very small differences to the time lapse data. The challenge is to acquire and process economical time lapse data such that reservoir changes can be detected above the noise of varying acquisition and environment. 7 refs., 9 figs.

  17. Coordinated hybrid automatic repeat request

    KAUST Repository

    Makki, Behrooz

    2014-11-01

    We develop a coordinated hybrid automatic repeat request (HARQ) approach. With the proposed scheme, if a user message is correctly decoded in the first HARQ rounds, its spectrum is allocated to other users, to improve the network outage probability and the users\\' fairness. The results, which are obtained for single- and multiple-antenna setups, demonstrate the efficiency of the proposed approach in different conditions. For instance, with a maximum of M retransmissions and single transmit/receive antennas, the diversity gain of a user increases from M to (J+1)(M-1)+1 where J is the number of users helping that user.

  18. MicroRNAs Suppress NB Domain Genes in Tomato That Confer Resistance to Fusarium oxysporum

    Science.gov (United States)

    Ouyang, Shouqiang; Park, Gyungsoon; Atamian, Hagop S.; Han, Cliff S.; Stajich, Jason E.; Kaloshian, Isgouhi; Borkovich, Katherine A.

    2014-01-01

    MicroRNAs (miRNAs) suppress the transcriptional and post-transcriptional expression of genes in plants. Several miRNA families target genes encoding nucleotide-binding site–leucine-rich repeat (NB-LRR) plant innate immune receptors. The fungus Fusarium oxysporum f. sp. lycopersici causes vascular wilt disease in tomato. We explored a role for miRNAs in tomato defense against F. oxysporum using comparative miRNA profiling of susceptible (Moneymaker) and resistant (Motelle) tomato cultivars. slmiR482f and slmiR5300 were repressed during infection of Motelle with F. oxysporum. Two predicted mRNA targets each of slmiR482f and slmiR5300 exhibited increased expression in Motelle and the ability of these four targets to be regulated by the miRNAs was confirmed by co-expression in Nicotiana benthamiana. Silencing of the targets in the resistant Motelle cultivar revealed a role in fungal resistance for all four genes. All four targets encode proteins with full or partial nucleotide-binding (NB) domains. One slmiR5300 target corresponds to tm-2, a susceptible allele of the Tomato Mosaic Virus resistance gene, supporting functions in immunity to a fungal pathogen. The observation that none of the targets correspond to I-2, the only known resistance (R) gene for F. oxysporum in tomato, supports roles for additional R genes in the immune response. Taken together, our findings suggest that Moneymaker is highly susceptible because its potential resistance is insufficiently expressed due to the action of miRNAs. PMID:25330340

  19. Crowding by a repeating pattern.

    Science.gov (United States)

    Rosen, Sarah; Pelli, Denis G

    2015-01-01

    Theinability to recognize a peripheral target among flankers is called crowding. For a foveal target, crowding can be distinguished from overlap masking by its sparing of detection, linear scaling with eccentricity, and invariance with target size.Crowding depends on the proximity and similarity of the flankers to the target. Flankers that are far from or dissimilar to the target do not crowd it. On a gray page, text whose neighboring letters have different colors, alternately black and white, has enough dissimilarity that it might escape crowding. Since reading speed is normally limited by crowding, escape from crowding should allow faster reading. Yet reading speed is unchanged (Chung & Mansfield, 2009). Why? A recent vernier study found that using alternating-color flankers produces strong crowding (Manassi, Sayim, & Herzog, 2012). Might that effect occur with letters and reading? Critical spacing is the minimum center-to-center target-flanker spacing needed to correctly identify the target. We measure it for a target letter surrounded by several equidistant flanker letters of the same polarity, opposite polarity, or mixed polarity: alternately white and black. We find strong crowding in the alternating condition, even though each flanker letter is beyond its own critical spacing (as measured in a separate condition). Thus a periodic repeating pattern can produce crowding even when the individual elements do not. Further, in all conditions we find that, once a periodic pattern repeats (two cycles), further repetition does not affect critical spacing of the innermost flanker.

  20. Automatization and familiarity in repeated checking

    NARCIS (Netherlands)

    Dek, Eliane C P; van den Hout, Marcel A.; Giele, Catharina L.; Engelhard, Iris M.

    2014-01-01

    Repeated checking paradoxically increases memory uncertainty. This study investigated the underlying mechanism of this effect. We hypothesized that as a result of repeated checking, familiarity with stimuli increases, and automatization of the checking procedure occurs, which should result in decrea

  1. CDC Vital Signs: Preventing Repeat Teen Births

    Science.gov (United States)

    ... file Error processing SSI file Preventing Repeat Teen Births Recommend on Facebook Tweet Share Compartir On this ... Too many teens, ages 15–19, have repeat births. Nearly 1 in 5 births to teens, ages ...

  2. Expanded complexity of unstable repeat diseases

    OpenAIRE

    Polak, Urszula; McIvor, Elizabeth; Dent, Sharon Y.R.; Wells, Robert D.; Napierala, Marek.

    2012-01-01

    Unstable Repeat Diseases (URDs) share a common mutational phenomenon of changes in the copy number of short, tandemly repeated DNA sequences. More than 20 human neurological diseases are caused by instability, predominantly expansion, of microsatellite sequences. Changes in the repeat size initiate a cascade of pathological processes, frequently characteristic of a unique disease or a small subgroup of the URDs. Understanding of both the mechanism of repeat instability and molecular consequen...

  3. 47 CFR 97.205 - Repeater station.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Repeater station. 97.205 Section 97.205... SERVICE Special Operations § 97.205 Repeater station. (a) Any amateur station licensed to a holder of a Technician, General, Advanced or Amateur Extra Class operator license may be a repeater. A holder of...

  4. 47 CFR 22.1015 - Repeater operation.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false Repeater operation. 22.1015 Section 22.1015... Offshore Radiotelephone Service § 22.1015 Repeater operation. Offshore central stations may be used as repeater stations provided that the licensee is able to maintain control of the station, and in...

  5. ProtRepeatsDB: a database of amino acid repeats in genomes

    Directory of Open Access Journals (Sweden)

    Chauhan Virander S

    2006-07-01

    Full Text Available Abstract Background Genome wide and cross species comparisons of amino acid repeats is an intriguing problem in biology mainly due to the highly polymorphic nature and diverse functions of amino acid repeats. Innate protein repeats constitute vital functional and structural regions in proteins. Repeats are of great consequence in evolution of proteins, as evident from analysis of repeats in different organisms. In the post genomic era, availability of protein sequences encoded in different genomes provides a unique opportunity to perform large scale comparative studies of amino acid repeats. ProtRepeatsDB http://bioinfo.icgeb.res.in/repeats/ is a relational database of perfect and mismatch repeats, access to which is designed as a resource and collection of tools for detection and cross species comparisons of different types of amino acid repeats. Description ProtRepeatsDB (v1.2 consists of perfect as well as mismatch amino acid repeats in the protein sequences of 141 organisms, the genomes of which are now available. The web interface of ProtRepeatsDB consists of different tools to perform repeat s; based on protein IDs, organism name, repeat sequences, and keywords as in FASTA headers, size, frequency, gene ontology (GO annotation IDs and regular expressions (REGEXP describing repeats. These tools also allow formulation of a variety of simple, complex and logical queries to facilitate mining and large-scale cross-species comparisons of amino acid repeats. In addition to this, the database also contains sequence analysis tools to determine repeats in user input sequences. Conclusion ProtRepeatsDB is a multi-organism database of different types of amino acid repeats present in proteins. It integrates useful tools to perform genome wide queries for rapid screening and identification of amino acid repeats and facilitates comparative and evolutionary studies of the repeats. The database is useful for identification of species or organism specific

  6. Sequencing analysis of the spinal bulbar muscular atrophy CAG expansion reveals absence of repeat interruptions.

    Science.gov (United States)

    Fratta, Pietro; Collins, Toby; Pemble, Sally; Nethisinghe, Suran; Devoy, Anny; Giunti, Paola; Sweeney, Mary G; Hanna, Michael G; Fisher, Elizabeth M C

    2014-02-01

    Trinucleotide repeat disorders are a heterogeneous group of diseases caused by the expansion, beyond a pathogenic threshold, of unstable DNA tracts in different genes. Sequence interruptions in the repeats have been described in the majority of these disorders and may influence disease phenotype and heritability. Spinal bulbar muscular atrophy (SBMA) is a motor neuron disease caused by a CAG trinucleotide expansion in the androgen receptor (AR) gene. Diagnostic testing and previous research have relied on fragment analysis polymerase chain reaction to determine the AR CAG repeat size, and have therefore not been able to assess the presence of interruptions. We here report a sequencing study of the AR CAG repeat in a cohort of SBMA patients and control subjects in the United Kingdom. We found no repeat interruptions to be present, and we describe differences between sequencing and traditional sizing methods.

  7. Pentatricopeptide repeat proteins in plants.

    Science.gov (United States)

    Barkan, Alice; Small, Ian

    2014-01-01

    Pentatricopeptide repeat (PPR) proteins constitute one of the largest protein families in land plants, with more than 400 members in most species. Over the past decade, much has been learned about the molecular functions of these proteins, where they act in the cell, and what physiological roles they play during plant growth and development. A typical PPR protein is targeted to mitochondria or chloroplasts, binds one or several organellar transcripts, and influences their expression by altering RNA sequence, turnover, processing, or translation. Their combined action has profound effects on organelle biogenesis and function and, consequently, on photosynthesis, respiration, plant development, and environmental responses. Recent breakthroughs in understanding how PPR proteins recognize RNA sequences through modular base-specific contacts will help match proteins to potential binding sites and provide a pathway toward designing synthetic RNA-binding proteins aimed at desired targets.

  8. Two-dimensional quantum repeaters

    Science.gov (United States)

    Wallnöfer, J.; Zwerger, M.; Muschik, C.; Sangouard, N.; Dür, W.

    2016-11-01

    The endeavor to develop quantum networks gave rise to a rapidly developing field with far-reaching applications such as secure communication and the realization of distributed computing tasks. This ultimately calls for the creation of flexible multiuser structures that allow for quantum communication between arbitrary pairs of parties in the network and facilitate also multiuser applications. To address this challenge, we propose a two-dimensional quantum repeater architecture to establish long-distance entanglement shared between multiple communication partners in the presence of channel noise and imperfect local control operations. The scheme is based on the creation of self-similar multiqubit entanglement structures at growing scale, where variants of entanglement swapping and multiparty entanglement purification are combined to create high-fidelity entangled states. We show how such networks can be implemented using trapped ions in cavities.

  9. General benchmarks for quantum repeaters

    CERN Document Server

    Pirandola, Stefano

    2015-01-01

    Using a technique based on quantum teleportation, we simplify the most general adaptive protocols for key distribution, entanglement distillation and quantum communication over a wide class of quantum channels in arbitrary dimension. Thanks to this method, we bound the ultimate rates for secret key generation and quantum communication through single-mode Gaussian channels and several discrete-variable channels. In particular, we derive exact formulas for the two-way assisted capacities of the bosonic quantum-limited amplifier and the dephasing channel in arbitrary dimension, as well as the secret key capacity of the qubit erasure channel. Our results establish the limits of quantum communication with arbitrary systems and set the most general and precise benchmarks for testing quantum repeaters in both discrete- and continuous-variable settings.

  10. Hungarian repeat station survey, 2010

    Directory of Open Access Journals (Sweden)

    Péter Kovács

    2013-03-01

    Full Text Available The last Hungarian repeat station survey was completed between October 2010 and February 2011. Declination, inclination and the total field were observed using one-axial DMI fluxgate magnetometer mounted on Zeiss20A theodolite and GSM 19 Overhauser magnetometer. The magnetic elements of the sites were reduced to the epoch of 2010.5 on the basis of the continuous recordings of Tihany Geophysical Observatory. In stations located far from the reference observatory, the observations were carried out in the morning and afternoon in order to decrease the effect of the distant temporal correction. To further increase the accuracy, on-site dIdD variometer has also been installed near the Aggtelek station, in the Baradla cave, during the survey of the easternmost sites. The paper presents the technical details and the results of our last campaign. The improvement of the accuracy of the temporal reduction by the use of the local variometer is also reported.

  11. Quality control during repeated fryings

    Directory of Open Access Journals (Sweden)

    Cuesta, C.

    1998-08-01

    Full Text Available Most of the debate ¡s about how the slow or frequent turnover of fresh fat affects the deterioration, of fat used in frying. Then, the modification of different oils used in repeated fryings of potatoes without or with turnover of fresh oil, under similar frying conditions, was evaluated by two criteria: by measuring the total polar component isolated by column chromatography and by the evaluation of the specific compounds related to thermoxidative and hydrolytic alteration by High Performance Size Exclusion Chromatography (HPSEC. The results indicate that with frequent turnover of fresh oil, the critical level of 25% of polar material is rarely reached, and there are fewer problems with fat deterioration because the frying tended to increase the level of polar material and thermoxidative compounds (polymers and dimers of triglycerides and oxidized triglycerides in the fryer oil during the first fryings, followed by minor changes and a tendency to reach a near-steady state in successive fryings. However, in repeated frying of potatoes using a null turnover the alteration rate was higher being linear the relationship found between polar material or the different thermoxidative compounds and the number of fryings. On the other hand chemical reactions produced during deep-fat frying can be minimized by using proper oils. In addition the increased level of consumers awareness toward fat composition and its impact on human health could had an impact on the selection of fats for snacks and for industry. In this way monoenic fats are the most adequate from a nutritional point of view and for its oxidative stability during frying.

  12. Somatostatin receptors

    DEFF Research Database (Denmark)

    Møller, Lars Neisig; Stidsen, Carsten Enggaard; Hartmann, Bolette

    2003-01-01

    therefore been acknowledged to be a third endogenous ligand at SRIF receptors. This review goes through mechanisms of signal transduction, pharmacology, and anatomical distribution of SRIF receptors. Structurally, SRIF receptors belong to the superfamily of G protein-coupled (GPC) receptors, sharing....... The generation of knock-out (KO) mice, intended as a means to define the contributions made by individual receptor subtypes, necessarily marks but an approximation. Furthermore, we must now take into account the stunning complexity of receptor co-operation indicated by the observation of receptor homo......-peptides, receptor agonists and antagonists. Relatively long half lives, as compared to those of the endogenous ligands, have been paramount from the outset. Motivated by theoretical puzzles or the shortcomings of present-day diagnostics and therapy, investigators have also aimed to produce subtype...

  13. Strengthening concept learning by repeated testing.

    Science.gov (United States)

    Wiklund-Hörnqvist, Carola; Jonsson, Bert; Nyberg, Lars

    2014-02-01

    The aim of this study was to examine whether repeated testing with feedback benefits learning compared to rereading of introductory psychology key-concepts in an educational context. The testing effect was examined immediately after practice, after 18 days, and at a five-week delay in a sample of undergraduate students (n = 83). The results revealed that repeated testing with feedback significantly enhanced learning compared to rereading at all delays, demonstrating that repeated retrieval enhances retention compared to repeated encoding in the short- and the long-term. In addition, the effect of repeated testing was beneficial for students irrespectively of working memory capacity. It is argued that teaching methods involving repeated retrieval are important to consider by the educational system.

  14. Repeat concussions in the national football league.

    Science.gov (United States)

    Casson, Ira R; Viano, David C; Powell, John W; Pellman, Elliot J

    2011-01-01

    Repeat concussion is an important issue in the National Football League (NFL). An initial description of repeat injuries was published for 6 years (1996-2001). The characteristics and frequency of repeat concussion in the NFL have not changed in the subsequent 6 years (2002-2007). Case control. From 1996 to 2007, concussions were reported using a standardized form documenting signs and symptoms, loss of consciousness and medical action taken. Data on repeat concussions were analyzed for the 12 years and compared between the 2 periods. In 2002-2007, 152 players had repeat concussions (vs 160 in 1996-2001); 44 had 3+ head injuries (vs 52). The positions most often associated with repeat concussion in 2002-2007 were the defensive secondary, kick unit, running back, and linebacker. The odds for repeat concussion were elevated for wide receivers, tight ends, and linebackers but lower than in the earlier period. During 2002-2007, over half of players with repeat concussion were removed from play, and fewer immediately returned (vs 1996-2001). The average duration between concussions was 1.25 years for 2002-2007 and 1.65 years for the 12-year period. Over 12 years, 7.6% of all repeat concussions occurred within 2 weeks of the prior concussion. The defensive secondary, kick unit, running back, and linebacker have the highest incidence of repeat concussion. During 2002-2007, more than half of players with repeat concussion were removed from play, and only a fraction immediately returned. Although concussion was managed more conservatively by team physicians in the recent 6 years, repeat concussions occurred at similar rates during both periods.

  15. Automated quality checks on repeat prescribing.

    OpenAIRE

    Rogers, Jeremy E; Wroe, Christopher J; Roberts, Angus; Swallow, Angela; Stables, David; Cantrill, Judith A; Rector, Alan L.

    2003-01-01

    BACKGROUND: Good clinical practice in primary care includes periodic review of repeat prescriptions. Markers of prescriptions that may need review have been described, but manually checking all repeat prescriptions against the markers would be impractical. AIM: To investigate the feasibility of computerising the application of repeat prescribing quality checks to electronic patient records in United Kingdom (UK) primary care. DESIGN OF STUDY: Software performance test against benchmark manual...

  16. Short Tandem Repeat DNA Internet Database

    Science.gov (United States)

    SRD 130 Short Tandem Repeat DNA Internet Database (Web, free access)   Short Tandem Repeat DNA Internet Database is intended to benefit research and application of short tandem repeat DNA markers for human identity testing. Facts and sequence information on each STR system, population data, commonly used multiplex STR systems, PCR primers and conditions, and a review of various technologies for analysis of STR alleles have been included.

  17. Repeatability & Workability Evaluation of SIGMOD 2009

    KAUST Repository

    Manegold, Stefan

    2010-12-15

    SIGMOD 2008 was the first database conference that offered to test submitters\\' programs against their data to verify the repeatability of the experiments published [1]. Given the positive feedback concerning the SIGMOD 2008 repeatability initiative, SIGMOD 2009 modified and expanded the initiative with a workability assessment.

  18. EGFR CA repeat polymorphism predict clinical outcome in EGFR mutation positive NSCLC patients treated with erlotinib

    DEFF Research Database (Denmark)

    Winther Larsen, Anne; Nissen, Peter Henrik; Meldgaard, Peter;

    2014-01-01

    OBJECTIVES: Somatic mutations in the epidermal growth factor receptor (EGFR) are predictors of efficacy for treatment with the EGFR tyrosine kinase inhibitor erlotinib in non-small cell lung cancer (NSCLC). A CA repeat polymorphism in intron 1 of the EGFR gene influences the transcription...... of the EGFR gene. This study evaluates the association between the CA repeat polymorphism and outcome in NSCLC patients treated with erlotinib.MATERIALS AND METHODS: Number of CA repeats in the EGFR gene was evaluated with PCR-fragment length analysis by capillary electrophoresis in 432 advanced NSCLC...... patients treated with erlotinib irrespective of EGFR mutation status. Patients were dichotomized into harboring short allele (CA≤16 in any allele) or long alleles (CA>16 in both alleles). Number of repeats was correlated with clinical characteristic and outcome. A subgroup analysis was performed based...

  19. Reward modulation of contextual cueing: Repeated context overshadows repeated target location.

    Science.gov (United States)

    Sharifian, Fariba; Contier, Oliver; Preuschhof, Claudia; Pollmann, Stefan

    2017-08-07

    Contextual cueing can be enhanced by reward. However, there is a debate if reward is associated with the repeated target-distractor configurations or with the repeated target locations that occur in both repeated and new displays. Based on neuroimaging evidence, we hypothesized that reward becomes associated with the target location only in new displays, but not in repeated displays, where the repeated target location is overshadowed by the more salient repeated target-distractor configuration. To test this hypothesis, we varied the reward value associated with the same target location in repeated and new displays. The results confirmed the overshadowing hypothesis in that search facilitation in repeated target-distractor configurations was modulated by the variable value associated with the target location. This effect was observed mainly in early learning.

  20. Childhood experiences and repeated suicidal behavior

    DEFF Research Database (Denmark)

    Krarup, Gertrud; Nielsen, Bent; Rask, P

    1991-01-01

    The aim of this study was to elucidate the influence of various events in childhood on suicidal behavior in adult age. For this purpose, 99 patients admitted to the Department of Psychiatry of Odense University Hospital after making a suicide attempt were followed for 5 years, to register repeated...... suicidal behavior. The results showed that three fourths of the patients attempted suicide more than once (62% nonfatal and 14% fatal outcome). The sex distribution was about the same among the first-evers as among the repeaters. Most repeaters were younger people in their twenties and thirties......, and the first-evers on average were past the age of 40. Somewhat unexpectedly, significantly more repeaters than first-evers had grown up with both their parents. However, the results also showed that significantly more repeaters than first-evers had had an unhappy childhood. This indicates...

  1. UK 2009-2010 repeat station report

    Directory of Open Access Journals (Sweden)

    Thomas J.G. Shanahan

    2013-03-01

    Full Text Available The British Geological Survey is responsible for conducting the UK geomagnetic repeat station programme. Measurements made at the UK repeat station sites are used in conjunction with the three UK magnetic observatories: Hartland, Eskdalemuir and Lerwick, to produce a regional model of the local field each year. The UK network of repeat stations comprises 41 stations which are occupied at approximately 3-4 year intervals. Practices for conducting repeat station measurements continue to evolve as advances are made in survey instrumentation and as the usage of the data continues to change. Here, a summary of the 2009 and 2010 UK repeat station surveys is presented, highlighting the measurement process and techniques, density of network, reduction process and recent results.

  2. Expression and its significance of stem cells marker leucine-rich repeat containing G protein coupled receptor 5 gene in human colorectal cancer%人结直肠癌干细胞标志物富含亮氨酸重复单位的G蛋白耦联受体5基因的表达及意义

    Institute of Scientific and Technical Information of China (English)

    孙艳; 盛春华; 文大成; 李玉林; 迟宝荣

    2013-01-01

    目的 探讨人结直肠癌组织及外周血中干细胞标志物富含亮氨酸重复单位的G蛋白耦联受体5(lgr5)基因的表达及其与临床病理特征间的关系.方法 采用SYBR Green实时定量PCR方法检测27份结直肠癌组织及配对的正常组织中、1 7例患者及8名健康对照者外周血中lgr5mRNA的表达.应用Wilcoxon秩和检验分析lgr5 mRNA在不同组织间、临床病理参数之间的表达差异.结果 结直肠癌组织中lgr5 mRNA表达水平为1.000(0.012,496.353),高于配对正常组织的0.147(0.004,73.002),差异有统计学意义(Z=8.029,P<0.01).结直肠癌患者外周血中lgr5mRNA表达水平为0.742(0.077,456.566),高于健康对照组的0.104(0.034,0.274),差异有统计学意义(Z=2.048,P<0.05).结直肠癌组织lgr5 mRNA在不同性别、年龄、肿瘤原发部位、肿瘤大小、组织学类型组间表达差异均无统计学意义(P均>0.05),但有淋巴结转移组lgr5 mRNA表达高于无淋巴结转移组,差异有统计学意义(Z=2.066,P<0.05).结论 lgr5在结直肠癌组织及外周血中的表达上调可能参与了结直肠癌的生长及转移.%Objective To investigate the expression of stem cell marker leucine-rich repeat containing G protein coupled receptor 5 (lgr5) gene in human colorectal cancer tissues and peripheral blood and its correlation with clinical pathological characteristics.Methods The expression of lgr5 at mRNA level was detected by SYBR Green quantitative real-time polymerase chain reaction (PCR) in 27 human colorectal cancer tissues and corresponding non-cancerous tissues as well as in peripheral blood of 17 patients and eight healthy controls.The differences of lgr5 mRNA expression in different tissues and clinical pathology parameters were analyzed by Wilcoxon test.Results The expression of lgr5 at mRNA level in colorectal cancer tissues was 1.000 (0.012,496.353),which was higher than that of corresponding non-cancerous tissues 0.147 (0.004,73.002),the

  3. 海岛棉的一个富含亮氨酸重复受体蛋白基因的克隆和功能分析%Cloning and functional analysis of a leucine-rich-repeat receptor-like pro-tein from island cotton

    Institute of Scientific and Technical Information of China (English)

    蔡立旺; 杨郁文; 陈天子; 刘廷利; 凌溪铁; 张保龙; 高进

    2014-01-01

    A receptor-1ike gene GbVdr1 was c1oned from is1and cotton by genome wa1king. It contains an open read-ing frame of 3 387 bp and encodes 1 128 amino acids. The mo1ecu1ar weight and isoe1ectric point of Gbvdr1 is 1. 249×105 and 5. 86. GbVdr1 shared simi1arity as high as 99. 85% with GhVdr1 and homo1ogous GhVdr1-1 iso1ated from resistant cu1ti-var Changkangmian and susceptib1e cu1tivar Yumian No. 1. Gbvdr1 has signa1 peptide, transmembrane region, LRR re-peat, PEST domain re1ated to protein proteo1ysis and endocytosis signa1. The expression of GbVdr1 was higher in root and stem than that in 1eaves, and was induced more intensive1y by non-defo1iating Verticillium dahlia iso1ate BP2 than by defo1i-ating iso1ate V991 in stem and root. GbVdr1 was 1ocated on the ce11 membrane. 23 GbVdr1 overexpressed p1ants were ob-tained by PCR identification, and the p1ant with the highest GbVdr1 expression was emp1oyed for Verticillium wi1t resistance ana1ysis. The resu1ts showed GbVdr1 cou1d enhance the resistance to BP2 notab1y but had no function on V991. In addi-tion, the expression of some pathogen re1ated (PR) genes such as PR1, PR5, EDS1 and GST1 were increased more in the transformed p1ants than that in the wi1d type inocu1ated with V. dahlia. The functiona1 ana1ysis of Gbvdr1 indicated it was invo1ved in the resistance reaction to BP2 in cotton.%通过染色体步移获得了海岛棉的一个受体蛋白基因GbVdr1,其开放阅读框为3387个核苷酸,编码1128个氨基酸,编码蛋白分子量为1.249×105,等电点为5.86. GbVdr1与陆地棉抗病材料常抗棉和感病材料渝棉1号中的同源基因GhVdr1和GhVdr1-1的相似度高达99.85%. Gbvdr1具有信号肽、跨膜区、LRR重复区、蛋白质降解相关的PEST结构域以及内吞信号. GbVdr1在根茎中的表达量高于叶片,其对非落叶型黄萎病菌株BP2的反应较落叶型菌株V991的更为强烈,并且这种差异在茎和根中更为明显. GbVdr1定位于细胞膜上. PCR

  4. Estrogen protects against the detrimental effects of repeated stress on glutamatergic transmission and cognition.

    Science.gov (United States)

    Wei, J; Yuen, E Y; Liu, W; Li, X; Zhong, P; Karatsoreos, I N; McEwen, B S; Yan, Z

    2014-05-01

    Converging evidence suggests that females and males show different responses to stress; however, little is known about the mechanism underlying the sexually dimorphic effects of stress. In this study, we found that young female rats exposed to 1 week of repeated restraint stress show no negative effects on temporal order recognition memory (TORM), a cognitive process controlled by the prefrontal cortex (PFC), which was contrary to the impairment in TORM observed in stressed males. Concomitantly, normal glutamatergic transmission and glutamate receptor surface expression in PFC pyramidal neurons were found in repeatedly stressed females, in contrast to the significant reduction seen in stressed males. The detrimental effects of repeated stress on TORM and glutamate receptors were unmasked in stressed females when estrogen receptors were inhibited or knocked down in PFC, and were prevented in stressed males with the administration of estradiol. Blocking aromatase, the enzyme for the biosynthesis of estrogen, revealed the stress-induced glutamatergic deficits and memory impairment in females, and the level of aromatase was significantly higher in the PFC of females than in males. These results suggest that estrogen protects against the detrimental effects of repeated stress on glutamatergic transmission and PFC-dependent cognition, which may underlie the stress resilience of females.

  5. Early onset and novel features in a spinal and bulbar muscular atrophy patient with a 68 CAG repeat.

    Science.gov (United States)

    Grunseich, Christopher; Kats, Ilona R; Bott, Laura C; Rinaldi, Carlo; Kokkinis, Angela; Fox, Derrick; Chen, Ke-Lian; Schindler, Alice B; Mankodi, Ami K; Shrader, Joseph A; Schwartz, Daniel P; Lehky, Tanya J; Liu, Chia-Ying; Fischbeck, Kenneth H

    2014-11-01

    Spinal and bulbar muscular atrophy (SBMA) is an X-linked neuromuscular disease caused by a trinucleotide (CAG) repeat expansion in the androgen receptor gene. Patients with SBMA have weakness, atrophy, and fasciculations in the bulbar and extremity muscles. Individuals with CAG repeat lengths greater than 62 have not previously been reported. We evaluated a 29year old SBMA patient with 68 CAGs who had unusually early onset and findings not seen in others with the disease. Analysis of the androgen receptor gene confirmed the repeat length of 68 CAGs in both peripheral blood and fibroblasts. Evaluation of muscle and sensory function showed deficits typical of SBMA, and in addition the patient had manifestations of autonomic dysfunction and abnormal sexual development. These findings extend the known phenotype associated with SBMA and shed new insight into the effects of the mutated androgen receptor.

  6. Molecular characterization of a novel human hybrid-type receptor that binds the alpha2-macroglobulin receptor-associated protein

    DEFF Research Database (Denmark)

    Jacobsen, Linda; Madsen, P; Moestrup, S K;

    1996-01-01

    the corresponding cDNA. The gene, designated SORL1, maps to chromosome 11q 23/24 and encodes a 2214-residue type 1 receptor containing a furin cleavage site immediately preceding the N terminus determined in the purified protein. The receptor, designated sorLA-1, has a short cytoplasmic tail containing a tyrosine......-based internalization signal and a large external part containing (from the N-terminal): 1) a segment homologous to domains in the yeast vacuolar protein sorting 10 protein, Vps10p, that binds carboxypeptidase Y, 2) five tandemly arranged YWTD repeats and a cluster of 11 class A repeats characteristic of the low...... density lipoprotein receptor gene family receptors, and 3) six tandemly arranged fibronectin type III repeats also found in certain neural adhesion proteins. sorLA-1 may therefore be classified as a hybrid receptor. Northern blotting revealed specific mRNA transcripts in brain, spinal cord, and testis...

  7. The child accident repeater: a review.

    Science.gov (United States)

    Jones, J G

    1980-04-01

    The child accident repeater is defined as one who has at least three accidents that come to medical attention within a year. The accident situation has features in common with those of the child who has a single accident through simple "bad luck", but other factors predispose him to repeated injury. In the child who has a susceptible personality, a tendency for accident repetition may be due to a breakdown in adjustment to a stressful environment. Prevention of repeat accidents should involve the usual measures considered appropriate for all children as well as an attempt to provide treatment of significant maladjustment and modification of a stressful environment.

  8. Repeated use of mifepristone and levonorgestrel and their effect on the ovarian function in mice.

    Science.gov (United States)

    Chen, Yuanyuan; Shi, Xiaobo

    2016-11-01

    To investigate the effects of repeated mifepristone and levonorgestrel use on estrous cycle and expression of ovarian follicle-stimulating hormone receptor (FSHR) and luteinizing hormone receptor (LHR) in mice. Ovarian FSHR and LHR mRNA expression was measured using real-time quantitative reverse transcription-polymerase chain reaction, while the protein levels were measured using immunohistochemistry. Repeated use of mifepristone and levonorgestrel significantly lengthened the estrous cycle and decreased FSHR and LHR mRNA and protein expression in the ovaries of mice at 4, 24, and 48 days after discontinuing drug use. Repeated use of mifepristone and levonorgestrel had significant main effects on estrous cycle length and the mRNA expression and protein level of ovarian FSHR and LHR. Repeated mifepristone and levonorgestrel use and withdrawal time had a significant interaction with mouse estrous cycle (F = 16.65, P < 0.05), ovarian LHR and FSHR mRNA expression (F = 563.072, P < 0.05), and protein level (F = 6.536, P < 0.05). Repeated use of mifepristone and levonorgestrel can lead to sustained damage to ovarian function through inhibition of ovarian FSHR and LHR expression in mice. © 2016 Japan Society of Obstetrics and Gynecology.

  9. The Moral Maturity of Repeater Delinquents.

    Science.gov (United States)

    Petronio, Richard J.

    1980-01-01

    Differences in moral development (as conceived by Kohlberg) were examined in a sample of delinquent teenagers. The repeater group was not found, as had been hypothesized, to be lower on moral maturity than those who engaged in less delinquency. (GC)

  10. Star repeaters for fiber optic links.

    Science.gov (United States)

    McMahon, D H; Gravel, R L

    1977-02-01

    A star repeater combines the functions of a passive star coupler and a signal regenerating amplifier. By more effectively utilizing the light power radiated by a light emitting diode, the star repeater can, when used with small diameter channels, couple as much power to all receivers of a multiterminal link as would be coupled to the single receiver of a simple point-to-point link.

  11. Digital repeat analysis; setup and operation.

    Science.gov (United States)

    Nol, J; Isouard, G; Mirecki, J

    2006-06-01

    Since the emergence of digital imaging, there have been questions about the necessity of continuing reject analysis programs in imaging departments to evaluate performance and quality. As a marketing strategy, most suppliers of digital technology focus on the supremacy of the technology and its ability to reduce the number of repeats, resulting in less radiation doses given to patients and increased productivity in the department. On the other hand, quality assurance radiographers and radiologists believe that repeats are mainly related to positioning skills, and repeat analysis is the main tool to plan training needs to up-skill radiographers. A comparative study between conventional and digital imaging was undertaken to compare outcomes and evaluate the need for reject analysis. However, digital technology still being at its early development stages, setting a credible reject analysis program became the major task of the study. It took the department, with the help of the suppliers of the computed radiography reader and the picture archiving and communication system, over 2 years of software enhancement to build a reliable digital repeat analysis system. The results were supportive of both philosophies; the number of repeats as a result of exposure factors was reduced dramatically; however, the percentage of repeats as a result of positioning skills was slightly on the increase for the simple reason that some rejects in the conventional system qualifying for both exposure and positioning errors were classified as exposure error. The ability of digitally adjusting dark or light images reclassified some of those images as positioning errors.

  12. Quantum Key Distribution over Probabilistic Quantum Repeaters

    CERN Document Server

    Amirloo, Jeyran; Majedi, A Hamed

    2010-01-01

    A feasible route towards implementing long-distance quantum key distribution (QKD) systems relies on probabilistic schemes for entanglement distribution and swapping as proposed in the work of Duan, Lukin, Cirac, and Zoller (DLCZ) [Nature 414, 413 (2001)]. Here, we calculate the conditional throughput and fidelity of entanglement for DLCZ quantum repeaters, by accounting for the DLCZ self-purification property, in the presence of multiple excitations in the ensemble memories as well as loss and other sources of inefficiency in the channel and measurement modules. We then use our results to find the generation rate of secure key bits for QKD systems that rely on DLCZ quantum repeaters. We compare the key generation rate per logical memory employed in the two cases of with and without a repeater node. We find the cross-over distance beyond which the repeater system outperforms the non-repeater one. That provides us with the optimum inter-node distancing in quantum repeater systems. We also find the optimal exci...

  13. Dynamic combinatorial libraries of artificial repeat proteins.

    Science.gov (United States)

    Eisenberg, Margarita; Shumacher, Inbal; Cohen-Luria, Rivka; Ashkenasy, Gonen

    2013-06-15

    Repeat proteins are found in almost all cellular systems, where they are involved in diverse molecular recognition processes. Recent studies have suggested that de novo designed repeat proteins may serve as universal binders, and might potentially be used as practical alternative to antibodies. We describe here a novel chemical methodology for producing small libraries of repeat proteins, and screening in parallel the ligand binding of library members. The first stage of this research involved the total synthesis of a consensus-based three-repeat tetratricopeptide (TPR) protein (~14 kDa), via sequential attachment of the respective peptides. Despite the effectiveness of the synthesis and ligation steps, this method was found to be too demanding for the production of proteins containing variable number of repeats. Additionally, the analysis of binding of the individual proteins was time consuming. Therefore, we designed and prepared novel dynamic combinatorial libraries (DCLs), and show that their equilibration can facilitate the formation of TPR proteins containing up to eight repeating units. Interestingly, equilibration of the library building blocks in the presence of the biologically relevant ligands, Hsp90 and Hsp70, induced their oligomerization into forming more of the proteins with large recognition surfaces. We suggest that this work presents a novel simple and rapid tool for the simultaneous screening of protein mixtures with variable binding surfaces, and for identifying new binders for ligands of interest.

  14. Long-lasting bradypnea induced by repeated social defeat.

    Science.gov (United States)

    Brouillard, Charly; Carrive, Pascal; Camus, Françoise; Bénoliel, Jean-Jacques; Similowski, Thomas; Sévoz-Couche, Caroline

    2016-08-01

    Repeated social defeat in the rat induces long-lasting cardiovascular changes associated with anxiety. In this study, we investigated the effects of repeated social defeat on breathing. Respiratory rate was extracted from the respiratory sinus arrhythmia (RSA) peak frequency of the ECG in rats subjected to social defeat for 4 consecutive days. Respiratory rate was recorded under anesthesia 6 days (D+10) or 26 days (D+30) after social defeat. At D+10, defeated (D) rats spent less time in the open arms of the elevated plus maze test, had heavier adrenal glands, and displayed bradypnea, unlike nondefeated animals. At D+30, all signs of anxiety had disappeared. However, one-half of the rats still displayed bradypnea (DL rats, for low respiratory rate indicated by a lower RSA frequency), whereas those with higher respiratory rate (DH rats) had recovered. Acute blockade of the dorsomedial hypothalamus (DMH) or nucleus tractus solitarii (NTS) 5-HT3 receptors reversed bradypnea in all D rats at D+10 and in DL rats at D+30. Respiratory rate was also recorded in conscious animals implanted with radiotelemetric ECG probes. DH rats recovered between D+10 and D+18, whereas DL rats remained bradypneic until D+30. In conclusion, social stress induces sustained chronic bradypnea mediated by DMH neurons and NTS 5-HT3 receptors. These changes are associated with an anxiety-like state that persists until D+10, followed by recovery. However, bradypnea may persist in one-half of the population up until D+30, despite apparent recovery of the anxiety-like state.

  15. Differential compartmentalization and distinct functions of GABAB receptor variants

    DEFF Research Database (Denmark)

    Vigot, Réjan; Barbieri, Samuel; Bräuner-Osborne, Hans

    2006-01-01

    GABAB receptors are the G protein-coupled receptors for the main inhibitory neurotransmitter in the brain, gamma-aminobutyric acid (GABA). Molecular diversity in the GABAB system arises from the GABAB1a and GABAB1b subunit isoforms that solely differ in their ectodomains by a pair of sushi repeat...

  16. Construction of covalently coupled, concatameric dimers of 7TM receptors

    DEFF Research Database (Denmark)

    Terpager, Marie; Scholl, D Jason; Kubale, Valentina;

    2009-01-01

    -Ala repeats flanked by flexible spacers and positively charged residues to ensure correct inside-out orientation plus an extracellular HA-tag to construct covalently coupled dimers of 7TM receptors. Such 15 TM concatameric homo- and heterodimers of the beta(2)-adrenergic and the NK(1) receptors, which...

  17. Automated genotyping of dinucleotide repeat markers

    Energy Technology Data Exchange (ETDEWEB)

    Perlin, M.W.; Hoffman, E.P. [Carnegie Mellon Univ., Pittsburgh, PA (United States)]|[Univ. of Pittsburgh, PA (United States)

    1994-09-01

    The dinucleotide repeats (i.e., microsatellites) such as CA-repeats are a highly polymorphic, highly abundant class of PCR-amplifiable markers that have greatly streamlined genetic mapping experimentation. It is expected that over 30,000 such markers (including tri- and tetranucleotide repeats) will be characterized for routine use in the next few years. Since only size determination, and not sequencing, is required to determine alleles, in principle, dinucleotide repeat genotyping is easily performed on electrophoretic gels, and can be automated using DNA sequencers. Unfortunately, PCR stuttering with these markers generates not one band for each allele, but a pattern of bands. Since closely spaced alleles must be disambiguated by human scoring, this poses a key obstacle to full automation. We have developed methods that overcome this obstacle. Our model is that the observed data is generated by arithmetic superposition (i.e., convolution) of multiple allele patterns. By quantitatively measuring the size of each component band, and exploiting the unique stutter pattern associated with each marker, closely spaced alleles can be deconvolved; this unambiguously reconstructs the {open_quotes}true{close_quotes} allele bands, with stutter artifact removed. We used this approach in a system for automated diagnosis of (X-linked) Duchenne muscular dystrophy; four multiplexed CA-repeats within the dystrophin gene were assayed on a DNA sequencer. Our method accurately detected small variations in gel migration that shifted the allele size estimate. In 167 nonmutated alleles, 89% (149/167) showed no size variation, 9% (15/167) showed 1 bp variation, and 2% (3/167) showed 2 bp variation. We are currently developing a library of dinucleotide repeat patterns; together with our deconvolution methods, this library will enable fully automated genotyping of dinucleotide repeats from sizing data.

  18. Mechanism of Repeat-Associated MicroRNAs in Fragile X Syndrome

    Directory of Open Access Journals (Sweden)

    Karen Kelley

    2012-01-01

    Full Text Available The majority of the human genome is comprised of non-coding DNA, which frequently contains redundant microsatellite-like trinucleotide repeats. Many of these trinucleotide repeats are involved in triplet repeat expansion diseases (TREDs such as fragile X syndrome (FXS. After transcription, the trinucleotide repeats can fold into RNA hairpins and are further processed by Dicer endoribonuclases to form microRNA (miRNA-like molecules that are capable of triggering targeted gene-silencing effects in the TREDs. However, the function of these repeat-associated miRNAs (ramRNAs is unclear. To solve this question, we identified the first native ramRNA in FXS and successfully developed a transgenic zebrafish model for studying its function. Our studies showed that ramRNA-induced DNA methylation of the FMR1 5′-UTR CGG trinucleotide repeat expansion is responsible for both pathological and neurocognitive characteristics linked to the transcriptional FMR1 gene inactivation and the deficiency of its protein product FMRP. FMRP deficiency often causes synapse deformity in the neurons essential for cognition and memory activities, while FMR1 inactivation augments metabotropic glutamate receptor (mGluR-activated long-term depression (LTD, leading to abnormal neuronal responses in FXS. Using this novel animal model, we may further dissect the etiological mechanisms of TREDs, with the hope of providing insights into new means for therapeutic intervention.

  19. NMDA receptors in the basolateral amygdala and gustatory neophobia.

    Science.gov (United States)

    Figueroa-Guzmán, Yazmín; Reilly, Steve

    2008-05-19

    The attenuation of gustatory neophobia occurs during repeated exposures to an initially novel taste solution that is increasingly perceived as safe and familiar. The present study examined whether NMDA receptors in the basolateral region of the amygdala (BLA) are involved in this important behavioral phenomenon. The results, which show that the attenuation, but not initial occurrence, of gustatory neophobia is dependent upon NMDA receptors in the BLA, are discussed with reference to a similar finding involving NMDA receptors in the insular cortex.

  20. Reference: 373 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available nt duplication event between the RLM1 and RLM2 loci. Two independent T-DNA mutants in a TIR-NB-LRR R gene (At1g64070) display...ion, two T-DNA mutants in a neighbouring homologous TIR-NB-LRR gene (At1g63880) displayed moderate susceptib

  1. Heterodimerization and endocytosis of Arabidopsis brassinosteroid receptors BRI1 and AtSERK3 (BAK1)

    DEFF Research Database (Denmark)

    Russinova, Eugenia; Borst, Jan-Willem; Kwaaitaal, Mark Adrianus Cornelis J

    2004-01-01

    In Arabidopsis thaliana brassinosteroid (BR), perception is mediated by two Leu-rich repeat receptor-like kinases, BRASSINOSTEROID INSENSITIVE1 (BRI1) and BRI1-ASSOCIATED RECEPTOR KINASE1 (BAK1) (Arabidopsis SOMATIC EMBRYOGENESIS RECEPTOR-like KINASE3 [AtSERK3]). Genetic, biochemical, and yeast (...

  2. Mining of simple sequence repeats in the Genome of Gentianaceae

    Directory of Open Access Journals (Sweden)

    R Sathishkumar

    2011-01-01

    Full Text Available Simple sequence repeats (SSRs or short tandem repeats are short repeat motifs that show high level of length polymorphism due to insertion or deletion mutations of one or more repeat types. Here, we present the detection and abundance of microsatellites or SSRs in nucleotide sequences of Gentianaceae family. A total of 545 SSRs were mined in 4698 nucleotide sequences downloaded from the National Center for Biotechnology Information (NCBI. Among the SSR sequences, the frequency of repeat type was about 429 -mono repeats, 99 -di repeats, 15 -tri repeats, and 2 --hexa repeats. Mononucleotide repeats were found to be abundant repeat types, about 78%, followed by dinucleotide repeats (18.16% among the SSR sequences. An attempt was made to design primer pairs for 545 identified SSRs but these were found only for 169 sequences.

  3. Lipoxin Receptors

    Directory of Open Access Journals (Sweden)

    Mario Romano

    2007-01-01

    Full Text Available Lipoxins (LXs represent a class of arachidonic acid (AA metabolites that carry potent immunoregulatory and anti-inflammatory properties, LXA4 and LXB4 being the main components of this series. LXs are generated by cooperation between 5-lipoxygenase (LO and 12- or 15-LO during cell-cell interactions or by single cell types. LX epimers at carbon 15, the 15-epi-LXs, are formed by aspirin-acetylated cyclooxygenase-2 (COX-2 in cooperation with 5-LO. 15-epi-LXA4 is also termed aspirin-triggered LX (ATL. In vivo studies with stable LX and ATL analogs have established that these eicosanoids possess potent anti-inflammatory activities. A LXA4 receptor has been cloned. It belongs to the family of chemotactic receptors and clusters with formyl peptide receptors on chromosome 19. Therefore, it was initially denominated formyl peptide receptor like 1 (FPRL1. This receptor binds with high affinity and stereoselectivity LXA4 and ATL. It also recognizes a variety of peptides, synthetic, endogenously generated, or disease associated, but with lower affinity compared to LXA4. For this reason, this receptor has been renamed ALX. This review summarizes the current knowledge on ALX expression, signaling, and potential pathophysiological role. The involvement of additional recognition sites in LX bioactions is also discussed.

  4. PolyQ repeat expansions in ATXN2 associated with ALS are CAA interrupted repeats.

    Directory of Open Access Journals (Sweden)

    Zhenming Yu

    Full Text Available Amyotrophic lateral sclerosis (ALS is a devastating, rapidly progressive disease leading to paralysis and death. Recently, intermediate length polyglutamine (polyQ repeats of 27-33 in ATAXIN-2 (ATXN2, encoding the ATXN2 protein, were found to increase risk for ALS. In ATXN2, polyQ expansions of ≥ 34, which are pure CAG repeat expansions, cause spinocerebellar ataxia type 2. However, similar length expansions that are interrupted with other codons, can present atypically with parkinsonism, suggesting that configuration of the repeat sequence plays an important role in disease manifestation in ATXN2 polyQ expansion diseases. Here we determined whether the expansions in ATXN2 associated with ALS were pure or interrupted CAG repeats, and defined single nucleotide polymorphisms (SNPs rs695871 and rs695872 in exon 1 of the gene, to assess haplotype association. We found that the expanded repeat alleles of 40 ALS patients and 9 long-repeat length controls were all interrupted, bearing 1-3 CAA codons within the CAG repeat. 21/21 expanded ALS chromosomes with 3CAA interruptions arose from one haplotype (GT, while 18/19 expanded ALS chromosomes with <3CAA interruptions arose from a different haplotype (CC. Moreover, age of disease onset was significantly earlier in patients bearing 3 interruptions vs fewer, and was distinct between haplotypes. These results indicate that CAG repeat expansions in ATXN2 associated with ALS are uniformly interrupted repeats and that the nature of the repeat sequence and haplotype, as well as length of polyQ repeat, may play a role in the neurological effect conferred by expansions in ATXN2.

  5. Repeatability of peripheral aberrations in young emmetropes.

    Science.gov (United States)

    Baskaran, Karthikeyan; Theagarayan, Baskar; Carius, Staffan; Gustafsson, Jörgen

    2010-10-01

    The purpose of this study is to assess the intrasession repeatability of ocular aberration measurements in the peripheral visual field with a commercially available Shack-Hartmann aberrometer (complete ophthalmic analysis system-high definition-vision research). The higher-order off-axis aberrations data in young healthy emmetropic eyes are also reported. The aberrations of the right eye of 18 emmetropes were measured using an aberrometer with an open field of view that allows peripheral measurements. Five repeated measures of ocular aberrations were obtained and assessed in steps of 10° out to ±40° in the horizontal visual field (nasal + and temporal -) and -20° in the inferior visual field. The coefficient of repeatability, coefficient of variation, and the intraclass correlation coefficient were calculated as a measure of intrasession repeatability. In all eccentric angles, the repeatability of the third- and fourth-order aberrations was better than the fifth and sixth order aberrations. The coefficient of variation was coefficient was >0.90 for the third and fourth order but reduced gradually for higher orders. There was no statistical significant difference in variance of total higher-order root mean square between on- and off-axis measurements (p > 0.05). The aberration data in this group of young emmetropes showed that the horizontal coma (C(3)(1)) was most positive at 40° in the temporal field, decreasing linearly toward negative values with increasing off-axis angle into the nasal field, whereas all other higher-order aberrations showed little or no change. The complete ophthalmic analysis system-high definition-vision research provides fast, repeatable, and valid peripheral aberration measurements and can be used efficiently to measure off-axis aberrations in the peripheral visual field.

  6. Safety of Repeated Yttrium-90 Radioembolization

    Energy Technology Data Exchange (ETDEWEB)

    Lam, Marnix G. E. H.; Louie, John D. [Stanford University School of Medicine, Division of Interventional Radiology (United States); Iagaru, Andrei H.; Goris, Michael L. [Stanford University School of Medicine, Division of Nuclear Medicine (United States); Sze, Daniel Y., E-mail: dansze@stanford.edu [Stanford University School of Medicine, Division of Interventional Radiology (United States)

    2013-10-15

    Purpose: Repeated radioembolization (RE) treatments carry theoretically higher risk of radiation-induced hepatic injury because of the liver's cumulative memory of previous exposure. We performed a retrospective safety analysis on patients who underwent repeated RE. Methods: From 2004 to 2011, a total of 247 patients were treated by RE. Eight patients (5 men, 3 women, age range 51-71 years) underwent repeated treatment of a targeted territory, all with resin microspheres (SIR-Spheres; Sirtex, Lane Cove, Australia). Adverse events were graded during a standardized follow-up. In addition, the correlation between the occurrence of RE-induced liver disease (REILD) and multiple variables was investigated in univariate and multivariate analyses in all 247 patients who received RE. Results: Two patients died shortly after the second treatment (at 84 and 107 days) with signs and symptoms of REILD. Both patients underwent whole liver treatment twice (cumulative doses 3.08 and 2.66 GBq). The other 6 patients demonstrated only minor toxicities after receiving cumulative doses ranging from 2.41 to 3.88 GBq. All patients experienced objective tumor responses. In the whole population, multifactorial analysis identified three risk factors associated with REILD: repeated RE (p = 0.036), baseline serum total bilirubin (p = 0.048), and baseline serum aspartate aminotransferase (p = 0.043). Repeated RE proved to be the only independent risk factor for REILD in multivariate analysis (odds ratio 9.6; p = 0.002). Additionally, the administered activity per target volume (in GBq/L) was found to be an independent risk factor for REILD, but only in whole liver treatments (p = 0.033). Conclusion: The risk of REILD appears to be elevated for repeated RE. Objective tumor responses were observed, but establishment of safety limits will require improvement in dosimetric measurement and prediction.

  7. Repeat Gamma Knife Radiosurgery for Trigeminal Neuralgia

    Energy Technology Data Exchange (ETDEWEB)

    Aubuchon, Adam C., E-mail: acaubuchon@gmail.com [Department of Radiation Oncology, Wake Forest University School of Medicine, Winston-Salem, NC (United States); Chan, Michael D. [Department of Radiation Oncology, Wake Forest University School of Medicine, Winston-Salem, NC (United States); Lovato, James F. [Department of Public Health Sciences, Wake Forest University School of Medicine, Winston-Salem, NC (United States); Balamucki, Christopher J. [Department of Radiation Oncology, University of Florida, Gainesville, FL (United States); Ellis, Thomas L.; Tatter, Stephen B. [Department of Neurosurgery, Wake Forest University School of Medicine, Winston-Salem, NC (United States); McMullen, Kevin P.; Munley, Michael T.; Deguzman, Allan F.; Ekstrand, Kenneth E.; Bourland, J. Daniel; Shaw, Edward G. [Department of Radiation Oncology, Wake Forest University School of Medicine, Winston-Salem, NC (United States)

    2011-11-15

    Purpose: Repeat gamma knife stereotactic radiosurgery (GKRS) for recurrent or persistent trigeminal neuralgia induces an additional response but at the expense of an increased incidence of facial numbness. The present series summarized the results of a repeat treatment series at Wake Forest University Baptist Medical Center, including a multivariate analysis of the data to identify the prognostic factors for treatment success and toxicity. Methods and Materials: Between January 1999 and December 2007, 37 patients underwent a second GKRS application because of treatment failure after a first GKRS treatment. The mean initial dose in the series was 87.3 Gy (range, 80-90). The mean retreatment dose was 84.4 Gy (range, 60-90). The dosimetric variables recorded included the dorsal root entry zone dose, pons surface dose, and dose to the distal nerve. Results: Of the 37 patients, 81% achieved a >50% pain relief response to repeat GKRS, and 57% experienced some form of trigeminal dysfunction after repeat GKRS. Two patients (5%) experienced clinically significant toxicity: one with bothersome numbness and one with corneal dryness requiring tarsorraphy. A dorsal root entry zone dose at repeat treatment of >26.6 Gy predicted for treatment success (61% vs. 32%, p = .0716). A cumulative dorsal root entry zone dose of >84.3 Gy (72% vs. 44%, p = .091) and a cumulative pons surface dose of >108.5 Gy (78% vs. 44%, p = .018) predicted for post-GKRS numbness. The presence of any post-GKRS numbness predicted for a >50% decrease in pain intensity (100% vs. 60%, p = .0015). Conclusion: Repeat GKRS is a viable treatment option for recurrent trigeminal neuralgia, although the patient assumes a greater risk of nerve dysfunction to achieve maximal pain relief.

  8. Copy number of tandem direct repeats within the inverted repeats of Marek's disease virus DNA.

    Science.gov (United States)

    Kanamori, A; Nakajima, K; Ikuta, K; Ueda, S; Kato, S; Hirai, K

    1986-12-01

    We previously reported that DNA of the oncogenic strain BC-1 of Marek's disease virus serotype 1 (MDV1) contains three units of tandem direct repeats with 132 base pair (bp) repeats within the inverted repeats of the long regions of the MDV1 genome, whereas the attenuated, nononcogenic viral DNA contains multiple units of tandem direct repeats (Maotani et al., 1986). In the present study, the difference in the copy numbers of 132 bp repeats of oncogenic and nononcogenic MDV1 DNAs in other strains of MDV1 was investigated by Southern blot hybridization. The main copy numbers in different oncogenic MDV1 strains differed: those of BC-1, JM and highly oncogenic Md5 were 3, 5 to 12 and 2, respectively. The viral DNA population with two units of repeats was small, but detectable, in cells infected with either the oncogenic BC-1 or JM strain. The MDV1 DNA in various MD cell lines contained either two units or both two and three units of repeats. The significance of the copy number of repeats in oncogenicity of MDV1 is discussed.

  9. Leucine-rich repeat, immunoglobulin-like and transmembrane domain 3 (LRIT3) is a modulator of FGFR1

    NARCIS (Netherlands)

    Kim, S.D.; Liu, J.L.; Roscioli, T.; Buckley, M.F.; Yagnik, G.; Boyadjiev, S.A.; Kim, J.

    2012-01-01

    Fibroblast growth factor receptors (FGFRs) play critical roles in craniofacial and skeletal development via multiple signaling pathways including MAPK, PI3K/AKT, and PLC-?. FGFR-mediated signaling is modulated by several regulators. Proteins with leucine-rich repeat (LRR) and/or immunoglobulin (IG)

  10. [C-11]raclopride-PET studies of the Huntington's disease rate of progression : Relevance of the trinucleotide repeat length

    NARCIS (Netherlands)

    Antonini, A; Leenders, KL; Eidelberg, D

    1998-01-01

    We used [C-11]raclopride and positron emission tomography (PET) to assess the relationship between striatal dopamine D2 receptor binding, trinucleotide repeat number (GAG), and subject age in 10 asymptomatic and 8 symptomatic carriers of the Huntington's disease (HD) mutation. In both preclinical an

  11. Y Se Repite = And It Repeats Itself

    Science.gov (United States)

    Katzew, Adriana

    2010-01-01

    In this article, the author discusses Y Se Repite [And It Repeats Itself], a project she conceptualized due to the growing number of Latino/a Mexican migrant workers in dairy farms in the state of Vermont. In 2006, approximately 2,000 Latinos/as--most of them undocumented Mexican migrant workers--worked throughout the state's dairy farms, yet…

  12. Repeater For A Digital-Communication Bus

    Science.gov (United States)

    Torres-Guzman, Esteban; Olson, Stephen; Heaps, Tim

    1993-01-01

    Digital repeater circuit designed to extend range of communication on MIL-STD-1553 bus beyond original maximum allowable length of 300 ft. Circuit provides two-way communication, one way at time, and conforms to specifications of MIL-STD-1553. Crosstalk and instability eliminated.

  13. Episodes of repeated sudden deafness following pregnancies.

    Science.gov (United States)

    Pawlak-Osinska, Katarzyna; Burduk, Pawel K; Kopczynski, Andrzej

    2009-04-01

    Sex hormones influence and provoke changes in hearing levels. Sudden deafness is rarely observed in pregnant women. The effective treatment of sudden deafness in pregnant women is a challenging problem. We present a case of repeatable, completely regressed sudden deafness in a woman during her first and second pregnancies.

  14. Repeated sprint training in normobaric hypoxia.

    Science.gov (United States)

    Galvin, Harvey M; Cooke, Karl; Sumners, David P; Mileva, Katya N; Bowtell, Joanna L

    2013-12-01

    Repeated sprint ability (RSA) is a critical success factor for intermittent sport performance. Repeated sprint training has been shown to improve RSA, we hypothesised that hypoxia would augment these training adaptations. Thirty male well-trained academy rugby union and rugby league players (18.4 ± 1.5 years, 1.83 ± 0.07 m, 88.1 ± 8.9 kg) participated in this single-blind repeated sprint training study. Participants completed 12 sessions of repeated sprint training (10 × 6 s, 30 s recovery) over 4 weeks in either hypoxia (13% FiO₂) or normoxia (21% FiO₂). Pretraining and post-training, participants completed sports specific endurance and sprint field tests and a 10 × 6 s RSA test on a non-motorised treadmill while measuring speed, heart rate, capillary blood lactate, muscle and cerebral deoxygenation and respiratory measures. Yo-Yo Intermittent Recovery Level 1 test performance improved after RS training in both groups, but gains were significantly greater in the hypoxic (33 ± 12%) than the normoxic group (14 ± 10%, prepeated aerobic high intensity workout than an equivalent normoxic training. Performance gains are evident in the short term (4 weeks), a period similar to a preseason training block.

  15. Adaptation and complexity in repeated games

    DEFF Research Database (Denmark)

    Maenner, Eliot Alexander

    2008-01-01

    The paper presents a learning model for two-player infinitely repeated games. In an inference step players construct minimally complex inferences of strategies based on observed play, and in an adaptation step players choose minimally complex best responses to an inference. When players randomly ...

  16. A Structured Group Program for Repeat Dieters.

    Science.gov (United States)

    McNamara, Kathleen

    1989-01-01

    Describes a structured group program for women who repeatedly diet and may be at risk of developing more serious eating disorders. Discusses sessions focusing on eating behavior as well as internal factors that contribute to low body esteem and food and weight preoccupation. Evaluates effectiveness of program by self-reports of members of two…

  17. Why Do Students Repeat Admissions Tests?

    Science.gov (United States)

    Jones, Martha S.

    Attitudes and beliefs about the admissions process, especially the role of standardized testing in admissions, were examined for students who took a standardized admissions test more than once. Their attitudes were compared with those of students who did not repeat the test. About 200 preveterinary students who had taken the Veterinary Aptitude…

  18. The Effect of Repeaters on Equating

    Science.gov (United States)

    Kim, HeeKyoung; Kolen, Michael J.

    2010-01-01

    Test equating might be affected by including in the equating analyses examinees who have taken the test previously. This study evaluated the effect of including such repeaters on Medical College Admission Test (MCAT) equating using a population invariance approach. Three-parameter logistic (3-PL) item response theory (IRT) true score and…

  19. Triggering of repeating earthquakes in central California

    Science.gov (United States)

    Wu, Chunquan; Gomberg, Joan; Ben-Naim, Eli; Johnson, Paul

    2014-01-01

    Dynamic stresses carried by transient seismic waves have been found capable of triggering earthquakes instantly in various tectonic settings. Delayed triggering may be even more common, but the mechanisms are not well understood. Catalogs of repeating earthquakes, earthquakes that recur repeatedly at the same location, provide ideal data sets to test the effects of transient dynamic perturbations on the timing of earthquake occurrence. Here we employ a catalog of 165 families containing ~2500 total repeating earthquakes to test whether dynamic perturbations from local, regional, and teleseismic earthquakes change recurrence intervals. The distance to the earthquake generating the perturbing waves is a proxy for the relative potential contributions of static and dynamic deformations, because static deformations decay more rapidly with distance. Clear changes followed the nearby 2004 Mw6 Parkfield earthquake, so we study only repeaters prior to its origin time. We apply a Monte Carlo approach to compare the observed number of shortened recurrence intervals following dynamic perturbations with the distribution of this number estimated for randomized perturbation times. We examine the comparison for a series of dynamic stress peak amplitude and distance thresholds. The results suggest a weak correlation between dynamic perturbations in excess of ~20 kPa and shortened recurrence intervals, for both nearby and remote perturbations.

  20. A Repeater in the Language Laboratory

    Science.gov (United States)

    Griffiths, B. T.

    1969-01-01

    Discusses the feasilility of the use of repeater devices in the language laboratory in order to enable the student to "recapitulate effortlessly and and indefinitely any utterance of any length which is causing him difficulty or is of special interest. (FWB)

  1. The Differential Effects of Repeating Kindergarten

    Science.gov (United States)

    Burkam, David T.; LoGerfo, Laura; Ready, Doug; Lee, Valerie E.

    2007-01-01

    We use the Early Childhood Longitudinal Study to investigate national patterns addressing (a) who repeats kindergarten, and (b) the subsequent cognitive effects of this event. Using OLS regression techniques, we investigate 1st-time kindergartners who are promoted, 1st-time kindergartners who are retained, and children who are already repeating…

  2. Preventing Repeat Teen Births PSA (:60)

    Centers for Disease Control (CDC) Podcasts

    2013-04-02

    This 60 second public service announcement is based on the April 2013 CDC Vital Signs report, which discusses repeat teen births and ways teens, parents and guardians, health care providers, and communities can help prevent them.  Created: 4/2/2013 by Centers for Disease Control and Prevention (CDC).   Date Released: 4/2/2013.

  3. Epigenetics and triplet repeat neurological diseases

    Directory of Open Access Journals (Sweden)

    Sathiji eNageshwaran

    2015-12-01

    Full Text Available The term ‘junk DNA’ has been reconsidered following the delineation of the functional significance of repetitive DNA regions. Typically associated with centromeres and telomeres, DNA repeats are found in nearly all organisms throughout their genomes. Repetitive regions are frequently heterchromatinised resulting in silencing of intrinsic and nearby genes. However, this is not a uniform rule, with several genes known to require such an environment to permit transcription. Repetitive regions frequently exist as dinucleotide, trinucleotide and tetranucleotide repeats. The association between repetitive regions and disease was emphasised following the discovery of abnormal trinucleotide repeats underlying spinal and bulbar muscular atrophy (Kennedy’s disease and fragile X syndrome of mental retardation (FRAXA in 1991. In this review we provide a brief overview of epigenetic mechanisms and then focus on several diseases caused by DNA triplet-repeat expansions, which exhibit diverse epigenetic effects. It is clear that the emerging field of epigenetics is already generating novel potential therapeutic avenues for this group of largely incurable diseases.

  4. Costly renegotiation in repeated Bertand games

    DEFF Research Database (Denmark)

    Andersson, Ola; Wengström, Erik Roland

    2010-01-01

    This paper extends the concept of weak renegotiation-proof equilibrium (WRP) to allow for costly renegotiation and shows that even small renegotiation costs can have dramatic effects on the set of equilibria. More specifically, the paper analyzes the infinitely repeated Bertrand game. It is shown...

  5. EVOLUTION AND RECOMBINATION OF BOVINE DNA REPEATS

    NARCIS (Netherlands)

    JOBSE, C; BUNTJER, JB; HAAGSMA, N; BREUKELMAN, HJ; BEINTEMA, JJ; LENSTRA, JA

    The history of the abundant repeat elements in the bovine genome has been studied by comparative hybridization and PCR. The Bov-A and Bov-B SINE elements both emerged just after the divergence of the Camelidae and the true ruminants. A 31-bp subrepeat motif in satellites of the Bovidae species

  6. Building Fluency through the Repeated Reading Method

    Science.gov (United States)

    Cohen, Joshua

    2011-01-01

    For the last two years the author has used Repeated Reading (RR) to teach reading fluency in English as a Foreign Language classrooms in colleges and universities in Japan. RR is a method where the student reads and rereads a text silently or aloud from two to four times to reach a predetermined level of speed, accuracy, and comprehension. RR…

  7. History repeats itself: genomic divergence in copepods.

    Science.gov (United States)

    Renaut, Sébastien; Dion-Côté, Anne-Marie

    2016-04-01

    Press stop, erase everything from now till some arbitrary time in the past and start recording life as it evolves once again. Would you see the same tape of life playing itself over and over, or would a different story unfold every time? The late Steven Jay Gould called this experiment replaying the tape of life and argued that any replay of the tape would lead evolution down a pathway radically different from the road actually taken (Gould 1989). This thought experiment has puzzled evolutionary biologists for a long time: how repeatable are evolutionary events? And if history does indeed repeat itself, what are the factors that may help us predict the path taken? A powerful means to address these questions at a small evolutionary scale is to study closely related populations that have evolved independently, under similar environmental conditions. This is precisely what Pereira et al. (2016) set out to do using marine copepods Tigriopus californicus, and present their results in this issue of Molecular Ecology. They show that evolution can be repeatable and even partly predictable, at least at the molecular level. As expected from theory, patterns of divergence were shaped by natural selection. At the same time, strong genetic drift due to small population sizes also constrained evolution down a similar evolutionary road, and probably contributed to repeatable patterns of genomic divergence.

  8. Costly renegotiation in repeated Bertand games

    DEFF Research Database (Denmark)

    Andersson, Ola; Wengström, Erik Roland

    2010-01-01

    This paper extends the concept of weak renegotiation-proof equilibrium (WRP) to allow for costly renegotiation and shows that even small renegotiation costs can have dramatic effects on the set of equilibria. More specifically, the paper analyzes the infinitely repeated Bertrand game. It is shown...

  9. Photometric Repeatability of Scanned Imagery: UVIS

    Science.gov (United States)

    Shanahan, Clare E.; McCullough, Peter; Baggett, Sylvia

    2017-08-01

    We provide the preliminary results of a study on the photometric repeatability of spatial scans of bright, isolated white dwarf stars with the UVIS channel of the Wide Field Camera 3 (WFC3) on the Hubble Space Telescope (HST). We analyze straight-line scans from the first pair of identical orbits of HST program 14878 to assess if sub 0.1% repeatability can be attained with WFC3/UVIS. This study is motivated by the desire to achieve better signal-to-noise in the UVIS contamination and stability monitor, in which observations of standard stars in staring mode have been taken from the installation of WFC3 in 2009 to the present to assess temporal photometric stability. Higher signal to noise in this program would greatly benefit the sensitivity to detect contamination, and to better characterize the observed small throughput drifts over time. We find excellent repeatability between identical visits of program 14878, with sub 0.1% repeatability achieved in most filters. These! results support the initiative to transition the staring mode UVIS contamination and photometric stability monitor from staring mode images to spatial scans.

  10. Repeat surgery after failed midurethral slings

    DEFF Research Database (Denmark)

    Foss Hansen, Margrethe; Lose, Gunnar; Kesmodel, Ulrik Schiøler

    2016-01-01

    MUS from 1998 through 2007. The outcome was repeat surgery with any subsequent procedure code for urinary incontinence within a 5-year period of the first procedure. RESULTS: A total of 5,820 women (mean age 55.4 years, ± 12.1) were registered with a synthetic MUS, and 354 (6 %) underwent reoperation...

  11. EVOLUTION AND RECOMBINATION OF BOVINE DNA REPEATS

    NARCIS (Netherlands)

    JOBSE, C; BUNTJER, JB; HAAGSMA, N; BREUKELMAN, HJ; BEINTEMA, JJ; LENSTRA, JA

    1995-01-01

    The history of the abundant repeat elements in the bovine genome has been studied by comparative hybridization and PCR. The Bov-A and Bov-B SINE elements both emerged just after the divergence of the Camelidae and the true ruminants. A 31-bp subrepeat motif in satellites of the Bovidae species cattl

  12. Multivariate linear models and repeated measurements revisited

    DEFF Research Database (Denmark)

    Dalgaard, Peter

    2009-01-01

    Methods for generalized analysis of variance based on multivariate normal theory have been known for many years. In a repeated measurements context, it is most often of interest to consider transformed responses, typically within-subject contrasts or averages. Efficiency considerations leads...

  13. On balanced minimal repeated measurements designs

    Directory of Open Access Journals (Sweden)

    Shakeel Ahmad Mir

    2014-10-01

    Full Text Available Repeated Measurements designs are concerned with scientific experiments in which each experimental unit is assigned more than once to a treatment either different or identical. This class of designs has the property that the unbiased estimators for elementary contrasts among direct and residual effects are obtainable. Afsarinejad (1983 provided a method of constructing balanced Minimal Repeated Measurements designs p < t , when t is an odd or prime power, one or more than one treatment may occur more than once in some sequences and  designs so constructed no longer remain uniform in periods. In this paper an attempt has been made to provide a new method to overcome this drawback. Specifically, two cases have been considered                RM[t,n=t(t-t/(p-1,p], λ2=1 for balanced minimal repeated measurements designs and  RM[t,n=2t(t-t/(p-1,p], λ2=2 for balanced  repeated measurements designs. In addition , a method has been provided for constructing              extra-balanced minimal designs for special case RM[t,n=t2/(p-1,p], λ2=1.

  14. Meta-analysis of relationship between androgen receptor CAG repeats length polymorphism and the polycystic ovary syndrome%雄激素受体(CAG)n基因多态性与多囊卵巢综合征相关性的Meta分析

    Institute of Scientific and Technical Information of China (English)

    余瑞梅; 邱娜璇; 陈春敏

    2015-01-01

    目的 评价雄激素受体(androgen receptor,AR) (CAG)n基因多态性与多囊卵巢综合征(polycystic ovary syndrome,PCOS)易感性的相关性.方法 检索Pubmed、Embase、CNKI、VIP、万方数据库,英文检索词为androgen receptor,polycystic ovarian syndrome,中文检索词为雄激素受体和多囊卵巢综合征,收集有关AR (CAG)n基因多态性与PCOS易感性的病例对照研究,进行Meta分析.结果 共纳入12篇文献,PCOS组1 697例,对照组(健康女性)1 984例.Meta分析结果显示,PCOS组与对照组间AR (CAG)n重复序列长度比较,差异无统计学意义[标准化均数差(SMD)=-0.05,95%CI:-0.19~0.08,P=0.440].PCOS患者中,高雄激素血症(hyperandrogenism,HA)患者与非HA患者间AR (CAG)n重复序列长度比较,差异无统计学意义(SMD=0.56,95%CI:-0.13~1.25,P=0.110).结论 AR (CAG)n基因多态性可能与P-COS及其并发的高雄激素血症的发生无关联.

  15. RepeatsDB 2.0: improved annotation, classification, search and visualization of repeat protein structures

    Science.gov (United States)

    Paladin, Lisanna; Hirsh, Layla; Piovesan, Damiano; Andrade-Navarro, Miguel A.; Kajava, Andrey V.; Tosatto, Silvio C.E.

    2017-01-01

    RepeatsDB 2.0 (URL: http://repeatsdb.bio.unipd.it/) is an update of the database of annotated tandem repeat protein structures. Repeat proteins are a widespread class of non-globular proteins carrying heterogeneous functions involved in several diseases. Here we provide a new version of RepeatsDB with an improved classification schema including high quality annotations for ∼5400 protein structures. RepeatsDB 2.0 features information on start and end positions for the repeat regions and units for all entries. The extensive growth of repeat unit characterization was possible by applying the novel ReUPred annotation method over the entire Protein Data Bank, with data quality is guaranteed by an extensive manual validation for >60% of the entries. The updated web interface includes a new search engine for complex queries and a fully re-designed entry page for a better overview of structural data. It is now possible to compare unit positions, together with secondary structure, fold information and Pfam domains. Moreover, a new classification level has been introduced on top of the existing scheme as an independent layer for sequence similarity relationships at 40%, 60% and 90% identity. PMID:27899671

  16. Opioid Receptors.

    Science.gov (United States)

    Stein, Christoph

    2016-01-01

    Opioids are the oldest and most potent drugs for the treatment of severe pain. Their clinical application is undisputed in acute (e.g., postoperative) and cancer pain, but their long-term use in chronic pain has met increasing scrutiny. This article reviews mechanisms underlying opioid analgesia and other opioid actions. It discusses the structure, function, and plasticity of opioid receptors; the central and peripheral sites of analgesic actions and side effects; endogenous and exogenous opioid receptor ligands; and conventional and novel opioid compounds. Challenging clinical situations, such as the tension between chronic pain and addiction, are also illustrated.

  17. 47 CFR 80.1179 - On-board repeater limitations.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false On-board repeater limitations. 80.1179 Section... On-board repeater limitations. When an on-board repeater is used, the following limitations must be met: (a) The on-board repeater antenna must be located no higher than 3 meters (10 feet) above...

  18. A study of allelic polymorphism of four short tandem repeats in the population of northwestern Russia

    Energy Technology Data Exchange (ETDEWEB)

    Aseev, M.V.; Skakun, V.N.; Baranov, V.S. [Ott Institute of Obstetrics and Gynecology, St. Petersburg (Russian Federation)

    1995-06-01

    Characteristics of the allelic polymorphisms of the trimeric AGC repeat of the androgen receptor gene (Xq11-12), exon 1 (AR); the tetrameric ATCT repeat of the von Willebrand factor gene (12p12), intron 40 (vWF); the AGAT repeat of the hypoxanthine phosphoribosyltransferase gene (Xq26) (HPRT); and the AGAT repeat of anonymous DNA sequences of the short arm of chromosome X (STRX1) were studied in 160 DNA samples from unrelated inhabitants of northwestern Russia using the method of polymerase chain reaction. Seventeen, ten, eight, and nine alleles were revealed electrophoretically for short tandem repeats of AR, vWF, HPRT, and STRX1, respectively. The heterozygosity indices for these repeats were 0.80, 0.70, 0.54, and 0.58, respectively. The values for AR and vWF correlated with those expected according to the Hardy-Weinberg equilibrium, whereas the values for HPRT and STRX1 differed significantly from those theoretically expected. The individualization potentials were 0.045, 0.135, 0.095, and 0.061 for the short tandem repeats of AR, vWF, HPRT, and STRX1, respectively. The distribution of genotypes for the set of these four loci in the population studied was determined. The possibilities of using the studied polymorphic marker systems in molecular diagnosis of the corresponding monogenic diseases - spinal and bulbar muscle atrophy (AR), Lesch-Nyhan disease (HPRT), and von Willebrand disease (vWF) - as well as in population human genetics, testing of personal identity, and molecular approaches to the estimation of mutagenic activity are discussed. 17 refs., 2 figs., 6 tabs.

  19. Repeated predictable stress causes resilience against colitis-induced behavioral changes in mice

    Science.gov (United States)

    Hassan, Ahmed M.; Jain, Piyush; Reichmann, Florian; Mayerhofer, Raphaela; Farzi, Aitak; Schuligoi, Rufina; Holzer, Peter

    2014-01-01

    Inflammatory bowel disease is associated with an increased risk of mental disorders and can be exacerbated by stress. In this study which was performed with male 10-week old C57Bl/6N mice, we used dextran sulfate sodium (DSS)-induced colitis to evaluate behavioral changes caused by intestinal inflammation, to assess the interaction between repeated psychological stress (water avoidance stress, WAS) and colitis in modifying behavior, and to analyze neurochemical correlates of this interaction. A 7-day treatment with DSS (2% in drinking water) decreased locomotion and enhanced anxiety-like behavior in the open field test and reduced social interaction. Repeated exposure to WAS for 7 days had little influence on behavior but prevented the DSS-induced behavioral disturbances in the open field and SI tests. In contrast, repeated WAS did not modify colon length, colonic myeloperoxidase content and circulating proinflammatory cytokines, parameters used to assess colitis severity. DSS-induced colitis was associated with an increase in circulating neuropeptide Y (NPY), a rise in the hypothalamic expression of cyclooxygenase-2 mRNA and a decrease in the hippocampal expression of NPY mRNA, brain-derived neurotrophic factor mRNA and mineralocorticoid receptor mRNA. Repeated WAS significantly decreased the relative expression of corticotropin-releasing factor mRNA in the hippocampus. The effect of repeated WAS to blunt the DSS-evoked behavioral disturbances was associated with a rise of circulating corticosterone and an increase in the expression of hypothalamic NPY mRNA. These results show that experimental colitis leads to a particular range of behavioral alterations which can be prevented by repeated WAS, a model of predictable chronic stress, while the severity of colitis remains unabated. We conclude that the mechanisms underlying the resilience effect of repeated WAS involves hypothalamic NPY and the hypothalamic-pituitary-adrenal axis. PMID:25414650

  20. Repeated Predictable Stress Causes Resilience against Colitis-Induced Behavioral Changes in Mice

    Directory of Open Access Journals (Sweden)

    Ahmed M Hassan

    2014-11-01

    Full Text Available Inflammatory bowel disease is associated with an increased risk of mental disorders and can be exacerbated by stress. In this study which was performed with male 10-week old C57Bl/6N mice, we used dextran sulfate sodium (DSS-induced colitis to evaluate behavioral changes caused by intestinal inflammation, to assess the interaction between repeated psychological stress (water avoidance stress, WAS and colitis in modifying behavior, and to analyze neurochemical correlates of this interaction. A 7-day treatment with DSS (2 % in drinking water decreased locomotion and enhanced anxiety-like behavior in the open field test and reduced social interaction. Repeated exposure to WAS for 7 days had little influence on behavior but prevented the DSS-induced behavioral disturbances in the open field and social interaction tests. In contrast, repeated WAS did not modify colon length, colonic myeloperoxidase content and circulating proinflammatory cytokines, parameters used to assess colitis severity. DSS-induced colitis was associated with an increase in circulating neuropeptide Y (NPY, a rise in the hypothalamic expression of cyclooxygenase-2 mRNA and a decrease in the hippocampal expression of NPY mRNA, brain-derived neurotrophic factor mRNA and mineralocorticoid receptor mRNA. Repeated WAS significantly decreased the relative expression of corticotropin-releasing factor mRNA in the hippocampus. The effect of repeated WAS to blunt the DSS-evoked behavioral disturbances was associated with a rise of circulating corticosterone and an increase in the expression of hypothalamic NPY mRNA. These results show that experimental colitis leads to a particular range of behavioral alterations which can be prevented by repeated WAS, a model of predictable chronic stress, while the severity of colitis remains unabated. We conclude that the mechanisms underlying the resilience effect of repeated WAS involves hypothalamic NPY and the hypothalamic-pituitary-adrenal axis.

  1. Repeated administration of imipramine modifies GABAergic transmission in rat frontal cortex.

    Science.gov (United States)

    Wabno, Joanna; Hess, Grzegorz

    2013-05-01

    Alterations in the functions of brain gamma-aminobutyric acid (GABA) inhibitory system and a distortion in the balance between excitatory and inhibitory synaptic transmission have been hypothesized to be possible causes of mood disorders. Experimental evidence points to modifications of GABAergic transmission as a result of prolonged treatment with antidepressant drugs, however, the influence of the tricyclic antidepressant imipramine on inhibitory synaptic transmission in the rat cerebral cortex has not yet been investigated. Therefore, in the present study the effects of single and repeated administration of imipramine were evaluated ex vivo in slices of the rat frontal cortex using electrophysiological approach. In slices prepared 2 days after the last drug administration from animals receiving imipramine for 14 days (dose 10 mg/kg p.o., twice daily) the mean frequency of spontaneous inhibitory postsynaptic currents (sIPSCs) recorded from layer II/III pyramidal neurons was decreased, while the mean amplitude of sIPSCs was increased. These effects were absent in slices obtained from rats which received imipramine once. Application of N,N'-dibenzhydrylethane-1,2-diamine dihydrochloride (AMN 082), a selective mGluR7 allosteric agonist, to the slice incubation medium resulted in a decrease in the mean frequency of sIPSCs in preparations obtained from repeated imipramine-treated animals, in contrast to slices originating from control rats where no AMN 082-induced effects were observed. Repeated imipramine treatment reduced protein density levels of the three tested GABAA receptor subunits: α 1, β 2 and γ 2. These data indicate that repeated treatment of normal rats with imipramine results in a modification of the release mechanism of GABA from presynaptic terminals and its modulation by mGluR7 receptors as well as in an alteration in GABAA receptor subunit protein levels in the rat cerebral cortex.

  2. Stability of dental waxes following repeated heatings.

    Science.gov (United States)

    Kotsiomiti, E; McCabe, J F

    1995-02-01

    The flow and strength properties of dental waxes were examined following excessive and repeated heatings of the materials. For one product, the flow at 40 +/- 0.5 degrees C was reduced by 25.3% following heating above 200 degrees C. A decrease of the elastic modulus at 20 +/- 1 degree C by approximately 66% was observed in some cases after the heating temperature had been increased to 300 degrees C. Property variations were related to compositional changes, which were investigated by infrared spectoscopy and thermal analysis. Exposure of dental waxes to temperatures higher than 200 degrees C, particularly if it is repeated, may affect the composition and properties, resulting in inferior materials.

  3. Learning with repeated-game strategies.

    Science.gov (United States)

    Ioannou, Christos A; Romero, Julian

    2014-01-01

    We use the self-tuning Experience Weighted Attraction model with repeated-game strategies as a computer testbed to examine the relative frequency, speed of convergence and progression of a set of repeated-game strategies in four symmetric 2 × 2 games: Prisoner's Dilemma, Battle of the Sexes, Stag-Hunt, and Chicken. In the Prisoner's Dilemma game, we find that the strategy with the most occurrences is the "Grim-Trigger." In the Battle of the Sexes game, a cooperative pair that alternates between the two pure-strategy Nash equilibria emerges as the one with the most occurrences. In the Stag-Hunt and Chicken games, the "Win-Stay, Lose-Shift" and "Grim-Trigger" strategies are the ones with the most occurrences. Overall, the pairs that converged quickly ended up at the cooperative outcomes, whereas the ones that were extremely slow to reach convergence ended up at non-cooperative outcomes.

  4. Learning With Repeated-Game Strategies

    Directory of Open Access Journals (Sweden)

    Christos A. Ioannou

    2014-07-01

    Full Text Available We use the self-tuning Experience Weighted Attraction model with repeated-game strategies as a computer testbed to examine the relative frequency, speed of convergence and progression of a set of repeated-game strategies in four symmetric 2x2 games: Prisoner's Dilemma, Battle of the Sexes, Stag-Hunt, and Chicken. In the Prisoner's Dilemma game, we fi□nd that the strategy with the most occurrences is the Grim-Trigger. In the Battle of the Sexes game, a cooperative pair that alternates between the two pure-strategy Nash equilibria emerges as the one with the most occurrences. In the Stag-Hunt and Chicken games, the Win-Stay, Lose-Shift and Grim-Trigger strategies are the ones with the most occurrences. Overall, the pairs that converged quickly ended up at the cooperative outcomes, whereas the ones that were extremely slow to reach convergence ended up at non-cooperative outcomes.

  5. Quantum repeaters with entangled coherent states

    CERN Document Server

    Sangouard, Nicolas; Gisin, Nicolas; Laurat, Julien; Tualle-Brouri, Rosa; Grangier, Philippe

    2009-01-01

    Entangled coherent states can be prepared remotely by subtracting non-locally a single photon from two quantum superpositions of coherent states, the so-called "Schroedinger's cat" state. Such entanglement can further be distributed over longer distances by successive entanglement swapping operations using linear optics and photon-number resolving detectors. The aim of this paper is to evaluate the performance of this approach to quantum repeaters for long distance quantum communications. Despite many attractive features at first sight, we show that, when using state-of-the-art photon counters and quantum memories, they do not achieve higher entanglement generation rates than repeaters based on single-photon entanglement. We discuss potential developments which may take better advantage of the richness of entanglement based on continuous variables, including in particular efficient parity measurements.

  6. Quantum repeaters based on heralded qubit amplifiers

    CERN Document Server

    Minář, Jiří; Sangouard, Nicolas

    2011-01-01

    We present a quantum repeater scheme based on the recently proposed qubit amplifier [N. Gisin, S. Pironio and N. Sangouard, Phys. Rev. Lett. 105, 070501 (2010)]. It relies on a on-demand entangled-photon pair source which uses on-demand single-photon sources, linear optical elements and atomic ensembles. Interestingly, the imperfections affecting the states created from this source, caused e.g. by detectors with non-unit efficiencies, are systematically purified from an entanglement swapping operation based on a two-photon detection. This allows the distribution of entanglement over very long distances with a high fidelity, i.e. without vacuum components and multiphoton errors. Therefore, the resulting quantum repeater architecture does not necessitate final postselections and thus achieves high entanglement distribution rates. This also provides unique opportunities for device-independent quantum key distribution over long distances with linear optics and atomic ensembles.

  7. Nonparametric additive regression for repeatedly measured data

    KAUST Repository

    Carroll, R. J.

    2009-05-20

    We develop an easily computed smooth backfitting algorithm for additive model fitting in repeated measures problems. Our methodology easily copes with various settings, such as when some covariates are the same over repeated response measurements. We allow for a working covariance matrix for the regression errors, showing that our method is most efficient when the correct covariance matrix is used. The component functions achieve the known asymptotic variance lower bound for the scalar argument case. Smooth backfitting also leads directly to design-independent biases in the local linear case. Simulations show our estimator has smaller variance than the usual kernel estimator. This is also illustrated by an example from nutritional epidemiology. © 2009 Biometrika Trust.

  8. Repeat-PPM Super-Symbol Synchronization

    Science.gov (United States)

    Connelly, J.

    2016-11-01

    To attain a wider range of data rates in pulse position modulation (PPM) schemes with constrained pulse durations, the sender can repeat a PPM symbol multiple times, forming a super-symbol. In addition to the slot and symbol synchronization typically required for PPM, the receiver must also properly align the noisy super-symbols. We present a low-complexity approximation of the maximum-likelihood method for performing super-symbol synchronization without use of synchronization sequences. We provide simulation results demonstrating performance advantage when PPM symbols are spread by a pseudo-noise sequence, as opposed to simply repeating. Additionally, the results suggest that this super-symbol synchronization technique requires signal levels below those required for reliable communication. This validates that the PPM spreading approach proposed to CCSDS can work properly as part of the overall scheme.

  9. High-bandwidth hybrid quantum repeater.

    Science.gov (United States)

    Munro, W J; Van Meter, R; Louis, Sebastien G R; Nemoto, Kae

    2008-07-25

    We present a physical- and link-level design for the creation of entangled pairs to be used in quantum repeater applications where one can control the noise level of the initially distributed pairs. The system can tune dynamically, trading initial fidelity for success probability, from high fidelity pairs (F=0.98 or above) to moderate fidelity pairs. The same physical resources that create the long-distance entanglement are used to implement the local gates required for entanglement purification and swapping, creating a homogeneous repeater architecture. Optimizing the noise properties of the initially distributed pairs significantly improves the rate of generating long-distance Bell pairs. Finally, we discuss the performance trade-off between spatial and temporal resources.

  10. Effects of acute versus repeated cocaine exposure on the expression of endocannabinoid signaling-related proteins in the mouse cerebellum

    Directory of Open Access Journals (Sweden)

    Ana ePalomino

    2014-03-01

    Full Text Available Growing awareness of cerebellar involvement in addiction is based on the cerebellum’s intermediary position between motor and reward, potentially acting as an interface between motivational and cognitive functions. Here, we examined the impact of acute and repeated cocaine exposure on the two main signaling systems in the mouse cerebellum: the endocannabinoid (eCB and glutamate systems. To this end, we investigated whether eCB signaling-related gene and protein expression (CB1 receptors and enzymes that produce (DAGLα/β and NAPE-PLD and degrade (MAGL and FAAH eCB were altered. In addition, we analyzed the gene expression of relevant components of the glutamate signaling system (glutamate synthesizing enzymes LGA and KGA, mGluR3/5 metabotropic receptors, and NR1/2A/2B/2C-NMDA and GluR1/2/3/4-AMPA ionotropic receptor subunits and the gene expression of tyrosine hydroxylase (TH, the rate-limiting enzyme in catecholamine biosynthesis, because noradrenergic terminals innervate the cerebellar cortex. Results indicated that acute cocaine exposure decreased DAGLα expression, suggesting a down-regulation of 2-AG production, as well as gene expression of TH, KGA, mGluR3 and all ionotropic receptor subunits analyzed in the cerebellum. The acquisition of conditioned locomotion and sensitization after repeated cocaine exposure were associated with an increased NAPE-PLD/FAAH ratio, suggesting enhanced anandamide production, and a decreased DAGLβ/MAGL ratio, suggesting decreased 2-AG generation. Repeated cocaine also increased LGA gene expression but had no effect on glutamate receptors. These findings indicate that acute cocaine modulates the expression of the eCB and glutamate systems. Repeated cocaine results in normalization of glutamate receptor expression, although sustained changes in eCB is observed. We suggest that cocaine-induced alterations to cerebellar eCB should be considered when analyzing the adaptations imposed by psychostimulants that

  11. Do Gamma-Ray Burst Sources Repeat?

    OpenAIRE

    Meegan, Charles A.; Hartmann, Dieter H.; Brainerd, J. J.; Briggs, Michael S.; Paciesas, William S.; Pendleton, Geoffrey; Kouveliotou, Chryssa; Fishman, Gerald; Blumenthal, George; Brock, Martin

    1995-01-01

    The demonstration of repeated gamma-ray bursts from an individual source would severely constrain burst source models. Recent reports (Quashnock and Lamb 1993; Wang and Lingenfelter 1993) of evidence for repetition in the first BATSE burst catalog have generated renewed interest in this issue. Here, we analyze the angular distribution of 585 bursts of the second BATSE catalog (Meegan et al. 1994). We search for evidence of burst recurrence using the nearest and farthest neighbor statistic and...

  12. 2D Metals by Repeated Size Reduction.

    Science.gov (United States)

    Liu, Hanwen; Tang, Hao; Fang, Minghao; Si, Wenjie; Zhang, Qinghua; Huang, Zhaohui; Gu, Lin; Pan, Wei; Yao, Jie; Nan, Cewen; Wu, Hui

    2016-10-01

    A general and convenient strategy for manufacturing freestanding metal nanolayers is developed on large scale. By the simple process of repeatedly folding and calendering stacked metal sheets followed by chemical etching, free-standing 2D metal (e.g., Ag, Au, Fe, Cu, and Ni) nanosheets are obtained with thicknesses as small as 1 nm and with sizes of the order of several micrometers.

  13. Repeatability and Workability Evaluation of SIGMOD 2011

    DEFF Research Database (Denmark)

    Bonnet, Philippe

    2011-01-01

    SIGMOD has offered, since 2008, to verify the experiments published in the papers accepted at the conference. This year, we have been in charge of reproducing the experiments provided by the authors (repeatability), and exploring changes to experiment parameters (workability). In this paper, we a...... find that most experiments are distributed as Linux packages accompanied by instructions on how to setup and run the experiments. We are still far from the vision of executable papers...

  14. Repeatability of Response to Asthma Medications

    Science.gov (United States)

    Wu, Ann; Tantisira, Kelan; Li, Lingling; Schuemann, Brooke; Weiss, Scott

    2010-01-01

    Background Pharmacogenetic studies of drug response in asthma assume that patients respond consistently to a treatment but that treatment response varies across patients, however, no formal studies have demonstrated this. Objective To determine the repeatability of commonly used outcomes for treatment response to asthma medications: bronchodilator response, forced expiratory volume in 1 second (FEV1), and provocative concentration of methacholine producing a 20% decline in FEV1 (PC20). Methods The Childhood Asthma Management Program (CAMP) was a multi-center clinical trial of children randomized to receiving budesonide, nedocromil, or placebo. We determined the intraclass correlation coefficient (ICC) for each outcome over repeated visits over four years in CAMP using mixed effects regression models. We adjusted for the covariates: age, race/ethnicity, height, family income, parental education, and symptom score. We incorporated each outcome for each child as repeated outcome measurements and stratified by treatment group. Results The ICC for bronchodilator response was 0.31 in the budesonide group, 0.35 in the nedocromil group, and 0.40 in the placebo group, after adjusting for covariates. The ICC for FEV1 was 0.71 in the budesonide group, 0.60 in the nedocromil group, and 0.69 in the placebo group, after adjusting for covariates. The ICC for PC20 was 0.67 in the budesonide and placebo groups and 0.73 in the nedocromil group, after adjusting for covariates. Conclusion The within treatment group repeatability of FEV1 and PC20 are high; thus these phenotypes are heritable. FEV1 and PC20 may be better phenotypes than bronchodilator response for studies of treatment response in asthma. PMID:19064281

  15. Repeated extraction of DNA from FTA cards

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Ferrero, Laura; Børsting, Claus

    2011-01-01

    Extraction of DNA using magnetic bead based techniques on automated DNA extraction instruments provides a fast, reliable and reproducible method for DNA extraction from various matrices. However, the yield of extracted DNA from FTA-cards is typically low. Here, we demonstrate that it is possible...... to repeatedly extract DNA from the processed FTA-disk. The method increases the yield from the nanogram range to the microgram range....

  16. Repeated extraction of DNA from FTA cards

    OpenAIRE

    Stangegaard, Michael; Ferrero, Laura; Børsting, Claus; Frank-Hansen, Rune; Hansen, Anders Johannes; Morling, Niels

    2011-01-01

    Extraction of DNA using magnetic bead based techniques on automated DNA extraction instruments provides a fast, reliable and reproducible method for DNA extraction from various matrices. However, the yield of extracted DNA from FTA-cards is typically low. Here, we demonstrate that it is possible to repeatedly extract DNA from the processed FTA-disk. The method increases the yield from the nanogram range to the microgram range.

  17. Repeated extraction of DNA from FTA cards

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Ferrero, Laura; Børsting, Claus

    2011-01-01

    Extraction of DNA using magnetic bead based techniques on automated DNA extraction instruments provides a fast, reliable and reproducible method for DNA extraction from various matrices. However, the yield of extracted DNA from FTA-cards is typically low. Here, we demonstrate that it is possible...... to repeatedly extract DNA from the processed FTA-disk. The method increases the yield from the nanogram range to the microgram range....

  18. A Central Limit Theorem for Repeating Patterns

    CERN Document Server

    Abrams, Aaron; Landau, Henry; Landau, Zeph; Pommersheim, James

    2012-01-01

    This note gives a central limit theorem for the length of the longest subsequence of a random permutation which follows some repeating pattern. This includes the case of any fixed pattern of ups and downs which has at least one of each, such as the alternating case considered by Stanley in [2] and Widom in [3]. In every case considered the convergence in the limit of long permutations is to normal with mean and variance linear in the length of the permutations.

  19. Repeatability and Workability Evaluation of SIGMOD 2011

    DEFF Research Database (Denmark)

    Bonnet, Philippe

    2011-01-01

    SIGMOD has offered, since 2008, to verify the experiments published in the papers accepted at the conference. This year, we have been in charge of reproducing the experiments provided by the authors (repeatability), and exploring changes to experiment parameters (workability). In this paper, we a...... find that most experiments are distributed as Linux packages accompanied by instructions on how to setup and run the experiments. We are still far from the vision of executable papers...

  20. Epigenetics and Triplet-Repeat Neurological Diseases

    OpenAIRE

    Nageshwaran, Sathiji; Festenstein, Richard

    2015-01-01

    The term “junk DNA” has been reconsidered following the delineation of the functional significance of repetitive DNA regions. Typically associated with centromeres and telomeres, DNA repeats are found in nearly all organisms throughout their genomes. Repetitive regions are frequently heterochromatinized resulting in silencing of intrinsic and nearby genes. However, this is not a uniform rule, with several genes known to require such an environment to permit transcription. Repetitive regions f...

  1. Epigenetics and triplet repeat neurological diseases

    OpenAIRE

    Sathiji eNageshwaran; Richard eFestenstein

    2015-01-01

    The term ‘junk DNA’ has been reconsidered following the delineation of the functional significance of repetitive DNA regions. Typically associated with centromeres and telomeres, DNA repeats are found in nearly all organisms throughout their genomes. Repetitive regions are frequently heterchromatinised resulting in silencing of intrinsic and nearby genes. However, this is not a uniform rule, with several genes known to require such an environment to permit transcription. Repetitive regions fr...

  2. Repeated-sprint ability and aerobic fitness.

    Science.gov (United States)

    Thébault, Nicolas; Léger, Luc A; Passelergue, Philippe

    2011-10-01

    The purpose of this study was to reinvestigate the relationship between aerobic fitness and fatigue indices of repeated-sprint ability (RSA), with special attention to methodological normalization. Soldiers were divided into low (n = 10) and high (n = 9) fitness groups according to a preset maximal aerobic speed (MAS) of 17 km·h(-1) (∼60 ml O2·kg(-1)·min) measured with the University of Montreal Track Test (UMTT). Subjects' assessment included the RSA test (3 sets of 5 40-m sprints with 1-minute rest between sprints and 1.5 minutes between sets), a 40-m sprint (criterion test used in the computation of fatigue indices for the RSA test), strength and power measurement of the lower limbs, and the 20-m shuttle run test (20-m SRT) and the UMTT, which are measures of maximal aerobic power. The highest correlation with the RSA fatigue indices was obtained with the 20-m SRT (r = 0.90, p = 0.0001, n = 19), a test with 180° direction changes and accelerations and decelerations. The lower correlation (r = 0.66, p repeated sprints and achieved better recovery between series. A MAS of at least 17 km·h(-1) favors constant and high speed level during repeated sprints. From a practical point of view, a high aerobic fitness is a precious asset in counteracting fatigue in sports with numerous sprint repetitions.

  3. Histone deacetylase complexes promote trinucleotide repeat expansions.

    Directory of Open Access Journals (Sweden)

    Kim Debacker

    2012-02-01

    Full Text Available Expansions of DNA trinucleotide repeats cause at least 17 inherited neurodegenerative diseases, such as Huntington's disease. Expansions can occur at frequencies approaching 100% in affected families and in transgenic mice, suggesting that specific cellular proteins actively promote (favor expansions. The inference is that expansions arise due to the presence of these promoting proteins, not their absence, and that interfering with these proteins can suppress expansions. The goal of this study was to identify novel factors that promote expansions. We discovered that specific histone deacetylase complexes (HDACs promote CTG•CAG repeat expansions in budding yeast and human cells. Mutation or inhibition of yeast Rpd3L or Hda1 suppressed up to 90% of expansions. In cultured human astrocytes, expansions were suppressed by 75% upon inhibition or knockdown of HDAC3, whereas siRNA against the histone acetyltransferases CBP/p300 stimulated expansions. Genetic and molecular analysis both indicated that HDACs act at a distance from the triplet repeat to promote expansions. Expansion assays with nuclease mutants indicated that Sae2 is one of the relevant factors regulated by Rpd3L and Hda1. The causal relationship between HDACs and expansions indicates that HDACs can promote mutagenesis at some DNA sequences. This relationship further implies that HDAC3 inhibitors being tested for relief of expansion-associated gene silencing may also suppress somatic expansions that contribute to disease progression.

  4. Landauer's Principle in Repeated Interaction Systems

    Science.gov (United States)

    Hanson, Eric P.; Joye, Alain; Pautrat, Yan; Raquépas, Renaud

    2017-01-01

    We study Landauer's Principle for Repeated Interaction Systems (RIS) consisting of a reference quantum system S in contact with a structured environment E made of a chain of independent quantum probes; S interacts with each probe, for a fixed duration, in sequence. We first adapt Landauer's lower bound, which relates the energy variation of the environment E to a decrease of entropy of the system S during the evolution, to the peculiar discrete time dynamics of RIS. Then we consider RIS with a structured environment E displaying small variations of order {T^{-1}} between the successive probes encountered by S, after {n ˜eq T} interactions, in keeping with adiabatic scaling. We establish a discrete time non-unitary adiabatic theorem to approximate the reduced dynamics of S in this regime, in order to tackle the adiabatic limit of Landauer's bound. We find that saturation of Landauer's bound is related to a detailed balance condition on the repeated interaction system, reflecting the non-equilibrium nature of the repeated interaction system dynamics. This is to be contrasted with the generic saturation of Landauer's bound known to hold for continuous time evolution of an open quantum system interacting with a single thermal reservoir in the adiabatic regime.

  5. A Unified Model for Repeating and Non-repeating Fast Radio Bursts

    Science.gov (United States)

    Bagchi, Manjari

    2017-04-01

    The model that fast radio bursts (FRBs) are caused by plunges of asteroids onto neutron stars can explain both repeating and non-repeating bursts. If a neutron star passes through an asteroid belt around another star, there would be a series of bursts caused by a series of asteroid impacts. Moreover, the neutron star would cross the same belt repetitively if it were in a binary with the star hosting the asteroid belt, leading to a repeated series of bursts. I explore the properties of neutron star binaries that could lead to the only known repeating FRB so far (FRB121102). In this model, the next two epochs of bursts are expected around 2017 February 27 and 2017 December 18. On the other hand, if the asteroid belt is located around the neutron star itself, then a chance fall of an asteroid from that belt onto the neutron star would lead to a non-repeating burst. Even a neutron star grazing an asteroid belt can lead to a non-repeating burst caused by just one asteroid plunge during the grazing. This is possible even when the neutron star is in a binary with the asteroid-hosting star, if the belt and the neutron star orbit are non-coplanar.

  6. LRR conservation mapping to predict functional sites within protein leucine-rich repeat domains.

    Directory of Open Access Journals (Sweden)

    Laura Helft

    Full Text Available Computational prediction of protein functional sites can be a critical first step for analysis of large or complex proteins. Contemporary methods often require several homologous sequences and/or a known protein structure, but these resources are not available for many proteins. Leucine-rich repeats (LRRs are ligand interaction domains found in numerous proteins across all taxonomic kingdoms, including immune system receptors in plants and animals. We devised Repeat Conservation Mapping (RCM, a computational method that predicts functional sites of LRR domains. RCM utilizes two or more homologous sequences and a generic representation of the LRR structure to identify conserved or diversified patches of amino acids on the predicted surface of the LRR. RCM was validated using solved LRR+ligand structures from multiple taxa, identifying ligand interaction sites. RCM was then used for de novo dissection of two plant microbe-associated molecular pattern (MAMP receptors, EF-TU RECEPTOR (EFR and FLAGELLIN-SENSING 2 (FLS2. In vivo testing of Arabidopsis thaliana EFR and FLS2 receptors mutagenized at sites identified by RCM demonstrated previously unknown functional sites. The RCM predictions for EFR, FLS2 and a third plant LRR protein, PGIP, compared favorably to predictions from ODA (optimal docking area, Consurf, and PAML (positive selection analyses, but RCM also made valid functional site predictions not available from these other bioinformatic approaches. RCM analyses can be conducted with any LRR-containing proteins at www.plantpath.wisc.edu/RCM, and the approach should be modifiable for use with other types of repeat protein domains.

  7. Exposure to repeated immobilization stress inhibits cocaine-induced increase in dopamine extracellular levels in the rat ventral tegmental area.

    Science.gov (United States)

    Sotomayor-Zárate, Ramón; Abarca, Jorge; Araya, Katherine A; Renard, Georgina M; Andrés, María E; Gysling, Katia

    2015-11-01

    A higher vulnerability to drug abuse has been observed in human studies of individuals exposed to chronic or persistent stress, as well as in animal models of drug abuse. Here, we explored the effect of repeated immobilization stress on cocaine-induced increase in dopamine extracellular levels in VTA and its regulation by corticotropin-releasing factor (CRF) and GABA systems. Cocaine (10mg/Kg i.p.) induced an increase of VTA DA extracellular levels in control rats. However, this effect was not observed in repeated stress rats. Considering the evidence relating stress with CRF, we decided to perfuse CRF and CP-154526 (selective antagonist of CRF1 receptor) in the VTA of control and repeated stress rats, respectively. We observed that perfusion of 20μM CRF inhibited the increase of VTA DA extracellular levels induced by cocaine in control rats. Interestingly, we observed that in the presence of 10μM CP-154526, cocaine induced a significant increase of VTA DA extracellular levels in repeated stress rats. Regarding the role of VTA GABA neurotransmission, cocaine administration induced a significant increase in VTA GABA extracellular levels only in repeated stress rats. Consistently, cocaine was able to increase VTA DA extracellular levels in repeated stress rats when 100μM bicuculline, an antagonist of GABAA receptor, was perfused intra VTA. Thus, both CRF and GABA systems are involved in the lack of response to cocaine in the VTA of repeated stress rats. It is tempting to suggest that the loss of response in VTA dopaminergic neurons to cocaine, after repeated stress, is due to an interaction between CRF and GABA systems. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Repeated allergen exposure reduce early phase airway response and leukotriene release despite upregulation of 5-lipoxygenase pathways

    Directory of Open Access Journals (Sweden)

    Cui Zhi-Hua

    2012-03-01

    Full Text Available Abstract Background Allergen induced early phase airway response and airway plasma exudation are predominantly mediated by inflammatory mast cell mediators including histamine, cysteinyl leukotrienes (cysLTs and thromboxane A2 (TXA2. The aim of the present study was to evaluate whether repeated allergen exposure affects early phase airway response to allergen challenge. Methods A trimellitic anhydride (TMA sensitized guinea pig model was used to investigate the effects of low dose repeated allergen exposure on cholinergic airway responsiveness, early phase airway response and plasma exudation, as well as local airway production of mast cell derived cysteinyl leukotrienes and thromboxane B2 (TXB2 after allergen challenge. Results Repeated low dose allergen exposure increased cholinergic airway responsiveness. In contrast, early phase airway response and plasma exudation in response to a high-dose allergen challenge were strongly attenuated after repeated low dose allergen exposure. Inhibition of the airway response was unspecific to exposed allergen and independent of histamine receptor blocking. Furthermore, a significant reduction of cysteinyl leukotrienes and TXB2 was found in the airways of animals repeatedly exposed to a low dose allergen. However, in vitro stimulation of airway tissue from animals repeatedly exposed to a low dose allergen with arachidonic acid and calcium ionophore (A23187 induced production of cysteinyl leukotrienes and TXB2, suggesting enhanced activity of 5-lipoxygenase and cyclooxygenase pathways. Conclusions The inhibition of the early phase airway response, cysteinyl leukotriene and TXB2 production after repeated allergen exposure may result from unresponsive effector cells.

  9. Repeated administration of histamine improves memory retrieval of inhibitory avoidance by lithium in mice.

    Science.gov (United States)

    Zarrindast, Mohammad Reza; Parsaei, Leila; Ahmadi, Shamseddin

    2008-01-01

    The influence of repeated administration of histamine on lithium-induced state dependency has been investigated. A single-trial step-down inhibitory avoidance task was used to assess memory in adult male NMRI mice. Intraperitoneal (i.p.) administration of lithium (10 mg/kg), immediately after training (post-training), impaired inhibitory avoidance memory on the test day. Pre-test administration of lithium reversed amnesia induced by the drug given after training, with the maximum response at a dose of 10 mg/kg. Repeated intracerebroventricular (i.c.v.) administration of histamine (20 microg/mouse) for 3 consecutive days followed by 5 days of no drug treatment improved memory retrieval of inhibitory avoidance by a pre-test lower dose (5 mg/kg i.p.) of lithium. In contrast, 3 days of i.c.v. injections of both the histamine H1 receptor antagonist pyrilamine (40 microg/mouse) and the histamine H2 receptor antagonist ranitidine (6.25 and 12.5 microg/mouse) prevented the improving effect of pre-test lithium (10 mg/kg i.p.) on memory retrieval. The results suggest that the repeated administration of histaminergic agents may induce a sensitization which affects the memory impairment induced by lithium.

  10. Repeatability and Reproducibility of Virtual Subjective Refraction.

    Science.gov (United States)

    Perches, Sara; Collados, M Victoria; Ares, Jorge

    2016-10-01

    To establish the repeatability and reproducibility of a virtual refraction process using simulated retinal images. With simulation software, aberrated images corresponding with each step of the refraction process were calculated following the typical protocol of conventional subjective refraction. Fifty external examiners judged simulated retinal images until the best sphero-cylindrical refraction and the best visual acuity were achieved starting from the aberrometry data of three patients. Data analyses were performed to assess repeatability and reproducibility of the virtual refraction as a function of pupil size and aberrometric profile of different patients. SD values achieved in three components of refraction (M, J0, and J45) are lower than 0.25D in repeatability analysis. Regarding reproducibility, we found SD values lower than 0.25D in the most cases. When the results of virtual refraction with different pupil diameters (4 and 6 mm) were compared, the mean of differences (MoD) obtained were not clinically significant (less than 0.25D). Only one of the aberrometry profiles with high uncorrected astigmatism shows poor results for the M component in reproducibility and pupil size dependence analysis. In all cases, vision achieved was better than 0 logMAR. A comparison between the compensation obtained with virtual and conventional subjective refraction was made as an example of this application, showing good quality retinal images in both processes. The present study shows that virtual refraction has similar levels of precision as conventional subjective refraction. Moreover, virtual refraction has also shown that when high low order astigmatism is present, the refraction result is less precise and highly dependent on pupil size.

  11. Oxygen uptake during repeated-sprint exercise.

    Science.gov (United States)

    McGawley, Kerry; Bishop, David J

    2015-03-01

    Repeated-sprint ability appears to be influenced by oxidative metabolism, with reductions in fatigue and improved sprint times related to markers of aerobic fitness. The aim of the current study was to measure the oxygen uptake (VO₂) during the first and last sprints during two, 5 × 6-s repeated-sprint bouts. Cross-sectional study. Eight female soccer players performed two, consecutive, 5 × 6-s maximal sprint bouts (B1 and B2) on five separate occasions, in order to identify the minimum time (trec) required to recover total work done (Wtot) in B1. On a sixth occasion, expired air was collected during the first and last sprint of B1 and B2, which were separated by trec. The trec was 10.9 ± 1.1 min. The VO₂ during the first sprint was significantly less than the last sprint in each bout (psprint (measured in kJ) was significantly related to VO₂max in both B1 (r=0.81, p=0.015) and B2 (r=0.93, p=0.001). In addition, the VO₂ attained in the final sprint was not significantly different from VO₂max in B1 (p=0.284) or B2 (p=0.448). The current study shows that the VO₂ increases from the first to the last of 5 × 6-s sprints and that VO₂max may be a limiting factor to performance in latter sprints. Increasing V˙O₂max in team-sport athletes may enable increased aerobic energy delivery, and consequently work done, during a bout of repeated sprints. Copyright © 2014 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  12. Mechanical processes with repeated attenuated impacts

    CERN Document Server

    Nagaev, R F

    1999-01-01

    This book is devoted to considering in the general case - using typical concrete examples - the motion of machines and mechanisms of impact and vibro-impact action accompanied by a peculiar phenomenon called "impact collapse". This phenomenon is that after the initial collision, a sequence of repeated gradually quickening collisions of decreasing-to-zero intensity occurs, with the final establishment of protracted contact between the interacting bodies. The initiation conditions of the impact collapse are determined and calculation techniques for the quantitative characteristics of the corresp

  13. Source coding model for repeated snapshot imaging

    CERN Document Server

    Li, Junhui; Yang, Dongyue; wu, Guohua; Yin, Longfei; Guo, Hong

    2016-01-01

    Imaging based on successive repeated snapshot measurement is modeled as a source coding process in information theory. The necessary number of measurement to maintain a certain level of error rate is depicted as the rate-distortion function of the source coding. Quantitative formula of the error rate versus measurement number relation is derived, based on the information capacity of imaging system. Second order fluctuation correlation imaging (SFCI) experiment with pseudo-thermal light verifies this formula, which paves the way for introducing information theory into the study of ghost imaging (GI), both conventional and computational.

  14. REPEAT facility. Report for May, June, July

    Science.gov (United States)

    Winn, C. B.

    1981-08-01

    The construction of the REPEAT facility, a test facility for passive and hybrid solar heating systems is reported. The development of a simulation program for envelope type passive solar systems, constructing an envelope test cell, collecting data to validate the program, and application of the program to determine the best envelope type design are discussed. A low cost monitoring system using a dedicated microprocessor system, an inexpensive, high accuracy A/D converter, and minimum system hardware is developed. A method to determine the average temperature and the average daily temperature variation inside a passively heated solar building is presented.

  15. Cataractogenesis after Repeat Laser in situ Keratomileusis

    Directory of Open Access Journals (Sweden)

    Ahmad M. Mansour

    2012-08-01

    Full Text Available There has been the unsubstantiated clinical impression that laser refractive surgery accelerates cataract development along with solid experimental data about the cataractogenic effects of excimer laser treatment. We present the first documented case of significant cataract formation in a young myope after repeat excimer laser ablation necessitating phacoemulsification with a posterior chamber implant. Proposed explanations include focusing of the ablation wave on the posterior capsule (acoustic wave lens epithelial damage, photooxidative stress of the lens (ultraviolet and inflammatory oxidative stress, and corticosteroid-induced cataract (lens toxicity.

  16. Multiplicatively Repeated Non-Binary LDPC Codes

    CERN Document Server

    Kasai, Kenta; Poulliat, Charly; Sakaniwa, Kohichi

    2010-01-01

    We propose non-binary LDPC codes concatenated with multiplicative repetition codes. By multiplicatively repeating the (2,3)-regular non-binary LDPC mother code of rate 1/3, we construct rate-compatible codes of lower rates 1/6, 1/9, 1/12,... Surprisingly, such simple low-rate non-binary LDPC codes outperform the best low-rate binary LDPC codes so far. Moreover, we propose the decoding algorithm for the proposed codes, which can be decoded with almost the same computational complexity as that of the mother code.

  17. Improving repeated sprint ability in young elite soccer players: repeated shuttle sprints vs. explosive strength training.

    Science.gov (United States)

    Buchheit, Martin; Mendez-Villanueva, Alberto; Delhomel, Gregory; Brughelli, Matt; Ahmaidi, Said

    2010-10-01

    To compare the effects of explosive strength (ExpS) vs. repeated shuttle sprint (RS) training on repeated sprint ability (RSA) in young elite soccer players, 15 elite male adolescents (14.5 ± 0.5 years) performed, in addition to their soccer training program, RS (n = 7) or ExpS (n = 8) training once a week for a total of 10 weeks. RS training consisted of 2-3 sets of 5-6 × 15- to 20-m repeated shuttle sprints interspersed with 14 seconds of passive or 23 seconds of active recovery (≈2 m·s⁻¹); ExpS training consisted of 4-6 series of 4-6 exercises (e.g., maximal unilateral countermovement jumps (CMJs), calf and squat plyometric jumps, and short sprints). Before and after training, performance was assessed by 10 and 30 m (10 and 30 m) sprint times, best (RSAbest) and mean (RSAmean) times on a repeated shuttle sprint ability test, a CMJ, and a hopping (Hop) test. After training, except for 10 m (p = 0.22), all performances were significantly improved in both groups (all p's repeated shuttle sprint test were only observed after RS training, whereas CMJ height was only increased after ExpS. Because RS and ExpS were equally efficient at enhancing maximal sprinting speed, RS training-induced improvements in RSA were likely more related to progresses in the ability to change direction.

  18. Repeated vitrification/warming of human sperm gives better results than repeated slow programmable freezing

    Institute of Scientific and Technical Information of China (English)

    Teraporn Vutyavanich; Worashorn Lattiwongsakorn; Waraporn Piromlertamorn; Sudarat Samchimchom

    2012-01-01

    In this study,we compared the effects of repeated freezing/thawing of human sperm by our in-house method of rapid freezing with slow programmable freezing.Sperm samples from 11 normozoospermic subjects were processed through density gradients and divided into three aliquots:non-frozen,rapid freezing and slow programmable freezing.Sperm in the rapid freezing group had better motility and viability than those in the slow freezing group (P<O.01) after the first,second and third cycles of freezing/thawing,but there was no difference in morphology.In the second experiment,rapid freezing was repeated three times in 20 subjects.The samples from each thawing cycle were evaluated for DNA fragmentation using the alkaline comet assay.DNA fragmentation began to increase considerably after the second cycle of freezing/thawing,but to a level that was not clinically important.In the third experiment,rapid freezing was done repeatedly in 10 subjects,until no motile sperm were observed after thawing.The median number of repeated freezing/thawing that yielded no motile sperm was seven (range:5-8,mean:6.8).In conclusion,we demonstrated that repeated freezing/thawing of processed semen using our rapid freezing method gave better results than standard slow programmable freezing.This method can help maximize the usage of precious cryopreserved sperm samples in assisted reproduction technology.

  19. Comparative genomics and molecular dynamics of DNA repeats in eukaryotes.

    Science.gov (United States)

    Richard, Guy-Franck; Kerrest, Alix; Dujon, Bernard

    2008-12-01

    Repeated elements can be widely abundant in eukaryotic genomes, composing more than 50% of the human genome, for example. It is possible to classify repeated sequences into two large families, "tandem repeats" and "dispersed repeats." Each of these two families can be itself divided into subfamilies. Dispersed repeats contain transposons, tRNA genes, and gene paralogues, whereas tandem repeats contain gene tandems, ribosomal DNA repeat arrays, and satellite DNA, itself subdivided into satellites, minisatellites, and microsatellites. Remarkably, the molecular mechanisms that create and propagate dispersed and tandem repeats are specific to each class and usually do not overlap. In the present review, we have chosen in the first section to describe the nature and distribution of dispersed and tandem repeats in eukaryotic genomes in the light of complete (or nearly complete) available genome sequences. In the second part, we focus on the molecular mechanisms responsible for the fast evolution of two specific classes of tandem repeats: minisatellites and microsatellites. Given that a growing number of human neurological disorders involve the expansion of a particular class of microsatellites, called trinucleotide repeats, a large part of the recent experimental work on microsatellites has focused on these particular repeats, and thus we also review the current knowledge in this area. Finally, we propose a unified definition for mini- and microsatellites that takes into account their biological properties and try to point out new directions that should be explored in a near future on our road to understanding the genetics of repeated sequences.

  20. Dopamine D4 receptor, but not the ADHD-associated D4.7 variant, forms functional heteromers with the dopamine D2S receptor in the brain

    Science.gov (United States)

    González, Sergio; Rangel-Barajas, Claudia; Peper, Marcela; Lorenzo, Ramiro; Moreno, Estefanía; Ciruela, Francisco; Borycz, Janusz; Ortiz, Jordi; Lluís, Carme; Franco, Rafael; McCormick, Peter J.; Volkow, Nora D.; Rubinstein, Marcelo; Floran, Benjamin; Ferré, Sergi

    2011-01-01

    Polymorphic variants of the dopamine D4 receptor have been consistently associated with attention-deficit hyperactivity disorder (ADHD). However the functional significance of the risk polymorphism (variable number of tandem repeats in exon 3) is still unclear. Here we show that whereas the most frequent 4-repeat (D4.4) and the 2-repeat (D4.2) variants form functional heteromers with the short isoform of the dopamine D2 receptor (D2S), the 7-repeat risk allele (D4.7) does not. D2 receptor activation in the D2S-D4 receptor heteromer potentiates D4 receptor-mediated MAPK signaling in transfected cells and in the striatum, which did not occur in cells expressing D4.7 or in the striatum of knock-in mutant mice carrying the 7 repeats of the human D4.7 in the third intracellular loop of the D4 receptor. In the striatum D4 receptors are localized in cortico-striatal glutamatergic terminals, where they selectively modulate glutamatergic neurotransmission by interacting with D2S receptors. This interaction shows the same qualitative characteristics than the D2S-D4 receptor heteromer-mediated MAPK signaling and D2S receptor activation potentiates D4 receptor-mediated inibition of striatal glutamate release. It is therefore postulated that dysfunctional D2S-D4.7 heteromers may impair presynaptic dopaminergic control of corticostriatal glutamatergic neurotransmission and explain functional deficits associated with ADHD. PMID:21844870

  1. Extending Teach and Repeat to Pivoting Wheelchairs

    Directory of Open Access Journals (Sweden)

    Guillermo Del Castillo

    2003-02-01

    Full Text Available The paper extends the teach-and-repeat paradigm that has been successful for the control of holonomic robots to nonholonomic wheelchairs which may undergo pivoting action over the course of their taught movement. Due to the nonholonomic nature of the vehicle kinematics, estimation is required -- in the example given herein, based upon video detection of wall-mounted cues -- both in the teaching and the tracking events. In order to accommodate motion that approaches pivoting action as well as motion that approaches straight-line action, the estimation equations of the Extended Kalman Filter and the control equations are formulated using two different definitions of a nontemporal independent variable. The paper motivates the need for pivoting action in real-life settings by reporting extensively on the abilities and limitations of estimation-based teach-and-repeat action where pivoting and near-pivoting action is disallowed. Following formulation of the equations in the near-pivot mode, the paper reports upon experiments where taught trajectories which entail a seamless mix of near-straight and near-pivot action are tracked.

  2. The Perpetual Repeater: an Educative Musical Experience.

    Directory of Open Access Journals (Sweden)

    Svetlana Skriagina

    2014-05-01

    Full Text Available To commemorate the 40th anniversary of the Music Undergraduate Program of the Universidad Pedagógica Nacional (National Pedagogic University, two musical events were planned: an original work written for choir, soloists and symphonic band, and an opera for children. As a result, the cantata ‘The Perpetual Repeater” has been created as an adaptation of a work named “50 Milions de Segons” (50 Millions of Seconds, staged by the CATANIA project of the Barcelona Servei Educatiu de L’Auditori. This work tells the story of those school teachers who, paradoxically enough repeat the same course year after year. After visiting L’Auditori of Barcelona to participate in the pedagogic musical work carried out with school children, we considered the possibility of developing an analogous project, in a similar sociocultural and educational environment, within our Music Undergraduate Program. So, this article deals with two fundamental moments which are essential to understand the educational work implemented with the ISPA students of sixth degree, as well as with a group of the program’s students: The Purpose, which describes in detail the planning of the musical work for children, and The Experience, in which the way the process of The Perpetual Repeater Cantatawas carried out is described.

  3. Airborne Radar Interferometric Repeat-Pass Processing

    Science.gov (United States)

    Hensley, Scott; Michel, Thierry R.; Jones, Cathleen E.; Muellerschoen, Ronald J.; Chapman, Bruce D.; Fore, Alexander; Simard, Marc; Zebker, Howard A.

    2011-01-01

    Earth science research often requires crustal deformation measurements at a variety of time scales, from seconds to decades. Although satellites have been used for repeat-track interferometric (RTI) synthetic-aperture-radar (SAR) mapping for close to 20 years, RTI is much more difficult to implement from an airborne platform owing to the irregular trajectory of the aircraft compared with microwave imaging radar wavelengths. Two basic requirements for robust airborne repeat-pass radar interferometry include the ability to fly the platform to a desired trajectory within a narrow tube and the ability to have the radar beam pointed in a desired direction to a fraction of a beam width. Uninhabited Aerial Vehicle Synthetic Aperture Radar (UAVSAR) is equipped with a precision auto pilot developed by NASA Dryden that allows the platform, a Gulfstream III, to nominally fly within a 5 m diameter tube and with an electronically scanned antenna to position the radar beam to a fraction of a beam width based on INU (inertial navigation unit) attitude angle measurements.

  4. Aggregating quantum repeaters for the quantum internet

    Science.gov (United States)

    Azuma, Koji; Kato, Go

    2017-09-01

    The quantum internet holds promise for accomplishing quantum teleportation and unconditionally secure communication freely between arbitrary clients all over the globe, as well as the simulation of quantum many-body systems. For such a quantum internet protocol, a general fundamental upper bound on the obtainable entanglement or secret key has been derived [K. Azuma, A. Mizutani, and H.-K. Lo, Nat. Commun. 7, 13523 (2016), 10.1038/ncomms13523]. Here we consider its converse problem. In particular, we present a universal protocol constructible from any given quantum network, which is based on running quantum repeater schemes in parallel over the network. For arbitrary lossy optical channel networks, our protocol has no scaling gap with the upper bound, even based on existing quantum repeater schemes. In an asymptotic limit, our protocol works as an optimal entanglement or secret-key distribution over any quantum network composed of practical channels such as erasure channels, dephasing channels, bosonic quantum amplifier channels, and lossy optical channels.

  5. Automated Planning in Repeated Adversarial Games

    CERN Document Server

    de Cote, Enrique Munoz; Sykulski, Adam M; Jennings, Nicholas R

    2012-01-01

    Game theory's prescriptive power typically relies on full rationality and/or self-play interactions. In contrast, this work sets aside these fundamental premises and focuses instead on heterogeneous autonomous interactions between two or more agents. Specifically, we introduce a new and concise representation for repeated adversarial (constant-sum) games that highlight the necessary features that enable an automated planing agent to reason about how to score above the game's Nash equilibrium, when facing heterogeneous adversaries. To this end, we present TeamUP, a model-based RL algorithm designed for learning and planning such an abstraction. In essence, it is somewhat similar to R-max with a cleverly engineered reward shaping that treats exploration as an adversarial optimization problem. In practice, it attempts to find an ally with which to tacitly collude (in more than two-player games) and then collaborates on a joint plan of actions that can consistently score a high utility in adversarial repeated gam...

  6. Chromosome-specific DNA Repeat Probes

    Energy Technology Data Exchange (ETDEWEB)

    Baumgartner, Adolf; Weier, Jingly Fung; Weier, Heinz-Ulrich G.

    2006-03-16

    In research as well as in clinical applications, fluorescence in situ hybridization (FISH) has gained increasing popularity as a highly sensitive technique to study cytogenetic changes. Today, hundreds of commercially available DNA probes serve the basic needs of the biomedical research community. Widespread applications, however, are often limited by the lack of appropriately labeled, specific nucleic acid probes. We describe two approaches for an expeditious preparation of chromosome-specific DNAs and the subsequent probe labeling with reporter molecules of choice. The described techniques allow the preparation of highly specific DNA repeat probes suitable for enumeration of chromosomes in interphase cell nuclei or tissue sections. In addition, there is no need for chromosome enrichment by flow cytometry and sorting or molecular cloning. Our PCR-based method uses either bacterial artificial chromosomes or human genomic DNA as templates with {alpha}-satellite-specific primers. Here we demonstrate the production of fluorochrome-labeled DNA repeat probes specific for human chromosomes 17 and 18 in just a few days without the need for highly specialized equipment and without the limitation to only a few fluorochrome labels.

  7. Repeat-induced gene silencing in mammals.

    Science.gov (United States)

    Garrick, D; Fiering, S; Martin, D I; Whitelaw, E

    1998-01-01

    In both plants and Drosophila melanogaster, expression from a transgenic locus may be silenced when repeated transgene copies are arranged as a concatameric array. This repeat-induced gene silencing is frequently manifested as a decrease in the proportion of cells that express the transgene, resulting in a variegated pattern of expression. There is also some indication that, in transgenic mammals, the number of transgene copies within an array can exert a repressive influence on expression, with several mouse studies reporting a decrease in the level of expression per copy as copy number increases. However, because these studies compare different sites of transgene integration as well as arrays with different numbers of copies, the expression levels observed may be subject to varying position effects as well as the influence of the multicopy array. Here we describe use of the lox/Cre system of site-specific recombination to generate transgenic mouse lines in which different numbers of a transgene are present at the same chromosomal location, thereby eliminating the contribution of position effects and allowing analysis of the effect of copy number alone on transgene silencing. Reduction in copy number results in a marked increase in expression of the transgene and is accompanied by decreased chromatin compaction and decreased methylation at the transgene locus. These findings establish that the presence of multiple homologous copies of a transgene within a concatameric array can have a repressive effect upon gene expression in mammalian systems.

  8. Discrepancies in reporting the CAG repeat lengths for Huntington's disease

    DEFF Research Database (Denmark)

    Quarrell, Oliver W; Handley, Olivia; O'Donovan, Kirsty

    2011-01-01

    Huntington's disease results from a CAG repeat expansion within the Huntingtin gene; this is measured routinely in diagnostic laboratories. The European Huntington's Disease Network REGISTRY project centrally measures CAG repeat lengths on fresh samples; these were compared with the original...

  9. 47 CFR 90.247 - Mobile repeater stations.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Mobile repeater stations. 90.247 Section 90.247... MOBILE RADIO SERVICES Non-Voice and Other Specialized Operations § 90.247 Mobile repeater stations. A... repeater to extend the communications range of hand-carried units subject to the following: (a)...

  10. Polymorphic GGC repeat differentially regulates human reelin gene expression levels.

    Science.gov (United States)

    Persico, A M; Levitt, P; Pimenta, A F

    2006-10-01

    The human gene encoding Reelin (RELN), a pivotal protein in neurodevelopment, includes a polymorphic GGC repeat in its 5' untranslated region (UTR). CHO cells transfected with constructs encompassing the RELN 5'UTR with 4-to-13 GGC repeats upstream of the luciferase reporter gene show declining luciferase activity with increasing GGC repeat number (P autism.

  11. CGG repeat in the FMR1 gene: Size matters

    NARCIS (Netherlands)

    R.A. Willemsen (Ralph); G.J. Levenga (Josien); B.A. Oostra (Ben)

    2011-01-01

    textabstractThe FMR1 gene contains a CGG repeat present in the 5'-untranslated region which can be unstable upon transmission to the next generation. The repeat is up to 55 CGGs long in the normal population. In patients with fragile X syndrome (FXS), a repeat length exceeding 200 CGGs (full

  12. Repeated intranasal TLR7 stimulation reduces allergen responsiveness in allergic rhinitis

    Directory of Open Access Journals (Sweden)

    Greiff Lennart

    2012-06-01

    Full Text Available Abstract Background Interactions between Th1 and Th2 immune responses are of importance to the onset and development of allergic disorders. A Toll-like receptor 7 agonist such as AZD8848 may have potential as a treatment for allergic airway disease by skewing the immune system away from a Th2 profile. Objective To evaluate the efficacy and safety of intranasal AZD8848. Methods In a placebo-controlled single ascending dose study, AZD8848 (0.3-600 μg was given intranasally to 48 healthy subjects and 12 patients with allergic rhinitis (NCT00688779. In a placebo-controlled repeat challenge/treatment study, AZD8848 (30 and 60 μg was given once weekly for five weeks to 74 patients with allergic rhinitis out of season: starting 24 hours after the final dose, daily allergen challenges were given for seven days (NCT00770003. Safety, tolerability, pharmacokinetics, and biomarkers were monitored. During the allergen challenge series, nasal symptoms and lavage fluid levels of tryptase and α2-macroglobulin, reflecting mast cell activity and plasma exudation, were monitored. Results AZD8848 produced reversible blood lymphocyte reductions and dose-dependent flu-like symptoms: 30–100 μg produced consistent yet tolerable effects. Plasma interleukin-1 receptor antagonist was elevated after administration of AZD8848, reflecting interferon production secondary to TLR7 stimulation. At repeat challenge/treatment, AZD8848 reduced nasal symptoms recorded ten minutes after allergen challenge up to eight days after the final dose. Tryptase and α2-macroglobulin were also reduced by AZD8848. Conclusions Repeated intranasal stimulation of Toll-like receptor 7 by AZD8848 was safe and produced a sustained reduction in the responsiveness to allergen in allergic rhinitis. Trial registration NCT00688779 and NCT00770003 as indicated above.

  13. Repeat Testing Effects on Credentialing Exams: Are Repeaters Misinformed or Uninformed?

    Science.gov (United States)

    Feinberg, Richard A.; Raymond, Mark R.; Haist, Steven A.

    2015-01-01

    To mitigate security concerns and unfair score gains, credentialing programs routinely administer new test material to examinees retesting after an initial failing attempt. Counterintuitively, a small but growing body of recent research suggests that repeating the identical form does not create an unfair advantage. This study builds upon and…

  14. Who Repeats Algebra, and How Does Initial Performance Relate to Improvement When the Course Is Repeated?

    Science.gov (United States)

    Fong, Anthony; Jaquet, Karina; Finkelstein, Neal

    2016-01-01

    The information provided in this report shows how students perform when they repeat algebra I and how the level of improvement varies depending on initial course performance and the academic measure (course grades or CST scores). This information can help inform decisions and policies regarding whether and under what circumstances students should…

  15. Hybrid quantum repeater using bright coherent light.

    Science.gov (United States)

    van Loock, P; Ladd, T D; Sanaka, K; Yamaguchi, F; Nemoto, Kae; Munro, W J; Yamamoto, Y

    2006-06-23

    We describe a quantum repeater protocol for long-distance quantum communication. In this scheme, entanglement is created between qubits at intermediate stations of the channel by using a weak dispersive light-matter interaction and distributing the outgoing bright coherent-light pulses among the stations. Noisy entangled pairs of electronic spin are then prepared with high success probability via homodyne detection and postselection. The local gates for entanglement purification and swapping are deterministic and measurement-free, based upon the same coherent-light resources and weak interactions as for the initial entanglement distribution. Finally, the entanglement is stored in a nuclear-spin-based quantum memory. With our system, qubit-communication rates approaching 100 Hz over 1280 km with fidelities near 99% are possible for reasonable local gate errors.

  16. Potential of repeated polymer well treatments

    Energy Technology Data Exchange (ETDEWEB)

    Lakatos, I.; Lakatos-Szabo, J. (Hungarian Academy of Sciences, Budapest (Hungary)); Munkacsi, I.; Troemboeczki, S.

    1993-11-01

    This paper analyzes field results obtained by routine application of a polymer/silicate well treatment technique at the Algyo-2 field in Hungary. First, the reservoir is described briefly; then, the basic concept of the method is outlined. Reference is made to the multifunctioning chemical mechanism of gelation and the favorable rheological properties of the treating fluids that jointly result in a highly selective placement and an efficient permeability reduction in the target reservoir space. Application of the method 17 times in 16 producing wells yielded more than 90,000 Mg of incremental oil production. Typical well behaviors also are illustrated. Finally, the potential of repeated treatments is discussed, taking laboratory and field results into account.

  17. Quantum repeaters using continuous-variable teleportation

    Science.gov (United States)

    Dias, Josephine; Ralph, T. C.

    2017-02-01

    Quantum optical states are fragile and can become corrupted when passed through a lossy communication channel. Unlike for classical signals, optical amplifiers cannot be used to recover quantum signals. Quantum repeaters have been proposed as a way of reducing errors and hence increasing the range of quantum communications. Current protocols target specific discrete encodings, for example quantum bits encoded on the polarization of single photons. We introduce a more general approach that can reduce the effect of loss on any quantum optical encoding, including those based on continuous variables such as the field amplitudes. We show that in principle the protocol incurs a resource cost that scales polynomially with distance. We analyze the simplest implementation and find that while its range is limited it can still achieve useful improvements in the distance over which quantum entanglement of field amplitudes can be distributed.

  18. Statistical Properties of repeating FRB 121102

    CERN Document Server

    Wang, F Y

    2016-01-01

    Fast radio bursts (FRBs) are millisecond-duration radio signals possibly occurring at cosmological distances. However the physical model of FRBs is mystery, many models have been proposed. Here we study the frequency distributions of peak flux, fluence, duration and waiting time for repeating FRB 121102. The cumulative distributions of peak flux, fluence and duration show power-law forms. The waiting time distribution also shows power-law distribution, and is consistent with a non-stationary Poisson process. We also use the statistical results to test the proposed models for FRBs. Comparing with the model predications, we find that the theoretical models proposed by Dai et al. (2016) and Katz (2016) are favored. These distributions are consistent with the predications from avalanche models of driven systems.

  19. Structure-based rational design of a Toll-like receptor 4 (TLR4 decoy receptor with high binding affinity for a target protein.

    Directory of Open Access Journals (Sweden)

    Jieun Han

    Full Text Available Repeat proteins are increasingly attracting much attention as alternative scaffolds to immunoglobulin antibodies due to their unique structural features. Nonetheless, engineering interaction interface and understanding molecular basis for affinity maturation of repeat proteins still remain a challenge. Here, we present a structure-based rational design of a repeat protein with high binding affinity for a target protein. As a model repeat protein, a Toll-like receptor4 (TLR4 decoy receptor composed of leucine-rich repeat (LRR modules was used, and its interaction interface was rationally engineered to increase the binding affinity for myeloid differentiation protein 2 (MD2. Based on the complex crystal structure of the decoy receptor with MD2, we first designed single amino acid substitutions in the decoy receptor, and obtained three variants showing a binding affinity (K(D one-order of magnitude higher than the wild-type decoy receptor. The interacting modes and contributions of individual residues were elucidated by analyzing the crystal structures of the single variants. To further increase the binding affinity, single positive mutations were combined, and two double mutants were shown to have about 3000- and 565-fold higher binding affinities than the wild-type decoy receptor. Molecular dynamics simulations and energetic analysis indicate that an additive effect by two mutations occurring at nearby modules was the major contributor to the remarkable increase in the binding affinities.

  20. Simple sequence repeats in mycobacterial genomes

    Indian Academy of Sciences (India)

    Vattipally B Sreenu; Pankaj Kumar; Javaregowda Nagaraju; Hampapathalu A Nagarajaram

    2007-01-01

    Simple sequence repeats (SSRs) or microsatellites are the repetitive nucleotide sequences of motifs of length 1–6 bp. They are scattered throughout the genomes of all the known organisms ranging from viruses to eukaryotes. Microsatellites undergo mutations in the form of insertions and deletions (INDELS) of their repeat units with some bias towards insertions that lead to microsatellite tract expansion. Although prokaryotic genomes derive some plasticity due to microsatellite mutations they have in-built mechanisms to arrest undue expansions of microsatellites and one such mechanism is constituted by post-replicative DNA repair enzymes MutL, MutH and MutS. The mycobacterial genomes lack these enzymes and as a null hypothesis one could expect these genomes to harbour many long tracts. It is therefore interesting to analyse the mycobacterial genomes for distribution and abundance of microsatellites tracts and to look for potentially polymorphic microsatellites. Available mycobacterial genomes, Mycobacterium avium, M. leprae, M. bovis and the two strains of M. tuberculosis (CDC1551 and H37Rv) were analysed for frequencies and abundance of SSRs. Our analysis revealed that the SSRs are distributed throughout the mycobacterial genomes at an average of 220–230 SSR tracts per kb. All the mycobacterial genomes contain few regions that are conspicuously denser or poorer in microsatellites compared to their expected genome averages. The genomes distinctly show scarcity of long microsatellites despite the absence of a post-replicative DNA repair system. Such severe scarcity of long microsatellites could arise as a result of strong selection pressures operating against long and unstable sequences although influence of GC-content and role of point mutations in arresting microsatellite expansions can not be ruled out. Nonetheless, the long tracts occasionally found in coding as well as non-coding regions may account for limited genome plasticity in these genomes.

  1. Repeat Gamma Knife surgery for vestibular schwannomas

    Science.gov (United States)

    Lonneville, Sarah; Delbrouck, Carine; Renier, Cécile; Devriendt, Daniel; Massager, Nicolas

    2015-01-01

    Background: Gamma Knife (GK) surgery is a recognized treatment option for the management of small to medium-sized vestibular schwannoma (VS) associated with high-tumor control and low morbidity. When a radiosurgical treatment fails to stop tumor growth, repeat GK surgery can be proposed in selected cases. Methods: A series of 27 GK retreatments was performed in 25 patients with VS; 2 patients underwent three procedures. The median time interval between GK treatments was 45 months. The median margin dose used for the first, second, and third GK treatments was 12 Gy, 12 Gy, and 14 Gy, respectively. Six patients (4 patients for the second irradiation and 2 patients for the third irradiation) with partial tumor regrowth were treated only on the growing part of the tumor using a median margin dose of 13 Gy. The median tumor volume was 0.9, 2.3, and 0.7 cc for the first, second, and third treatments, respectively. Stereotactic positron emission tomography (PET) guidance was used for dose planning in 6 cases. Results: Mean follow-up duration was 46 months (range 24–110). At the last follow-up, 85% of schwannomas were controlled. The tumor volume decreased, remained unchanged, or increased after retreatment in 15, 8, and 4 cases, respectively. Four patients had PET during follow-up, and all showed a significant metabolic decrease of the tumor. Hearing was not preserved after retreatment in any patients. New facial or trigeminal palsy did not occur after retreatment. Conclusions: Our results support the long-term efficacy and low morbidity of repeat GK treatment for selected patients with tumor growth after initial treatment. PMID:26500799

  2. Effects of acute versus repeated cocaine exposure on the expression of endocannabinoid signaling-related proteins in the mouse cerebellum

    Science.gov (United States)

    Palomino, Ana; Pavón, Francisco-Javier; Blanco-Calvo, Eduardo; Serrano, Antonia; Arrabal, Sergio; Rivera, Patricia; Alén, Francisco; Vargas, Antonio; Bilbao, Ainhoa; Rubio, Leticia; Rodríguez de Fonseca, Fernando; Suárez, Juan

    2014-01-01

    Growing awareness of cerebellar involvement in addiction is based on the cerebellum’s intermediary position between motor and reward, potentially acting as an interface between motivational and cognitive functions. Here, we examined the impact of acute and repeated cocaine exposure on the two main signaling systems in the mouse cerebellum: the endocannabinoid (eCB) and glutamate systems. To this end, we investigated whether eCB signaling-related gene and protein expression {cannabinoid receptor type 1 receptors and enzymes that produce [diacylglycerol lipase alpha/beta (DAGLα/β) and N-acyl phosphatidylethanolamine phospholipase D (NAPE-PLD)] and degrade [monoacylglycerol lipase (MAGL) and fatty acid amino hydrolase (FAAH)] eCB} were altered. In addition, we analyzed the gene expression of relevant components of the glutamate signaling system [glutamate synthesizing enzymes liver-type glutaminase isoform (LGA) and kidney-type glutaminase isoform (KGA), metabotropic glutamatergic receptor (mGluR3/5), NMDA-ionotropic glutamatergic receptor (NR1/2A/2B/2C) and AMPA-ionotropic receptor subunits (GluR1/2/3/4)] and the gene expression of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, because noradrenergic terminals innervate the cerebellar cortex. Results indicated that acute cocaine exposure decreased DAGLα expression, suggesting a down-regulation of 2-arachidonylglycerol (2-AG) production, as well as gene expression of TH, KGA, mGluR3 and all ionotropic receptor subunits analyzed in the cerebellum. The acquisition of conditioned locomotion and sensitization after repeated cocaine exposure were associated with an increased NAPE-PLD/FAAH ratio, suggesting enhanced anandamide production, and a decreased DAGLβ/MAGL ratio, suggesting decreased 2-AG generation. Repeated cocaine also increased LGA gene expression but had no effect on glutamate receptors. These findings indicate that acute cocaine modulates the expression of the eCB and

  3. CAG repeat size correlates to electrophysiological motor and sensory phenotypes in SBMA.

    Science.gov (United States)

    Suzuki, Keisuke; Katsuno, Masahisa; Banno, Haruhiko; Takeuchi, Yu; Atsuta, Naoki; Ito, Mizuki; Watanabe, Hirohisa; Yamashita, Fumitada; Hori, Norio; Nakamura, Tomohiko; Hirayama, Masaaki; Tanaka, Fumiaki; Sobue, Gen

    2008-01-01

    Spinal and bulbar muscular atrophy (SBMA) is an adult-onset, lower motor neuron disease caused by an aberrant elongation of a CAG repeat in the androgen receptor (AR) gene. The main symptoms are weakness and atrophy of bulbar, facial and limb muscles, but sensory disturbances are frequently found in SBMA patients. Motor symptoms have been attributed to the accumulation of mutant AR in the nucleus of lower motor neurons, which is more profound in patients with a longer CAG repeat. We examined nerve conduction properties including F-waves in a total of 106 patients with genetically confirmed SBMA (mean age at data collection = 53.8 years; range = 31-75 years) and 85 control subjects. Motor conduction velocities (MCV), compound muscle action potentials (CMAP), sensory conduction velocities (SCV) and sensory nerve action potentials (SNAP) were significantly decreased in all nerves examined in the SBMA patients compared with that in the normal controls, indicating that axonal degeneration is the primary process in both motor and sensory nerves. More profound abnormalities were observed in the nerves of the upper limbs than in those of the lower limbs. F-waves in the median nerve were absent in 30 of 106 cases (28.3%), but no cases of absent F-waves were observed in the tibial nerve. From an analysis of the relationship between CMAPs and SNAPs, patients were identified with different electrophysiological phenotypes: motor-dominant, sensory-dominant and non-dominant phenotypes. The CAG repeat size and the age at onset were significantly different among the patients with motor- and sensory-dominant phenotypes, indicating that a longer CAG repeat is more closely linked to the motor-dominant phenotype and a shorter CAG repeat is more closely linked to the sensory-dominant phenotype. Furthermore, when we classified the patients by CAG repeat size, CMAP values showed a tendency to be decreased in patients with a longer CAG repeat (> or =47), while SNAPs were significantly

  4. Assembly of neuronal connectivity by neurotrophic factors and leucine-rich repeat proteins

    Directory of Open Access Journals (Sweden)

    Fernanda Ledda

    2016-08-01

    Full Text Available Proper function of the nervous system critically relies on sophisticated neuronal networks interconnected in a highly specific pattern. The architecture of these connections arises from sequential developmental steps such as axonal growth and guidance, dendrite development, target determination, synapse formation and plasticity. Leucine-rich repeat (LRR transmembrane proteins have been involved in cell-type specific signaling pathways that underlie these developmental processes. The members of this superfamily of proteins execute their functions acting as trans-synaptic cell adhesion molecules involved in target specificity and synapse formation or working in cis as cell-intrinsic modulators of neurotrophic factor receptor trafficking and signaling. In this review, we will focus on novel physiological mechanisms through which LRR proteins regulate neurotrophic factor receptor signaling, highlighting the importance of these modulatory events for proper axonal extension and guidance, tissue innervation and dendrite morphogenesis. Additionally, we discuss few examples linking this set of LRR proteins to neurodevelopmental and psychiatric disorders.

  5. The excess of small inverted repeats in prokaryotes.

    Science.gov (United States)

    Ladoukakis, Emmanuel D; Eyre-Walker, Adam

    2008-09-01

    Recent analyses have shown that there is a large excess of perfect inverted repeats in many prokaryotic genomes but not in eukaryotic ones. This difference could be due to a genuine difference between prokaryotes and eukaryotes or to differences in the methods and types of data analyzed--full genome versus protein coding sequences. We used simulations to show that the method used previously tends to underestimate the expected number of inverted repeats. However, this bias is not large and cannot explain the excess of inverted repeats observed in real data. In contrast, our method is unbiased. When both methods are applied to bacterial protein coding sequences they both detect an excess of inverted repeats, which is much lower than previously reported in whole prokaryotic genomes. This suggests that the reported large excess of inverted repeats is due to repeats found in intergenic regions. These repeats could be due to transcription factor binding sites, or other types of repetitive DNA, on opposite strands of the DNA sequence. In contrast, the smaller, but significant, excess of inverted repeats that we report in protein coding sequences may be due to sequence-directed mutagenesis (SDM). SDM is a process where one copy of a small, imperfect, inverted repeat corrects the other copy via strand misalignment, resulting in a perfect repeat and a series of mutations. We show by simulation that even very low levels of SDM, relative to the rate of point mutation, can generate a substantial excess of inverted repeats.

  6. Role of DNA Polymerases in Repeat-Mediated Genome Instability

    Directory of Open Access Journals (Sweden)

    Kartik A. Shah

    2012-11-01

    Full Text Available Expansions of simple DNA repeats cause numerous hereditary diseases in humans. We analyzed the role of DNA polymerases in the instability of Friedreich’s ataxia (GAAn repeats in a yeast experimental system. The elementary step of expansion corresponded to ∼160 bp in the wild-type strain, matching the size of Okazaki fragments in yeast. This step increased when DNA polymerase α was mutated, suggesting a link between the scale of expansions and Okazaki fragment size. Expandable repeats strongly elevated the rate of mutations at substantial distances around them, a phenomenon we call repeat-induced mutagenesis (RIM. Notably, defects in the replicative DNA polymerases δ and ∊ strongly increased rates for both repeat expansions and RIM. The increases in repeat-mediated instability observed in DNA polymerase δ mutants depended on translesion DNA polymerases. We conclude that repeat expansions and RIM are two sides of the same replicative mechanism.

  7. PRR repeats in the intracellular domain of KISS1R are important for its export to cell membrane.

    Science.gov (United States)

    Chevrier, Lucie; de Brevern, Alexandre; Hernandez, Eva; Leprince, Jérome; Vaudry, Hubert; Guedj, Anne Marie; de Roux, Nicolas

    2013-06-01

    Inactivating mutations of KISS-1 receptor (KISS1R) have been recently described as a rare cause of isolated hypogonadotropic hypogonadism transmitted as a recessive trait. Few mutations have been described, and the structure-function relationship of KISS1R remains poorly understood. Here, we have taken advantage of the discovery of a novel mutation of KISS1R to characterize the structure and function of an uncommon protein motif composed of 3 proline-arginine-arginine (PRR) repeats located within the intracellular domain. A heterozygous insertion of 1 PRR repeat in-frame with 3 PRR repeats leading to synthesis of a receptor bearing 4 PRR repeats (PRR-KISS1R) was found in the index case. Functional analysis of PRR-KISS1R showed a decrease of the maximal response to kisspeptin stimulation, associated to a lower cell surface expression without modification of total expression. PRR-KISS1R exerts a dominant negative effect on the synthesis of the wild-type (WT)-KISS1R. This effect was due to the nature of inserted residues but also to the difference of the length of the intracellular domain between PRR-KISS1R and WT-KISS1R. A molecular dynamic analysis showed that the additional PRR constrained this arginine-rich region into a polyproline type II helix. Altogether, this study shows that a heterozygous insertion in KISS1R may lead to hypogonadotropic hypogonadism by a dominant negative effect on the WT receptor. An additional PRR repeat into a proline-arginine-rich motif can dramatically changed the conformation of the intracellular domain of KISS1R and its probable interaction with partner proteins.

  8. Chaperone receptors: guiding proteins to intracellular compartments.

    Science.gov (United States)

    Kriechbaumer, Verena; von Löffelholz, Ottilie; Abell, Ben M

    2012-01-01

    Despite mitochondria and chloroplasts having their own genome, 99% of mitochondrial proteins (Rehling et al., Nat Rev Mol Cell Biol 5:519-530, 2004) and more than 95% of chloroplast proteins (Soll, Curr Opin Plant Biol 5:529-535, 2002) are encoded by nuclear DNA, synthesised in the cytosol and imported post-translationally. Protein targeting to these organelles depends on cytosolic targeting factors, which bind to the precursor, and then interact with membrane receptors to deliver the precursor into a translocase. The molecular chaperones Hsp70 and Hsp90 have been widely implicated in protein targeting to mitochondria and chloroplasts, and receptors capable of recognising these chaperones have been identified at the surface of both these organelles (Schlegel et al., Mol Biol Evol 24:2763-2774, 2007). The role of these chaperone receptors is not fully understood, but they have been shown to increase the efficiency of protein targeting (Young et al., Cell 112:41-50, 2003; Qbadou et al., EMBO J 25:1836-1847, 2006). Whether these receptors contribute to the specificity of targeting is less clear. A class of chaperone receptors bearing tetratricopeptide repeat domains is able to specifically bind the highly conserved C terminus of Hsp70 and/or Hsp90. Interestingly, at least of one these chaperone receptors can be found on each organelle (Schlegel et al., Mol Biol Evol 24:2763-2774, 2007), which suggests a universal role in protein targeting for these chaperone receptors. This review will investigate the role that chaperone receptors play in targeting efficiency and specificity, as well as examining recent in silico approaches to find novel chaperone receptors.

  9. New Horizons for Lipoprotein ReceptorsCommunication by β-propellers

    DEFF Research Database (Denmark)

    Andersen, Olav Michael; Dagil, Robert; Kragelund, Birthe B

    2013-01-01

    The lipoprotein receptor (LR) family constitutes a large group of structurally closely related receptors with broad ligand-binding specificity. Traditionally, ligand binding to LRs has been anticipated to involve merely the complement type repeat (CR)-domains omnipresent in the family. Recently...

  10. The conserved scavenger receptor cysteine-rich superfamily in therapy and diagnosis

    DEFF Research Database (Denmark)

    Martínez, Vanesa Gabriela; Moestrup, Søren Kragh; Holmskov, Uffe;

    2011-01-01

    The scavenger receptor cysteine-rich (SRCR) superfamily of soluble or membrane-bound protein receptors is characterized by the presence of one or several repeats of an ancient and highly conserved protein module, the SRCR domain. This superfamily (SRCR-SF) has been in constant and progressive...

  11. On the Origin of SERKs: Bioinformatics Analysis of the Somatic Embryogenesis Receptor Kinases

    NARCIS (Netherlands)

    Toorn, aan den M.; Albrecht, C.; Vries, de S.C.

    2015-01-01

    Somatic embryogenesis receptor-like kinases (SERKs) are leucine-rich repeat receptor-like kinases involved in several, seemingly unrelated, plant-signaling pathways. In Arabidopsis thaliana, functional and genetic analysis of four SERK proteins has indicated that they are only partly redundant; thei

  12. A genome-wide functional investigation into the roles of receptor-like proteins in Arabidopsis

    NARCIS (Netherlands)

    Guodong Wang, G.; Ellendorff, U.; Kemp, B.; Mansfield, J.W.; Forsyth, A.; Mitchell, K.; Bastas, K.; Liu, C.M.; Woods-Tör, A.; Zipfel, C.; Wit, de P.J.G.M.; Jones, J.D.G.; Tör, M.; Thomma, B.P.H.J.

    2008-01-01

    Receptor-like proteins (RLPs) are cell surface receptors that typically consist of an extracellular leucine-rich repeat domain, a transmembrane domain, and a short cytoplasmatic tail. In several plant species, RLPs have been found to play a role in disease resistance, such as the tomato (Solanum lyc

  13. The androgen receptor and estrogen receptor

    NARCIS (Netherlands)

    Oosterkamp, H.M.; Bernards, R.A.

    2002-01-01

    The androgen receptor (AR) and the estrogen receptors (ER) are members of the nuclear receptor (NR) family. These NRs are distinguished from the other transcription factors by their ability to control gene expression upon ligand binding (steroids, retinoids, thyroid hormone, vitamin D, fatty acids,

  14. Synaptic Impairment in Layer 1 of the Prefrontal Cortex Induced by Repeated Stress During Adolescence is Reversed in Adulthood

    Science.gov (United States)

    Negrón-Oyarzo, Ignacio; Dagnino-Subiabre, Alexies; Muñoz Carvajal, Pablo

    2015-01-01

    Chronic stress is a risk factor for the development of psychiatric disorders, some of which involve dysfunction of the prefrontal cortex (PFC). There is a higher prevalence of these chronic stress-related psychiatric disorders during adolescence, when the PFC has not yet fully matured. In the present work we studied the effect of repeated stress during adolescence on synaptic function in the PFC in adolescence and adulthood. To this end, adolescent Sprague-Dawley rats were subjected to seven consecutive days of restraint stress. Afterward, both synaptic transmission and short- and long-term synaptic plasticity were evaluated in layer 1 of medial-PFC (mPFC) slices from adolescent and adult rats. We found that repeated stress significantly reduced the amplitude of evoked field excitatory post-synaptic potential (fEPSP) in the mPFC. Isolation of excitatory transmission reveled that lower-amplitude fEPSPs were associated with a reduction in α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor-mediated transmission. We also found that repeated stress significantly decreased long-term depression (LTD). Interestingly, AMPA/kainate receptor-mediated transmission and LTD were recovered in adult animals that experienced a three-week stress-free recovery period. The data indicates that the changes in synaptic transmission and plasticity in the mPFC induced by repeated stress during adolescence are reversed in adulthood after a stress-free period. PMID:26617490

  15. Androgen receptor gene polymorphisms and risk of prostate cancer: a meta-analysis

    Science.gov (United States)

    Weng, Hong; Li, Sheng; Huang, Jing-Yu; He, Zi-Qi; Meng, Xiang-Yu; Cao, Yue; Fang, Cheng; Zeng, Xian-Tao

    2017-01-01

    Although the association between CAG and GGN repeats in the androgen receptor gene and prostate cancer risk has been widely studied, it remains controversial from previous meta-analyses and narrative reviews. Therefore, we performed this meta-analysis to provide more precise estimates with sufficient power. A total of 51 publications with 61 studies for CAG repeats and 14 publications with 16 studies for GGN repeats were identified in the meta-analysis. The results showed that short CAG repeats (repeats) carriers presented an elevated risk of prostate cancer than long CAG repeats (≥22) carriers (OR = 1.31, 95% CI 1.16 to 1.47). Prostate cancer cases presented an average fewer CAG repeats (MD = −0.85, 95% CI −1.28 to −0.42) than controls. Short GGN repeats (≤16) carriers presented an increased risk of prostate cancer than long GGN repeats (>16) carriers (OR = 1.38, 95% CI 1.05 to 1.82). In subgroup analyses, the abovementioned significant association was predominantly observed in Caucasian populations. The meta-analysis showed that short CAG and GGN repeats in androgen receptor gene were associated with increased risk of prostate cancer, especially in Caucasians. PMID:28091563

  16. REPdenovo: Inferring De Novo Repeat Motifs from Short Sequence Reads.

    Directory of Open Access Journals (Sweden)

    Chong Chu

    Full Text Available Repeat elements are important components of eukaryotic genomes. One limitation in our understanding of repeat elements is that most analyses rely on reference genomes that are incomplete and often contain missing data in highly repetitive regions that are difficult to assemble. To overcome this problem we develop a new method, REPdenovo, which assembles repeat sequences directly from raw shotgun sequencing data. REPdenovo can construct various types of repeats that are highly repetitive and have low sequence divergence within copies. We show that REPdenovo is substantially better than existing methods both in terms of the number and the completeness of the repeat sequences that it recovers. The key advantage of REPdenovo is that it can reconstruct long repeats from sequence reads. We apply the method to human data and discover a number of potentially new repeats sequences that have been missed by previous repeat annotations. Many of these sequences are incorporated into various parasite genomes, possibly because the filtering process for host DNA involved in the sequencing of the parasite genomes failed to exclude the host derived repeat sequences. REPdenovo is a new powerful computational tool for annotating genomes and for addressing questions regarding the evolution of repeat families. The software tool, REPdenovo, is available for download at https://github.com/Reedwarbler/REPdenovo.

  17. Somatostatin receptor imaging in patients with sarcoidosis

    Energy Technology Data Exchange (ETDEWEB)

    Kwekkeboom, D.J.; Breeman, W.A.P. [Department of Nuclear Medicine, University Hospital Dijkzigt, Rotterdam (Netherlands); Krenning, E.P. [Department of Nuclear Medicine, University Hospital Dijkzigt, Rotterdam (Netherlands)]|[Department of Internal Medicine, University Hospital Dijkzigt, Rotterdam (Netherlands); Kho, G.S. [Department of Pulmonology, University Hospital Dijkzigt, Rotterdam (Netherlands); Van Hagen, P.M. [Department of Internal Medicine, University Hospital Dijkzigt, Rotterdam (Netherlands)]|[Department of Immunology, University Hospital Dijkzigt, Rotterdam (Netherlands)

    1998-09-01

    Granulomatous diseases can be visualized in vivo after the injection of indium-111-DTPA-octreotide ({sup 111}In-pentetreotide), a radiolabelled somatostatin analogue. We evaluated whether somatostatin receptor imaging reflects disease activity, whether certain scintigraphic characteristics can predict the disease prognosis and whether repeat scintigraphy correlates with the clinical course in patients with sarcoidosis. {sup 111}In-pentetreotide was injected in 46 patients and images were obtained 24 h later. Known mediastinal, hilar and interstitial disease was recognized in 36 of 37 patients. Also, such pathology was found in seven other patients who had normal chest X-rays. In five of these, somatostatin receptor imaging pointed to interstitial disease. Frequently, accumulation of radioactivity in parotid glands and supraclavicular lymph nodes was found. Neither the degree of radioactive accumulation in the thorax nor a specific pattern of pathological uptake was correlated with disease severity or clinical course. The degree of uptake of radioactivity in the parotid glands was correlated with significantly higher serum angiotensin-converting enzyme (ACE) levels. Somatostatin receptor imaging was repeated in 13 patients. In five of six patients in whom chest X-ray monitored improvement of disease activity, the pentetreotide scintigram also showed a decrease in pathological uptake. In two of five patients in whom the chest X-ray was unchanged, but serum ACE concentrations had decreased and lung function improved, normalization on pentetreotide scintigrams was found. It is concluded that: (1) somatostatin receptor imaging can demonstrate active granulomatous disease in patients with sarcoidosis; (2) pathological uptake of radioactivity in the parotid glands during somatostatin receptor imaging is correlated with higher serum ACE concentrations; (3) the value of somatostatin receptor imaging in the follow-up of patients with sarcoidosis will have to be determined in

  18. Repeated-sprint and effort ability in rugby league players.

    Science.gov (United States)

    Johnston, Rich D; Gabbett, Tim J

    2011-10-01

    The aim of this study was to (a) investigate the influence of tackling on repeated-sprint performance; (b) determine whether repeated-sprint ability (RSA) and repeated-effort ability (REA) are 2 distinct qualities; and (c) assess the test-retest reliability of repeated-sprint and repeated-effort tests in rugby league. Twelve rugby league players performed a repeated-sprint (12 × 20-m sprints performed on a 20-second cycle) and a repeated-effort (12 × 20-m sprints with intermittent tackling, performed on a 20-second cycle) test 7 days apart. The test-retest reliability of these tests was also established. Heart rate and rating of perceived exertion were recorded throughout the tests. There was a significantly greater (p ≤ 0.05) and large effect size (ES) differences for total sprint time (ES = 1.19), average heart rate (ES = 1.64), peak heart rate (ES = 1.35), and perceived exertion (ES = 3.39) for the repeated-effort test compared with the repeated-sprint test. A large difference (ES = 1.02, p = 0.06) was detected for percentage decrement between the 2 tests. No significant relationship was found between the repeated-sprint and repeated-effort tests for any of the dependent variables. Both tests proved reliable, with total sprint time being the most reliable method of assessing performance. This study demonstrates that the addition of tackling significantly increases the physiological response to repeated-sprint exercise and reduces repeated-sprint performance in rugby league players. Furthermore, RSA and REA appear to be 2 distinct qualities that can be reliably assessed with total time being the most reliable measure of performance.

  19. Multineuronal Spike Sequences Repeat with Millisecond Precision

    Directory of Open Access Journals (Sweden)

    Koki eMatsumoto

    2013-06-01

    Full Text Available Cortical microcircuits are nonrandomly wired by neurons. As a natural consequence, spikes emitted by microcircuits are also nonrandomly patterned in time and space. One of the prominent spike organizations is a repetition of fixed patterns of spike series across multiple neurons. However, several questions remain unsolved, including how precisely spike sequences repeat, how the sequences are spatially organized, how many neurons participate in sequences, and how different sequences are functionally linked. To address these questions, we monitored spontaneous spikes of hippocampal CA3 neurons ex vivo using a high-speed functional multineuron calcium imaging technique that allowed us to monitor spikes with millisecond resolution and to record the location of spiking and nonspiking neurons. Multineuronal spike sequences were overrepresented in spontaneous activity compared to the statistical chance level. Approximately 75% of neurons participated in at least one sequence during our observation period. The participants were sparsely dispersed and did not show specific spatial organization. The number of sequences relative to the chance level decreased when larger time frames were used to detect sequences. Thus, sequences were precise at the millisecond level. Sequences often shared common spikes with other sequences; parts of sequences were subsequently relayed by following sequences, generating complex chains of multiple sequences.

  20. Modelling repeatedly flaring delta-sunspots

    CERN Document Server

    Chatterjee, Piyali; Carlsson, Mats

    2016-01-01

    Active regions (AR) appearing on the surface of the Sun are classified into $\\alpha$, $\\beta$, $\\gamma$, and $\\delta$ by the rules of the Mount Wilson Observatory, California on the basis of their topological complexity. Amongst these, the $\\delta$-sunspots are known to be super-active and produce the most X-ray flares. Here, we present results from a simulation of the Sun by mimicking the upper layers and the corona, but starting at a more primitive stage than any earlier treatment. We find that this initial state consisting of only a thin sub-photospheric magnetic sheet breaks into multiple flux-tubes which evolve into a colliding-merging system of spots of opposite polarity upon surface emergence, similar to those often seen on the Sun. The simulation goes on to produce many exotic $\\delta$-sunspot associated phenomena: repeated flaring in the range of typical solar flare energy release and ejective helical flux ropes with embedded cool-dense plasma filaments resembling solar coronal mass ejections.

  1. A Repeated Signal Difference for Recognising Patterns

    Directory of Open Access Journals (Sweden)

    Kieran Greer

    2016-08-01

    Full Text Available This paper describes a new mechanism that might help with defining pattern sequences, by the fact that it can produce an upper bound on the ensemble value that can persistently oscillate with the actual values produced from each pattern. With every firing event, a node also receives an on/off feedback switch. If the node fires then it sends a feedback result depending on the input signal strength. If the input signal is positive or larger, it can store an ‘on’ switch feedback for the next iteration. If the signal is negative or smaller it can store an ‘off’ switch feedback for the next iteration. If the node does not fire, then it does not affect the current feedback situation and receives the switch command produced by the last active pattern event for the same neuron. The upper bound therefore also represents the largest or most enclosing pattern set and the lower value is for the actual set of firing patterns. If the pattern sequence repeats, it will oscillate between the two values, allowing them to be recognised and measured more easily, over time. Tests show that changing the sequence ordering produces different value sets, which can also be measured.

  2. Widespread Alu repeat-driven expansion of consensus DR2 retinoic acid response elements during primate evolution

    Directory of Open Access Journals (Sweden)

    Wang Tian-Tian

    2007-01-01

    Full Text Available Abstract Background Nuclear receptors are hormone-regulated transcription factors whose signaling controls numerous aspects of development and physiology. Many receptors recognize DNA hormone response elements formed by direct repeats of RGKTCA motifs separated by 1 to 5 bp (DR1-DR5. Although many known such response elements are conserved in the mouse and human genomes, it is unclear to which extent transcriptional regulation by nuclear receptors has evolved specifically in primates. Results We have mapped the positions of all consensus DR-type hormone response elements in the human genome, and found that DR2 motifs, recognized by retinoic acid receptors (RARs, are heavily overrepresented (108,582 elements. 90% of these are present in Alu repeats, which also contain lesser numbers of other consensus DRs, including 50% of consensus DR4 motifs. Few DR2s are in potentially mobile AluY elements and the vast majority are also present in chimp and macaque. 95.5% of Alu-DR2s are distributed throughout subclasses of AluS repeats, and arose largely through deamination of a methylated CpG dinucleotide in a non-consensus motif present in AluS sequences. We find that Alu-DR2 motifs are located adjacent to numerous known retinoic acid target genes, and show by chromatin immunoprecipitation assays in squamous carcinoma cells that several of these elements recruit RARs in vivo. These findings are supported by ChIP-on-chip data from retinoic acid-treated HL60 cells revealing RAR binding to several Alu-DR2 motifs. Conclusion These data provide strong support for the notion that Alu-mediated expansion of DR elements contributed to the evolution of gene regulation by RARs and other nuclear receptors in primates and humans.

  3. Hypoxic Repeat Sprint Training Improves Rugby Player's Repeated Sprint but Not Endurance Performance.

    Science.gov (United States)

    Hamlin, Michael J; Olsen, Peter D; Marshall, Helen C; Lizamore, Catherine A; Elliot, Catherine A

    2017-01-01

    This study aims to investigate the performance changes in 19 well-trained male rugby players after repeat-sprint training (six sessions of four sets of 5 × 5 s sprints with 25 s and 5 min of active recovery between reps and sets, respectively) in either normobaric hypoxia (HYP; n = 9; FIO2 = 14.5%) or normobaric normoxia (NORM; n = 10; FIO2 = 20.9%). Three weeks after the intervention, 2 additional repeat-sprint training sessions in hypoxia (FIO2 = 14.5%) was investigated in both groups to gauge the efficacy of using "top-up" sessions for previously hypoxic-trained subjects and whether a small hypoxic dose would be beneficial for the previously normoxic-trained group. Repeated sprint (8 × 20 m) and Yo-Yo Intermittent Recovery Level 1 (YYIR1) performances were tested twice at baseline (Pre 1 and Pre 2) and weekly after (Post 1-3) the initial intervention (intervention 1) and again weekly after the second "top-up" intervention (Post 4-5). After each training set, heart rate, oxygen saturation, and rate of perceived exertion were recorded. Compared to baseline (mean of Pre 1 and Pre 2), both the hypoxic and normoxic groups similarly lowered fatigue over the 8 sprints 1 week after the intervention (Post 1: -1.8 ± 1.6%, -1.5 ± 1.4%, mean change ± 90% CI in HYP and NORM groups, respectively). However, from Post 2 onwards, only the hypoxic group maintained the performance improvement compared to baseline (Post 2: -2.1 ± 1.8%, Post 3: -2.3 ± 1.7%, Post 4: -1.9 ± 1.8%, and Post 5: -1.2 ± 1.7%). Compared to the normoxic group, the hypoxic group was likely to have substantially less fatigue at Post 3-5 (-2.0 ± 2.4%, -2.2 ± 2.4%, -1.6 ± 2.4% Post 3, Post 4, Post 5, respectively). YYIR1 performances improved throughout the recovery period in both groups (13-37% compared to baseline) with unclear differences found between groups. The addition of two sessions of "top-up" training after intervention 1, had little effect on either group. Repeat-sprint training in

  4. Hypoxic Repeat Sprint Training Improves Rugby Player's Repeated Sprint but Not Endurance Performance

    Science.gov (United States)

    Hamlin, Michael J.; Olsen, Peter D.; Marshall, Helen C.; Lizamore, Catherine A.; Elliot, Catherine A.

    2017-01-01

    This study aims to investigate the performance changes in 19 well-trained male rugby players after repeat-sprint training (six sessions of four sets of 5 × 5 s sprints with 25 s and 5 min of active recovery between reps and sets, respectively) in either normobaric hypoxia (HYP; n = 9; FIO2 = 14.5%) or normobaric normoxia (NORM; n = 10; FIO2 = 20.9%). Three weeks after the intervention, 2 additional repeat-sprint training sessions in hypoxia (FIO2 = 14.5%) was investigated in both groups to gauge the efficacy of using “top-up” sessions for previously hypoxic-trained subjects and whether a small hypoxic dose would be beneficial for the previously normoxic-trained group. Repeated sprint (8 × 20 m) and Yo-Yo Intermittent Recovery Level 1 (YYIR1) performances were tested twice at baseline (Pre 1 and Pre 2) and weekly after (Post 1–3) the initial intervention (intervention 1) and again weekly after the second “top-up” intervention (Post 4–5). After each training set, heart rate, oxygen saturation, and rate of perceived exertion were recorded. Compared to baseline (mean of Pre 1 and Pre 2), both the hypoxic and normoxic groups similarly lowered fatigue over the 8 sprints 1 week after the intervention (Post 1: −1.8 ± 1.6%, −1.5 ± 1.4%, mean change ± 90% CI in HYP and NORM groups, respectively). However, from Post 2 onwards, only the hypoxic group maintained the performance improvement compared to baseline (Post 2: −2.1 ± 1.8%, Post 3: −2.3 ± 1.7%, Post 4: −1.9 ± 1.8%, and Post 5: −1.2 ± 1.7%). Compared to the normoxic group, the hypoxic group was likely to have substantially less fatigue at Post 3–5 (−2.0 ± 2.4%, −2.2 ± 2.4%, −1.6 ± 2.4% Post 3, Post 4, Post 5, respectively). YYIR1 performances improved throughout the recovery period in both groups (13–37% compared to baseline) with unclear differences found between groups. The addition of two sessions of “top-up” training after intervention 1, had little effect on either

  5. Electroacupuncture Inhibition of Hyperalgesia in Rats with Adjuvant Arthritis: Involvement of Cannabinoid Receptor 1 and Dopamine Receptor Subtypes in Striatum

    Directory of Open Access Journals (Sweden)

    Yin Shou

    2013-01-01

    Full Text Available Electroacupuncture (EA has been regarded as an alternative treatment for inflammatory pain for several decades. However, the molecular mechanisms underlying the antinociceptive effect of EA have not been thoroughly clarified. Previous studies have shown that cannabinoid CB1 receptors are related to pain relief. Accumulating evidence has shown that the CB1 and dopamine systems sometimes interact and may operate synergistically in rat striatum. To our knowledge, dopamine D1/D2 receptors are involved in EA analgesia. In this study, we found that repeated EA at Zusanli (ST36 and Kunlun (BL60 acupoints resulted in marked improvements in thermal hyperalgesia. Both western blot assays and FQ-PCR analysis results showed that the levels of CB1 expression in the repeated-EA group were much higher than those in any other group (P=0.001. The CB1-selective antagonist AM251 inhibited the effects of repeated EA by attenuating the increases in CB1 expression. The two kinds of dopamine receptors imparted different actions on the EA-induced CB1 upregulation in AA rat model. These results suggested that the strong activation of the CB1 receptor after repeated EA resulted in the concomitant phenomenon of the upregulation of D1 and D2 levels of gene expression.

  6. An Expanded CAG Repeat in Huntingtin Causes +1 Frameshifting.

    Science.gov (United States)

    Saffert, Paul; Adamla, Frauke; Schieweck, Rico; Atkins, John F; Ignatova, Zoya

    2016-08-26

    Maintenance of triplet decoding is crucial for the expression of functional protein because deviations either into the -1 or +1 reading frames are often non-functional. We report here that expression of huntingtin (Htt) exon 1 with expanded CAG repeats, implicated in Huntington pathology, undergoes a sporadic +1 frameshift to generate from the CAG repeat a trans-frame AGC repeat-encoded product. This +1 recoding is exclusively detected in pathological Htt variants, i.e. those with expanded repeats with more than 35 consecutive CAG codons. An atypical +1 shift site, UUC C at the 5' end of CAG repeats, which has some resemblance to the influenza A virus shift site, triggers the +1 frameshifting and is enhanced by the increased propensity of the expanded CAG repeats to form a stem-loop structure. The +1 trans-frame-encoded product can directly influence the aggregation of the parental Htt exon 1.

  7. Repeats in transforming acidic coiled-coil (TACC) genes.

    Science.gov (United States)

    Trivedi, Seema

    2013-06-01

    Transforming acidic coiled-coil proteins (TACC1, 2, and 3) are essential proteins associated with the assembly of spindle microtubules and maintenance of bipolarity. Dysregulation of TACCs is associated with tumorigenesis, but studies of microsatellite instability in TACC genes have not been extensive. Microsatellite or simple sequence repeat instability is known to cause many types of cancer. The present in silico analysis of SSRs in human TACC gene sequences shows the presence of mono- to hexa-nucleotide repeats, with the highest densities found for mono- and di-nucleotide repeats. Density of repeats is higher in introns than in exons. Some of the repeats are present in regulatory regions and retained introns. Human TACC genes show conservation of many repeat classes. Microsatellites in TACC genes could be valuable markers for monitoring numerical chromosomal aberrations and or cancer.

  8. Survey of simple sequence repeats in woodland strawberry (Fragaria vesca).

    Science.gov (United States)

    Guan, L; Huang, J F; Feng, G Q; Wang, X W; Wang, Y; Chen, B Y; Qiao, Y S

    2013-07-30

    The use of simple sequence repeats (SSRs), or microsatellites, as genetic markers has become popular due to their abundance and variation in length among individuals. In this study, we investigated linkage groups (LGs) in the woodland strawberry (Fragaria vesca) and demonstrated variation in the abundances, densities, and relative densities of mononucleotide, dinucleotide, and trinucleotide repeats. Mononucleotide, dinucleotide, and trinucleotide repeats were more common than longer repeats in all LGs examined. Perfect SSRs were the predominant SSR type found and their abundance was extremely stable among LGs and chloroplasts. Abundances of mononucleotide, dinucleotide, and trinucleotide repeats were positively correlated with LG size, whereas those of tetranucleotide and hexanucleotide SSRs were not. Generally, in each LG, the abundance, relative abundance, relative density, and the proportion of each unique SSR all declined rapidly as the repeated unit increased. Furthermore, the lengths and frequencies of SSRs varied among different LGs.

  9. Quasimonomorphic Mononucleotide Repeats for High-Level Microsatellite Instability Analysis

    Directory of Open Access Journals (Sweden)

    Olivier Buhard

    2004-01-01

    Full Text Available Microsatellite instability (MSI analysis is becoming more and more important to detect sporadic primary tumors of the MSI phenotype as well as in helping to determine Hereditary Non-Polyposis Colorectal Cancer (HNPCC cases. After some years of conflicting data due to the absence of consensus markers for the MSI phenotype, a meeting held in Bethesda to clarify the situation proposed a set of 5 microsatellites (2 mononucleotide repeats and 3 dinucleotide repeats to determine MSI tumors. A second Bethesda consensus meeting was held at the end of 2002. It was discussed here that the 1998 microsatellite panel could underestimate high-level MSI tumors and overestimate low-level MSI tumors. Amongst the suggested changes was the exclusive use of mononucleotide repeats in place of dinucleotide repeats. We have already proposed a pentaplex MSI screening test comprising 5 quasimonomorphic mononucleotide repeats. This article compares the advantages of mono or dinucleotide repeats in determining microsatellite instability.

  10. Zinc-finger directed double-strand breaks within CAG repeat tracts promote repeat instability in human cells.

    Science.gov (United States)

    Mittelman, David; Moye, Christopher; Morton, Jason; Sykoudis, Kristen; Lin, Yunfu; Carroll, Dana; Wilson, John H

    2009-06-16

    Expanded triplet repeats have been identified as the genetic basis for a growing number of neurological and skeletal disorders. To examine the contribution of double-strand break repair to CAG x CTG repeat instability in mammalian systems, we developed zinc finger nucleases (ZFNs) that recognize and cleave CAG repeat sequences. Engineered ZFNs use a tandem array of zinc fingers, fused to the FokI DNA cleavage domain, to direct double-strand breaks (DSBs) in a site-specific manner. We first determined that the ZFNs cleave CAG repeats in vitro. Then, using our previously described tissue culture assay for identifying modifiers of CAG repeat instability, we found that transfection of ZFN-expression vectors induced up to a 15-fold increase in changes to the CAG repeat in human and rodent cell lines, and that longer repeats were much more sensitive to cleavage than shorter ones. Analysis of individual colonies arising after treatment revealed a spectrum of events consistent with ZFN-induced DSBs and dominated by repeat contractions. We also found that expressing a dominant-negative form of RAD51 in combination with a ZFN, dramatically reduced the effect of the nuclease, suggesting that DSB-induced repeat instability is mediated, in part, through homology directed repair. These studies identify a ZFN as a useful reagent for characterizing the effects of DSBs on CAG repeats in cells.

  11. Desensitization of B-adrenergic receptors following repeated injections of 2-substituted-4-phenylquinolines

    Energy Technology Data Exchange (ETDEWEB)

    Alhaider, A.A.

    1986-03-05

    In a previous work, they synthesized some new 2-substituted-4-phenylquinoline derivatives which demonstrated potent antidepressant activities as revealed by their antagonism to the uptake of /sup 3/(H)-norepinephrine and /sup 3/(H)-serotonin into brain synaptosomal preparation. Also, these compounds have demonstrated less anticholinergic, antihistamine and cardiovascular effects as compared to imipramine in animal models. In this present work, the chronic effects of some of these compounds on the sensitivity of the noradrenergic cyclic-AMP generating system on rat brain cortex has been conducted by the daily injection of 20 mg/kg i.p. for a period of three weeks. Imipramine and trazodone were utilized as standards, representing typical and atypical antidepressants, respectively. Acute treatment (single dose 20 mg/kg) and subchronic treatment (20 mg/kg for 10 days) produced no significant desensitization of the B-adrenoceptors. However, chronic treatment with the compounds significantly decreased isoprenaline-induced increase in c-AMP in the cortex which suggests desensitization of B-adrenoceptors. This effect coupled with the previous findings point to a potential rule of these compounds as suitable antidepressant candidates.

  12. GLP-1 Receptor Agonists

    Science.gov (United States)

    ... in Balance › GLP-1 Receptor Agonists Fact Sheet GLP-1 Receptor Agonists May, 2012 Download PDFs English Espanol Editors Silvio ... are too high or too low. What are GLP-1 receptor agonist medicines? GLP-1 receptor agonist medicines, also called ...

  13. Assembly of Repeat Content Using Next Generation Sequencing Data

    Energy Technology Data Exchange (ETDEWEB)

    labutti, Kurt; Kuo, Alan; Grigoriev, Igor; Copeland, Alex

    2014-03-17

    Repetitive organisms pose a challenge for short read assembly, and typically only unique regions and repeat regions shorter than the read length, can be accurately assembled. Recently, we have been investigating the use of Pacific Biosciences reads for de novo fungal assembly. We will present an assessment of the quality and degree of repeat reconstruction possible in a fungal genome using long read technology. We will also compare differences in assembly of repeat content using short read and long read technology.

  14. Neuropathological diagnosis and CAG repeat expansion in Huntington's disease.

    OpenAIRE

    Xuereb, J H; MacMillan, J C; Snell, R; Davies, P.; Harper, P S

    1996-01-01

    OBJECTIVE--To correlate the degree of CAG repeat expansion with neuropathological findings in Huntington's disease. METHODS--The CAG repeat polymorphism was analysed in a large series of brain samples from 268 patients with a clinical diagnosis of Huntington's disease in which full neuropathological data was available. RESULTS--Analysis by polymerase chain reaction was successful in 63% of samples (169 of 268). Repeat expansions were detected in 152 of 153 (99%) samples with a neuropathologic...

  15. The evolution of filamin – A protein domain repeat perspective

    OpenAIRE

    Light, Sara; Sagit, Rauan; Ithychanda, Sujay S.; Qin, Jun; Elofsson, Arne

    2012-01-01

    Particularly in higher eukaryotes, some protein domains are found in tandem repeats, performing broad functions often related to cellular organization. For instance, the eukaryotic protein filamin interacts with many proteins and is crucial for the cytoskeleton. The functional properties of long repeat domains are governed by the specific properties of each individual domain as well as by the repeat copy number. To provide better understanding of the evolutionary and functional history of rep...

  16. Repeated fecal microbiota transplantation in a child with ulcerative colitis.

    Science.gov (United States)

    Shimizu, Hirotaka; Arai, Katsuhiro; Abe, Jun; Nakabayashi, Kazuhiko; Yoshioka, Takako; Hosoi, Kenji; Kuroda, Makoto

    2016-08-01

    We report the case of an 11-year-old girl with ulcerative colitis refractory to conventional therapy, who was subsequently treated successfully with repeated fecal microbiota transplantation (FMT). The patient was steroid dependent despite several infliximab treatments, and colectomy was proposed to improve quality of life. After repeated FMT, she was able to maintain remission with on minimal dose of steroid. Although her fecal microbiota was dysbiotic before FMT, it was restored to a similar pattern as the donor after repeated FMT.

  17. Structural Analyses of the Ankyrin Repeat Domain of TRPV6 and Related TRPV Ion Channels

    Energy Technology Data Exchange (ETDEWEB)

    Phelps, C.B.; Huang, R.J.; Lishko, P.V.; Wang, R.R.; Gaudet, R. (Harvard)

    2008-06-03

    Transient receptor potential (TRP) proteins are cation channels composed of a transmembrane domain flanked by large N- and C-terminal cytoplasmic domains. All members of the vanilloid family of TRP channels (TRPV) possess an N-terminal ankyrin repeat domain (ARD). The ARD of mammalian TRPV6, an important regulator of calcium uptake and homeostasis, is essential for channel assembly and regulation. The 1.7 A crystal structure of the TRPV6-ARD reveals conserved structural elements unique to the ARDs of TRPV proteins. First, a large twist between the fourth and fifth repeats is induced by residues conserved in all TRPV ARDs. Second, the third finger loop is the most variable region in sequence, length and conformation. In TRPV6, a number of putative regulatory phosphorylation sites map to the base of this third finger. Size exclusion chromatography and crystal packing indicate that the TRPV6-ARD does not assemble as a tetramer and is monomeric in solution. Adenosine triphosphate-agarose and calmodulin-agarose pull-down assays show that the TRPV6-ARD does not interact with either ligand, indicating a different functional role for the TRPV6-ARD than in the paralogous thermosensitive TRPV1 channel. Similar biochemical findings are also presented for the highly homologous mammalian TRPV5-ARD. The implications of the structural and biochemical data on the role of the ankyrin repeats in different TRPV channels are discussed.

  18. Context-Dependent Sensitivity to Mutations Disrupting the Structural Integrity of Individual EGF Repeats in the Mouse Notch Ligand DLL1.

    Science.gov (United States)

    Schuster-Gossler, Karin; Cordes, Ralf; Müller, Julia; Geffers, Insa; Delany-Heiken, Patricia; Taft, Manuel; Preller, Matthias; Gossler, Achim

    2016-03-01

    The highly conserved Notch-signaling pathway mediates cell-to-cell communication and is pivotal for multiple developmental processes and tissue homeostasis in adult organisms. Notch receptors and their ligands are transmembrane proteins with multiple epidermal-growth-factor-like (EGF) repeats in their extracellular domains. In vitro the EGF repeats of mammalian ligands that are essential for Notch activation have been defined. However, in vivo the significance of the structural integrity of each EGF repeat in the ligand ectodomain for ligand function is still unclear. Here, we analyzed the mouse Notch ligand DLL1. We expressed DLL1 proteins with mutations disrupting disulfide bridges in each individual EGF repeat from single-copy transgenes in the HPRT locus of embryonic stem cells. In Notch transactivation assays all mutations impinged on DLL1 function and affected both NOTCH1 and NOTCH2 receptors similarly. An allelic series in mice that carried the same point mutations in endogenous Dll1, generated using a mini-gene strategy, showed that early developmental processes depending on DLL1-mediated NOTCH activation were differently sensitive to mutation of individual EGF repeats in DLL1. Notably, some mutations affected only somite patterning and resulted in vertebral column defects resembling spondylocostal dysostosis. In conclusion, the structural integrity of each individual EGF repeat in the extracellular domain of DLL1 is necessary for full DLL1 activity, and certain mutations in Dll1 might contribute to spondylocostal dysostosis in humans.

  19. Coexistence of 3G repeaters with LTE base stations.

    Science.gov (United States)

    Yeo, Woon-Young; Lee, Sang-Min; Hwang, Gyung-Ho; Kim, Jae-Hoon

    2013-01-01

    Repeaters have been an attractive solution for mobile operators to upgrade their wireless networks at low cost and to extend network coverage effectively. Since the first LTE commercial deployment in 2009, many mobile operators have launched LTE networks by upgrading their 3G and legacy networks. Because all 3G frequency bands are shared with the frequency bands for LTE deployment and 3G mobile operators have an enormous number of repeaters, reusing 3G repeaters in LTE networks is definitely a practical and cost-efficient solution. However, 3G repeaters usually do not support spatial multiplexing with multiple antennas, and thus it is difficult to reuse them directly in LTE networks. In order to support spatial multiplexing of LTE, the role of 3G repeaters should be replaced with small LTE base stations or MIMO-capable repeaters. In this paper, a repeater network is proposed to reuse 3G repeaters in LTE deployment while still supporting multilayer transmission of LTE. Interestingly, the proposed network has a higher cluster throughput than an LTE network with MIMO-capable repeaters.

  20. Mononucleotide repeats are asymmetrically distributed in fungal genes

    Directory of Open Access Journals (Sweden)

    de Graaff Leo H

    2008-12-01

    Full Text Available Abstract Background Systematic analyses of sequence features have resulted in a better characterisation of the organisation of the genome. A previous study in prokaryotes on the distribution of sequence repeats, which are notoriously variable and can disrupt the reading frame in genes, showed that these motifs are skewed towards gene termini, specifically the 5' end of genes. For eukaryotes no such intragenic analysis has been performed, though this could indicate the pervasiveness of this distribution bias, thereby helping to expose the selective pressures causing it. Results In fungal gene repertoires we find a similar 5' bias of intragenic mononucleotide repeats, most notably for Candida spp., whereas e.g. Coccidioides spp. display no such bias. With increasing repeat length, ever larger discrepancies are observed in genome repertoire fractions containing such repeats, with up to an 80-fold difference in gene fractions at repeat lengths of 10 bp and longer. This species-specific difference in gene fractions containing large repeats could be attributed to variations in intragenic repeat tolerance. Furthermore, long transcripts experience an even more prominent bias towards the gene termini, with possibly a more adaptive role for repeat-containing short transcripts. Conclusion Mononucleotide repeats are intragenically biased in numerous fungal genomes, similar to earlier studies on prokaryotes, indicative of a similar selective pressure in gene organization.

  1. Huntington's disease as caused by 34 CAG repeats.

    Science.gov (United States)

    Andrich, Jürgen; Arning, Larissa; Wieczorek, Stefan; Kraus, Peter H; Gold, Ralf; Saft, Carsten

    2008-04-30

    Huntington's disease (HD) is an autosomal dominantly inherited neurodegenerative disorder caused by an abnormal expansion of a polymorphic stretch of CAG repeats in the coding 5' part of the HD gene on chromosome 4p. Expansions of CAG blocks beyond 35 repeats are associated with the clinical presentation of HD. There is an intermediate range of rare alleles between 27 and 35 CAG repeats with a higher risk for further expansion in subsequent generations. Here, we report a 75-year-old male with clinical features of HD and 34 CAG repeat units.

  2. Intragenic tandem repeat variation between Legionella pneumophila strains

    Directory of Open Access Journals (Sweden)

    Jarraud Sophie

    2008-12-01

    Full Text Available Abstract Background Bacterial genomes harbour a large number of tandem repeats, yet the possible phenotypic effects of those found within the coding region of genes are only beginning to be examined. Evidence exists from other organisms that these repeats can be involved in the evolution of new genes, gene regulation, adaptation, resistance to environmental stresses, and avoidance of the immune system. Results In this study, we have investigated the presence and variability in copy number of intragenic tandemly repeated sequences in the genome of Legionella pneumophila, the etiological agent of a severe pneumonia known as Legionnaires' disease. Within the genome of the Philadelphia strain, we have identified 26 intragenic tandem repeat sequences using conservative selection criteria. Of these, seven were "polymorphic" in terms of repeat copy number between a large number of L. pneumophila serogroup 1 strains. These strains were collected from a wide variety of environments and patients in several geographical regions. Within this panel of strains, all but one of these seven genes exhibited statistically different patterns in repeat copy number between samples from different origins (environmental, clinical, and hot springs. Conclusion These results support the hypothesis that intragenic tandem repeats could play a role in virulence and adaptation to different environments. While tandem repeats are an increasingly popular focus of molecular typing studies in prokaryotes, including in L. pneumophila, this study is the first examining the difference in tandem repeat distribution as a function of clinical or environmental origin.

  3. Exaggerated phosphorylation of brain tau protein in CRH KO mice exposed to repeated immobilization stress.

    Science.gov (United States)

    Kvetnansky, Richard; Novak, Petr; Vargovic, Peter; Lejavova, Katarina; Horvathova, Lubica; Ondicova, Katarina; Manz, George; Filipcik, Peter; Novak, Michal; Mravec, Boris

    2016-07-01

    Neuroendocrine and behavioral stress responses are orchestrated by corticotropin-releasing hormone (CRH) and norepinephrine (NE) synthesizing neurons. Recent findings indicate that stress may promote development of neurofibrillary pathology in Alzheimer's disease. Therefore, we investigated relationships among stress, tau protein phosphorylation, and brain NE using wild-type (WT) and CRH-knockout (CRH KO) mice. We assessed expression of phosphorylated tau (p-tau) at the PHF-1 epitope and NE concentrations in the locus coeruleus (LC), A1/C1 and A2/C2 catecholaminergic cell groups, hippocampus, amygdala, nucleus basalis magnocellularis, and frontal cortex of unstressed, singly stressed or repeatedly stressed mice. Moreover, gene expression and protein levels of tyrosine hydroxylase (TH) and CRH receptor mRNA were determined in the LC. Plasma corticosterone levels were also measured. Exposure to a single stress increases tau phosphorylation throughout the brain in WT mice when compared to singly stressed CRH KO animals. In contrast, repeatedly stressed CRH KO mice showed exaggerated tau phosphorylation relative to WT controls. We also observed differences in extent of tau phosphorylation between investigated structures, e.g. the LC and hippocampus. Moreover, CRH deficiency leads to different responses to stress in gene expression of TH, NE concentrations, CRH receptor mRNA, and plasma corticosterone levels. Our data indicate that CRH effects on tau phosphorylation are dependent on whether stress is single or repeated, and differs between brain regions. Our findings indicate that CRH attenuates mechanisms responsible for development of stress-induced tau neuropathology, particularly in conditions of chronic stress. However, the involvement of central catecholaminergic neurons in these mechanisms remains unclear and is in need of further investigation.

  4. Repeated administration of dopaminergic agents in the dorsal hippocampus and morphine-induced place preference.

    Science.gov (United States)

    Zarrindast, M-R; Nasehi, M; Rostami, P; Rezayof, A; Fazli-Tabaei, S

    2005-03-01

    The aim of the present experiments was to investigate whether repeated intra-hippocampal CA1 (intra-CA1) administration of dopaminergic agents can affect morphine-induced conditioned place preference (CPP). Effects of repeated intra-CA1 injections of dopamine (DA) receptor agonists and antagonists on morphine-induced CPP in rats were investigated using an unbiased 3-day schedule of place conditioning. Animals receiving once-daily subcutaneous (s.c.) injections of morphine (1-9 mg/kg) or saline (1.0 ml/kg, s.c.) showed a significant place preference in a dose-dependent manner: the maximum response was observed with 3 mg/kg morphine. Three days' intra-CA1 injections of apomorphine (0.25-1 microg/rat) followed by 5 days free of the drug, significantly decreased morphine CPP (1 and 3 mg/kg, s.c.). Moreover, pre-treatment with the highest dose of apomorphine (1 microg/rat) altered the effect of morphine to an aversive response. The morphine (1 and 3 mg/kg) CPP was also significantly decreased in animals that previously received three intra-CA1 injections of SKF 38393 (2-9 microg/rat), quinpirole (1-3 microg/rat) or sulpiride (1-3 microg/rat), and significantly increased in animals that had previously received three intra-CA1 injections of SCH 23390 (0.02 microg/rat). The 3-day pre-treatment with apomorphine, SKF 38393 or quinpirole reduced locomotor activity in the test session, while SCH 23390 and sulpiride did not have any influence on locomotor activity. It is concluded that repeated injections of DA receptor agents in the dorsal hippocampus, followed by 5 days free of the drugs, can affect morphine reward.

  5. Genus-specific protein binding to the large clusters of DNA repeats (short regularly spaced repeats) present in Sulfolobus genomes

    DEFF Research Database (Denmark)

    Peng, Xu; Brügger, Kim; Shen, Biao

    2003-01-01

    Short regularly spaced repeats (SRSRs) occur in multiple large clusters in archaeal chromosomes and as smaller clusters in some archaeal conjugative plasmids and bacterial chromosomes. The sequence, size, and spacing of the repeats are generally constant within a cluster but vary between clusters...... that are identical in sequence to one of the repeat variants in the S. solfataricus chromosome. Repeats from the pNOB8 cluster were amplified and tested for protein binding with cell extracts from S. solfataricus. A 17.5-kDa SRSR-binding protein was purified from the cell extracts and sequenced. The protein is N...... terminally modified and corresponds to SSO454, an open reading frame of previously unassigned function. It binds specifically to DNA fragments carrying double and single repeat sequences, binding on one side of the repeat structure, and producing an opening of the opposite side of the DNA structure. It also...

  6. Cardiorespiratory Coordination in Repeated Maximal Exercise

    Directory of Open Access Journals (Sweden)

    Sergi Garcia-Retortillo

    2017-06-01

    Full Text Available Increases in cardiorespiratory coordination (CRC after training with no differences in performance and physiological variables have recently been reported using a principal component analysis approach. However, no research has yet evaluated the short-term effects of exercise on CRC. The aim of this study was to delineate the behavior of CRC under different physiological initial conditions produced by repeated maximal exercises. Fifteen participants performed 2 consecutive graded and maximal cycling tests. Test 1 was performed without any previous exercise, and Test 2 6 min after Test 1. Both tests started at 0 W and the workload was increased by 25 W/min in males and 20 W/min in females, until they were not able to maintain the prescribed cycling frequency of 70 rpm for more than 5 consecutive seconds. A principal component (PC analysis of selected cardiovascular and cardiorespiratory variables (expired fraction of O2, expired fraction of CO2, ventilation, systolic blood pressure, diastolic blood pressure, and heart rate was performed to evaluate the CRC defined by the number of PCs in both tests. In order to quantify the degree of coordination, the information entropy was calculated and the eigenvalues of the first PC (PC1 were compared between tests. Although no significant differences were found between the tests with respect to the performed maximal workload (Wmax, maximal oxygen consumption (VO2 max, or ventilatory threshold (VT, an increase in the number of PCs and/or a decrease of eigenvalues of PC1 (t = 2.95; p = 0.01; d = 1.08 was found in Test 2 compared to Test 1. Moreover, entropy was significantly higher (Z = 2.33; p = 0.02; d = 1.43 in the last test. In conclusion, despite the fact that no significant differences were observed in the conventionally explored maximal performance and physiological variables (Wmax, VO2 max, and VT between tests, a reduction of CRC was observed in Test 2. These results emphasize the interest of CRC

  7. Cardiorespiratory Coordination in Repeated Maximal Exercise.

    Science.gov (United States)

    Garcia-Retortillo, Sergi; Javierre, Casimiro; Hristovski, Robert; Ventura, Josep L; Balagué, Natàlia

    2017-01-01

    Increases in cardiorespiratory coordination (CRC) after training with no differences in performance and physiological variables have recently been reported using a principal component analysis approach. However, no research has yet evaluated the short-term effects of exercise on CRC. The aim of this study was to delineate the behavior of CRC under different physiological initial conditions produced by repeated maximal exercises. Fifteen participants performed 2 consecutive graded and maximal cycling tests. Test 1 was performed without any previous exercise, and Test 2 6 min after Test 1. Both tests started at 0 W and the workload was increased by 25 W/min in males and 20 W/min in females, until they were not able to maintain the prescribed cycling frequency of 70 rpm for more than 5 consecutive seconds. A principal component (PC) analysis of selected cardiovascular and cardiorespiratory variables (expired fraction of O2, expired fraction of CO2, ventilation, systolic blood pressure, diastolic blood pressure, and heart rate) was performed to evaluate the CRC defined by the number of PCs in both tests. In order to quantify the degree of coordination, the information entropy was calculated and the eigenvalues of the first PC (PC1) were compared between tests. Although no significant differences were found between the tests with respect to the performed maximal workload (Wmax), maximal oxygen consumption (VO2 max), or ventilatory threshold (VT), an increase in the number of PCs and/or a decrease of eigenvalues of PC1 (t = 2.95; p = 0.01; d = 1.08) was found in Test 2 compared to Test 1. Moreover, entropy was significantly higher (Z = 2.33; p = 0.02; d = 1.43) in the last test. In conclusion, despite the fact that no significant differences were observed in the conventionally explored maximal performance and physiological variables (Wmax, VO2 max, and VT) between tests, a reduction of CRC was observed in Test 2. These results emphasize the interest of CRC evaluation in

  8. Hyperalgesic priming (type II) induced by repeated opioid exposure: maintenance mechanisms.

    Science.gov (United States)

    Araldi, Dioneia; Ferrari, Luiz F; Levine, Jon D

    2017-07-01

    We previously developed a model of opioid-induced neuroplasticity in the peripheral terminal of the nociceptor that could contribute to opioid-induced hyperalgesia, type II hyperalgesic priming. Repeated administration of mu-opioid receptor (MOR) agonists, such as DAMGO, at the peripheral terminal of the nociceptor, induces long-lasting plasticity expressed, prototypically as opioid-induced hyperalgesia and prolongation of prostaglandin E2-induced hyperalgesia. In this study, we evaluated the mechanisms involved in the maintenance of type II priming. Opioid receptor antagonist, naloxone, induced hyperalgesia in DAMGO-primed paws. When repeatedly injected, naloxone-induced hyperalgesia, and hyperalgesic priming, supporting the suggestion that maintenance of priming involves changes in MOR signaling. However, the knockdown of MOR with oligodeoxynucleotide antisense did not reverse priming. Mitogen-activated protein kinase and focal adhesion kinase, which are involved in the Src signaling pathway, previously implicated in type II priming, also inhibited the expression, but not maintenance of priming. However, when Src and mitogen-activated protein kinase inhibitors were coadministered, type II priming was reversed, in male rats. A second model of priming, latent sensitization, induced by complete Freund's adjuvant was also reversed, in males. In females, the inhibitor combination was only able to inhibit the expression and maintenance of DAMGO-induced priming when knockdown of G-protein-coupled estrogen receptor 30 (GPR30) in the nociceptor was performed. These findings demonstrate that the maintenance of DAMGO-induced type II priming, and latent sensitization is mediated by an interaction between, Src and MAP kinases, which in females is GPR30 dependent.

  9. HIGH AFFINITY ACYLATING ANTAGONISTS FOR MUSCARINIC RECEPTORS

    Science.gov (United States)

    Baumgold, Jesse; Karton, Yishai; Malka, Naftali; Jacobson, Kenneth A.

    2012-01-01

    Summary The muscarinic antagonists pirenzepine and telenzepine were derivitized as alkylamino derivatives at a site on the molecules corresponding to a region of bulk tolerance in receptor binding. The distal primary amino groups were coupled to the cross-linking reagent meta-phenylene diisothiocyanate, resulting in two isothiocyanate derivatives that were found to inhibit muscarinic receptors irreversibly and in a dose-dependent fashion. Preincubation of rat forebrain membranes with an isothiocyanate derivative followed by radioligand binding using [3H]N-methylscopolamine diminished the Bmax value, but did not affect the Kd value. The receptor binding site was not restored upon repeated washing, indicating that irreversible inhibition had occurred. IC50 values for the irreversible inhibition at rat forebrain muscarinic receptors were 0.15 nM and 0.19 nM, for derivatives of pirenzepine and telenzepine, respectively. The isothiocyanate derivative of pirenzepine was non-selective as an irreversible muscarinic inhibitor, and the corresponding derivative prepared from telenzepine was 5-fold selective for forebrain (mainly m1) vs. heart (m2) muscarinic receptors. PMID:1625525

  10. Stress regulates endocannabinoid-CB1 receptor signaling.

    Science.gov (United States)

    Hillard, Cecilia J

    2014-10-01

    The CB1 cannabinoid receptor is a G protein coupled receptor that is widely expressed throughout the brain. The endogenous ligands for the CB1 receptor (endocannabinoids) are N-arachidonylethanolamine and 2-arachidonoylglycerol; together the endocannabinoids and CB1R subserve activity dependent, retrograde inhibition of neurotransmitter release in the brain. Deficiency of CB1 receptor signaling is associated with anhedonia, anxiety, and persistence of negative memories. CB1 receptor-endocannabinoid signaling is activated by stress and functions to buffer or dampen the behavioral and endocrine effects of acute stress. Its role in regulation of neuronal responses is more complex. Chronic variable stress exposure reduces endocannabinoid-CB1 receptor signaling and it is hypothesized that the resultant deficiency in endocannabinoid signaling contributes to the negative consequences of chronic stress. On the other hand, repeated exposure to the same stress can sensitize CB1 receptor signaling, resulting in dampening of the stress response. Data are reviewed that support the hypothesis that CB1 receptor signaling is stress responsive and that maintaining robust endocannabinoid/CB1 receptor signaling provides resilience against the development of stress-related pathologies.

  11. On the Applicability of Elastic Network Models for the Study of RNA CUG Trinucleotide Repeat Overexpansion.

    Directory of Open Access Journals (Sweden)

    Àlex L González

    Full Text Available Non-coding RNAs play a pivotal role in a number of diseases promoting an aberrant sequestration of nuclear RNA-binding proteins. In the particular case of myotonic dystrophy type 1 (DM1, a multisystemic autosomal dominant disease, the formation of large non-coding CUG repeats set up long-tract hairpins able to bind muscleblind-like proteins (MBNL, which trigger the deregulation of several splicing events such as cardiac troponin T (cTNT and insulin receptor's, among others. Evidence suggests that conformational changes in RNA are determinant for the recognition and binding of splicing proteins, molecular modeling simulations can attempt to shed light on the structural diversity of CUG repeats and to understand their pathogenic mechanisms. Molecular dynamics (MD are widely used to obtain accurate results at atomistic level, despite being very time consuming, and they contrast with fast but simplified coarse-grained methods such as Elastic Network Model (ENM. In this paper, we assess the application of ENM (traditionally applied on proteins for studying the conformational space of CUG repeats and compare it to conventional and accelerated MD conformational sampling. Overall, the results provided here reveal that ANM can provide useful insights into dynamic rCUG structures at a global level, and that their dynamics depend on both backbone and nucleobase fluctuations. On the other hand, ANM fail to describe local U-U dynamics of the rCUG system, which require more computationally expensive methods such as MD. Given that several limitations are inherent to both methods, we discuss here the usefulness of the current theoretical approaches for studying highly dynamic RNA systems such as CUG trinucleotide repeat overexpansions.

  12. Significant molecular and systemic adaptations after repeated sprint training in hypoxia.

    Directory of Open Access Journals (Sweden)

    Raphael Faiss

    Full Text Available While intermittent hypoxic training (IHT has been reported to evoke cellular responses via hypoxia inducible factors (HIFs but without substantial performance benefits in endurance athletes, we hypothesized that repeated sprint training in hypoxia could enhance repeated sprint ability (RSA performed in normoxia via improved glycolysis and O(2 utilization. 40 trained subjects completed 8 cycling repeated sprint sessions in hypoxia (RSH, 3000 m or normoxia (RSN, 485 m. Before (Pre- and after (Post- training, muscular levels of selected mRNAs were analyzed from resting muscle biopsies and RSA tested until exhaustion (10-s sprint, work-to-rest ratio 1:2 with muscle perfusion assessed by near-infrared spectroscopy. From Pre- to Post-, the average power output of all sprints in RSA was increased (p<0.01 to the same extent (6% vs 7%, NS in RSH and in RSN but the number of sprints to exhaustion was increased in RSH (9.4±4.8 vs. 13.0±6.2 sprints, p<0.01 but not in RSN (9.3±4.2 vs. 8.9±3.5. mRNA concentrations of HIF-1α (+55%, carbonic anhydrase III (+35% and monocarboxylate transporter-4 (+20% were augmented (p<0.05 whereas mitochondrial transcription factor A (-40%, peroxisome proliferator-activated receptor gamma coactivator 1α (-23% and monocarboxylate transporter-1 (-36% were decreased (p<0.01 in RSH only. Besides, the changes in total hemoglobin variations (Δ[tHb] during sprints throughout RSA test increased to a greater extent (p<0.01 in RSH. Our findings show larger improvement in repeated sprint performance in RSH than in RSN with significant molecular adaptations and larger blood perfusion variations in active muscles.

  13. Turkish population data on the short tandem repeat locus TPOX

    DEFF Research Database (Denmark)

    Vural, B; Poda, M; Atlioglu, E;

    1998-01-01

    Allele and genotype frequencies were determined for the STR (short tandem repeat) locus TPOX in a random Turkish population sample of 200 individuals.......Allele and genotype frequencies were determined for the STR (short tandem repeat) locus TPOX in a random Turkish population sample of 200 individuals....

  14. PILER-CR: Fast and accurate identification of CRISPR repeats

    Directory of Open Access Journals (Sweden)

    Edgar Robert C

    2007-01-01

    Full Text Available Abstract Background Sequencing of prokaryotic genomes has recently revealed the presence of CRISPR elements: short, highly conserved repeats separated by unique sequences of similar length. The distinctive sequence signature of CRISPR repeats can be found using general-purpose repeat- or pattern-finding software tools. However, the output of such tools is not always ideal for studying these repeats, and significant effort is sometimes needed to build additional tools and perform manual analysis of the output. Results We present PILER-CR, a program specifically designed for the identification and analysis of CRISPR repeats. The program executes rapidly, completing a 5 Mb genome in around 5 seconds on a current desktop computer. We validate the algorithm by manual curation and by comparison with published surveys of these repeats, finding that PILER-CR has both high sensitivity and high specificity. We also present a catalogue of putative CRISPR repeats identified in a comprehensive analysis of 346 prokaryotic genomes. Conclusion PILER-CR is a useful tool for rapid identification and classification of CRISPR repeats. The software is donated to the public domain. Source code and a Linux binary are freely available at http://www.drive5.com/pilercr.

  15. Repeatable mechanochemical activation of dynamic covalent bonds in thermoplastic elastomers.

    Science.gov (United States)

    Imato, Keiichi; Kanehara, Takeshi; Nojima, Shiki; Ohishi, Tomoyuki; Higaki, Yuji; Takahara, Atsushi; Otsuka, Hideyuki

    2016-08-18

    Repeated mechanical scission and recombination of dynamic covalent bonds incorporated in segmented polyurethane elastomers are demonstrated by utilizing a diarylbibenzofuranone-based mechanophore and by the design of the segmented polymer structures. The repeated mechanochemical reactions can accompany clear colouration and simultaneous fading.

  16. PCR-free digital minisatellite tandem repeat genotyping.

    Science.gov (United States)

    Chen, Yuchao; Seo, Tae Seok

    2011-06-01

    We demonstrated a proof-of-concept for novel minisatellite tandem repeat typing, called PCR-free digital VNTR (variable number tandem repeat) typing, which is composed of three steps: a ligation reaction instead of PCR thermal cycling, magnetic bead-based solid-phase capture for purification, and an elongated sample stacking microcapillary electrophoresis (μCE) for sensitive digital coding of repeat number. We designed a 16-bp fluorescently labeled ligation probe which is complementary to a repeat unit of a biotinylated synthetic template mimicking the human D1S80 VNTR locus and is randomly hybridized with the minisatellite tandem repeats. A quick isothermal ligation reaction was followed to link the adjacent ligation probes on the DNA templates, and then the ligated products were purified by streptavidin-coated magnetic beads. After a denaturing step, a large amount of ligated products whose size difference was equivalent to the repeat unit were released and recovered. Through the elongated sample stacking μCE separation on a microdevice, the fluorescence signal of the ligated products was generated in the electropherogram and the peak number was directly counted which was exactly matched with the repeat number of VNTR locus. We could successfully identify the minisatellite tandem repeat number with only 5 fmol of DNA template in 30 min.

  17. Development of Repeated Sprint Ability in Talented Youth Basketball Players

    NARCIS (Netherlands)

    te Wierike, Sanne C. M.; de Jong, Mark C.; Tromp, Eveline J. Y.; Vuijk, Pieter J.; Lemmink, Koen A. P. M.; Malina, Robert M.; Elferink-Gemser, Marije T.; Visscher, Chris

    te Wierike, SCM, de Jong, MC, Tromp, EJY, Vuijk, PJ, Lemmink, KAPM, Malina, RM, Elferink-Gemser, MT, and Visscher, C. Development of repeated sprint ability in talented youth basketball players. J Strength Cond Res 28(4): 928-934, 2014-Factors affecting repeated sprint ability (RSA) were evaluated

  18. Vocabulary Learning through Assisted and Unassisted Repeated Reading

    Science.gov (United States)

    Webb, Stuart; Chang, Anna C-S.

    2012-01-01

    Previous research investigating the effects of unassisted and assisted repeated reading has primarily focused on how each approach may contribute to improvement in reading comprehension and fluency. Incidental learning of the form and meaning of unknown or partially known words encountered through assisted and unassisted repeated reading has yet…

  19. Impact of Inclusion or Exclusion of Repeaters on Test Equating

    Science.gov (United States)

    Puhan, Gautam

    2011-01-01

    This study examined the effect of including or excluding repeaters on the equating process and results. New forms of two tests were equated to their respective old forms using either all examinees or only the first timer examinees in the new form sample. Results showed that for both tests used in this study, including or excluding repeaters in the…

  20. Effect of Repeated Simulations by Standardized Patients on Intercase Reliability.

    Science.gov (United States)

    Colliver, Jerry A.; And Others

    1991-01-01

    A study using five Southern Illinois University senior medical school classes (n=350 students) investigated whether having a standardized patient simulate a case repeatedly in postclerkship medical student evaluation affects the measure's reliability. Results suggest that repeated simulation had little or no effect on intercase reliability of…

  1. Analysis of CR1 Repeats in the Zebra Finch Genome

    Directory of Open Access Journals (Sweden)

    George E. Liu

    2013-06-01

    Full Text Available Most bird species have smaller genomes and fewer repeats than mammals. Chicken Repeat 1 (CR1 repeat is one of the most abundant families of repeats, ranging from ~133,000 to ~187,000 copies accounting for ~50 to ~80% of the interspersed repeats in the zebra finch and chicken genomes, respectively. CR1 repeats are believed to have arisen from the retrotransposition of a small number of master elements, which gave rise to multiple CR1 subfamilies in the chicken. In this study, we performed a global assessment of the divergence distributions, phylogenies, and consensus sequences of CR1 repeats in the zebra finch genome. We identified and validated 34 CR1 subfamilies and further analyzed the correlation between these subfamilies. We also discovered 4 novel lineage-specific CR1 subfamilies in the zebra finch when compared to the chicken genome. We built various evolutionary trees of these subfamilies and concluded that CR1 repeats may play an important role in reshaping the structure of bird genomes.

  2. Repeated Witnessing of Conspecifics in Pain : Effects on Emotional Contagion

    NARCIS (Netherlands)

    Carrillo, Maria; Migliorati, Filippo; Bruls, Rune; Han, Yingying; Heinemans, Mirjam; Pruis, Ilanah; Gazzola, V.; Keysers, C.

    2015-01-01

    Witnessing of conspecifics in pain has been shown to elicit socially triggered freezing in rodents. It is unknown how robust this response is to repeated exposure to a cage-mate experiencing painful stimulation. To address this question, shock-experienced Observer rats repeatedly witnessed familiar

  3. Secret key rates for an encoded quantum repeater

    Science.gov (United States)

    Bratzik, Sylvia; Kampermann, Hermann; Bruß, Dagmar

    2014-03-01

    We investigate secret key rates for the quantum repeater using encoding [L. Jiang et al., Phys. Rev. A 79, 032325 (2009), 10.1103/PhysRevA.79.032325] and compare them to the standard repeater scheme by Briegel, Dür, Cirac, and Zoller. The former scheme has the advantage of a minimal consumption of classical communication. We analyze the trade-off in the secret key rate between the communication time and the required resources. For this purpose we introduce an error model for the repeater using encoding which allows for input Bell states with a fidelity smaller than one, in contrast to the model given by L. Jiang et al. [Phys. Rev. A 79, 032325 (2009), 10.1103/PhysRevA.79.032325]. We show that one can correct additional errors in the encoded connection procedure of this repeater and develop a suitable decoding algorithm. Furthermore, we derive the rate of producing entangled pairs for the quantum repeater using encoding and give the minimal parameter values (gate quality and initial fidelity) for establishing a nonzero secret key. We find that the generic quantum repeater is optimal regarding the secret key rate per memory per second and show that the encoded quantum repeater using the simple three-qubit repetition code can even have an advantage with respect to the resources compared to other recent quantum repeater schemes with encoding.

  4. CTG trinucleotide repeat "big jumps": large expansions, small mice.

    Directory of Open Access Journals (Sweden)

    Mário Gomes-Pereira

    2007-04-01

    Full Text Available Trinucleotide repeat expansions are the genetic cause of numerous human diseases, including fragile X mental retardation, Huntington disease, and myotonic dystrophy type 1. Disease severity and age of onset are critically linked to expansion size. Previous mouse models of repeat instability have not recreated large intergenerational expansions ("big jumps", observed when the repeat is transmitted from one generation to the next, and have never attained the very large tract lengths possible in humans. Here, we describe dramatic intergenerational CTG*CAG repeat expansions of several hundred repeats in a transgenic mouse model of myotonic dystrophy type 1, resulting in increasingly severe phenotypic and molecular abnormalities. Homozygous mice carrying over 700 trinucleotide repeats on both alleles display severely reduced body size and splicing abnormalities, notably in the central nervous system. Our findings demonstrate that large intergenerational trinucleotide repeat expansions can be recreated in mice, and endorse the use of transgenic mouse models to refine our understanding of triplet repeat expansion and the resulting pathogenesis.

  5. Development of Repeated Sprint Ability in Talented Youth Basketball Players

    NARCIS (Netherlands)

    te Wierike, Sanne C. M.; de Jong, Mark C.; Tromp, Eveline J. Y.; Vuijk, Pieter J.; Lemmink, Koen A. P. M.; Malina, Robert M.; Elferink-Gemser, Marije T.; Visscher, Chris

    2014-01-01

    te Wierike, SCM, de Jong, MC, Tromp, EJY, Vuijk, PJ, Lemmink, KAPM, Malina, RM, Elferink-Gemser, MT, and Visscher, C. Development of repeated sprint ability in talented youth basketball players. J Strength Cond Res 28(4): 928-934, 2014-Factors affecting repeated sprint ability (RSA) were evaluated i

  6. Monotone missing data and repeated controls of fallible authors

    NARCIS (Netherlands)

    Raats, V.M.

    2004-01-01

    Chapters 2 and 3 focus on repeated audit controls with categorical variables. Chapter 4 and 5 introduce and analyse a very general multivariate regression model for (monotone) missing data. In the final Chapter 6 the previous chapters are combined into a more realistic model for repeated audit contr

  7. Development of Repeated Sprint Ability in Talented Youth Basketball Players

    NARCIS (Netherlands)

    te Wierike, Sanne C. M.; de Jong, Mark C.; Tromp, Eveline J. Y.; Vuijk, Pieter J.; Lemmink, Koen A. P. M.; Malina, Robert M.; Elferink-Gemser, Marije T.; Visscher, Chris

    2014-01-01

    te Wierike, SCM, de Jong, MC, Tromp, EJY, Vuijk, PJ, Lemmink, KAPM, Malina, RM, Elferink-Gemser, MT, and Visscher, C. Development of repeated sprint ability in talented youth basketball players. J Strength Cond Res 28(4): 928-934, 2014-Factors affecting repeated sprint ability (RSA) were evaluated i

  8. Contraceptive Use among Women Seeking Repeat Abortion in ...

    African Journals Online (AJOL)

    AJRH Managing Editor

    Compared with women seeking their first abortion, significantly more repeat abortion clients had ever used ... social sigma24, repeat abortion may be as well, perhaps even .... 0.1198. aIncludes hostess, cleaner, waitress, housemaid, commercial sex worker, and cook ..... be made to support the process by strengthening.

  9. Witness recall across repeated interviews in a case of repeated abuse.

    Science.gov (United States)

    Brubacher, Sonja P; La Rooy, David

    2014-02-01

    In this illustrative case study we examine the three forensic interviews of a girl who experienced repeated sexual abuse from ages 7 to 11. She disclosed the abuse after watching a serialized television show that contained a storyline similar to her own experience. This triggered an investigation that ended in successful prosecution of the offender. Because this case involved abuse that was repeated on a weekly basis for 4 years we thus investigated the degree to which the child's narrative reflected specific episodes or generic accounts, and both the interviewer's and child's attempts to elicit and provide, respectively, specific details across the 3 interviews collected in a 1 month period. Across the 3 interviews, the child's account was largely generic, yet on a number of occasions she provided details specific to individual incidents (episodic leads) that could have been probed further. As predicted: earlier interviews were characterized more by episodic than generic prompts and the reverse was true for the third interview; the child often responded using the same style of language (episodic or generic) as the interviewer; and open questions yielded narrative information. We discuss the importance of adopting children's words to specify occurrences, and the potential benefits of permitting generic recall in investigative interviews on children's ability to provide episodic leads. Despite the fact that the testimony was characterized by generic information about what usually happened, rather than specific episodic details about individual occurrences, this case resulted in successful prosecution.

  10. Treating glioblastoma multiforme with selective high-dose liposomal doxorubicin chemotherapy induced by repeated focused ultrasound

    Directory of Open Access Journals (Sweden)

    Yang FY

    2012-02-01

    ratio (P < 0.001. Combining repeated pulsed HIFU with AP-1 liposomal doxorubicin or untargeted liposomal doxorubicin has similar antitumor effects.Conclusion: This study demonstrates that targeted or untargeted liposomal doxorubicin, followed by repeated pulsed HIFU, is a promising high-dose chemotherapy method that allows the desired brain tumor region to be targeted specifically.Keywords: repeated focused ultrasound, interleukin-4 receptor, blood-brain barrier, brain tumor, target drug delivery

  11. Effects of 3-repeat tau on taxol mobility through microtubules

    Science.gov (United States)

    Park, Hyunjoo; Fygenson, Deborah; Kim, Mahn Won

    2005-03-01

    Both the anti-cancer drug taxol and the microtubule-associated protein tau suppress dynamics of microtubules (MT). We have observed taxol mobility with full-length 3-repeat tau, one of six tau isoforms, using fluorescence recovery after photobleaching (FRAP) on MTs and compare with earlier results on recombinant full-length adult 4-repeat tau. Taxol mobility becomes highly sensitive to taxol concentration in the presence of 3-repeat tau (up to 1:1 molar ratio) as it does in the presence of 4-repeat tau, but is 2 to 3 times faster at low taxol concentrations. Fitting to a mean-field binding reaction model [J.L. Ross et.al, PNAS 101:12910-5 (2004)] suggests that the presence of 3-repeat tau enhances taxol movement through pores in the MT walls.

  12. The origin and evolution of variable number tandem repeat of CLEC4M gene in the global human population.

    Directory of Open Access Journals (Sweden)

    Hui Li

    Full Text Available CLEC4M is a C-type lectin gene serving as cell adhesion receptor and pathogen recognition receptor. It recognizes several pathogens of important public health concern. In particular, a highly polymorphic variable number tandem repeat (VNTR at the neck-region of CLEC4M had been associated with genetic predisposition to some infectious diseases. To gain insight into the origin and evolution of this VNTR in CLEC4M, we studied 21 Africans, 20 Middle Easterns, 35 Europeans, 38 Asians, 13 Oceania, and 18 Americans (a total of 290 chromosomes from the (Human Genome Diversity Panel HGDP-CEPH panel; these samples covered most of alleles of this VNTR locus present in human populations. We identified a limited number of haplotypes among the basic repeat subunits that is 69 base pairs in length. Only 8 haplotypes were found. Their sequence identities were determined in the 290 chromosomes. VNTR alleles of different repeat length (from 4 to 9 repeats were analyzed for composition and orientation of these subunits. Our results showed that the subunit configuration of the same repeat number of VNTR locus from different populations were, in fact, virtually identical. It implies that most of the VNTR alleles existed before dispersion of modern humans outside Africa. Further analyses indicate that the present diversity profile of this locus in worldwide populations is generated from the effect of migration of different tribes and neutral evolution. Our findings do not support the hypothesis that the origin of the VNTR alleles were arisen by independent (separate mutation events and caused by differential allele advantage and natural selection as suggested by previous report based on SNP data.

  13. Consistency of Repeated Naming in Aphasia

    Directory of Open Access Journals (Sweden)

    Elizabeth E. Galletta

    2015-09-01

    Full Text Available Background People with mild aphasia and healthy elderly often exhibit similar impairments on language tests of word retrieval. However, variable practice effects in object naming by three individuals with aphasia compared to young and elderly adults have been reported (Wingfield et al. 2006. Wingfield et al. (2006 found that naming of the same pictures of objects over five trials demonstrated decreasing response latencies over repeated trials for both older and younger adults, but not for individuals with aphasia. In fact, among their three participants with aphasia, response latencies in the consecutive trials differed considerably. The authors suggested that different underlying processes may be involved in word retrieval for people with aphasia compared to adults without brain injuries. In our study we aimed to further consider the effect of practice on both object and action naming in individuals with mild aphasia. Method One woman with anomic aphasia (age 38 years; WAB Aphasia Quotient = 88 and one healthy woman (age 25 years participated. Both were native English speakers and reported 18 years of formal education. Participants were tested individually, with a set of 27 object pictures and a set of 27 action pictures presented one at a time on a computer screen. The participants were instructed to name each picture as quickly as possible as soon as each picture appeared on the screen. There were 10 trials of each set of pictures, with different random orders for each trial. The order of presentation of the object and action picture sets alternated across participants. Naming responses were recorded to computer sound files for later measurements of response latencies. A brief tone was presented simultaneous with the picture onset, allowing later measurement of response latencies from the onset of picture presentation to the onset of the participant’s correct response. Results Our findings resembled those reported in Wingfield et al. (2006

  14. CAG trinucleotide RNA repeats interact with RNA-binding proteins

    Energy Technology Data Exchange (ETDEWEB)

    McLaughlin, B.A.; Eberwine, J.; Spencer, C. [Univ. of Pennsylvania, Philadelphia, PA (United States)

    1996-09-01

    Genes associated with several neurological diseases are characterized by the presence of an abnormally long trinucleotide repeat sequence. By way of example, Huntington`s disease (HD), is characterized by selective neuronal degeneration associated with the expansion of a polyglutamine-encoding CAG tract. Normally, this CAG tract is comprised of 11-34 repeats, but in HD it is expanded to >37 repeats in affected individuals. The mechanism by which CAG repeats cause neuronal degeneration is unknown, but it has been speculated that the expansion primarily causes abnormal protein functioning, which in turn causes HD pathology. Other mechanisms, however, have not been ruled out. Interactions between RNA and RNA-binding proteins have previously been shown to play a role in the expression of several eukaryotic genes. Herein, we report the association of cytoplasmic proteins with normal length and extended CAG repeats, using gel shift and LJV crosslinking assays. Cytoplasmic protein extracts from several rat brain regions, including the striatum and cortex, sites of neuronal degeneration in HD, contain a 63-kD RNA-binding protein that specifically interacts with these CAG-repeat sequences. These protein-RNA interactions are dependent on the length of the CAG repeat, with longer repeats binding substantially more protein. Two CAG repeat-binding proteins are present in human cortex and striatum; one comigrates with the rat protein at 63 kD, while the other migrates at 49 kD. These data suggest mechanisms by which RNA-binding proteins may be involved in the pathological course of trinucleotide repeat-associated neurological diseases. 47 refs., 5 figs.

  15. Repeatability Evaluation of Finger Tapping Device with Magnetic Sensors

    Science.gov (United States)

    Sano, Yuko; Kandori, Akihiko; Shima, Keisuke; Tamura, Yasuhiro; Takagi, Hiroshi; Tsuji, Toshio; Noda, Masafumi; Higashikawa, Fumiko; Yokoe, Masaru; Sakoda, Saburo

    We tested the repeatability of a finger tapping device with magnetic sensors to determine its reliability. This device, which was developed to assist in the diagnosis of movement disorders such as Parkinson's disease (PD) and strokes, measures the distance between the first and index fingers during finger tapping movements (opening and closing the fingers repeatedly). We evaluated three types of repeatability based on ICC (interclass correlation coefficient) and Welch's test (test for equal means in a oneway layout): repeatability when measured at different times, when using different devices, and when using different measurers. We calculated these three types for three finger tapping tasks on both hands for 21 characteristics calculated from finger tapping waveforms. Results demonstrated that the repeatability when using different devices is high regardless of the task or hand. The repeatability when measuring at different times and when using different measurers is high at some tasks, but not all. One of the finger tapping tasks (finger tapping movement with the largest amplitude and highest velocity), which is used in a conventional PD diagnosis method (UPDRS), does not have enough repeatability, while other tasks show high repeatability. Results also showed that five characteristics have the highest repeatability (ICC ≥ 0.5 or significance probability of Welch's test ≥ 5% in all tasks): “total moving distance,” “average of local minimum acceleration in opening motion,” “average of local minimum acceleration in closing motion,” “average of local maximum distance” and “average of local minimum velocity”. These results clearly demonstrate the strong repeatability of this device and lead to more precise diagnosis of movement disorders.

  16. Strategy When Faced with Failure: Persistence and Degree Attainment of Course Repeaters versus Non-Repeaters. AIR 2002 Forum Paper.

    Science.gov (United States)

    Fenton, Kathleen S.

    Graduation and persistence rates were compared for 184 students, 92 of whom had repeated multiple courses or at least 1 course 3 times. A control group of 92 nonrepeating students was drawn from the remaining 303 students of the entire 1996 cohort. There was no difference between the graduation rate of repeaters and nonrepeaters. The persistence…

  17. Acetylcholine receptor antibody

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003576.htm Acetylcholine receptor antibody To use the sharing features on this page, please enable JavaScript. Acetylcholine receptor antibody is a protein found in the blood ...

  18. Repeating earthquakes recorded by Liaoning Regional Seismograph Network

    Institute of Scientific and Technical Information of China (English)

    LI Yu-tong; WU Zhong-liang; JIANG Chang-sheng; LI Guang-ping

    2008-01-01

    In the list of 'repeating pairs' or 'doublets' of earthquakes in China identified by Schaff and Richards using tele-seismic waveform cross-correlation, there were 23 repeating pairs located in Liaoning Province. In this study the waveforms of these events were cross-correlated using records from Liaoning Regional Seismograph Network (LRSN), and the 'repeating events' in the sense of regional waveform cross-correlation were obtained. The result was compared with that of Schaff and Richards and was used for the assessment of the seismic phase picking and event location practice of LRSN. The result shows that 'repeating events' in the sense of teleseismic waveform cross-correlation and those in the sense of regional waveform cross-correlation have significant difference, al-though with some overlap. However, the overall assessment of the location accuracy and the phase pick errors of LRSN by using these two sets of 'repeating events', respectively, provides similar results, while 'repeating events' in the sense of regional waveform cross-correlation seem to be better performing in such an assessment. With the assumption that the separation between the 'repeaters' be less than 1 km, the uncertainty in routine earthquake location of LRSN is estimated to be below 5 km, with the average of 2 km. In the observational bulletins of LRSN the time error in phase picking is estimated to be within±Is for 94% Pg readings and for 88% Sg readings.

  19. Repeat breeding: Incidence, risk factors and diagnosis in buffaloes

    Directory of Open Access Journals (Sweden)

    Chandra Shekher Saraswat

    2016-04-01

    Full Text Available Repeat breeding in buffaloes was evaluated in terms of incidence, risk factors and diagnosis. The incidence of repeat breeding is low in buffaloes however in different studies the incidence varied from 0.70% to 30%. Because of seasonal suppression of fertility repeat breeding in buffaloes should be limited to the breeding season. Spring and winter calving, first parity, peri-parturient disease and lactation are significant risk factors for repeat breeding in buffaloes. The etiologies of repeat breeding in buffaloes can be failure of fertilization and early embryonic deaths. Only a few of causes of failure of fertilization have been identified in buffaloes. Ovulatory disturbances and ovarian cysts are uncommon in buffaloes and cysts have poor clinical manifestation. Endometritis is the common female cause of fertilization failures in buffaloes whereas poor semen quality and improper insemination are the bull side factors for fertilization failures. Early embryonic deaths are common in buffaloes mated/inseminated during the end of the breeding season due to a low luteal progesterone however embryonic deaths occur late (<25 days in buffaloes. Diagnostic approaches for repeat breeding include vaginoscopic and transrectal examination and uterine cytology for genital health. More precise evaluations of the ovarian and uterine function can be obtained by ultrasonographic and hysteroscopic examinations performed sequentially however, precise diagnosis of the cause of repeat breeding seems difficult.

  20. Exploring the repeat protein universe through computational protein design.

    Science.gov (United States)

    Brunette, T J; Parmeggiani, Fabio; Huang, Po-Ssu; Bhabha, Gira; Ekiert, Damian C; Tsutakawa, Susan E; Hura, Greg L; Tainer, John A; Baker, David

    2015-12-24

    A central question in protein evolution is the extent to which naturally occurring proteins sample the space of folded structures accessible to the polypeptide chain. Repeat proteins composed of multiple tandem copies of a modular structure unit are widespread in nature and have critical roles in molecular recognition, signalling, and other essential biological processes. Naturally occurring repeat proteins have been re-engineered for molecular recognition and modular scaffolding applications. Here we use computational protein design to investigate the space of folded structures that can be generated by tandem repeating a simple helix-loop-helix-loop structural motif. Eighty-three designs with sequences unrelated to known repeat proteins were experimentally characterized. Of these, 53 are monomeric and stable at 95 °C, and 43 have solution X-ray scattering spectra consistent with the design models. Crystal structures of 15 designs spanning a broad range of curvatures are in close agreement with the design models with root mean square deviations ranging from 0.7 to 2.5 Å. Our results show that existing repeat proteins occupy only a small fraction of the possible repeat protein sequence and structure space and that it is possible to design novel repeat proteins with precisely specified geometries, opening up a wide array of new possibilities for biomolecular engineering.

  1. ACCA phosphopeptide recognition by the BRCT repeats of BRCA1.

    Science.gov (United States)

    Ray, Hind; Moreau, Karen; Dizin, Eva; Callebaut, Isabelle; Venezia, Nicole Dalla

    2006-06-16

    The tumour suppressor gene BRCA1 encodes a 220 kDa protein that participates in multiple cellular processes. The BRCA1 protein contains a tandem of two BRCT repeats at its carboxy-terminal region. The majority of disease-associated BRCA1 mutations affect this region and provide to the BRCT repeats a central role in the BRCA1 tumour suppressor function. The BRCT repeats have been shown to mediate phospho-dependant protein-protein interactions. They recognize phosphorylated peptides using a recognition groove that spans both BRCT repeats. We previously identified an interaction between the tandem of BRCA1 BRCT repeats and ACCA, which was disrupted by germ line BRCA1 mutations that affect the BRCT repeats. We recently showed that BRCA1 modulates ACCA activity through its phospho-dependent binding to ACCA. To delineate the region of ACCA that is crucial for the regulation of its activity by BRCA1, we searched for potential phosphorylation sites in the ACCA sequence that might be recognized by the BRCA1 BRCT repeats. Using sequence analysis and structure modelling, we proposed the Ser1263 residue as the most favourable candidate among six residues, for recognition by the BRCA1 BRCT repeats. Using experimental approaches, such as GST pull-down assay with Bosc cells, we clearly showed that phosphorylation of only Ser1263 was essential for the interaction of ACCA with the BRCT repeats. We finally demonstrated by immunoprecipitation of ACCA in cells, that the whole BRCA1 protein interacts with ACCA when phosphorylated on Ser1263.

  2. Secure quantum network coding for controlled repeater networks

    Science.gov (United States)

    Shang, Tao; Li, Jiao; Liu, Jian-wei

    2016-07-01

    To realize efficient quantum communication based on quantum repeater, we propose a secure quantum network coding scheme for controlled repeater networks, which adds a controller as a trusted party and is able to control the process of EPR-pair distribution. As the key operations of quantum repeater, local operations and quantum communication are designed to adopt quantum one-time pad to enhance the function of identity authentication instead of local operations and classical communication. Scheme analysis shows that the proposed scheme can defend against active attacks for quantum communication and realize long-distance quantum communication with minimal resource consumption.

  3. Instability of trinucleotidic repeats during chromatin remodeling in spermatids.

    Science.gov (United States)

    Simard, Olivier; Grégoire, Marie-Chantal; Arguin, Mélina; Brazeau, Marc-André; Leduc, Frédéric; Marois, Isabelle; Richter, Martin V; Boissonneault, Guylain

    2014-11-01

    Transient DNA breaks and evidence of DNA damage response have recently been reported during the chromatin remodeling process in haploid spermatids, creating a potential window of enhanced genetic instability. We used flow cytometry to achieve separation of differentiating spermatids into four highly purified populations using transgenic mice harboring 160 CAG repeats within exon 1 of the human Huntington disease gene (HTT). Trinucleotic repeat expansion was found to occur immediately following the chromatin remodeling steps, confirming the genetic instability of the process and pointing to the origin of paternal anticipation observed in some trinucleotidic repeats diseases.

  4. Analysis of repeated outcome measures from longitudinal studies

    Institute of Scientific and Technical Information of China (English)

    Yuanjia WANG; Naihua DUAN

    2011-01-01

    @@ In many clinical studies repeated measurements of an outcome are collected over time.For example,in an 8-week study of treatment for obsessive compulsive disorder,the severity of the disorder may be measured weekly using the Yale-Brown-Obsessive-Compulsive-Disorder-Scale (YBOCS).For each study participant who completes the study,there will be nine repeated measures of YBOCS (a baseline assessment plus eight assessments during the course of treatment).Such a study in which participants are followed and measured repeatedly over time is called a longitudinal study and the resulting data are called longitudinal data.

  5. Frequency Bandwidth of Half-Wave Impedance Repeater

    Directory of Open Access Journals (Sweden)

    Marek Dvorsky

    2012-01-01

    Full Text Available This article brings in the second part general information about half-wave impedance repeater. The third part describes the basic functional principles of the half-wave impedance repeater using Smith chart. The main attention is focused in part four on the derivation of repeater frequency bandwidth depending on characteristics and load impedance of unknown feeder line. Derived dependences are based on the elementary features of the feeder lines with specific length. The described functionality is proved in part 4.3 by measurement of transformed impedance using vector several unbalanced feeder lines and network analyzer VNWA3+.

  6. Androgen receptor abnormalities

    NARCIS (Netherlands)

    A.O. Brinkmann (Albert); G.G.J.M. Kuiper (George); C. Ris-Stalpers (Carolyn); H.C.J. van Rooij (Henri); G. Romalo (G.); G. Trifiro (Gianluca); E. Mulder (Eppo); L. Pinsky (L.); H.U. Schweikert (H.); J. Trapman (Jan)

    1991-01-01

    markdownabstract__Abstract__ The human androgen receptor is a member of the superfamily of steroid hormone receptors. Proper functioning of this protein is a prerequisite for normal male sexual differentiation and development. The cloning of the human androgen receptor cDNA and the elucidation of t

  7. Mammalian Sweet Taste Receptors

    National Research Council Canada - National Science Library

    Nelson, Greg; Hoon, Mark A; Chandrashekar, Jayaram; Zhang, Yifeng; Ryba, Nicholas J.P; Zuker, Charles S

    2001-01-01

    ... and information coding, and have focused on the isolation and characterization of genes encoding sweet and bitter taste receptors. The identification of taste receptors generates powerful molecular tools to investigate not only the function of taste receptor cells, but also the logic of taste coding. For example, defining the size and diversity of the re...

  8. The effects of repeated opioid administration on locomotor activity: II. Unidirectional cross-sensitization to cocaine.

    Science.gov (United States)

    Smith, Mark A; Greene-Naples, Jennifer L; Felder, Jennifer N; Iordanou, Jordan C; Lyle, Megan A; Walker, Katherine L

    2009-08-01

    Sensitization refers to an increase in sensitivity to the effects of a drug and is believed to play a role in the etiology of substance use disorders. Cross-sensitization has been observed between drugs from different pharmacological classes and may play a role in the escalation of drug use in polydrug-abusing populations. The purpose of this study was to examine cross-sensitization between opioids and cocaine and to determine the extent to which cross-sensitization is mediated by an opioid's selectivity for mu, kappa, and delta receptors. Separate groups of rats were treated with opioid receptor agonists and antagonists every other day for 10 days, and the locomotor effects of cocaine were tested 8 days later. The mu agonists, morphine and buprenorphine, and the delta agonist, BW373U86 [(+/-)-4-[(R(*))-[(2S(*),5R(*))-2,5-dimethyl-4-(2-propenyl)-1-piperazinyl]-(3-hydroxyphenyl)methyl]-N,N-diethylbenzamide hydrochloride], produced cross-sensitization to cocaine, such that repeated administration of these drugs over a 10-day period significantly enhanced cocaine's locomotor effects when tested later. Coadministration of the opioid antagonist naltrexone prevented morphine and buprenorphine from producing cross-sensitization. Coadministration of naltrexone, but not the delta antagonist naltrindole, also prevented BW373U86 from producing cross-sensitization. The kappa agonist spiradoline failed to produce cross-sensitization, but coadministration of spiradoline prevented morphine and buprenorphine from producing cross-sensitization. The ability of spiradoline to block cross-sensitization was itself blocked by the kappa antagonist nor-binaltorphimine. The mixed mu/kappa opioids butorphanol, nalbuphine, and nalorphine did not produce cross-sensitization under any condition examined. These data indicate that agonist activity at mu receptors positively modulates cross-sensitization between opioids and cocaine, whereas agonist activity at kappa receptors negatively modulates

  9. Repeated morphine treatment influences operant and spatial learning differentially

    Institute of Scientific and Technical Information of China (English)

    Mei-Na WANG; Zhi-Fang DONG; Jun CAO; Lin XU

    2006-01-01

    Objective To investigate whether repeated morphine exposure or prolonged withdrawal could influence operant and spatial learning differentially. Methods Animals were chronically treated with morphine or subjected to morphine withdrawal. Then, they were subjected to two kinds of learning: operant conditioning and spatial learning.Results The acquisition of both simple appetitive and cued operant learning was impaired after repeated morphine treatment. Withdrawal for 5 weeks alleviated the impairments. Single morphine exposure disrupted the retrieval of operant memory but had no effect on rats after 5-week withdrawal. Contrarily, neither chronic morphine exposure nor 5-week withdrawal influenced spatial learning task of the Morris water maze. Nevertheless, the retrieval of spatial memory was impaired by repeated morphine exposure but not by 5-week withdrawal. Conclusion These observations suggest that repeated morphine exposure can influence different types of learning at different aspects, implicating that the formation of opiate addiction may usurp memory mechanisms differentially.

  10. Highly Informative Simple Sequence Repeat (SSR) Markers for Fingerprinting Hazelnut

    Science.gov (United States)

    Simple sequence repeat (SSR) or microsatellite markers have many applications in breeding and genetic studies of plants, including fingerprinting of cultivars and investigations of genetic diversity, and therefore provide information for better management of germplasm collections. They are repeatab...

  11. On the role of memory errors in quantum repeaters

    CERN Document Server

    Hartmann, L; Dür, W; Kraus, B

    2006-01-01

    We investigate the influence of memory errors in the quantum repeater scheme for long-range quantum communication. We show that the communication distance is limited in standard operation mode due to memory errors resulting from unavoidable waiting times for classical signals. We show how to overcome these limitations by (i) improving local memory, and (ii) introducing two new operational modes of the quantum repeater. In both operational modes, the repeater is run blindly, i.e. without waiting for classical signals to arrive. In the first scheme, entanglement purification protocols based on one-way classical communication are used allowing to communicate over arbitrary distances. However, the error thresholds for noise in local control operations are very stringent. The second scheme makes use of entanglement purification protocols with two-way classical communication and inherits the favorable error thresholds of the repeater run in standard mode. One can increase the possible communication distance by an o...

  12. Analysis of Simple Sequence Repeats in Genomes of Rhizobia

    Institute of Scientific and Technical Information of China (English)

    GAO Ya-mei; HAN Yi-qiang; TANG Hui; SUN Dong-mei; WANG Yan-jie; WANG Wei-dong

    2008-01-01

    Simple sequence repeats (SSRs) or microsatellites, as genetic markers, are ubiquitous in genomes of various organisms. The analysis of SSR in rhizobia genome provides useful information for a variety of applications in population genetics of rhizobia. We analyzed the occurrences, relative abundance, and relative density of SSRs, the most common in Bradyrhizobium japonicum, Mesorhizobium loti, and Sinorhizobium meliloti genomes se-quenced in the microorganisms tandem repeats database, and SSRs in the three species genomes were compared with each other. The result showed that there were 1 410, 859, and 638 SSRs in B. japonicum, M. loti, and 5. meliloti genomes, respectively. In the genomes of B. japonicum, M. loti, and 5. meliloti, tetranucleotide, pentanucleotide, and hexanucleotide repeats were more abundant and indicated higher mutation rates in these species. The least abundance was mononucleotide repeat. The SSRs type and distribution were similar among these species.

  13. simple sequence repeat (SSR) markers in genetic analysis of

    African Journals Online (AJOL)

    Yomi

    2012-08-28

    Aug 28, 2012 ... In the present study, 78 mapped simple sequence repeat (SSR) markers representing 11 ... mean (UPGMA) with each cluster representing a particular Vigna species. ..... were reported to be more frequent than the compound.

  14. Study of simple sequence repeat (SSR) polymorphism for biotic ...

    African Journals Online (AJOL)

    home

    2013-10-02

    Oct 2, 2013 ... back cross breeding; SSRs, simple sequence repeats; PIC, polymorphism ..... PIC values were reported in barley wheat and rice (Gu et ... doubled-haploid rice population. Theor. ... Grover A, Aishwarya V, Sharma PC (2007).

  15. Markerless modification of trinucleotide repeat loci in BACs.

    Science.gov (United States)

    Benzow, Kellie A; Koob, Michael D

    2013-01-01

    Transcription and splicing of human genes are regulated by nucleotide sequences encoded across large segments of our genome, and trinucleotide repeat expansion mutations can have both profound and subtle effects on these processes. In the course of our work to understand the impact of the Spinocerebellar Ataxia type 8 (SCA8) CTG repeat expansion on the transcription and splicing of the RNAs encoded near the SCA8 locus, we have developed a set of reagents and protocols for modifying large genomic BAC clones of this region. We describe the two-step procedure that allows us to precisely replace unexpanded trinucleotide repeats with expanded variants of these repeat sequences without leaving any exogenous sequences in the final constructs, and we discuss how this approach can be adapted to make other desired sequence changes to these genomic clones.

  16. Discriminant analysis for repeated measures data: a review

    Directory of Open Access Journals (Sweden)

    Lisa Lix

    2010-09-01

    Full Text Available Discriminant analysis (DA encompasses procedures for classifying observations into groups (i.e., predictive discriminative analysis and describing the relative importance of variables for distinguishing amongst groups (i.e., descriptive discriminative analysis. In recent years, a number of developments have occurred in DA procedures for the analysis of data from repeated measures designs. Specifically, DA procedures have been developed for repeated measures data characterized by missing observations and/or unbalanced measurement occasions, as well as high-dimensional data in which measurements are collected repeatedly on two or more variables. This paper reviews the literature on DA procedures for univariate and multivariate repeated measures data, focusing on covariance pattern and linear mixed-effects models. A numeric example illustrates their implementation using SAS software.

  17. Bayesian model selection of informative hypotheses for repeated measurements

    NARCIS (Netherlands)

    Mulder, Joris; Klugkist, I.G.; Schoot, Rens van de; Meeus, W.H.J.; Selfhout, Maarten; Hoijtink, Herbert

    2010-01-01

    When analyzing repeated measurements data, researchers often have expectations about the relations between the measurement means. The expectations can often be formalized using equality and inequality constraints between (i) the measurement means over time, (ii) the measurement means between

  18. Bayesian model selection of informative hypotheses for repeated measurements

    NARCIS (Netherlands)

    Mulder, J.|info:eu-repo/dai/nl/304823031; Klugkist, I.G.|info:eu-repo/dai/nl/27330089X; Van de Schoot, R.|info:eu-repo/dai/nl/304833207; Meeus, W.H.J.|info:eu-repo/dai/nl/070442215; van Zalk, M.H.W.|info:eu-repo/dai/nl/304836214; Hoijtink, H.J.A.|info:eu-repo/dai/nl/075184427

    2009-01-01

    When analyzing repeated measurements data, researchers often have expectations about the relations between the measurement means. The expectations can often be formalized using equality and inequality constraints between (i) the measurement means over time, (ii) the measurement means between groups,

  19. Correct use of repeated measures analysis of variance.

    Science.gov (United States)

    Park, Eunsik; Cho, Meehye; Ki, Chang-Seok

    2009-02-01

    In biomedical research, researchers frequently use statistical procedures such as the t-test, standard analysis of variance (ANOVA), or the repeated measures ANOVA to compare means between the groups of interest. There are frequently some misuses in applying these procedures since the conditions of the experiments or statistical assumptions necessary to apply these procedures are not fully taken into consideration. In this paper, we demonstrate the correct use of repeated measures ANOVA to prevent or minimize ethical or scientific problems due to its misuse. We also describe the appropriate use of multiple comparison tests for follow-up analysis in repeated measures ANOVA. Finally, we demonstrate the use of repeated measures ANOVA by using real data and the statistical software package SPSS (SPSS Inc., USA).

  20. [Melatonin receptor agonist].

    Science.gov (United States)

    Uchiyama, Makoto

    2015-06-01

    Melatonin is a hormone secreted by the pineal gland and is involved in the regulation of human sleep-wake cycle and circadian rhythms. The melatonin MT1 and MT2 receptors located in the suprachiasmatic nucleus in the hypothalamus play a pivotal role in the sleep-wake regulation. Based on the fact that MT1 receptors are involved in human sleep onset process, melatonin receptor agonists have been developed to treat insomnia. In this article, we first reviewed functions of melatonin receptors with special reference to MT1 and MT2, and properties and clinical application of melatonin receptor agonists as hypnotics.

  1. Synaptic proteins and receptors defects in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Jianling eChen

    2014-09-01

    Full Text Available Recent studies have found that hundreds of genetic variants, including common and rare variants, rare and de novo mutations, and common polymorphisms have contributed to the occurrence of autism spectrum disorders (ASDs. The mutations in a number of genes such as neurexin, neuroligin, postsynaptic density protein 95 (PSD-95, SH3 and multiple ankyrin repeat domains 3 (SHANK3, synapsin, gephyrin, cadherin (CDH and protocadherin (PCDH, thousand-and-one-amino acid 2 kinase (TAOK2, and contactin (CNTN, have been shown to play important roles in the development and function of synapses. In addition, synaptic receptors, such as gamma-aminobutyric acid (GABA receptors and glutamate receptors, have also been associated with ASDs. This review will primarily focus on the defects of synaptic proteins and receptors associated with ASDs and their roles in the pathogenesis of ASDs via synaptic pathways.

  2. The Pathogenic Role of Low Range Repeats in SCA17.

    Directory of Open Access Journals (Sweden)

    Jung Hwan Shin

    Full Text Available SCA17 is an autosomal dominant cerebellar ataxia with expansion of the CAG/CAA trinucleotide repeats in the TATA-binding protein (TBP gene. SCA17 can have various clinical presentations including parkinsonism, ataxia, chorea and dystonia. SCA17 is diagnosed by detecting the expanded CAG repeats in the TBP gene; however, in the literature, pathologic repeat numbers as low as 41 overlap with normal repeat numbers.The subjects in this study included patients with involuntary movement disorders such as cerebellar ataxia, parkinsonism, chorea and dystonia who visited Seoul National University Hospital between Jan. 2006 and Apr. 2014 and were screened for SCA17. Those who were diagnosed with other genetic diseases or nondegenerative diseases were excluded. DNA from healthy subjects who did not have a family history of parkinsonism, ataxia, psychiatric symptoms, chorea or dystonia served as the control. In total, 5242 chromosomes from 2099 patients and 522 normal controls were analyzed.The total number of patients included in the analysis was 2099 (parkinsonism, 1706; ataxia, 345; chorea, 37; and dystonia, 11. In the normal control, up to 44 repeats were found. In the 44 repeat group, there were 7 (0.3% patients and 1 (0.2% normal control. In 43 repeat group, there were 8 (0.4% patients and 2 (0.4% normal controls. In the 42 repeat group, there were 16 (0.8% patients and 3 (0.6% normal controls. In 41 repeat group, there were 48 (2.3% patients and 8 (1.5% normal controls. Considering the overlaps and non-significant differences in allelic frequencies between the patients and the normal controls with low-expansions, we could not determine a definitive cutoff value for the pathologic CAG repeat number of SCA17.Because the statistical analysis between the normal controls and patients with low range expansions failed to show any differences so far, we must consider that clinical cases with low range expansions could be idiopathic movement disorders showing

  3. Evaluation of Mammalian Interspersed Repeats to investigate the goat genome

    Directory of Open Access Journals (Sweden)

    P. Mariani

    2010-01-01

    Full Text Available Among the repeated sequences present in most eukaryotic genomes, SINEs (Short Interspersed Nuclear Elements are widely used to investigate evolution in the mammalian order (Buchanan et al., 1999. One family of these repetitive sequences, the MIR (Mammalian Interspersed Repeats; Jurka et al., 1995, is ubiquitous in all mammals.MIR elements are tRNA-derived SINEs and are identifiable by a conserved core region of about 70 nucleotides.

  4. The evolution of filamin – A protein domain repeat perspective

    Science.gov (United States)

    Light, Sara; Sagit, Rauan; Ithychanda, Sujay S.; Qin, Jun; Elofsson, Arne

    2013-01-01

    Particularly in higher eukaryotes, some protein domains are found in tandem repeats, performing broad functions often related to cellular organization. For instance, the eukaryotic protein filamin interacts with many proteins and is crucial for the cytoskeleton. The functional properties of long repeat domains are governed by the specific properties of each individual domain as well as by the repeat copy number. To provide better understanding of the evolutionary and functional history of repeating domains, we investigated the mode of evolution of the filamin domain in some detail. Among the domains that are common in long repeat proteins, sushi and spectrin domains evolve primarily through cassette tandem duplications while scavenger and immunoglobulin repeats appear to evolve through clustered tandem duplications. Additionally, immunoglobulin and filamin repeats exhibit a unique pattern where every other domain shows high sequence similarity. This pattern may be the result of tandem duplications, serve to avert aggregation between adjacent domains or it is the result of functional constraints. In filamin, our studies confirm the presence of interspersed integrin binding domains in vertebrates, while invertebrates exhibit more varied patterns, including more clustered integrin binding domains. The most notable case is leech filamin, which contains a 20 repeat expansion and exhibits unique dimerization topology. Clearly, invertebrate filamins are varied and contain examples of similar adjacent integrin-binding domains. Given that invertebrate integrin shows more similarity to the weaker filamin binder, integrin β3, it is possible that the distance between integrin-binding domains is not as crucial for invertebrate filamins as for vertebrates. PMID:22414427

  5. The evolution of filamin-a protein domain repeat perspective.

    Science.gov (United States)

    Light, Sara; Sagit, Rauan; Ithychanda, Sujay S; Qin, Jun; Elofsson, Arne

    2012-09-01

    Particularly in higher eukaryotes, some protein domains are found in tandem repeats, performing broad functions often related to cellular organization. For instance, the eukaryotic protein filamin interacts with many proteins and is crucial for the cytoskeleton. The functional properties of long repeat domains are governed by the specific properties of each individual domain as well as by the repeat copy number. To provide better understanding of the evolutionary and functional history of repeating domains, we investigated the mode of evolution of the filamin domain in some detail. Among the domains that are common in long repeat proteins, sushi and spectrin domains evolve primarily through cassette tandem duplications while scavenger and immunoglobulin repeats appear to evolve through clustered tandem duplications. Additionally, immunoglobulin and filamin repeats exhibit a unique pattern where every other domain shows high sequence similarity. This pattern may be the result of tandem duplications, serve to avert aggregation between adjacent domains or it is the result of functional constraints. In filamin, our studies confirm the presence of interspersed integrin binding domains in vertebrates, while invertebrates exhibit more varied patterns, including more clustered integrin binding domains. The most notable case is leech filamin, which contains a 20 repeat expansion and exhibits unique dimerization topology. Clearly, invertebrate filamins are varied and contain examples of similar adjacent integrin-binding domains. Given that invertebrate integrin shows more similarity to the weaker filamin binder, integrin β3, it is possible that the distance between integrin-binding domains is not as crucial for invertebrate filamins as for vertebrates. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. DSR-Based Selective Repeat ARQ Protocol in MANET

    Institute of Scientific and Technical Information of China (English)

    张全新; 宋瀚涛

    2003-01-01

    The efficient route algorithms involved in mobile ad hoc network(MANET) are studied. An arrangement of a combination of the traditional dynamic source routing(DSR) protocol is put forward and the selective repeat ARQ protocol is put forward by analyzing and studying them in detail and providing the scheme. In networks, especially in wireless networks, the nodes are capable to process data much faster than transmission, the DSR-based selective repeat ARQ protocol has real meanings in MANET.

  7. Are major repeater patients addicted to suicidal behavior?

    Science.gov (United States)

    Blasco-Fontecilla, Hilario; Artieda-Urrutia, Paula; Berenguer-Elias, Nuria; Garcia-Vega, Juan Manuel; Fernandez-Rodriguez, Monica; Rodriguez-Lomas, Cesar; Gonzalez-Villalobos, Isabel; Iruela-Cuadrado, Luis; de Leon, José

    2014-01-01

    The literature provides support for the hypothesis that some major repeaters (individuals with >=5 lifetime suicide attempts) are addicted to suicidal behavior (SB). This study explores whether major repeaters are addicted to SB or not using 7 criteria: tolerance (Criterion 1), withdrawal (Criterion 2), loss of control (Criterion 3), problems in quitting/cutting down (Criterion 4), much time spent using (Criterion 5), substantial reduction in activities (Criterion 6), and adverse physiological/physical consequences (Criterion 7). Total dependence on SB was indicated by the presence of 3 or more of the 7 criteria in the last 12 months. This cross-sectional study at Puerta de Hierro University Hospital (Madrid, Spain) recruited 118 suicide attempters including 8 major repeaters (7%, 8/118), who were all females. The association between each SB addiction criterion, physiological dependence and total dependence with major repeater status was tested for significance and for effect size with odds ratios (ORs) and their 95% confidence intervals. As hypothesized, major repeaters met significantly higher frequency of criteria for total dependence on SB, OR=62.9 (6.4-615). A backward stepwise logistic regression model was used to provide an OR between major repeater status and total dependence status corrected by confounding variables. Age, panic disorder without agoraphobia, borderline personality disorder, history of psychiatric inpatient admission, and total dependence on SB were introduced as independent variables with major repeater status as the dependent variable. The model selected total dependence and age as the remaining significant variables in the last step. Accordingly, major repeaters appear to be addicted to SB.

  8. A note on renegotiation in repeated Bertrand duopolies

    DEFF Research Database (Denmark)

    Andersson, Ola; Wengström, Erik Roland

    2007-01-01

    Weak Renegotiation-Proofness (WRP) singles out marginal cost pricing as a unique pure-strategy equilibrium of the infinitely repeated Bertrand duopoly. We show that, with a discrete strategy space, WRP does not eliminate any relevant subgame perfect equilibrium outcome......Weak Renegotiation-Proofness (WRP) singles out marginal cost pricing as a unique pure-strategy equilibrium of the infinitely repeated Bertrand duopoly. We show that, with a discrete strategy space, WRP does not eliminate any relevant subgame perfect equilibrium outcome...

  9. Repeated nondiagnostic result of thyroid fine-needle aspiration biopsy.

    Science.gov (United States)

    Ziemiańska, Klaudia; Kopczyński, Janusz; Kowalska, Aldona

    2016-01-01

    Fine-needle aspiration biopsy (FNAB) is the most accurate and cost-effective method to evaluate the risk of malignancy of thyroid nodules, but approximately 1-24% of FNABs generate a nondiagnostic result (ND-FNAB). The aim of this study was to determine the predictive factors of a repeated nondiagnostic result of FNAB. A total of 4018 FNABs performed in a territorial referral centre were analysed, of which 288 (7.17%) were nondiagnostic. Medical records were available for 245 biopsies performed in 228 patients. The retrospective analysis of factors that may influence a repeat ND-FNAB, including demographic, clinical and ultrasound characteristics, was performed. A repeat FNAB was performed in 159 nodules giving a diagnostic result in 79.2% of cases. The time between the biopsies ranged from 1 to 611 days (mean 154.4, median 119). The timing of a repeat FNAB did not significantly alter the diagnostic output (p = 0.29). In the univariate analysis, significant predictors of a repeat ND-FNAB were older patient age (p = 0.02), L-thyroxine supplementation (p = 0.05), and a history of (131)I therapy (p < 0.0001). In the multivariate analysis, only a history of (131)I therapy was a statistically significant risk factor for a repeat ND-FNAB (p = 0.002). Patients with a history of (131)I therapy and ND-FNAB should undergo periodic ultrasonographic assessment rather than a repeat biopsy. The interval between repeated FNABs recommended by guidelines does not affect the diagnostic output.

  10. Linking SNPs to CAG repeat length in Huntington's disease patients.

    Science.gov (United States)

    Liu, Wanzhao; Kennington, Lori A; Rosas, H Diana; Hersch, Steven; Cha, Jang-Ho; Zamore, Phillip D; Aronin, Neil

    2008-11-01

    Allele-specific silencing using small interfering RNAs targeting heterozygous single-nucleotide polymorphisms (SNPs) is a promising therapy for human trinucleotide repeat diseases such as Huntington's disease. Linking SNP identities to the two HTT alleles, normal and disease-causing, is a prerequisite for allele-specific RNA interference. Here we describe a method, SNP linkage by circularization (SLiC), to identify linkage between CAG repeat length and nucleotide identity of heterozygous SNPs using Huntington's disease patient peripheral blood samples.

  11. Failure Characteristic of Laser Cladding Samples on Repeated Impact

    Institute of Scientific and Technical Information of China (English)

    SHI Shi-hong; ZHENG Qi-guang; FU Ge-yan; ZHANG Jin-ping

    2004-01-01

    Using self-made impact fatigue test instruments and related analytic devices,the mechanical components with laser cladding layer have been attempted.It is found that,on repeated impact force,several failure modes of the components include the surface cracks,surface plastic deformation,corrosive pitting and coat collapse,etc.The paper reported the test method and initial analysis conclusions about the unique failure characteristics of the mechanical components on repeated impact load.

  12. Memory-based quantum repeater in quantum information communication

    Institute of Scientific and Technical Information of China (English)

    Wu Xiang-Sheng

    2004-01-01

    This paper studies the quantum repeater in quantum information communication. We propose to introduce the photon buffer mechanism for storing photons, which uses fibre delay loops as photon memories and a programmable 1 × N switcher for distributing photon delay time. Meanwhile, we also consider entanglement purification and entanglement swapping restoration at an entanglement purification or entanglement swapping failure and introduce a protection link mechanism that allows the photonic quantum repeater of a broken connection to initiate a connection restoration process.

  13. Inflammation and Vascular Effects after Repeated Intratracheal Instillations of Carbon Black and Lipopolysaccharide

    DEFF Research Database (Denmark)

    Christophersen, Daniel Vest; Jacobsen, Nicklas Raun; Jensen, Ditte Marie;

    2016-01-01

    .5% plasma extracted from CB-exposed ApoE-/- mice caused vasoconstriction in aorta rings isolated from naïve mice; this effect was abolished by the treatment with the serotonin receptor antagonist Ketanserin. In conclusion, repeated pulmonary exposure to nanosized CB and LPS caused lung inflammation without......Inflammation and oxidative stress are considered the main drivers of vasomotor dysfunction and progression of atherosclerosis after inhalation of particulate matter. In addition, new studies have shown that particle exposure can induce the level of bioactive mediators in serum, driving vascular......- and systemic toxicity. We aimed to investigate if pulmonary inflammation would accelerate nanoparticle-induced atherosclerotic plaque progression in Apolipoprotein E knockout (ApoE-/-) mice. ApoE -/- mice were exposed to vehicle, 8.53 or 25.6 μg nanosized carbon black (CB) alone or spiked with LPS (0.2 μg...

  14. Morphine Analgesia Modification in Normotensive and Hypertensive Female Rats after Repeated Fluoxetine Administration.

    Science.gov (United States)

    Kosiorek-Witek, Anna; Makulska-Nowak, Helena Elżbieta

    2016-01-01

    The purpose of this investigation was to determine through the use of fluoxetine the effect of administering a serotonin reuptake inhibitor over several days on the antinociceptive action of μ-morphine type opioid receptor agonist. Investigations were performed on rats of both sexes, both the WKY normotensive strains as well as on the SHR genetically conditioned hypertensive strains. Results showed that the efficacy of morphine analgesia is higher in the SHR strain compared to normotensive rats (WKY). Surprisingly, repeated administration of fluoxetine reduced morphine analgesia, with the weakening of opioid antinociceptive action comparable to the duration of serotonin reuptake inhibitor administration. It was also concluded that the antinociceptive action of morphine in female rats and the alteration of its efficacy as a result of fluoxetine premedication for several days depend on oestrus cycle phase. The highest sensitivity of female rats to morphine was reported in the dioestrus and oestrus phases; much lower values were reported for the metoestrus phase.

  15. Inflammation and Vascular Effects after Repeated Intratracheal Instillations of Carbon Black and Lipopolysaccharide

    DEFF Research Database (Denmark)

    Christophersen, Daniel Vest; Jacobsen, Nicklas Raun; Jensen, Ditte Marie

    2016-01-01

    -and systemic toxicity. We aimed to investigate if pulmonary inflammation would accelerate nanoparticle-induced atherosclerotic plaque progression in Apolipoprotein E knockout (ApoE-/-) mice. ApoE-/- mice were exposed to vehicle, 8.53 or 25.6 mu g nanosized carbon black (CB) alone or spiked with LPS (0.2 mu g...... mediators in plasma of exposed ApoE-/- mice was assessed in aorta rings isolated from naive C57BL/6 mice. Pulmonary exposure to CB and/or LPS resulted in pulmonary inflammation with a robust influx of neutrophils. The CB exposure did not promote plaque progression in aorta or BCA. Incubation with 0.......5% plasma extracted from CB-exposed ApoE-/- mice caused vasoconstriction in aorta rings isolated from naive mice; this effect was abolished by the treatment with the serotonin receptor antagonist Ketanserin. In conclusion, repeated pulmonary exposure to nanosized CB and LPS caused lung inflammation without...

  16. Leucine-rich repeat transmembrane proteins instruct discrete dendrite targeting in an olfactory map.

    Science.gov (United States)

    Hong, Weizhe; Zhu, Haitao; Potter, Christopher J; Barsh, Gabrielle; Kurusu, Mitsuhiko; Zinn, Kai; Luo, Liqun

    2009-12-01

    Olfactory systems utilize discrete neural pathways to process and integrate odorant information. In Drosophila, axons of first-order olfactory receptor neurons (ORNs) and dendrites of second-order projection neurons (PNs) form class-specific synaptic connections at approximately 50 glomeruli. The mechanisms underlying PN dendrite targeting to distinct glomeruli in a three-dimensional discrete neural map are unclear. We found that the leucine-rich repeat (LRR) transmembrane protein Capricious (Caps) was differentially expressed in different classes of PNs. Loss-of-function and gain-of-function studies indicated that Caps instructs the segregation of Caps-positive and Caps-negative PN dendrites to discrete glomerular targets. Moreover, Caps-mediated PN dendrite targeting was independent of presynaptic ORNs and did not involve homophilic interactions. The closely related protein Tartan was partially redundant with Caps. These LRR proteins are probably part of a combinatorial cell-surface code that instructs discrete olfactory map formation.

  17. Impaired effect of activation of rat hippocampal 5-HT7 receptors, induced by treatment with the 5-HT7 receptor antagonist SB 269970.

    Science.gov (United States)

    Kusek, M; Sowa, J; Tokarski, K; Hess, G

    2015-04-01

    Effects of the 5-HT(7) receptor antagonist SB 269970, administered for 14 days (1.25 mg/kg), were studied in ex vivo slices of rat hippocampus. To activate the 5-HT(7) receptor, 5-carboxamidotryptamine (5-CT, 200 nM) was applied in the presence of WAY 100635 (2 μM), a 5-HT(1A) receptor antagonist. In contrast to control preparations, no 5-HT(7) receptor-mediated increase in excitability nor depolarization and an increase in the input resistance of CA1 and CA3 pyramidal neurons were present in slices prepared from rats treated with SB 269970. The treatment also abolished the stimulatory effect of 5-HT(7) receptor activation on spontaneous excitatory postsynaptic currents recorded from CA1 stratum radiatum/lacunosum-moleculare interneurons. These data demonstrate that repeated administration of SB 269970 impairs the reactivity of the CA1 hippocampal neuronal network to 5-HT(7) receptor activation.

  18. Dopamine receptors and hypertension.

    Science.gov (United States)

    Banday, Anees Ahmad; Lokhandwala, Mustafa F

    2008-08-01

    Dopamine plays an important role in regulating renal function and blood pressure. Dopamine synthesis and dopamine receptor subtypes have been shown in the kidney. Dopamine acts via cell surface receptors coupled to G proteins; the receptors are classified via pharmacologic and molecular cloning studies into two families, D1-like and D2-like. Two D1-like receptors cloned in mammals, the D1 and D5 receptors (D1A and D1B in rodents), are linked to adenylyl cyclase stimulation. Three D2-like receptors (D2, D3, and D4) have been cloned and are linked mainly to adenylyl cyclase inhibition. Activation of D1-like receptors on the proximal tubules inhibits tubular sodium reabsorption by inhibiting Na/H-exchanger and Na/K-adenosine triphosphatase activity. Reports exist of defective renal dopamine production and/or dopamine receptor function in human primary hypertension and in genetic models of animal hypertension. In humans with essential hypertension, renal dopamine production in response to sodium loading is often impaired and may contribute to hypertension. A primary defect in D1-like receptors and an altered signaling system in proximal tubules may reduce dopamine-mediated effects on renal sodium excretion. The molecular basis for dopamine receptor dysfunction in hypertension is being investigated, and may involve an abnormal posttranslational modification of the dopamine receptor.

  19. Structure and Notch receptor binding of the tandem WWE domain of Deltex.

    Science.gov (United States)

    Zweifel, Mark E; Leahy, Daniel J; Barrick, Doug

    2005-11-01

    Deltex is a cytosolic effector of Notch signaling thought to bind through its N-terminal domain to the Notch receptor. Here we report the structure of the Drosophila Deltex N-terminal domain, which contains two tandem WWE sequence repeats. The WWE repeats, which adopt a novel fold, are related by an approximate two-fold axis of rotation. Although the WWE repeats are structurally distinct, they interact extensively and form a deep cleft at their junction that appears well suited for ligand binding. The two repeats are thermodynamically coupled; this coupling is mediated in part by a conserved segment that is immediately C-terminal to the second WWE domain. We demonstrate that although the Deltex WWE tandem is monomeric in solution, it forms a heterodimer with the ankyrin domain of the Notch receptor. These results provide structural and functional insight into how Deltex modulates Notch signaling, and how WWE modules recognize targets for ubiquitination.

  20. Quantum repeater based on cavity QED evolutions and coherent light

    Science.gov (United States)

    Gonţa, Denis; van Loock, Peter

    2016-05-01

    In the framework of cavity QED, we propose a quantum repeater scheme that uses coherent light and chains of atoms coupled to optical cavities. In contrast to conventional repeater schemes, in our scheme there is no need for an explicit use of two-qubit quantum logical gates by exploiting solely the cavity QED evolution. In our previous work (Gonta and van Loock in Phys Rev A 88:052308, 2013), we already proposed a quantum repeater in which the entanglement between two neighboring repeater nodes was distributed using controlled displacements of input coherent light, while the produced low-fidelity entangled pairs were purified using ancillary (four-partite) entangled states. In the present work, the entanglement distribution is realized using a sequence of controlled phase shifts and displacements of input coherent light. Compared to previous coherent-state-based distribution schemes for two-qubit entanglement, our scheme here relies only upon a simple discrimination of two coherent states with opposite signs, which can be performed in a quantum mechanically optimal fashion via a beam splitter and two on-off detectors. For the entanglement purification, we employ a method that avoids the use of extra entangled ancilla states. Our repeater scheme exhibits reasonable fidelities and repeater rates providing an attractive platform for long-distance quantum communication.