WorldWideScience

Sample records for repeat kinase-2 lrrk2

  1. Development of inducible leucine-rich repeat kinase 2 (LRRK2) cell lines for therapeutics development in Parkinson's disease.

    Science.gov (United States)

    Huang, Liang; Shimoji, Mika; Wang, Juan; Shah, Salim; Kamila, Sukanta; Biehl, Edward R; Lim, Seung; Chang, Allison; Maguire-Zeiss, Kathleen A; Su, Xiaomin; Federoff, Howard J

    2013-10-01

    The pathogenic mechanism(s) contributing to loss of dopamine neurons in Parkinson's disease (PD) remain obscure. Leucine-rich repeat kinase 2 (LRRK2) mutations are linked, as a causative gene, to PD. LRRK2 mutations are estimated to account for 10% of familial and between 1 % and 3 % of sporadic PD. LRRK2 proximate single nucleotide polymorphisms have also been significantly associated with idiopathic/sporadic PD by genome-wide association studies. LRRK2 is a multidomain-containing protein and belongs to the protein kinase super-family. We constructed two inducible dopaminergic cell lines expressing either human-LRRK2-wild-type or human-LRRK2-mutant (G2019S). Phenotypes of these LRRK2 cell lines were examined with respect to cell viability, morphology, and protein function with or without induction of LRRK2 gene expression. The overexpression of G2019S gene promoted (1) low cellular metabolic activity without affecting cell viability, (2) blunted neurite extension, and (3) increased phosphorylation at S910 and S935. Our observations are consistent with reported general phenotypes in LRRK2 cell lines by other investigators. We used these cell lines to interrogate the biological function of LRRK2, to evaluate their potential as a drug-screening tool, and to investigate screening for small hairpin RNA-mediated LRRK2 G2019S gene knockdown as a potential therapeutic strategy. A proposed LRRK2 kinase inhibitor (i.e., IN-1) decreased LRRK2 S910 and S935 phosphorylation in our MN9DLRRK2 cell lines in a dose-dependent manner. Lentivirus-mediated transfer of LRRK2 G2019S allele-specific small hairpin RNA reversed the blunting of neurite extension caused by LRRK2 G2019S overexpression. Taken together, these inducible LRRK2 cell lines are suitable reagents for LRRK2 functional studies, and the screening of potential LRRK2 therapeutics.

  2. Transcriptional responses to loss or gain of function of the leucine-rich repeat kinase 2 (LRRK2) gene uncover biological processes modulated by LRRK2 activity

    Science.gov (United States)

    Nikonova, Elena V.; Xiong, Yulan; Tanis, Keith Q.; Dawson, Valina L.; Vogel, Robert L.; Finney, Eva M.; Stone, David J.; Reynolds, Ian J.; Kern, Jonathan T.; Dawson, Ted M.

    2012-01-01

    Mutations in the leucine-rich repeat kinase 2 gene (LRRK2) are the most common genetic cause of Parkinson's disease (PD) and cause both autosomal dominant familial and sporadic PD. Currently, the physiological and pathogenic activities of LRRK2 are poorly understood. To decipher the biological functions of LRRK2, including the genes and pathways modulated by LRRK2 kinase activity in vivo, we assayed genome-wide mRNA expression in the brain and peripheral tissues from LRRK2 knockout (KO) and kinase hyperactive G2019S (G2019S) transgenic mice. Subtle but significant differences in mRNA expression were observed relative to wild-type (WT) controls in the cortex, striatum and kidney of KO animals, but only in the striatum in the G2019S model. In contrast, robust, consistent and highly significant differences were identified by the direct comparison of KO and G2019S profiles in the cortex, striatum, kidney and muscle, indicating opposite effects on mRNA expression by the two models relative to WT. Ribosomal and glycolytic biological functions were consistently and significantly up-regulated in LRRK2 G2019S compared with LRRK2 KO tissues. Genes involved in membrane-bound organelles, oxidative phosphorylation, mRNA processing and the endoplasmic reticulum were down-regulated in LRRK2 G2019S mice compared with KO. We confirmed the expression patterns of 35 LRRK2-regulated genes using quantitative reverse transcription polymerase chain reaction. These findings provide the first description of the transcriptional responses to genetically modified LRRK2 activity and provide preclinical target engagement and/or pharmacodynamic biomarker strategies for LRRK2 and may inform future therapeutic strategies for LRRK2-associated PD. PMID:21972245

  3. Leucine rich repeat kinase 2 (LRRK2) as a potential therapeutic target for Parkinson’s disease

    Science.gov (United States)

    Lee, Byoung Dae; Dawson, Valina L.; Dawson, Ted M.

    2012-01-01

    Parkinson’s disease (PD) is caused by the progressive degeneration of dopaminergic neurons in the substantia nigra. Although the etiology for most PD remains elusive, the identification of specific genetic defects in familial cases of PD and the signaling pathways governed by these genes has provided tremendous insight into PD pathogenesis. Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene are frequently found in familial and sporadic PD. Although current knowledge regarding the regulatory mechanisms of LRRK2 activation is limited, it is becoming increasingly evident that aberrant kinase activity of the pathologic mutants of LRRK2 is associated with neurodegeneration, suggesting that the kinase activity of LRRK2 is a potential therapeutic target. In addition, LRRK2 inhibitors might provide valuable tools to understand the pathophysiological and physiological roles of LRRK2 as well as the etiology of PD. We discuss here the potential and feasibility of targeting LRRK2 as a therapeutic strategy for PD. PMID:22578536

  4. Interplay between Leucine-Rich Repeat Kinase 2 (LRRK2) and p62/SQSTM-1 in Selective Autophagy

    Science.gov (United States)

    Park, Sangwook; Han, Seulki; Choi, Insup; Kim, Beomsue; Park, Seung Pyo; Joe, Eun-Hye; Suh, Young Ho

    2016-01-01

    The deposit of polyubiquitinated aggregates has been implicated in the pathophysiology of Parkinson’s disease (PD), and growing evidence indicates that selective autophagy plays a critical role in the clearance of ubiquitin-positive protein aggregates by autophagosomes. The selective autophagic receptor p62/SQSTM-1, which associates directly with both ubiquitin and LC3, transports ubiquitin conjugates to autophagosomes for degradation. Leucine-rich repeat kinase 2 (LRRK2), a PD-associated protein kinase, is tightly controlled by autophagy-lysosome degradation as well as by the ubiquitin-proteasome pathway. However, little is known about the degradation of ubiquitinated LRRK2 via selective autophagy. In the present study, we found that p62/SQSTM-1 physically interacts with LRRK2 as a selective autophagic receptor. The overexpression of p62 leads to the robust degradation of LRRK2 through the autophagy-lysosome pathway. In addition, LRRK2 indirectly regulates Ser351 and Ser403 phosphorylation of p62. Of particular interest, the interaction between phosphorylated p62 and Keap1 is reduced by LRRK2 overexpression. Therefore, we propose that the interplay between LRRK2 and p62 may contribute to the pathophysiological function and homeostasis of LRRK2 protein. PMID:27631370

  5. Leucine-Rich Repeat Kinase 2 (Lrrk2) Deficiency Diminishes the Development of Experimental Autoimmune Uveitis (EAU) and the Adaptive Immune Response.

    Science.gov (United States)

    Wandu, Wambui S; Tan, Cuiyan; Ogbeifun, Osato; Vistica, Barbara P; Shi, Guangpu; Hinshaw, Samuel J H; Xie, Chengsong; Chen, Xi; Klinman, Dennis M; Cai, Huaibin; Gery, Igal

    2015-01-01

    Mutations in LRRK2 are related to certain forms of Parkinson's disease and, possibly, to the pathogenesis of Crohn's disease. In both these diseases inflammatory processes participate in the pathogenic process. LRRK2 is expressed in lymphoid cells and, interestingly, Lrrk2 (-/-) mice were reported to develop more severe experimental colitis than their wild type (WT) controls. Here, we examined the possible involvement of LRRK2 in the pathogenesis of experimental autoimmune uveitis (EAU), an animal model for human uveitis, by testing Lrrk2 (-/-) mice for their capacity to develop this experimental eye disease and related immune responses. Lrrk2 (-/-) mice and their WT controls (C57Bl/6) were immunized with interphotoreceptor retinoid-binding protein (IRBP) and compared for their development of EAU, delayed type hypersensitivity (DTH) by skin tests, production of cytokines in culture, and expression of interferon (IFN)-γ, interleukin (IL)-17 and FoxP3 by spleen cells, using flow cytometry. Peritoneal macrophages were examined for their production of cytokines/chemokines in culture following stimulation with LPS or the oligodeoxynucleotide CpG. The Lrrk2 (-/-) and WT mice were also compared for their response to bovine serum albumin (BSA). The Lrrk2 (-/-) mice developed lower levels of EAU, DTH responses and cytokine production by lymphocytes than did their WT controls. Intracellular expression of IFN-γ and IL-17, by spleen cells, and secretion of cytokines/chemokines by activated peritoneal macrophages of Lrrk2 (-/-) mice trended toward diminished levels, although variabilities were noted. The expression levels of FoxP3 by Lrrk2 (-/-) spleen cells, however, were similar to those seen in WT controls. Consistent with their low response to IRBP, Lrrk2 (-/-) mice responded to BSA less vigorously than their WT controls. Lrrk2 deficiency in mice diminished the development of EAU and the related adaptive immune responses to IRBP as compared to the WT controls.

  6. Leucine-rich repeat kinase 2 (LRRK2-deficient rats exhibit renal tubule injury and perturbations in metabolic and immunological homeostasis.

    Directory of Open Access Journals (Sweden)

    Daniel Ness

    Full Text Available Genetic evidence links mutations in the LRRK2 gene with an increased risk of Parkinson's disease, for which no neuroprotective or neurorestorative therapies currently exist. While the role of LRRK2 in normal cellular function has yet to be fully described, evidence suggests involvement with immune and kidney functions. A comparative study of LRRK2-deficient and wild type rats investigated the influence that this gene has on the phenotype of these rats. Significant weight gain in the LRRK2 null rats was observed and was accompanied by significant increases in insulin and insulin-like growth factors. Additionally, LRRK2-deficient rats displayed kidney morphological and histopathological alterations in the renal tubule epithelial cells of all animals assessed. These perturbations in renal morphology were accompanied by significant decreases of lipocalin-2, in both the urine and plasma of knockout animals. Significant alterations in the cellular composition of the spleen between LRRK2 knockout and wild type animals were identified by immunophenotyping and were associated with subtle differences in response to dual infection with rat-adapted influenza virus (RAIV and Streptococcus pneumoniae. Ontological pathway analysis of LRRK2 across metabolic and kidney processes and pathological categories suggested that the thioredoxin network may play a role in perturbing these organ systems. The phenotype of the LRRK2 null rat is suggestive of a complex biology influencing metabolism, immune function and kidney homeostasis. These data need to be extended to better understand the role of the kinase domain or other biological functions of the gene to better inform the development of pharmacological inhibitors.

  7. Leucine-rich repeat kinase 2 (LRRK2)-deficient rats exhibit renal tubule injury and perturbations in metabolic and immunological homeostasis.

    Science.gov (United States)

    Ness, Daniel; Ren, Zhao; Gardai, Shyra; Sharpnack, Douglas; Johnson, Victor J; Brennan, Richard J; Brigham, Elizabeth F; Olaharski, Andrew J

    2013-01-01

    Genetic evidence links mutations in the LRRK2 gene with an increased risk of Parkinson's disease, for which no neuroprotective or neurorestorative therapies currently exist. While the role of LRRK2 in normal cellular function has yet to be fully described, evidence suggests involvement with immune and kidney functions. A comparative study of LRRK2-deficient and wild type rats investigated the influence that this gene has on the phenotype of these rats. Significant weight gain in the LRRK2 null rats was observed and was accompanied by significant increases in insulin and insulin-like growth factors. Additionally, LRRK2-deficient rats displayed kidney morphological and histopathological alterations in the renal tubule epithelial cells of all animals assessed. These perturbations in renal morphology were accompanied by significant decreases of lipocalin-2, in both the urine and plasma of knockout animals. Significant alterations in the cellular composition of the spleen between LRRK2 knockout and wild type animals were identified by immunophenotyping and were associated with subtle differences in response to dual infection with rat-adapted influenza virus (RAIV) and Streptococcus pneumoniae. Ontological pathway analysis of LRRK2 across metabolic and kidney processes and pathological categories suggested that the thioredoxin network may play a role in perturbing these organ systems. The phenotype of the LRRK2 null rat is suggestive of a complex biology influencing metabolism, immune function and kidney homeostasis. These data need to be extended to better understand the role of the kinase domain or other biological functions of the gene to better inform the development of pharmacological inhibitors.

  8. Curcumin exposure induces expression of the Parkinson's disease-associated leucine-rich repeat kinase 2 (LRRK2) in rat mesencephalic cells.

    Science.gov (United States)

    Ortiz-Ortiz, Miguel A; Morán, José M; Ruiz-Mesa, Luz M; Niso-Santano, Mireia; Bravo-SanPedro, José M; Gómez-Sánchez, Rubén; González-Polo, Rosa A; Fuentes, José M

    2010-01-04

    Turmeric (curry powder), an essential ingredient of culinary preparations of Southeast Asia, contains a major polyphenolic compound known as curcumin or diferuloylmethane. Curcumin is a widely studied phytochemical with a variety of biological activities. In addition to its anti-inflammatory and antimicrobial/antiviral properties, curcumin is considered as a cancer chemopreventive agent as well as a modulator of gene expression and a potent antioxidant. Since oxidative stress has been implicated in the degeneration of dopaminergic neurons in the substantia nigra in Parkinson's disease (PD), curcumin has been proposed to have potential therapeutic value for the treatment of neurodegenerative diseases such as PD. Following age, a family history of PD is the most commonly reported risk factor, suggesting a genetic component of the disease in a subgroup of patients. The LRRK2 gene has emerged as the gene most commonly associated with both familial and sporadic PD. Here, we report that exposure of rat mesencephalic cells to curcumin induces the expression of LRRK2 mRNA and protein in a time-dependent manner. The expression of other PD-related genes, such alpha-synuclein and parkin, was not affected by exposure to curcumin, and PTEN-induced putative kinase 1 (PINK1) was not expressed in rat mesencephalic cells. As LRRK2 overexpression is strongly associated with the pathological inclusions found in several neurodegenerative disorders, further studies are needed to evaluate the effects of curcumin as a therapeutic agent for neurodegenerative diseases.

  9. Measuring the Activity of Leucine-Rich Repeat Kinase 2: A Kinase Involved in Parkinson's Disease

    Science.gov (United States)

    Lee, Byoung Dae; Li, Xiaojie; Dawson, Ted M.; Dawson, Valina L.

    2015-01-01

    Mutations in the LRRK2 (Leucine-Rich Repeat Kinase 2) gene are the most common cause of autosomal dominant Parkinson's disease. LRRK2 has multiple functional domains including a kinase domain. The kinase activity of LRRK2 is implicated in the pathogenesis of Parkinson's disease. Developing an assay to understand the mechanisms of LRRK2 kinase activity is important for the development of pharmacologic and therapeutic applications. Here, we describe how to measure in vitro LRRK2 kinase activity and its inhibition. PMID:21960214

  10. Sequence conservation between porcine and human LRRK2

    DEFF Research Database (Denmark)

    Larsen, Knud; Madsen, Lone Bruhn

    2009-01-01

     Leucine-rich repeat kinase 2 (LRRK2) is a member of the ROCO protein superfamily (Ras of complex proteins (Roc) with a C-terminal Roc domain). Mutations in the LRRK2 gene lead to autosomal dominant Parkinsonism. We have cloned the porcine LRRK2 cDNA in an attempt to characterize conserved and th...... and expression patterns are conserved across species. The porcine LRRK2 gene was mapped to chromosome 5q25. The results obtained suggest that the LRRK2 gene might be of particular interest in our attempt to generate a transgenic porcine model for Parkinson's disease...... Leucine-rich repeat kinase 2 (LRRK2) is a member of the ROCO protein superfamily (Ras of complex proteins (Roc) with a C-terminal Roc domain). Mutations in the LRRK2 gene lead to autosomal dominant Parkinsonism. We have cloned the porcine LRRK2 cDNA in an attempt to characterize conserved...

  11. Homo- and heterodimerization of ROCO kinases: LRRK2 kinase inhibition by the LRRK2 ROCO fragment.

    Science.gov (United States)

    Klein, Christian L; Rovelli, Giorgio; Springer, Wolfdieter; Schall, Christoph; Gasser, Thomas; Kahle, Philipp J

    2009-11-01

    Mutations in the gene encoding leucine-rich repeat kinase 2 (LRRK2) are the most common cause of autosomal-dominant familial and late-onset sporadic Parkinson's disease (PD). LRRK2 is a large multi-domain protein featuring a GTP-binding C-terminal of Ras of complex proteins (ROC) (ROCO) domain combination unique for the ROCO protein family, directly followed by a kinase domain. Dimerization is a well-established phenomenon among protein kinases. Here, we confirm LRRK2 self-interaction, and provide evidence for general homo- and heterodimerization potential among the ROCO kinase family (LRRK2, LRRK1, and death-associated protein kinase 1). The ROCO domain was critically, though not exclusively involved in dimerization, as a LRRK2 deletion mutant lacking the ROCO domain retained dimeric properties. GTP binding did not appear to influence ROCO(LRRK2) self-interaction. Interestingly, ROCO(LRRK2) fragments exerted an inhibitory effect on both wild-type and the elevated G2019S LRRK2 autophosphorylation activity. Insertion of PD mutations into ROCO(LRRK2) reduced self-interaction and led to a reduction of LRRK2 kinase inhibition. Collectively, these results suggest a functional link between ROCO interactions and kinase activity of wild-type and mutant LRRK2. Importantly, our finding of ROCO(LRRK2) fragment-mediated LRRK2 kinase inhibition offers a novel lead for drug design and thus might have important implications for new therapeutic avenues in PD.

  12. ARHGEF7 (Beta-PIX acts as guanine nucleotide exchange factor for leucine-rich repeat kinase 2.

    Directory of Open Access Journals (Sweden)

    Karina Haebig

    Full Text Available BACKGROUND: Mutations within the leucine-rich repeat kinase 2 (LRRK2 gene are a common cause of familial and sporadic Parkinson's disease. The multidomain protein LRRK2 exhibits overall low GTPase and kinase activity in vitro. METHODOLOGY/PRINCIPAL FINDINGS: Here, we show that the rho guanine nucleotide exchange factor ARHGEF7 and the small GTPase CDC42 are interacting with LRRK2 in vitro and in vivo. GTPase activity of full-length LRRK2 increases in the presence of recombinant ARHGEF7. Interestingly, LRRK2 phosphorylates ARHGEF7 in vitro at previously unknown phosphorylation sites. We provide evidence that ARHGEF7 might act as a guanine nucleotide exchange factor for LRRK2 and that R1441C mutant LRRK2 with reduced GTP hydrolysis activity also shows reduced binding to ARHGEF7. CONCLUSIONS/SIGNIFICANCE: Downstream effects of phosphorylation of ARHGEF7 through LRRK2 could be (i a feedback control mechanism for LRRK2 activity as well as (ii an impact of LRRK2 on actin cytoskeleton regulation. A newly identified familial mutation N1437S, localized within the GTPase domain of LRRK2, further underlines the importance of the GTPase domain of LRRK2 in Parkinson's disease pathogenesis.

  13. LRRK2 GTPase Dysfunction in the Pathogenesis of Parkinson’s disease

    Science.gov (United States)

    Xiong, Yulan; Dawson, Valina L.; Dawson, Ted M.

    2013-01-01

    Mutations in the leucine-rich repeat kinase 2 gene (LRRK2) are the most frequent genetic cause of Parkinson’s disease (PD) and these mutations play important roles in sporadic PD. The LRRK2 protein contains GTPase and kinase domains and several protein-protein interaction domains. The kinase and GTPase activity of LRRK2 seem to be important in regulating LRRK2-dependent cellular signaling pathways. LRRK2’s GTPase and kinase domains may reciprocally regulate each other to direct LRRK2’s ultimate function. While most LRRK2 investigations are centered on LRRK2’s kinase activity, this review focuses on the function of LRRK2’s GTPase in LRRK2 physiology and pathophysiology. PMID:22988868

  14. LRRK2 kinase activity is dependent on LRRK2 GTP binding capacity but independent of LRRK2 GTP binding.

    Science.gov (United States)

    Taymans, Jean-Marc; Vancraenenbroeck, Renée; Ollikainen, Petri; Beilina, Alexandra; Lobbestael, Evy; De Maeyer, Marc; Baekelandt, Veerle; Cookson, Mark R

    2011-01-01

    Leucine rich repeat kinase 2 (LRRK2) is a Parkinson's disease (PD) gene that encodes a large multidomain protein including both a GTPase and a kinase domain. GTPases often regulate kinases within signal transduction cascades, where GTPases act as molecular switches cycling between a GTP bound "on" state and a GDP bound "off" state. It has been proposed that LRRK2 kinase activity may be increased upon GTP binding at the LRRK2 Ras of complex proteins (ROC) GTPase domain. Here we extensively test this hypothesis by measuring LRRK2 phosphorylation activity under influence of GDP, GTP or non-hydrolyzable GTP analogues GTPγS or GMPPCP. We show that autophosphorylation and lrrktide phosphorylation activity of recombinant LRRK2 protein is unaltered by guanine nucleotides, when co-incubated with LRRK2 during phosphorylation reactions. Also phosphorylation activity of LRRK2 is unchanged when the LRRK2 guanine nucleotide binding pocket is previously saturated with various nucleotides, in contrast to the greatly reduced activity measured for the guanine nucleotide binding site mutant T1348N. Interestingly, when nucleotides were incubated with cell lysates prior to purification of LRRK2, kinase activity was slightly enhanced by GTPγS or GMPPCP compared to GDP, pointing to an upstream guanine nucleotide binding protein that may activate LRRK2 in a GTP-dependent manner. Using metabolic labeling, we also found that cellular phosphorylation of LRRK2 was not significantly modulated by nucleotides, although labeling is significantly reduced by guanine nucleotide binding site mutants. We conclude that while kinase activity of LRRK2 requires an intact ROC-GTPase domain, it is independent of GDP or GTP binding to ROC.

  15. LRRK2 kinase activity is dependent on LRRK2 GTP binding capacity but independent of LRRK2 GTP binding.

    Directory of Open Access Journals (Sweden)

    Jean-Marc Taymans

    Full Text Available Leucine rich repeat kinase 2 (LRRK2 is a Parkinson's disease (PD gene that encodes a large multidomain protein including both a GTPase and a kinase domain. GTPases often regulate kinases within signal transduction cascades, where GTPases act as molecular switches cycling between a GTP bound "on" state and a GDP bound "off" state. It has been proposed that LRRK2 kinase activity may be increased upon GTP binding at the LRRK2 Ras of complex proteins (ROC GTPase domain. Here we extensively test this hypothesis by measuring LRRK2 phosphorylation activity under influence of GDP, GTP or non-hydrolyzable GTP analogues GTPγS or GMPPCP. We show that autophosphorylation and lrrktide phosphorylation activity of recombinant LRRK2 protein is unaltered by guanine nucleotides, when co-incubated with LRRK2 during phosphorylation reactions. Also phosphorylation activity of LRRK2 is unchanged when the LRRK2 guanine nucleotide binding pocket is previously saturated with various nucleotides, in contrast to the greatly reduced activity measured for the guanine nucleotide binding site mutant T1348N. Interestingly, when nucleotides were incubated with cell lysates prior to purification of LRRK2, kinase activity was slightly enhanced by GTPγS or GMPPCP compared to GDP, pointing to an upstream guanine nucleotide binding protein that may activate LRRK2 in a GTP-dependent manner. Using metabolic labeling, we also found that cellular phosphorylation of LRRK2 was not significantly modulated by nucleotides, although labeling is significantly reduced by guanine nucleotide binding site mutants. We conclude that while kinase activity of LRRK2 requires an intact ROC-GTPase domain, it is independent of GDP or GTP binding to ROC.

  16. Leucine-rich repeat kinase 2 mutations and Parkinson’s disease: three questions

    OpenAIRE

    Elisa Greggio; Cookson, Mark R

    2009-01-01

    Mutations in the gene encoding LRRK2 (leucine-rich repeat kinase 2) were first identified in 2004 and have since been shown to be the single most common cause of inherited Parkinson's disease. The protein is a large GTP-regulated serine/threonine kinase that additionally contains several protein–protein interaction domains. In the present review, we discuss three important, but unresolved, questions concerning LRRK2. We first ask: what is the normal function of LRRK2? Related to this, we disc...

  17. Leucine-rich repeat kinase 2 modulates retinoic acid-induced neuronal differentiation of murine embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Cathrin Schulz

    Full Text Available BACKGROUND: Dominant mutations in the leucine-rich repeat kinase 2 (LRRK2 gene are the most prevalent cause of Parkinson's disease, however, little is known about the biological function of LRRK2 protein. LRRK2 is expressed in neural precursor cells suggesting a role in neurodevelopment. METHODOLOGY/PRINCIPAL FINDINGS: In the present study, differential gene expression profiling revealed a faster silencing of pluripotency-associated genes, like Nanog, Oct4, and Lin28, during retinoic acid-induced neuronal differentiation of LRRK2-deficient mouse embryonic stem cells compared to wildtype cultures. By contrast, expression of neurotransmitter receptors and neurotransmitter release was increased in LRRK2+/- cultures indicating that LRRK2 promotes neuronal differentiation. Consistently, the number of neural progenitor cells was higher in the hippocampal dentate gyrus of adult LRRK2-deficient mice. Alterations in phosphorylation of the putative LRRK2 substrates, translation initiation factor 4E binding protein 1 and moesin, do not appear to be involved in altered differentiation, rather there is indirect evidence that a regulatory signaling network comprising retinoic acid receptors, let-7 miRNA and downstream target genes/mRNAs may be affected in LRRK2-deficient stem cells in culture. CONCLUSION/SIGNIFICANCE: Parkinson's disease-linked LRRK2 mutations that associated with enhanced kinase activity may affect retinoic acid receptor signaling during neurodevelopment and/or neuronal maintenance as has been shown in other mouse models of chronic neurodegenerative diseases.

  18. LRRK2 in Parkinson's disease and dementia with Lewy bodies

    Directory of Open Access Journals (Sweden)

    Zhu Xiongwei

    2006-11-01

    Full Text Available Abstract Background Mutations in LRRK2 encoding leucine-rich repeat kinase 2 are thus far the most frequent genetic cause associated with autosomal dominant and idiopathic Parkinson's disease (PD. To examine whether LRRK2 is directly associated with neuropathology of PD and other related disorders, we analyzed LRRK2 in brains of patients affected by PD and dementia with Lewy bodies (DLB using highly specific antibodies to LRRK2. Results We demonstrated that anti-LRRK2 antibodies strongly labelled brainstem and cortical Lewy bodies, the pathological hallmarks of PD and DLB, respectively. In addition, anti-LRRK2 also labelled brain vasculature, axons, and neuronal cell bodies. Interestingly, the immunocytochemical profile of LRRK2 varied with different antibodies depending upon specific antigenic sites along the LRRK2 protein. All anti-LRRK2 antibodies tested that were raised against various regions of LRRK2, were found to be immunoreactive to recombinant LRRK2 on Western blots. However, only the antibodies raised against the N-terminal and C-terminal regions of LRRK2, but not the regions containing folded protein domains, were positive in immunolabeling of Lewy bodies, suggesting a differential exposure of specific antigenic sites of LRRK2 on tissue sections. Conclusion We conclude that LRRK2 is a component of Lewy bodies in both PD and DLB, and therefore plays an important role in the Lewy body formation and disease pathogenesis. Information on the cellular localization of LRRK2 under normal and pathological conditions will deepen our understanding of its functions and molecular pathways relevant to the progression of PD and related disorders.

  19. LRRK2 Pathobiology in Parkinson’s Disease

    Science.gov (United States)

    Martin, Ian; Kim, Jungwoo Wren; Dawson, Valina L.; Dawson, Ted M.

    2014-01-01

    Mutations in the catalytic Roc-COR and kinase domains of leucine-rich repeat kinase 2 (LRRK2) are a common cause of familial Parkinson’s disease (PD). LRRK2 mutations cause PD with age-related penetrance and clinical features identical to late-onset sporadic PD. Biochemical studies support an increase in LRRK2 kinase activity and a decrease in GTPase activity for kinase domain and Roc-COR mutations, respectively. Strong evidence exists that LRRK2 toxicity is kinase-dependent leading to extensive efforts to identify selective and brain-permeable LRRK2 kinase inhibitors for clinical development. Cell and animal models of PD indicate that LRRK2 mutations affect vesicular trafficking, autophagy, protein synthesis and cytoskeletal function. Although some of these biological functions are affected consistently by most disease-linked mutations, others are not and it is currently unclear how mutations that produce variable effects on LRRK2 biochemistry and function all commonly result in the degeneration and death of dopamine neurons. LRRK2 is typically present in Lewy bodies and its toxicity in mammalian models appears to be dependent on the presence of α-synuclein, which is elevated in human iPS-derived dopamine neurons from patients harboring LRRK2 mutations. Here, we summarize biochemical and functional studies of LRRK2 and its mutations and focus on aberrant vesicular trafficking and protein synthesis as two leading mechanisms underlying LRRK2-linked disease. PMID:25251388

  20. ArfGAP1 is a GTPase Activating Protein for LRRK2: Reciprocal Regulation of ArfGAP1 by LRRK2

    Science.gov (United States)

    Xiong, Yulan; Yuan, Changqing; Chen, Rong; Dawson, Ted M.; Dawson, Valina L.

    2012-01-01

    Both sporadic and autosomal dominant forms of Parkinson’s disease (PD) have been causally linked to mutations in leucine-rich repeat kinase 2 (LRRK2), a large protein with multiple domains. The kinase domain plays an important role in LRRK2 mediated toxicity. While a number of investigations have focused on LRRK2 kinase activity, less is known about the GTPase function of LRRK2. The activity of GTPases is regulated by GTPase activating proteins (GAPs) and GTP exchange factors (GEFs). Here, we identify ArfGAP1 as the first GAP for LRRK2. ArfGAP1 binds LRRK2 predominantly via the WD40 and kinase domain of LRRK2 and it increases LRRK2 GTPase activity and regulates LRRK2 toxicity both in vitro and in vivo in Drosophila melanogaster. Unexpectedly, ArfGAP1 is a LRRK2 kinase substrate whose GAP activity is inhibited by LRRK2, while wild type and G2019S LRRK2 autophosphorylation and kinase activity are significantly reduced in the presence of ArfGAP1. Overexpressed ArfGAP1 exhibits toxicity that is reduced by LRRK2 both in vitro and in vivo. Δ64-ArfGAP1, a dominant negative ArfGAP1, and shRNA knockdown of ArfGAP1 reduce LRRK2 toxicity. Thus, LRRK2 and ArfGAP1 reciprocally regulate the activity of each other. Our results provide insight into the basic pathobiology of LRRK2 and indicate an important role for the GTPase domain and ArfGAP1 in LRRK2 mediated toxicity. These data suggest that agents targeted towards regulation of LRRK2 GTP hydrolysis might be therapeutic agents for the treatment of Parkinson’s disease. PMID:22423108

  1. Phenotype, genotype, and worldwide genetic penetrance of LRRK2-associated Parkinson's disease: a case-control study

    NARCIS (Netherlands)

    D.G. Healy (Daniel); M. Falchi (Mario); S.S. O'Sullivan (Sean); V. Bonifati (Vincenzo); A. Durr; S. Bressman (Susan); A. Brice; J.O. Aasly (Jan); C.P. Zabetian (Cyrus); S. Goldwurm (Stefano); J.J. Ferreira (Joaquim); E. Tolosa; D.M. Kay (Denise); C. Klein (Christoph); D.R. Williams (David); C. Marras (Connie); A.E. Lang; Z.K. Wszolek (Zbigniew); J. Berciano (José); A.H.V. Schapira (Anthony); T. Lynch (Tim); K.P. Bhatia (Kailash); T. Gasser (Thomas); A.J. Lees (Andrew); N.W. Wood (Nicholas)

    2008-01-01

    textabstractBackground: Mutations in LRRK2, the gene that encodes leucine-rich repeat kinase 2, are a cause of Parkinson's disease (PD). The International LRRK2 Consortium was established to answer three key clinical questions: can LRRK2-associated PD be distinguished from idiopathic PD; which

  2. Leucine-rich repeat kinase 2 inhibitors: a patent review (2014-2016).

    Science.gov (United States)

    Galatsis, Paul

    2017-06-01

    Leucine-rich repeat kinase 2 (LRRK2) is a member of the Tyrosine Kinase-Like (TKL) branch of the kinome tree and is a multi-domain protein that includes GTPase and kinase activity. While genome-wide association studies (GWAS) has linked LRRK2 with Crohn's disease and leprosy, it has received the greatest attention due to it being implicated as one of the genetic loci associated with autosomal dominant inheritance in Parkinson's disease (PD). Areas covered: In this review, the small molecule patent literature from 2014-2016 with a focus on composition of matter and use patents was surveyed. Scifinder was primarily searched using 'LRRK2' as the query to identify all relevant literature and then triaged for small molecule patents. Expert opinion: The patent landscape around LRRK2 continues to develop. The early patents covered using existing kinase inhibitors for use against LRRK2. This evolved to compounds specifically designed for selectivity against LRRK2, but key exemplified compounds lacked sufficient brain exposure to affect sufficient efficacy. More recent compounds have addressed this deficiency and show greater potential for treating PD. While potency will be necessary to generate medicines with low human daily doses, brain penetration and safety will be the key differentiators for ultimately determining the most effective LRRK2 disease-modifying treatment for PD.

  3. Dynamic and redundant regulation of LRRK2 and LRRK1 expression

    Directory of Open Access Journals (Sweden)

    Dawson Ted M

    2007-11-01

    Full Text Available Abstract Background Mutations within the leucine-rich repeat kinase 2 (LRRK2 gene account for a significant proportion of autosomal-dominant and some late-onset sporadic Parkinson's disease. Elucidation of LRRK2 protein function in health and disease provides an opportunity for deciphering molecular pathways important in neurodegeneration. In mammals, LRRK1 and LRRK2 protein comprise a unique family encoding a GTPase domain that controls intrinsic kinase activity. The expression profiles of the murine LRRK proteins have not been fully described and insufficiently characterized antibodies have produced conflicting results in the literature. Results Herein, we comprehensively evaluate twenty-one commercially available antibodies to the LRRK2 protein using mouse LRRK2 and human LRRK2 expression vectors, wild-type and LRRK2-null mouse brain lysates and human brain lysates. Eleven antibodies detect over-expressed human LRRK2 while four antibodies detect endogenous human LRRK2. In contrast, two antibodies recognize over-expressed mouse LRRK2 and one antibody detected endogenous mouse LRRK2. LRRK2 protein resides in both soluble and detergent soluble protein fractions. LRRK2 and the related LRRK1 genes encode low levels of expressed mRNA species corresponding to low levels of protein both during development and in adulthood with largely redundant expression profiles. Conclusion Despite previously published results, commercially available antibodies generally fail to recognize endogenous mouse LRRK2 protein; however, several antibodies retain the ability to detect over-expressed mouse LRRK2 protein. Over half of the commercially available antibodies tested detect over-expressed human LRRK2 protein and some have sufficient specificity to detect endogenous LRRK2 in human brain. The mammalian LRRK proteins are developmentally regulated in several tissues and coordinated expression suggest possible redundancy in the function between LRRK1 and LRRK2.

  4. GTPase activity plays a key role in the pathobiology of LRRK2.

    Directory of Open Access Journals (Sweden)

    Yulan Xiong

    2010-04-01

    Full Text Available Mutations in the leucine-rich repeat kinase 2 (LRRK2 gene are associated with late-onset, autosomal-dominant, familial Parkinson's disease (PD and also contribute to sporadic disease. The LRRK2 gene encodes a large protein with multiple domains, including functional Roc GTPase and protein kinase domains. Mutations in LRRK2 most likely cause disease through a toxic gain-of-function mechanism. The expression of human LRRK2 variants in cultured primary neurons induces toxicity that is dependent on intact GTP binding or kinase activities. However, the mechanism(s underlying LRRK2-induced neuronal toxicity is poorly understood, and the contribution of GTPase and/or kinase activity to LRRK2 pathobiology is not well defined. To explore the pathobiology of LRRK2, we have developed a model of LRRK2 cytotoxicity in the baker's yeast Saccharomyces cerevisiae. Protein domain analysis in this model reveals that expression of GTPase domain-containing fragments of human LRRK2 are toxic. LRRK2 toxicity in yeast can be modulated by altering GTPase activity and is closely associated with defects in endocytic vesicular trafficking and autophagy. These truncated LRRK2 variants induce similar toxicity in both yeast and primary neuronal models and cause similar vesicular defects in yeast as full-length LRRK2 causes in primary neurons. The toxicity induced by truncated LRRK2 variants in yeast acts through a mechanism distinct from toxicity induced by human alpha-synuclein. A genome-wide genetic screen identified modifiers of LRRK2-induced toxicity in yeast including components of vesicular trafficking pathways, which can also modulate the trafficking defects caused by expression of truncated LRRK2 variants. Our results provide insight into the basic pathobiology of LRRK2 and suggest that the GTPase domain may contribute to the toxicity of LRRK2. These findings may guide future therapeutic strategies aimed at attenuating LRRK2-mediated neurodegeneration.

  5. A Direct Interaction between Leucine-rich Repeat Kinase 2 and Specific β-Tubulin Isoforms Regulates Tubulin Acetylation*

    Science.gov (United States)

    Law, Bernard M. H.; Spain, Victoria A.; Leinster, Veronica H. L.; Chia, Ruth; Beilina, Alexandra; Cho, Hyun J.; Taymans, Jean-Marc; Urban, Mary K.; Sancho, Rosa M.; Ramírez, Marian Blanca; Biskup, Saskia; Baekelandt, Veerle; Cai, Huaibin; Cookson, Mark R.; Berwick, Daniel C.; Harvey, Kirsten

    2014-01-01

    Mutations in LRRK2, encoding the multifunctional protein leucine-rich repeat kinase 2 (LRRK2), are a common cause of Parkinson disease. LRRK2 has been suggested to influence the cytoskeleton as LRRK2 mutants reduce neurite outgrowth and cause an accumulation of hyperphosphorylated Tau. This might cause alterations in the dynamic instability of microtubules suggested to contribute to the pathogenesis of Parkinson disease. Here, we describe a direct interaction between LRRK2 and β-tubulin. This interaction is conferred by the LRRK2 Roc domain and is disrupted by the familial R1441G mutation and artificial Roc domain mutations that mimic autophosphorylation. LRRK2 selectively interacts with three β-tubulin isoforms: TUBB, TUBB4, and TUBB6, one of which (TUBB4) is mutated in the movement disorder dystonia type 4 (DYT4). Binding specificity is determined by lysine 362 and alanine 364 of β-tubulin. Molecular modeling was used to map the interaction surface to the luminal face of microtubule protofibrils in close proximity to the lysine 40 acetylation site in α-tubulin. This location is predicted to be poorly accessible within mature stabilized microtubules, but exposed in dynamic microtubule populations. Consistent with this finding, endogenous LRRK2 displays a preferential localization to dynamic microtubules within growth cones, rather than adjacent axonal microtubule bundles. This interaction is functionally relevant to microtubule dynamics, as mouse embryonic fibroblasts derived from LRRK2 knock-out mice display increased microtubule acetylation. Taken together, our data shed light on the nature of the LRRK2-tubulin interaction, and indicate that alterations in microtubule stability caused by changes in LRRK2 might contribute to the pathogenesis of Parkinson disease. PMID:24275654

  6. Chemical genetic approach identifies microtubule affinity-regulating kinase 1 as a leucine-rich repeat kinase 2 substrate.

    Science.gov (United States)

    Krumova, Petranka; Reyniers, Lauran; Meyer, Marc; Lobbestael, Evy; Stauffer, Daniela; Gerrits, Bertran; Muller, Lionel; Hoving, Sjouke; Kaupmann, Klemens; Voshol, Johannes; Fabbro, Doriano; Bauer, Andreas; Rovelli, Giorgio; Taymans, Jean-Marc; Bouwmeester, Tewis; Baekelandt, Veerle

    2015-07-01

    Mutations in leucine-rich repeat kinase 2 (LRRK2) are the most common cause of autosomal-dominant forms of Parkinson's disease. LRRK2 is a modular, multidomain protein containing 2 enzymatic domains, including a kinase domain, as well as several protein-protein interaction domains, pointing to a role in cellular signaling. Although enormous efforts have been made, the exact pathophysiologic mechanisms of LRRK2 are still not completely known. In this study, we used a chemical genetics approach to identify LRRK2 substrates from mouse brain. This approach allows the identification of substrates of 1 particular kinase in a complex cellular environment. Several of the identified peptides are involved in the regulation of microtubule (MT) dynamics, including microtubule-associating protein (MAP)/microtubule affinity-regulating kinase 1 (MARK1). MARK1 is a serine/threonine kinase known to phosphorylate MT-binding proteins such as Tau, MAP2, and MAP4 at KXGS motifs leading to MT destabilization. In vitro kinase assays and metabolic-labeling experiments in living cells confirmed MARK1 as an LRRK2 substrate. Moreover, we also showed that LRRK2 and MARK1 are interacting in eukaryotic cells. Our findings contribute to the identification of physiologic LRRK2 substrates and point to a potential mechanism explaining the reported effects of LRRK2 on neurite morphology.

  7. Mutant LRRK2 toxicity in neurons depends on LRRK2 levels and synuclein but not kinase activity or inclusion bodies.

    Science.gov (United States)

    Skibinski, Gaia; Nakamura, Ken; Cookson, Mark R; Finkbeiner, Steven

    2014-01-08

    By combining experimental neuron models and mathematical tools, we developed a "systems" approach to deconvolve cellular mechanisms of neurodegeneration underlying the most common known cause of Parkinson's disease (PD), mutations in leucine-rich repeat kinase 2 (LRRK2). Neurons ectopically expressing mutant LRRK2 formed inclusion bodies (IBs), retracted neurites, accumulated synuclein, and died prematurely, recapitulating key features of PD. Degeneration was predicted from the levels of diffuse mutant LRRK2 that each neuron contained, but IB formation was neither necessary nor sufficient for death. Genetic or pharmacological blockade of its kinase activity destabilized LRRK2 and lowered its levels enough to account for the moderate reduction in LRRK2 toxicity that ensued. By contrast, targeting synuclein, including neurons made from PD patient-derived induced pluripotent cells, dramatically reduced LRRK2-dependent neurodegeneration and LRRK2 levels. These findings suggest that LRRK2 levels are more important than kinase activity per se in predicting toxicity and implicate synuclein as a major mediator of LRRK2-induced neurodegeneration.

  8. Mutant LRRK2 Toxicity in Neurons Depends on LRRK2 Levels and Synuclein But Not Kinase Activity or Inclusion Bodies

    Science.gov (United States)

    Skibinski, Gaia; Nakamura, Ken; Cookson, Mark R.

    2014-01-01

    By combining experimental neuron models and mathematical tools, we developed a “systems” approach to deconvolve cellular mechanisms of neurodegeneration underlying the most common known cause of Parkinson's disease (PD), mutations in leucine-rich repeat kinase 2 (LRRK2). Neurons ectopically expressing mutant LRRK2 formed inclusion bodies (IBs), retracted neurites, accumulated synuclein, and died prematurely, recapitulating key features of PD. Degeneration was predicted from the levels of diffuse mutant LRRK2 that each neuron contained, but IB formation was neither necessary nor sufficient for death. Genetic or pharmacological blockade of its kinase activity destabilized LRRK2 and lowered its levels enough to account for the moderate reduction in LRRK2 toxicity that ensued. By contrast, targeting synuclein, including neurons made from PD patient-derived induced pluripotent cells, dramatically reduced LRRK2-dependent neurodegeneration and LRRK2 levels. These findings suggest that LRRK2 levels are more important than kinase activity per se in predicting toxicity and implicate synuclein as a major mediator of LRRK2-induced neurodegeneration. PMID:24403142

  9. The unconventional G-protein cycle of LRRK2 and Roco proteins

    NARCIS (Netherlands)

    Terheyden, Susanne; Nederveen-Schippers, Laura M; Kortholt, Arjan

    2016-01-01

    Mutations in the human leucine-rich repeat kinase 2 (LRRK2) are the most frequent cause of hereditary Parkinson's disease (PD). LRRK2 belongs to the Roco family of proteins, which are characterized by the presence of a Ras of complex proteins domain (Roc), a C-terminal of Roc domain (COR) and a kina

  10. The unconventional G-protein cycle of LRRK2 and Roco proteins

    NARCIS (Netherlands)

    Terheyden, Susanne; Nederveen-Schippers, Laura M; Kortholt, Arjan

    2016-01-01

    Mutations in the human leucine-rich repeat kinase 2 (LRRK2) are the most frequent cause of hereditary Parkinson's disease (PD). LRRK2 belongs to the Roco family of proteins, which are characterized by the presence of a Ras of complex proteins domain (Roc), a C-terminal of Roc domain (COR) and a

  11. Clinical correlations with lewy body pathology in LRRK2-related Parkinson disease

    NARCIS (Netherlands)

    L.V. Kalia (Lorraine V.); A.E. Lang (Anthony E.); L.-N. Hazrati (Lili-Naz); S. Fujioka (Shinsuke); Z.K. Wszolek (Zbigniew); D. Dickson (Dennis); O.A. Ross (Owen); V.M. Deerlin (Vivianna); J.Q. Trojanowski (John); H.I. Hurtig (Howard); R.N. Alcalay (Roy N.); K.S. Marder (Karen S.); L.N. Clark (Lorraine N.); C. Gaig; E. Tolosa; J. Ruiz-Martínez (Javier); J.F. Marti-Masso (Jose F.); I. Ferrer (Isidro); A. López De Munain (Adolfo); S.M. Goldman (Samuel M.); B. Schüle (Birgitt); J.W. Langston (J. William); J.O. Aasly (Jan); M.T. Giordana; V. Bonifati (Vincenzo); A. Puschmann (Andreas); M. Canesi (Margherita); G. Pezzoli (Gianni); A. Maues De Paula (Andre); K. Hasegawa (Kazuko); C. Duyckaerts (Charles); A. Brice (Alexis); A.J. Stoessl (A. Jon); C. Marras (Connie)

    2015-01-01

    textabstractIMPORTANCE: Mutations in leucine-rich repeat kinase 2 (LRRK2) are the most common cause of genetic Parkinson disease (PD) known to date. The clinical features of manifesting LRRK2 mutation carriers are generally indistinguishable from those of patients with sporadic PD. However, some PD

  12. mTOR independent regulation of macroautophagy by Leucine Rich Repeat Kinase 2 via Beclin-1

    Science.gov (United States)

    Manzoni, Claudia; Mamais, Adamantios; Roosen, Dorien A.; Dihanich, Sybille; Soutar, Marc P. M.; Plun-Favreau, Helene; Bandopadhyay, Rina; Hardy, John; Tooze, Sharon A.; Cookson, Mark R.; Lewis, Patrick A.

    2016-01-01

    Leucine rich repeat kinase 2 is a complex enzyme with both kinase and GTPase activities, closely linked to the pathogenesis of several human disorders including Parkinson’s disease, Crohn’s disease, leprosy and cancer. LRRK2 has been implicated in numerous cellular processes; however its physiological function remains unclear. Recent reports suggest that LRRK2 can act to regulate the cellular catabolic process of macroautophagy, although the precise mechanism whereby this occurs has not been identified. To investigate the signalling events through which LRRK2 acts to influence macroautophagy, the mammalian target of rapamycin (mTOR)/Unc-51-like kinase 1 (ULK1) and Beclin-1/phosphatidylinositol 3-kinase (PI3K) pathways were evaluated in astrocytic cell models in the presence and absence of LRRK2 kinase inhibitors. Chemical inhibition of LRRK2 kinase activity resulted in the stimulation of macroautophagy in a non-canonical fashion, independent of mTOR and ULK1, but dependent upon the activation of Beclin 1-containing class III PI3-kinase. PMID:27731364

  13. Structural interface between LRRK2 and 14-3-3 protein.

    Science.gov (United States)

    Stevers, Loes M; de Vries, Rens M J M; Doveston, Richard G; Milroy, Lech-Gustav; Brunsveld, Luc; Ottmann, Christian

    2017-03-23

    Binding of 14-3-3 proteins to leucine-rich repeat protein kinase 2 (LRRK2) is known to be impaired by many Parkinson's disease (PD)-relevant mutations. Abrogation of this interaction is connected to enhanced LRRK2 kinase activity, which in turn is implicated in increased ubiquitination of LRRK2, accumulation of LRRK2 into inclusion bodies and reduction in neurite length. Hence, the interaction between 14-3-3 and LRRK2 is of significant interest as a possible drug target for the treatment of PD. However, LRRK2 possesses multiple sites that, upon phosphorylation, can bind to 14-3-3, thus rendering the interaction relatively complex. Using biochemical assays and crystal structures, we characterize the multivalent interaction between these two proteins. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

  14. The LRRK2 G2019S mutant exacerbates basal autophagy through activation of the MEK/ERK pathway

    NARCIS (Netherlands)

    Bravo-San Pedro, José M; Niso-Santano, Mireia; Gómez-Sánchez, Rubén; Pizarro-Estrella, Elisa; Aiastui-Pujana, Ana; Gorostidi, Ana; Climent, Vicente; López de Maturana, Rakel; Sanchez-Pernaute, Rosario; López de Munain, Adolfo; Fuentes, José M; González-Polo, Rosa A

    2013-01-01

    Mutations in leucine-rich repeat kinase 2 (LRRK2) are a major cause of familial Parkinsonism, and the G2019S mutation of LRRK2 is one of the most prevalent mutations. The deregulation of autophagic processes in nerve cells is thought to be a possible cause of Parkinson's disease (PD). In this study,

  15. Overexpression of Parkinson’s Disease-Associated Mutation LRRK2 G2019S in Mouse Forebrain Induces Behavioral Deficits and α-Synuclein Pathology

    Science.gov (United States)

    Grima, Jonathan C.; Chen, Guanxing; Swing, Debbie; Tessarollo, Lino

    2017-01-01

    Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene have been identified as an unambiguous cause of late-onset, autosomal-dominant familial Parkinson’s disease (PD) and LRRK2 mutations are the strongest genetic risk factor for sporadic PD known to date. A number of transgenic mice expressing wild-type or mutant LRRK2 have been described with varying degrees of LRRK2-related abnormalities and modest pathologies. None of these studies directly addressed the role of the kinase domain in the changes observed and none of the mice present with robust features of the human disease. In an attempt to address these issues, we created a conditional LRRK2 G2019S (LRRK2 GS) mutant and a functionally negative control, LRRK2 G2019S/D1994A (LRRK2 GS/DA). Expression of LRRK2 GS or LRRK2 GS/DA was conditionally controlled using the tet-off system in which the presence of tetracycline-transactivator protein (tTA) with a CAMKIIα promoter (CAMKIIα-tTA) induced expression of TetP-LRRK2 GS or TetP-LRRK2 GS/DA in the mouse forebrain. Overexpression of LRRK2 GS in mouse forebrain induced behavioral deficits and α-synuclein pathology in a kinase-dependent manner. Similar to other genetically engineered LRRK2 GS mice, there was no significant loss of dopaminergic neurons. These mice provide an important new tool to study neurobiological changes associated with the increased kinase activity from the LRRK2 G2019S mutation, which may ultimately lead to a better understanding of not only the physiologic actions of LRRK2, but also potential pathologic actions that underlie LRRK2 GS-associated PD.

  16. The Role of LRRK2 in Parkinson's Disease

    NARCIS (Netherlands)

    A. Di Fonzo (Alessio)

    2009-01-01

    textabstractThis thesis focuses on the role of the leucine rich repeat kinase 2 (LRRK2) gene in Parkinson’s disease (PD). PD is the second most frequent human neurodegenerative disorder after Alzheimer’s disease. The etiology of PD remains unknown in most cases, but several genetically-determine

  17. The Role of LRRK2 in Parkinson's Disease

    NARCIS (Netherlands)

    A. Di Fonzo (Alessio)

    2009-01-01

    textabstractThis thesis focuses on the role of the leucine rich repeat kinase 2 (LRRK2) gene in Parkinson’s disease (PD). PD is the second most frequent human neurodegenerative disorder after Alzheimer’s disease. The etiology of PD remains unknown in most cases, but several genetically-determine

  18. LRRK2 kinase inhibition prevents pathological microglial phagocytosis in response to HIV-1 Tat protein

    Directory of Open Access Journals (Sweden)

    Marker Daniel F

    2012-11-01

    Full Text Available Abstract Background Human Immunodeficiency Virus-1 (HIV-1 associated neurocognitive disorders (HANDs are accompanied by significant morbidity, which persists despite the use of combined antiretroviral therapy (cART. While activated microglia play a role in pathogenesis, changes in their immune effector functions, including phagocytosis and proinflammatory signaling pathways, are not well understood. We have identified leucine-rich repeat kinase 2 (LRRK2 as a novel regulator of microglial phagocytosis and activation in an in vitro model of HANDs, and hypothesize that LRRK2 kinase inhibition will attenuate microglial activation during HANDs. Methods We treated BV-2 immortalized mouse microglia cells with the HIV-1 trans activator of transcription (Tat protein in the absence or presence of LRRK2 kinase inhibitor (LRRK2i. We used Western blot, qRT-PCR, immunocytochemistry and latex bead engulfment assays to analyze LRRK2 protein levels, proinflammatory cytokine and phagocytosis receptor expression, LRRK2 cellular distribution and phagocytosis, respectively. Finally, we utilized ex vivo microfluidic chambers containing primary hippocampal neurons and BV-2 microglia cells to investigate microglial phagocytosis of neuronal axons. Results We found that Tat-treatment of BV-2 cells induced kinase activity associated phosphorylation of serine 935 on LRRK2 and caused the formation of cytoplasmic LRRK2 inclusions. LRRK2i decreased Tat-induced phosphorylation of serine 935 on LRRK2 and inhibited the formation of Tat-induced cytoplasmic LRRK2 inclusions. LRRK2i also decreased Tat-induced process extension in BV-2 cells. Furthermore, LRRK2i attenuated Tat-induced cytokine expression and latex bead engulfment. We examined relevant cellular targets in microfluidic chambers and found that Tat-treated BV-2 microglia cells cleared axonal arbor and engulfed neuronal elements, whereas saline treated controls did not. LRRK2i was found to protect axons in the presence

  19. Synaptic function is modulated by LRRK2 and glutamate release is increased in cortical neurons of G2019S LRRK2 knock-in mice

    Directory of Open Access Journals (Sweden)

    Dayne A Beccano-Kelly

    2014-09-01

    Full Text Available Mutations in Leucine-Rich Repeat Kinase-2 (LRRK2 result in familial Parkinson’s disease and the G2019S mutation alone accounts for up to 30% in some ethnicities. Despite this, the function of LRRK2 is largely undetermined although evidence suggests roles in phosphorylation, protein interactions, autophagy and endocytosis. Emerging reports link loss of LRRK2 to altered synaptic transmission, but the effects of the G2019S mutation upon synaptic release in mammalian neurons are unknown. To assess wild type and mutant LRRK2 in established neuronal networks, we conducted immunocytochemical, electrophysiological and biochemical characterisation of >3 week old cortical cultures of LRRK2 knock-out, wild-type overexpressing and G2019S knock-in mice. Synaptic release and synapse numbers were grossly normal in LRRK2 knock-out cells, but discretely reduced glutamatergic activity and reduced synaptic protein levels were observed. Conversely, synapse density was modestly but significantly increased in wild-type LRRK2 overexpressing cultures although event frequency was not. In knock-in cultures, glutamate release was markedly elevated, in the absence of any change to synapse density; indicating that physiological levels of G2019S LRRK2 elevate probability of release. Several presynaptic regulatory proteins shown by others to interact with LRRK2 were expressed at normal levels in knock-in cultures; however, synapsin 1 phosphorylation was significantly reduced. Thus, perturbations to the presynaptic release machinery and elevated synaptic transmission are early neuronal effects of LRRK2 G2019S. Furthermore, the comparison of knock-in and overexpressing cultures suggests that one copy of the G2019S mutation has a more pronounced effect than an ~3-fold increase in LRRK2 protein. Mutant-induced increases in transmission may convey additional stressors to neuronal physiology that may eventually contribute to the pathogenesis of Parkinson’s disease.

  20. The unconventional G-protein cycle of LRRK2 and Roco proteins.

    Science.gov (United States)

    Terheyden, Susanne; Nederveen-Schippers, Laura M; Kortholt, Arjan

    2016-12-15

    Mutations in the human leucine-rich repeat kinase 2 (LRRK2) are the most frequent cause of hereditary Parkinson's disease (PD). LRRK2 belongs to the Roco family of proteins, which are characterized by the presence of a Ras of complex proteins domain (Roc), a C-terminal of Roc domain (COR) and a kinase domain. Despite intensive research, much remains unknown about activity and the effect of PD-associated mutations. Recent biochemical and structural studies suggest that LRRK2 and Roco proteins are noncanonical G-proteins that do not depend on guanine nucleotide exchange factors or GTPase-activating proteins for activation. In this review, we will discuss the unusual G-protein cycle of LRRK2 in the context of the complex intramolecular LRRK2 activation mechanism.

  1. GTPase activity and neuronal toxicity of Parkinson's disease-associated LRRK2 is regulated by ArfGAP1.

    Directory of Open Access Journals (Sweden)

    Klodjan Stafa

    Full Text Available Mutations in the leucine-rich repeat kinase 2 (LRRK2 gene are the most common cause of autosomal dominant familial Parkinson's disease (PD and also contribute to idiopathic PD. LRRK2 encodes a large multi-domain protein with GTPase and kinase activity. Initial data indicates that an intact functional GTPase domain is critically required for LRRK2 kinase activity. PD-associated mutations in LRRK2, including the most common G2019S variant, have variable effects on enzymatic activity but commonly alter neuronal process morphology. The mechanisms underlying the intrinsic and extrinsic regulation of LRRK2 GTPase and kinase activity, and the pathogenic effects of familial mutations, are incompletely understood. Here, we identify a novel functional interaction between LRRK2 and ADP-ribosylation factor GTPase-activating protein 1 (ArfGAP1. LRRK2 and ArfGAP1 interact in vitro in mammalian cells and in vivo in brain, and co-localize in the cytoplasm and at Golgi membranes. PD-associated and functional mutations that alter the GTPase activity of LRRK2 modulate the interaction with ArfGAP1. The GTP hydrolysis activity of LRRK2 is markedly enhanced by ArfGAP1 supporting a role for ArfGAP1 as a GTPase-activating protein for LRRK2. Unexpectedly, ArfGAP1 promotes the kinase activity of LRRK2 suggesting a potential role for GTP hydrolysis in kinase activation. Furthermore, LRRK2 robustly and directly phosphorylates ArfGAP1 in vitro. Silencing of ArfGAP1 expression in primary cortical neurons rescues the neurite shortening phenotype induced by G2019S LRRK2 overexpression, whereas the co-expression of ArfGAP1 and LRRK2 synergistically promotes neurite shortening in a manner dependent upon LRRK2 GTPase activity. Neurite shortening induced by ArfGAP1 overexpression is also attenuated by silencing of LRRK2. Our data reveal a novel role for ArfGAP1 in regulating the GTPase activity and neuronal toxicity of LRRK2; reciprocally, LRRK2 phosphorylates ArfGAP1 and is

  2. The Parkinson's Disease-Associated Protein Kinase LRRK2 Modulates Notch Signaling through the Endosomal Pathway.

    Directory of Open Access Journals (Sweden)

    Yuzuru Imai

    2015-09-01

    Full Text Available Leucine-rich repeat kinase 2 (LRRK2 is a key molecule in the pathogenesis of familial and idiopathic Parkinson's disease (PD. We have identified two novel LRRK2-associated proteins, a HECT-type ubiquitin ligase, HERC2, and an adaptor-like protein with six repeated Neuralized domains, NEURL4. LRRK2 binds to NEURL4 and HERC2 via the LRRK2 Ras of complex proteins (ROC domain and NEURL4, respectively. HERC2 and NEURL4 link LRRK2 to the cellular vesicle transport pathway and Notch signaling, through which the LRRK2 complex promotes the recycling of the Notch ligand Delta-like 1 (Dll1/Delta (Dl through the modulation of endosomal trafficking. This process negatively regulates Notch signaling through cis-inhibition by stabilizing Dll1/Dl, which accelerates neural stem cell differentiation and modulates the function and survival of differentiated dopaminergic neurons. These effects are strengthened by the R1441G ROC domain-mutant of LRRK2. These findings suggest that the alteration of Notch signaling in mature neurons is a component of PD etiology linked to LRRK2.

  3. LRRK2: an éminence grise of Wnt-mediated neurogenesis?

    Directory of Open Access Journals (Sweden)

    Daniel C Berwick

    2013-05-01

    Full Text Available The importance of Leucine-Rich Repeat Kinase 2 (LRRK2 to mature neurons is well-established, since mutations in PARK8, the gene encoding LRRK2, are the most common known cause of Parkinson’s disease. Nonetheless, despite the LRRK2 knockout mouse having no overt neurodevelopmental defect, numerous lines of in vitro data point towards a central role for this protein in neurogenesis. Roles for LRRK2 have been described in many key processes, including neurite outgrowth and the regulation of microtubule dynamics. Moreover, LRRK2 has been implicated in cell cycle control, suggesting additional roles in neurogenesis that precede terminal differentiation. However, we contend that the suggested function of LRRK2 as a scaffolding protein at the heart of numerous Wnt signaling cascades provides the most tantalizing link to neurogenesis in the developing brain. Numerous lines of evidence show a critical requirement for multiple Wnt pathways in the development of certain brain regions, not least the dopaminergic neurons of the ventral mid-brain. In conclusion, these observations indicate a function of LRRK2 as a subtle yet critical mediator of the action of Wnt ligands on developing neurons. We suggest that LRRK2 loss- or gain-of-function are likely modifiers of developmental phenotypes seen in animal models of Wnt signaling deregulation, a hypothesis that can be tested by cross-breeding relevant genetically modified experimental strains.

  4. Temporal Expression of Mutant LRRK2 in Adult Rats Impairs Dopamine Reuptake

    Directory of Open Access Journals (Sweden)

    Hongxia Zhou, Cao Huang, Jianbin Tong, Weimin C Hong, Yong-Jian Liu, Xu-Gang Xia

    2011-01-01

    Full Text Available Parkinson's disease (PD results from progressive degeneration of dopaminergic neurons. Most PD cases are sporadic, but some have pathogenic mutation in the individual genes. Mutation of the leucine-rich repeat kinase-2 (LRRK2 gene is associated with familial and sporadic PD, as exemplified by G2019S substitution. While constitutive expression of mutant LRRK2 in transgenic mice fails to induce neuron death, transient expression of the disease gene by viral delivery causes a substantial loss of dopaminergic neurons in mice. To further assess LRRK2 pathogenesis, we created inducible transgenic rats expressing human LRRK2 with G2019S substitution. Temporal overexpression of LRRK2G2019S in adult rats impaired dopamine reuptake by dopamine transporter (DAT and thus enhanced locomotor activity, the phenotypes that were not observed in transgenic rats constitutively expressing the gene throughout life time. Reduced DAT binding activity is an early sign of dopaminergic dysfunction in asymptomatic subjects carrying pathogenic mutation in LRRK2. Our transgenic rats recapitulated the initiation process of dopaminergic dysfunction caused by pathogenic mutation in LRRK2. Inducible transgenic approach uncovered phenotypes that may be obscured by developmental compensation in constitutive transgenic rats. Finding in inducible LRRK2 transgenic rats would guide developing effective strategy in transgenic studies: Inducible expression of transgene may induce greater phenotypes than constitutive gene expression, particularly in rodents with short life time.

  5. LRRK2 affects vesicle trafficking, neurotransmitter extracellular level and membrane receptor localization.

    Directory of Open Access Journals (Sweden)

    Rossana Migheli

    Full Text Available The leucine-rich repeat kinase 2 (LRRK2 gene was found to play a role in the pathogenesis of both familial and sporadic Parkinson's disease (PD. LRRK2 encodes a large multi-domain protein that is expressed in different tissues. To date, the physiological and pathological functions of LRRK2 are not clearly defined. In this study we have explored the role of LRRK2 in controlling vesicle trafficking in different cellular or animal models and using various readouts. In neuronal cells, the presence of LRRK2(G2019S pathological mutant determines increased extracellular dopamine levels either under basal conditions or upon nicotine stimulation. Moreover, mutant LRRK2 affects the levels of dopamine receptor D1 on the membrane surface in neuronal cells or animal models. Ultrastructural analysis of PC12-derived cells expressing mutant LRRK2(G2019S shows an altered intracellular vesicle distribution. Taken together, our results point to the key role of LRRK2 to control vesicle trafficking in neuronal cells.

  6. LRRK2 Affects Vesicle Trafficking, Neurotransmitter Extracellular Level and Membrane Receptor Localization

    Science.gov (United States)

    Spissu, Ylenia; Sanna, Giovanna; Xiong, Yulan; Dawson, Ted M.; Dawson, Valina L.; Galioto, Manuela; Rocchitta, Gaia; Biosa, Alice; Serra, Pier Andrea; Carri, Maria Teresa; Crosio, Claudia; Iaccarino, Ciro

    2013-01-01

    The leucine-rich repeat kinase 2 (LRRK2) gene was found to play a role in the pathogenesis of both familial and sporadic Parkinson’s disease (PD). LRRK2 encodes a large multi-domain protein that is expressed in different tissues. To date, the physiological and pathological functions of LRRK2 are not clearly defined. In this study we have explored the role of LRRK2 in controlling vesicle trafficking in different cellular or animal models and using various readouts. In neuronal cells, the presence of LRRK2G2019S pathological mutant determines increased extracellular dopamine levels either under basal conditions or upon nicotine stimulation. Moreover, mutant LRRK2 affects the levels of dopamine receptor D1 on the membrane surface in neuronal cells or animal models. Ultrastructural analysis of PC12-derived cells expressing mutant LRRK2G2019S shows an altered intracellular vesicle distribution. Taken together, our results point to the key role of LRRK2 to control vesicle trafficking in neuronal cells. PMID:24167564

  7. Ribosomal protein s15 phosphorylation mediates LRRK2 neurodegeneration in Parkinson's disease

    Science.gov (United States)

    Martin, Ian; Kim, Jungwoo Wren; Lee, Byoung Dae; Kang, Ho Chul; Xu, Jin-Chong; Jia, Hao; Stankowski, Jeannette; Kim, Min-Sik; Zhong, Jun; Kumar, Manoj; Andrabi, Shaida A.; Xiong, Yulan; Dickson, Dennis W.; Wszolek, Zbigniew K.; Pandey, Akhilesh; Dawson, Ted M.; Dawson, Valina L.

    2014-01-01

    Summary Mutations in leucine-rich repeat kinase 2 (LRRK2) are a common cause of familial and sporadic Parkinson's disease (PD). Elevated LRRK2 kinase activity and neurodegeneration are linked, but the phosphosubstrate that connects LRRK2 kinase activity to neurodegeneration is not known. Here, we show that ribosomal protein s15 is a key pathogenic LRRK2 substrate in Drosophila and human neuron PD models. Phospho-deficient s15 carrying a threonine 136 to alanine substitution rescues dopamine neuron degeneration and age-related locomotor deficits in G2019S LRRK2 transgenic Drosophila and substantially reduces G2019S LRRK2-mediated neurite loss and cell death in human dopamine and cortical neurons. Remarkably, pathogenic LRRK2 stimulates both cap-dependent and cap-independent mRNA translation, and induces a bulk increase in protein synthesis in Drosophila, which can be prevented by phospho-deficient T136A s15. These results reveal a novel mechanism of PD pathogenesis linked to elevated LRRK2 kinase activity and aberrant protein synthesis in vivo. PMID:24725412

  8. LRRK2 phosphorylates moesin at threonine-558: characterization of how Parkinson's disease mutants affect kinase activity

    Science.gov (United States)

    Jaleel, Mahaboobi; Nichols, R. Jeremy; Deak, Maria; Campbell, David G.; Gillardon, Frank; Knebel, Axel; Alessi, Dario R.

    2007-01-01

    Mutations in the LRRK2 (leucine-rich repeat kinase-2) gene cause late-onset PD (Parkinson's disease). LRRK2 contains leucine-rich repeats, a GTPase domain, a COR [C-terminal of Roc (Ras of complex)] domain, a kinase and a WD40 (Trp-Asp 40) motif. Little is known about how LRRK2 is regulated, what its physiological substrates are or how mutations affect LRRK2 function. Thus far LRRK2 activity has only been assessed by autophosphorylation and phosphorylation of MBP (myelin basic protein), which is catalysed rather slowly. We undertook a KESTREL (kinase substrate tracking and elucidation) screen in rat brain extracts to identify proteins that were phosphorylated by an activated PD mutant of LRRK2 (G2019S). This led to the discovery that moesin, a protein which anchors the actin cytoskeleton to the plasma membrane, is efficiently phosphorylated by LRRK2, at Thr558, a previously identified in-vivo-phosphorylation site that regulates the ability of moesin to bind actin. LRRK2 also phosphorylated ezrin and radixin, which are related to moesin, at the residue equivalent to Thr558, as well as a peptide (LRRKtide: RLGRDKYKTLRQIRQ) encompassing Thr558. We exploited these findings to determine how nine previously reported PD mutations of LRRK2 affected kinase activity. Only one of the mutations analysed, namely G2019S, stimulated kinase activity. Four mutations inhibited LRRK2 kinase activity (R1941H, I2012T, I2020T and G2385R), whereas the remainder (R1441C, R1441G, Y1699C and T2356I) did not influence activity. Therefore the manner in which LRRK2 mutations induce PD is more complex than previously imagined and is not only caused by an increase in LRRK2 kinase activity. Finally, we show that the minimum catalytically active fragment of LRRK2 requires an intact GTPase, COR and kinase domain, as well as a WD40 motif and a C-terminal tail. The results of the present study suggest that moesin, ezrin and radixin may be LRRK2 substrates, findings that have been exploited to develop

  9. Inhibitors of LRRK2 kinase attenuate neurodegeneration and Parkinson-like phenotypes in Caenorhabditis elegans and Drosophila Parkinson's disease models

    Science.gov (United States)

    Liu, Zhaohui; Hamamichi, Shusei; Dae Lee, Byoung; Yang, Dejun; Ray, Arpita; Caldwell, Guy A.; Caldwell, Kim A.; Dawson, Ted M.; Smith, Wanli W.; Dawson, Valina L.

    2011-01-01

    Mutations in leucine-rich repeat kinase 2 (LRRK2) have been identified as a genetic cause of familial Parkinson's disease (PD) and have also been found in the more common sporadic form of PD, thus positioning LRRK2 as important in the pathogenesis of PD. Biochemical studies of the disease-causing mutants of LRRK2 implicates an enhancement of kinase activity as the basis of neuronal toxicity and thus possibly the pathogenesis of PD due to LRRK2 mutations. Previously, a chemical library screen identified inhibitors of LRRK2 kinase activity. Here, two of these inhibitors, GW5074 and sorafenib, are shown to protect against G2019S LRRK2-induced neurodegeneration in vivo in Caenorhabditis elegans and in Drosophila. These findings indicate that increased kinase activity of LRRK2 is neurotoxic and that inhibition of LRRK2 activity can have a disease-modifying effect. This suggests that inhibition of LRRK2 holds promise as a treatment for PD. PMID:21768216

  10. The I2020T Leucine-rich repeat kinase 2 transgenic mouse exhibits impaired locomotive ability accompanied by dopaminergic neuron abnormalities

    Directory of Open Access Journals (Sweden)

    Maekawa Tatsunori

    2012-04-01

    Full Text Available Abstract Background Leucine-rich repeat kinase 2 (LRRK2 is the gene responsible for autosomal-dominant Parkinson’s disease (PD, PARK8, but the mechanism by which LRRK2 mutations cause neuronal dysfunction remains unknown. In the present study, we investigated for the first time a transgenic (TG mouse strain expressing human LRRK2 with an I2020T mutation in the kinase domain, which had been detected in the patients of the original PARK8 family. Results The TG mouse expressed I2020T LRRK2 in dopaminergic (DA neurons of the substantia nigra, ventral tegmental area, and olfactory bulb. In both the beam test and rotarod test, the TG mice exhibited impaired locomotive ability in comparison with their non-transgenic (NTG littermates. Although there was no obvious loss of DA neurons in either the substantia nigra or striatum, the TG brain showed several neurological abnormalities such as a reduced striatal dopamine content, fragmentation of the Golgi apparatus in DA neurons, and an increased degree of microtubule polymerization. Furthermore, the tyrosine hydroxylase-positive primary neurons derived from the TG mouse showed an increased frequency of apoptosis and had neurites with fewer branches and decreased outgrowth in comparison with those derived from the NTG controls. Conclusions The I2020T LRRK2 TG mouse exhibited impaired locomotive ability accompanied by several dopaminergic neuron abnormalities. The TG mouse should provide valuable clues to the etiology of PD caused by the LRRK2 mutation.

  11. Chemoproteomics-based design of potent LRRK2-selective lead compounds that attenuate Parkinson's disease-related toxicity in human neurons

    Science.gov (United States)

    Ramsden, Nigel; Perrin, Jessica; Ren, Zhao; Lee, Byoung Dae; Zinn, Nico; Dawson, Valina L.; Tam, Danny; Bova, Michael; Delling, Manja; Drewes, Gerard; Bantscheff, Marcus; Bard, Frederique; Dawson, Ted M.; Hopf, Carsten

    2013-01-01

    Leucine-rich repeat kinase-2 (LRRK2) mutations are the most important cause of familial Parkinson's disease and non-selective inhibitors are protective in rodent disease models. Due to their poor potency and selectivity, the neuroprotective mechanism of these tool compounds has remained elusive so far and it is still unknown whether selective LRRK2 inhibition can attenuate mutant LRRK2-dependent toxicity in human neurons. Here, we employ a chemoproteomics strategy to identify potent, selective and metabolically stable LRRK2 inhibitors. We demonstrate that CZC-25146 prevents mutant LRRK2-induced injury of cultured rodent and human neurons with mid-nanomolar potency. These precise chemical probes further validate this emerging therapeutic strategy. They will enable more detailed studies of LRRK2-dependent signaling and pathogenesis and accelerate drug discovery. PMID:21812418

  12. LRRK2 transport is regulated by its novel interacting partner Rab32.

    Directory of Open Access Journals (Sweden)

    Dieter Waschbüsch

    Full Text Available Leucine-rich repeat kinase 2 (LRRK2 is a multi-domain 280 kDa protein that is linked to Parkinson's disease (PD. Mutations especially in the GTPase and kinase domains of LRRK2 are the most common causes of heritable PD and are also found in sporadic forms of PD. Although the cellular function of LRRK2 is largely unknown there is increasing evidence that these mutations cause cell death due to autophagic dysfunction and mitochondrial damage. Here, we demonstrate a novel mechanism of LRRK2 binding and transport, which involves the small GTPases Rab32 and Rab38. Rab32 and its closest homologue Rab38 are known to organize the trans-Golgi network and transport of key enzymes in melanogenesis, whereas their function in non-melanogenic cells is still not well understood. Cellular processes such as autophagy, mitochondrial dynamics, phagocytosis or inflammatory processes in the brain have previously been linked to Rab32. Here, we demonstrate that Rab32 and Rab38, but no other GTPase tested, directly interact with LRRK2. GFP-Trap analyses confirmed the interaction of Rab32 with the endogenous LRRK2. In yeast two-hybrid experiments we identified a predicted coiled-coil motif containing region within the aminoterminus of LRRK2 as the possible interacting domain. Fluorescence microscopy demonstrated a co-localization of Rab32 and LRRK2 at recycling endosomes and transport vesicles, while overexpression of a constitutively active mutant of Rab32 led to an increased co-localization with Rab7/9 positive perinuclear late endosomes/MVBs. Subcellular fractionation experiments supported the novel role of Rab32 in LRRK2 late endosomal transport and sorting in the cell. Thus, Rab32 may regulate the physiological functions of LRRK2.

  13. Conditional Expression of Parkinson's Disease-Related R1441C LRRK2 in Midbrain Dopaminergic Neurons of Mice Causes Nuclear Abnormalities without Neurodegeneration

    Science.gov (United States)

    Tsika, Elpida; Kannan, Meghna; Foo, Caroline Shi-Yan; Dikeman, Dustin; Glauser, Liliane; Gellhaar, Sandra; Galter, Dagmar; Knott, Graham W.; Dawson, Ted M.; Dawson, Valina L.; Moore, Darren J.

    2015-01-01

    Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene cause late-onset, autosomal dominant Parkinson's disease (PD). The clinical and neurochemical features of LRRK2-linked PD are similar to idiopathic disease although neuropathology is somewhat heterogeneous. Dominant mutations in LRRK2 precipitate neurodegeneration through a toxic gain-of-function mechanism which can be modeled in transgenic mice overexpressing human LRRK2 variants. A number of LRRK2 transgenic mouse models have been developed that display abnormalities in dopaminergic neurotransmission and alterations in tau metabolism yet without consistently inducing dopaminergic neurodegeneration. To directly explore the impact of mutant LRRK2 on the nigrostriatal dopaminergic pathway, we developed conditional transgenic mice that selectively express human R1441C LRRK2 in dopaminergic neurons from the endogenous murine ROSA26 promoter. The expression of R1441C LRRK2 does not induce the degeneration of substantia nigra dopaminergic neurons or striatal dopamine deficits in mice up to 2 years of age, and fails to precipitate abnormal protein inclusions containing alpha-synuclein, tau, ubiquitin or autophagy markers (LC3 and p62). Furthermore, mice expressing R1441C LRRK2 exhibit normal motor activity and olfactory function with increasing age. Intriguingly, the expression of R1441C LRRK2 induces age-dependent abnormalities of the nuclear envelope in nigral dopaminergic neurons including reduced nuclear circularity and increased invaginations of the nuclear envelope. In addition, R1441C LRRK2 mice display increased neurite complexity of cultured midbrain dopaminergic neurons. Collectively, these novel R1441C LRRK2 conditional transgenic mice reveal altered dopaminergic neuronal morphology with advancing age, and provide a useful tool for exploring the pathogenic mechanisms underlying the R1441C LRRK2 mutation in PD. PMID:25174890

  14. Unbiased screen for interactors of leucine-rich repeat kinase 2 supports a common pathway for sporadic and familial Parkinson disease

    Science.gov (United States)

    Beilina, Alexandria; Rudenko, Iakov N.; Kaganovich, Alice; Civiero, Laura; Chau, Hien; Kalia, Suneil K.; Kalia, Lorraine V.; Lobbestael, Evy; Chia, Ruth; Ndukwe, Kelechi; Ding, Jinhui; Nalls, Mike A.; Olszewski, Maciej; Hauser, David N.; Kumaran, Ravindran; Lozano, Andres M.; Baekelandt, Veerle; Greene, Lois E.; Taymans, Jean-Marc; Greggio, Elisa; Cookson, Mark R.; Nalls, Mike A.; Plagnol, Vincent; Martinez, Maria; Hernandez, Dena G; Sharma, Manu; Sheerin, Una-Marie; Saad, Mohamad; Simón-Sánchez, Javier; Schulte, Claudia; Lesage, Suzanne; Sveinbjörnsdóttir, Sigurlaug; Arepalli, Sampath; Barker, Roger; Ben-Shlomo, Yoav; Berendse, Henk W; Berg, Daniela; Bhatia, Kailash; de Bie, Rob M A; Biffi, Alessandro; Bloem, Bas; Bochdanovits, Zoltan; Bonin, Michael; Bras, Jose M; Brockmann, Kathrin; Brooks, Janet; Burn, David J; Charlesworth, Gavin; Chen, Honglei; Chong, Sean; Clarke, Carl E; Cookson, Mark R; Cooper, J Mark; Corvol, Jean Christophe; Counsell, Carl; Damier, Philippe; Dartigues, Jean-François; Deloukas, Panos; Deuschl, Günther; Dexter, David T; van Dijk, Karin D; Dillman, Allissa; Durif, Frank; Dürr, Alexandra; Edkins, Sarah; Evans, Jonathan R; Foltynie, Thomas; Gao, Jianjun; Gardner, Michelle; Gibbs, J Raphael; Goate, Alison; Gray, Emma; Guerreiro, Rita; Gústafsson, Ómar; Harris, Clare; van Hilten, Jacobus J; Hofman, Albert; Hollenbeck, Albert; Holton, Janice; Hu, Michele; Huang, Xuemei; Huber, Heiko; Hudson, Gavin; Hunt, Sarah E; Huttenlocher, Johanna; Illig, Thomas; München, Helmholtz Zentrum; Jónsson, Pálmi V; Lambert, Jean-Charles; Langford, Cordelia; Lees, Andrew; Lichtner, Peter; München, Helmholtz Zentrum; Limousin, Patricia; Lopez, Grisel; Lorenz, Delia; McNeill, Alisdair; Moorby, Catriona; Moore, Matthew; Morris, Huw R; Morrison, Karen E; Mudanohwo, Ese; O’Sullivan, Sean S; Pearson, Justin; Perlmutter, Joel S; Pétursson, Hjörvar; Pollak, Pierre; Post, Bart; Potter, Simon; Ravina, Bernard; Revesz, Tamas; Riess, Olaf; Rivadeneira, Fernando; Rizzu, Patrizia; Ryten, Mina; Sawcer, Stephen; Schapira, Anthony; Scheffer, Hans; Shaw, Karen; Shoulson, Ira; Sidransky, Ellen; Smith, Colin; Spencer, Chris C A; Stefánsson, Hreinn; Steinberg, Stacy; Stockton, Joanna D; Strange, Amy; Talbot, Kevin; Tanner, Carlie M; Tashakkori-Ghanbaria, Avazeh; Tison, François; Trabzuni, Daniah; Traynor, Bryan J; Uitterlinden, André G; Velseboer, Daan; Vidailhet, Marie; Walker, Robert; van de Warrenburg, Bart; Wickremaratchi, Mirdhu; Williams, Nigel; Williams-Gray, Caroline H; Winder-Rhodes, Sophie; Stefánsson, Kári; Hardy, John; Heutink, Peter; Brice, Alexis; Gasser, Thomas; Singleton, Andrew B; Wood, Nicholas W; Chinnery, Patrick F; Arepalli, Sampath; Cookson, Mark R; Dillman, Allissa; Ferrucci, Luigi; Gibbs, J Raphael; Hernandez, Dena G; Johnson, Robert; Longo, Dan L; Majounie, Elisa; Nalls, Michael A; O’Brien, Richard; Singleton, Andrew B; Traynor, Bryan J; Troncoso, Juan; van der Brug, Marcel; Zielke, H Ronald; Zonderman, Alan B

    2014-01-01

    Mutations in leucine-rich repeat kinase 2 (LRRK2) cause inherited Parkinson disease (PD), and common variants around LRRK2 are a risk factor for sporadic PD. Using protein–protein interaction arrays, we identified BCL2-associated athanogene 5, Rab7L1 (RAB7, member RAS oncogene family-like 1), and Cyclin-G–associated kinase as binding partners of LRRK2. The latter two genes are candidate genes for risk for sporadic PD identified by genome-wide association studies. These proteins form a complex that promotes clearance of Golgi-derived vesicles through the autophagy–lysosome system both in vitro and in vivo. We propose that three different genes for PD have a common biological function. More generally, data integration from multiple unbiased screens can provide insight into human disease mechanisms. PMID:24510904

  15. Neural correlates of executive functions in healthy G2019S LRRK2 mutation carriers

    NARCIS (Netherlands)

    Thaler, A.; Mirelman, A.; Helmich, R.C.G.; Nuenen, B.F.L. van; Rosenberg-Katz, K.; Gurevich, T.; Orr-Urtreger, A.; Marder, K.; Bressman, S.; Bloem, B.R.; Giladi, N.; Hendler, T.; consortium, L.A.J.

    2013-01-01

    INTRODUCTION: The G2019S mutation in the leucine rich repeat kinase 2 (LRRK2) gene is prevalent among Ashkenazi Jewish patients with Parkinson's disease (PD). Cognitive deficits are common in early stage PD. We aimed to characterize the effect of the G2019S mutation on neural mechanisms of executive

  16. Altered Expression of EPO Might Underlie Hepatic Hemangiomas in LRRK2 Knockout Mice.

    Science.gov (United States)

    Wu, Ben; Xiao, Kaifu; Zhang, Zhuohua; Ma, Long

    2016-01-01

    Parkinson's disease (PD) is a severe neurodegenerative disorder caused by progressive loss of dopaminergic neurons in the substantia nigra pars compacta of the midbrain. The molecular mechanism of PD pathogenesis is unclear. Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene are a common genetic cause of familial and sporadic PD. However, studies on LRRK2 mutant mice revealed no visible dopaminergic neuronal loss in the midbrain. While surveying a LRRK2 knockout mouse strain, we found that old animals developed age-dependent hepatic vascular growths similar to cavernous hemangiomas. In livers of these hemangioma-positive LRRK2 knockout mice, we detected an increased expression of the HIF-2α protein and significant reactivation of the expression of the HIF-2α target gene erythropoietin (EPO), a finding consistent with a role of the HIF-2α pathway in blood vessel vascularization. We also found that the kidney EPO expression was reduced to 20% of the wild-type level in 18-month-old LRRK2 knockout mice. Unexpectedly, this reduction was restored to wild-type levels when the knockout mice were 22 months to 23 months old, implying a feedback mechanism regulating kidney EPO expression. Our findings reveal a novel function of LRRK2 in regulating EPO expression and imply a potentially novel relationship between PD genes and hematopoiesis.

  17. Dopaminergic neuronal loss, reduced neurite complexity and autophagic abnormalities in transgenic mice expressing G2019S mutant LRRK2.

    Directory of Open Access Journals (Sweden)

    David Ramonet

    Full Text Available Mutations in the leucine-rich repeat kinase 2 (LRRK2 gene cause late-onset, autosomal dominant familial Parkinson's disease (PD and also contribute to idiopathic PD. LRRK2 mutations represent the most common cause of PD with clinical and neurochemical features that are largely indistinguishable from idiopathic disease. Currently, transgenic mice expressing wild-type or disease-causing mutants of LRRK2 have failed to produce overt neurodegeneration, although abnormalities in nigrostriatal dopaminergic neurotransmission have been observed. Here, we describe the development and characterization of transgenic mice expressing human LRRK2 bearing the familial PD mutations, R1441C and G2019S. Our study demonstrates that expression of G2019S mutant LRRK2 induces the degeneration of nigrostriatal pathway dopaminergic neurons in an age-dependent manner. In addition, we observe autophagic and mitochondrial abnormalities in the brains of aged G2019S LRRK2 mice and markedly reduced neurite complexity of cultured dopaminergic neurons. These new LRRK2 transgenic mice will provide important tools for understanding the mechanism(s through which familial mutations precipitate neuronal degeneration and PD.

  18. Dopaminergic Neuronal Loss, Reduced Neurite Complexity and Autophagic Abnormalities in Transgenic Mice Expressing G2019S Mutant LRRK2

    Science.gov (United States)

    Lin, Brian M.; Stafa, Klodjan; Kim, Jaekwang; Banerjee, Rebecca; Westerlund, Marie; Pletnikova, Olga; Glauser, Liliane; Yang, Lichuan; Liu, Ying; Swing, Deborah A.; Beal, M. Flint; Troncoso, Juan C.; McCaffery, J. Michael; Jenkins, Nancy A.; Copeland, Neal G.; Galter, Dagmar; Thomas, Bobby; Lee, Michael K.; Dawson, Ted M.; Dawson, Valina L.; Moore, Darren J.

    2011-01-01

    Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene cause late-onset, autosomal dominant familial Parkinson's disease (PD) and also contribute to idiopathic PD. LRRK2 mutations represent the most common cause of PD with clinical and neurochemical features that are largely indistinguishable from idiopathic disease. Currently, transgenic mice expressing wild-type or disease-causing mutants of LRRK2 have failed to produce overt neurodegeneration, although abnormalities in nigrostriatal dopaminergic neurotransmission have been observed. Here, we describe the development and characterization of transgenic mice expressing human LRRK2 bearing the familial PD mutations, R1441C and G2019S. Our study demonstrates that expression of G2019S mutant LRRK2 induces the degeneration of nigrostriatal pathway dopaminergic neurons in an age-dependent manner. In addition, we observe autophagic and mitochondrial abnormalities in the brains of aged G2019S LRRK2 mice and markedly reduced neurite complexity of cultured dopaminergic neurons. These new LRRK2 transgenic mice will provide important tools for understanding the mechanism(s) through which familial mutations precipitate neuronal degeneration and PD. PMID:21494637

  19. Evaluation of the Role of LRRK2 Gene in Parkinson’s Disease in an East Indian Cohort

    Directory of Open Access Journals (Sweden)

    Tamal Sadhukhan

    2012-01-01

    Full Text Available Leucine rich repeat kinase 2 (LRRK2 gene defects cause Parkinson's disease (PD. Recently, LRRK2 has also been shown by genome wide association (GWA studies to be a susceptibility gene for the disease. In India mutations in LRRK2 is a rare cause of PD. We, therefore, genotyped 64 SNPs across LRRK2 in 161 control samples and finally studied 6 haplotype tagging SNPs for association-based study on 300 cases and 446 ethnically matched controls to explore the potential role of LRRK2 as a susceptibility gene in PD for East Indians. We did not find any significant allele/ genotype or haplotype associations with PD suggesting that common genetic variants within LRRK2 play limited role in modulating PD among East Indians. In addition, we also screened for the common mutations (viz. p.R1441C, p.R1441G, p.R1441H, p.Y1699C, p.G2019S, and a risk variant common among Asians (p.G2385R but did not observe any of the above mentioned variants in our cohort. Our study, therefore, strongly suggests that LRRK2 has minimal role as a candidate and susceptibility gene in PD pathogenesis among East Indians.

  20. The IkappaB kinase family phosphorylates the Parkinson's disease kinase LRRK2 at Ser935 and Ser910 during Toll-like receptor signaling.

    Directory of Open Access Journals (Sweden)

    Nicolas Dzamko

    Full Text Available Mutations in leucine-rich repeat kinase 2 (LRRK2 are strongly associated with late-onset autosomal dominant Parkinson's disease. LRRK2 is highly expressed in immune cells and recent work points towards a link between LRRK2 and innate immunity. Here we demonstrate that stimulation of the Toll-Like Receptor (TLR pathway by MyD88-dependent agonists in bone marrow-derived macrophages (BMDMs or RAW264.7 macrophages induces marked phosphorylation of LRRK2 at Ser910 and Ser935, the phosphorylation sites that regulate the binding of 14-3-3 to LRRK2. Phosphorylation of these residues is prevented by knock-out of MyD88 in BMDMs, but not the alternative TLR adaptor protein TRIF. Utilising both pharmacological inhibitors, including a new TAK1 inhibitor, NG25, and genetic models, we provide evidence that both the canonical (IKKα and IKKβ and IKK-related (IKKε and TBK1 kinases mediate TLR agonist induced phosphorylation of LRRK2 in vivo. Moreover, all four IKK members directly phosphorylate LRRK2 at Ser910 and Ser935 in vitro. Consistent with previous work describing Ser910 and Ser935 as pharmacodynamic biomarkers of LRRK2 activity, we find that the TLR independent basal phosphorylation of LRRK2 at Ser910 and Ser935 is abolished following treatment of macrophages with LRRK2 kinase inhibitors. However, the increased phosphorylation of Ser910 and Ser935 induced by activation of the MyD88 pathway is insensitive to LRRK2 kinase inhibitors. Finally, employing LRRK2-deficient BMDMs, we present data indicating that LRRK2 does not play a major role in regulating the secretion of inflammatory cytokines induced by activation of the MyD88 pathway. Our findings provide the first direct link between LRRK2 and the IKKs that mediate many immune responses. Further work is required to uncover the physiological roles that phosphorylation of LRRK2 by IKKs play in controlling macrophage biology and to determine how phosphorylation of LRRK2 by IKKs impacts upon the use of Ser

  1. Phenotype, genotype, and worldwide genetic penetrance of LRRK2-associated Parkinson's disease: a case-control study.

    Science.gov (United States)

    Healy, Daniel G; Falchi, Mario; O'Sullivan, Sean S; Bonifati, Vincenzo; Durr, Alexandra; Bressman, Susan; Brice, Alexis; Aasly, Jan; Zabetian, Cyrus P; Goldwurm, Stefano; Ferreira, Joaquim J; Tolosa, Eduardo; Kay, Denise M; Klein, Christine; Williams, David R; Marras, Connie; Lang, Anthony E; Wszolek, Zbigniew K; Berciano, Jose; Schapira, Anthony H V; Lynch, Timothy; Bhatia, Kailash P; Gasser, Thomas; Lees, Andrew J; Wood, Nicholas W

    2008-07-01

    Mutations in LRRK2, the gene that encodes leucine-rich repeat kinase 2, are a cause of Parkinson's disease (PD). The International LRRK2 Consortium was established to answer three key clinical questions: can LRRK2-associated PD be distinguished from idiopathic PD; which mutations in LRRK2 are pathogenic; and what is the age-specific cumulative risk of PD for individuals who inherit or are at risk of inheriting a deleterious mutation in LRRK2? Researchers from 21 centres across the world collaborated on this study. The frequency of the common LRRK2 Gly2019Ser mutation was estimated on the basis of data from 24 populations worldwide, and the penetrance of the mutation was defined in 1045 people with mutations in LRRK2 from 133 families. The LRRK2 phenotype was defined on the basis of 59 motor and non-motor symptoms in 356 patients with LRRK2-associated PD and compared with the symptoms of 543 patients with pathologically proven idiopathic PD. Six mutations met the consortium's criteria for being proven pathogenic. The frequency of the common LRRK2 Gly2019Ser mutation was 1% of patients with sporadic PD and 4% of patients with hereditary PD; the frequency was highest in the middle east and higher in southern Europe than in northern Europe. The risk of PD for a person who inherits the LRRK2 Gly2019Ser mutation was 28% at age 59 years, 51% at 69 years, and 74% at 79 years. The motor symptoms (eg, disease severity, rate of progression, occurrence of falls, and dyskinesia) and non-motor symptoms (eg, cognition and olfaction) of LRRK2-associated PD were more benign than those of idiopathic PD. Mutations in LRRK2 are a clinically relevant cause of PD that merit testing in patients with hereditary PD and in subgroups of patients with PD. However, this knowledge should be applied with caution in the diagnosis and counselling of patients. UK Medical Research Council; UK Parkinson's Disease Society; UK Brain Research Trust; Internationaal Parkinson Fonds; Volkswagen Foundation

  2. Parkinson's disease-related LRRK2 G2019S mutation results from independent mutational events in humans.

    OpenAIRE

    2010-01-01

    7 pages; International audience; Mutations in the leucine-rich-repeat kinase 2 (LRRK2) gene have been identified in families with autosomal dominant Parkinson's disease (PD) and in sporadic cases; the G2019S mutation is the single most frequent. Intriguingly, the frequency of this mutation in PD patients varies greatly among ethnic groups and geographic origins: it is present at

  3. Mutant of leucine-rich repeat kinase 2 is not associated with non-motor symptoms in Chinese Parkinson's disease patients.

    Science.gov (United States)

    Hao, Maolin; Pan, Ning; Zhang, Qinghua; Wang, Xiaohong

    2014-01-01

    Non-motor symptoms (NMS) are common in patients with Parkinson's disease (PD). However, little is known about NMS in patients with mutant of leucine-rich repeat kinase 2 (LRRK2). This study aimed to elucidate the relationship between NMS in Chinese PD patients and to ascertain if there were differences in NMS between PD patients and mutant of LRRK2. 200 sporadic PD (sPD) patients were recruited from a Provincial Hospital Affiliated to Shandong University. The Non-motor Symptom Questionnaire (NMSQ) was used to screen for the presence of NMS. A mean of 9.73 NMS (SD=4.53) was reported per patient. Forgetfulness, constipation and daytime sleepiness were found to be the most frequent NMS. No differences were found in 9 domains analysis between PD with and without LRRK2 variants. Non-motor symptoms in PD are too important to remain undetected. There are no Clinical characteristics of NMS tend to be similar between LRRK2 variants carriers and non-carriers in Chinese sPD patients.

  4. Fibroblast Biomarkers of Sporadic Parkinson's Disease and LRRK2 Kinase Inhibition.

    Science.gov (United States)

    Smith, G A; Jansson, J; Rocha, E M; Osborn, T; Hallett, P J; Isacson, O

    2016-10-01

    It has been uncertain whether specific disease-relevant biomarker phenotypes can be found using sporadic Parkinson's disease (PD) patient-derived samples, as it has been proposed that there may be a plethora of underlying causes and pathological mechanisms. Fibroblasts derived from familial PD patients harboring leucine-rich repeat kinase 2 (LRRK2), PTEN-induced putative kinase 1 (PINK1), and Parkin mutations show clear disease-relevant mitochondrial phenotypes, which are exacerbated under conditions of pharmacological stress. We utilized fibroblasts derived from non-familial sporadic PD patients (without LRRK2 mutations) or LRRK2 mutation carriers to directly compare the cellular phenotypes during and after mitochondrial stress. We then determined the effects of pharmacological LRRK2 kinase inhibition using LRRK2-in-1. We found that there were two distinct populations of sporadic PD patient-derived fibroblast lines. One group of sporadic PD lines was highly susceptible to valinomycin-induced mitochondrial depolarization, emulating the mutant LRRK2 phenotype. These lines showed elevated mitochondrial superoxide/ nitric oxide levels, displayed increased mitochondrial and lysosome co-localization, and an increased rate of mitochondrial collapse, which corresponded with changes in mitochondrial fission and fusion proteins. The application of LRRK2-in-1 reversed decreased levels of mitochondrial and lysosome co-localization and partially restored mitochondrial network associated proteins and the mitochondrial membrane potential in the fibroblasts. This study identifies novel mitochondrial biomarkers in sporadic PD patient-derived fibroblast lines, which could be used as preclinical tools in which to test novel and known neuroprotective compounds.

  5. The LRRK2 G2019S mutation as the cause of Parkinson's disease in Ashkenazi Jews.

    Science.gov (United States)

    Thaler, Avner; Ash, Elissa; Gan-Or, Ziv; Orr-Urtreger, Avi; Giladi, Nir

    2009-11-01

    Mutations in the leucine rich repeat kinase 2 gene (LRRK2) are recognized as the most common cause of genetic Parkinsonism to date. The G2019S mutation has been implicated as an important determinant of Parkinson's disease (PD) in both Ashkenazi Jewish and North African Arab populations with carrier frequency of 29.7% among familial and 6% in sporadic Ashkenazi Jewish PD cases. PD patients with the G2019S mutation display similar clinical characteristics to patients with sporadic PD. While the function of the LRRK2 protein has yet to be fully determined, its distribution coincides with brain areas most affected by PD. The G2019S mutation is believed to be responsible for up-regulation of LRRK2 kinase activity, which may ultimately play a role in neuronal loss. The utility of LRRK2 G2019S screening in family members of Ashkenazi PD patients is discussed. LRRK2 G2019S mutation carriers without PD may be an ideal population for the study of possible neuroprotective strategies as they become available, and for furthering the understanding of the pathogenesis and long-term clinical outcomes of the disease.

  6. Parkinson disease phenotype in Ashkenazi Jews with and without LRRK2 G2019S mutations.

    Science.gov (United States)

    Alcalay, Roy N; Mirelman, Anat; Saunders-Pullman, Rachel; Tang, Ming-X; Mejia Santana, Helen; Raymond, Deborah; Roos, Ernest; Orbe-Reilly, Martha; Gurevich, Tanya; Bar Shira, Anat; Gana Weisz, Mali; Yasinovsky, Kira; Zalis, Maayan; Thaler, Avner; Deik, Andres; Barrett, Matthew James; Cabassa, Jose; Groves, Mark; Hunt, Ann L; Lubarr, Naomi; San Luciano, Marta; Miravite, Joan; Palmese, Christina; Sachdev, Rivka; Sarva, Harini; Severt, Lawrence; Shanker, Vicki; Swan, Matthew Carrington; Soto-Valencia, Jeannie; Johannes, Brooke; Ortega, Robert; Fahn, Stanley; Cote, Lucien; Waters, Cheryl; Mazzoni, Pietro; Ford, Blair; Louis, Elan; Levy, Oren; Rosado, Llency; Ruiz, Diana; Dorovski, Tsvyatko; Pauciulo, Michael; Nichols, William; Orr-Urtreger, Avi; Ozelius, Laurie; Clark, Lorraine; Giladi, Nir; Bressman, Susan; Marder, Karen S

    2013-12-01

    The phenotype of Parkinson's disease (PD) in patients with and without leucine-rich repeat kinase 2 (LRRK2) G2019S mutations reportedly is similar; however, large, uniformly evaluated series are lacking. The objective of this study was to characterize the clinical phenotype of Ashkenazi Jewish (AJ) PD carriers of the LRRK2 G2019S mutation. We studied 553 AJ PD patients, including 65 patients who were previously reported, from three sites (two in New York and one in Tel-Aviv). Glucocerebrosidase (GBA) mutation carriers were excluded. Evaluations included the Montreal Cognitive Assessment (MoCA), the Unified Parkinson's Disease Rating Scale (UPDRS), the Geriatric Depression Scale (GDS) and the Non-Motor Symptoms (NMS) questionnaire. Regression models were constructed to test the association between clinical and demographic features and LRRK2 status (outcome) in 488 newly recruited participants. LRRK2 G2019S carriers (n = 97) and non-carriers (n = 391) were similar in age and age at onset of PD. Carriers had longer disease duration (8.6 years vs. 6.1 years; P 5 years (P = 0.042). Performance on the UPDRS, MoCA, GDS, and NMS did not differ by mutation status. PD in AJ LRRK2 G2019S mutation carriers is similar to idiopathic PD but is characterized by more frequent lower extremity involvement at onset and PIGD without the associated cognitive impairment.

  7. LRRK2 mouse models: dissecting the behavior, striatal neurochemistry and neurophysiology of PD pathogenesis.

    Science.gov (United States)

    Volta, Mattia; Melrose, Heather

    2017-02-08

    Mutations in leucine-rich repeat kinase 2 (LRRK2) are the most common genetic cause of familial Parkinson's disease (PD), resembling the sporadic disorder. Intensive effort has been directed toward LRRK2 mouse modeling and investigation, aimed at reproducing the human disease to inform mechanistic studies of pathogenesis and design of neuroprotective therapies. The physiological function of LRRK2 is still under exploration, but a clear role in striatal neurophysiology and animal behavior has emerged. Alterations in LRRK2 impair dopamine (DA) transmission, regulation and signaling, in addition to corticostriatal synaptic plasticity. Consistently, several subtle abnormalities in motor and nonmotor abilities have been demonstrated in LRRK2 genetic mouse models, generally paralleling preclinical symptoms of early DA dysfunction. However, the variability in model design and phenotypes observed requires a critical approach in interpreting the results, adapting the model used to the specific research question. Etiologically appropriate knockin mice might represent the ultimate animal model in which to study early disease mechanisms and therapies as well as to investigate drug effectiveness and off-target consequences.

  8. LRRK2 inhibitors and their potential in the treatment of Parkinson’s disease: current perspectives

    Directory of Open Access Journals (Sweden)

    Atashrazm F

    2016-10-01

    Full Text Available Farzaneh Atashrazm,1 Nicolas Dzamko2 1Neuroscience Research Australia, Randwick; 2School of Medical Sciences, Faculty of Medicine, University of New South Wales, Kensington, NSW, Australia Abstract: Major advances in understanding how genetics underlies Parkinson’s disease (PD have provided new opportunities for understanding disease pathogenesis and potential new targets for therapeutic intervention. One such target is leucine-rich repeat kinase 2 (LRRK2, an enigmatic enzyme implicated in both familial and idiopathic PD risk. Both academia and industry have promoted the development of potent and selective inhibitors of LRRK2, and these are currently being employed to assess the safety and efficacy of such compounds in preclinical models of PD. This review examines the evidence that LRRK2 kinase activity contributes to the pathogenesis of PD and outlines recent progress on inhibitor development and early results from preclinical safety and efficacy testing. This review also looks at some of the challenges remaining for translation of LRRK2 inhibitors to the clinic, if indeed this is ultimately warranted. As a disease with no current cure that is increasing in prevalence in line with an aging population, there is much need for developing new treatments for PD, and targeting LRRK2 is currently a promising option. Keywords: synuclein, inflammation, lysosome, Rab, inhibitor, autophagy

  9. A proteomic analysis of LRRK2 binding partners reveals interactions with multiple signaling components of the WNT/PCP pathway.

    Science.gov (United States)

    Salašová, Alena; Yokota, Chika; Potěšil, David; Zdráhal, Zbyněk; Bryja, Vítězslav; Arenas, Ernest

    2017-07-11

    Autosomal-dominant mutations in the Park8 gene encoding Leucine-rich repeat kinase 2 (LRRK2) have been identified to cause up to 40% of the genetic forms of Parkinson's disease. However, the function and molecular pathways regulated by LRRK2 are largely unknown. It has been shown that LRRK2 serves as a scaffold during activation of WNT/β-catenin signaling via its interaction with the β-catenin destruction complex, DVL1-3 and LRP6. In this study, we examine whether LRRK2 also interacts with signaling components of the WNT/Planar Cell Polarity (WNT/PCP) pathway, which controls the maturation of substantia nigra dopaminergic neurons, the main cell type lost in Parkinson's disease patients. Co-immunoprecipitation and tandem mass spectrometry was performed in a mouse substantia nigra cell line (SN4741) and human HEK293T cell line in order to identify novel LRRK2 binding partners. Inhibition of the WNT/β-catenin reporter, TOPFlash, was used as a read-out of WNT/PCP pathway activation. The capacity of LRRK2 to regulate WNT/PCP signaling in vivo was tested in Xenopus laevis' early development. Our proteomic analysis identified that LRRK2 interacts with proteins involved in WNT/PCP signaling such as the PDZ domain-containing protein GIPC1 and Integrin-linked kinase (ILK) in dopaminergic cells in vitro and in the mouse ventral midbrain in vivo. Moreover, co-immunoprecipitation analysis revealed that LRRK2 binds to two core components of the WNT/PCP signaling pathway, PRICKLE1 and CELSR1, as well as to FLOTILLIN-2 and CULLIN-3, which regulate WNT secretion and inhibit WNT/β-catenin signaling, respectively. We also found that PRICKLE1 and LRRK2 localize in signalosomes and act as dual regulators of WNT/PCP and β-catenin signaling. Accordingly, analysis of the function of LRRK2 in vivo, in X. laevis revelaed that LRKK2 not only inhibits WNT/β-catenin pathway, but induces a classical WNT/PCP phenotype in vivo. Our study shows for the first time that LRRK2 activates the WNT

  10. Structural model of the dimeric Parkinson’s protein LRRK2 reveals a compact architecture involving distant interdomain contacts

    Science.gov (United States)

    Guaitoli, Giambattista; Raimondi, Francesco; Gilsbach, Bernd K.; Gómez-Llorente, Yacob; Deyaert, Egon; Renzi, Fabiana; Li, Xianting; Schaffner, Adam; Jagtap, Pravin Kumar Ankush; Boldt, Karsten; von Zweydorf, Felix; Gotthardt, Katja; Lorimer, Donald D.; Yue, Zhenyu; Burgin, Alex; Janjic, Nebojsa; Sattler, Michael; Versées, Wim; Ueffing, Marius; Ubarretxena-Belandia, Iban; Kortholt, Arjan; Gloeckner, Christian Johannes

    2016-01-01

    Leucine-rich repeat kinase 2 (LRRK2) is a large, multidomain protein containing two catalytic domains: a Ras of complex proteins (Roc) G-domain and a kinase domain. Mutations associated with familial and sporadic Parkinson’s disease (PD) have been identified in both catalytic domains, as well as in several of its multiple putative regulatory domains. Several of these mutations have been linked to increased kinase activity. Despite the role of LRRK2 in the pathogenesis of PD, little is known about its overall architecture and how PD-linked mutations alter its function and enzymatic activities. Here, we have modeled the 3D structure of dimeric, full-length LRRK2 by combining domain-based homology models with multiple experimental constraints provided by chemical cross-linking combined with mass spectrometry, negative-stain EM, and small-angle X-ray scattering. Our model reveals dimeric LRRK2 has a compact overall architecture with a tight, multidomain organization. Close contacts between the N-terminal ankyrin and C-terminal WD40 domains, and their proximity—together with the LRR domain—to the kinase domain suggest an intramolecular mechanism for LRRK2 kinase activity regulation. Overall, our studies provide, to our knowledge, the first structural framework for understanding the role of the different domains of full-length LRRK2 in the pathogenesis of PD. PMID:27357661

  11. Dysregulated LRRK2 signaling in response to endoplasmic reticulum stress leads to dopaminergic neuron degeneration in C. elegans.

    Directory of Open Access Journals (Sweden)

    Yiyuan Yuan

    Full Text Available Mutation of leucine-rich repeat kinase 2 (LRRK2 is the leading genetic cause of Parkinson's Disease (PD, manifested as age-dependent dopaminergic neurodegeneration, but the underlying molecular mechanisms remain unclear. Multiple roles of LRRK2 may contribute to dopaminergic neurodegeneration. Endoplasmic reticulum (ER stress has also been linked to PD pathogenesis, but its interactive mechanism with PD genetic factors is largely unknown. Here, we used C. elegans, human neuroblastoma cells and murine cortical neurons to determine the role of LRRK2 in maintaining dopaminergic neuron viability. We found that LRRK2 acts to protect neuroblastoma cells and C. elegans dopaminergic neurons from the toxicity of 6-hydroxydopamine and/or human α-synuclein, possibly through the p38 pathway, by supporting upregulation of GRP78, a key cell survival molecule during ER stress. A pathogenic LRRK2 mutant (G2019S, however, caused chronic p38 activation that led to death of murine neurons and age-related dopaminergic-specific neurodegeneration in nematodes. These observations establish a critical functional link between LRRK2 and ER stress.

  12. Dysregulated LRRK2 signaling in response to endoplasmic reticulum stress leads to dopaminergic neuron degeneration in C. elegans.

    Science.gov (United States)

    Yuan, Yiyuan; Cao, Pengxiu; Smith, Mark A; Kramp, Kristopher; Huang, Ying; Hisamoto, Naoki; Matsumoto, Kunihiro; Hatzoglou, Maria; Jin, Hui; Feng, Zhaoyang

    2011-01-01

    Mutation of leucine-rich repeat kinase 2 (LRRK2) is the leading genetic cause of Parkinson's Disease (PD), manifested as age-dependent dopaminergic neurodegeneration, but the underlying molecular mechanisms remain unclear. Multiple roles of LRRK2 may contribute to dopaminergic neurodegeneration. Endoplasmic reticulum (ER) stress has also been linked to PD pathogenesis, but its interactive mechanism with PD genetic factors is largely unknown. Here, we used C. elegans, human neuroblastoma cells and murine cortical neurons to determine the role of LRRK2 in maintaining dopaminergic neuron viability. We found that LRRK2 acts to protect neuroblastoma cells and C. elegans dopaminergic neurons from the toxicity of 6-hydroxydopamine and/or human α-synuclein, possibly through the p38 pathway, by supporting upregulation of GRP78, a key cell survival molecule during ER stress. A pathogenic LRRK2 mutant (G2019S), however, caused chronic p38 activation that led to death of murine neurons and age-related dopaminergic-specific neurodegeneration in nematodes. These observations establish a critical functional link between LRRK2 and ER stress.

  13. The Gly2019Ser mutation in LRRK2 is not fully penetrant in familial Parkinson's disease: the GenePD study

    Science.gov (United States)

    Latourelle, Jeanne C; Sun, Mei; Lew, Mark F; Suchowersky, Oksana; Klein, Christine; Golbe, Lawrence I; Mark, Margery H; Growdon, John H; Wooten, G Frederick; Watts, Ray L; Guttman, Mark; Racette, Brad A; Perlmutter, Joel S; Ahmed, Anwar; Shill, Holly A; Singer, Carlos; Goldwurm, Stefano; Pezzoli, Gianni; Zini, Michela; Saint-Hilaire, Marie H; Hendricks, Audrey E; Williamson, Sally; Nagle, Michael W; Wilk, Jemma B; Massood, Tiffany; Huskey, Karen W; Laramie, Jason M; DeStefano, Anita L; Baker, Kenneth B; Itin, Ilia; Litvan, Irene; Nicholson, Garth; Corbett, Alastair; Nance, Martha; Drasby, Edward; Isaacson, Stuart; Burn, David J; Chinnery, Patrick F; Pramstaller, Peter P; Al-hinti, Jomana; Moller, Anette T; Ostergaard, Karen; Sherman, Scott J; Roxburgh, Richard; Snow, Barry; Slevin, John T; Cambi, Franca; Gusella, James F; Myers, Richard H

    2008-01-01

    Background We report age-dependent penetrance estimates for leucine-rich repeat kinase 2 (LRRK2)-related Parkinson's disease (PD) in a large sample of familial PD. The most frequently seen LRRK2 mutation, Gly2019Ser (G2019S), is associated with approximately 5 to 6% of familial PD cases and 1 to 2% of idiopathic cases, making it the most common known genetic cause of PD. Studies of the penetrance of LRRK2 mutations have produced a wide range of estimates, possibly due to differences in study design and recruitment, including in particular differences between samples of familial PD versus sporadic PD. Methods A sample, including 903 affected and 58 unaffected members from 509 families ascertained for having two or more PD-affected members, 126 randomly ascertained PD patients and 197 controls, was screened for five different LRRK2 mutations. Penetrance was estimated in families of LRRK2 carriers with consideration of the inherent bias towards increased penetrance in a familial sample. Results Thirty-one out of 509 families with multiple cases of PD (6.1%) were found to have 58 LRRK2 mutation carriers (6.4%). Twenty-nine of the 31 families had G2019S mutations while two had R1441C mutations. No mutations were identified among controls or unaffected relatives of PD cases. Nine PD-affected relatives of G2019S carriers did not carry the LRRK2 mutation themselves. At the maximum observed age range of 90 to 94 years, the unbiased estimated penetrance was 67% for G2019S families, compared with a baseline PD risk of 17% seen in the non-LRRK2-related PD families. Conclusion Lifetime penetrance of LRRK2 estimated in the unascertained relatives of multiplex PD families is greater than that reported in studies of sporadically ascertained LRRK2 cases, suggesting that inherited susceptibility factors may modify the penetrance of LRRK2 mutations. In addition, the presence of nine PD phenocopies in the LRRK2 families suggests that these susceptibility factors may also increase the

  14. The Gly2019Ser mutation in LRRK2 is not fully penetrant in familial Parkinson's disease: the GenePD study

    Directory of Open Access Journals (Sweden)

    Corbett Alastair

    2008-11-01

    Full Text Available Abstract Background We report age-dependent penetrance estimates for leucine-rich repeat kinase 2 (LRRK2-related Parkinson's disease (PD in a large sample of familial PD. The most frequently seen LRRK2 mutation, Gly2019Ser (G2019S, is associated with approximately 5 to 6% of familial PD cases and 1 to 2% of idiopathic cases, making it the most common known genetic cause of PD. Studies of the penetrance of LRRK2 mutations have produced a wide range of estimates, possibly due to differences in study design and recruitment, including in particular differences between samples of familial PD versus sporadic PD. Methods A sample, including 903 affected and 58 unaffected members from 509 families ascertained for having two or more PD-affected members, 126 randomly ascertained PD patients and 197 controls, was screened for five different LRRK2 mutations. Penetrance was estimated in families of LRRK2 carriers with consideration of the inherent bias towards increased penetrance in a familial sample. Results Thirty-one out of 509 families with multiple cases of PD (6.1% were found to have 58 LRRK2 mutation carriers (6.4%. Twenty-nine of the 31 families had G2019S mutations while two had R1441C mutations. No mutations were identified among controls or unaffected relatives of PD cases. Nine PD-affected relatives of G2019S carriers did not carry the LRRK2 mutation themselves. At the maximum observed age range of 90 to 94 years, the unbiased estimated penetrance was 67% for G2019S families, compared with a baseline PD risk of 17% seen in the non-LRRK2-related PD families. Conclusion Lifetime penetrance of LRRK2 estimated in the unascertained relatives of multiplex PD families is greater than that reported in studies of sporadically ascertained LRRK2 cases, suggesting that inherited susceptibility factors may modify the penetrance of LRRK2 mutations. In addition, the presence of nine PD phenocopies in the LRRK2 families suggests that these susceptibility

  15. LRRK2 Kinase Activity and Biology are Not Uniformly Predicted by its Autophosphorylation and Cellular Phosphorylation Site Status

    Directory of Open Access Journals (Sweden)

    April eReynolds

    2014-06-01

    Full Text Available Missense mutations in the Leucine Rich Repeat protein Kinase 2 (LRRK2 gene are the most common genetic predisposition to develop Parkinson’s disease (PD LRRK2 is a large multi-domain phosphoprotein with a GTPase domain and a serine/threonine protein kinase domain whose activity is implicated in neuronal toxicity; however the precise mechanism is unknown. LRRK2 autophosphorylates on several serine/threonine residues across the enzyme and is found constitutively phosphorylated on Ser910, Ser935, Ser955 and Ser973, which are proposed to be regulated by upstream kinases. Here we investigate the phosphoregulation at these sites by analyzing the effects of disease-associated mutations Arg1441Cys, Arg1441Gly, Ala1442Pro, Tyr1699Cys, Ile2012Thr, Gly2019Ser, and Ile2020Thr. We also studied alanine substitutions of phosphosite serines 910, 935, 955 and 973 and specific LRRK2 inhibition on autophosphorylation of LRRK2 Ser1292, Thr1491, Thr2483 and phosphorylation at the cellular sites. We found that mutants in the Roc-COR domains, including Arg1441Cys, Arg1441His, Ala1442Pro and Tyr1699Cys, can positively enhance LRRK2 kinase activity while concomitantly inducing the dephosphorylation of the cellular sites. Mutation of the cellular sites individually did not affect LRRK2 intrinsic kinase activity; however, Ser910/935/955/973Ala mutations trended toward increased kinase activity of LRRK2. Increased cAMP levels did not lead to increased LRRK2 cellular site phosphorylation, 14-3-3 binding or kinase activity. In cells, inhibition of LRRK2 kinase activity leads to dephosphorylation of Ser1292 by Calyculin A and okadaic acid sensitive phosphatases, while the cellular sites are dephosphorylated by Calyculin A sensitive phosphatases. These findings indicate that comparative analysis of both Ser1292 and Ser910/935/955/973 phosphorylation sites will provide important and distinct measures of LRRK2 kinase and biological activity in vitro and in vivo.

  16. Genetic analysis of LRRK2 mutations in patients with Parkinson disease.

    Science.gov (United States)

    Deng, Hao; Le, WeiDong; Guo, Yi; Hunter, Christine B; Xie, WenJie; Huang, MaoSheng; Jankovic, Joseph

    2006-12-21

    In addition to the G2019S mutation in the leucine-rich repeat kinase 2 gene (LRRK2), which is particularly frequent in patients of Ashkenazi Jewish and Northern African origin, three amino acid substitutions (R1441C, R1441G, and R1441H), all at the same residue (R1441), have been identified as important genetic causes of Parkinson disease (PD). To evaluate the frequency of R1441C/G/H and G2019S mutations in the LRRK2 gene in North American patients with PD and to explore genotype-phenotype correlations, we screened 496 PD patients from North America. One Hispanic female was heterozygous for the LRRK2 R1441G mutation, and six other cases including 2 non-Jewish/non-Hispanic whites, 3 Ashkenazi Jewish, and 1 Hispanic, were found to be heterozygous for the LRRK2 G2019S mutation. G2019S mutation in the LRRK2 gene is a common mutation associated with PD in a North American population, especially in Jewish PD patients (10.7%), while the R1441C/G/H mutation occurs at a relatively low frequency in North Americans except possibly in Hispanics for R1441G. All six G2019S carriers shared a common haplotype with that observed in Europeans and North Africans. The clinical features of all seven cases with LRRK2 mutation were quite broad and included early and late disease onset. These finding may provide new insights into the cause and diagnosis of PD and have implications for genetic counseling.

  17. LRRK2 G2019S in the North African population: a review.

    Science.gov (United States)

    Benamer, Hani T S; de Silva, Rajith

    2010-01-01

    Parkinson's disease (PD) is a common neurodegenerative disorder, for which environmental and/or genetic factors are postulated as possible causes. Over the past decade there has been a substantial increase in the knowledge of the genetics of PD. Mutations in Leucine-rich repeat kinase 2 (LRRK2) are the most frequent genetic causes of PD, and the common G2019S mutation has been identified in various ethnic groups with variable frequency. The aim of this article is to review the literature relating to LRRK2 G2019S in the North African population, which is composed of two main ethnic groups - the Berbers and the Arabs. The frequency of LRRK2 G2019S is 30-41% in familial PD and 30-39% in apparently sporadic PD in North Africa. Within healthy controls, Moroccan Berbers appear to have the highest carrier frequency at 3.3%. The majority of the available studies do not draw a clear distinction between the two ethnic groups, despite the distinct possibility that their ancestral origins are different. Further research looking at the respective prevalences of LRRK2 G2019S in Berbers and Arabs, and in different Arab populations, seems justified.

  18. The protective effect of LRRK2 p.R1398H on risk of Parkinson’s disease is independent of MAPT and SNCA variants

    Science.gov (United States)

    Heckman, Michael G.; Elbaz, Alexis; Soto-Ortolaza, Alexandra I.; Serie, Daniel J.; Aasly, Jan O.; Annesi, Grazia; Auburger, Georg; Bacon, Justin A.; Boczarska-Jedynak, Magdalena; Bozi, Maria; Brighina, Laura; Chartier-Harlin, Marie-Christine; Dardiotis, Efthimios; Destée, Alain; Ferrarese, Carlo; Ferraris, Alessandro; Fiske, Brian; Gispert, Suzana; Hadjigeorgiou, Georgios M.; Hattori, Nobutaka; Ioannidis, John P. A.; Jasinska-Myga, Barbara; Jeon, Beom S.; Kim, Yun Joong; Klein, Christine; Kruger, Rejko; Kyratzi, Elli; Lin, Chin-Hsien; Lohmann, Katja; Loriot, Marie-Anne; Lynch, Timothy; Mellick, George D.; Mutez, Eugénie; Opala, Grzegorz; Park, Sung Sup; Petrucci, Simona; Quattrone, Aldo; Sharma, Manu; Silburn, Peter A.; Sohn, Young Ho; Stefanis, Leonidas; Tadic, Vera; Tomiyama, Hiroyuki; Uitti, Ryan J.; Valente, Enza Maria; Vassilatis, Demetrios K.; Vilariño-Güell, Carles; White, Linda R.; Wirdefeldt, Karin; Wszolek, Zbigniew K.; Wu, Ruey-Meei; Xiromerisiou, Georgia; Maraganore, Demetrius M.; Farrer, Matthew J.; Ross, Owen A.

    2013-01-01

    The best validated susceptibility variants for Parkinson’s disease (PD) are located in the alpha-synuclein (SNCA) and microtubule-associated protein tau (MAPT) genes. Recently, a protective p.N551K-R1398H-K1423K haplotype in the leucine-rich repeat kinase 2 (LRRK2) gene was identified, with p.R1398H appearing to be the most likely functional variant. To date, the consistency of the protective effect of LRRK2 p.R1398H across MAPT and SNCA variant genotypes has not been assessed. To address this, we examined four SNCA variants (rs181489, rs356219, rs11931074, rs2583988), the MAPT H1-haplotype defining variant rs1052553, and LRRK2 p.R1398H (rs7133914) in Caucasian (N=10,322) and Asian (N=2,289) series. There was no evidence of an interaction of LRRK2 p.R1398H with MAPT or SNCA variants (all P≥0.10); the protective effect of p.R1398H was observed at similar magnitude across MAPT and SNCA genotypes, and the risk effects of MAPT and SNCA variants were observed consistently for LRRK2 p.R1398H genotypes. Our results indicate that the association of LRRK2 p.R1398H with PD is independent of SNCA and MAPT variants, and vice versa, in Caucasian and Asian populations. PMID:23962496

  19. Functional and Morphological Correlates in the Drosophila LRRK2 loss-of-function Model of Parkinson's Disease: Drug Effects of Withania somnifera (Dunal Administration.

    Directory of Open Access Journals (Sweden)

    Francescaelena De Rose

    Full Text Available The common fruit fly Drosophila melanogaster (Dm is a simple animal species that contributed significantly to the development of neurobiology whose leucine-rich repeat kinase 2 mutants (LRRK2 loss-of-function in the WD40 domain represent a very interesting tool to look into physiopathology of Parkinson's disease (PD. Accordingly, LRRK2 Dm have also the potential to contribute to reveal innovative therapeutic approaches to its treatment. Withania somnifera Dunal, a plant that grows spontaneously also in Mediterranean regions, is known in folk medicine for its anti-inflammatory and protective properties against neurodegeneration. The aim of this study was to evaluate the neuroprotective effects of its standardized root methanolic extract (Wse on the LRRK2 loss-of-function Dm model of PD. To this end mutant and wild type (WT flies were administered Wse, through diet, at different concentrations as larvae and adults (L+/A+ or as adults (L-/A+ only. LRRK2 mutants have a significantly reduced lifespan and compromised motor function and mitochondrial morphology compared to WT flies 1% Wse-enriched diet, administered to Dm LRRK2 as L-/A+and improved a locomotor activity b muscle electrophysiological response to stimuli and also c protected against mitochondria degeneration. In contrast, the administration of Wse to Dm LRRK2 as L+/A+, no matter at which concentration, worsened lifespan and determined the appearance of increased endosomal activity in the thoracic ganglia. These results, while confirming that the LRRK2 loss-of-function in the WD40 domain represents a valid model of PD, reveal that under appropriate concentrations Wse can be usefully employed to counteract some deficits associated with the disease. However, a careful assessment of the risks, likely related to the impaired endosomal activity, is required.

  20. Functional and Morphological Correlates in the Drosophila LRRK2 loss-of-function Model of Parkinson's Disease: Drug Effects of Withania somnifera (Dunal) Administration.

    Science.gov (United States)

    De Rose, Francescaelena; Marotta, Roberto; Poddighe, Simone; Talani, Giuseppe; Catelani, Tiziano; Setzu, Maria Dolores; Solla, Paolo; Marrosu, Francesco; Sanna, Enrico; Kasture, Sanjay; Acquas, Elio; Liscia, Anna

    2016-01-01

    The common fruit fly Drosophila melanogaster (Dm) is a simple animal species that contributed significantly to the development of neurobiology whose leucine-rich repeat kinase 2 mutants (LRRK2) loss-of-function in the WD40 domain represent a very interesting tool to look into physiopathology of Parkinson's disease (PD). Accordingly, LRRK2 Dm have also the potential to contribute to reveal innovative therapeutic approaches to its treatment. Withania somnifera Dunal, a plant that grows spontaneously also in Mediterranean regions, is known in folk medicine for its anti-inflammatory and protective properties against neurodegeneration. The aim of this study was to evaluate the neuroprotective effects of its standardized root methanolic extract (Wse) on the LRRK2 loss-of-function Dm model of PD. To this end mutant and wild type (WT) flies were administered Wse, through diet, at different concentrations as larvae and adults (L+/A+) or as adults (L-/A+) only. LRRK2 mutants have a significantly reduced lifespan and compromised motor function and mitochondrial morphology compared to WT flies 1% Wse-enriched diet, administered to Dm LRRK2 as L-/A+and improved a) locomotor activity b) muscle electrophysiological response to stimuli and also c) protected against mitochondria degeneration. In contrast, the administration of Wse to Dm LRRK2 as L+/A+, no matter at which concentration, worsened lifespan and determined the appearance of increased endosomal activity in the thoracic ganglia. These results, while confirming that the LRRK2 loss-of-function in the WD40 domain represents a valid model of PD, reveal that under appropriate concentrations Wse can be usefully employed to counteract some deficits associated with the disease. However, a careful assessment of the risks, likely related to the impaired endosomal activity, is required.

  1. Phosphopeptide analysis reveals two discrete clusters of phosphorylation in the N-terminus and the Roc domain of the Parkinson-disease associated protein kinase LRRK2.

    Science.gov (United States)

    Gloeckner, Christian Johannes; Boldt, Karsten; von Zweydorf, Felix; Helm, Sandra; Wiesent, Ludwig; Sarioglu, Hakan; Ueffing, Marius

    2010-04-05

    Mutations in leucine-rich repeat kinase 2 (LRRK2) that increase its kinase activity associate with familial forms of Parkinson disease (PD). As phosphorylation determines the functional state of most protein kinases, we systematically mapped LRRK2 phosphorylation sites by mass spectrometry. Our analysis revealed a high degree of constitutive phosphorylation in a narrow serine-rich region preceding the LRR-domain. Allowing de novo autophosphorylation of purified LRRK2 in an in vitro autokinase assay prior to mass spectrometric analysis, we discovered multiple sites of autophosphorylation. Solely serine and threonine residues were found phosphorylated suggesting LRRK2 as a true serine threonine kinase. Autophosphorylation mainly targets the ROC GTPase domain and its clustering around the GTP binding pocket of ROC suggests cross-regulatory activity between kinase and Roc domain. In conclusion, the phosphoprotein LRRK2 functions as an autocatalytically active serine threonine kinase. Clustering of phosphosites within two discrete domains suggest that phosphorylation may regulate its biological functions in a yet unknown fashion.

  2. Neurocirculatory and nigrostriatal abnormalities in Parkinson disease from LRRK2 mutation.

    Science.gov (United States)

    Goldstein, D S; Imrich, R; Peckham, E; Holmes, C; Lopez, G; Crews, C; Hardy, J; Singleton, A; Hallett, M

    2007-10-16

    Patients with Parkinson disease (PD) often have cardiac sympathetic denervation and failure of neurocirculatory regulation by baroreflexes. Familial PD caused by mutation of the gene encoding alpha-synuclein or by alpha-synuclein gene triplication also features cardiac sympathetic denervation and baroreflex failure. Here we report results of cardiac sympathetic neuroimaging by 6-[(18)F]fluorodopamine PET, baroreflex testing based on beat-to-beat hemodynamic responses to the Valsalva maneuver, and nigrostriatal neuroimaging using 6-[(18)F] fluorodopa PET in a proband with mutation of the gene encoding leucine-rich repeat kinase 2 (LRRK2), the most common genetic abnormality identified so far in familial PD. The patient had no detectable 6-[(18)F] fluorodopamine-derived radioactivity in the left ventricular myocardium, a progressive fall in blood pressure during the Valsalva maneuver and no pressure overshoot after release of the maneuver, and decreased 6-[(18)F] fluorodopa-derived radioactivity bilaterally in the putamen and substantia nigra. This patient with Parkinson disease (PD) caused by LRRK2 mutation had evidence of cardiac sympathetic denervation, baroreflex-sympathoneural and baroreflex-cardiovagal failure, and nigrostriatal dopamine deficiency, a pattern resembling that in the sporadic disease. The results fit with the concept that in LRRK2 PD, parkinsonism, cardiac sympathetic denervation, and baroreflex failure can result from a common pathogenetic process.

  3. LRRK2 in Parkinson's disease: genetic and clinical studies from patients.

    Science.gov (United States)

    Kumari, Udhaya; Tan, E K

    2009-11-01

    Mutations in leucine-rich repeat kinase 2 (LRRK2) (PARK8) are associated with both familial and sporadic forms of Parkinson's disease. Most studies have shown that LRRK2 mutations may explain between 5% and 13% of familial and 1-5% of sporadic Parkinson's disease. Importantly, a common recurrent mutation (G2019S) located in the kinase domain has been reported across most ethnic populations, with the highest prevalence among Ashkenazi Jews and North African Arabs. A recent worldwide meta-analysis pooling data from 24 populations reported a higher occurrence of G2019S in southern than in northern European countries and the penetrance is estimated to be approximately 75% at the age of 79 years. The R1441 'hotspot' amino acid codon residue (G/H/C) in the Ras of complex proteins domain is the second most common site of pathogenic LRRK2 substitutions after G2019S, with most carriers developing symptoms by the age of 75 years. Two polymorphic variants found almost exclusively among Asians (G2385R and R1628P) have been shown to increase the Parkinson's disease risk by approximately two-fold. The mutational event associated with R1628P is more recent, occurring approximately 2500 years ago, compared to estimates of 4000 years for G2385R carriers. LRRK2 mutation carriers generally simulate late onset Parkinson's disease and present with the usual typical clinical features. Genetic testing for G2019S in sporadic late-onset Parkinson's disease can be considered in some situations and may be useful in populations with high carrier status. The identification of asymptomatic mutation and risk variant carriers provides a unique opportunity for recruiting these subjects in potential neuroprotective trials and longitudinal studies to identify biomarkers of neurodegeneration.

  4. Self-report of cognitive impairment and Mini-Mental State Exam performance in PRKN, LRRK2, and GBA carriers with early onset Parkinson’s disease

    OpenAIRE

    Alcalay, Roy N.; Mejia-Santana, Helen; Tang, Ming X.; Rakitin, Brian; Rosado, Llency; Ross, Barbara; Verbitsky, Miguel; Kisselev, Sergey; Louis, Elan D.; Comella, Cynthia; Colcher, Amy; Jennings, Danna; Nance, Martha; Bressman, Susan; William K Scott

    2010-01-01

    While little is known about risk factors for cognitive impairment in early onset Parkinson disease (EOPD), postmortem studies have shown an association between dementia with Lewy bodies (DLB) and glucocerebrosidase (GBA) mutation. We compared Mini-Mental State Examination (MMSE) performance and self-reported cognitive impairment in 699 EOPD participants genotyped for mutations in parkin (PRKN), leucine-rich repeat kinase-2 (LRRK2), and GBA. Logistic regression was used to assess the associati...

  5. Correlation between Mutations in the LRRK2 and Parkinson′s Disease%LRRK2基因突变与帕金森病关联性研究

    Institute of Scientific and Technical Information of China (English)

    卢红腾

    2012-01-01

    帕金森病(PD)是一种常见的中枢神经系统退行性疾病,主要病变部位在黑质及纹状体,临床上以静止性震颤、肌强直、动作迟缓和姿势反射障碍为主要特征,其发病机制迄今不明,但大多数学者认为遗传因素在PD发病过程中起着重要作用.LRRK2基因突变是家族聚集性常染色体显性遗传性PD最常见的原因,随后的研究发现,它可能在散发性PD的发病中也起一定作用.现对LRRK2基因结构特征、生物学功能及其位点突变后导致PD的分子机制进行综述,为PD的分子研究提供参考.%Parkinson disease( PD )is a common degenerative disease of tha rantral nervous system,mainly involving substantia nisra and striatum. The disease is progressive and characterized clinically by resting tremor,biadykinesia,rigidity and postural instability. Although the causes of the disease have remained ob-snire until now, genetic fart or plays an important role in the pathogenesis of PD. Mutations in laurina-rirh repeat kinase 2( LRRK2 )aie by far" the most common genetic causes for familial autosomal dominant PD. Subsequently ,LRRK2 gene may play a significant role in sporadic PD. Here is to summarize the rhararteristics of LRRK2 gene structure,biological junctions,molerular mechanisms of point mutation,to provide reference for PD molecular study.

  6. Phosphatases of α-synuclein, LRRK2 and tau: important players in the phosphorylation-dependent pathology of Parkinsonism

    Directory of Open Access Journals (Sweden)

    Jean-Marc eTaymans

    2014-11-01

    Full Text Available An important challenge in the field of Parkinson’s disease is to develop disease modifying therapies capable of stalling or even halting disease progression. Coupled to this challenge is the need to identify disease biomarkers, in order to identify pre-symptomatic hallmarks of disease and monitor disease progression. The answer to these challenges lies in the elucidation of the molecular causes underlying PD, for which important leads are disease genes identified in studies investigating the underlying genetic causes of PD. Interestingly, evidence suggests that phosphorylation changes in 2 major dominant genes of PD, namely leucine-rich repeat kinase 2 (LRRK2 and α-synuclein (α-syn, are important in PD pathogenesis. LRRK2 and α-syn have been both linked to familial forms of PD as well as associated to sporadic PD. Another gene, microtubule associated protein tau (MAPT, has been genetically linked to a dominant form of frontotemporal dementia and parkinsonism linked to chromosome 17 (FTDP-17 and genome-wide association studies report a strong association between MAPT and sporadic PD. Interestingly, LRRK2, α-syn and tau are all phosphorylated proteins, and their phosphorylation patterns are linked to disease. In this review, we provide an overview of the evidence linking LRRK2, α-syn and tau phosphorylation to PD pathology and focus on studies which have aimed at identifying phosphatases responsible for dephosphorylation of pathological phosphorylations. We also discuss how the LRRK2, α-syn and tau phosphatases may point to separate or cross-talking pathological pathways in PD. Finally, we will discuss how the study of phosphatases of dominant Parkinsonism proteins opens perspectives for targeting pathological phosphorylation events and may aid in identifying biomarkers to monitor early PD and PD progression.

  7. 他莫昔芬介导小胶质细胞 LRRK-2表达对炎症刺激 PC12细胞的影响%Effect of Tamoxifen on Inflammation-Stimulated PC12 Cells Mediated by LRRK-2 Gene Expression of Microglia

    Institute of Scientific and Technical Information of China (English)

    卢奎; 吴文军; 周敏; 黎捷; 钟健强; 张成

    2014-01-01

    Objective To study the effect of tamoxifen on the expressions of leucine-rich repeat kinase 2(LRRK-2) gene of microglia and related inflammatory factors .Methods Primary microglia was divided into 4 groups including control group,lipopolysaccharide(LPS) group,LPS plus tamoxifen group and LPS plus LRRK-2 group.LPS-activated microglia was regulated by tamoxifen .PC12 cells of rats were co-cultured with microglia for 24 hours in each group .The expressions of LRRK-2 gene and iNOS were detected by Western Blot .The levels of tumor necrosis factor α( TNF-α) and interleukin 1β(IL-1β) were tested by enzyme-linked immunosorbent assay ( ELISA).The apoptosis/survival ratio of PC12 cells was determined by Hochest staining .Results Tamoxifen down-regulated the LRRK-2 gene expression of microglia by LPS stimulation,inhibited the release of iNOS ,TNF-αand IL-1βby suppressing LRRK-2 gene,and decreased the co-cultured inflammatory expression of microglia and PC12 cells as well as apoptosis/survival ratio of PC12 cells.Conclusion LRRK-2 might be an upstream-regulated target for the release of iNOS in microglia .Tamoxifen can inhibit the activation of microglia by regulation of LRRK-2 gene,which might alleviate the inflammation-associated dopamine neuron injury .%目的:探讨他莫昔芬对小胶质细胞的富含亮氨酸重复序列激酶2( LRRK2)基因及相关炎症因子表达的影响。方法取原代小胶质细胞分为CON组、脂多糖( LPS)组、LPS+他莫昔芬组、LPS+LRRK2组;以LPS刺激激活小胶质细胞,用他莫昔芬调控小胶质细胞激活;将各组小胶质细胞与大鼠肾上腺嗜铬瘤细胞( PC12)细胞共培养24 h;Western Blot法检测小胶质细胞的LRRK2、一氧化氮合成酶( iNOS )表达,酶联免疫吸附法( ELISA)测定TNF-α、IL-1β水平;Hochest染核法检测PC12细胞凋亡/存活比。结果他莫昔芬抑制LPS刺激后小胶质细胞的LRRK2表达,通过抑制LRRK2

  8. Association of LRRK2 exonic variants with susceptibility to Parkinson's disease: a case-control study.

    Science.gov (United States)

    Ross, Owen A; Soto-Ortolaza, Alexandra I; Heckman, Michael G; Aasly, Jan O; Abahuni, Nadine; Annesi, Grazia; Bacon, Justin A; Bardien, Soraya; Bozi, Maria; Brice, Alexis; Brighina, Laura; Van Broeckhoven, Christine; Carr, Jonathan; Chartier-Harlin, Marie-Christine; Dardiotis, Efthimios; Dickson, Dennis W; Diehl, Nancy N; Elbaz, Alexis; Ferrarese, Carlo; Ferraris, Alessandro; Fiske, Brian; Gibson, J Mark; Gibson, Rachel; Hadjigeorgiou, Georgios M; Hattori, Nobutaka; Ioannidis, John P A; Jasinska-Myga, Barbara; Jeon, Beom S; Kim, Yun Joong; Klein, Christine; Kruger, Rejko; Kyratzi, Elli; Lesage, Suzanne; Lin, Chin-Hsien; Lynch, Timothy; Maraganore, Demetrius M; Mellick, George D; Mutez, Eugénie; Nilsson, Christer; Opala, Grzegorz; Park, Sung Sup; Puschmann, Andreas; Quattrone, Aldo; Sharma, Manu; Silburn, Peter A; Sohn, Young Ho; Stefanis, Leonidas; Tadic, Vera; Theuns, Jessie; Tomiyama, Hiroyuki; Uitti, Ryan J; Valente, Enza Maria; van de Loo, Simone; Vassilatis, Demetrios K; Vilariño-Güell, Carles; White, Linda R; Wirdefeldt, Karin; Wszolek, Zbigniew K; Wu, Ruey-Meei; Farrer, Matthew J

    2011-10-01

    Background The leucine-rich repeat kinase 2 gene (LRRK2) harbours highly penetrant mutations that are linked to familial parkinsonism. However, the extent of its polymorphic variability in relation to risk of Parkinson's disease (PD) has not been assessed systematically. We therefore assessed the frequency of LRRK2 exonic variants in individuals with and without PD, to investigate the role of the variants in PD susceptibility. LRRK2 was genotyped in patients with PD and controls from three series (white, Asian, and Arab-Berber) from sites participating in the Genetic Epidemiology of Parkinson's Disease Consortium. Genotyping was done for exonic variants of LRRK2 that were identified through searches of literature and the personal communications of consortium members. Associations with PD were assessed by use of logistic regression models. For variants that had a minor allele frequency of 0·5% or greater, single variant associations were assessed, whereas for rarer variants information was collapsed across variants. 121 exonic LRRK2 variants were assessed in 15 540 individuals: 6995 white patients with PD and 5595 controls, 1376 Asian patients and 962 controls, and 240 Arab-Berber patients and 372 controls. After exclusion of carriers of known pathogenic mutations, new independent risk associations were identified for polymorphic variants in white individuals (M1646T, odds ratio 1·43, 95% CI 1·15-1·78; p=0·0012) and Asian individuals (A419V, 2·27, 1·35-3·83; p=0·0011). A protective haplotype (N551K-R1398H-K1423K) was noted at a frequency greater than 5% in the white and Asian series, with a similar finding in the Arab-Berber series (combined odds ratio 0·82, 0·72-0·94; p=0·0043). Of the two previously reported Asian risk variants, G2385R was associated with disease (1·73, 1·20-2·49; p=0·0026), but no association was noted for R1628P (0·62, 0·36-1·07; p=0·087). In the Arab-Berber series, Y2189C showed potential evidence of risk association with

  9. Phosphorylation of p53 by LRRK2 induces microglial tumor necrosis factor α-mediated neurotoxicity.

    Science.gov (United States)

    Ho, Dong Hwan; Seol, Wongi; Eun, Jin Hwan; Son, Il-Hong

    2017-01-22

    Leucine-rich repeat kinase (LRRK2), a major causal gene of Parkinson's disease (PD), functions as a kinase. The most prevalent mutation of LRRK2 is G2019S. It exhibits increased kinase activity compared to the wildtype LRRK2. Previous studies have shown that LRRK2 can phosphorylate p53 at T304 and T377 of threonine-X-arginine (TXR) motif in neurons. Reduction of LRRK2 expression or inhibition of LRRK2 kinase activity has been shown to be able to alleviate LPS-induced neuroinflammation in microglia cells. In this study, we found that LRRK2 could also phosphorylate p53 in microglia model BV2 cells. Transfection of BV2 with phosphomimetic p53 T304/377D significantly increased the secretion of pro-inflammatory cytokine TNFα compared to BV2 transfected with p53 wild type after LPS treatment. In addition, conditioned media from these transfected cells increased the death of dopaminergic neuronal SN4741 cells. Moreover, such neurotoxic effect was rescued by co-treatment with the conditioned media and etanercept, a TNFα blocking antibody. Furthermore, TNFα secretion was significantly increased in primary microglia derived from G2019S transgenic mice treated with LPS compared to that in cells derived from their littermates. These results suggest that LRRK2 kinase activity in microglia can contribute to neuroinflammation in PD via phosphorylating p53 at T304 and T377 site.

  10. LRRK2 G2019S mutations are associated with an increased cancer risk in Parkinson disease.

    Science.gov (United States)

    Saunders-Pullman, Rachel; Barrett, Matthew J; Stanley, Kaili M; Luciano, Marta San; Shanker, Vicki; Severt, Lawrence; Hunt, Ann; Raymond, Deborah; Ozelius, Laurie J; Bressman, Susan B

    2010-11-15

    Leucine rich repeat kinase (LRRK2) G2019S mutations are presumed to cause PD through a toxic gain of function of the protein kinase. Small molecule kinase inhibitors have been developed for the treatment of certain cancers, and some antioncogenic agents such as sunitinib, may nonspecifically inhibit LRRK2. Few studies, however, have assessed cancer risk in LRRK2 mutation carriers. To explore this risk, we evaluated records of Ashkenazi Jewish (AJ) PD patients participating in genetic research. Charts were reviewed for 163 unrelated AJ PD patients, 31 of whom harbored the G2019S mutation. History of cancer was queried at baseline intake using a form reviewing medical conditions, and charts were reviewed for all follow-up visits. 9/31 LRRK2 G2019S mutation carriers had nonskin cancers, whereas 15/132 without mutations had nonskin cancers, representing an almost threefold increased risk in this group (HR 2.9, 95% CI 1.3-6.6). Age at first nonskin cancer was younger in the LRRK2 carriers (56.0 years) than the noncarriers (62.0 years), but was not significant. 67% of the LRRK2 carriers had their cancer before the onset of PD, whereas only 40% of noncarriers developed their first nonskin cancer before onset of PD. While further evaluation is warranted, our findings indicate an increased risk of nonskin cancers in LRRK2 G2019S mutation carriers, which may be related to toxic gain of function of mutated LRRK2.

  11. LRRK2 G2019S mutation: frequency and haplotype data in South African Parkinson's disease patients.

    Science.gov (United States)

    Bardien, Soraya; Marsberg, Angelica; Keyser, Rowena; Lombard, Debbie; Lesage, Suzanne; Brice, Alexis; Carr, Jonathan

    2010-07-01

    Mutations in the leucine-rich repeat kinase 2 gene (LRRK2) are the most significant genetic cause of Parkinson's disease (PD). The exact function of LRRK2 is currently unknown but the presence of multiple protein interaction domains including WD40 and ankyrin indicates that it may act a scaffold for assembly of a multi-protein signaling complex. The G2019S mutation in LRRK2 represents the most clinically relevant PD-causing mutation and has been found in both familial and sporadic forms of the disorder. This mutation is situated in the highly conserved kinase MAPKKK domain, and has been found in up to 40% of PD patients from North African Arabic, 30% of Ashkenazi Jewish and approximately 10% of Portuguese and Spanish populations. Although extensively investigated in numerous European and North American populations, studies on the frequency of G2019S in African countries have been rare. The present study is the first on the South African population. High-resolution melt analysis was used to identify the G2019S mutation and it was found in 2% (4/205) of the patients studied. G2019S was not found in any of the Black PD patients screened. In all four G2019S-positive probands the mutation was shown to be present on the common haplotype referred to as haplotype 1. This reveals that the four South African G2019S-positive probands (three Caucasian and one of mixed ancestry) share a common ancestor with the other haplotype 1-associated families reported worldwide.

  12. Intact working memory in non-manifesting LRRK2 carriers--an fMRI study.

    Science.gov (United States)

    Thaler, Avner; Helmich, Rick C; Or-Borichev, Ayelet; van Nuenen, Bart F L; Shapira-Lichter, Irit; Gurevich, Tanya; Orr-Urtreger, Avi; Marder, Karen; Bressman, Susan; Bloem, Bastiaan R; Giladi, Nir; Hendler, Talma; Mirelman, Anat

    2016-01-01

    Cognitive impairments are prevalent in patients with Parkinson's disease. Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene are the most common cause of genetic Parkinsonism. Non-manifesting carriers of the G2019S mutation in the LRRK2 gene were found to have lower executive functions as measured by the Stroop task. This exploratory study aimed to assess whether the cognitive impairment in non-manifesting carriers is specific for executive functions or includes other cognitive domains such as working memory. We recruited 77 non-manifesting first-degree relatives of Parkinson's disease patients (38 carriers). A block-design fMRI N-back task, with 0-back, 2-back and 3-back conditions, was used in order to assess working memory. Participants were well matched on the Montreal Cognitive Assessment, University of Pennsylvania Smell Identification Test, Unified Parkinson's Disease Rating Scale part III, digit span, age, gender and Beck Depression Inventory. The task achieved the overall expected effect in both groups with longer reaction times and lower accuracy rates with increasing task demands. However, no whole-brain or region-of-interest between-groups differences were found on any of the task conditions. These results indicate that non-manifesting carriers of the G2019S mutation in the LRRK2 gene have a specific cognitive profile with executive functions, as assessed by the Stroop task, demonstrating significant impairment but with working memory, as assessed with the N-back task, remaining relatively intact. These finding shed light on the pre-motor cognitive changes in this unique 'at risk' population and should enable more focused cognitive assessments of these cohorts.

  13. LRRK2 mutations and Parkinson's disease in Sardinia--A Mediterranean genetic isolate.

    Science.gov (United States)

    Cossu, Giovanni; van Doeselaar, Marina; Deriu, Marcello; Melis, Maurizio; Molari, Andrea; Di Fonzo, Alessio; Oostra, Ben A; Bonifati, Vincenzo

    2007-02-01

    The Leucine-Rich Repeat Kinase 2 (LRRK2) Gly2019Ser mutation is frequent among Parkinson's disease (PD) patients from the Arab, Jewish, and Iberian populations, while another mutation, Arg1441Gly, is common in the Basque population. We studied the prevalence of these mutations in Sardinia, a Mediterranean genetic isolate with peculiar structure and similarities with the Basque population. Among 98 Sardinian PD probands we detected one heterozygous Gly2019Ser carrier. This mutation was also found in one of 55 Sardinian controls, an 85-year-old man, later shown to have a positive family history of parkinsonism. No carriers of Arg1441Gly, Arg1441Cys, or Arg1441His mutations were found among cases and controls. Our results suggest that the "Basque"LRRK2 mutation is absent or very rare in Sardinia. The Gly2019Ser mutation is present but its frequency is lower than that in Iberian, Arab, or Jewish populations. The identification of an 85-year-old, healthy Gly2019Ser carrier supports the concept that this mutation displays incomplete penetrance.

  14. Molecular mechanisms of LRRK2 regulation

    Science.gov (United States)

    Webber, Philip Jeffrey

    Non-synonymous mutations in LRRK2 are the most common known cause of familial and sporadic Parkinson's disease (PD). The dominant inheritance of these mutations in familial PD suggests a gain-of-function mechanism. Increased kinase activity observed in the most common PD associated LRRK2 mutation G2019S suggests that kinase activity is central to disease. However, not all mutations associated with disease are reported to alter kinase activity and controversy exists in the literature about the effects of mutations appearing in the GTPase domain on kinase activity. The studies conducted as a part of this work aim to characterize the mechanisms that regulate LRRK2 kinase activity and the effects of mutations on enzymatic activity of LRRK2 protein. LRRK2 is a large protein with multiple predicted functional domains including two enzymatic domains in the same protein, the small ras-like GTPase domain and a serine-threonine protein kinase domain. Previous studies indicate that LRRK2 kinase is dependent on a functional GTPase domain and binding to GTP is required for kinase activity. Recent work detailed in this dissertation indicates a complex and reciprocal relationship between kinase and GTPase domains. LRRK2 kinase activity is dependent on adapting a homo-dimer that is augmented by PD mutations that increase LRRK2 kinase activity. Activated LRRK2 autophosphorylates the GTPase and c-terminus of Ras (COR) domains robustly. Phosphorylation of these domains is required for normal activity, as preventing autophosphorylation of these sites drastically lowers kinase activity and GTP binding while phosphorylation maintains baseline activity while still reducing GTP binding. Furthermore, we have developed antibodies specific to autophosphorylation residues that track with LRRK2 kinase activity in vitro. While no measurable activity was detected from treated LRRK2 in vivo, LRRK2 protein purified from brain tissue treated with inflammatory stimuli such as LPS, which increases

  15. The LRRK2 G2019S mutation in Ashkenazi Jews with Parkinson disease: is there a gender effect?

    Science.gov (United States)

    Orr-Urtreger, A; Shifrin, C; Rozovski, U; Rosner, S; Bercovich, D; Gurevich, T; Yagev-More, H; Bar-Shira, A; Giladi, N

    2007-10-16

    Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene are the most common genetic determinant of Parkinson disease (PD) identified to date, and have been implicated in both familial and sporadic forms of the disease. The G2019S change in LRRK2 exon 41 has been associated with disease at varying frequencies in Asian, European, North American, and North African populations, and is particularly prevalent among Ashkenazi Jews. We assessed the occurrence of the LRRK2 G2019S, I2012T, I2020T, and R1441G/C/H mutations in our cohort of Jewish Israeli patients with PD, and determined the LRRK2 haplotypes in 76 G2019S-carriers detected and in 50 noncarrier Ashkenazi patients, using six microsatellite markers that span the entire gene. Only the G2019S mutation was identified among our patients with PD, 14.8% in the Ashkenazi and 2.7% in the non-Ashkenazi patients, and in 26% and 10.6% of the Ashkenazi familial and apparently sporadic cases. The carrier frequencies in the Ashkenazi and non-Ashkenazi control samples were 2.4% and 0.4%. A common shared haplotype was detected in all non-Ashkenazi and half-Ashkenazi carriers and in all full-Ashkenazi carriers tested, except two. Women and patients with a positive family history of PD were significantly over-represented among the G2019S mutation carriers. Age at disease onset was similar in carriers and noncarriers. Our data suggest that the LRRK2 G2019S mutation plays an important role in the causality of familial and sporadic Parkinson disease (PD) in Israel and that gender affects its frequency among patients. Although testing symptomatic patients may help establish the diagnosis of PD, the value of screening asymptomatic individuals remains questionable until the penetrance and age-dependent risk of this mutation are more accurately assessed, and specific disease prevention or modifying interventions become available.

  16. Non-motor symptoms in healthy Ashkenazi Jewish carriers of the G2019S mutation in the LRRK2 gene

    Science.gov (United States)

    Mirelman, Anat; Alcalay, Roy N.; Saunders-Pullman, Rachel; Yasinovsky, Kira; Thaler, Avner; Gurevich, Tanya; Mejia-Santana, Helen; Raymond, Deborah; Gana-Weisz, Mali; Bar-Shira, Anat; Ozelius, Laurie; Clark, Lorraine; Orr-Urtreger, Avi; Bressman, Susan; Marder, Karen; Giladi, Nir

    2015-01-01

    Background The Asymptomatic carriers of the Leucine rich repeat kinase 2 (LRRK2) G2019S mutation represent a population at risk for developing PD. The aim of this study was to assess differences in non-motor symptoms between non-manifesting carriers and non-carriers of the G2019S mutation. Methods 253 subjects participated in this observational cross sectional multi-center study. Standard questionnaires assessing anxiety, depression, cognition, smell, non-motor symptoms and REM sleep behavior were administered. Analyses were adjusted for age, gender, family relations, education and site. Results 134 carriers were identified. carriers had higher non-motor symptoms score on the NMS questionnaire (p=0.02). These findings were amplified in carriers over the age of 50 with higher non-motor symptoms scores and trait anxiety scores (p<0.03). Conclusions In this cross section study, carriers of the G2019S LRRK2 mutation endorsed subtle non-motor symptoms. Whether these are early features of PD will require a longitudinal study. PMID:25809001

  17. Combined LRRK2 mutation, aging and chronic low dose oral rotenone as a model of Parkinson’s disease

    Science.gov (United States)

    Liu, Hui-Fang; Ho, Philip Wing-Lok; Leung, Gideon Chi-Ting; Lam, Colin Siu-Chi; Pang, Shirley Yin-Yu; Li, Lingfei; Kung, Michelle Hiu-Wai; Ramsden, David Boyer; Ho, Shu-Leong

    2017-01-01

    Aging, genetics and environmental toxicity are important etiological factors in Parkinson’s disease (PD). However, its pathogenesis remains unclear. A major obstacle is the lack of an appropriate experimental model which incorporates genetic susceptibility, aging and prolonged environmental toxicity. Here, we explored the interplay amongst these factors using mutant LRRK2R1441G (leucine-rich-repeat-kinase-2) knockin mice. We found that mutant primary cortical and mesencephalic dopaminergic neurons were more susceptible to rotenone-induced ATP deficiency and cell death. Compared with wild-type controls, striatal synaptosomes isolated from young mutant mice exhibited significantly lower dopamine uptake after rotenone toxicity, due to reduced striatal synaptosomal mitochondria and synaptic vesicular proton pump protein (V-ATPase H) levels. Mutant mice developed greater locomotor deficits in open-field tests than wild-type mice following low oral rotenone doses given twice weekly over 50 weeks (half their lifespan). The increased locomotor deficit was associated with specific reduction in striatal mitochondrial Complex-I (NDUFS4) in rotenone-treated mutant but not in similarly treated wild-type mice. Our unique experimental model which incorporates genetic effect, natural aging and prolonged oral environmental toxicity administered to mutant knockin LRRK2 mice over half their life span, with observable and measurable phenotype, is invaluable in further studies of the pathogenic process and therapeutics of PD. PMID:28098219

  18. Parkinson's disease-related LRRK2 G2019S mutation results from independent mutational events in humans.

    Science.gov (United States)

    Lesage, Suzanne; Patin, Etienne; Condroyer, Christel; Leutenegger, Anne-Louise; Lohmann, Ebba; Giladi, Nir; Bar-Shira, Anat; Belarbi, Soraya; Hecham, Nassima; Pollak, Pierre; Ouvrard-Hernandez, Anne-Marie; Bardien, Soraya; Carr, Jonathan; Benhassine, Traki; Tomiyama, Hiroyuki; Pirkevi, Caroline; Hamadouche, Tarik; Cazeneuve, Cécile; Basak, A Nazli; Hattori, Nobutaka; Dürr, Alexandra; Tazir, Meriem; Orr-Urtreger, Avi; Quintana-Murci, Lluis; Brice, Alexis

    2010-05-15

    Mutations in the leucine-rich-repeat kinase 2 (LRRK2) gene have been identified in families with autosomal dominant Parkinson's disease (PD) and in sporadic cases; the G2019S mutation is the single most frequent. Intriguingly, the frequency of this mutation in PD patients varies greatly among ethnic groups and geographic origins: it is present at Jewish origin, mostly from Eastern Europe, one was from Japan, one from Turkey and two were of mixed origins. We found the G2019S mutation on three different haplotypes. Network analyses of the three carrier haplotypes showed that G2019S arose independently at least twice in humans. In addition, the population distribution of the intra-allelic diversity of the most widespread carrier haplotype, together with estimations of the age of G2019S determined by two different methods, suggests that one of the founding G2019S mutational events occurred in the Near East at least 4000 years ago.

  19. alpha-synuclein and LRRK2: partners in crime.

    Science.gov (United States)

    Tong, Youren; Shen, Jie

    2009-12-24

    In this issue of Neuron, Lin et al. report that LRRK2 modulates age-related neurodegeneration caused by overexpression of alpha-synuclein in the forebrain of transgenic mice. Overexpression of LRRK2 accelerates the progression of alpha-synuclein-mediated neuropathological changes, whereas deletion of LRRK2 alleviates these alterations. The results reveal an interesting interaction between alpha-synuclein and LRRK2, two gene products linked to dominantly inherited Parkinson's disease.

  20. Parkinson's disease: leucine-rich repeat kinase 2 and autophagy, intimate enemies.

    Science.gov (United States)

    Bravo-San Pedro, José M; Gómez-Sánchez, Rubén; Pizarro-Estrella, Elisa; Niso-Santano, Mireia; González-Polo, Rosa A; Fuentes Rodríguez, José M

    2012-01-01

    Parkinson's disease is the second common neurodegenerative disorder, after Alzheimer's disease. It is a clinical syndrome characterized by loss of dopamine-generating cells in the substancia nigra, a region of the midbrain. The etiology of Parkinson's disease has long been through to involve both genetic and environmental factors. Mutations in the leucine-rich repeat kinase 2 gene cause late-onset Parkinson's disease with a clinical appearance indistinguishable from Parkinson's disease idiopathic. Autophagy is an intracellular catabolic mechanism whereby a cell recycles or degrades damage proteins and cytoplasmic organelles. This degradative process has been associated with cellular dysfunction in neurodegenerative processes including Parkinson's disease. We discuss the role of leucine-rich repeat kinase 2 in autophagy, and how the deregulations of this degradative mechanism in cells can be implicated in the Parkinson's disease etiology.

  1. G2019S LRRK2 mutation in familial and sporadic Parkinson's disease in Russia.

    Science.gov (United States)

    Pchelina, Sofya N; Yakimovskii, Andrei F; Ivanova, Olga N; Emelianov, Anton K; Zakharchuk, Andrei H; Schwarzman, Alexander L

    2006-12-01

    Among mutations associated with autosomal dominant and sporadic Parkinson's disease (PD) the G2019S substitution in the leucine-rich repeat kinase 2 (LRRK2) gene is the most frequently identified. To estimate its frequency in Russia, we analyzed 208 patients with PD from the Northwestern region of Russia. Of these, 51 patients were probands from families with PD compatible with autosomal dominant inheritance. The control group represented 161 subjects without neurological disorders settled in the same region. The frequency of the G2019S mutation was greater in familial PD (2 [3.9%] of 51) than in sporadic PD (1 [0.6%] of 157). In addition, this mutation was found in the proband's father, who also had PD, in 1 PD family, and in 1 carrier without signs of PD at age 40 in another PD family. All carriers were heterozygous for the G2019S mutation and reported the Ashkenazi Jewish origin. The mutation was not found in the control group.

  2. Interaction of LRRK2 with kinase and GTPase signaling cascades

    Directory of Open Access Journals (Sweden)

    Joon Y Boon

    2014-07-01

    Full Text Available LRRK2 is a protein that interacts with a plethora of signaling molecules, but the complexity of LRRK2 function presents a challenge for understanding the role of LRRK2 in the pathophysiology of Parkinson’s disease. Studies of LRRK2 using over-expression in transgenic mice have been disappointing, however studies using invertebrate systems have yielded a much clearer picture, with clear effects of LRRK2 expression, knockdown or deletion in C. elegans and Drosophila on modulation of survival of dopaminergic neurons. Recent studies have begun to focus attention on particular signaling cascades that are a target of LRRK2 function. LRRK2 interacts with members of the MAPK pathway and might regulate the pathway action by acting as a scaffold that directs the location of MAPK pathway activity, without strongly affecting the amount of MAPK pathway activity. Binding to GTPases, GAPs and GEFs are another strong theme in LRRK2 biology, with LRRK2 binding to Rac1, cdc42, rab5, rab7L1, endoA, RGS2, ArfGAP1 and ArhGEF7. All of these molecules appear to feed into a function output for LRRK2 that modulates cytoskeletal outgrowth and vesicular dynamics, including autophagy. These functions likely impact modulation of α-synuclein aggregation and associated toxicity eliciting the disease processes that we term Parkinson’s disease.

  3. Metabolomic profiling in LRRK2-related Parkinson's disease.

    Directory of Open Access Journals (Sweden)

    Krisztina K Johansen

    Full Text Available BACKGROUND: Mutations in LRRK2 gene represent the most common known genetic cause of Parkinson's disease (PD. METHODOLOGY/PRINCIPAL FINDINGS: We used metabolomic profiling to identify biomarkers that are associated with idiopathic and LRRK2 PD. We compared plasma metabolomic profiles of patients with PD due to the G2019S LRRK2 mutation, to asymptomatic family members of these patients either with or without G2019S LRRK2 mutations, and to patients with idiopathic PD, as well as non-related control subjects. We found that metabolomic profiles of both idiopathic PD and LRRK2 PD subjects were clearly separated from controls. LRRK2 PD patients had metabolomic profiles distinguishable from those with idiopathic PD, and the profiles could predict whether the PD was secondary to LRRK2 mutations or idiopathic. Metabolomic profiles of LRRK2 PD patients were well separated from their family members, but there was a slight overlap between family members with and without LRRK2 mutations. Both LRRK2 and idiopathic PD patients showed significantly reduced uric acid levels. We also found a significant decrease in levels of hypoxanthine and in the ratios of major metabolites of the purine pathway in plasma of PD patients. CONCLUSIONS/SIGNIFICANCE: These findings show that LRRK2 patients with the G2019S mutation have unique metabolomic profiles that distinguish them from patients with idiopathic PD. Furthermore, asymptomatic LRRK2 carriers can be separated from gene negative family members, which raises the possibility that metabolomic profiles could be useful in predicting which LRRK2 carriers will eventually develop PD. The results also suggest that there are aberrations in the purine pathway in PD which may occur upstream from uric acid.

  4. Lrrk2 R1441G-related Parkinson's disease: evidence of a common founding event in the seventh century in Northern Spain.

    Science.gov (United States)

    Mata, Ignacio F; Hutter, Carolyn M; González-Fernández, María C; de Pancorbo, Marian M; Lezcano, Elena; Huerta, Cecilia; Blazquez, Marta; Ribacoba, Renee; Guisasola, Luis M; Salvador, Carlos; Gómez-Esteban, Juan C; Zarranz, Juan J; Infante, Jon; Jankovic, Joseph; Deng, Hao; Edwards, Karen L; Alvarez, Victoria; Zabetian, Cyrus P

    2009-10-01

    Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene together represent the most common genetic determinant of Parkinson's disease (PD) identified to date. The vast majority of patients with LRRK2-related PD reported in the literature carry one of three pathogenic substitutions: G2019S, R1441C, or R1441G. While G2019S and R1441C are geographically widespread, R1441G is most prevalent in the Basque Country and is rare outside of Northern Spain. We sought to better understand the processes that have shaped the current distribution of R1441G. We performed a haplotype analysis of 29 unrelated PD patients heterozygous for R1441G and 85 wild-type controls using 20 markers that spanned 15.1 Mb across the LRRK2 region. Nine of the patients were of Basque origin and 20 were non-Basques. We inferred haplotypes using a Bayesian approach and utilized a maximum-likelihood method to estimate the age of the most recent common ancestor. Significant but incomplete allele sharing was observed over a distance of 6.0 Mb and a single, rare ten-marker haplotype 5.8 Mb in length was seen in all mutation carriers. We estimate that the most recent common ancestor lived 1,350 (95% CI, 1,020-1,740) years ago in approximately the seventh century. We hypothesize that R1441G originated in the Basque population and that dispersion of the mutation then occurred through short-range gene flow that was largely limited to nearby regions in Spain.

  5. Self-report of cognitive impairment and Mini-Mental State Exam performance in PRKN, LRRK2, and GBA carriers with early onset Parkinson’s disease

    Science.gov (United States)

    Alcalay, Roy N.; Mejia-Santana, Helen; Tang, Ming X.; Rakitin, Brian; Rosado, Llency; Ross, Barbara; Verbitsky, Miguel; Kisselev, Sergey; Louis, Elan D.; Comella, Cynthia; Colcher, Amy; Jennings, Danna; Nance, Martha; Bressman, Susan; Scott, William K.; Tanner, Caroline; Mickel, Susan; Andrews, Howard; Waters, Cheryl; Fahn, Stanley; Cote, Lucien; Frucht, Steven; Ford, Blair; Rezak, Michael; Novak, Kevin; Friedman, Joseph; Pfeiffer, Ronald; Marsh, Laura; Hiner, Bradley; Siderowf, Andrew; Ottman, Ruth; Clark, Lorraine; Marder, Karen; Caccappolo, Elise

    2010-01-01

    While little is known about risk factors for cognitive impairment in early onset Parkinson disease (EOPD), postmortem studies have shown an association between dementia with Lewy bodies (DLB) and glucocerebrosidase (GBA) mutation. We compared Mini-Mental State Examination (MMSE) performance and self-reported cognitive impairment in 699 EOPD participants genotyped for mutations in parkin (PRKN), leucine-rich repeat kinase-2 (LRRK2), and GBA. Logistic regression was used to assess the association between reported cognitive impairment and MMSE score, as well as between GBA group membership and self-reported impairment and MMSE. GBA carriers reported more impairment, but MMSE performance did not differ among genetic groups. Detailed neuropsychological testing is required to explore the association between cognitive impairment and GBA mutations. PMID:20182943

  6. Sleep Disorders in Parkinsonian and Nonparkinsonian LRRK2 Mutation Carriers.

    Directory of Open Access Journals (Sweden)

    Claustre Pont-Sunyer

    Full Text Available In idiopathic Parkinson disease (IPD sleep disorders are common and may antedate the onset of parkinsonism. Based on the clinical similarities between IPD and Parkinson disease associated with LRRK2 gene mutations (LRRK2-PD, we aimed to characterize sleep in parkinsonian and nonmanifesting LRRK2 mutation carriers (NMC.A comprehensive interview conducted by sleep specialists, validated sleep scales and questionnaires, and video-polysomnography followed by multiple sleep latency test (MSLT assessed sleep in 18 LRRK2-PD (17 carrying G2019S and one R1441G mutations, 17 NMC (11 G2019S, three R1441G, three R1441C, 14 non-manifesting non-carriers (NMNC and 19 unrelated IPD.Sleep complaints were frequent in LRRK2-PD patients; 78% reported poor sleep quality, 33% sleep onset insomnia, 56% sleep fragmentation and 39% early awakening. Sleep onset insomnia correlated with depressive symptoms and poor sleep quality. In LRRK2-PD, excessive daytime sleepiness (EDS was a complaint in 33% patients and short sleep latencies on the MSLT, which are indicative of objective EDS, were found in 71%. Sleep attacks occurred in three LRRK2-PD patients and a narcoleptic phenotype was not observed. REM sleep behavior disorder (RBD was diagnosed in three LRRK2-PD. EDS and RBD were always reported to start after the onset of parkinsonism in LRRK2-PD. In NMC, EDS was rarely reported and RBD was absent. When compared to IPD, sleep onset insomnia was more significantly frequent, EDS was similar, and RBD was less significantly frequent and less severe in LRRK2-PD. In NMC, RBD was not detected and sleep complaints were much less frequent than in LRRK2-PD. No differences were observed in sleep between NMC and NMNC.Sleep complaints are frequent in LRRK2-PDand show a pattern that when compared to IPD is characterized by more frequent sleep onset insomnia, similar EDS and less prominent RBD. Unlike in IPD, RBD and EDS seem to be not markers of the prodromal stage of LRRK2-PD.

  7. Cerebral pathological and compensatory mechanisms in the premotor phase of leucine-rich repeat kinase 2 parkinsonism.

    Science.gov (United States)

    van Nuenen, Bart F L; Helmich, Rick C; Ferraye, Murielle; Thaler, Avner; Hendler, Talma; Orr-Urtreger, Avi; Mirelman, Anat; Bressman, Susan; Marder, Karen S; Giladi, Nir; van de Warrenburg, Bart P C; Bloem, Bastiaan R; Toni, Ivan

    2012-12-01

    Compensatory cerebral mechanisms can delay motor symptom onset in Parkinson's disease. We aim to characterize these compensatory mechanisms and early disease-related changes by quantifying movement-related cerebral function in subjects at significantly increased risk of developing Parkinson's disease, namely carriers of a leucine-rich repeat kinase 2-G2019S mutation associated with dominantly inherited parkinsonism. Functional magnetic resonance imaging was used to examine cerebral activity evoked during internal selection of motor representations, a core motor deficit in clinically overt Parkinson's disease. Thirty-nine healthy first-degree relatives of Ashkenazi Jewish patients with Parkinson's disease, who carry the leucine-rich repeat kinase 2-G2019S mutation, participated in this study. Twenty-one carriers of the leucine-rich repeat kinase 2-G2019S mutation and 18 non-carriers of this mutation were engaged in a motor imagery task (laterality judgements of left or right hands) known to be sensitive to motor control parameters. Behavioural performance of both groups was matched. Mutation carriers and non-carriers were equally sensitive to the extent and biomechanical constraints of the imagined movements in relation to the current posture of the participants' hands. Cerebral activity differed between groups, such that leucine-rich repeat kinase 2-G2019S carriers had reduced imagery-related activity in the right caudate nucleus and increased activity in the right dorsal premotor cortex. More severe striatal impairment was associated with stronger effective connectivity between the right dorsal premotor cortex and the right extrastriate body area. These findings suggest that altered movement-related activity in the caudate nuclei of leucine-rich repeat kinase 2-G2019S carriers might remain behaviourally latent by virtue of cortical compensatory mechanisms involving long-range connectivity between the dorsal premotor cortex and posterior sensory regions. These

  8. Leucine-rich repeat kinase 2 and alpha-synuclein: intersecting pathways in the pathogenesis of Parkinson's disease?

    Directory of Open Access Journals (Sweden)

    Civiero Laura

    2011-01-01

    Full Text Available Abstract Although Parkinson's disease (PD is generally a sporadic neurological disorder, the discovery of monogenic, hereditable forms of the disease has been crucial in delineating the molecular pathways that lead to this pathology. Genes responsible for familial PD can be ascribed to two categories based both on their mode of inheritance and their suggested biological function. Mutations in parkin, PINK1 and DJ-1 cause of recessive Parkinsonism, with a variable pathology often lacking the characteristic Lewy bodies (LBs in the surviving neurons. Intriguingly, recent findings highlight a converging role of all these genes in mitochondria function, suggesting a common molecular pathway for recessive Parkinsonism. Mutations in a second group of genes, encoding alpha-synuclein (α-syn and LRRK2, are transmitted in a dominant fashion and generally lead to LB pathology, with α-syn being the major component of these proteinaceous aggregates. In experimental systems, overexpression of mutant proteins is toxic, as predicted for dominant mutations, but the normal function of both proteins is still elusive. The fact that α-syn is heavily phosphorylated in LBs and that LRRK2 is a protein kinase, suggests that a link, not necessarily direct, exists between the two. What are the experimental data supporting a common molecular pathway for dominant PD genes? Do α-syn and LRRK2 target common molecules? Does LRRK2 act upstream of α-syn? In this review we will try to address these of questions based on the recent findings available in the literature.

  9. The prodromal phase of leucine-rich repeat kinase 2-associated Parkinson disease: Clinical and imaging Studies.

    Science.gov (United States)

    Pont-Sunyer, Claustre; Tolosa, Eduardo; Caspell-Garcia, Chelsea; Coffey, Christopher; Alcalay, Roy N; Chan, Piu; Duda, John E; Facheris, Maurizio; Fernández-Santiago, Rubén; Marek, Kenneth; Lomeña, Francisco; Marras, Connie; Mondragon, Elisabet; Saunders-Pullman, Rachel; Waro, Bjorg

    2017-05-01

    Asymptomatic, nonmanifesting carriers of leucine-rich repeat kinase 2 mutations are at increased risk of developing PD. Clinical and neuroimaging features may be associated with gene carriage and/or may demarcate individuals at greater risk for phenoconversion to PD. To investigate clinical and dopamine transporter single-photon emission computed tomography imaging characteristics of leucine-rich repeat kinase 2 asymptomatic carriers. A total of 342 carriers' and 259 noncarriers' relatives of G2019S leucine-rich repeat kinase 2/PD patients and 39 carriers' and 31 noncarriers' relatives of R1441G leucine-rich repeat kinase 2/PD patients were evaluated. Motor and nonmotor symptoms were assessed using specific scales and questionnaires. Neuroimaging quantitative data were obtained in 81 carriers and compared with 41 noncarriers. G2019S carriers scored higher in motor scores and had lower radioligand uptake compared to noncarriers, but no differences in nonmotor symptoms scores were observed. R1441G carriers scored higher in motor scores, had lower radioligand uptake, and had higher scores in depression, dysautonomia, and Rapid Eye Movements Sleep Behavior Disorder Screening Questionnaire scores, but had better cognition scores than noncarriers. Among G2019S carriers, a group with "mild motor signs" was identified, and was significantly older, with worse olfaction and lower radioligand uptake. G2019S and R1441G carriers differ from their noncarriers' relatives in higher motor scores and slightly lower radioligand uptake. Nonmotor symptoms were mild, and different nonmotor profiles were observed in G2019S carriers compared to R1441G carriers. A group of G2019S carriers with known prodromal features was identified. Longitudinal studies are required to determine whether such individuals are at short-term risk of developing overt parkinsonism. © 2017 International Parkinson and Movement Disorder Society. © 2017 International Parkinson and Movement Disorder Society.

  10. Frequency of LRRK2 mutations in early- and late-onset Parkinson disease.

    Science.gov (United States)

    Clark, L N; Wang, Y; Karlins, E; Saito, L; Mejia-Santana, H; Harris, J; Louis, E D; Cote, L J; Andrews, H; Fahn, S; Waters, C; Ford, B; Frucht, S; Ottman, R; Marder, K

    2006-11-28

    To evaluate the frequency of leucine-rich repeat kinase gene (LRRK2) mutations and single nucleotide polymorphisms (SNPs) in early-onset Parkinson disease (EOPD) and late-onset Parkinson disease (LOPD). We genotyped five previously reported LRRK2 mutations (G2019S, L1114L, I1122V, R1441C, and Y1699C) and 17 coding SNPs for haplotype analysis in 504 cases with PD and 314 controls enrolled in the Genetic Epidemiology of PD Study. Cases and controls were recruited without knowledge of family history of PD and cases were oversampled in the 50 (p = 0.56). All cases with PD with the G2019S mutation shared the same disease-associated haplotype. The frequency of the LRRK2 G2019S mutation was higher in the subset of 181 cases reporting four Jewish grandparents (9.9%) than in other cases (3.1%) (p Parkinson disease and confirms the previous report of a greater frequency of the G2019S mutation in Jewish than in non-Jewish cases with Parkinson disease.

  11. Functional interaction of Parkinson's disease-associated LRRK2 with members of the dynamin GTPase superfamily

    Science.gov (United States)

    Stafa, Klodjan; Tsika, Elpida; Moser, Roger; Musso, Alessandra; Glauser, Liliane; Jones, Amy; Biskup, Saskia; Xiong, Yulan; Bandopadhyay, Rina; Dawson, Valina L.; Dawson, Ted M.; Moore, Darren J.

    2014-01-01

    Mutations in LRRK2 cause autosomal dominant Parkinson's disease (PD). LRRK2 encodes a multi-domain protein containing GTPase and kinase domains, and putative protein–protein interaction domains. Familial PD mutations alter the GTPase and kinase activity of LRRK2 in vitro. LRRK2 is suggested to regulate a number of cellular pathways although the underlying mechanisms are poorly understood. To explore such mechanisms, it has proved informative to identify LRRK2-interacting proteins, some of which serve as LRRK2 kinase substrates. Here, we identify common interactions of LRRK2 with members of the dynamin GTPase superfamily. LRRK2 interacts with dynamin 1–3 that mediate membrane scission in clathrin-mediated endocytosis and with dynamin-related proteins that mediate mitochondrial fission (Drp1) and fusion (mitofusins and OPA1). LRRK2 partially co-localizes with endosomal dynamin-1 or with mitofusins and OPA1 at mitochondrial membranes. The subcellular distribution and oligomeric complexes of dynamin GTPases are not altered by modulating LRRK2 in mouse brain, whereas mature OPA1 levels are reduced in G2019S PD brains. LRRK2 enhances mitofusin-1 GTP binding, whereas dynamin-1 and OPA1 serve as modest substrates of LRRK2-mediated phosphorylation in vitro. While dynamin GTPase orthologs are not required for LRRK2-induced toxicity in yeast, LRRK2 functionally interacts with dynamin-1 and mitofusin-1 in cultured neurons. LRRK2 attenuates neurite shortening induced by dynamin-1 by reducing its levels, whereas LRRK2 rescues impaired neurite outgrowth induced by mitofusin-1 potentially by reversing excessive mitochondrial fusion. Our study elucidates novel functional interactions of LRRK2 with dynamin-superfamily GTPases that implicate LRRK2 in the regulation of membrane dynamics important for endocytosis and mitochondrial morphology. PMID:24282027

  12. Leucine-Rich Repeat Kinase 2 interacts with Parkin, DJ-1 and PINK-1 in a Drosophila melanogaster model of Parkinson's disease.

    Science.gov (United States)

    Venderova, Katerina; Kabbach, Ghassan; Abdel-Messih, Elizabeth; Zhang, Yi; Parks, Robin J; Imai, Yuzuru; Gehrke, Stephan; Ngsee, Johnny; Lavoie, Matthew J; Slack, Ruth S; Rao, Yong; Zhang, Zhuohua; Lu, Bingwei; Haque, M Emdadul; Park, David S

    2009-11-15

    Mutations in the LRRK2 gene are the most common genetic cause of familial Parkinson's disease (PD). However, its physiological and pathological functions are unknown. Therefore, we generated several independent Drosophila lines carrying WT or mutant human LRRK2 (mutations in kinase, COR or LRR domains, resp.). Ectopic expression of WT or mutant LRRK2 in dopaminergic neurons caused their significant loss accompanied by complex age-dependent changes in locomotor activity. Overall, the ubiquitous expression of LRRK2 increased lifespan and fertility of the flies. However, these flies were more sensitive to rotenone. LRRK2 expression in the eye exacerbated retinal degeneration. Importantly, in double transgenic flies, various indices of the eye and dopaminergic survival were modified in a complex fashion by a concomitant expression of PINK1, DJ-1 or Parkin. This evidence suggests a genetic interaction between these PD-relevant genes.

  13. Novel recruitment strategy to enrich for LRRK2 mutation carriers.

    Science.gov (United States)

    Foroud, Tatiana; Smith, Danielle; Jackson, Jacqueline; Verbrugge, Jennifer; Halter, Cheryl; Wetherill, Leah; Sims, Katherine; Xin, Winnie; Arnedo, Vanessa; Lasch, Shirley; Marek, Kenneth

    2015-09-01

    The LRRK2 G2019S mutation is found at higher frequency among Parkinson disease (PD) patients of Ashkenazi Jewish (AJ) ancestry. This study was designed to test whether an internet-based approach could be an effective approach to screen and identify mutation carriers. Individuals with and without PD of AJ ancestry were recruited and consented through an internet-based study website. An algorithm was applied to a series of screening questions to identify individuals at increased risk to carry the LRRK2 G2019S mutation. About 1000 individuals completed the initial screening. Around 741 qualified for mutation testing and 650 were tested. Seventy-two individuals carried at least one LRRK2 G2019S mutation; 38 with PD (12.5%) and 34 without (10.1%). Among the AJ PD participants, each affected first-degree relative increased the likelihood the individual was LRRK2+ [OR = 4.7; 95% confidence interval = (2.4-9.0)]. The same was not observed among the unaffected AJ subjects (P = 0.11). An internet-based approach successfully screened large numbers of individuals to identify those with risk factors increasing the likelihood that they carried a LRRK2 G2019S mutation. A similar approach could be implemented in other disorders to identify individuals for clinical trials, biomarker analyses and other types of research studies.

  14. Mood and cognition in leucine-rich repeat kinase 2 G2019S Parkinson's disease.

    Science.gov (United States)

    Shanker, Vicki; Groves, Mark; Heiman, Gary; Palmese, Christina; Saunders-Pullman, Rachel; Ozelius, Laurie; Raymond, Deborah; Bressman, Susan

    2011-08-15

    The behavioral and cognitive features of the leucine-rich repeat kinase G2019S mutation in Parkinson's disease in the Ashkenazi Jewish population are not well described; therefore, we sought to more systematically characterize these features using a semistructured psychiatric interview and neuropsychological testing. Twenty-one Ashkenazi Jewish patients having the leucine-rich repeat kinase G2019S mutation were compared with age- and sex-matched Ashkenazi Jewish patients with Parkinson's disease without mutations. Although overall rates of affective disorders were not greater in mutation carriers, the carriers exhibited a 6-fold increased risk of premorbid affective disorders (odds ratio, 6.0; P = .10), as determined by the Structured Clinical Interview for the Diagnostic and Statistical Manual of Mental Disorders-IV. Of interest, we identified 2 leucine-rich repeat kinase carriers with bipolar disorder; no mutation-negative subjects had this diagnosis. Performance on the Hopkins Verbal Learning Test-Revised, Judgment of Line Orientation, and Frontal Assessment Battery was consistent with previous reports and did not differ between groups. Study findings suggest a possible association between premorbid mood disorders and leucine-rich repeat kinase Parkinson's disease, warranting further evaluation.

  15. LRRK2 G2019S in families with Parkinson disease who originated from Europe and the Middle East: evidence of two distinct founding events beginning two millennia ago.

    Science.gov (United States)

    Zabetian, Cyrus P; Hutter, Carolyn M; Yearout, Dora; Lopez, Alexis N; Factor, Stewart A; Griffith, Alida; Leis, Berta C; Bird, Thomas D; Nutt, John G; Higgins, Donald S; Roberts, John W; Kay, Denise M; Edwards, Karen L; Samii, Ali; Payami, Haydeh

    2006-10-01

    The leucine-rich repeat kinase 2 (LRRK2) G2019S mutation is the most common genetic determinant of Parkinson disease (PD) identified to date. It accounts for 1%-7% of PD in patients of European origin and 20%-40% in Ashkenazi Jews and North African Arabs with PD. Previous studies concluded that patients from these populations all shared a common Middle Eastern founder who lived in the 13th century. We tested this hypothesis by genotyping 25 microsatellite and single-nucleotide-polymorphism markers in 22 families with G2019S and observed two distinct haplotypes. Haplotype 1 was present in 19 families of Ashkenazi Jewish and European ancestry, whereas haplotype 2 occurred in three European American families. Using a maximum-likelihood method, we estimated that the families with haplotype 1 shared a common ancestor 2,250 (95% confidence interval 1,650-3,120) years ago, whereas those with haplotype 2 appeared to share a more recent founder. Our data suggest two separate founding events for G2019S in these populations, beginning at a time that coincides with the Jewish Diasporas.

  16. Abberant protein synthesis in G2019S LRRK2 Drosophila Parkinson disease-related phenotypes

    Science.gov (United States)

    Martin, Ian; Abalde-Atristain, Leire; Kim, Jungwoo Wren; Dawson, Ted M; Dawson, Valina L

    2014-01-01

    LRRK2 mutations are a frequent cause of familial Parkinson disease (PD) and are also found in a number of sporadic PD cases. PD-linked G2019S and I2020T mutations in the kinase domain of LRRK2 result in elevated kinase activity, which is required for the toxicity of these pathogenic variants in cell and animal models of PD. We recently reported that LRRK2 interacts with and phosphorylates a number of mammalian ribosomal proteins, several of which exhibit increased phosphorylation via both G2019S and I2020T LRRK2. Blocking the phosphorylation of ribosomal protein s15 through expression of phospho-deficient T136A s15 prevents age-associated locomotor deficits and dopamine neuron loss caused by G2019S LRRK2 expression in Drosophila indicating that s15 is a pathogenic LRRK2 substrate. We previously described that G2019S LRRK2 causes an induction of bulk mRNA translation that is blocked by T136A s15 or the protein synthesis inhibitor anisomycin. Here, we report the protective effects of the eIF4E/eIF4G interaction inhibitor 4EGI-1, in preventing neurodegenerative phenotypes in G2019S LRRK2 flies, and discuss how our findings and those of other groups provide a framework to begin investigating the mechanistic impact of LRRK2 on translation. PMID:25483009

  17. Mitochondrial DNA in CSF distinguishes LRRK2 from idiopathic Parkinson's disease.

    Science.gov (United States)

    Podlesniy, Petar; Vilas, Dolores; Taylor, Peggy; Shaw, Leslie M; Tolosa, Eduard; Trullas, Ramon

    2016-10-01

    Mitochondrial DNA regulates mitochondrial function which is altered in both idiopathic and familial forms of Parkinson's disease. To investigate whether these two disease forms exhibit an altered regulation of mitochondrial DNA we measured cell free mitochondrial DNA content in cerebrospinal fluid (CSF) from idiopathic and LRRK2-related Parkinson's disease patients. The concentration of mitochondrial DNA was measured using a digital droplet polymerase chain reaction technique in a total of 98 CSF samples from a cohort of subjects including: 20 LRRK2(G2019S) mutation carriers with Parkinson's disease, 26 asymptomatic LRRK2(G2019S) mutation carriers, 31 patients with idiopathic Parkinson's disease and 21 first-degree relatives of LRRK2 Parkinson's disease patients without the mutation. Here we report that LRRK2(G2019S) mutation carriers with Parkinson's disease exhibit a high concentration of mitochondrial DNA in CSF compared with asymptomatic LRRK2(G2019S) mutation carriers and with idiopathic Parkinson's disease patients. In addition, idiopathic, but not LRRK2 Parkinson's disease is associated with low CSF concentration of α-synuclein. These results show that high mitochondrial DNA content in CSF distinguishes idiopathic from LRRK2-related Parkinson's disease suggesting that different biochemical pathways underlie neurodegeneration in these two disorders.

  18. Reorganization of corticostriatal circuits in healthy G2019S LRRK2 carriers

    NARCIS (Netherlands)

    Helmich, R.C.G.; Thaler, A.; Nuenen, B.F. van; Gurevich, T.; Mirelman, A.; Marder, K.S.; Bressman, S.; Orr-Urtreger, A.; Giladi, N.; Bloem, B.R.; Toni, I.

    2015-01-01

    OBJECTIVE: We investigated system-level corticostriatal changes in a human model of premotor Parkinson disease (PD), i.e., healthy carriers of the G2019S LRRK2 mutation that is associated with a markedly increased, age-dependent risk of developing PD. METHODS: We compared 37 asymptomatic LRRK2 G2019

  19. RNAi Mediated Silencing of LRRK2G2019S in Parkinson’s Disease

    Science.gov (United States)

    2013-08-01

    kinase domain (kinase dead mutants) diminishes neurotoxicity and basal kinase levels appear to be required for the toxicity of all LRRK2 mutants [6...between 1 % and 573 % of sporadic PD [5–10]. LRRK2 proximate single nucleo - 58tide polymorphisms have also been significantly associated 59with

  20. Lrrk2-associated parkinsonism is a major cause of disease in Northern Spain.

    Science.gov (United States)

    González-Fernández, María C; Lezcano, Elena; Ross, Owen A; Gómez-Esteban, Juan C; Gómez-Busto, Fernando; Velasco, Fernando; Alvarez-Alvarez, Maite; Rodríguez-Martínez, María B; Ciordia, Roberto; Zarranz, Juan J; Farrer, Matthew J; Mata, Ignacio F; de Pancorbo, Marian M

    2007-12-01

    Herein we describe a comparative clinical and genetic study of Lrrk2-associated parkinsonism in Northern Spain. In our sample from the Basque region, Lrrk2 R1441G and G2019S account for 15 out of 50 kindreds (30%) with familial Parkinson's disease. We observe common founder haplotypes for both R1441G and G2019S carriers. Our findings highlight the importance of Lrrk2 parkinsonism in this population and may have important consequences for its extended Diaspora in North, Central and South Americas.

  1. A Missense LRRK2 Variant Is a Risk Factor for Excessive Inflammatory Responses in Leprosy.

    Directory of Open Access Journals (Sweden)

    Vinicius M Fava

    2016-02-01

    Full Text Available Depending on the epidemiological setting, a variable proportion of leprosy patients will suffer from excessive pro-inflammatory responses, termed type-1 reactions (T1R. The LRRK2 gene encodes a multi-functional protein that has been shown to modulate pro-inflammatory responses. Variants near the LRRK2 gene have been associated with leprosy in some but not in other studies. We hypothesized that LRRK2 was a T1R susceptibility gene and that inconsistent association results might reflect different proportions of patients with T1R in the different sample settings. Hence, we evaluated the association of LRRK2 variants with T1R susceptibility.An association scan of the LRRK2 locus was performed using 156 single-nucleotide polymorphisms (SNPs. Evidence of association was evaluated in two family-based samples: A set of T1R-affected and a second set of T1R-free families. Only SNPs significant for T1R-affected families with significant evidence of heterogeneity relative to T1R-free families were considered T1R-specific. An expression quantitative trait locus (eQTL analysis was applied to evaluate the impact of T1R-specific SNPs on LRRK2 gene transcriptional levels.A total of 18 T1R-specific variants organized in four bins were detected. The core SNP capturing the T1R association was the LRRK2 missense variant M2397T (rs3761863 that affects LRRK2 protein turnover. Additionally, a bin of nine SNPs associated with T1R were eQTLs for LRRK2 in unstimulated whole blood cells but not after exposure to Mycobacterium leprae antigen.The results support a preferential association of LRRK2 variants with T1R. LRRK2 involvement in T1R is likely due to a pathological pro-inflammatory loop modulated by LRRK2 availability. Interestingly, the M2397T variant was reported in association with Crohn's disease with the same risk allele as in T1R suggesting common inflammatory mechanism in these two distinct diseases.

  2. Discovery of a Highly Selective, Brain-Penetrant Aminopyrazole LRRK2 Inhibitor.

    Science.gov (United States)

    Chan, Bryan K; Estrada, Anthony A; Chen, Huifen; Atherall, John; Baker-Glenn, Charles; Beresford, Alan; Burdick, Daniel J; Chambers, Mark; Dominguez, Sara L; Drummond, Jason; Gill, Andrew; Kleinheinz, Tracy; Le Pichon, Claire E; Medhurst, Andrew D; Liu, Xingrong; Moffat, John G; Nash, Kevin; Scearce-Levie, Kimberly; Sheng, Zejuan; Shore, Daniel G; Van de Poël, Hervé; Zhang, Shuo; Zhu, Haitao; Sweeney, Zachary K

    2013-01-10

    The modulation of LRRK2 kinase activity by a selective small molecule inhibitor has been proposed as a potentially viable treatment for Parkinson's disease. By using aminopyrazoles as aniline bioisosteres, we discovered a novel series of LRRK2 inhibitors. Herein, we describe our optimization effort that resulted in the identification of a highly potent, brain-penetrant aminopyrazole LRRK2 inhibitor (18) that addressed the liabilities (e.g., poor solubility and metabolic soft spots) of our previously disclosed anilino-aminopyrimidine inhibitors. In in vivo rodent PKPD studies, 18 demonstrated good brain exposure and engendered significant reduction in brain pLRRK2 levels post-ip administration. The strategies of bioisosteric substitution of aminopyrazoles for anilines and attenuation of CYP1A2 inhibition described herein have potential applications to other drug discovery programs.

  3. LRRK2 enhances oxidative stress-induced neurotoxicity via its kinase activity.

    Science.gov (United States)

    Heo, Hye Young; Park, Ji-Min; Kim, Cy-Hyun; Han, Baek Soo; Kim, Kwang-Soo; Seol, Wongi

    2010-02-15

    LRRK2 is an autosomal dominant gene whose mutations cause familial Parkinson's disease (PD). The LRRK2 protein contains a functional kinase and a GTPase domain. PD phenotypes caused by LRRK2 mutations are similar to those of idiopathic PD, implying that LRRK2 is an important participant in PD pathogenesis. Of LRRK2's PD-specific mutations, the G2019S is the most frequently observed one. Its over-expression is known to increase kinase activity and neurotoxicity compared to wild type (WT) LRRK2. Here, using a simple colorimetric cell viability assay, we analyzed LRRK2's neurotoxicity in dopaminergic SN4741 cells following treatment with hydrogen peroxide. When WT, G2019S, or empty vector was expressed in SN4741 cells, cell death was modestly and significantly increased in the order of G2019S>WT>vector. When these transfected cells were treated with hydrogen peroxide to mimic oxidative stress, cellular neurotoxicity was enhanced in the same order (i.e. G2019S>WT>vector). Moreover, incubation of SN4741 cells with conditioned medium from cells expressing G2019S and subjected to hydrogen peroxide treatment exhibited 10-15% more cell death than conditioned medium from cells transfected with vector or WT, suggesting that G2019S-expressing cells secrete a factor(s) affecting viability of neighboring cells. The kinase domain was mapped to be responsible for oxidative stress-induced neurotoxicity. In addition, over-expression of WT and G2019S LRRK2 lead to a weak, but significant, increase in intracellular reactive oxygen species (ROS) in the order of G2019S>WT as measured by DCFH-DA assay in both the presence and absence of H(2)O(2) treatment. Furthermore, in G2019S-expressing cells, co-expression of the anti-oxidant protein DJ-1 or ERK inhibitor treatment restored survival rate to a level similar to that of cells transfected with control vector under H(2)O(2) treatment. Taken together, our data suggest that the LRRK2 kinase domain increases the generation of ROS and causes

  4. Lrrk2 p.Q1111H substitution and Parkinson’s disease in Latin America

    Science.gov (United States)

    Mata, Ignacio F.; Wilhoite, Greggory J.; Yearout, Dora; Bacon, Justin A.; Cornejo, Mario; Mazzetti, Pilar; Marca, Victoria; Ortega, Olimpio; Acosta, Oscar; Cosentino, Carlos; Torres, Luis; Medina, Angel C.; Perez-Pastene, Carolina; Díaz-Grez, Fernando; Vilariño-Güell, Carles; Venegas, Pablo; Miranda, Marcelo; Trujillo-Godoy, Osvaldo; Layson, Luis; Avello, Rodrigo; Dieguez, Elena; Raggio, Victor; Micheli, Federico; Perandones, Claudia; Alvarez, Victoria; Segura-Aguilar, Juan; Farrer, Matthew J.; Zabetian, Cyrus P.; Ross, Owen A.

    2011-01-01

    Mutations in the LRRK2 gene are the most common genetic cause of Parkinson’s disease, with frequencies displaying a high degree of population-specificity. Although more than 100 coding substitutions have been identified, only seven have been proven to be highly penetrant pathogenic mutations. Studies however are lacking in non-white populations. Recently, Lrrk2 p.Q1111H (rs78365431) was identified in two affected Hispanic brothers and absent in 386 non-Hispanic white healthy controls. We therefore screened this variant in 1460 individuals (1150 PD patients and 310 healthy controls) from 4 Latin American countries (Peru, Chile, Uruguay and Argentina). In our case-control series from Peru and Chile we observed an increased frequency of Lrrk2 p.Q1111H in patients (7.9%) compared to controls (5.4%) although the difference did not reach significance (OR 1.38; p=0.10). In addition, the frequency of Lrrk2 p.Q1111H varied greatly between populations and further screening in a set of pure Amerindian and pure Spanish controls suggested that this variant likely originated in an Amerindian population. Further studies in other Latin American populations are warranted to assess its role as a risk factor for Parkinson’s disease. Screening in Parkinson’s disease patients from under-represented populations will increase our understanding of the role of LRRK2 variants in disease risk worldwide. PMID:21632271

  5. Association of the LRRK2 genetic polymorphisms with leprosy in Han Chinese from Southwest China.

    Science.gov (United States)

    Wang, D; Xu, L; Lv, L; Su, L-Y; Fan, Y; Zhang, D-F; Bi, R; Yu, D; Zhang, W; Li, X-A; Li, Y-Y; Yao, Y-G

    2015-03-01

    Leprosy is a chronic infectious and neurological disease that is caused by infection of Mycobacterium leprae (M. leprae). A recent genome-wide association study indicated a suggestive association of LRRK2 genetic variant rs1873613 with leprosy in Chinese population. To validate this association and further identify potential causal variants of LRRK2 with leprosy, we genotyped 13 LRRK2 variants in 548 leprosy patients and 1078 healthy individuals from Yunnan Province and (re-)analyzed 3225 Han Chinese across China. Variants rs1427267, rs3761863, rs1873613, rs732374 and rs7298930 were significantly associated with leprosy per se and/or paucibacillary leprosy (PB). Haplotype A-G-A-C-A was significantly associated with leprosy per se (P=0.018) and PB (P=0.020). Overexpression of the protective allele (Thr2397) of rs3761863 in HEK293 cells led to a significantly increased nuclear factor of activated T-cells' activity compared with allele Met2397 after lipopolysaccharides stimulation. Allele Thr2397 could attenuate 1-methyl-4-phenyl-1, 2, 3, 6-tetrahydropyridine-induced autophagic activity in U251 cells. These data suggest that the protective effect of LRRK2 variant p.M2397T on leprosy might be mediated by increasing immune response and decreasing neurotoxicity after M. leprae loading. Our findings confirm that LRRK2 is a susceptible gene to leprosy in Han Chinese population.

  6. Neurodegenerative phenotypes in an A53T α-synuclein transgenic mouse model are independent of LRRK2

    Science.gov (United States)

    Daher, João Paulo L.; Pletnikova, Olga; Biskup, Saskia; Musso, Alessandra; Gellhaar, Sandra; Galter, Dagmar; Troncoso, Juan C.; Lee, Michael K.; Dawson, Ted M.; Dawson, Valina L.; Moore, Darren J.

    2012-01-01

    Mutations in the genes encoding LRRK2 and α-synuclein cause autosomal dominant forms of familial Parkinson's disease (PD). Fibrillar forms of α-synuclein are a major component of Lewy bodies, the intracytoplasmic proteinaceous inclusions that are a pathological hallmark of idiopathic and certain familial forms of PD. LRRK2 mutations cause late-onset familial PD with a clinical, neurochemical and, for the most part, neuropathological phenotype that is indistinguishable from idiopathic PD. Importantly, α-synuclein-positive Lewy bodies are the most common pathology identified in the brains of PD subjects harboring LRRK2 mutations. These observations may suggest that LRRK2 functions in a common pathway with α-synuclein to regulate its aggregation. To explore the potential pathophysiological interaction between LRRK2 and α-synuclein in vivo, we modulated LRRK2 expression in a well-established human A53T α-synuclein transgenic mouse model with transgene expression driven by the hindbrain-selective prion protein promoter. Deletion of LRRK2 or overexpression of human G2019S-LRRK2 has minimal impact on the lethal neurodegenerative phenotype that develops in A53T α-synuclein transgenic mice, including premature lethality, pre-symptomatic behavioral deficits and human α-synuclein or glial neuropathology. We also find that endogenous or human LRRK2 and A53T α-synuclein do not interact together to influence the number of nigrostriatal dopaminergic neurons. Taken together, our data suggest that α-synuclein-related pathology, which occurs predominantly in the hindbrain of this A53T α-synuclein mouse model, occurs largely independently from LRRK2 expression. These observations fail to provide support for a pathophysiological interaction of LRRK2 and α-synuclein in vivo, at least within neurons of the mouse hindbrain. PMID:22357653

  7. Topological Fingerprints as an Aid in Finding Structural Patterns for LRRK2 Inhibition.

    Science.gov (United States)

    Kahn, Iiris; Lomaka, Andre; Karelson, Mati

    2014-04-01

    Multiplet-based fingerprint mapping has been used to analyse the relationship between the structural features of potential drug candidates and the enzyme LRRK2 inhibition expressed as the inhibition constant (pKi ). For 198 structurally diverse compounds 4195 dimensional fingerprints were generated and mathematically manipulated using partial least squares (PLS) regression. A variation of PLS-BETA technique was developed for the reduction of noise by eliminating excess variables that resulted in a 636 dimensional fingerprint related to pKi . The QSAR model for the training set of 170 compounds (R(2) =0.87, Q(2) =0.77 and SDEC=0.42) had four latent variables (PLS components) and it was validated by the external test set of 28 compounds (Qext (2) =0.63). The proposed model of LRRK2 inhibitory activity can be helpful in designing focused libraries enriched in LRRK2 inhibitors and identifying new active chemotypes in compound databases.

  8. A cognitive fMRI study in non-manifesting LRRK2 and GBA carriers.

    Science.gov (United States)

    Bregman, Noa; Thaler, Avner; Mirelman, Anat; Helmich, Rick C; Gurevich, Tanya; Orr-Urtreger, Avi; Marder, Karen; Bressman, Susan; Bloem, Bastiaan R; Giladi, Nir

    2017-04-01

    Mutations in the GBA and LRRK2 genes account for one-third of the prevalence of Parkinson's disease (PD) in Ashkenazi Jews. Non-manifesting carriers (NMC) of these mutations represent a population at risk for future development of PD. PD patient who carry mutations in the GBA gene demonstrates more significant cognitive decline compared to idiopathic PD patients. We assessed cognitive domains using fMRI among NMC of both LRRK2 and GBA mutations to better understand pre-motor cognitive functions in these populations. Twenty-one LRRK2-NMC, 10 GBA-NMC, and 22 non-manifesting non-carriers (NMNC) who participated in this study were evaluated using the standard questionnaires and scanned while performing two separate cognitive tasks; a Stroop interference task and an N-Back working memory task. Cerebral activation patterns were assessed using both whole brain and predefined region of interest (ROI) analysis. Subjects were well matched in all demographic and clinical characteristics. On the Stroop task, in spite of similar behavior, GBA-NMC demonstrated increased task-related activity in the right medial frontal gyrus and reduced task-related activity in the left lingual gyrus compared to both LRRK2-NMC and NMNC. In addition, GBA-NMC had higher activation patterns in the incongruent task compared to NMNC in the left medial frontal gyrus and bilateral precentral gyrus. No whole-brain differences were noted between groups on the N-Back task. Paired cognitive and task-related performance between GBA-NMC, LRRK2-NMC, and NMNC could indicate that the higher activation patterns in the incongruent Stroop condition among GBA-NMC compared to LRRK2-NMC and NMNC may represent a compensatory mechanism that enables adequate cognitive performance.

  9. Pathogenic LRRK2 mutations do not alter gene expression in cell model systems or human brain tissue.

    Directory of Open Access Journals (Sweden)

    Michael J Devine

    Full Text Available Point mutations in LRRK2 cause autosomal dominant Parkinson's disease. Despite extensive efforts to determine the mechanism of cell death in patients with LRRK2 mutations, the aetiology of LRRK2 PD is not well understood. To examine possible alterations in gene expression linked to the presence of LRRK2 mutations, we carried out a case versus control analysis of global gene expression in three systems: fibroblasts isolated from LRRK2 mutation carriers and healthy, non-mutation carrying controls; brain tissue from G2019S mutation carriers and controls; and HEK293 inducible LRRK2 wild type and mutant cell lines. No significant alteration in gene expression was found in these systems following correction for multiple testing. These data suggest that any alterations in basal gene expression in fibroblasts or cell lines containing mutations in LRRK2 are likely to be quantitatively small. This work suggests that LRRK2 is unlikely to play a direct role in modulation of gene expression, although it remains possible that this protein can influence mRNA expression under pathogenic cicumstances.

  10. High nigral iron deposition in LRRK2 and Parkin mutation carriers using R2* relaxometry

    DEFF Research Database (Denmark)

    Pyatigorskaya, Nadya; Sharman, Michael; Corvol, Jean-Christophe

    2015-01-01

    symptomatic and two asymptomatic Parkin subjects, nine symptomatic and five asymptomatic LRRK2 subjects) were compared with 20 patients with idiopathic PD (IPD) and 20 healthy subjects. Images were obtained at 3 teslas, using multi-echo T2 and T2* sequences. R2 and R2* values were calculated in the substantia...

  11. Non-motor and motor features in LRRK2 transgenic mice.

    Directory of Open Access Journals (Sweden)

    Zoë Bichler

    Full Text Available BACKGROUND: Non-motor symptoms are increasingly recognized as important features of Parkinson's disease (PD. LRRK2 mutations are common causes of familial and sporadic PD. Non-motor features have not been yet comprehensively evaluated in LRRK2 transgenic mouse models. OBJECTIVE: Using a transgenic mouse model overexpressing the R1441G mutation of the human LRRK2 gene, we have investigated the longitudinal correlation between motor and non-motor symptoms and determined if specific non-motor phenotypes precede motor symptoms. METHODOLOGY: We investigated the onset of motor and non-motor phenotypes on the LRRK2(R1441G BAC transgenic mice and their littermate controls from 4 to 21 month-old using a battery of behavioral tests. The transgenic mutant mice displayed mild hypokinesia in the open field from 16 months old, with gastrointestinal dysfunctions beginning at 6 months old. Non-motor features such as depression and anxiety-like behaviors, sensorial functions (pain sensitivity and olfaction, and learning and memory abilities in the passive avoidance test were similar in the transgenic animals compared to littermate controls. CONCLUSIONS: LRRK2(R1441G BAC transgenic mice displayed gastrointestinal dysfunction at an early stage but did not have abnormalities in fine behaviors, olfaction, pain sensitivity, mood disorders and learning and memory compared to non-transgenic littermate controls. The observations on olfaction and gastrointestinal dysfunction in this model validate findings in human carriers. These mice did recapitulate mild Parkinsonian motor features at late stages but compensatory mechanisms modulating the progression of PD in these models should be further evaluated.

  12. LRRK2 knockout mice have an intact dopaminergic system but display alterations in exploratory and motor co-ordination behaviors

    Directory of Open Access Journals (Sweden)

    Hinkle Kelly M

    2012-05-01

    Full Text Available Abstract Mutations in the LRRK2 gene are the most common cause of genetic Parkinson’s disease. Although the mechanisms behind the pathogenic effects of LRRK2 mutations are still not clear, data emerging from in vitro and in vivo models suggests roles in regulating neuronal polarity, neurotransmission, membrane and cytoskeletal dynamics and protein degradation. We created mice lacking exon 41 that encodes the activation hinge of the kinase domain of LRRK2. We have performed a comprehensive analysis of these mice up to 20 months of age, including evaluation of dopamine storage, release, uptake and synthesis, behavioral testing, dendritic spine and proliferation/neurogenesis analysis. Our results show that the dopaminergic system was not functionally comprised in LRRK2 knockout mice. However, LRRK2 knockout mice displayed abnormal exploratory activity in the open-field test. Moreover, LRRK2 knockout mice stayed longer than their wild type littermates on the accelerated rod during rotarod testing. Finally, we confirm that loss of LRRK2 caused degeneration in the kidney, accompanied by a progressive enhancement of autophagic activity and accumulation of autofluorescent material, but without evidence of biphasic changes.

  13. Deletion of the WD40 domain of LRRK2 in Zebrafish causes Parkinsonism-like loss of neurons and locomotive defect.

    Directory of Open Access Journals (Sweden)

    Donglai Sheng

    2010-04-01

    Full Text Available LRRK2 plays an important role in Parkinson's disease (PD, but its biological functions are largely unknown. Here, we cloned the homolog of human LRRK2, characterized its expression, and investigated its biological functions in zebrafish. The blockage of zebrafish LRRK2 (zLRRK2 protein by morpholinos caused embryonic lethality and severe developmental defects such as growth retardation and loss of neurons. In contrast, the deletion of the WD40 domain of zLRRK2 by morpholinos targeting splicing did not induce severe embryonic developmental defects; rather it caused Parkinsonism-like phenotypes, including loss of dopaminergic neurons in diencephalon and locomotion defects. These neurodegenerative and locomotion defects could be rescued by over-expressing zLRRK2 or hLRRK2 mRNA. The administration of L-dopa could also rescue the locomotion defects, but not the neurodegeneration. Taken together, our results demonstrate that zLRRK2 is an ortholog of hLRRK2 and that the deletion of WD40 domain of zLRRK2 provides a disease model for PD.

  14. Evaluation of LRRK2 G2019S penetrance: relevance for genetic counseling in Parkinson disease.

    Science.gov (United States)

    Goldwurm, S; Zini, M; Mariani, L; Tesei, S; Miceli, R; Sironi, F; Clementi, M; Bonifati, V; Pezzoli, G

    2007-04-03

    We report the results of a family-based study of LRRK2 G2019S penetrance in Parkinson disease. We studied 19 families identified through the analysis of unrelated consecutive patients. The cumulative incidence of the disease was 15% at 60 years, 21% at 70 years, and 32% at 80 years. This study provides accurate estimates of G2019S penetrance by minimizing the selection bias.

  15. Common Variation in the LRRK2 Gene is a Risk Factor for Parkinson’s Disease

    Science.gov (United States)

    Mata, Ignacio F.; Checkoway, Harvey; Hutter, Carolyn M.; Samii, Ali; Roberts, John W.; Kim, Hojoong M.; Agarwal, Pinky; Alvarez, Victoria; Ribacoba, Renee; Pastor, Pau; Lorenzo-Betancor, Oswaldo; Infante, Jon; Sierra, María; Gómez-Garre, Pilar; Mir, Pablo; Ritz, Beate; Rhodes, Shannon L; Colcher, Amy; Van Deerlin, Vivianna; Chung, Kathryn A.; Quinn, Joseph F.; Yearout, Dora; Martinez, Erica; Farin, Federico M.; Wan, Jia Y.; Edwards, Karen L.; Zabetian, Cyrus P.

    2012-01-01

    Background Common variants in the LRRK2 gene influence risk of Parkinson’s disease (PD) in Asians, but whether the same is true in European-derived populations is less clear. Methods We genotyped 66 LRRK2 tagging single nucleotide polymorphisms (SNPs) in 575 PD patients and 689 controls from the Northwestern U.S. (Tier 1). PD-associated SNPs (p<0.05) were then genotyped in an independent sample of 3617 cases and 2512 controls from the U.S. and Spain (Tier 2). Logistic regression was used to model additive SNP genotype effects adjusted for age and sex among white individuals. Results Two regions showed independent association with PD in Tier 1, and SNPs in both regions were successfully replicated in Tier 2 (rs10878226, combined odds ratio [OR], 1.20; 95% confidence interval [CI], 1.08-1.33; p=6.3×10−4; rs11176013, OR, 0.89; CI, 0.83-0.95; p=4.6×10−4). Conclusions Our data suggest that common variation within LRRK2 conveys susceptibility for PD in individuals of European ancestry. PMID:23115130

  16. Type II kinase inhibitors show an unexpected inhibition mode against Parkinson's disease-linked LRRK2 mutant G2019S.

    Science.gov (United States)

    Liu, Min; Bender, Samantha A; Cuny, Gregory D; Sherman, Woody; Glicksman, Marcie; Ray, Soumya S

    2013-03-12

    A number of well-known type II inhibitors (ATP-noncompetitive) that bind kinases in their DFG-out conformation were tested against wild-type LRRK2 and the most common Parkinson's disease-linked mutation, G2019S. We found that traditional type II inhibitors exhibit surprising variability in their inhibition mechanism between the wild type (WT) and the G2019S mutant of LRRK2. The type II kinase inhibitors were found to work in an ATP-competitive fashion against the G2019S mutant, whereas they appear to follow the expected noncompetitive mechanism against WT. Because the G2019S mutation lies in the DXG motif (DYG in LRRK2 but DFG in most other kinases) of the activation loop, we explored the structural consequence of the mutation on loop dynamics using an enhanced sampling method called metadynamics. The simulations suggest that the G2019S mutation stabilizes the DYG-in state of LRRK2 through a series of hydrogen bonds, leading to an increase in the conformational barrier between the active and inactive forms of the enzyme and a relative stabilization of the active form. The conformational bias toward the active form of LRRK2 mutants has two primary consequences. (1) The mutant enzyme becomes hyperactive, a known contributor to the Parkinsonian phenotype, as a consequence of being "locked" into the activated state, and (2) the mutation creates an unusual allosteric pocket that can bind type II inhibitors but in an ATP-competitive fashion. Our results suggest that developing type II inhibitors, which are generally considered superior to type I inhibitors because of desirable selectivity profiles, might be especially challenging for the G2019S LRRK2 mutant.

  17. Correlation between LRRK2 gene polymorphism sites S1647T and R1398H and Parkinson's disease in a Chinese Han population

    Institute of Scientific and Technical Information of China (English)

    Xueli Chang; Xueye Mao; Zijuan Zhang; Jinhong Zhang; Yuan Yang; Tao Li; Nannan Li; Jean-Marc Burgunder; Rong Peng

    2011-01-01

    A recent multicenter study demonstrated that two variants of LRRK2, S1647T and R1398H, are associated with sporadic Parkinson's disease.The present study analyzed LRRK2 gene polymorphisms of S1647T and R1398H, demonstrating that the LRRK2 gene polymorphism S1647T variant is a risk factor for Parkinson's disease in a Chinese Han population.However, the R1398H variant did not influence the risk for Parkinson's disease.In addition, there was no difference in clinical symptoms of Parkinson's disease patients with various genotypes.Results showed that the LRRK2 S1647T variant was associated with an increased risk for developing early-onset Parkinson's disease in a Chinese Han population.In addition, there was no correlation between LRRK2 S1647T, R1398H variants and G2385R, R1628P variants in Parkinson's disease patients.

  18. LRRK2的常见变异体与散发性帕金森病无关

    Institute of Scientific and Technical Information of China (English)

    Biskup; S.; Mueller; J.; C.; Sharma; M.

    2006-01-01

    富亮氨酸重复激酶(LRRK2)基因多发突变导致常染色体显性遗传性迟发帕金森病(PARK8)的发生,在不同人群中似乎常见Gly2019Ser突变。为了探讨这种新基因是否影响非孟德尔式遗传性散发帕金森病,选择来自德国的340例帕金森病患者和680例相匹配的正常对照者,对其LRRK2全基因区的121个单核苷酸多态性进行基因型分析,研究证实LRRK2与PARK8不相关。因此,尚无证据支持以下观点,即LRRK2的常见变异体显著影响帕金森病风险。

  19. Higher frequency of certain cancers in LRRK2 G2019S mutation carriers with Parkinson disease: a pooled analysis.

    Science.gov (United States)

    Agalliu, Ilir; San Luciano, Marta; Mirelman, Anat; Giladi, Nir; Waro, Bjorg; Aasly, Jan; Inzelberg, Rivka; Hassin-Baer, Sharon; Friedman, Eitan; Ruiz-Martinez, Javier; Marti-Masso, Jose Felix; Orr-Urtreger, Avi; Bressman, Susan; Saunders-Pullman, Rachel

    2015-01-01

    Patients with Parkinson disease (PD) who harbor LRRK2 G2019S mutations may have increased risks of nonskin cancers. However, the results have been inconsistent across studies. To analyze pooled data from 5 centers to further examine the association between LRRK2 G2019S mutation and cancer among patients with PD and to explore factors that could explain discrepancies. Clinical, demographic, and genotyping data as well as cancer outcomes were pooled from 1549 patients with PD recruited across 5 movement disorders clinics located in Europe, Israel, and the United States. Associations between LRRK2 G2019S mutation and the outcomes were examined using mixed-effects logistic regression models to estimate odds ratios (ORs) and 95% CIs. Models were adjusted for age and ethnicity (Ashkenazi Jewish vs others) as fixed effects and study center as a random effect. All cancers combined, nonskin cancers, smoking-related cancers, hormone-related cancers, and other types of cancer. The overall prevalence of the LRRK2 G2019S mutation was 11.4% among all patients with PD. Mutation carriers were younger at PD diagnosis and more likely to be women (53.1%) and of Ashkenazi Jewish descent (76.8%) in comparison with individuals who were not mutation carriers. The LRRK2 G2019S mutation carriers had statistically significant increased risks for nonskin cancers (OR, 1.62; 95% CI, 1.04-2.52), hormone-related cancers (OR, 1.87; 95% CI, 1.07-3.26) and breast cancer (OR, 2.34; 95% CI, 1.05-5.22) in comparison with noncarriers. There were no associations with other cancers. There were no major statistically significant differences in the results when the data were stratified by Ashkenazi Jewish ethnicity; however, there was some evidence of heterogeneity across centers. This multinational study from 5 centers demonstrates that LRRK2 G2019S mutation carriers have an overall increased risk of cancer, especially for hormone-related cancer and breast cancer in women. Larger prospective cohorts or

  20. Αlpha-synuclein levels in blood plasma from LRRK2 mutation carriers.

    Directory of Open Access Journals (Sweden)

    Ana Gorostidi

    Full Text Available The diagnosis of Parkinson's disease (PD remains primarily a clinical issue, based mainly on phenotypic patterns. The identification of biomarkers capable of permitting the preclinical detection of PD is critically needed. α-Synuclein is a key protein in PD, with missense and multiplication mutations in the gene encoding α-synuclein (SNCA having been reported in familial cases of PD, and accumulation of the protein identified in Lewy bodies (LBs and Lewy neurites (LNs in affected brain regions. With the objective of validating the use of α-synuclein as a clinical or progressive biomarker in an accessible tissue, we used an enzyme-linked immunosorbent assay (ELISA to measure α-synuclein levels in the peripheral blood plasma of idiopathic PD and LRRK2 mutation carrier patients and compared our findings with healthy control subjects. Compared to healthy controls, we found a significant decrease in plasma total α-synuclein levels in idiopathic PD (iPD patients (n = 134, p = 0.010. However, the reduction was less significant in patients who were LRRK2 mutation carriers (n = 32, p = 0.133. This lack of significance could be due to the small number of individuals employed in this group. No predictive value of total α-synuclein in the diagnosis of PD was found in a receiver operating characteristic (ROC curve analysis. Although this is a pilot study requiring corroboration on a larger cohort of patients, our results highlight the possible use of plasma α-synuclein as a biomarker for PD.

  1. No dopamine cell loss or changes in cytoskeleton function in transgenic mice expressing physiological levels of wild type or G2019S mutant LRRK2 and in human fibroblasts.

    Science.gov (United States)

    Garcia-Miralles, Marta; Coomaraswamy, Janaky; Häbig, Karina; Herzig, Martin C; Funk, Natalja; Gillardon, Frank; Maisel, Martina; Jucker, Mathias; Gasser, Thomas; Galter, Dagmar; Biskup, Saskia

    2015-01-01

    Mutations within the LRRK2 gene have been identified in Parkinson's disease (PD) patients and have been implicated in the dysfunction of several cellular pathways. Here, we explore how pathogenic mutations and the inhibition of LRRK2 kinase activity affect cytoskeleton dynamics in mouse and human cell systems. We generated and characterized a novel transgenic mouse model expressing physiological levels of human wild type and G2019S-mutant LRRK2. No neuronal loss or neurodegeneration was detected in midbrain dopamine neurons at the age of 12 months. Postnatal hippocampal neurons derived from transgenic mice showed no alterations in the seven parameters examined concerning neurite outgrowth sampled automatically on several hundred neurons using high content imaging. Treatment with the kinase inhibitor LRRK2-IN-1 resulted in no significant changes in the neurite outgrowth. In human fibroblasts we analyzed whether pathogenic LRRK2 mutations change cytoskeleton functions such as cell adhesion. To this end we compared the adhesion characteristics of human skin fibroblasts derived from six PD patients carrying one of three different pathogenic LRRK2 mutations and from four age-matched control individuals. The mutant LRRK2 variants as well as the inhibition of LRRK2 kinase activity did not reveal any significant cell adhesion differences in cultured fibroblasts. In summary, our results in both human and mouse cell systems suggest that neither the expression of wild type or mutant LRRK2, nor the inhibition of LRRK2 kinase activity affect neurite complexity and cellular adhesion.

  2. No dopamine cell loss or changes in cytoskeleton function in transgenic mice expressing physiological levels of wild type or G2019S mutant LRRK2 and in human fibroblasts.

    Directory of Open Access Journals (Sweden)

    Marta Garcia-Miralles

    Full Text Available Mutations within the LRRK2 gene have been identified in Parkinson's disease (PD patients and have been implicated in the dysfunction of several cellular pathways. Here, we explore how pathogenic mutations and the inhibition of LRRK2 kinase activity affect cytoskeleton dynamics in mouse and human cell systems. We generated and characterized a novel transgenic mouse model expressing physiological levels of human wild type and G2019S-mutant LRRK2. No neuronal loss or neurodegeneration was detected in midbrain dopamine neurons at the age of 12 months. Postnatal hippocampal neurons derived from transgenic mice showed no alterations in the seven parameters examined concerning neurite outgrowth sampled automatically on several hundred neurons using high content imaging. Treatment with the kinase inhibitor LRRK2-IN-1 resulted in no significant changes in the neurite outgrowth. In human fibroblasts we analyzed whether pathogenic LRRK2 mutations change cytoskeleton functions such as cell adhesion. To this end we compared the adhesion characteristics of human skin fibroblasts derived from six PD patients carrying one of three different pathogenic LRRK2 mutations and from four age-matched control individuals. The mutant LRRK2 variants as well as the inhibition of LRRK2 kinase activity did not reveal any significant cell adhesion differences in cultured fibroblasts. In summary, our results in both human and mouse cell systems suggest that neither the expression of wild type or mutant LRRK2, nor the inhibition of LRRK2 kinase activity affect neurite complexity and cellular adhesion.

  3. Changes to Intermediary Metabolites in Sporadic and LRRK2 Parkinson’s Disease Demonstrated by Proton Magnetic Resonance Spectroscopy

    Directory of Open Access Journals (Sweden)

    Jan O. Aasly

    2015-01-01

    Full Text Available Background. Parkinson’s disease (PD remains a clinical diagnosis and biomarkers are needed to detect the disease as early as possible. Genetically determined PD provides an opportunity for studying metabolic differences in connection with disease development. Objectives. To study the levels of intermediary metabolites in cerebrospinal fluid (CSF from patients with PD, either of sporadic type or in carriers of the LRRK2 p.G2019S mutation. Methods. Results from patients with sporadic PD or LRRK2-PD were compared with asymptomatic LRRK2 mutation carriers and healthy control individuals. CSF was analysed by proton MR spectroscopy (1H-MRS giving reliable results for 16 intermediary metabolites. Partial least squares discriminant analysis (PLS-DA was applied to study group differences. Results. PLS-DA distinguished PD patients from healthy individuals based on the metabolites identified in CSF, with 2-hydroxybutyrate, glutamine, and dimethyl sulphone largely contributing to the separations. Conclusion. Speculatively, all three metabolites could alter concentration in response to metabolic changes connected with neurodegeneration; glutamine as a means of removing excess nitrogen from brain, dimethyl sulphone as an anti-inflammatory agent, and 2-hydroxybutyrate in connection with altered glutathione metabolism. Potentially, 1H-MRS is a promising tool for identifying novel biomarkers for PD.

  4. LRRK2 and RIPK2 variants in the NOD 2-mediated signaling pathway are associated with susceptibility to Mycobacterium leprae in Indian populations.

    Directory of Open Access Journals (Sweden)

    Patrick Marcinek

    Full Text Available In recent years, genome wide association studies have discovered a large number of gene loci that play a functional role in innate and adaptive immune pathways associated with leprosy susceptibility. The immunological control of intracellular bacteria M. leprae is modulated by NOD2-mediated signaling of Th1 responses. In this study, we investigated 211 clinically classified leprosy patients and 230 ethnically matched controls in Indian population by genotyping four variants in NOD2 (rs9302752A/G, LRRK2 (rs1873613A/G, RIPK2 (rs40457A/G and rs42490G/A. The LRRK2 locus is associated with leprosy outcome. The LRRK2 rs1873613A minor allele and respective rs1873613AA genotypes were significantly associated with an increased risk whereas the LRRK2 rs1873613G major allele and rs1873613GG genotypes confer protection in paucibacillary and leprosy patients. The reconstructed GA haplotypes from RIPK2 rs40457A/G and rs42490G/A variants was observed to contribute towards increased risk whereas haplotypes AA was observed to confer protective role. Our results indicate that a possible shared mechanisms underlying the development of these two clinical forms of the disease as hypothesized. Our findings confirm and validates the role of gene variants involved in NOD2-mediated signalling pathways that play a role in immunological control of intracellular bacteria M. leprae.

  5. Dopaminergic neurons differentiating from LRRK2 G2019S induced pluripotent stem cells show early neuritic branching defects.

    Science.gov (United States)

    Borgs, Laurence; Peyre, Elise; Alix, Philippe; Hanon, Kevin; Grobarczyk, Benjamin; Godin, Juliette D; Purnelle, Audrey; Krusy, Nathalie; Maquet, Pierre; Lefebvre, Philippe; Seutin, Vincent; Malgrange, Brigitte; Nguyen, Laurent

    2016-09-19

    Some mutations of the LRRK2 gene underlie autosomal dominant form of Parkinson's disease (PD). The G2019S is a common mutation that accounts for about 2% of PD cases. To understand the pathophysiology of this mutation and its possible developmental implications, we developed an in vitro assay to model PD with human induced pluripotent stem cells (hiPSCs) reprogrammed from skin fibroblasts of PD patients suffering from the LRKK2 G2019S mutation. We differentiated the hiPSCs into neural stem cells (NSCs) and further into dopaminergic neurons. Here we show that NSCs bearing the mutation tend to differentiate less efficiently into dopaminergic neurons and that the latter exhibit significant branching defects as compared to their controls.

  6. Derivation, Characterization, and Neural Differentiation of Integration-Free Induced Pluripotent Stem Cell Lines from Parkinson's Disease Patients Carrying SNCA, LRRK2, PARK2, and GBA Mutations

    DEFF Research Database (Denmark)

    Momcilovic, Olga; Sivapatham, Renuka; Oron, Tal Ronnen

    2016-01-01

    We report generation of induced pluripotent stem cell (iPSC) lines from ten Parkinson's disease (PD) patients carrying SNCA, PARK2, LRRK2, and GBA mutations, and one age-matched control. After validation of pluripotency, long-term genome stability, and integration-free reprogramming, eight...... of these lines (one of each SNCA, LRRK2 and GBA, four PARK2 lines, and the control) were differentiated into neural stem cells (NSC) and subsequently to dopaminergic cultures. We did not observe significant differences in the timeline of neural induction and NSC derivation between the patient and control line...... to identify alterations by large-scale evaluation. While gene expression profiling clearly distinguished cells at different stages of differentiation, no mutation-specific clustering or difference was observed, though consistent changes in patient lines were detected in genes associated mitochondrial biology...

  7. Ashkenazi Parkinson's disease patients with the LRRK2 G2019S mutation share a common founder dating from the second to fifth centuries.

    Science.gov (United States)

    Bar-Shira, Anat; Hutter, Carolyn M; Giladi, Nir; Zabetian, Cyrus P; Orr-Urtreger, Avi

    2009-10-01

    The LRRK2 G2019S mutation is a major genetic determinant of Parkinson's disease (PD) across the world that occurs at an elevated frequency in Ashkenazi Jews. We determined the LRRK2 haplotypes in 77 G2019S carriers, mostly Ashkenazi Jews, and in 50 noncarrier Ashkenazi PD patients, using 16 genetic markers. A single haplotype was detected in all mutation carriers, indicating that these individuals share a common founder. Using a maximum-likelihood method, we estimate that Ashkenazi Jews with G2019S share a common ancestor who lived approximately 1,830 (95% CI 1,560-2,160) years ago, around the second century, after the second Jewish Diaspora.

  8. Study of Parkin, LRRK2 gene secuence in PD patients%早发性帕金森病患者中Parkin, LRRK2基因序列变异研究

    Institute of Scientific and Technical Information of China (English)

    余元勋; 鲍远程; 汪鸿浩; 吴鹏; 蒋怀周

    2007-01-01

    目的 观察散发性早发帕金森病(Parkinsons disease, PD)患者遗传易感基因突变的形式和分布,探讨易感基因突变在PD发病中的可能作用.方法 病例组由13例散发性早发帕金森患者组成.以基因组DNA为模板,扩增Parkin基因的第1、4、6号外显子和LRRK2基因的第31号外显子.观察PCR产物测序后的突变情况.结果 发现样本中存在突变,在正常人中存在单核苷酸多态性(single nucleotide polymorphism,SNP).结论 Parkin基因外显子的突变是我国散发性早发PD患者的致病原因之一.

  9. Identification of candidate genes for Parkinson's disease through blood transcriptome analysis in LRRK2-G2019S carriers, idiopathic cases, and controls.

    Science.gov (United States)

    Infante, Jon; Prieto, Carlos; Sierra, María; Sánchez-Juan, Pascual; González-Aramburu, Isabel; Sánchez-Quintana, Coro; Berciano, José; Combarros, Onofre; Sainz, Jesús

    2015-02-01

    The commonest known cause of Parkinson's disease (PD) is the G2019S mutation of the LRRK2 gene, but this mutation is not sufficient for causing PD, and many carriers of the mutation never develop PD symptoms during life. Differences at the expression level of certain genes, resulting from either genetic variations or environmental interactions, might be one of the mechanisms underlying differential risks for developing both idiopathic and genetic PD. To identify the genes involved in PD pathogenesis, we compared genome-wide gene expression (RNA-seq) in peripheral blood of 20 PD patients carrying the G2019S mutation of the LRRK2 gene, 20 asymptomatic carriers of the mutation, 20 subjects with idiopathic PD, 20 controls and 7 PD patients before and after initiating dopaminergic therapy. We identified 13 common genes (ADARB2, CEACAM6, CNTNAP2, COL19A1, DEF4, DRAXIN, FCER2, HBG1, NCAPG2, PVRL2, SLC2A14, SNCA, and TCL1B) showing significant differential expression between G2019S-associated PD and asymptomatic carriers and also between idiopathic PD and controls but not between untreated and treated patients. Some of these genes are functionally involved in the processes known to be involved in PD pathogenesis, such as Akt signaling, glucose metabolism, or immunity. We consider that these genes merit further attention in future studies as potential candidate genes involved in both idiopathic and LRRK2-G2019S-associated forms of PD.

  10. Study on the Parkin and LRRK 2 Sequence Variation in Parkinson's Disease%帕金森病Parkin,LRRK 2基因序列变异研究

    Institute of Scientific and Technical Information of China (English)

    鲍远程; 余元勋; 汪鸿浩; 吴鹏; 蒋怀周

    2008-01-01

    目的 探讨散发性早发性帕金森病患者遗传易感基因突变的形式和分布及易感基因突变在PD发病中的可能作用.方法 病例组由23例散发性早发帕金森患者组成,10例对照组.以基因组DNA为模板,扩增Parkin基因的第1、4、6号外显子和LRRK 2基因的第31号外显子.观察PCR产物测序后的突变情况.结果 发现样本中存在突变以及单核苷酸多态性(Single Nucleotide Polymorphism,SNP).在一例患者Parkin基因Exon6上发现735ntT→C,对应的密码子TGT212CGT,翻译的氨基酸C212R,国内罕有报道.另一例患者Parkin基因Exon6上发现突变833ntG→C,导致第244密码子同义突变.结论 Parkin基因外显子4、6的突变可能是我国散发性早发PD患者的致病原因之一.

  11. Revisiting the Roco G-protein cycle

    NARCIS (Netherlands)

    Terheyden, Susanne; Ho, Franz Y.; Gilsbach, Bernd K.; Wittinghofer, Alfred; Kortholt, Arjan

    2015-01-01

    Mutations in leucine-rich-repeat kinase 2 (LRRK2) are the most frequent cause of late-onset Parkinson's disease (PD). LRRK2 belongs to the Roco family of proteins which share a conserved Ras-like G-domain (Roc) and a C-terminal of Roc (COR) domain tandem. The nucleotide state of small G-proteins is

  12. Mutations in the gene LRRK2 encoding dardarin (PARK8) cause familial Parkinson's disease: clinical, pathological, olfactory and functional imaging and genetic data.

    Science.gov (United States)

    Khan, Naheed L; Jain, Shushant; Lynch, John M; Pavese, Nicola; Abou-Sleiman, Patrick; Holton, Janice L; Healy, Daniel G; Gilks, William P; Sweeney, Mary G; Ganguly, Milan; Gibbons, Vaneesha; Gandhi, Sonia; Vaughan, Jenny; Eunson, Louise H; Katzenschlager, Regina; Gayton, Juliet; Lennox, Graham; Revesz, Tamas; Nicholl, David; Bhatia, Kailash P; Quinn, Niall; Brooks, David; Lees, Andrew J; Davis, Mary B; Piccini, Paola; Singleton, Andrew B; Wood, Nicholas W

    2005-12-01

    We have established that the frequency of LRRK2 mutations in a series of 118 cases of familial Parkinson's disease is 5.1%. In the largest family with autosomal dominant, late-onset Parkinson's disease where affected subjects share a Y1699C missense mutation we provide a detailed clinical, pathological and imaging report. The phenotype in this large British kindred included asymmetrical, levodopa-responsive parkinsonism where unilateral leg tremor at onset and foot dystonia were prominent features. There was no significant abnormality of cognition but there was prominent behavioural disorder. We observed a lower age of onset in successive generations. Histopathology in one patient showed substantia nigra cell loss and Lewy body formation, with small numbers of cortical Lewy bodies. 18F-dopa positron emission tomography (PET) in another patient showed a pattern of nigrostriatal dysfunction typical of idiopathic Parkinson's disease. 18F-dopa-PET scans in unaffected family members prior to identifying the disease locus did not detect subclinical nigrostriatal dysfunction. Olfaction was assessed in affected subjects and Lewy bodies were identified in the olfactory bulb as well as cortex and brainstem of one deceased patient. In order to assess the role of mutations in this gene in other familial cases we undertook a mutation screen of all 51 exons of LRRK2 in 117 other smaller British kindreds with familial Parkinson's disease. The commonest mutation was G2019S and we also identified two novel mutations, R1941H and T2356I, in the coding sequence. These data suggest that parkinsonism caused by mutations in LRRK2 is likely to represent the commonest locus for autosomal dominant Parkinson's disease with a phenotype, pathology and in vivo imaging similar to idiopathic, late-onset Parkinson's disease.

  13. LRRK2 but not ATG16L1 is associated with Paneth cell defect in Japanese Crohn’s disease patients

    Science.gov (United States)

    Liu, Ta-Chiang; Naito, Takeo; VanDussen, Kelli L.; Li, Dalin; Endo, Katsuya; Kawai, Yosuke; Nagasaki, Masao; Kinouchi, Yoshitaka; McGovern, Dermot P.B.; Shimosegawa, Tooru; Stappenbeck, Thaddeus S.

    2017-01-01

    BACKGROUND. Morphological patterns of Paneth cells are a prognostic biomarker in Western Crohn’s disease (CD) patients, and are associated with autophagy-associated ATG16L1 and NOD2 variants. We hypothesized that genetic determinants of Paneth cell phenotype in other ethnic CD cohorts are distinct but also involved in autophagy. METHODS. We performed a hypothesis-driven analysis of 56 single nucleotide polymorphisms (SNPs) associated with CD susceptibility or known to affect Paneth cell function in 110 Japanese CD patients who underwent ileal resection. We subsequently performed a genome-wide association analysis. Paneth cell phenotype was determined by defensin-5 immunofluorescence. Selected genotype–Paneth cell defect correlations were compared to a Western CD cohort (n = 164). RESULTS. The average percentage of abnormal Paneth cells in Japanese CD was similar to Western CD (P = 0.87), and abnormal Paneth cell phenotype was also associated with early recurrence (P = 0.013). In contrast to Western CD, ATG16L1 T300A was not associated with Paneth cell defect in Japanese CD (P = 0.20). Among the 56 selected SNPs, only LRRK2 M2397T showed significant association with Paneth cell defect (P = 3.62 × 10–4), whereas in the Western CD cohort it was not (P = 0.76). Pathway analysis of LRRK2 and other candidate genes with P less than 5 × 10–4 showed connections with known CD susceptibility genes and links to autophagy and TNF-α networks. CONCLUSIONS. We found dichotomous effects of ATG16L1 and LRRK2 on Paneth cell defect between Japanese and Western CD. Genes affecting Paneth cell phenotype in Japanese CD were also associated with autophagy. Paneth cell phenotype also predicted prognosis in Japanese CD. FUNDING. Helmsley Charitable Trust, Doris Duke Foundation (grant 2014103), Japan Society for the Promotion of Science (KAKENHI grants JP15H04805 and JP15K15284), Crohn’s and Colitis Foundation grant 274415, NIH (grants 1R56DK095820, K01DK109081, and UL1 TR000448

  14. LRRK2 G2385R and R1628P Mutations Are Associated with an Increased Risk of Parkinson’s Disease in the Malaysian Population

    Directory of Open Access Journals (Sweden)

    Aroma Agape Gopalai

    2014-01-01

    Full Text Available The LRRK2 gene has been associated with both familial and sporadic forms of Parkinson’s disease (PD. The G2019S variant is commonly found in North African Arab and Caucasian PD patients, but this locus is monomorphic in Asians. The G2385R and R1628P variants are associated with a higher risk of developing PD in certain Asian populations but have not been studied in the Malaysian population. Therefore, we screened the G2385R and R1628P variants in 1,202 Malaysian subjects consisting of 695 cases and 507 controls. The G2385R and R1628P variants were associated with a 2.2-fold (P=0.019 and 1.2-fold (P=0.054 increased risk of PD, respectively. Our data concur with other reported findings in Chinese, Taiwanese, Singaporean, and Korean studies.

  15. Derivation, Characterization, and Neural Differentiation of Integration-Free Induced Pluripotent Stem Cell Lines from Parkinson's Disease Patients Carrying SNCA, LRRK2, PARK2, and GBA Mutations.

    Science.gov (United States)

    Momcilovic, Olga; Sivapatham, Renuka; Oron, Tal Ronnen; Meyer, Morten; Mooney, Sean; Rao, Mahendra S; Zeng, Xianmin

    2016-01-01

    We report generation of induced pluripotent stem cell (iPSC) lines from ten Parkinson's disease (PD) patients carrying SNCA, PARK2, LRRK2, and GBA mutations, and one age-matched control. After validation of pluripotency, long-term genome stability, and integration-free reprogramming, eight of these lines (one of each SNCA, LRRK2 and GBA, four PARK2 lines, and the control) were differentiated into neural stem cells (NSC) and subsequently to dopaminergic cultures. We did not observe significant differences in the timeline of neural induction and NSC derivation between the patient and control line, nor amongst the patient lines, although we report considerable variability in the efficiency of dopaminergic differentiation among patient lines. We performed whole genome expression analyses of the lines at each stage of differentiation (fibroblast, iPSC, NSC, and dopaminergic culture) in an attempt to identify alterations by large-scale evaluation. While gene expression profiling clearly distinguished cells at different stages of differentiation, no mutation-specific clustering or difference was observed, though consistent changes in patient lines were detected in genes associated mitochondrial biology. We further examined gene expression in a stress model (MPTP-induced dopaminergic neuronal death) using two clones from the SNCA triplication line, and detected changes in genes associated with mitophagy. Our data suggested that even a well-characterized line of a monogenic disease may not be sufficient to determine the cause or mechanism of the disease, and highlights the need to use more focused strategies for large-scale data analysis.

  16. Metabolic labeling of leucine rich repeat kinases 1 and 2 with radioactive phosphate.

    Science.gov (United States)

    Taymans, Jean-Marc; Gao, Fangye; Baekelandt, Veerle

    2013-09-18

    Leucine rich repeat kinases 1 and 2 (LRRK1 and LRRK2) are paralogs which share a similar domain organization, including a serine-threonine kinase domain, a Ras of complex proteins domain (ROC), a C-terminal of ROC domain (COR), and leucine-rich and ankyrin-like repeats at the N-terminus. The precise cellular roles of LRRK1 and LRRK2 have yet to be elucidated, however LRRK1 has been implicated in tyrosine kinase receptor signaling, while LRRK2 is implicated in the pathogenesis of Parkinson's disease. In this report, we present a protocol to label the LRRK1 and LRRK2 proteins in cells with (32)P orthophosphate, thereby providing a means to measure the overall phosphorylation levels of these 2 proteins in cells. In brief, affinity tagged LRRK proteins are expressed in HEK293T cells which are exposed to medium containing (32)P-orthophosphate. The (32)P-orthophosphate is assimilated by the cells after only a few hours of incubation and all molecules in the cell containing phosphates are thereby radioactively labeled. Via the affinity tag (3xflag) the LRRK proteins are isolated from other cellular components by immunoprecipitation. Immunoprecipitates are then separated via SDS-PAGE, blotted to PVDF membranes and analysis of the incorporated phosphates is performed by autoradiography ((32)P signal) and western detection (protein signal) of the proteins on the blots. The protocol can readily be adapted to monitor phosphorylation of any other protein that can be expressed in cells and isolated by immunoprecipitation.

  17. Unaltered striatal dopamine release levels in young Parkin knockout, Pink1 knockout, DJ-1 knockout and LRRK2 R1441G transgenic mice.

    Directory of Open Access Journals (Sweden)

    Gonzalo Sanchez

    Full Text Available Parkinson's disease (PD is one of the most prevalent neurodegenerative brain diseases; it is accompanied by extensive loss of dopamine (DA neurons of the substantia nigra that project to the putamen, leading to impaired motor functions. Several genes have been associated with hereditary forms of the disease and transgenic mice have been developed by a number of groups to produce animal models of PD and to explore the basic functions of these genes. Surprisingly, most of the various mouse lines generated such as Parkin KO, Pink1 KO, DJ-1 KO and LRRK2 transgenic have been reported to lack degeneration of nigral DA neuron, one of the hallmarks of PD. However, modest impairments of motor behavior have been reported, suggesting the possibility that the models recapitulate at least some of the early stages of PD, including early dysfunction of DA axon terminals. To further evaluate this possibility, here we provide for the first time a systematic comparison of DA release in four different mouse lines, examined at a young age range, prior to potential age-dependent compensations. Using fast scan cyclic voltammetry in striatal sections prepared from young, 6-8 weeks old mice, we examined sub-second DA overflow evoked by single pulses and action potential trains. Unexpectedly, none of the models displayed any dysfunction of DA overflow or reuptake. These results, compatible with the lack of DA neuron loss in these models, suggest that molecular dysfunctions caused by the absence or mutation of these individual genes are not sufficient to perturb the function and survival of mouse DA neurons.

  18. Casein kinase-2 structure-function relationship

    DEFF Research Database (Denmark)

    Boldyreff, B; Meggio, F; Pinna, L A

    1992-01-01

    Nine mutants of human casein kinase-2 beta subunit have been created and assayed for their ability to assemble with the catalytic alpha subunit to give, at a 1:1 molar ratio, a fully competent CK-2 holoenzyme as judged by the following criteria: 1) the generation of an active heterotetrameric form...... of CK-2 exhibiting the expected sedimentation coefficient and 2) the enhancement of catalytic activity of CK-2 alpha. Extended deletions of 71 and 44 residues from the C-terminal end, but not a 7 residue deletion (including the cdc2 phosphorylation site) prevent both reconstitution of the holoenzyme and......-70 sequence give rise to mutants that still assemble with the alpha subunit to give a tetrameric holoenzyme. However, in the case of the mutants A57,59, A63,64, A59-61,63,64 in vitro assembly with the CK-2 alpha subunit was not complete. There were also intermediate complexes, free alpha-subunit and beta...

  19. Low-variance RNAs identify Parkinson's disease molecular signature in blood.

    Science.gov (United States)

    Chikina, Maria D; Gerald, Christophe P; Li, Xianting; Ge, Yongchao; Pincas, Hanna; Nair, Venugopalan D; Wong, Aaron K; Krishnan, Arjun; Troyanskaya, Olga G; Raymond, Deborah; Saunders-Pullman, Rachel; Bressman, Susan B; Yue, Zhenyu; Sealfon, Stuart C

    2015-05-01

    The diagnosis of Parkinson's disease (PD) is usually not established until advanced neurodegeneration leads to clinically detectable symptoms. Previous blood PD transcriptome studies show low concordance, possibly resulting from the use of microarray technology, which has high measurement variation. The Leucine-rich repeat kinase 2 (LRRK2) G2019S mutation predisposes to PD. Using preclinical and clinical studies, we sought to develop a novel statistically motivated transcriptomic-based approach to identify a molecular signature in the blood of Ashkenazi Jewish PD patients, including LRRK2 mutation carriers. Using a digital gene expression platform to quantify 175 messenger RNA (mRNA) markers with low coefficients of variation (CV), we first compared whole-blood transcript levels in mouse models (1) overexpressing wild-type (WT) LRRK2, (2) overexpressing G2019S LRRK2, (3) lacking LRRK2 (knockout), and (4) and in WT controls. We then studied an Ashkenazi Jewish cohort of 34 symptomatic PD patients (both WT LRRK2 and G2019S LRRK2) and 32 asymptomatic controls. The expression profiles distinguished the four mouse groups with different genetic background. In patients, we detected significant differences in blood transcript levels both between individuals differing in LRRK2 genotype and between PD patients and controls. Discriminatory PD markers included genes associated with innate and adaptive immunity and inflammatory disease. Notably, gene expression patterns in levodopa-treated PD patients were significantly closer to those of healthy controls in a dose-dependent manner. We identify whole-blood mRNA signatures correlating with LRRK2 genotype and with PD disease state. This approach may provide insight into pathogenesis and a route to early disease detection.

  20. Expression of casein kinase 2 during mouse embryogenesis

    DEFF Research Database (Denmark)

    Mestres, P; Boldyreff, B; Ebensperger, C;

    1994-01-01

    This paper deals with the expression and distribution of casein kinase 2 (CK-2) subunits in mouse embryos at different developmental stages. Expression was investigated at the mRNA level of CK-2 alpha- and beta-subunits by in situ hybridization and distribution at the protein level by immunohisto......This paper deals with the expression and distribution of casein kinase 2 (CK-2) subunits in mouse embryos at different developmental stages. Expression was investigated at the mRNA level of CK-2 alpha- and beta-subunits by in situ hybridization and distribution at the protein level...

  1. Janus Kinase 2: An Epigenetic 'Writer' that Activates Leukemogenic Genes

    Institute of Scientific and Technical Information of China (English)

    Jin He; Yi Zhang

    2010-01-01

    @@ Activation of Janus kinase 2 (JAK2) plays a critical role in normal hematopoiesis and leukemogenesis. Dawson et al. (2009; JAK2 phosphorylates histone H3Y41 and excludes Hplalpha from chromatin. Nature 461, 819-822) report that JAK2 performs this function by displacing the heterochromatin protein HP1α from chromatin through phosphorylation of histone H3.

  2. Mayaro virus infection cycle relies on casein kinase 2 activity.

    Science.gov (United States)

    Barroso, Madalena M S; Lima, Carla S; Silva-Neto, Mário A C; Da Poian, Andrea T

    2002-09-06

    Replication of Mayaro virus in Vero cells induces dramatic cytopathic effects and cell death. In this study, we have evaluated the role of casein kinase 2 (CK2) during Mayaro virus infection cycle. We found that CK2 was activated during the initial stages of infection ( approximately 36% after 4h). This activation was further confirmed when the enzyme was partially purified from the cellular lysate either by Mono Q 5/5Hr column or heparin-agarose column. Using this later column, we found that the elution profile of CK2 activity from infected cells was different from that obtained for control cell enzyme, suggesting a structural modification of CK2 after infection. Treatment of infected cells with a cell-permeable inhibitor of CK2, dichloro-1-(beta-D-ribofuranosyl)benzimidazole (DRB), abolished the cytopathic effect in a dose-dependent manner. Together this set of data demonstrates for the first time that CK2 activity in host cells is required in Mayaro virus infection cycle.

  3. 编码dardarin(PARK8)的LRRK2基因突变所致家族性帕金森病:临床、病理、嗅觉及功能成像和遗传资料

    Institute of Scientific and Technical Information of China (English)

    Khan; N.; L.; Jain; S.; Lynch; J.; M.

    2006-01-01

    在118例家族性帕金森病患者的系列研究中,已经确定LRRK2基因突变的发生率为5.1%。在1个最大的常染色体显性遗传性迟发帕金森病家族中,其中的受累者具有相同的Y1699C错义突变,本文对该病的临床、病理和影像研究进行了详细报道。本研究中英国大家族的表型包括不对称的左旋多巴反应性帕金森综合征,发病时单侧小腿震颤及足部肌张力障碍为其突出特征,患者的认知功能无显著障碍,但有明显的行为异常。在连续几代受试者中观察到患者的发病年龄较低。1例患者的组织病理检查显示黑质细胞丢失及Lewy体形成,并有少量皮质Lewy体。另1例患者的“F一多巴正电子发射断层扫描(PET)显示为原发性帕金森病的典型黑质纹状体功能障碍模式。在确定病变部位之前对未受累家族成员进行18F-多巴PET扫描,未检测出亚临床黑质纹状体功能障碍。对受累患者进行嗅觉评估,对1例死亡患者的嗅球、皮质和脑干的Lewy体进行检查。为了评估LRRK2基因突变在其他家族患者中的作用,在117个其他较小的家族性帕金森病英国家族中对所有LRRK2的51个外显子进行突变筛查,在编码序列中最常见的基因突变是G2019S,另外还识别出2个新的基因突变(R1941H和T2356I)。上述资料提示,由LRRK2基因突变所致帕金森综合征可能代表着常染色体显性遗传性帕金森病的最常见位点,该病的表型、病理及体内成像特征与先天迟发性帕金森病相同。

  4. Genetic, Structural, and Molecular Insights into the Function of Ras of Complex Proteins Domains

    OpenAIRE

    Civiero, Laura; Dihanich, Sybille; Lewis, Patrick A.; Greggio, Elisa

    2014-01-01

    Ras of complex proteins (ROC) domains were identified in 2003 as GTP binding modules in large multidomain proteins from Dictyostelium discoideum. Research into the function of these domains exploded with their identification in a number of proteins linked to human disease, including leucine-rich repeat kinase 2 (LRRK2) and death-associated protein kinase 1 (DAPK1) in Parkinson’s disease and cancer, respectively. This surge in research has resulted in a growing body of data revealing the role ...

  5. Huntington CAG repeat size does not modify onset age in familial Parkinson’s disease: The GenePD Study

    Science.gov (United States)

    McNicoll, Christopher F.; Latourelle, Jeanne C.; MacDonald, Marcy E.; Lew, Mark F.; Suchowersky, Oksana; Klein, Christine; Golbe, Lawrence I.; Mark, Margery H.; Growdon, John H.; Wooten, G. Frederick; Watts, Ray L.; Guttman, Mark; Racette, Brad A.; Perlmutter, Joel S.; Ahmed, Anwar; Shill, Holly A.; Singer, Carlos; Saint-Hilaire, Marie H.; Massood, Tiffany; Huskey, Karen W.; DeStefano, Anita L.; Gillis, Tammy; Mysore, Jayalakshmi; Goldwurm, Stefano; Pezzoli, Gianni; Baker, Kenneth B.; Itin, Ilia; Litvan, Irene; Nicholson, Garth; Corbett, Alastair; Nance, Martha; Drasby, Edward; Isaacson, Stuart; Burn, David J.; Chinnery, Patrick F.; Pramstaller, Peter P.; Al-hinti, Jomana; Moller, Anette T.; Ostergaard, Karen; Sherman, Scott J.; Roxburgh, Richard; Snow, Barry; Slevin, John T.; Cambi, Franca; Gusella, James F.; Myers, Richard H.

    2009-01-01

    The ATP/ADP ratio reflects mitochondrial function and has been reported to be influenced by the size of the Huntington disease gene (HD) repeat. Impaired mitochondrial function has long been implicated in the pathogenesis of Parkinson’s disease (PD) and therefore, we evaluated the relationship of the HD CAG repeat size to PD onset age in a large sample of familial PD cases. PD affected siblings (n=495) with known onset ages from 248 families, were genotyped for the HD CAG repeat. Genotyping failed in 11 cases leaving 484 for analysis, including 35 LRRK2 carriers. All cases had HD CAG repeats (range 15 to 34) below the clinical range for HD, although 5.2 percent of the sample (n=25) had repeats in the intermediate range (the intermediate range lower limit=27; upper limit=35 repeats), suggesting that the prevalence of intermediate allele carriers in the general population is significant. No relation between the HD CAG repeat size and the age at onset for PD was found in this sample of familial PD. PMID:18649400

  6. Sphingosine kinase 2-deficiency mediated changes in spinal pain processing

    Directory of Open Access Journals (Sweden)

    Jastrow eCanlas

    2015-08-01

    Full Text Available Chronic pain is one of the most burdensome health issues facing the planet (as costly as diabetes and cancer combined, and in desperate need for new diagnostic targets leading to better therapies. The bioactive lipid sphingosine 1-phosphate (S1P and its receptors have recently been shown to modulate nociceptive signalling at the level of peripheral nociceptors and central neurons. However, the exact role of S1P generating enzymes, in particular sphingosine kinase 2 (Sphk2, in nociception remains unknown. We found that both sphingosine kinases, Sphk1 and Sphk2, were expressed in spinal cord with higher levels of Sphk2 mRNA compared to Sphk1. All three Sphk2 mRNA-isoforms were present with the Sphk2.1 mRNA showing the highest relative expression. Mice deficient in Sphk2 (Sphk2-/- showed in contrast to mice deficient in Sphk1 (Sphk1-/- substantially lower spinal S1P levels compared to wild-type C57BL/6 mice. In the formalin model of acute peripheral inflammatory pain, Sphk2-/- mice showed facilitation of nociceptive transmission during the late response, whereas responses to early acute pain, and the number of c-Fos immunoreactive dorsal horn neurons were not different between Sphk2-/- and wild-type mice. Chronic peripheral inflammation (CPI caused a bilateral increase in mechanical sensitivity in Sphk2-/- mice. Additionally, CPI increased the relative mRNA expression of P2X4 receptor, brain-derived neurotrophic factor and inducible nitric oxide synthase in the ipsilateral spinal cord of wild-type but not Sphk2-/- mice. Similarly, Sphk2-/- mice showed in contrast to wild-type no CPI-dependent increase in areas of the dorsal horn immunoreactive for the microglia marker Iba-1 and the astrocyte marker GFAP. Our results suggest that the tightly regulated cell signalling enzyme Sphk2 may be a key component for facilitation of nociceptive circuits in the CNS leading to central sensitization and pain memory formation.

  7. Helicobacter pylori induces cell migration and invasion through casein kinase 2 in gastric epithelial cells.

    Science.gov (United States)

    Lee, Yeo Song; Lee, Do Yeon; Yu, Da Yeon; Kim, Shin; Lee, Yong Chan

    2014-12-01

    Chronic infection with Helicobacter pylori (H. pylori) is causally linked with gastric carcinogenesis. Virulent H. pylori strains deliver bacterial CagA into gastric epithelial cells. Induction of high motility and an elongated phenotype is considered to be CagA-dependent process. Casein kinase 2 plays a critical role in carcinogenesis through signaling pathways related to the epithelial mesenchymal transition. This study was aimed to investigate the effect of H. pylori infection on the casein kinase 2-mediated migration and invasion in gastric epithelial cells. AGS or MKN28 cells as human gastric epithelial cells and H. pylori strains Hp60190 (ATCC 49503, CagA(+)) and Hp8822 (CagA(-)) were used. Cells were infected with H. pylori at multiplicity of infection of 100 : 1 for various times. We measured in vitro kinase assay to examine casein kinase 2 activity and performed immunofluorescent staining to observe E-cadherin complex. We also examined β-catenin transactivation through promoter assay and MMP7 expression by real-time PCR and ELISA. H. pylori upregulates casein kinase 2 activity and inhibition of casein kinase 2 in H. pylori-infected cells profoundly suppressed cell invasiveness and motility. We confirmed that casein kinase 2 mediates membranous α-catenin depletion through dissociation of the α-/β-catenin complex in H. pylori-infected cells. We also found that H. pylori induces β-catenin nuclear translocation and increases MMP7 expressions mediated through casein kinase 2. We show for the first time that CagA(+) H. pylori upregulates cellular invasiveness and motility through casein kinase 2. The demonstration of a mechanistic interplay between H. pylori and casein kinase 2 provides important insights into the role of CagA(+) H. pylori in the gastric cancer invasion and metastasis. © 2014 John Wiley & Sons Ltd.

  8. Ser2 is the autophosphorylation site in the beta subunit from bicistronically expressed human casein kinase-2 and from native rat liver casein kinase-2 beta

    DEFF Research Database (Denmark)

    Boldyreff, B; James, P; Staudenmann, W;

    1993-01-01

    Human casein kinase-2 (CK-2) subunits alpha and beta were bicistronically expressed in bacteria. The recombinant holoenzyme shared all investigated properties with the native CK-2 from mammalian sources (rat liver, Krebs II mouse ascites tumour cells). Contrary to recombinant human CK-2 produced...

  9. Cerebral pathological and compensatory mechanisms in the premotor phase of leucine-rich repeat kinase 2 parkinsonism

    NARCIS (Netherlands)

    Nuenen, B.F.L. van; Helmich, R.C.G.; Ferraye, M.; Thaler, A.; Hendler, T.; Orr-Urtreger, A.; Mirelman, A.; Bressman, S.; Marder, K.S.; Giladi, N.; Warrenburg, B.P.C. van de; Bloem, B.R.; Toni, I.

    2012-01-01

    Compensatory cerebral mechanisms can delay motor symptom onset in Parkinson's disease. We aim to characterize these compensatory mechanisms and early disease-related changes by quantifying movement-related cerebral function in subjects at significantly increased risk of developing Parkinson's diseas

  10. Assignment of casein kinase 2 alpha sequences to two different human chromosomes

    DEFF Research Database (Denmark)

    Boldyreff, B; Klett, C; Göttert, E

    1992-01-01

    Human casein kinase 2 alpha gene (CK-2-alpha) sequences have been localized within the human genome by in situ hybridization and somatic cell hybrid analysis using a CK-2 alpha cDNA as a probe. By in situ hybridization, the CK-2 alpha cDNA could be assigned to two different loci, one on 11p15.1-ter...

  11. Phosphorylation of nm23/nucleoside diphosphate kinase by casein kinase 2 in vitro

    DEFF Research Database (Denmark)

    Engel, M; Issinger, O G; Lascu, I;

    1994-01-01

    We have investigated phosphorylation of human nucleoside diphosphate kinase (NDPK) and of homologous NDPK from different species by human casein kinase 2 (CK-2). The human NDPK isotypes A and B were phosphorylated by CK-2 in vitro both when the purified proteins and total lysate of HL-60 leukemia...

  12. Cloning and sequencing of the casein kinase 2 alpha subunit from Zea mays

    DEFF Research Database (Denmark)

    Dobrowolska, G; Boldyreff, B; Issinger, O G

    1991-01-01

    The nucleotide sequence of the cDNA coding for the alpha subunit of casein kinase 2 of Zea mays has been determined. The cDNA clone contains an open reading frame of 996 nucleotides encoding a polypeptide comprising 332 amino acids. The primary amino acid sequence exhibits 75% identity to the alpha...

  13. G protein-coupled receptor kinase 2 positively regulates epithelial cell migration

    NARCIS (Netherlands)

    Penela, Petronila; Ribas, Catalina; Aymerich, Ivette; Eijkelkamp, Niels; Barreiro, Olga; Heijnen, Cobi J.; Kavelaars, Annemieke; Sanchez-Madrid, Francisco; Mayor, Federico

    2008-01-01

    Cell migration requires integration of signals arising from both the extracellular matrix and messengers acting through G protein-coupled receptors (GPCRs). We find that increased levels of G protein-coupled receptor kinase 2 (GRK2), a key player in GPCR regulation, poteniate migration of epithelial

  14. Checkpoint kinase 2-mediated phosphorylation of BRCA1 regulates the fidelity of nonhomologous end-joining

    NARCIS (Netherlands)

    J. Zhuang; J. Zhang (Shuzhong); H. Willers; H. Wang (Hong); J.H. Chung; D.C. van Gent (Dik); D.E. Hallahan; S.N. Powell; F. Xia

    2006-01-01

    textabstractThe tumor suppressor gene BRCA1 maintains genomic integrity by protecting cells from the deleterious effects of DNA double-strand breaks (DSBs). Through its interactions with the checkpoint kinase 2 (Chk2) kinase and Rad51, BRCA1 promotes homologous recombination, which

  15. Nuclear Targeting of Cyclin-Dependent Kinase 2 Reveals Essential Roles of Cyclin-Dependent Kinase 2 Localization and Cyclin E in Vitamin D-Mediated Growth Inhibition

    OpenAIRE

    Flores, Omar; Wang, Zhengying; Knudsen, Karen E; Burnstein, Kerry L.

    2010-01-01

    1,25-Dihydroxyvitamin D3 (1,25-(OH)2D3), inhibits proliferation of a variety of cell types including adenocarcinoma of the prostate. We have previously shown that 1,25-(OH)2D3 increases the stability of the cyclin-dependent kinase inhibitor p27KIP1, decreases cyclin-dependent kinase 2 (CDK2) activity, and promotes G1 phase accumulation in human prostate cancer cells. These effects correlate with cytoplasmic relocalization of CDK2. In this study, we investigated the role of CDK2 cytoplasmic re...

  16. Deployment Repeatability

    Science.gov (United States)

    2016-04-01

    controlled to great precision, but in a Cubesat , there may be no attitude determination at all. Such a Cubesat might treat sun angle and tumbling rates as...could be sensitive to small differences in motor controller timing. In these cases, the analyst might choose to model the entire deployment path, with...knowledge of the material damage model or motor controller timing precision. On the other hand, if many repeated and environmentally representative

  17. Inositol hexakisphosphate kinase-2 acts as an effector of the vertebrate Hedgehog pathway

    OpenAIRE

    Sarmah, Bhaskarjyoti; Wente, Susan R.

    2010-01-01

    Inositol phosphate (IP) kinases constitute an emerging class of cellular kinases linked to multiple cellular activities. Here, we report a previously uncharacterized cellular function in Hedgehog (Hh) signaling for the IP kinase designated inositol hexakisphosphate kinase-2 (IP6K2) that produces diphosphoryl inositol phosphates (PP-IPs). In zebrafish embryos, IP6K2 activity was required for normal development of craniofacial structures, somites, and neural crest cells. ip6k2 depletion in both...

  18. Extracellular-regulated kinase 2 is activated by the enhancement of hinge flexibility.

    OpenAIRE

    Sours, Kevin M.; Xiao,Yao; Ahn, Natalie G.

    2014-01-01

    Protein motions underlie conformational and entropic contributions to enzyme catalysis; however, relatively little is known about the ways in which this occurs. Studies of the mitogen-activated protein kinase ERK2 (extracellular-regulated protein kinase 2) by hydrogen-exchange mass spectrometry suggest that activation enhances backbone flexibility at the linker between N- and C-terminal domains while altering nucleotide binding mode. Here, we address the hypothesis that enhanced backbone flex...

  19. Damage-induced DNA replication stalling relies on MAPK-activated protein kinase 2 activity

    DEFF Research Database (Denmark)

    Köpper, Frederik; Bierwirth, Cathrin; Schön, Margarete

    2013-01-01

    DNA damage can obstruct replication forks, resulting in replicative stress. By siRNA screening, we identified kinases involved in the accumulation of phosphohistone 2AX (γH2AX) upon UV irradiation-induced replication stress. Surprisingly, the strongest reduction of phosphohistone 2AX followed...... replication impaired by gemcitabine or by Chk1 inhibition. This rescue strictly depended on translesion DNA polymerases. In conclusion, instead of being an unavoidable consequence of DNA damage, alterations of replication speed and origin firing depend on MK2-mediated signaling....... knockdown of the MAP kinase-activated protein kinase 2 (MK2), a kinase currently implicated in p38 stress signaling and G2 arrest. Depletion or inhibition of MK2 also protected cells from DNA damage-induced cell death, and mice deficient for MK2 displayed decreased apoptosis in the skin upon UV irradiation...

  20. Pyrrolopyridine inhibitors of mitogen-activated protein kinase-activated protein kinase 2 (MK-2).

    Science.gov (United States)

    Anderson, David R; Meyers, Marvin J; Vernier, William F; Mahoney, Matthew W; Kurumbail, Ravi G; Caspers, Nicole; Poda, Gennadiy I; Schindler, John F; Reitz, David B; Mourey, Robert J

    2007-05-31

    A new class of potent kinase inhibitors selective for mitogen-activated protein kinase-activated protein kinase 2 (MAPKAP-K2 or MK-2) for the treatment of rheumatoid arthritis has been prepared and evaluated. These inhibitors have IC50 values as low as 10 nM against the target and have good selectivity profiles against a number of kinases including CDK2, ERK, JNK, and p38. These MK-2 inhibitors have been shown to suppress TNFalpha production in U397 cells and to be efficacious in an acute inflammation model. The structure-activity relationships of this series, the selectivity for MK-2 and their activity in both in vitro and in vivo models are discussed. The observed selectivity is discussed with the aid of an MK-2/inhibitor crystal structure.

  1. Identifying allosteric fluctuation transitions between different protein conformational states as applied to Cyclin Dependent Kinase 2

    Directory of Open Access Journals (Sweden)

    Gu Jenny

    2007-02-01

    Full Text Available Abstract Background The mechanisms underlying protein function and associated conformational change are dominated by a series of local entropy fluctuations affecting the global structure yet are mediated by only a few key residues. Transitional Dynamic Analysis (TDA is a new method to detect these changes in local protein flexibility between different conformations arising from, for example, ligand binding. Additionally, Positional Impact Vertex for Entropy Transfer (PIVET uses TDA to identify important residue contact changes that have a large impact on global fluctuation. We demonstrate the utility of these methods for Cyclin-dependent kinase 2 (CDK2, a system with crystal structures of this protein in multiple functionally relevant conformations and experimental data revealing the importance of local fluctuation changes for protein function. Results TDA and PIVET successfully identified select residues that are responsible for conformation specific regional fluctuation in the activation cycle of Cyclin Dependent Kinase 2 (CDK2. The detected local changes in protein flexibility have been experimentally confirmed to be essential for the regulation and function of the kinase. The methodologies also highlighted possible errors in previous molecular dynamic simulations that need to be resolved in order to understand this key player in cell cycle regulation. Finally, the use of entropy compensation as a possible allosteric mechanism for protein function is reported for CDK2. Conclusion The methodologies embodied in TDA and PIVET provide a quick approach to identify local fluctuation change important for protein function and residue contacts that contributes to these changes. Further, these approaches can be used to check for possible errors in protein dynamic simulations and have the potential to facilitate a better understanding of the contribution of entropy to protein allostery and function.

  2. Diversity of Mitochondrial Pathology in a Mouse Model of Axonal Degeneration in Synucleinopathies

    Directory of Open Access Journals (Sweden)

    Akio Sekigawa

    2013-01-01

    Full Text Available There is mounting evidence for a role of mitochondrial dysfunction in the pathogenesis of α-synucleinopathies such as Parkinson's disease (PD and dementia with Lewy bodies (DLB. In particular, recent studies have demonstrated that failure of mitochondrial quality control caused by loss of function of the PTEN-induced kinase 1 (PINK1, PARK6 Parkin (PARK2 pathway may be causative in some familial PD. In sporadic PD, α-synuclein aggregation may interfere with mitochondrial function, and this might be further exacerbated by leucine-rich repeat kinase 2 (LRRK2. The majority of these findings have been obtained in Drosophila and cell cultures, whereas the objective of this paper is to discuss our recent results on the axonal pathology of brains derived from transgenic mice expressing α-synuclein or DLB-linked P123H β-synuclein. In line with the current view of the pathogenesis of sporadic PD, mitochondria abnormally accumulated in α-synuclein/LRRK2-immunopositive axonal swellings in mice expressing α-synuclein. Curiously, neither mitochondria nor LRRK2 was present in the swellings of mice expressing P123H β-synuclein, suggesting that α- and β-synuclein might play differential roles in the mitochondrial pathology of α-synucleinopathies.

  3. Role of the beta subunit of casein kinase-2 on the stability and specificity of the recombinant reconstituted holoenzyme

    DEFF Research Database (Denmark)

    Meggio, F; Boldyreff, B; Marin, O;

    1992-01-01

    Recombinant human alpha subunit from casein kinase-2 (CK-2) was subjected, either alone or in combination with recombinant human beta subunit, to high temperature, tryptic digestion and urea treatment. In all three cases, it was shown that the presence of the beta subunit could drastically reduce...

  4. Extracellular signal-regulated kinases control expression of G protein-coupled receptor kinase 2 (GRK2)

    DEFF Research Database (Denmark)

    Theilade, Juliane; Lerche Hansen, Jakob; Haunsø, Stig;

    2002-01-01

    G protein-coupled receptor kinase 2 (GRK2) phosphorylates G protein-coupled receptors resulting in uncoupling from G proteins. Receptors modulate GRK2 expression, however the mechanistic basis for this effect is largely unknown. Here we report a novel mechanism by which receptors use...

  5. Calcium calmodulin dependent kinase kinase 2 - a novel therapeutic target for gastric adenocarcinoma

    Science.gov (United States)

    Subbannayya, Yashwanth; Syed, Nazia; Barbhuiya, Mustafa A; Raja, Remya; Marimuthu, Arivusudar; Sahasrabuddhe, Nandini; Pinto, Sneha M; Manda, Srikanth Srinivas; Renuse, Santosh; Manju, HC; Zameer, Mohammed Abdul Lateef; Sharma, Jyoti; Brait, Mariana; Srikumar, Kotteazeth; Roa, Juan Carlos; Vijaya Kumar, M; Kumar, KV Veerendra; Prasad, TS Keshava; Ramaswamy, Girija; Kumar, Rekha Vijay; Pandey, Akhilesh; Gowda, Harsha; Chatterjee, Aditi

    2015-01-01

    Gastric cancer is one of the most common gastrointestinal malignancies and is associated with poor prognosis. Exploring alterations in the proteomic landscape of gastric cancer is likely to provide potential biomarkers for early detection and molecules for targeted therapeutic intervention. Using iTRAQ-based quantitative proteomic analysis, we identified 22 proteins that were overexpressed and 17 proteins that were downregulated in gastric tumor tissues as compared to the adjacent normal tissue. Calcium/calmodulin-dependent protein kinase kinase 2 (CAMKK2) was found to be 7-fold overexpressed in gastric tumor tissues. Immunohistochemical labeling of tumor tissue microarrays for validation of CAMKK2 overexpression revealed that it was indeed overexpressed in 94% (92 of 98) of gastric cancer cases. Silencing of CAMKK2 using siRNA significantly reduced cell proliferation, colony formation and invasion of gastric cancer cells. Our results demonstrate that CAMKK2 signals in gastric cancer through AMPK activation and suggest that CAMKK2 could be a novel therapeutic target in gastric cancer. PMID:25756516

  6. Casein Kinase 2 Reverses Tail-Independent Inactivation of Kinesin-1

    Science.gov (United States)

    Xu, Jing; Reddy, Babu J. N.; Anand, Preetha; Shu, Zhanyong; Cermelli, Silvia; Mattson, Michelle K.; Tripathy, Suvranta K.; Hoss, Matthew T.; James, Nikita S.; King, Stephen J.; Huang, Lan; Bardwell, Lee; Gross, Steven P.

    2013-01-01

    Kinesin-1 is a plus-end microtubule-based motor, and defects in kinesin-based transport are linked to diseases including neurodegeneration. Kinesin can auto-inhibit via a head-tail interaction, but is believed to be active otherwise. Here we report a tail-independent inactivation of kinesin, reversible by the disease-relevant signaling protein, casein kinase 2 (CK2). The majority of initially active kinesin (native or tail-less) loses its ability to interact with microtubules in vitro, and CK2 reverses this inactivation (~ 4-fold) without altering kinesin’s single motor properties. This activation pathway does not require motor phosphorylation, and is independent of head-tail auto-inhibition. In cultured mammalian cells, reducing CK2 expression, but not its kinase activity, decreases the force required to stall lipid droplet transport, consistent with a decreased number of active kinesin motors. Our results provide the first direct evidence of a protein kinase up-regulating kinesin-based transport, and suggest a novel pathway for regulating the activity of cargo-bound kinesin. PMID:22453827

  7. Regulation of Ikaros function by casein kinase 2 and protein phosphatase 1

    Institute of Scientific and Technical Information of China (English)

    Amy; K; Erbe; Aleksandar; Savic; Sinisa; Dovat

    2011-01-01

    The Ikaros gene encodes a zinc finger,DNA-binding protein that regulates gene transcription and chromatin remodeling.Ikaros is a master regulator of hematopoiesis and an established tumor suppressor.Moderate alteration of Ikaros activity (e.g.haploinsufficiency) appears to be sufficient to promote malignant transformation in human hematopoietic cells.This raises questions about the mechanisms that normally regulate Ikaros function and the potential of these mechanisms to contribute to the development of leukemia.The focus of this review is the regulation of Ikaros function by phosphorylation/dephosphorylation.Site-specific phosphorylation of Ikaros by casein kinase 2 (CK2) controls Ikaros DNA-binding ability and subcellular localization.As a consequence,the ability of Ikaros to regulate cell cycle progression,chromatin remodeling,target gene expression,and thymocyte differentiation are controlled by CK2.In addition,hyperphosphorylation of Ikaros by CK2 leads to decreased Ikaros levels due to ubiquitinmediated degradation.Dephosphorylation of Ikaros by protein phosphatase 1 (PP1) acts in opposition to CK2 to increase Ikaros stability and restore Ikaros DNA binding ability and pericentromeric localization.Thus,the CK2 and PP1 pathways act in concert to regulate Ikaros activity in hematopoiesis and as a tumor suppressor.This highlights the importance of these signal transduction pathways as potential mediators of leukemogenesis via their role in regulating the activities of Ikaros.

  8. G-protein-coupled receptor kinase 2 and endothelial dysfunction: molecular insights and pathophysiological mechanisms.

    Science.gov (United States)

    Taguchi, Kumiko; Matsumoto, Takayuki; Kobayashi, Tsuneo

    2015-01-01

    Smooth muscle cells (SMC) and endothelial cells are the major cell types in blood vessels. The principal function of vascular SMC in the body is to regulate blood flow and pressure through contraction and relaxation. The endothelium performs a crucial role in maintaining vascular integrity by achieving whole-organ metabolic homeostasis via the production of factors associated with vasoconstriction or vasorelaxation. In this review, we have focused on the production of nitric oxide (NO), a vasorelaxation factor. The extent of NO production represents a key marker in vascular health. A decrease in NO is capable of inducing pathological conditions associated with endothelial dysfunction, such as obesity, diabetes, cardiovascular disease, and atherosclerosis. Recent studies have strongly implicated the involvement of G-protein-coupled receptor kinase 2 (GRK2) in the progression of cardiovascular disease. Vasculature which is affected by insulin resistance and type 2 diabetes expresses high levels of GRK2, which may induce endothelial dysfunction by reducing intracellular NO. GRK2 activation also induces changes in the subcellular localization of GRK2 itself and also of β-arrestin 2, a downstream protein. In this review, we describe the pathophysiological mechanisms of insulin resistance and diabetes, focusing on the signal transduction for NO production via GRK2 and β-arrestin 2, providing novel insights into the potential field of translational investigation in the treatment of diabetic complications.

  9. Adenylate kinase 2 (AK2 promotes cell proliferation in insect development

    Directory of Open Access Journals (Sweden)

    Chen Ru-Ping

    2012-09-01

    Full Text Available Abstract Background Adenylate kinase 2 (AK2 is a phosphotransferase that catalyzes the reversible reaction 2ADP(GDP ↔ ATP(GTP + AMP and influences cellular energy homeostasis. However, the role of AK2 in regulating cell proliferation remains unclear because AK2 has been reported to be involved in either cell proliferation or cell apoptosis in different cell types of various organisms. Results This study reports AK2 promotion of cell proliferation using the lepidopteran insect Helicoverpa armigera and its epidermal cell line HaEpi as models. Western blot analysis indicates that AK2 constitutively expresses in various tissues during larval development. Immunocytochemistry analysis indicates that AK2 localizes in the mitochondria. The recombinant expressed AK2 in E. coli promotes cell growth and viability of HaEpi cell line by 3-(4, 5-Dimethylthiazol-2-yl-2, 5-diphenyltetrazolium bromide (MTT assay. AK2 knockdown in larvae by RNA interference causes larval growth defects, including body weight decrease and development delay. AK2 knockdown in larvae also decreases the number of circulating haemocytes. The mechanism for such effects might be the suppression of gene transcription involved in insect development caused by AK2 knockdown. Conclusion These results show that AK2 regulates cell growth, viability, and proliferation in insect growth and development.

  10. MAPKAP kinase 2 (MK2)-dependent and independent models of blister formation in pemphigus vulgaris

    Science.gov (United States)

    Mao, Xuming; Li, Hong; Sano, Yasuyo; Gaestel, Matthias; Park, Jin Mo; Payne, Aimee S.

    2013-01-01

    Pemphigus vulgaris (PV) is an autoimmune blistering disease characterized by autoantibodies to the keratinocyte adhesion protein desmoglein (Dsg) 3. Previous studies suggest that PV pathogenesis involves p38 mitogen activated protein kinase-dependent and -independent pathways. However, p38 is a difficult protein to study and therapeutically target because it has four isoforms and multiple downstream effectors. In the current study, we identify MAPKAP kinase 2 (MK2) as a downstream effector of p38 signaling in PV and describe MK2-dependent and -independent mechanisms of blister formation using passive transfer of human anti-Dsg IgG4 mAbs to neonatal mice. In human keratinocytes, PV mAbs activate MK2 in a dose-dependent manner. MK2 is also activated in human pemphigus skin blisters, causing translocation of MK2 from the nucleus to the cytosol. Small molecule inhibition of MK2 and silencing of MK2 expression block PV mAb-induced Dsg3 endocytosis in human keratinocytes. Additionally, small molecule inhibition and genetic deletion of p38α and MK2 inhibit spontaneous, but not induced, suprabasal blisters by PV mAbs in mouse passive transfer models. Collectively, these data suggest that MK2 is a key downstream effector of p38 that can modulate PV autoantibody pathogenicity. MK2 inhibition may be a valuable adjunctive therapy for control of pemphigus blistering. PMID:23657501

  11. Reconstitution of normal and hyperactivated forms of casein kinase-2 by variably mutated beta-subunits

    DEFF Research Database (Denmark)

    Boldyreff, B; Meggio, F; Pinna, L A

    1993-01-01

    an altered sedimentation coefficient. The holoenzymes reconstituted with substituted mutants beta A 55,57, beta A55-57, and, to a lesser extent, beta A 59-61, beta A63,64, and beta A5,6 display a basal activity which is higher (up to 4-fold) than that of the wild type holoenzyme.(ABSTRACT TRUNCATED AT 250......Twenty-one mutants of the noncatalytic beta-subunit of human casein kinase-2 have been created, expressed in Escherichia coli, and purified to homogeneity. They are either modified at the autophosphorylation site (mutants beta delta 1-4 and beta A 5,6) or bear variable deletions in their C......-terminal part (mutants beta delta 209-215, beta delta 194-215, beta delta 181-215, beta delta 171-215, beta delta 150-215) or have undergone Ala substitutions for the acidic and basic residues which are concentrated in the sequences 55-70 and 171-180, respectively. All these mutants have been examined...

  12. Regulation of Ceramide Synthase by Casein Kinase 2-dependent Phosphorylation in Saccharomyces cerevisiae*

    Science.gov (United States)

    Fresques, Tara; Niles, Brad; Aronova, Sofia; Mogri, Huzefa; Rakhshandehroo, Taha; Powers, Ted

    2015-01-01

    Complex sphingolipids are important components of eukaryotic cell membranes and, together with their biosynthetic precursors, including sphingoid long chain bases and ceramides, have important signaling functions crucial for cell growth and survival. Ceramides are produced at the endoplasmic reticulum (ER) membrane by a multicomponent enzyme complex termed ceramide synthase (CerS). In budding yeast, this complex is composed of two catalytic subunits, Lac1 and Lag1, as well as an essential regulatory subunit, Lip1. Proper formation of ceramides by CerS has been shown previously to require the Cka2 subunit of casein kinase 2 (CK2), a ubiquitous enzyme with multiple cellular functions, but the precise mechanism involved has remained unidentified. Here we present evidence that Lac1 and Lag1 are direct targets for CK2 and that phosphorylation at conserved positions within the C-terminal cytoplasmic domain of each protein is required for optimal CerS activity. Our data suggest that phosphorylation of Lac1 and Lag1 is important for proper localization and distribution of CerS within the ER membrane and that phosphorylation of these sites is functionally linked to the COP I-dependent C-terminal dilysine ER retrieval pathway. Together, our data identify CK2 as an important regulator of sphingolipid metabolism, and additionally, because both ceramides and CK2 have been implicated in the regulation of cancer, our findings may lead to an enhanced understanding of their relationship in health and disease. PMID:25429105

  13. Regulation of ceramide synthase by casein kinase 2-dependent phosphorylation in Saccharomyces cerevisiae.

    Science.gov (United States)

    Fresques, Tara; Niles, Brad; Aronova, Sofia; Mogri, Huzefa; Rakhshandehroo, Taha; Powers, Ted

    2015-01-16

    Complex sphingolipids are important components of eukaryotic cell membranes and, together with their biosynthetic precursors, including sphingoid long chain bases and ceramides, have important signaling functions crucial for cell growth and survival. Ceramides are produced at the endoplasmic reticulum (ER) membrane by a multicomponent enzyme complex termed ceramide synthase (CerS). In budding yeast, this complex is composed of two catalytic subunits, Lac1 and Lag1, as well as an essential regulatory subunit, Lip1. Proper formation of ceramides by CerS has been shown previously to require the Cka2 subunit of casein kinase 2 (CK2), a ubiquitous enzyme with multiple cellular functions, but the precise mechanism involved has remained unidentified. Here we present evidence that Lac1 and Lag1 are direct targets for CK2 and that phosphorylation at conserved positions within the C-terminal cytoplasmic domain of each protein is required for optimal CerS activity. Our data suggest that phosphorylation of Lac1 and Lag1 is important for proper localization and distribution of CerS within the ER membrane and that phosphorylation of these sites is functionally linked to the COP I-dependent C-terminal dilysine ER retrieval pathway. Together, our data identify CK2 as an important regulator of sphingolipid metabolism, and additionally, because both ceramides and CK2 have been implicated in the regulation of cancer, our findings may lead to an enhanced understanding of their relationship in health and disease.

  14. Modulation of Janus kinase 2 by p53 in ovarian cancer cells.

    Science.gov (United States)

    Reid, Thomas; Jin, Xiaohong; Song, Hui; Tang, Huai-Jing; Reynolds, R Kevin; Lin, Jiayuh

    2004-08-20

    The constitutive activation of the Janus kinase 2 (JAK2) and mutation of the p53 tumor suppressor are both detected in human cancer. We examined the potential regulation of JAK2 phosphorylation by wild-type (wt) p53 in human ovarian cancer cell lines, Caov-3 and MDAH2774, which harbor mutant form of p53 tumor suppressor gene and high levels of phosphorylated JAK2. The wt p53 gene was re-introduced into the cells using an adenovirus vector. In addition to wt p53, mutant p53 22/23, mutant p53-175, and NCV (negative control virus) were introduced into the cells in the control groups. Expression of wt p53, but not that of p53-175 mutant, diminished JAK2 tyrosine phosphorylation in MDAH2774 and Caov-3 cell lines. Expression of wt p53 or p53 22/23 mutant did not cause a reduction in the phosphorylation of unrelated protein kinases, ERK1 and ERK2 (ERK1/2). The inhibition of JAK2 tyrosine phosphorylation can be reversed by tyrosine phosphatase inhibitor, sodium orthovanadate. Protein tyrosine phosphatase 1-B levels increased with introduction of wt p53 and may be involved in the dephosphorylation of JAK2. These findings present a possible p53-dependent cellular process of modulating JAK2 tyrosine phosphorylation in ovarian cancer cell lines.

  15. Crystal structure of the polo-box domain of polo-like kinase 2.

    Science.gov (United States)

    Shan, Hong-Mei; Wang, Tao; Quan, Jun-Min

    2015-01-16

    Polo-like kinase 2 (PLK2) is a crucial regulator in cell cycle progression, DNA damage response, and neuronal activity. PLK2 is characterized by the conserved N-terminal kinase domain and the unique C-terminal polo-box domain (PBD). The PBD mediates diverse functions of PLK2 by binding phosphorylated Ser-pSer/pThr motifs of its substrates. Here, we report the first crystal structure of the PBD of PLK2. The overall structure of the PLK2 PBD is similar to that of the PLK1 PBD, which is composed by two polo boxes each contain β6α structures that form a 12-stranded β sandwich domain. The edge of the interface between the two polo boxes forms the phosphorylated Ser-pSer/pThr motifs binding cleft. On the hand, the peripheral regions around the core binding cleft of the PLK2 PBD is distinct from that of the PLK1 PBD, which might confer the substrate specificity of the PBDs of the polo-like kinase family. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. P90 Ribosomal s6 kinase 2 negatively regulates axon growth in motoneurons.

    Science.gov (United States)

    Fischer, Matthias; Pereira, Patricia Marques; Holtmann, Bettina; Simon, Christian M; Hanauer, Andre; Heisenberg, Martin; Sendtner, Michael

    2009-10-01

    Mutations in Ribosomal s6 kinase 2 (Rsk2) are associated with severe neuronal dysfunction in Coffin-Lowry syndrome (CLS) patients, flies and mice. So far, the mechanisms of how Rsk2 regulates development, maintenance and activity of neurons are not understood. We have investigated the consequences of Rsk2 deficiency in mouse spinal motoneurons. Survival of isolated Rsk2 deficient motoneurons is not reduced, but these cells grow significantly longer neurites. Conversely, overexpression of a constitutively active form of Rsk2 leads to reduced axon growth. Increased axon growth in Rsk2 deficient neurons was accompanied by higher Erk 1/2 phosphorylation, and the knockout phenotype could be rescued by pharmacological inhibition of MAPK/Erk kinase (Mek). These data indicate that Rsk2 negatively regulates axon elongation via the MAPK pathway. Thus, the functional defects observed in the nervous system of CLS patients and animal models with Rsk2 deficiency might be caused by dysregulated neurite growth rather than primary neurodegeneration.

  17. Janus kinase 2 mutations in cases with BCR-ABL-negative chronic myeloproliferative disorders from Turkey

    Science.gov (United States)

    Yildiz, Ismail; Yokuş, Osman; Gedik, Habip

    2017-01-01

    Objective: We aimed to investigate the frequency of Janus kinase 2 (JAK2) mutations in cases with chronic myeloproliferative disorders (CMDs), and the relationship between the presence of JAK2 mutation and leukocytosis and splenomegaly, retrospectively. Materials and Methods: Patients, who were diagnosed with BCR-ABL-negative CMDs according to diagnosis criteria of the World Health Organization and followed up at the hematology clinic between 2013 and 2015, were investigated in terms of the frequency of JAK2 mutation in cases with CMDs, and the relationship between the presence of JAK2 mutation and leukocytosis and splenomegaly, retrospectively. Results: In total, 100 patients, who were diagnosed with BCR-ABL-negative CMDs, were evaluated retrospectively. The mean age of the patients with JAK2 positivity was significantly higher compared to patients with negative. JAK2-positivity rates in the age groups were significantly different. Gender, diagnosis, splenomegaly, and leukocytosis were not statistically different for JAK2 positivity between the groups. Conclusion: JAK2 V617F mutation is more commonly seen in older age as a risk for complications related to CDMS. Splenomegaly and leukocytosis are not associated with JAK2 V617F mutation. PMID:28182037

  18. Extracellular-regulated kinase 2 is activated by the enhancement of hinge flexibility.

    Science.gov (United States)

    Sours, Kevin M; Xiao, Yao; Ahn, Natalie G

    2014-05-01

    Protein motions underlie conformational and entropic contributions to enzyme catalysis; however, relatively little is known about the ways in which this occurs. Studies of the mitogen-activated protein kinase ERK2 (extracellular-regulated protein kinase 2) by hydrogen-exchange mass spectrometry suggest that activation enhances backbone flexibility at the linker between N- and C-terminal domains while altering nucleotide binding mode. Here, we address the hypothesis that enhanced backbone flexibility within the hinge region facilitates kinase activation. We show that hinge mutations enhancing flexibility promote changes in the nucleotide binding mode consistent with domain movement, without requiring phosphorylation. They also lead to the activation of monophosphorylated ERK2, a form that is normally inactive. The hinge mutations bypass the need for pTyr but not pThr, suggesting that Tyr phosphorylation controls hinge motions. In agreement, monophosphorylation of pTyr enhances both hinge flexibility and nucleotide binding mode, measured by hydrogen-exchange mass spectrometry. Our findings demonstrate that regulated protein motions underlie kinase activation. Our working model is that constraints to domain movement in ERK2 are overcome by phosphorylation at pTyr, which increases hinge dynamics to promote the active conformation of the catalytic site.

  19. Investigation of the Rho-kinase 2 gene Thr431Asn polymorphism in migraine

    Directory of Open Access Journals (Sweden)

    Samiye Uslu Kuzudisli

    2014-01-01

    Full Text Available Background: Migraine has a complex etiology determined by genetic and environmental factors, but the molecular mechanisms and genetics of this disease have not yet been fully clarified. Aim: This case/control study was designed to analyze the genotype distributions and allele frequencies for the Rho-kinase 2 (ROCK2 gene Thr431Asn polymorphism among the migraine patients. Materials and Methods: A total of 155 migraine patients and 155 healthy age and sex matched controls were included in this study. Genomic deoxyribonucleic acid from migraine patients and controls was analyzed by real-time polymerase chain reaction. Results: Neither genotype distributions nor the allele frequencies for the Thr431Asn polymorphism showed a significant difference between the groups. In addition, there were no marked differences in genotype and allele frequencies for the migraine without aura and migraine with aura subgroups when compared with control group. Conclusion: This is the first study to show that the ROCK2 gene Thr431Asn polymorphism is not a risk factor for the migraine in the Turkish population.

  20. Complex regulation of CREB-binding protein by homeodomain-interacting protein kinase 2

    KAUST Repository

    Kovács, Krisztián A.

    2015-11-01

    CREB-binding protein (CBP) and p300 are transcriptional coactivators involved in numerous biological processes that affect cell growth, transformation, differentiation, and development. In this study, we provide evidence of the involvement of homeodomain-interacting protein kinase 2 (HIPK2) in the regulation of CBP activity. We show that HIPK2 interacts with and phosphorylates several regions of CBP. We demonstrate that serines 2361, 2363, 2371, 2376, and 2381 are responsible for the HIPK2-induced mobility shift of CBP C-terminal activation domain. Moreover, we show that HIPK2 strongly potentiates the transcriptional activity of CBP. However, our data suggest that HIPK2 activates CBP mainly by counteracting the repressive action of cell cycle regulatory domain 1 (CRD1), located between amino acids 977 and 1076, independently of CBP phosphorylation. Our findings thus highlight a complex regulation of CBP activity by HIPK2, which might be relevant for the control of specific sets of target genes involved in cellular proliferation, differentiation and apoptosis. © 2015 Elsevier Inc.

  1. MAPKAP kinase 2 (MK2)-dependent and -independent models of blister formation in pemphigus vulgaris.

    Science.gov (United States)

    Mao, Xuming; Li, Hong; Sano, Yasuyo; Gaestel, Matthias; Mo Park, Jin; Payne, Aimee S

    2014-01-01

    Pemphigus vulgaris (PV) is an autoimmune blistering disease characterized by autoantibodies to the keratinocyte adhesion protein desmoglein 3 (Dsg3). Previous studies suggest that PV pathogenesis involves p38 mitogen-activated protein kinase-dependent and -independent pathways. However, p38 is a difficult protein to study and therapeutically target because it has four isoforms and multiple downstream effectors. In this study, we identify MAPKAP (mitogen-activated protein kinase-activated protein) kinase 2 (MK2) as a downstream effector of p38 signaling in PV and describe MK2-dependent and -independent mechanisms of blister formation using passive transfer of human anti-Dsg IgG4 mAbs to neonatal mice. In human keratinocytes, PV mAbs activate MK2 in a dose-dependent manner. MK2 is also activated in human pemphigus skin blisters, causing translocation of MK2 from the nucleus to the cytosol. Small-molecule inhibition of MK2 and silencing of MK2 expression block PV mAb-induced Dsg3 endocytosis in human keratinocytes. In addition, small-molecule inhibition and genetic deletion of p38α and MK2 inhibit spontaneous but not induced suprabasal blisters by PV mAbs in mouse passive transfer models. Collectively, these data suggest that MK2 is a key downstream effector of p38 that can modulate PV autoantibody pathogenicity. MK2 inhibition may be a valuable adjunctive therapy for control of pemphigus blistering.

  2. Repeat-until-success quantum repeaters

    Science.gov (United States)

    Bruschi, David Edward; Barlow, Thomas M.; Razavi, Mohsen; Beige, Almut

    2014-09-01

    We propose a repeat-until-success protocol to improve the performance of probabilistic quantum repeaters. Conventionally, these rely on passive static linear-optics elements and photodetectors to perform Bell-state measurements (BSMs) with a maximum success rate of 50%. This is a strong impediment for entanglement swapping between distant quantum memories. Every time a BSM fails, entanglement needs to be redistributed between the corresponding memories in the repeater link. The key ingredients of our scheme are repeatable BSMs. Under ideal conditions, these turn probabilistic quantum repeaters into deterministic ones. Under realistic conditions, our protocol too might fail. However, using additional threshold detectors now allows us to improve the entanglement generation rate by almost orders of magnitude, at a nominal distance of 1000 km, compared to schemes that rely on conventional BSMs. This improvement is sufficient to make the performance of our scheme comparable to the expected performance of some deterministic quantum repeaters.

  3. G Protein–Coupled Receptor Kinase 2 Plays a Relevant Role in Insulin Resistance and Obesity

    Science.gov (United States)

    Garcia-Guerra, Lucia; Nieto-Vazquez, Iria; Vila-Bedmar, Rocio; Jurado-Pueyo, María; Zalba, Guillermo; Díez, Javier; Murga, Cristina; Fernández-Veledo, Sonia; Mayor, Federico; Lorenzo, Margarita

    2010-01-01

    OBJECTIVE Insulin resistance is associated with the pathogenesis of metabolic disorders as type 2 diabetes and obesity. Given the emerging role of signal transduction in these syndromes, we set out to explore the possible role that G protein–coupled receptor kinase 2 (GRK2), first identified as a G protein–coupled receptor regulator, could have as a modulator of insulin responses. RESEARCH DESIGN AND METHODS We analyzed the influence of GRK2 levels in insulin signaling in myoblasts and adipocytes with experimentally increased or silenced levels of GRK2, as well as in GRK2 hemizygous animals expressing 50% lower levels of this kinase in three different models of insulin resistance: tumor necrosis factor-α (TNF-α) infusion, aging, and high-fat diet (HFD). Glucose transport, whole-body glucose and insulin tolerance, the activation status of insulin pathway components, and the circulating levels of important mediators were measured. The development of obesity and adipocyte size with age and HFD was analyzed. RESULTS Altering GRK2 levels markedly modifies insulin-mediated signaling in cultured adipocytes and myocytes. GRK2 levels are increased by ∼2-fold in muscle and adipose tissue in the animal models tested, as well as in lymphocytes from metabolic syndrome patients. In contrast, hemizygous GRK2 mice show enhanced insulin sensitivity and do not develop insulin resistance by TNF-α, aging, or HFD. Furthermore, reduced GRK2 levels induce a lean phenotype and decrease age-related adiposity. CONCLUSIONS Overall, our data identify GRK2 as an important negative regulator of insulin effects, key to the etiopathogenesis of insulin resistance and obesity, which uncovers this protein as a potential therapeutic target in the treatment of these disorders. PMID:20627936

  4. Purification and characterization of a casein kinase 2-type protein kinase from pea nuclei

    Science.gov (United States)

    Li, H.; Roux, S. J.

    1992-01-01

    Almost all the polyamine-stimulated protein kinase activity associated with the chromatin fraction of nuclei purified from etiolated pea (Pisum sativum L.) plumules is present in a single enzyme that can be extracted from chromatin by 0.35 molar NaCl. This protein kinase can be further purified over 2000-fold by salt fractionation and anion-exchange and casein-agarose column chromatography, after which it is more than 90% pure. The purified kinase has a specific activity of about 650 nanomoles per minute per milligram protein in the absence of polyamines, with either ATP or GTP as phosphoryl donor. Spermidine can stimulate its activity fourfold, with half-maximal activation at about 2 millimolar. Spermine and putrescine also stimulate activity, although somewhat less effectively. This kinase has a tetrameric alpha 2 beta 2 structure with a native molecular weight of 130,000, and subunit molecular weights of 36,000 for the catalytic subunit (alpha) and 29,000 for the regulatory subunit (beta). In western blot analyses, only the alpha subunit reacts strongly with polyclonal antibodies to a Drosophila casein kinase II. The pea kinase can use casein and phosvitin as artificial substrates, phosphorylating both the serine and threonine residues of casein. It has a pH optimum near 8.0, a Vmax of 1.5 micromoles per minute per milligram protein, and a Km for ATP of approximately 75 micromolar. Its activity can be almost completely inhibited by heparin at 5 micrograms per milliliter, but is relatively insensitive to concentrations of staurosporine, K252a, and chlorpromazine that strongly antagonize Ca(2+) -regulated protein kinases. These results are discussed in relation to recent findings that casein kinase 2-type kinases may phosphorylate trans-acting factors that bind to light-regulated promoters in plants.

  5. Regulation of vascular endothelial growth factor expression by homeodomain-interacting protein kinase-2

    Directory of Open Access Journals (Sweden)

    D'Orazi Gabriella

    2008-07-01

    Full Text Available Abstract Background Homeodomain-interacting protein kinase-2 (HIPK2 plays an essential role in restraining tumor progression as it may regulate, by itself or within multiprotein complexes, many proteins (mainly transcription factors involved in cell growth and apoptosis. This study takes advantage of the recent finding that HIPK2 may repress the β-catenin transcription activity. Thus, we investigated whether HIPK2 overexpression may down-regulate vascular endothelial growth factor (VEGF levels (a β-catenin target gene and the role of β-catenin in this regulation, in order to consider HIPK2 as a tool for novel anti-tumoral therapeutical approaches. Methods The regulation of VEGF expression by HIPK2 was evaluated by using luciferase assay with VEGF reporter construct, after overexpression of the β-catenin transcription factor. Relative quantification of VEGF and β-catenin mRNAs were assessed by reverse-transcriptase-PCR (RT-PCR analyses, following HIPK2 overexpression, while β-catenin protein levels were evaluated by western immunoblotting. Results HIPK2 overexpression in tumor cells downregulated VEGF mRNA levels and VEGF promoter activity. The VEGF downregulation was partly depending on HIPK2-mediated β-catenin regulation. Thus, HIPK2 could induce β-catenin protein degradation that was prevented by cell treatment with proteasome inhibitor MG132. The β-catenin degradation was dependent on HIPK2 catalytic activity and independent of p53 and glycogen synthase kinase 3β (GSK-3β activities. Conclusion These results suggest that VEGF might be a target of HIPK2, at least in part, through regulation of β-catenin activity. These findings support the function of HIPK2 as tumor suppressor and hypothesise a role for HIPK2 as antiangiogenic tool in tumor therapy approaches.

  6. Activin-Like Kinase 2 Functions in Peri-implantation Uterine Signaling in Mice and Humans

    Science.gov (United States)

    Clementi, Caterina; Tripurani, Swamy K.; Large, Michael J.; Edson, Mark A.; Creighton, Chad J.; Hawkins, Shannon M.; Kovanci, Ertug; Kaartinen, Vesa; Lydon, John P.; Pangas, Stephanie A.; DeMayo, Francesco J.; Matzuk, Martin M.

    2013-01-01

    Implantation of a blastocyst in the uterus is a multistep process tightly controlled by an intricate regulatory network of interconnected ovarian, uterine, and embryonic factors. Bone morphogenetic protein (BMP) ligands and receptors are expressed in the uterus of pregnant mice, and BMP2 has been shown to be a key regulator of implantation. In this study, we investigated the roles of the BMP type 1 receptor, activin-like kinase 2 (ALK2), during mouse pregnancy by producing mice carrying a conditional ablation of Alk2 in the uterus (Alk2 cKO mice). In the absence of ALK2, embryos demonstrate delayed invasion into the uterine epithelium and stroma, and upon implantation, stromal cells fail to undergo uterine decidualization, resulting in sterility. Mechanistically, microarray analysis revealed that CCAAT/enhancer-binding protein β (Cebpb) expression is suppressed during decidualization in Alk2 cKO females. These findings and the similar phenotypes of Cebpb cKO and Alk2 cKO mice lead to the hypothesis that BMPs act upstream of CEBPB in the stroma to regulate decidualization. To test this hypothesis, we knocked down ALK2 in human uterine stromal cells (hESC) and discovered that ablation of ALK2 alters hESC decidualization and suppresses CEBPB mRNA and protein levels. Chromatin immunoprecipitation (ChIP) analysis of decidualizing hESC confirmed that BMP signaling proteins, SMAD1/5, directly regulate expression of CEBPB by binding a distinct regulatory sequence in the 3′ UTR of this gene; CEBPB, in turn, regulates the expression of progesterone receptor (PGR). Our work clarifies the conserved mechanisms through which BMPs regulate peri-implantation in rodents and primates and, for the first time, uncovers a linear pathway of BMP signaling through ALK2 to regulate CEBPB and, subsequently, PGR during decidualization. PMID:24244176

  7. Mutation analysis of the checkpoint kinase 2 gene in colorectal cancer cell lines

    Institute of Scientific and Technical Information of China (English)

    LIU Wei-dong; ZHONG Bai-yun; ZHANG Yang-de; CHOI Gyu-seog

    2007-01-01

    Background Checkpoint kinase 2 (CHK2) is a DNA damage-activated protein kinase which is involved in cell cycle checkpoint control.CHK2 gene could be a candidate gene for colorectal cancer susceptibility.But there are few systematic repots on mutation of CHK2 in colorectal cancer.Methods The mutations of all 14 exons of CHK2 in 56 colorecfal cancer cell lines were screened systematically.using denaturing high-performance liquid chromatography (DHPLC) to screen the mismatches of the CHK2 exons amplified products,and then the suspected mutant cell lines were scanned by nucleotide sequence analysis.Results VACO400 in CHK2 exon 1a was suspected to have mutation by DHPLC and confirmed by sequence,but this was nonsense mutation.C106,CX-1,HT-29,SK01,SW480,SW620 and VACO400 in CHK2 exon 1b were confirmed to have the same nonsense mutation in 11609 A>G.DLD-1 and HCT-15 in CHK2 exon 2 were confirmed to have missense mutation R145W.which was heterozygous C>T missense mutation at nucleotide 433.leading to an Arg>Trp substitution within the FHA domain.Conclusions The CHK2 mutation in colorectal cancer is a low frequency event.There are just 10 cell lines to have sequence variations in all the 14 exons in 56 colorectal cancer cell lines and only DLD-1/HCT-15 had heterozygous missense mutation.These findings may give useful information of susceptibility of colorectal cancer as single nucleotide polymorphysim.

  8. Phosphoglycerate kinase 2 (PGK2) is essential for sperm function and male fertility in mice.

    Science.gov (United States)

    Danshina, Polina V; Geyer, Christopher B; Dai, Qunsheng; Goulding, Eugenia H; Willis, William D; Kitto, G Barrie; McCarrey, John R; Eddy, E M; O'Brien, Deborah A

    2010-01-01

    Phosphoglycerate kinase 2 (PGK2), an isozyme that catalyzes the first ATP-generating step in the glycolytic pathway, is encoded by an autosomal retrogene that is expressed only during spermatogenesis. It replaces the ubiquitously expressed phosphoglycerate kinase 1 (PGK1) isozyme following repression of Pgk1 transcription by meiotic sex chromosome inactivation during meiotic prophase and by postmeiotic sex chromatin during spermiogenesis. The targeted disruption of Pgk2 by homologous recombination eliminates PGK activity in sperm and severely impairs male fertility, but does not block spermatogenesis. Mating behavior, reproductive organ weights (testis, excurrent ducts, and seminal vesicles), testis histology, sperm counts, and sperm ultrastructure were indistinguishable between Pgk2(-/-) and wild-type mice. However, sperm motility and ATP levels were markedly reduced in males lacking PGK2. These defects in sperm function were slightly less severe than observed in males lacking glyceraldehyde-3-phosphate dehydrogenase, spermatogenic (GAPDHS), the isozyme that catalyzes the step preceding PGK2 in the sperm glycolytic pathway. Unlike Gapdhs(-/-) males, the Pgk2(-/-) males also sired occasional pups. Alternative pathways that bypass the PGK step of glycolysis exist. We determined that one of these bypass enzymes, acylphosphatase, is active in mouse sperm, perhaps contributing to phenotypic differences between mice lacking GAPDHS or PGK2. This study determined that PGK2 is not required for the completion of spermatogenesis, but is essential for sperm motility and male fertility. In addition to confirming the importance of the glycolytic pathway for sperm function, distinctive phenotypic characteristics of Pgk2(-/-) mice may provide further insights into the regulation of sperm metabolism.

  9. Inositol Hexakisphosphate Kinase 2 Promotes Cell Death in Cells with Cytoplasmic TDP-43 Aggregation.

    Science.gov (United States)

    Nagata, Eiichiro; Nonaka, Takashi; Moriya, Yusuke; Fujii, Natsuko; Okada, Yoshinori; Tsukamoto, Hideo; Itoh, Johbu; Okada, Chisa; Satoh, Tadayuki; Arai, Tetsuaki; Hasegawa, Masato; Takizawa, Shunya

    2016-10-01

    TAR DNA-binding protein 43 (TDP-43) has been identified as a major component of ubiquitin-positive inclusions in the brains and spinal cords of patients with frontotemporal lobar degeneration with ubiquitinated inclusions (FTLD-U) or amyotrophic lateral sclerosis (ALS). The phosphorylated C-terminal fragment of TDP-43 forms aggregates in the neuronal cytoplasm, possibly resulting in neuronal cell death in patients with FTLD-U or ALS. The inositol pyrophosphate known as diphosphoinositol pentakisphosphate (InsP7) contains highly energetic pyrophosphate bonds. We previously reported that inositol hexakisphosphate kinase type 2 (InsP6K2), which converts inositol hexakisphosphate (InsP6) to InsP7, mediates cell death in mammalian cells. Moreover, InsP6K2 is translocated from the nucleus to the cytosol during apoptosis. In this study, we verified that phosphorylated TDP-43 co-localized and co-bound with InsP6K2 in the cytoplasm of anterior horn cells of the spinal cord. Furthermore, we verified that cell death was augmented in the presence of cytoplasmic TDP-43 aggregations and activated InsP6K2. However, cells with only cytoplasmic TDP-43 aggregation survived because Akt activity increased. In the presence of both TDP-43 aggregation and activated InsP6K2 in the cytoplasm of cells, the expression levels of HSP90 and casein kinase 2 decreased, as the activity of Akt decreased. These conditions may promote cell death. Thus, InsP6K2 could cause neuronal cell death in patients with FTLD-U or ALS. Moreover, InsP6K2 plays an important role in a novel cell death pathway present in FTLD-U and ALS.

  10. Activin-like kinase 2 functions in peri-implantation uterine signaling in mice and humans.

    Science.gov (United States)

    Clementi, Caterina; Tripurani, Swamy K; Large, Michael J; Edson, Mark A; Creighton, Chad J; Hawkins, Shannon M; Kovanci, Ertug; Kaartinen, Vesa; Lydon, John P; Pangas, Stephanie A; DeMayo, Francesco J; Matzuk, Martin M

    2013-11-01

    Implantation of a blastocyst in the uterus is a multistep process tightly controlled by an intricate regulatory network of interconnected ovarian, uterine, and embryonic factors. Bone morphogenetic protein (BMP) ligands and receptors are expressed in the uterus of pregnant mice, and BMP2 has been shown to be a key regulator of implantation. In this study, we investigated the roles of the BMP type 1 receptor, activin-like kinase 2 (ALK2), during mouse pregnancy by producing mice carrying a conditional ablation of Alk2 in the uterus (Alk2 cKO mice). In the absence of ALK2, embryos demonstrate delayed invasion into the uterine epithelium and stroma, and upon implantation, stromal cells fail to undergo uterine decidualization, resulting in sterility. Mechanistically, microarray analysis revealed that CCAAT/enhancer-binding protein β (Cebpb) expression is suppressed during decidualization in Alk2 cKO females. These findings and the similar phenotypes of Cebpb cKO and Alk2 cKO mice lead to the hypothesis that BMPs act upstream of CEBPB in the stroma to regulate decidualization. To test this hypothesis, we knocked down ALK2 in human uterine stromal cells (hESC) and discovered that ablation of ALK2 alters hESC decidualization and suppresses CEBPB mRNA and protein levels. Chromatin immunoprecipitation (ChIP) analysis of decidualizing hESC confirmed that BMP signaling proteins, SMAD1/5, directly regulate expression of CEBPB by binding a distinct regulatory sequence in the 3' UTR of this gene; CEBPB, in turn, regulates the expression of progesterone receptor (PGR). Our work clarifies the conserved mechanisms through which BMPs regulate peri-implantation in rodents and primates and, for the first time, uncovers a linear pathway of BMP signaling through ALK2 to regulate CEBPB and, subsequently, PGR during decidualization.

  11. Activin-like kinase 2 functions in peri-implantation uterine signaling in mice and humans.

    Directory of Open Access Journals (Sweden)

    Caterina Clementi

    2013-11-01

    Full Text Available Implantation of a blastocyst in the uterus is a multistep process tightly controlled by an intricate regulatory network of interconnected ovarian, uterine, and embryonic factors. Bone morphogenetic protein (BMP ligands and receptors are expressed in the uterus of pregnant mice, and BMP2 has been shown to be a key regulator of implantation. In this study, we investigated the roles of the BMP type 1 receptor, activin-like kinase 2 (ALK2, during mouse pregnancy by producing mice carrying a conditional ablation of Alk2 in the uterus (Alk2 cKO mice. In the absence of ALK2, embryos demonstrate delayed invasion into the uterine epithelium and stroma, and upon implantation, stromal cells fail to undergo uterine decidualization, resulting in sterility. Mechanistically, microarray analysis revealed that CCAAT/enhancer-binding protein β (Cebpb expression is suppressed during decidualization in Alk2 cKO females. These findings and the similar phenotypes of Cebpb cKO and Alk2 cKO mice lead to the hypothesis that BMPs act upstream of CEBPB in the stroma to regulate decidualization. To test this hypothesis, we knocked down ALK2 in human uterine stromal cells (hESC and discovered that ablation of ALK2 alters hESC decidualization and suppresses CEBPB mRNA and protein levels. Chromatin immunoprecipitation (ChIP analysis of decidualizing hESC confirmed that BMP signaling proteins, SMAD1/5, directly regulate expression of CEBPB by binding a distinct regulatory sequence in the 3' UTR of this gene; CEBPB, in turn, regulates the expression of progesterone receptor (PGR. Our work clarifies the conserved mechanisms through which BMPs regulate peri-implantation in rodents and primates and, for the first time, uncovers a linear pathway of BMP signaling through ALK2 to regulate CEBPB and, subsequently, PGR during decidualization.

  12. Virtual Screening for Potential Allosteric Inhibitors of Cyclin-Dependent Kinase 2 from Traditional Chinese Medicine

    Directory of Open Access Journals (Sweden)

    Fang Lu

    2016-09-01

    Full Text Available Cyclin-dependent kinase 2 (CDK2, a member of Cyclin-dependent kinases (CDKs, plays an important role in cell division and DNA replication. It is regarded as a desired target to treat cancer and tumor by interrupting aberrant cell proliferation. Compared to lower subtype selectivity of CDK2 ATP-competitive inhibitors, CDK2 allosteric inhibitor with higher subtype selectivity has been used to treat CDK2-related diseases. Recently, the first crystal structure of CDK2 with allosteric inhibitor has been reported, which provides new opportunities to design pure allosteric inhibitors of CDK2. The binding site of the ATP-competition inhibitors and the allosteric inhibitors are partially overlapped in space position, so the same compound might interact with the two binding sites. Thus a novel screening strategy was essential for the discovery of pure CDK2 allosteric inhibitors. In this study, pharmacophore and molecular docking were used to screen potential CDK2 allosteric inhibitors and ATP-competition inhibitors from Traditional Chinese Medicine (TCM. In the docking result of the allosteric site, the compounds which can act with the CDK2 ATP site were discarded, and the remaining compounds were regarded as the potential pure allosteric inhibitors. Among the results, prostaglandin E1 and nordihydroguaiaretic acid (NDGA were available and their growth inhibitory effect on human HepG2 cell lines was determined by MTT assay. The two compounds could substantially inhibit the growth of HepG2 cell lines with an estimated IC50 of 41.223 μmol/L and 45.646 μmol/L. This study provides virtual screening strategy of allosteric compounds and a reliable method to discover potential pure CDK2 allosteric inhibitors from TCM. Prostaglandin E1 and NDGA could be regarded as promising candidates for CDK2 allosteric inhibitors.

  13. Receptor interacting protein kinase-2 inhibition by CYLD impairs anti-bacterial immune responses in macrophages

    Directory of Open Access Journals (Sweden)

    Katharina eWex

    2016-01-01

    Full Text Available Upon infection with intracellular bacteria, nucleotide oligomerization domain protein 2 (NOD2 recognizes bacterial muramyl dipeptide and binds, subsequently, to receptor-interacting serine/threonine kinase 2 (RIPK2. RIPK2 mediates the activation of immune responses via the nuclear factor-κB (NF-κB and extracellular-signal regulated kinase (ERK pathways. Previously, it has been shown that RIPK2 activation dependens on its K63-ubiquitination by the E3 ligases pellino-3 and ITCH, whereas the deubiquitinating enzyme A20 counter-regulates RIPK2 activity by cleaving K63-polyubiquitin chains from RIPK2. Here, we newly identify the deubiquitinating enzyme CYLD as a new interacting partner and inhibitor of RIPK2. We show that CYLD binds to and removes K63-polyubiquitin chains from RIPK2 in Listeria monocytogenes (Lm infected bone-marrow-derived macrophages (BMDM. CYLD-mediated K63-deubiquitination of RIPK2 resulted in an impaired activation of both NF-κB and ERK1/2 pathways, reduced production of proinflammatory cytokines (IL-6, IL-12, anti-listerial ROS and NO, and, finally, impaired pathogen control. In turn, RIPK2 inhibition by siRNA prevented activation of NF-κB and ERK1/2 and completely abolished the protective effect of CYLD-deficiency with respect to the production of IL-6, NO, ROS and pathogen control. Noteworthy, CYLD also inhibited autophagy of Listeria in a RIPK2-ERK1/2 dependent manner.The protective function of CYLD-deficiency was dependent on IFN-γ pre-stimulation of infected macrophages. Interestingly, the reduced NF-κB activation in CYLD-expressing macrophages limited the protective effect of IFN-γ by reducing NF-κB-dependent STAT1 activation. Taken together, our study identifies CYLD as an important inhibitor of RIPK2-dependent anti-bacterial immune responses in macrophages.

  14. Ca2+-dependent inhibition of G protein-coupled receptor kinase 2 by calmodulin.

    Science.gov (United States)

    Haga, K; Tsuga, H; Haga, T

    1997-02-11

    Agonist- or light-dependent phosphorylation of muscarinic acetylcholine receptor m2 subtypes (m2 receptors) or rhodopsin by G protein-coupled receptor kinase 2 (GRK2) was found to be inhibited by calmodulin in a Ca2+-dependent manner. The phosphorylation was fully inhibited in the absence of G protein betagamma subunits and partially inhibited in the presence of betagamma subunits. The dose-response curve for stimulation by betagamma subunits of the m2 and rhodopsin phosphorylation was shifted to the higher concentration of betagamma subunits by addition of Ca2+-calmodulin. The phosphorylation by GRK2 of a glutathione S-transferase fusion protein containing a peptide corresponding to the central part of the third intracellular loop of m2 receptors (I3-GST) was not affected by Ca2+-calmodulin in the presence or absence of betagamma subunits, but the agonist-dependent stimulation of I3-GST phosphorylation by an I3-deleted m2 receptor mutant in the presence of betagamma subunits was suppressed by Ca2+-calmodulin. These results indicate that Ca2+-calmodulin does not directly interact with the catalytic site of GRK2 but inhibits the kinase activity of GRK2 by interfering with the activation of GRK2 by agonist-bound m2 receptors and G protein betagamma subunits. In agreement with the assumption that GRK2 activity is suppressed by the increase in intracellular Ca2+, the sequestration of m2 receptors expressed in Chinese hamster ovary cells was found to be attenuated by the treatment with a Ca2+ ionophore, A23187.

  15. Drosophila mbm is a nucleolar myc and casein kinase 2 target required for ribosome biogenesis and cell growth of central brain neuroblasts.

    Science.gov (United States)

    Hovhanyan, Anna; Herter, Eva K; Pfannstiel, Jens; Gallant, Peter; Raabe, Thomas

    2014-05-01

    Proper cell growth is a prerequisite for maintaining repeated cell divisions. Cells need to translate information about intracellular nutrient availability and growth cues from energy-sensing organs into growth-promoting processes, such as sufficient supply with ribosomes for protein synthesis. Mutations in the mushroom body miniature (mbm) gene impair proliferation of neural progenitor cells (neuroblasts) in the central brain of Drosophila melanogaster. Yet the molecular function of Mbm has so far been unknown. Here we show that mbm does not affect the molecular machinery controlling asymmetric cell division of neuroblasts but instead decreases their cell size. Mbm is a nucleolar protein required for small ribosomal subunit biogenesis in neuroblasts. Accordingly, levels of protein synthesis are reduced in mbm neuroblasts. Mbm expression is transcriptionally regulated by Myc, which, among other functions, relays information from nutrient-dependent signaling pathways to ribosomal gene expression. At the posttranslational level, Mbm becomes phosphorylated by casein kinase 2 (CK2), which has an impact on localization of the protein. We conclude that Mbm is a new part of the Myc target network involved in ribosome biogenesis, which, together with CK2-mediated signals, enables neuroblasts to synthesize sufficient amounts of proteins required for proper cell growth.

  16. Structure of Human G Protein-Coupled Receptor Kinase 2 in Complex with the Kinase Inhibitor Balanol

    Energy Technology Data Exchange (ETDEWEB)

    Tesmer, John J.G.; Tesmer, Valerie M.; Lodowski, David T.; Steinhagen, Henning; Huber, Jochen (Sanofi); (Michigan); (Texas)

    2010-07-19

    G protein-coupled receptor kinase 2 (GRK2) is a pharmaceutical target for the treatment of cardiovascular diseases such as congestive heart failure, myocardial infarction, and hypertension. To better understand how nanomolar inhibition and selectivity for GRK2 might be achieved, we have determined crystal structures of human GRK2 in complex with G{beta}{gamma} in the presence and absence of the AGC kinase inhibitor balanol. The selectivity of balanol among human GRKs is assessed.

  17. Design and synthesis of carbazole carboxamides as promising inhibitors of Bruton's tyrosine kinase (BTK) and Janus kinase 2 (JAK2).

    Science.gov (United States)

    Liu, Qingjie; Batt, Douglas G; Lippy, Jonathan S; Surti, Neha; Tebben, Andrew J; Muckelbauer, Jodi K; Chen, Lin; An, Yongmi; Chang, Chiehying; Pokross, Matt; Yang, Zheng; Wang, Haiqing; Burke, James R; Carter, Percy H; Tino, Joseph A

    2015-10-01

    Four series of disubstituted carbazole-1-carboxamides were designed and synthesised as inhibitors of Bruton's tyrosine kinase (BTK). 4,7- and 4,6-disubstituted carbazole-1-carboxamides were potent and selective inhibitors of BTK, while 3,7- and 3,6-disubstituted carbazole-1-carboxamides were potent and selective inhibitors of Janus kinase 2 (JAK2). Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Inhibition of sphingosine kinase-2 suppresses inflammation and attenuates graft injury after liver transplantation in rats.

    Directory of Open Access Journals (Sweden)

    Qinlong Liu

    Full Text Available Inflammation mediates/promotes graft injury after liver transplantation (LT. This study investigated the roles of sphingosine kinase-2 (SK2 in inflammation after LT. Liver grafts were stored in UW solution with and without ABC294640 (100 µM, a selective inhibitor of SK2, before implantation. Hepatic sphingosine-1-phosphate (S1P levels increased ∼4-fold after LT, which was blunted by 40% by ABC294640. Hepatic toll-like receptor-4 (TLR4 expression and nuclear factor-κB (NF-κB p65 subunit phosphorylation elevated substantially after transplantation. The pro-inflammatory cytokines/chemokines tumor necrosis factor-α, interleukin-1β and C-X-C motif chemokine 10 mRNAs increased 5.9-fold, 6.1-fold and 16-fold, respectively following transplantation, while intrahepatic adhesion molecule-1 increased 5.7-fold and monocytes/macrophage and neutrophil infiltration and expansion of residential macrophage population increased 7.8-13.4 fold, indicating enhanced inflammation. CD4+ T cell infiltration and interferon-γ production also increased. ABC294640 blunted TLR4 expression by 60%, NF-κB activation by 84%, proinflammatory cytokine/chemokine production by 45-72%, adhesion molecule expression by 54% and infiltration of monocytes/macrophages and neutrophils by 62-67%. ABC294640 also largely blocked CD4+ T cell infiltration and interferon-γ production. Focal necrosis and apoptosis occurred after transplantation with serum alanine aminotransferase (ALT reaching ∼6000 U/L and serum total bilirubin elevating to ∼1.5 mg/dL. Inhibition of SK2 by ABC294640 blunted necrosis by 57%, apoptosis by 74%, ALT release by ∼68%, and hyperbilirubinemia by 74%. Most importantly, ABC294640 also increased survival from ∼25% to ∼85%. In conclusion, SK2 plays an important role in hepatic inflammation responses and graft injury after cold storage/transplantation and represents a new therapeutic target for liver graft failure.

  19. Characterization of the alpha and beta subunits of casein kinase 2 by far-UV CD spectroscopy

    DEFF Research Database (Denmark)

    Issinger, O G; Brockel, C; Boldyreff, B;

    1992-01-01

    Although Chou-Fasman calculations of the secondary structure of recombinant casein kinase 2 subunits alpha and beta suggest they have a similar overall conformation, circular dichroism (CD) studies show that substantial differences in the conformation of the two subunits exist. In addition......, no changes in the far-UV CD spectrum of the alpha subunit are observed in the presence of casein or the synthetic decapeptide substrate RRRDDDSDDD. Furthermore, the alpha-helical structure of the alpha subunit (but not the beta subunit) can be increased in the presence of stoichiometric amounts of heparin...

  20. Quantum repeated games revisited

    CERN Document Server

    Frackiewicz, Piotr

    2011-01-01

    We present a scheme for playing quantum repeated 2x2 games based on the Marinatto and Weber's approach to quantum games. As a potential application, we study twice repeated Prisoner's Dilemma game. We show that results not available in classical game can be obtained when the game is played in the quantum way. Before we present our idea, we comment on the previous scheme of playing quantum repeated games.

  1. Upregulation of Na+,Cl--Coupled Betaine/ γ-Amino-Butyric Acid Transporter BGT1 by Tau Tubulin Kinase 2

    Directory of Open Access Journals (Sweden)

    Ahmad Almilaji

    2013-08-01

    Full Text Available Background/Aims: The serine/threonine kinase Tau-tubulin-kinase 2 (TTBK2 is expressed in various tissues including kidney, liver and brain. Loss of function mutations of TTBK2 lead to autosomal dominant spinocerebellar ataxia type 11 (SCA11. Cell survival is fostered by cellular accumulation of organic osmolytes. Carriers accomplishing cellular accumulation of organic osmolytes include the Na+, Cl--coupled betaine/γ-amino-butyric acid transporter BGT1. The present study explored whether TTBK2 participates in the regulation of BGT1 activity. Methods: Electrogenic transport of GABA was determined in Xenopus oocytes expressing BGT1 with or without wild-type TTBK2, truncated TTBK2[1-450] or kinase inactive mutants TTBK2- KD and TTBK2[1-450]-KD. Results: Coexpression of wild-type TTBK2, but not of TTBK2[1-450], TTBK2-KD or TTBK2[1-450]-KD, increased electrogenic GABA transport. Wildtype TTBK2 increased the maximal transport rate without significantly modifying affinity of the carrier. Coexpression of wild-type TTBK2 significantly delayed the decline of transport following inhibition of carrier insertion with brefeldin A, indicating that wild-type TTBK2 increased carrier stability in the cell membrane. Conclusion: Tau-tubulin-kinase 2 TTBK2 is a powerful stimulator of the osmolyte and GABA transporter BGT1.

  2. Reconfigurable multiport EPON repeater

    Science.gov (United States)

    Oishi, Masayuki; Inohara, Ryo; Agata, Akira; Horiuchi, Yukio

    2009-11-01

    An extended reach EPON repeater is one of the solutions to effectively expand FTTH service areas. In this paper, we propose a reconfigurable multi-port EPON repeater for effective accommodation of multiple ODNs with a single OLT line card. The proposed repeater, which has multi-ports in both OLT and ODN sides, consists of TRs, BTRs with the CDR function and a reconfigurable electrical matrix switch, can accommodate multiple ODNs to a single OLT line card by controlling the connection of the matrix switch. Although conventional EPON repeaters require full OLT line cards to accommodate subscribers from the initial installation stage, the proposed repeater can dramatically reduce the number of required line cards especially when the number of subscribers is less than a half of the maximum registerable users per OLT. Numerical calculation results show that the extended reach EPON system with the proposed EPON repeater can save 17.5% of the initial installation cost compared with a conventional repeater, and can be less expensive than conventional systems up to the maximum subscribers especially when the percentage of ODNs in lightly-populated areas is higher.

  3. Revisiting the TALE repeat.

    Science.gov (United States)

    Deng, Dong; Yan, Chuangye; Wu, Jianping; Pan, Xiaojing; Yan, Nieng

    2014-04-01

    Transcription activator-like (TAL) effectors specifically bind to double stranded (ds) DNA through a central domain of tandem repeats. Each TAL effector (TALE) repeat comprises 33-35 amino acids and recognizes one specific DNA base through a highly variable residue at a fixed position in the repeat. Structural studies have revealed the molecular basis of DNA recognition by TALE repeats. Examination of the overall structure reveals that the basic building block of TALE protein, namely a helical hairpin, is one-helix shifted from the previously defined TALE motif. Here we wish to suggest a structure-based re-demarcation of the TALE repeat which starts with the residues that bind to the DNA backbone phosphate and concludes with the base-recognition hyper-variable residue. This new numbering system is consistent with the α-solenoid superfamily to which TALE belongs, and reflects the structural integrity of TAL effectors. In addition, it confers integral number of TALE repeats that matches the number of bound DNA bases. We then present fifteen crystal structures of engineered dHax3 variants in complex with target DNA molecules, which elucidate the structural basis for the recognition of bases adenine (A) and guanine (G) by reported or uncharacterized TALE codes. Finally, we analyzed the sequence-structure correlation of the amino acid residues within a TALE repeat. The structural analyses reported here may advance the mechanistic understanding of TALE proteins and facilitate the design of TALEN with improved affinity and specificity.

  4. Recursive quantum repeater networks

    CERN Document Server

    Van Meter, Rodney; Horsman, Clare

    2011-01-01

    Internet-scale quantum repeater networks will be heterogeneous in physical technology, repeater functionality, and management. The classical control necessary to use the network will therefore face similar issues as Internet data transmission. Many scalability and management problems that arose during the development of the Internet might have been solved in a more uniform fashion, improving flexibility and reducing redundant engineering effort. Quantum repeater network development is currently at the stage where we risk similar duplication when separate systems are combined. We propose a unifying framework that can be used with all existing repeater designs. We introduce the notion of a Quantum Recursive Network Architecture, developed from the emerging classical concept of 'recursive networks', extending recursive mechanisms from a focus on data forwarding to a more general distributed computing request framework. Recursion abstracts independent transit networks as single relay nodes, unifies software layer...

  5. Sphingosine kinase 2 is a chikungunya virus host factor co-localized with the viral replication complex.

    Science.gov (United States)

    Reid, St Patrick; Tritsch, Sarah R; Kota, Krishna; Chiang, Chih-Yuan; Dong, Lian; Kenny, Tara; Brueggemann, Ernest E; Ward, Michael D; Cazares, Lisa H; Bavari, Sina

    2015-10-01

    Chikungunya virus (CHIKV) is a re-emerging alphavirus which causes severe and prolonged arthralgic febrile illness. The recent global spread of the virus and lack of approved therapeutic options makes it imperative to gain greater insight into the molecular mechanisms underlying CHIKV pathogenesis, in particular host factors recruited by the virus. In the current study, we identify sphingosine kinase 2 (SK2) as a CHIKV host factor co-localized with the viral replication complex (VRC) during infection. SK2 was demonstrated to co-localize with viral RNA and nonstructural proteins. Targeted impairment of SK2 expression or function significantly inhibited CHIKV infection. Furthermore, affinity purification-mass spectrometry studies revealed that SK2 associates with a number of proteins involved in cellular gene expression specifically during viral infection, suggesting a role in replication. Collectively these results identify SK2 as a novel CHIKV host factor.

  6. Molecular Mechanism for Inhibition of G Protein-Coupled Receptor Kinase 2 by a Selective RNA Aptamer

    Energy Technology Data Exchange (ETDEWEB)

    Tesmer, Valerie M.; Lennarz, Sabine; Mayer, Günter; Tesmer, John J.G. (Bonn); (Michigan)

    2012-08-31

    Cardiovascular homeostasis is maintained in part by the rapid desensitization of activated heptahelical receptors that have been phosphorylated by G protein-coupled receptor kinase 2 (GRK2). However, during chronic heart failure GRK2 is upregulated and believed to contribute to disease progression. We have determined crystallographic structures of GRK2 bound to an RNA aptamer that potently and selectively inhibits kinase activity. Key to the mechanism of inhibition is the positioning of an adenine nucleotide into the ATP-binding pocket and interactions with the basic {alpha}F-{alpha}G loop region of the GRK2 kinase domain. Constraints imposed on the RNA by the terminal stem of the aptamer also play a role. These results highlight how a high-affinity aptamer can be used to selectively trap a novel conformational state of a protein kinase.

  7. The human Na(+)/H(+) exchanger 1 is a membrane scaffold protein for extracellular signal-regulated kinase 2

    DEFF Research Database (Denmark)

    Hendus-Altenburger, Ruth; Pedraz-Cuesta, Elena; Olesen, Christina W;

    2016-01-01

    BACKGROUND: Extracellular signal-regulated kinase 2 (ERK2) is an S/T kinase with more than 200 known substrates, and with critical roles in regulation of cell growth and differentiation and currently no membrane proteins have been linked to ERK2 scaffolding. METHODS AND RESULTS: Here, we identify...... the human Na(+)/H(+) exchanger 1 (hNHE1) as a membrane scaffold protein for ERK2 and show direct hNHE1-ERK1/2 interaction in cellular contexts. Using nuclear magnetic resonance (NMR) spectroscopy and immunofluorescence analysis we demonstrate that ERK2 scaffolding by hNHE1 occurs by one of three D...... and ERK2, and provides a molecular mechanism for the important ERK2 scaffolding function of the membrane protein hNHE1, which regulates the phosphorylation of both hNHE1 and ERK2....

  8. The human Na+/H+ exchanger 1 is a membrane scaffold protein for extracellular signal-regulated kinase 2

    DEFF Research Database (Denmark)

    Hendus-Altenburger, Ruth; Pedraz Cuesta, Elena; Olesen, Christina Wilkens

    2016-01-01

    BACKGROUND: Extracellular signal-regulated kinase 2 (ERK2) is an S/T kinase with more than 200 known substrates, and with critical roles in regulation of cell growth and differentiation and currently no membrane proteins have been linked to ERK2 scaffolding. METHODS AND RESULTS: Here, we identify...... the human Na(+)/H(+) exchanger 1 (hNHE1) as a membrane scaffold protein for ERK2 and show direct hNHE1-ERK1/2 interaction in cellular contexts. Using nuclear magnetic resonance (NMR) spectroscopy and immunofluorescence analysis we demonstrate that ERK2 scaffolding by hNHE1 occurs by one of three D...... in vitro, in a distinct temporal order, with the phosphorylation rates at the individual sites being modulated by the docking sites in a distant dependent manner. CONCLUSIONS: This work characterizes a new type of scaffolding complex, which we term a "shuffle complex", between the disordered hNHE1-tail...

  9. The Pentapeptide Repeat Proteins

    Energy Technology Data Exchange (ETDEWEB)

    Vetting,M.; Hegde, S.; Fajardo, J.; Fiser, A.; Roderick, S.; Takiff, H.; Blanchard, J.

    2006-01-01

    The Pentapeptide Repeat Protein (PRP) family has over 500 members in the prokaryotic and eukaryotic kingdoms. These proteins are composed of, or contain domains composed of, tandemly repeated amino acid sequences with a consensus sequence of [S, T,A, V][D, N][L, F]-[S, T,R][G]. The biochemical function of the vast majority of PRP family members is unknown. The three-dimensional structure of the first member of the PRP family was determined for the fluoroquinolone resistance protein (MfpA) from Mycobacterium tuberculosis. The structure revealed that the pentapeptide repeats encode the folding of a novel right-handed quadrilateral {beta}-helix. MfpA binds to DNA gyrase and inhibits its activity. The rod-shaped, dimeric protein exhibits remarkable size, shape and electrostatic similarity to DNA.

  10. Repeating the Past

    Science.gov (United States)

    Moore, John W.

    1998-05-01

    As part of the celebration of the Journal 's 75th year, we are scanning each Journal issue from 25, 50, and 74 years ago. Many of the ideas and practices described are so similar to present-day "innovations" that George Santayana's adage (1) "Those who cannot remember the past are condemned to repeat it" comes to mind. But perhaps "condemned" is too strong - sometimes it may be valuable to repeat something that was done long ago. One example comes from the earliest days of the Division of Chemical Education and of the Journal.

  11. All-optical repeater.

    Science.gov (United States)

    Silberberg, Y

    1986-06-01

    An all-optical device containing saturable gain, saturable loss, and unsaturable loss is shown to transform weak, distorted optical pulses into uniform standard-shape pulses. The proposed device performs thresholding, amplification, and pulse shaping as required from an optical repeater. It is shown that such a device could be realized by existing semiconductor technology.

  12. Bidirectional Manchester repeater

    Science.gov (United States)

    Ferguson, J.

    1980-01-01

    Bidirectional Manchester repeater is inserted at periodic intervals along single bidirectional twisted pair transmission line to detect, amplify, and transmit bidirectional Manchester 11 code signals. Requiring only 18 TTL 7400 series IC's, some line receivers and drivers, and handful of passive components, circuit is simple and relatively inexpensive to build.

  13. Casein kinase 2α regulates multidrug resistance-associated protein 1 function via phosphorylation of Thr249.

    Science.gov (United States)

    Stolarczyk, Elzbieta I; Reiling, Cassandra J; Pickin, Kerry A; Coppage, Ryan; Knecht, Marc R; Paumi, Christian M

    2012-09-01

    We have shown previously that the function of Ycf1p, yeast ortholog of multidrug resistance-associated protein 1 (MRP1), is regulated by yeast casein kinase 2α (Cka1p) via phosphorylation at Ser251. In this study, we explored whether casein kinase 2α (CK2α), the human homolog of Cka1p, regulates MRP1 by phosphorylation at the semiconserved site Thr249. Knockdown of CK2α in MCF7-derived cells expressing MRP1 [MRP1 CK2α(-)] resulted in increased doxorubicin sensitivity. MRP1-dependent transport of leukotriene C(4) and estradiol-17β-d-glucuronide into vesicles derived from MRP1 CK2α(-) cells was decreased compared with MRP1 vesicles. Moreover, mutation of Thr249 to alanine (MRP1-T249A) also resulted in decreased MRP1-dependent transport, whereas a phosphomimicking mutation (MRP1-T249E) led to dramatic increase in MRP1-dependent transport. Studies in tissue culture confirmed these findings, showing increased intracellular doxorubicin accumulation in MRP1 CK2α(-) and MRP1-T249A cells compared with MRP1 cells. Inhibition of CK2 kinase by 2-dimethylamino-4,5,6,7-tetrabromo-1H-benzimidazole resulted in increased doxorubicin accumulation in MRP1 cells, but not in MRP1 CK2α(-), MRP1-T249A, or MRP1-T249E cells, suggesting that CK2α regulates MRP1 function via phosphorylation of Thr249. Indeed, CK2α and MRP1 interact physically, and recombinant CK2 phosphorylates MRP1-derived peptide in vitro in a Thr249-dependent manner, whereas knockdown of CK2α results in decreased phosphorylation at MRP1-Thr249. The role of CK2 in regulating MRP1 was confirmed in other cancer cell lines where CK2 inhibition decreased MRP1-mediated efflux of doxorubicin and increased doxorubicin cytotoxicity. This study supports a model in which CK2α potentiates MRP1 function via direct phosphorylation of Thr249.

  14. The autophosphorylation and p34cdc2 phosphorylation sites of casein kinase-2 beta-subunit are not essential for reconstituting the fully-active heterotetrameric holoenzyme

    DEFF Research Database (Denmark)

    Meggio, F; Boldyreff, B; Issinger, O G;

    1993-01-01

    Two mutants of human casein kinase-2 beta-subunit with short deletions at either their amino (delta 1-4) or carboxy (delta 209-215) terminal side have been created that have lost the capability to undergo autophosphorylation and p34cdc2 mediated phosphorylation, respectively. Both mutants give rise...

  15. Mitogen-Activated Protein Kinase-Activated Protein Kinase 2 Deficiency Reduces Insulin Sensitivity in High-Fat Diet-Fed Mice

    NARCIS (Netherlands)

    de Boer, Jan Freark; Dikkers, Arne; Jurdzinski, Angelika; von Felden, Johann; Gaestel, Matthias; Bavendiek, Udo; Tietge, Uwe J. F.

    2014-01-01

    Adipose tissue inflammation is considered an important contributor to insulin resistance. Mitogen-activated protein kinase-activated protein kinase 2 (MK2) is a major downstream target of p38 MAPK and enhances inflammatory processes. In line with the role of MK2 as contributor to inflammation,

  16. Mitogen-Activated Protein Kinase-Activated Protein Kinase 2 Deficiency Reduces Insulin Sensitivity in High-Fat Diet-Fed Mice

    NARCIS (Netherlands)

    de Boer, Jan Freark; Dikkers, Arne; Jurdzinski, Angelika; von Felden, Johann; Gaestel, Matthias; Bavendiek, Udo; Tietge, Uwe J. F.

    2014-01-01

    Adipose tissue inflammation is considered an important contributor to insulin resistance. Mitogen-activated protein kinase-activated protein kinase 2 (MK2) is a major downstream target of p38 MAPK and enhances inflammatory processes. In line with the role of MK2 as contributor to inflammation, MK2(-

  17. Adrenal incidentaloma and the Janus Kinase 2 V617F mutation: A case-based review of the literature

    Directory of Open Access Journals (Sweden)

    Mustafa Unubol

    2013-01-01

    Full Text Available Adrenal incidentaloma was detected in an 81-year-old male patient and a 37-year-old female patient who had been diagnosed with essential thrombocytosis. Each patient′s Janus Kinase 2 (JAK2 V617F mutation was positive, and they were evaluated as having non-functional adrenal incidentaloma. The JAK2 activates the signal transducers and activators of transcription (STAT proteins which then activate the phosphoinositol-3 kinases, Ras, mitogen-activated protein (MAP kinases, and transcription. Constitutive activation causes cell proliferation and dysregulation of apoptosis. It is thought that STAT3 activation-mediated JAK family kinases have a central role in the solid tumor cell series. Permanent activation of STAT3 and STAT5 causes tumor cell proliferation, survival, metastasis, and an increase in tumor-mediated inflammation in solid and hematologic tumors. According to our literature screening, irregular JAK signaling, seen at the pathogenesis of many solid and hematologic tumors, has not been previously evaluated with regard to adrenal tumors. As a result, our cases are the first coexistence of JAK V617F mutation with adrenal incidentaloma in the literature. Because of this, we think that JAK2 mutation must be evaluated to clarify the etiology of adrenal incidentalomas.

  18. Gene expression analysis of microtubule affinity-regulating kinase 2 in non-small cell lung cancer

    Directory of Open Access Journals (Sweden)

    Erin A. Marshall

    2015-12-01

    Full Text Available Lung cancer is the leading cause of cancer death worldwide, and has a five-year survival rate of 18% [1]. MARK2 is a serine/threonine-protein kinase, and is a key component in the phosphorylation of microtubule-associated proteins [2,3]. A recent study published by Hubaux et al. found that microtubule affinity-regulating kinase 2 (MARK2 showed highly frequent DNA and RNA level disruption in lung cancer cell lines and independent non-small cell lung cancer (NSCLC cohorts [4]. These alterations result in the acquisition of oncogenic properties in cell lines, such as increased viability and anchorage-independent growth. Furthermore, a microarray-based transcriptome analysis of three short hairpin RNA (shRNA-mediated MARK2 knockdown lung adenocarcinoma cell lines (GEO#: GSE57966 revealed an association between MARK2 gene expression and cell cycle activation and DNA damage response. Here, we present a detailed description of transcriptome analysis to support the described role of MARK2 in promoting a malignant phenotype.

  19. Casein kinase 2 (CK2) phosphorylates the deubiquitylase OTUB1 at Ser16 to trigger its nuclear localization.

    Science.gov (United States)

    Herhaus, Lina; Perez-Oliva, Ana B; Cozza, Giorgio; Gourlay, Robert; Weidlich, Simone; Campbell, David G; Pinna, Lorenzo A; Sapkota, Gopal P

    2015-04-14

    The deubiquitylating enzyme OTUB1 is present in all tissues and targets many substrates, in both the cytosol and nucleus. We found that casein kinase 2 (CK2) phosphorylated OTUB1 at Ser(16) to promote its nuclear accumulation in cells. Pharmacological inhibition or genetic ablation of CK2 blocked the phosphorylation of OTUB1 at Ser(16), causing its nuclear exclusion in various cell types. Whereas we detected unphosphorylated OTUB1 mainly in the cytosol, we detected Ser(16)-phosphorylated OTUB1 only in the nucleus. In vitro, Ser(16)-phosphorylated OTUB1 and nonphosphorylated OTUB1 exhibited similar catalytic activity, bound K63-linked ubiquitin chains, and interacted with the E2 enzyme UBE2N. CK2-mediated phosphorylation and subsequent nuclear localization of OTUB1 promoted the formation of 53BP1 (p53-binding protein 1) DNA repair foci in the nucleus of osteosarcoma cells exposed to ionizing radiation. Our findings indicate that the activity of CK2 is necessary for the nuclear translocation and subsequent function of OTUB1 in DNA damage repair. Copyright © 2015, American Association for the Advancement of Science.

  20. Anticancer screening of medicinal plant phytochemicals against Cyclin-Dependent Kinase-2 (CDK2: An in-silico approach

    Directory of Open Access Journals (Sweden)

    Wajahat Khan

    2017-08-01

    Full Text Available Background: Cyclin-Dependent Kinase-2 (CDK2 is a member of serine/threonine protein kinases family and plays an important role in regulation of various eukaryotic cell division events. Over-expression of CDK2 during cell cycle may lead to several cellular functional aberrations including diverse types of cancers (lung cancer, primary colorectal carcinoma, ovarian cancer, melanoma and pancreatic carcinoma in humans. Medicinal plants phytochemicals which have anticancer potential can be used as an alternative drug resource. Methods: This study was designed to find out anticancer phytochemicals from medicinal plants which could inhibit CDK2 with the help of molecular docking technique. Molecular Operating Environment (MOE v2009 software was used to dock 2300 phytochemicals in this study. Results: The outcome of this study shows that four phytochemicals Kushenol T, Remangiflavanone B, Neocalyxins A and Elenoside showed the lowest S-score (-17.83, -17.57, -17.26, -17.17 respectively and binds strongly with all eight active residues Tyr15, Lys33, Ileu52, Lys56, Leu78, phe80, Asp145 and Phe146 of CDK2 binding site. These phytochemicals could successfully inhibit the CDK2. Conclusion: These phytochemicals can be considered as potential anticancer agents and used in drug development against CDK2. We anticipate that this study would pave way for phytochemical based novel small molecules as more efficacious and selective anti-cancer therapeutic compounds.

  1. Lemur tyrosine kinase-2 signalling regulates kinesin-1 light chain-2 phosphorylation and binding of Smad2 cargo.

    LENUS (Irish Health Repository)

    Manser, C

    2012-05-31

    A recent genome-wide association study identified the gene encoding lemur tyrosine kinase-2 (LMTK2) as a susceptibility gene for prostate cancer. The identified genetic alteration is within intron 9, but the mechanisms by which LMTK2 may impact upon prostate cancer are not clear because the functions of LMTK2 are poorly understood. Here, we show that LMTK2 regulates a known pathway that controls phosphorylation of kinesin-1 light chain-2 (KLC2) by glycogen synthase kinase-3β (GSK3β). KLC2 phosphorylation by GSK3β induces the release of cargo from KLC2. LMTK2 signals via protein phosphatase-1C (PP1C) to increase inhibitory phosphorylation of GSK3β on serine-9 that reduces KLC2 phosphorylation and promotes binding of the known KLC2 cargo Smad2. Smad2 signals to the nucleus in response to transforming growth factor-β (TGFβ) receptor stimulation and transport of Smad2 by kinesin-1 is required for this signalling. We show that small interfering RNA loss of LMTK2 not only reduces binding of Smad2 to KLC2, but also inhibits TGFβ-induced Smad2 signalling. Thus, LMTK2 may regulate the activity of kinesin-1 motor function and Smad2 signalling.

  2. Contribution of casein kinase 2 and spleen tyrosine kinase to CFTR trafficking and protein kinase A-induced activity.

    Science.gov (United States)

    Luz, Simão; Kongsuphol, Patthara; Mendes, Ana Isabel; Romeiras, Francisco; Sousa, Marisa; Schreiber, Rainer; Matos, Paulo; Jordan, Peter; Mehta, Anil; Amaral, Margarida D; Kunzelmann, Karl; Farinha, Carlos M

    2011-11-01

    Previously, the pleiotropic "master kinase" casein kinase 2 (CK2) was shown to interact with CFTR, the protein responsible for cystic fibrosis (CF). Moreover, CK2 inhibition abolished CFTR conductance in cell-attached membrane patches, native epithelial ducts, and Xenopus oocytes. CFTR possesses two CK2 phosphorylation sites (S422 and T1471), with unclear impact on its processing and trafficking. Here, we investigated the effects of mutating these CK2 sites on CFTR abundance, maturation, and degradation coupled to effects on ion channel activity and surface expression. We report that CK2 inhibition significantly decreased processing of wild-type (wt) CFTR, with no effect on F508del CFTR. Eliminating phosphorylation at S422 and T1471 revealed antagonistic roles in CFTR trafficking: S422 activation versus T1471 inhibition, as evidenced by a severe trafficking defect for the T1471D mutant. Notably, mutation of Y512, a consensus sequence for the spleen tyrosine kinase (SYK) possibly acting in a CK2 context adjacent to the common CF-causing defect F508del, had a strong effect on both maturation and CFTR currents, allowing the identification of this kinase as a novel regulator of CFTR. These results reinforce the importance of CK2 and the S422 and T1471 residues for regulation of CFTR and uncover a novel regulation of CFTR by SYK, a recognized controller of inflammation.

  3. Polo-like kinase 2-dependent phosphorylation of NPM/B23 on serine 4 triggers centriole duplication.

    Science.gov (United States)

    Krause, Annekatrin; Hoffmann, Ingrid

    2010-03-24

    Duplication of the centrosome is well controlled during faithful cell division while deregulation of this process leads to supernumary centrosomes, chromosome missegregation and aneuploidy, a hallmark of many cancer cells. We previously reported that Polo-like kinase 2 (Plk2) is activated near the G1/S phase transition, and regulates the reproduction of centrosomes. In search for Plk2 interacting proteins we have identified NPM/B23 (Nucleophosmin) as a novel Plk2 binding partner. We find that Plk2 and NPM/B23 interact in vitro in a Polo-box dependent manner. An association between both proteins was also observed in vivo. Moreover, we show that Plk2 phosphorylates NPM/B23 on serine 4 in vivo in S-phase. Notably, expression of a non-phosphorylatable NPM/B23 S4A mutant interferes with centriole reduplication in S-phase arrested cells and leads to a dilution of centriole numbers in unperturbed U2OS cells. The corresponding phospho-mimicking mutants have the opposite effect and their expression leads to the accumulation of centrioles. These findings suggest that NPM/B23 is a direct target of Plk2 in the regulation of centriole duplication and that phosphorylation on serine 4 can trigger this process.

  4. Polo-like kinase 2-dependent phosphorylation of NPM/B23 on serine 4 triggers centriole duplication.

    Directory of Open Access Journals (Sweden)

    Annekatrin Krause

    Full Text Available Duplication of the centrosome is well controlled during faithful cell division while deregulation of this process leads to supernumary centrosomes, chromosome missegregation and aneuploidy, a hallmark of many cancer cells. We previously reported that Polo-like kinase 2 (Plk2 is activated near the G1/S phase transition, and regulates the reproduction of centrosomes. In search for Plk2 interacting proteins we have identified NPM/B23 (Nucleophosmin as a novel Plk2 binding partner. We find that Plk2 and NPM/B23 interact in vitro in a Polo-box dependent manner. An association between both proteins was also observed in vivo. Moreover, we show that Plk2 phosphorylates NPM/B23 on serine 4 in vivo in S-phase. Notably, expression of a non-phosphorylatable NPM/B23 S4A mutant interferes with centriole reduplication in S-phase arrested cells and leads to a dilution of centriole numbers in unperturbed U2OS cells. The corresponding phospho-mimicking mutants have the opposite effect and their expression leads to the accumulation of centrioles. These findings suggest that NPM/B23 is a direct target of Plk2 in the regulation of centriole duplication and that phosphorylation on serine 4 can trigger this process.

  5. Inhibition of Pyruvate Dehydrogenase Kinase 2 Protects Against Hepatic Steatosis Through Modulation of Tricarboxylic Acid Cycle Anaplerosis and Ketogenesis.

    Science.gov (United States)

    Go, Younghoon; Jeong, Ji Yun; Jeoung, Nam Ho; Jeon, Jae-Han; Park, Bo-Yoon; Kang, Hyeon-Ji; Ha, Chae-Myeong; Choi, Young-Keun; Lee, Sun Joo; Ham, Hye Jin; Kim, Byung-Gyu; Park, Keun-Gyu; Park, So Young; Lee, Chul-Ho; Choi, Cheol Soo; Park, Tae-Sik; Lee, W N Paul; Harris, Robert A; Lee, In-Kyu

    2016-10-01

    Hepatic steatosis is associated with increased insulin resistance and tricarboxylic acid (TCA) cycle flux, but decreased ketogenesis and pyruvate dehydrogenase complex (PDC) flux. This study examined whether hepatic PDC activation by inhibition of pyruvate dehydrogenase kinase 2 (PDK2) ameliorates these metabolic abnormalities. Wild-type mice fed a high-fat diet exhibited hepatic steatosis, insulin resistance, and increased levels of pyruvate, TCA cycle intermediates, and malonyl-CoA but reduced ketogenesis and PDC activity due to PDK2 induction. Hepatic PDC activation by PDK2 inhibition attenuated hepatic steatosis, improved hepatic insulin sensitivity, reduced hepatic glucose production, increased capacity for β-oxidation and ketogenesis, and decreased the capacity for lipogenesis. These results were attributed to altered enzymatic capacities and a reduction in TCA anaplerosis that limited the availability of oxaloacetate for the TCA cycle, which promoted ketogenesis. The current study reports that increasing hepatic PDC activity by inhibition of PDK2 ameliorates hepatic steatosis and insulin sensitivity by regulating TCA cycle anaplerosis and ketogenesis. The findings suggest PDK2 is a potential therapeutic target for nonalcoholic fatty liver disease.

  6. An Activin Receptor IA/Activin-Like Kinase-2 (R206H Mutation in Fibrodysplasia Ossificans Progressiva

    Directory of Open Access Journals (Sweden)

    Rafael Herrera-Esparza

    2013-01-01

    Full Text Available Fibrodysplasia ossificans progressiva (FOP is an exceptionally rare genetic disease that is characterised by congenital malformations of the great toes and progressive heterotopic ossification (HO in specific anatomical areas. This disease is caused by a mutation in activin receptor IA/activin-like kinase-2 (ACVR1/ALK2. A Mexican family with one member affected by FOP was studied. The patient is a 19-year-old female who first presented with symptoms of FOP at 8 years old; she developed spontaneous and painful swelling of the right scapular area accompanied by functional limitation of movement. Mutation analysis was performed in which genomic DNA as PCR amplified using primers flanking exons 4 and 6, and PCR products were digested with Cac8I and HphI restriction enzymes. The most informative results were obtained with the exon 4 flanking primers and the Cac8I restriction enzyme, which generated a 253 bp product that carries the ACVR1 617G>A mutation, which causes an amino acid substitution of histidine for arginine at position 206 of the glycine-serine (GS domain, and its mutation results in the dysregulation of bone morphogenetic protein (BMP signalling that causes FOP.

  7. Paroxetine Is a Direct Inhibitor of G Protein-Coupled Receptor Kinase 2 and Increases Myocardial Contractility

    Energy Technology Data Exchange (ETDEWEB)

    Thal, David M. [Univ. of Michigan, Ann Arbor, MI (United States); Homan, Kristoff T. [Univ. of Michigan, Ann Arbor, MI (United States); Chen, Jun [Univ. of New Mexico Health Sciences Center, Albuquerque, NM (United States); Wu, Emily K. [Univ. of Michigan, Ann Arbor, MI (United States); Hinkle, Patricia M. [Univ. of Rochester Medical Center, Rochester, NY (United States); Huang, Z. Maggie [Temple Univ. School of Medicine, Philadelphia, Pennsylvania (United States); Chuprun, J. Kurt [Temple Univ. School of Medicine, Philadelphia, Pennsylvania (United States); Song, Jianliang [Temple Univ. School of Medicine, Philadelphia, Pennsylvania (United States); Gao, Erhe [Temple Univ. School of Medicine, Philadelphia, Pennsylvania (United States); Cheung, Joseph Y. [Temple Univ. School of Medicine, Philadelphia, Pennsylvania (United States); Sklar, Larry A. [Univ. of New Mexico Health Sciences Center, Albuquerque, NM (United States); Koch, Walter J. [Temple Univ. School of Medicine, Philadelphia, Pennsylvania (United States); Tesmer, John J.G. [Univ. of Michigan, Ann Arbor, MI (United States)

    2012-08-10

    G protein-coupled receptor kinase 2 (GRK2) is a well-established therapeutic target for the treatment of heart failure. In this paper we identify the selective serotonin reuptake inhibitor (SSRI) paroxetine as a selective inhibitor of GRK2 activity both in vitro and in living cells. In the crystal structure of the GRK2·paroxetine–Gβγ complex, paroxetine binds in the active site of GRK2 and stabilizes the kinase domain in a novel conformation in which a unique regulatory loop forms part of the ligand binding site. Isolated cardiomyocytes show increased isoproterenol-induced shortening and contraction amplitude in the presence of paroxetine, and pretreatment of mice with paroxetine before isoproterenol significantly increases left ventricular inotropic reserve in vivo with no significant effect on heart rate. Neither is observed in the presence of the SSRI fluoxetine. Our structural and functional results validate a widely available drug as a selective chemical probe for GRK2 and represent a starting point for the rational design of more potent and specific GRK2 inhibitors.

  8. Activated CaMKII Couples GluN2B and Casein Kinase 2 to Control Synaptic NMDA Receptors

    Directory of Open Access Journals (Sweden)

    Antonio Sanz-Clemente

    2013-03-01

    Full Text Available Synaptic activity triggers a profound reorganization of the molecular composition of excitatory synapses. For example, NMDA receptors are removed from synapses in an activity- and calcium-dependent manner, via casein kinase 2 (CK2 phosphorylation of the PDZ ligand of the GluN2B subunit (S1480. However, how synaptic activity drives this process remains unclear because CK2 is a constitutively active kinase, which is not directly regulated by calcium. We show here that activated CaMKII couples GluN2B and CK2 to form a trimolecular complex and increases CK2-mediated phosphorylation of GluN2B S1480. In addition, a GluN2B mutant, which contains an insert to mimic the GluN2A sequence and cannot bind to CaMKII, displays reduced S1480 phosphorylation and increased surface expression. We find that although disrupting GluN2B/CaMKII binding reduces synapse number, it increases synaptic-GluN2B content. Therefore, the GluN2B/CaMKII association controls synapse density and PSD composition in an activity-dependent manner, including recruitment of CK2 for the removal of GluN2B from synapses.

  9. MAPK-activated protein kinase 2 is required for mouse meiotic spindle assembly and kinetochore-microtubule attachment.

    Directory of Open Access Journals (Sweden)

    Ju Yuan

    Full Text Available MAPK-activated protein kinase 2 (MK2, a direct substrate of p38 MAPK, plays key roles in multiple physiological functions in mitosis. Here, we show for the first time the unique distribution pattern of MK2 in meiosis. Phospho-MK2 was localized on bipolar spindle minus ends and along the interstitial axes of homologous chromosomes extending over centromere regions and arm regions at metaphase of first meiosis (MI stage in mouse oocytes. At metaphase of second meiosis (MII stage, p-MK2 was localized on the bipolar spindle minus ends and at the inner centromere region of sister chromatids as dots. Knockdown or inhibition of MK2 resulted in spindle defects. Spindles were surrounded by irregular nondisjunction chromosomes, which were arranged in an amphitelic or syntelic/monotelic manner, or chromosomes detached from the spindles. Kinetochore-microtubule attachments were impaired in MK2-deficient oocytes because spindle microtubules became unstable in response to cold treatment. In addition, homologous chromosome segregation and meiosis progression were inhibited in these oocytes. Our data suggest that MK2 may be essential for functional meiotic bipolar spindle formation, chromosome segregation and proper kinetochore-microtubule attachments.

  10. Role of the ATM-checkpoint kinase 2 pathway in CDT-mediated apoptosis of gingival epithelial cells.

    Science.gov (United States)

    Alaoui-El-Azher, Mounia; Mans, Jeffrey J; Baker, Henry V; Chen, Casey; Progulske-Fox, Ann; Lamont, Richard J; Handfield, Martin

    2010-07-23

    The cytolethal distending toxin (CDT) of the oral pathogen Aggregatibacter actinomycetemcomitans induces cell cycle arrest and apoptosis in various cell types. Western analysis, pharmacological inhibition and siRNA silencing were performed in human immortalized gingival keratinocytes (HIGK) to dissect the functional role of the ataxia telangiectasia mutated (ATM) pathway in the signal transduction steps triggered by the CDT. Infection of HIGK was associated with a time-dependent induction of cytoplasmic histone-associated DNA fragmentation. However, in the absence of CDT, infected HIGK underwent reversible DNA strand breaks but not apoptosis, while caspase 3 activity, p21 levels, and HIGK viability were unaffected. Caspase 9 activity was attenuated in the CDT mutant-infected HIGK compared to wild-type infected cells. Pharmacological inhibition and siRNA-silencing of the ATM downstream effector, the protein kinase checkpoint kinase 2 (Chk2), significantly impacted CDT-mediated apoptosis. Together, these findings provide insight on the specificity of the ATM-Chk2 pathway in response to the CDT of A. actinomycetemcomitans in oral epithelial cells, which ultimately leads to apoptosis. We further propose the existence of an unidentified factor that is distinct from the CDT, and involved with a reversible DNA fragmentation that does not trigger terminal apoptosis in oral epithelial cells. This model potentially explains conflicting reports on the biological activity of the A. actinomycetemcomitans CDT.

  11. Role of the ATM-checkpoint kinase 2 pathway in CDT-mediated apoptosis of gingival epithelial cells.

    Directory of Open Access Journals (Sweden)

    Mounia Alaoui-El-Azher

    Full Text Available The cytolethal distending toxin (CDT of the oral pathogen Aggregatibacter actinomycetemcomitans induces cell cycle arrest and apoptosis in various cell types. Western analysis, pharmacological inhibition and siRNA silencing were performed in human immortalized gingival keratinocytes (HIGK to dissect the functional role of the ataxia telangiectasia mutated (ATM pathway in the signal transduction steps triggered by the CDT. Infection of HIGK was associated with a time-dependent induction of cytoplasmic histone-associated DNA fragmentation. However, in the absence of CDT, infected HIGK underwent reversible DNA strand breaks but not apoptosis, while caspase 3 activity, p21 levels, and HIGK viability were unaffected. Caspase 9 activity was attenuated in the CDT mutant-infected HIGK compared to wild-type infected cells. Pharmacological inhibition and siRNA-silencing of the ATM downstream effector, the protein kinase checkpoint kinase 2 (Chk2, significantly impacted CDT-mediated apoptosis. Together, these findings provide insight on the specificity of the ATM-Chk2 pathway in response to the CDT of A. actinomycetemcomitans in oral epithelial cells, which ultimately leads to apoptosis. We further propose the existence of an unidentified factor that is distinct from the CDT, and involved with a reversible DNA fragmentation that does not trigger terminal apoptosis in oral epithelial cells. This model potentially explains conflicting reports on the biological activity of the A. actinomycetemcomitans CDT.

  12. Duct Leakage Repeatability Testing

    Energy Technology Data Exchange (ETDEWEB)

    Walker, Iain [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Sherman, Max [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2014-01-01

    Duct leakage often needs to be measured to demonstrate compliance with requirements or to determine energy or Indoor Air Quality (IAQ) impacts. Testing is often done using standards such as ASTM E1554 (ASTM 2013) or California Title 24 (California Energy Commission 2013 & 2013b), but there are several choices of methods available within the accepted standards. Determining which method to use or not use requires an evaluation of those methods in the context of the particular needs. Three factors that are important considerations are the cost of the measurement, the accuracy of the measurement and the repeatability of the measurement. The purpose of this report is to evaluate the repeatability of the three most significant measurement techniques using data from the literature and recently obtained field data. We will also briefly discuss the first two factors. The main question to be answered by this study is to determine if differences in the repeatability of these tests methods is sufficient to indicate that any of these methods is so poor that it should be excluded from consideration as an allowed procedure in codes and standards.

  13. Identification of four genomic loci highly related to casein-kinase-2-alpha cDNA and characterization of a casein kinase-2-alpha pseudogene within the mouse genome

    DEFF Research Database (Denmark)

    Boldyreff, B; Wehr, K; Hecht, R;

    1992-01-01

    positive clone was further analyzed by sequencing a 3.1 kb XbaI fragment. This clone displays the characteristics of a pseudogene, i.e. lack of introns and several nucleotide insertions and deletions. In its 3' region it contains a 91 bp large CT-rich stretch which consists of (CCTT) and (CT) repeats...

  14. S-Nitrosylation of proline-rich tyrosine kinase 2 involves its activation induced by oxygen-glucose deprivation.

    Science.gov (United States)

    Yan, Xian-Liang; Liu, Dong-Hai; Zhang, Gong-Liang; Hu, Shu-Qun; Chen, Yu-Guo; Xu, Tie

    2015-06-15

    Previous studies have demonstrated that activation of proline-rich tyrosine kinase 2 (PYK2) in cerebral ischemia is involved in the modulation of N-methyl-d-aspartate-type (NMDA) glutamate receptor activity and Ca(2+) dynamics, resulting in ischemic neuron death ultimately. A number of reports indicate that PYK2 is a redox sensitive kinase that must be activated by an estrogen-induced reactive oxygen species (ROS). However, the mechanism of PYK2 activation remains incompletely illustrated. Accumulating attention is focused on nitric oxide (NO, a free radical) which plays a critical role in cellular signal transduction through stimulus-coupled S-nitrosylation of cysteine residues. Here we reported that PYK2 over-expressed in human embryonic kidney (HEK293) cells was S-nitrosylated (forming SNO-PYK2) by reacting with GSNO, an exogenous NO donor, at one critical cysteine residue (Cys534) with a biotin switch assay. Moreover, our results showed that S-nitrosylation and phosphorylation of PYK2 over-expressed in SH-SY5Y cells was significantly increased after oxygen-glucose deprivation (OGD). We further investigated whether the activation (phosphorylation) of PYK2 was associated with S-nitrosylation following SH-SY5Y cells OGD. Our results showed that the cysteine534 residue (site of S-nitrosylation) mutant PYK2 over-expressed in SH-SY5Y cells diminished S-nitrosylation of PYK2 and inhibited its phosphorylation induced by OGD. In addition, overexpression of the mutant PYK2 protein could prevent nuclear accumulation and abrogate neuronal cell death compared to wild type PYK2 in SH-SY5Y cells induced by OGD. These data suggest that the activation of PYK2 following OGD may be modulated by S-nitrosylation, which provides a new avenue for stroke therapy by targeting the post-translational modification machinery.

  15. TNFα inhibits IGFBP-3 through activation of p38α and casein kinase 2 in human retinal endothelial cells.

    Directory of Open Access Journals (Sweden)

    Qiuhua Zhang

    Full Text Available We recently reported a reciprocal relationship between tumor necrosis factor alpha (TNFα and insulin-like receptor growth factor binding protein 3 (IGFBP-3 in whole retina of normal and IGFBP-3 knockout mice. A similar relationship was also observed in cultured retinal endothelial cells (REC. We found that TNFα significantly reduced IGFBP-3 levels and vice-versa, IGFBP-3 can lower TNFα and TNFα receptor expression. Since IGFBP-3 is protective to the diabetic retina and TNFα is causative in the development of diabetic retinopathy, we wanted to better understand the cellular mechanisms by which TNFα can reduce IGFBP-3 levels. For these studies, primary human retinal endothelial cells (REC were used since these cells undergo TNFα-mediated apoptosis under conditions of high glucose conditions and contribute to diabetic retinopathy. We first cultured REC in normal or high glucose, treated with exogenous TNFα, then measured changes in potential signaling pathways, with a focus on P38 mitogen-activated protein kinase alpha (P38α and casein kinase 2 (CK2 as these pathways have been linked to both TNFα and IGFBP-3. We found that TNFα significantly increased phosphorylation of P38α and CK2. Furthermore, specific inhibitors of P38α or CK2 blocked TNFα inhibition of IGFBP-3 expression, demonstrating that TNFα reduces IGFBP-3 through activation of P38α and CK2. Since TNFα and IGFBP-3 are key mediators of retinal damage and protection respectively in diabetic retinopathy, increased understanding of the relationship between these two proteins will offer new therapeutic options for treatment.

  16. Molecular clone and characterization of c-Jun N-terminal kinases 2 from orange-spotted grouper, Epinephelus coioides.

    Science.gov (United States)

    Guo, Minglan; Wei, Jingguang; Zhou, Yongcan; Qin, Qiwei

    2016-02-01

    c-Jun N-terminal kinase 2 (JNK2) is a multifunctional mitogen-activated protein kinases involving in cell differentiation and proliferation, apoptosis, immune response and inflammatory conditions. In this study, we reported a new JNK2 (Ec-JNK2) derived from orange-spotted grouper, Epinephelus coioides. The full-length cDNA of Ec-JNK2 was 1920 bp in size, containing a 174 bp 5'-untranslated region (UTR), 483 bp 3'-UTR, and a 1263 bp open reading frame (ORF), which encoded a putative protein of 420 amino acids. The deduced protein sequence of Ec-JNK2 contained a conserved Thr-Pro-Tyr (TPY) motif in the domain of serine/threonine protein kinase (S-TKc). Ec-JNK2 has been found to involve in the immune response to pathogen challenges in vivo, and the infection of Singapore grouper iridovirus (SGIV) in vitro. Immunofluorescence staining showed that Ec-JNK2 was localized in the cytoplasm of grouper spleen (GS) cells, and moved to the nucleus after infecting with SGIV. Ec-JNK2 distributed in all immune-related tissues examined. After challenging with lipopolysaccharide (LPS), SGIV and polyriboinosinic polyribocytidylic acid (poly I:C), the mRNA expression of Ec-JNK2 was significantly (P orange-spotted grouper. Over-expressing Ec-JNK2 in fathead minnow (FHM) cells increased the SGIV infection and replication, while over-expressing the dominant-negative Ec-JNK2Δ181-183 mutant decreased it. These results indicated that Ec-JNK2 could be an important molecule in the successful infection and evasion of SGIV.

  17. Structural diversity of the active N-terminal kinase domain of p90 ribosomal S6 kinase 2.

    Directory of Open Access Journals (Sweden)

    Margarita Malakhova

    Full Text Available The p90 ribosomal protein kinase 2 (RSK2 is a highly expressed Ser/Thr kinase activated by growth factors and is involved in cancer cell proliferation and tumor promoter-induced cell transformation. RSK2 possesses two non-identical kinase domains, and the structure of its N-terminal domain (NTD, which is responsible for phosphorylation of a variety of substrates, is unknown. The crystal structure of the NTD RSK2 was determined at 1.8 A resolution in complex with AMP-PNP. The N-terminal kinase domain adopted a unique active conformation showing a significant structural diversity of the kinase domain compared to other kinases. The NTD RSK2 possesses a three-stranded betaB-sheet inserted in the N-terminal lobe, resulting in displacement of the alphaC-helix and disruption of the Lys-Glu interaction, classifying the kinase conformation as inactive. The purified protein was phosphorylated at Ser227 in the T-activation loop and exhibited in vitro kinase activity. A key characteristic is the appearance of a new contact between Lys216 (betaB-sheet and the beta-phosphate of AMP-PNP. Mutation of this lysine to alanine impaired both NTDs in vitro and full length RSK2 ex vivo activity, emphasizing the importance of this interaction. Even though the N-terminal lobe undergoes structural re-arrangement, it possesses an intact hydrophobic groove formed between the alphaC-helix, the beta4-strand, and the betaB-sheet junction, which is occupied by the N-terminal tail. The presence of a unique betaB-sheet insert in the N-lobe suggests a different type of activation mechanism for RSK2.

  18. WP1066 disrupts Janus kinase-2 and induces caspase-dependent apoptosis in acute myelogenous leukemia cells.

    Science.gov (United States)

    Ferrajoli, Alessandra; Faderl, Stefan; Van, Quin; Koch, Patricia; Harris, David; Liu, Zhiming; Hazan-Halevy, Inbal; Wang, Yongtao; Kantarjian, Hagop M; Priebe, Waldemar; Estrov, Zeev

    2007-12-01

    Several cytokines and growth factors that stimulate the proliferation of acute myelogenous leukemia (AML) cells transduce their signals by activating the transcription factor Janus-activated kinase 2 (JAK2). Accordingly, the inhibition of JAK2 or of its downstream signaling pathways suppresses the proliferation of AML cells. Because (E)-3(6-bromopyridin-2-yl)-2-cyano-N-((S0-1-phenylethyl)acrylamide) (WP1066) is a novel analogue of the JAK2 inhibitor AG490, we tested its activity in AML cells and investigated its mechanism of action. Using clonogenic assays, we found that although WP1066 had a marginal effect on normal marrow progenitors, it inhibited the proliferation of AML colony-forming cells obtained from patients with newly diagnosed AML and that of the AML cell lines OCIM2 and K562. WP1066 inhibited OCIM2 cell multiplication by inducing accumulation of cells at the G(0)-G(1) phase of the cell cycle. Similar to its parent compound AG490, WP1066 inhibited the phosphorylation of JAK2, but unlike AG490, WP1066 also degraded JAK2 protein, thereby blocking its downstream signal transducer and activator of transcription (STAT) and phosphoinositide-3-kinase pathways. These effects resulted in the activation of the caspase pathway. Incubation of both OCIM2 and K562 cells with WP1066 activated caspase-3, induced cleavage of poly(ADP-ribose) polymerase, and caused caspase-dependent apoptotic cell death. Thus, WP1066 is a potent JAK2 inhibitor whose effects in AML and other hematologic malignancies merit further investigation.

  19. Impaired angiogenesis during fracture healing in GPCR kinase 2 interacting protein-1 (GIT1 knock out mice.

    Directory of Open Access Journals (Sweden)

    Guoyong Yin

    Full Text Available G protein coupled receptor kinase 2 (GRK2 interacting protein-1 (GIT1, is a scaffold protein that plays an important role in angiogenesis and osteoclast activity. We have previously demonstrated that GIT1 knockout (GIT1 KO mice have impaired angiogenesis and dysregulated osteoclast podosome formation leading to a reduction in the bone resorbing ability of these cells. Since both angiogenesis and osteoclast-mediated bone remodeling are involved in the fracture healing process, we hypothesized that GIT1 participates in the normal progression of repair following bone injury. In the present study, comparison of fracture healing in wild type (WT and GIT1 KO mice revealed altered healing in mice with loss of GIT1 function. Alcian blue staining of fracture callus indicated a persistence of cartilagenous matrix in day 21 callus samples from GIT1 KO mice which was temporally correlated with increased type 2 collagen immunostaining. GIT1 KO mice also showed a decrease in chondrocyte proliferation and apoptosis at days 7 and 14, as determined by PCNA and TUNEL staining. Vascular microcomputed tomography analysis of callus samples at days 7, 14 and 21 revealed decreased blood vessel volume, number, and connection density in GIT1 KO mice compared to WT controls. Correlating with this, VEGF-A, phospho-VEGFR2 and PECAM1 (CD31 were decreased in GIT1 KO mice, indicating reduced angiogenesis with loss of GIT1. Finally, calluses from GIT1 KO mice displayed a reduced number of tartrate resistant acid phosphatase-positive osteoclasts at days 14 and 21. Collectively, these results indicate that GIT1 is an important signaling participant in fracture healing, with gene ablation leading to reduced callus vascularity and reduced osteoclast number in the healing callus.

  20. Casein kinase 2α regulates glioblastoma brain tumor-initiating cell growth through the β-catenin pathway.

    Science.gov (United States)

    Nitta, R T; Gholamin, S; Feroze, A H; Agarwal, M; Cheshier, S H; Mitra, S S; Li, G

    2015-07-01

    Glioblastoma (GBM) is the most common and fatal primary brain tumor in humans, and it is essential that new and better therapies are developed to treat this disease. Previous research suggests that casein kinase 2 (CK2) may be a promising therapeutic target for GBMs. CK2 has enhanced expression or activity in numerous cancers, including GBM, and it has been demonstrated that inhibitors of CK2 regressed tumor growth in GBM xenograft mouse models. Our studies demonstrate that the CK2 subunit, CK2α, is overexpressed in and has an important role in regulating brain tumor-initiating cells (BTIC) in GBM. Initial studies showed that two GBM cell lines (U87-MG and U138) transduced with CK2α had enhanced proliferation and anchorage-independent growth. Inhibition of CKα using siRNA or small-molecule inhibitors (TBBz, CX-4945) reduced cell growth, decreased tumor size, and increased survival rates in GBM xenograft mouse models. We also verified that inhibition of CK2α decreased the activity of a well-known GBM-initiating cell regulator, β-catenin. Loss of CK2α decreased two β-catenin-regulated genes that are involved in GBM-initiating cell growth, OCT4 and NANOG. To determine the importance of CK2α in GBM stem cell maintenance, we reduced CK2α activity in primary GBM samples and tumor spheres derived from GBM patients. We discovered that loss of CK2α activity reduced the sphere-forming capacity of BTIC and decreased numerous GBM stem cell markers, including CD133, CD90, CD49f and A2B5. Our study suggests that CK2α is involved in GBM tumorigenesis by maintaining BTIC through the regulation of β-catenin.

  1. A novel role of protein tyrosine kinase2 in mediating chloride secretion in human airway epithelial cells.

    Directory of Open Access Journals (Sweden)

    Lihua Liang

    Full Text Available Ca(2+ activated Cl(- channels (CaCC are up-regulated in cystic fibrosis (CF airway surface epithelia. The presence and functional properties of CaCC make it a possible therapeutic target to compensate for the deficiency of Cl(- secretion in CF epithelia. CaCC is activated by an increase in cytosolic Ca(2+, which not only activates epithelial CaCCs, but also inhibits epithelial Na(+ hyperabsorption, which may also be beneficial in CF. Our previous study has shown that spiperone, a known antipsychotic drug, activates CaCCs and stimulates Cl(- secretion in polarized human non-CF and CF airway epithelial cell monolayers in vitro, and in Cystic Fibrosis Transmembrane Conductance Regulator (CFTR knockout mice in vivo. Spiperone activates CaCC not by acting in its well-known role as an antagonist of either 5-HT2 or D2 receptors, but through a protein tyrosine kinase-coupled phospholipase C-dependent pathway. Moreover, spiperone independently activates CFTR through a novel mechanism. Herein, we performed a mass spectrometry analysis and identified the signaling molecule that mediates the spiperone effect in activating chloride secretion through CaCC and CFTR. Proline-rich tyrosine kinase 2 (PYK2 is a non-receptor protein tyrosine kinase, which belongs to the focal adhesion kinase family. The inhibition of PYK2 notably reduced the ability of spiperone to increase intracellular Ca(2+ and Cl(- secretion. In conclusion, we have identified the tyrosine kinase, PYK2, as the modulator, which plays a crucial role in the activation of CaCC and CFTR by spiperone. The identification of this novel role of PYK2 reveals a new signaling pathway in human airway epithelial cells.

  2. Repeatability of Cryogenic Multilayer Insulation

    Science.gov (United States)

    Johnson, W. L.; Vanderlaan, M.; Wood, J. J.; Rhys, N. O.; Guo, W.; Van Sciver, S.; Chato, D. J.

    2017-01-01

    Due to the variety of requirements across aerospace platforms, and one off projects, the repeatability of cryogenic multilayer insulation has never been fully established. The objective of this test program is to provide a more basic understanding of the thermal performance repeatability of MLI systems that are applicable to large scale tanks. There are several different types of repeatability that can be accounted for: these include repeatability between multiple identical blankets, repeatability of installation of the same blanket, and repeatability of a test apparatus. The focus of the work in this report is on the first two types of repeatability. Statistically, repeatability can mean many different things. In simplest form, it refers to the range of performance that a population exhibits and the average of the population. However, as more and more identical components are made (i.e. the population of concern grows), the simple range morphs into a standard deviation from an average performance. Initial repeatability testing on MLI blankets has been completed at Florida State University. Repeatability of five GRC provided coupons with 25 layers was shown to be +/- 8.4 whereas repeatability of repeatedly installing a single coupon was shown to be +/- 8.0. A second group of 10 coupons have been fabricated by Yetispace and tested by Florida State University, through the first 4 tests, the repeatability has been shown to be +/- 16. Based on detailed statistical analysis, the data has been shown to be statistically significant.

  3. Impact of recent genetic findings in Parkinson's disease.

    Science.gov (United States)

    Klein, Christine; Lohmann-Hedrich, Katja

    2007-08-01

    Parkinson's disease is the second most common age-related neurodegenerative disorder and is characterized clinically by classical parkinsonism and pathologically by selective loss of dopaminergic neurons in the substantia nigra and Lewy bodies. Although for most classical parkinsonism the etiology is unknown, a clear genetic component has been determined in a minority. Mutations in five causative genes combined [alpha-Synuclein (SNCA), Parkin, PTEN-induced kinase 1 (PINK1), DJ-1, Leucine-rich repeat kinase 2 (LRRK2)] account for 2-3% of all cases with classical parkinsonism, often clinically indistinguishable from idiopathic Parkinson's disease. The functional role of PINK1 and LRRK2 as kinases has been clearly established. Further, mutations in the ATP13A2 gene have been linked to Kufor-Rakeb syndrome (PARK9), a form of atypical parkinsonism. ATP13A2 encodes a lysosomal ATPase and shows elevated expression levels in the brains of sporadic patients, suggesting a potential role in the more common idiopathic Parkinson's disease. Finally, first promising pilot studies have been performed to identify differentially expressed genes and proteins as biomarkers for parkinsonism. The identification of single genes and their functional characterization has enhanced our understanding of the pathogenesis of parkinsonism, has led to improvement of diagnostic tools for genetic parkinsonism, and allows for the purposeful consideration of novel therapeutic targets.

  4. Mitogen-Activated Protein Kinase–Activated Protein Kinase 2 in Angiotensin II–Induced Inflammation and Hypertension

    Science.gov (United States)

    Ebrahimian, Talin; Li, Melissa Wei; Lemarié, Catherine A.; Simeone, Stefania M.C.; Pagano, Patrick J.; Gaestel, Matthias; Paradis, Pierre; Wassmann, Sven; Schiffrin, Ernesto L.

    2015-01-01

    Vascular oxidative stress and inflammation play an important role in angiotensin II–induced hypertension, and mitogen-activated protein kinases participate in these processes. We questioned whether mitogen-activated protein kinase–activated protein kinase 2 (MK2), a downstream target of p38 mitogen–activated protein kinase, is involved in angiotensin II–induced vascular responses. In vivo experiments were performed in wild-type and Mk2 knockout mice infused intravenously with angiotensin II. Angiotensin II induced a 30 mm Hg increase in mean blood pressure in wild-type that was delayed in Mk2 knockout mice. Angiotensin II increased superoxide production and vascular cell adhesion molecule-1 in blood vessels of wild-type but not in Mk2 knockout mice. Mk2 knockdown by small interfering RNA in mouse mesenteric vascular smooth muscle cells caused a 42% reduction in MK2 protein and blunted the angiotensin II–induced 40% increase of MK2 expression. Mk2 knockdown blunted angiotensin II–induced doubling of intracellular adhesion molecule-1 expression, 2.4-fold increase of nuclear p65, and 1.4-fold increase in Ets-1. Mk2 knockdown abrogated the angiotensin II–induced 4.7-fold and 1.3-fold increase of monocyte chemoattractant protein-1 mRNA and protein. Angiotensin II enhanced reactive oxygen species levels (by 29%) and nicotinamide adenine dinucleotide phosphate oxidase activity (by 48%), both abolished by Mk2 knockdown. Reduction of MK2 blocked angiotensin II–induced p47phox translocation to the membrane, associated with a 53% enhanced catalase expression. Angiotensin II–induced increase of MK2 was prevented by the nicotinamide adenine dinucleotide phosphate oxidase inhibitor Nox2ds-tat. Mk2 small interfering RNA prevented the angiotensin II–induced 30% increase of proliferation. In conclusion, MK2 plays a critical role in angiotensin II signaling, leading to hypertension, oxidative stress via activation of p47phox and inhibition of antioxidants, and

  5. A liquid phase based C. elegans behavioral analysis system identifies motor activity loss in a nematode Parkinson's disease model.

    Science.gov (United States)

    Zheng, Maohua; Gorelenkova, Olga; Yang, Jiong; Feng, Zhaoyang

    2012-03-15

    Motor activity of Caenorhabditis elegans is widely used to study the mechanisms ranging from basic neuronal functions to human neurodegenerative diseases. It may also serve as a paradigm to screen for potential therapeutic reagents treating these diseases. Here, we developed an automated, 96-well plate and liquid phase based system that quantifies nematode motor activity in real time. Using this system, we identified an adult-onset, ageing-associated motor activity loss in a transgenic nematode line expressing human pathogenic G2019S mutant LRRK2 (leucine-rich repeat kinase 2), the leading genetic cause of Parkinson's disease characterized by dopaminergic neurodegeneration associated motor deficient mainly in elder citizens. Thus, our system may be used as a platform to screen for potential therapeutic drugs treating Parkinson's disease. It can also be used to monitor motor activity of nematodes in liquid phase at similar scenario. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Polo-like kinase 2 acting as a promoter in human tumor cells with an abundance of TAp73

    Directory of Open Access Journals (Sweden)

    Hu ZB

    2015-11-01

    Full Text Available ZhengBo Hu,1,* ZunYing Xu,1,* XiaoHong Liao,2,* Xiao Yang,1 Cao Dong,1 KuaDi Luk,3 AnMin Jin,1,* Hai Lu4,5,* 1Department of Orthopedics, Zhujiang Hospital of Southern Medical University, 2The State Key Laboratory of Respiratory Diseases, the First Affiliated Hospital of Guangzhou Medical University, Guangzhou, Guangdong, 3Department of Orthopedics and Traumatology, The University of Hong Kong, Hong Kong, SAR, 4Department of Orthopedics, the Third Affiliated Hospital of the Southern Medical University, Guangzhou, Guangdong, 5Academy of Orthopedics, Guangdong Province, People’s Republic of China *These authors contributed equally to this work Background: TAp73, a member of the p53 tumor suppressor family, is frequently overexpressed in malignant tumors in humans. TAp73 abundance and phosphorylation modification result in variations in transcriptional activity. In a previous study, we found that the antitumor function of TAp73 was reactivated by dephosphorylation in head and neck squamous cell carcinomas. Polo-like kinase 2 (PLK2 displayed a close relationship with the p53 family in affecting the fate of cells. Herein, we investigate the hypothesis that PLK2 phosphorylates TAp73 and inhibits TAp73 function.Materials and methods: Head and neck squamous cell carcinoma cell lines and osteosarcoma cell lines were used as natural models of the different expression levels of TAp73. Phosphorylation predictor software Scansite 3.0 and the predictor GPS-polo 1.0 were used to analyze the phosphorylation sites. Coimmunoprecipitation, phosphor-tag Western blot, metabolic labeling, and indirect immunofluorescence assays were used to determine the interactions between PLK2 and TAp73. TAp73 activity was assessed by Western blot and reverse transcription polymerase chain reaction, which we used to detect P21 and PUMA, both downstream genes of TAp73. The physiological effects of PLK2 cross talk with TAp73 on cell cycle progress and apoptosis were observed by

  7. Expansion of protein domain repeats.

    Directory of Open Access Journals (Sweden)

    Asa K Björklund

    2006-08-01

    Full Text Available Many proteins, especially in eukaryotes, contain tandem repeats of several domains from the same family. These repeats have a variety of binding properties and are involved in protein-protein interactions as well as binding to other ligands such as DNA and RNA. The rapid expansion of protein domain repeats is assumed to have evolved through internal tandem duplications. However, the exact mechanisms behind these tandem duplications are not well-understood. Here, we have studied the evolution, function, protein structure, gene structure, and phylogenetic distribution of domain repeats. For this purpose we have assigned Pfam-A domain families to 24 proteomes with more sensitive domain assignments in the repeat regions. These assignments confirmed previous findings that eukaryotes, and in particular vertebrates, contain a much higher fraction of proteins with repeats compared with prokaryotes. The internal sequence similarity in each protein revealed that the domain repeats are often expanded through duplications of several domains at a time, while the duplication of one domain is less common. Many of the repeats appear to have been duplicated in the middle of the repeat region. This is in strong contrast to the evolution of other proteins that mainly works through additions of single domains at either terminus. Further, we found that some domain families show distinct duplication patterns, e.g., nebulin domains have mainly been expanded with a unit of seven domains at a time, while duplications of other domain families involve varying numbers of domains. Finally, no common mechanism for the expansion of all repeats could be detected. We found that the duplication patterns show no dependence on the size of the domains. Further, repeat expansion in some families can possibly be explained by shuffling of exons. However, exon shuffling could not have created all repeats.

  8. DWI Repeaters and Non-Repeaters: A Comparison.

    Science.gov (United States)

    Weeber, Stan

    1981-01-01

    Discussed how driving-while-intoxicated (DWI) repeaters differed signigicantly from nonrepeaters on 4 of 23 variables tested. Repeaters were more likely to have zero or two dependent children, attend church frequently, drink occasionally and have one or more arrests for public intoxication. (Author)

  9. To Repeat or Not to Repeat a Course

    Science.gov (United States)

    Armstrong, Michael J.; Biktimirov, Ernest N.

    2013-01-01

    The difficult transition from high school to university means that many students need to repeat (retake) 1 or more of their university courses. The authors examine the performance of students repeating first-year core courses in an undergraduate business program. They used data from university records for 116 students who took a total of 232…

  10. Nifty Nines and Repeating Decimals

    Science.gov (United States)

    Brown, Scott A.

    2016-01-01

    The traditional technique for converting repeating decimals to common fractions can be found in nearly every algebra textbook that has been published, as well as in many precalculus texts. However, students generally encounter repeating decimal numerals earlier than high school when they study rational numbers in prealgebra classes. Therefore, how…

  11. Nifty Nines and Repeating Decimals

    Science.gov (United States)

    Brown, Scott A.

    2016-01-01

    The traditional technique for converting repeating decimals to common fractions can be found in nearly every algebra textbook that has been published, as well as in many precalculus texts. However, students generally encounter repeating decimal numerals earlier than high school when they study rational numbers in prealgebra classes. Therefore, how…

  12. CK2(beta)tes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster

    DEFF Research Database (Denmark)

    Kalmykova, Alla I; Shevelyov, Yuri Y; Polesskaya, Oksana O

    2002-01-01

    An earlier described CK2(beta)tes gene of Drosophila melanogaster is shown to encode a male germline specific isoform of regulatory beta subunit of casein kinase 2. Western-analysis using anti-CK2(beta)tes Ig revealed CK2(beta)tes protein in Drosophila testes extract. Expression of a CK2(beta...... and coimmunoprecipitation analysis of protein extract from Drosophila testes, we demonstrated an association between CK2(beta)tes and CK2alpha. Northern-analysis has shown that another regulatory (beta') subunit found recently in D. melanogaster genome is also testis-specific. Thus, we describe the first example of two...

  13. Retraction: Open and closed conformations reveal induced fit movements in butyrate kinase 2 activation. J. Diao, Y. D. Ma, and M. S. Hasson.

    Science.gov (United States)

    2012-06-01

    The following article from Proteins: Structure, Function, and Bioinformatics, "Open and closed conformations reveal induced fit movements in butyrate kinase 2 activation," by Jiasheng Diao, Yunglin D. Ma, and Miriam S. Hasson, published online on 21 October 2010 in Wiley Online Library (onlinelibrary.wiley.com), has been retracted by agreement between the journal Editor in Chief, Bertrand Garcia-Moreno, and Wiley Periodicals. The retraction has been agreed because it was established by internal investigation performed by Purdue University that the authors of this article are not the owners of the data and have no right to publication.

  14. Concurrent Deletion of Cyclin E1 and Cyclin-Dependent Kinase 2 in Hepatocytes Inhibits DNA Replication and Liver Regeneration in Mice

    OpenAIRE

    Hu W; Nevzorova YA; Haas U; Moro N.; Sicinski P; Geng Y; Barbacid M; Trautwein C; Liedtke C.

    2014-01-01

    The liver has a strong regenerative capacity. After injury, quiescent hepatocytes can reenter the mitotic cell cycle to restore tissue homeostasis. This G0/G1-S cell-cycle transition of primed hepatocytes is regulated by complexes of cyclin-dependent kinase 2 (Cdk2) with E-type cyclins (CcnE1 or CcnE2). However, single genetic ablation of either E-cyclin or Cdk2 does not affect overall liver regeneration. Here, we systematically investigated the contribution of CcnE1, CcnE2, and Cdk2 for live...

  15. All-photonic quantum repeaters

    Science.gov (United States)

    Azuma, Koji; Tamaki, Kiyoshi; Lo, Hoi-Kwong

    2015-01-01

    Quantum communication holds promise for unconditionally secure transmission of secret messages and faithful transfer of unknown quantum states. Photons appear to be the medium of choice for quantum communication. Owing to photon losses, robust quantum communication over long lossy channels requires quantum repeaters. It is widely believed that a necessary and highly demanding requirement for quantum repeaters is the existence of matter quantum memories. Here we show that such a requirement is, in fact, unnecessary by introducing the concept of all-photonic quantum repeaters based on flying qubits. In particular, we present a protocol based on photonic cluster-state machine guns and a loss-tolerant measurement equipped with local high-speed active feedforwards. We show that, with such all-photonic quantum repeaters, the communication efficiency scales polynomially with the channel distance. Our result paves a new route towards quantum repeaters with efficient single-photon sources rather than matter quantum memories. PMID:25873153

  16. Analysis of repeated measures data

    CERN Document Server

    Islam, M Ataharul

    2017-01-01

    This book presents a broad range of statistical techniques to address emerging needs in the field of repeated measures. It also provides a comprehensive overview of extensions of generalized linear models for the bivariate exponential family of distributions, which represent a new development in analysing repeated measures data. The demand for statistical models for correlated outcomes has grown rapidly recently, mainly due to presence of two types of underlying associations: associations between outcomes, and associations between explanatory variables and outcomes. The book systematically addresses key problems arising in the modelling of repeated measures data, bearing in mind those factors that play a major role in estimating the underlying relationships between covariates and outcome variables for correlated outcome data. In addition, it presents new approaches to addressing current challenges in the field of repeated measures and models based on conditional and joint probabilities. Markov models of first...

  17. Crystal structure of human cyclin-dependent kinase-2 complex with MK2 inhibitor TEI-I01800: insight into the selectivity

    Energy Technology Data Exchange (ETDEWEB)

    Fujino, Aiko; Fukushima, Kei; Kubota, Takaharu; Kosugi, Tomomi; Takimoto-Kamimura, Midori, E-mail: m.kamimura@teijin.co.jp [Teijin Pharma Limited, 4-3-2 Asahigaoka, Hino-shi, Tokyo 191-8512 (Japan)

    2013-11-01

    The Gly-rich loop of cyclin-dependent kinase 2 (CDK2) bound to TEI-I01800 as an MK2 specific inhibitor forms a β-sheet which is a common structure in CDK2–ligand complexes. Here, the reason why TEI-I01800 does not become a strong inhibitor against CDK2 based on the conformation of TEI-I01800 is presented. Mitogen-activated protein kinase-activated protein kinase 2 (MK2 or MAPKAP-K2) is a Ser/Thr kinase from the p38 mitogen-activated protein kinase signalling pathway and plays an important role in inflammatory diseases. The crystal structure of the MK2–TEI-I01800 complex has been reported; its Gly-rich loop was found to form an α-helix, not a β-sheet as has been observed for other Ser/Thr kinases. TEI-I01800 is 177-fold selective against MK2 compared with CDK2; in order to understand the inhibitory mechanism of TEI-I01800, the cyclin-dependent kinase 2 (CDK2) complex structure with TEI-I01800 was determined at 2.0 Å resolution. Interestingly, the Gly-rich loop of CDK2 formed a β-sheet that was different from that of MK2. In MK2, TEI-I01800 changed the secondary structure of the Gly-rich loop from a β-sheet to an α-helix by collision between Leu70 and a p-ethoxyphenyl group at the 7-position and bound to MK2. However, for CDK2, TEI-I01800 bound to CDK2 without this structural change and lost the interaction with the substituent at the 7-position. In summary, the results of this study suggest that the reason for the selectivity of TEI-I01800 is the favourable conformation of TEI-I01800 itself, making it suitable for binding to the α-form MK2.

  18. High mobility group A-interacting proteins in cancer: focus on chromobox protein homolog 7, homeodomain interacting protein kinase 2 and PATZ

    Directory of Open Access Journals (Sweden)

    Monica Fedele

    2012-03-01

    Full Text Available The High Mobility Group A (HMGA proteins, a family of DNA architectural factors, by interacting with different proteins play crucial roles in neoplastic transformation of a wide range of tissues. Therefore, the search for HMGA-interacting partners was carried out by several laboratories in order to investigate the mechanisms underlying HMGA-dependent tumorigenesis. Three of the several HMGA-binding proteins are discussed in this review. These are the Chromobox family protein (chromobox protein homolog 7, CBX7, the homeodomain interacting protein kinase 2 (HIPK2 and the POZ/domain and Kruppel zinc finger family member, PATZ. All of them play a critical role in tumorigenesis, and may also be independent markers of cancer. Their activities are linked to cell cycle, apoptosis and senescence. In this review, we discuss the properties of each protein, including their effect on HMGA1 functions, and propose a model accounting for how their activities might be coordinated.

  19. Limitations on quantum key repeaters.

    Science.gov (United States)

    Bäuml, Stefan; Christandl, Matthias; Horodecki, Karol; Winter, Andreas

    2015-04-23

    A major application of quantum communication is the distribution of entangled particles for use in quantum key distribution. Owing to noise in the communication line, quantum key distribution is, in practice, limited to a distance of a few hundred kilometres, and can only be extended to longer distances by use of a quantum repeater, a device that performs entanglement distillation and quantum teleportation. The existence of noisy entangled states that are undistillable but nevertheless useful for quantum key distribution raises the question of the feasibility of a quantum key repeater, which would work beyond the limits of entanglement distillation, hence possibly tolerating higher noise levels than existing protocols. Here we exhibit fundamental limits on such a device in the form of bounds on the rate at which it may extract secure key. As a consequence, we give examples of states suitable for quantum key distribution but unsuitable for the most general quantum key repeater protocol.

  20. Hysteresis of magnetostructural transitions: Repeatable and non-repeatable processes

    Energy Technology Data Exchange (ETDEWEB)

    Provenzano, Virgil [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States); Della Torre, Edward; Bennett, Lawrence H. [Department of Electrical and Computer Engineering, The George Washington University, Washington, DC 20052 (United States); ElBidweihy, Hatem, E-mail: Hatem@gwmail.gwu.edu [Department of Electrical and Computer Engineering, The George Washington University, Washington, DC 20052 (United States)

    2014-02-15

    The Gd{sub 5}Ge{sub 2}Si{sub 2} alloy and the off-stoichiometric Ni{sub 50}Mn{sub 35}In{sub 15} Heusler alloy belong to a special class of metallic materials that exhibit first-order magnetostructural transitions near room temperature. The magnetic properties of this class of materials have been extensively studied due to their interesting magnetic behavior and their potential for a number of technological applications such as refrigerants for near-room-temperature magnetic refrigeration. The thermally driven first-order transitions in these materials can be field-induced in the reverse order by applying a strong enough field. The field-induced transitions are typically accompanied by the presence of large magnetic hysteresis, the characteristics of which are a complicated function of temperature, field, and magneto-thermal history. In this study we show that the virgin curve, the major loop, and sequentially measured MH loops are the results of both repeatable and non-repeatable processes, in which the starting magnetostructural state, prior to the cycling of field, plays a major role. Using the Gd{sub 5}Ge{sub 2}Si{sub 2} and Ni{sub 50}Mn{sub 35}In{sub 15} alloys, as model materials, we show that a starting single phase state results in fully repeatable processes and large magnetic hysteresis, whereas a mixed phase starting state results in non-repeatable processes and smaller hysteresis.

  1. EAMJ Dec. Repeatability.indd

    African Journals Online (AJOL)

    2008-12-12

    Dec 12, 2008 ... Results:Kappa values for four-week repeatability for the wheeze and asthma questions were 0.61 ... for logistic, cultural and ethical reasons, to use ... individual with baseline forced expiratory volume in .... period is likely to also include the effects of true ... data, the writing of the manuscript or the decision.

  2. Directionality switchable gain stabilized linear repeater

    Science.gov (United States)

    Ota, Takayuki; Ohmachi, Tadashi; Aida, Kazuo

    2004-10-01

    We propose a new approach to realize a bidirectional linear repeater suitable for future optical internet networks and fault location in repeater chain with OTDR. The proposed approach is the linear repeater of simple configuration whose directionality is rearranged dynamically by electrical control signal. The repeater is composed of a magneto-optical switch, a circulator, a dynamically gain stabilized unidirectional EDFA, and control circuits. The repeater directionality is rearranged as fast as 0.1ms by an electrical control pulse. It is experimentally confirmed that OTDR with the directionality switchable repeater is feasible for repeater chain. The detailed design and performance of the repeater are also discussed, including the multi-pass interference (MPI) which may arise in the proposed repeater, the effect of the MPI on SNR degradation of the repeater chain and the feed-forward EDFA gain control circuit.

  3. Measurement-based quantum repeaters

    CERN Document Server

    Zwerger, M; Briegel, H J

    2012-01-01

    We introduce measurement-based quantum repeaters, where small-scale measurement-based quantum processors are used to perform entanglement purification and entanglement swapping in a long-range quantum communication protocol. In the scheme, pre-prepared entangled states stored at intermediate repeater stations are coupled with incoming photons by simple Bell-measurements, without the need of performing additional quantum gates or measurements. We show how to construct the required resource states, and how to minimize their size. We analyze the performance of the scheme under noise and imperfections, with focus on small-scale implementations involving entangled states of few qubits. We find measurement-based purification protocols with significantly improved noise thresholds. Furthermore we show that already resource states of small size suffice to significantly increase the maximal communication distance. We also discuss possible advantages of our scheme for different set-ups.

  4. A Repeating Fast Radio Burst

    CERN Document Server

    Spitler, L G; Hessels, J W T; Bogdanov, S; Brazier, A; Camilo, F; Chatterjee, S; Cordes, J M; Crawford, F; Deneva, J; Ferdman, R D; Freire, P C C; Kaspi, V M; Lazarus, P; Lynch, R; Madsen, E C; McLaughlin, M A; Patel, C; Ransom, S M; Seymour, A; Stairs, I H; Stappers, B W; van Leeuwen, J; Zhu, W W

    2016-01-01

    Fast Radio Bursts are millisecond-duration astronomical radio pulses of unknown physical origin that appear to come from extragalactic distances. Previous follow-up observations have failed to find additional bursts at the same dispersion measures (i.e. integrated column density of free electrons between source and telescope) and sky position as the original detections. The apparent non-repeating nature of the fast radio bursts has led several authors to hypothesise that they originate in cataclysmic astrophysical events. Here we report the detection of ten additional bursts from the direction of FRB121102, using the 305-m Arecibo telescope. These new bursts have dispersion measures and sky positions consistent with the original burst. This unambiguously identifies FRB121102 as repeating and demonstrates that its source survives the energetic events that cause the bursts. Additionally, the bursts from FRB121102 show a wide range of spectral shapes that appear to be predominantly intrinsic to the source and wh...

  5. Repeatability of Harris Corner Detector

    Institute of Scientific and Technical Information of China (English)

    HU Lili

    2003-01-01

    Interest point detectors are commonly employed to reduce the amount of data to be processed. The ideal interest point detector would robustly select those features which are most appropriate or salient for the application and data at hand. This paper shows that interest points are geometrically stable under different transformations.This property makes interest points very successful in the context of image matching. To measure this property quantatively, we introduce a evaluation criterion: repeatability rate.

  6. Involvement of nucleotide diphosphate kinase 2 in the reopening of the sensitive period of filial imprinting of domestic chicks (Gallus gallus domesticus).

    Science.gov (United States)

    Yamaguchi, Shinji; Aoki, Naoya; Takehara, Akihiko; Mori, Masaru; Kanai, Akio; Matsushima, Toshiya; Homma, Koichi J

    2016-01-26

    Filial imprinting is a behavior characterized by the sensitive or critical period restricted to the first few days after hatching. Once the sensitive period is closed, it is widely believed that chicks can never be imprinted under natural conditions. Previously, we showed that the exogenous injection of T3 reopened the sensitive period which was already closed. That study suggested that T3 functioned by way of a rapid non-genomic action; however, the molecular mechanism of how T3 reopens the sensitive period remains unknown. Here, we show that the phosphorylation level of nucleotide diphosphate kinase 2 (NDPK2) was upregulated following T3 injection. Pharmacological deprivation of the kinase activity of NDPK hampered the molecular process prerequisite for the reopening of the sensitive period of filial imprinting. Moreover, it is shown that the kinase activity of NDPK2 participates in the priming process by T3 signaling which endows the potential for learning. Our data indicate that NDPK2 plays a crucial role downstream of T3 action and that its phosphorylation is involved in the non-genomic signaling during imprinting. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  7. Extracellular signal-regulated kinase 2 (ERK2) phosphorylation sites and docking domain on the nuclear pore complex protein Tpr cooperatively regulate ERK2-Tpr interaction.

    Science.gov (United States)

    Vomastek, Tomás; Iwanicki, Marcin P; Burack, W Richard; Tiwari, Divya; Kumar, Devanand; Parsons, J Thomas; Weber, Michael J; Nandicoori, Vinay Kumar

    2008-11-01

    Identifying direct substrates of mitogen-activated protein kinases (MAPKs) and understanding how those substrates are selected is central to understanding how these ubiquitously activated enzymes generate diverse biological responses. In previous work, we identified several new candidate substrates for the MAPK ERK2 (extracellular signal-regulated kinase 2), including the nuclear pore complex protein Tpr (translocated promoter region). In this report, we identify sites on Tpr for ERK2 phosphorylation and binding and demonstrate their functional interaction. ERK2 phosphorylation and dimerization are necessary for ERK2-Tpr binding, and this occurs through a DEF (docking site for ERK2, FXF) domain on Tpr. Surprisingly, the DEF domain and the phosphorylation sites displayed positive cooperativity to promote ERK2 binding to Tpr, in contrast to substrates where phosphorylation reduces binding. Ectopic expression or depletion of Tpr resulted in decreased movement of activated ERK2 from the cytoplasm to the nucleus, implying a role for Tpr in ERK2 translocation. Collectively, the data provide direct evidence that a component of the nuclear pore complex is a bona fide substrate of ERK2 in vivo and that activated ERK2 stably associates with this substrate after phosphorylation, where it could play a continuing role in nuclear pore function. We propose that Tpr is both a substrate and a scaffold for activated ERKs.

  8. Stability of the human Hsp90-p50Cdc37 chaperone complex against nucleotides and Hsp90 inhibitors, and the influence of phosphorylation by casein kinase 2.

    Science.gov (United States)

    Olesen, Sanne H; Ingles, Donna J; Zhu, Jin-Yi; Martin, Mathew P; Betzi, Stephane; Georg, Gunda I; Tash, Joseph S; Schönbrunn, Ernst

    2015-01-19

    The molecular chaperone Hsp90 is regulated by co-chaperones such as p50Cdc37, which recruits a wide selection of client protein kinases. Targeted disruption of the Hsp90-p50Cdc37 complex by protein-protein interaction (PPI) inhibitors has emerged as an alternative strategy to treat diseases characterized by aberrant Hsp90 activity. Using isothermal microcalorimetry, ELISA and GST-pull down assays we evaluated reported Hsp90 inhibitors and nucleotides for their ability to inhibit formation of the human Hsp90β-p50Cdc37 complex, reconstituted in vitro from full-length proteins. Hsp90 inhibitors, including the proposed PPI inhibitors gedunin and H2-gamendazole, did not affect the interaction of Hsp90 with p50Cdc37 in vitro. Phosphorylation of Hsp90 and p50Cdc37 by casein kinase 2 (CK2) did not alter the thermodynamic signature of complex formation. However, the phosphorylated complex was vulnerable to disruption by ADP (IC50 = 32 µM), while ATP, AMPPNP and Hsp90 inhibitors remained largely ineffective. The differential inhibitory activity of ADP suggests that phosphorylation by CK2 primes the complex for dissociation in response to a drop in ATP/ADP levels. The approach applied herein provides robust assays for a comprehensive biochemical evaluation of potential effectors of the Hsp90-p50Cdc37 complex, such as phosphorylation by a kinase or the interaction with small molecule ligands.

  9. Structural Characterization of Proline-rich Tyrosine Kinase 2 (PYK2) Reveals a Unique (DFG-out) Conformation and Enables Inhibitor Design

    Energy Technology Data Exchange (ETDEWEB)

    Han, Seungil; Mistry, Anil; Chang, Jeanne S.; Cunningham, David; Griffor, Matt; Bonnette, Peter C.; Wang, Hong; Chrunyk, Boris A.; Aspnes, Gary E.; Walker, Daniel P.; Brosius, Arthur D.; Buckbinder, Leonard; Pfizer

    2009-05-21

    Proline-rich tyrosine kinase 2 (PYK2) is a cytoplasmic, non-receptor tyrosine kinase implicated in multiple signaling pathways. It is a negative regulator of osteogenesis and considered a viable drug target for osteoporosis treatment. The high-resolution structures of the human PYK2 kinase domain with different inhibitor complexes establish the conventional bilobal kinase architecture and show the conformational variability of the DFG loop. The basis for the lack of selectivity for the classical kinase inhibitor, PF-431396, within the FAK family is explained by our structural analyses. Importantly, the novel DFG-out conformation with two diarylurea inhibitors (BIRB796, PF-4618433) reveals a distinct subclass of non-receptor tyrosine kinases identifiable by the gatekeeper Met-502 and the unique hinge loop conformation of Leu-504. This is the first example of a leucine residue in the hinge loop that blocks the ATP binding site in the DFG-out conformation. Our structural, biophysical, and pharmacological studies suggest that the unique features of the DFG motif, including Leu-504 hinge-loop variability, can be exploited for the development of selective protein kinase inhibitors.

  10. New scoring functions for virtual screening from molecular dynamics simulations with a quantum-refined force-field (QRFF-MD). Application to cyclin-dependent kinase 2.

    Science.gov (United States)

    Ferrara, Ph; Curioni, A; Vangrevelinghe, E; Meyer, T; Mordasini, T; Andreoni, W; Acklin, P; Jacoby, E

    2006-01-01

    A recently introduced new methodology based on ultrashort (50-100 ps) molecular dynamics simulations with a quantum-refined force-field (QRFF-MD) is here evaluated in its ability both to predict protein-ligand binding affinities and to discriminate active compounds from inactive ones. Physically based scoring functions are derived from this approach, and their performance is compared to that of several standard knowledge-based scoring functions. About 40 inhibitors of cyclin-dependent kinase 2 (CDK2) representing a broad chemical diversity were considered. The QRFF-MD method achieves a correlation coefficient, R(2), of 0.55, which is significantly better than that obtained by a number of traditional approaches in virtual screening but only slightly better than that obtained by consensus scoring (R(2) = 0.50). Compounds from the Available Chemical Directory, along with the known active compounds, were docked into the ATP binding site of CDK2 using the program Glide, and the 650 ligands from the top scored poses were considered for a QRFF-MD analysis. Combined with structural information extracted from the simulations, the QRFF-MD methodology results in similar enrichment of known actives compared to consensus scoring. Moreover, a new scoring function is introduced that combines a QRFF-MD based scoring function with consensus scoring, which results in substantial improvement on the enrichment profile.

  11. IκB Kinase 2 Is Essential for IgE-Induced Mast Cell De Novo Cytokine Production but Not for Degranulation

    Directory of Open Access Journals (Sweden)

    Katrin Peschke

    2014-09-01

    Full Text Available The immunoglobulin E (IgE-mediated mast cell (MC response is central to the pathogenesis of type I allergy and asthma. IκB kinase 2 (IKK2 was reported to couple IgE-induced signals to MC degranulation by phosphorylating the SNARE protein SNAP23. We investigated MC responses in mice with MC-specific inactivation of IKK2 or NF-κB essential modulator (NEMO, or animals with MC-specific expression of a mutant, constitutively active IKK2. We show that the IgE-induced late-phase cytokine response is reduced in mice lacking IKK2 or NEMO in MCs. However, anaphylactic in vivo responses of these animals are not different from those of control mice, and in vitro IKK2-deficient MCs readily phosphorylate SNAP23 and degranulate similarly to control cells in response to allergen or calcium ionophore. Constitutive overactivation of the NF-κB pathway has only slight effects on allergen-triggered MC responses. Thus, IKK2 is dispensable for MC degranulation, and the important question how IgE-induced signals trigger MC vesicle fusion remains open.

  12. Identification of a novel crosstalk between casein kinase 2α and NPM-ALK in ALK-positive anaplastic large cell lymphoma.

    Science.gov (United States)

    Armanious, Hanan; Gelebart, Pascal; Anand, Mona; Lai, Raymond

    2013-02-01

    It was previously reported that β-catenin contributes to the tumorigenesis of ALK-positive anaplastic large cell lymphoma (ALK(+)ALCL), and the oncogenic effects of β-catenin in these tumors are promoted by NPM-ALK, an abnormal fusion protein characteristic of ALK(+)ALCL. In this study, we hypothesized that NPM-ALK promotes the oncogenic activity of β-catenin via its functional interactions with the Wnt canonical pathway (WCP). To test this hypothesis, we examined if NPM-ALK modulates the gene expression of various members in the WCP. Using a Wnt pathway-specific oligonucleotide array and Western blots, we found that the expression of casein kinase 2α (CK2α) was substantially downregulated in ALK(+)ALCL cells in response to siRNA knockdown of NPM-ALK. CK2α is biologically important in ALK(+)ALCL, as its inhibition using 4,5,6,7-tetrabromobenzotriazole or siRNA resulted in a significant decrease in cell growth and a substantial decrease in the β-catenin protein level. Furthermore, CK2α co-immunoprecipitated with NPM-ALK and regulated its level of serine phosphorylation, a feature previously shown to correlate with the oncogenic potential of this fusion protein. To conclude, this study has revealed a novel crosstalk between NPM-ALK and CK2α, and our data supports the model that these two molecules work synergistically to promote the tumorigenicity of these lymphomas.

  13. Cdc2-like kinase 2 suppresses hepatic fatty acid oxidation and ketogenesis through disruption of the PGC-1α and MED1 complex.

    Science.gov (United States)

    Tabata, Mitsuhisa; Rodgers, Joseph T; Hall, Jessica A; Lee, Yoonjin; Jedrychowski, Mark P; Gygi, Steven P; Puigserver, Pere

    2014-05-01

    Hepatic ketogenesis plays an important role in catabolism of fatty acids during fasting along with dietary lipid overload, but the mechanisms regulating this process remain poorly understood. Here, we show that Cdc2-like kinase 2 (Clk2) suppresses fatty acid oxidation and ketone body production during diet-induced obesity. In lean mice, hepatic Clk2 protein is very low during fasting and strongly increased during feeding; however, in diet-induced obese mice, Clk2 protein remains elevated through both fed and fasted states. Liver-specific Clk2 knockout mice fed a high-fat diet exhibit increased fasting levels of blood ketone bodies, reduced respiratory exchange ratio, and increased gene expression of fatty acid oxidation and ketogenic pathways. This effect of Clk2 is cell-autonomous, because manipulation of Clk2 in hepatocytes controls genes and rates of fatty acid utilization. Clk2 phosphorylation of peroxisome proliferator-activated receptor γ coactivator (PGC-1α) disrupts its interaction with Mediator subunit 1, which leads to a suppression of PGC-1α activation of peroxisome proliferator-activated receptor α target genes in fatty acid oxidation and ketogenesis. These data demonstrate the importance of Clk2 in the regulation of fatty acid metabolism in vivo and suggest that inhibition of hepatic Clk2 could provide new therapies in the treatment of fatty liver disease.

  14. Combined use of pharmacokinetic modeling and a steady-state delivery approach allows early assessment of IkappaB kinase-2 (IKK-2) target safety and efficacy.

    Science.gov (United States)

    Chiang, Po-Chang; Kishore, Nandini N; Thompson, David C

    2010-03-01

    NF-kappaB activation is clearly linked to the pathogenesis of multiple inflammatory diseases including arthritis. The prominent role of IkappaB kinase-2 (IKK-2) in regulating NF-kappaB signaling in response to proinflammatory stimuli has made IKK-2 a primary anti-inflammation therapeutic target. PHA-408, a potent and selective IKK-2 inhibitor, was identified internally and used for our studies to assess this target. In early in vivo studies, PHA-408 demonstrated efficacy at high doses; however, the correlation between PHA-408 exposure and efficacy could not be established using standard dosing paradigms for the rat disease models. Similar concerns arose from early in vivo safety studies where appropriate NOAEL margins were not achieved. Following a full investigation of the physicochemical properties of the molecule and pharmacokinetic modeling, an oral steady-state delivery strategy was designed to administer PHA-408 to the rat for both efficacy and safety studies. Using this steady-state delivery, a clear dose-response relationship was established between plasma concentrations of PHA-408 and efficacy in the rat arthritis model. The same steady-state delivery approach was used to demonstrate the target safety. In summary, a combination of pharmacokinetic modeling with a steady-state delivery approach allowed us to establish confidence in both the mechanism and safety of the target.

  15. Association of factor V Leiden, Janus kinase 2, prothrombin, and MTHFR mutations with primary Budd-Chiari syndrome in Egyptian patients.

    Science.gov (United States)

    El Sebay, Hatem M; Safan, Manal A; Daoud, Ashraf A; Tayel, Safaa I; Nouh, Mohamed A; El Shafie, Shymaa

    2016-01-01

    Budd-Chiari syndrome (BCS) is defined as obstruction of hepatic venous outflow anywhere from the small hepatic veins to the suprahepatic inferior vena cava. The pathogenesis of BCS is still not fully understood. This study aimed to evaluate the association of factor V Leiden (FVL), Janus kinase 2 (JAK2), prothrombin, and methylene tetrahydrofolate reductase (MTHFR) mutations with primary BCS. The study was carried out on 35 patients with primary BCS and 15 age and gender matched healthy individuals as a control group. Genotyping of FVL, prothrombin, and MTHFR mutations was determined by GENEQUALITY AB-THROMBO TYPE kit based on the reverse hybridization principle. JAK2 mutation was determined by polymerase chain reaction-restriction fragment length polymorphism. There was a statistically significant difference between patients and controls regarding FVL, MTHFR C677T, and MTHFR A1298C mutations with odds ratio of 1.83, 2.0, and 1.79, respectively. Hetero MTHFR C677T, hetero FVL, and hetero MTHFR A1298C were the most common etiological factors being responsible for 57.1, 42.9, and 42.9% of primary BCS cases, respectively. It could be concluded that BCS is a multifactorial disease; in the current study, MTHFR C677T mutation was the most common cause of disease. Identification of one cause of BCS should not eliminate investigations for detection of other etiological factors. © 2015 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

  16. Pharmacological and safety evaluation of CIGB-300, a casein kinase 2 inhibitor peptide, administered intralesionally to patients with cervical cancer stage IB2/II

    Directory of Open Access Journals (Sweden)

    Soriano-García JL

    2013-08-01

    Full Text Available CIGB-300 is a pro-apoptotic casein kinase 2 inhibitor peptide with potential anticancer action. An open-label and dose scaling Phase I trial was carried out to investigate the peptide tumor uptake, pharmacokinetics, toxicity, and levels of a CIGB-300 response biomarker in patients with cervical cancer stage IB2/II. Fourteen patients were included; six of them received 35 mg, 6 received 70 mg and the two remaining patients received 245 mg of CIGB-300 prior chemoradiotherapy. CIGB-300 was applied by intratumor injections during 5-consecutive days. For pharmacokinetic and biodistribution studies, the peptide was radiolabeled with 99mTc in the first administration and whole body gammagraphy and plasma testing were done during 48 h. Data showed that the maximum tolerated dose was 70 mg for CIGB-300 in this clinical setting. Furthermore, an allergic-like syndrome was identified as the dose limiting toxicity, which was well-correlated with plasmatic histamine levels. Importantly, the mean tumor uptake was 14.9 mg and 10.4 mg for CIGB-300 doses of 35 and 70 mg, respectively. Also, the kidneys were the main target organ for drug elimination. Finally, treatment with CIGB-300 significantly reduced the B23/nucleophosmin levels in tumor specimens. CIGB-300 meets potentialities to be tested in future trials in a neoadjuvant setting prior to chemoradiotherapy in cervical cancer.

  17. Modulation of adrenal catecholamine secretion by in vivo gene transfer and manipulation of G protein-coupled receptor kinase-2 activity.

    Science.gov (United States)

    Lymperopoulos, Anastasios; Rengo, Giuseppe; Zincarelli, Carmela; Soltys, Stephen; Koch, Walter J

    2008-02-01

    We recently reported that the upregulation of adrenal G protein-coupled receptor kinase-2 (GRK2) causes enhanced catecholamine (CA) secretion by desensitizing sympatho-inhibitory alpha (2)-adrenergic receptors (alpha (2)ARs) of chromaffin cells, and thereby aggravating heart failure (HF). In this study, we sought to develop an efficient and reproducible in vivo adrenal gene transfer method to determine whether manipulation of adrenal GRK2 levels/activity regulates physiological CA secretion in rats. We specifically investigated two different in vivo gene delivery methods: direct injection into the suprarenal glands, and retrograde delivery through the suprarenal veins. We delivered adenoviral (Ad) vectors containing either GRK2 or an inhibitor of GRK2 activity, the beta ARKct. We found both delivery approaches equally effective at supporting robust (>80% of the whole organ) and adrenal-restricted transgene expression, in the cortical region as well as in the medullar region. Additionally, rats with AdGRK2-infected adrenals exhibit enhanced plasma CA levels when compared with control rats (AdGFP-injected adrenals), whereas plasma CA levels after Ad beta ARKct infection were significantly lower. Finally, in isolated chromaffin cells, alpha (2)ARs of AdGRK2-infected cells failed to inhibit CA secretion whereas Ad beta ARKct-infected cells showed normal alpha (2)AR responsiveness. These results not only indicate that in vivo adrenal gene transfer is an effective way of manipulating adrenal gland signalling, but also identify GRK2 as a critically important molecule involved in CA secretion.

  18. Expression, Purification, and Characterization of a Sucrose Nonfermenting 1-Related Protein Kinases 2 of Arabidopsis thaliana in E. coli-Based Cell-Free System

    Directory of Open Access Journals (Sweden)

    Xu Zhang

    2016-01-01

    Full Text Available The plant-specific sucrose nonfermenting 1-related protein kinase 2 (SnRK2 family is considered an important regulator of plant responses to abiotic stresses such as drought, cold, salinity, and nutrition deficiency. However, little information is available on how SnRK2s regulate sulfur deprivation responses in Arabidopsis. Large-scale production of SnRK2 kinases in vitro can help to elucidate the biochemical properties and physiological functions of this protein family. However, heterogenous expression of SnRK2s usually leads to inactive proteins. In this study, we expressed a recombinant Arabidopsis SnRK2.1 in a modified E. coli cell-free system, which combined two kinds of extracts allowing for a convenient and affordable protein preparation. The recombinant SnRK2.1 was produced in large-scale and the autophosphorylation activity of purified SnRK2.1 was characterized, allowing for further biochemical and substrate binding analysis in sulfur signaling. The application of this improved E. coli cell-free system provides us a promising and convenient platform to enhance expression of the target proteins economically.

  19. Stability of the Human Hsp90-p50Cdc37 Chaperone Complex against Nucleotides and Hsp90 Inhibitors, and the Influence of Phosphorylation by Casein Kinase 2

    Directory of Open Access Journals (Sweden)

    Sanne H. Olesen

    2015-01-01

    Full Text Available The molecular chaperone Hsp90 is regulated by co-chaperones such as p50Cdc37, which recruits a wide selection of client protein kinases. Targeted disruption of the Hsp90-p50Cdc37 complex by protein–protein interaction (PPI inhibitors has emerged as an alternative strategy to treat diseases characterized by aberrant Hsp90 activity. Using isothermal microcalorimetry, ELISA and GST-pull down assays we evaluated reported Hsp90 inhibitors and nucleotides for their ability to inhibit formation of the human Hsp90β-p50Cdc37 complex, reconstituted in vitro from full-length proteins. Hsp90 inhibitors, including the proposed PPI inhibitors gedunin and H2-gamendazole, did not affect the interaction of Hsp90 with p50Cdc37 in vitro. Phosphorylation of Hsp90 and p50Cdc37 by casein kinase 2 (CK2 did not alter the thermodynamic signature of complex formation. However, the phosphorylated complex was vulnerable to disruption by ADP (IC50 = 32 µM, while ATP, AMPPNP and Hsp90 inhibitors remained largely ineffective. The differential inhibitory activity of ADP suggests that phosphorylation by CK2 primes the complex for dissociation in response to a drop in ATP/ADP levels. The approach applied herein provides robust assays for a comprehensive biochemical evaluation of potential effectors of the Hsp90-p50Cdc37 complex, such as phosphorylation by a kinase or the interaction with small molecule ligands.

  20. Quantitative assay for the detection of the V617F variant in the Janus kinase 2 (JAK2 gene using the Luminex xMAP technology

    Directory of Open Access Journals (Sweden)

    Gaudet Daniel

    2010-04-01

    Full Text Available Abstract Background The availability of clinically valid biomarkers contribute to improve the diagnosis and clinical management of diseases. A valine-to-phenylalanine substitution at position 617 (V617F in the Janus kinase 2 (JAK2 gene has been recently associated with key signaling abnormalities in the transduction of haemopoietic growth-factor receptors and is now considered as a useful clinical marker of myeloproliferative neoplasms. Several methods have recently been reported to detect the JAK2 V617F point mutation and show variable sensitivity. Methods Using the Luminex xMAP technology, we developed a quantitative assay to detect the JAK2V617F variant. The method was based on polymerase chain reaction (PCR followed by hybridization to specific probes coupled with internally dyed microspheres. The assay comprises 3 steps: genomic DNA extraction, end point PCR reaction, direct hybridization of PCR fragments and quantification. It has been tested with different sources of nucleic acid. Results Applied to whole blood samples, this quantitative assay showed a limit of detection of 2%. A highly sensitive allele-specific primer extension reaction performed in parallel allowed to validate the results and to identify the specimens with values below 2%. Conclusion Direct hybridization assay using the Luminex xMAP technology allows sensitive quantification of JAK2V617F from blood spots. It is simple and can be easily performed in a clinical setting.

  1. Stability of the Human Hsp90-p50Cdc37 Chaperone Complex against Nucleotides and Hsp90 Inhibitors, and the Influence of Phosphorylation by Casein Kinase 2

    Science.gov (United States)

    Olesen, Sanne H.; Ingles, Donna J.; Zhu, Jin-Yi; Martin, Mathew P.; Betzi, Stephane; Georg, Gunda I.; Tash, Joseph S.; Schönbrunn, Ernst

    2015-01-01

    The molecular chaperone Hsp90 is regulated by co-chaperones such as p50Cdc37, which recruits a wide selection of client protein kinases. Targeted disruption of the Hsp90-p50Cdc37 complex by protein-protein interaction (PPI) inhibitors has emerged as an alternative strategy to treat diseases characterized by aberrant Hsp90 activity. Using isothermal microcalorimetry, ELISA and GST-pull down assays we evaluated reported Hsp90 inhibitors and nucleotides for their ability to inhibit formation of the human Hsp90β-p50Cdc37 complex, reconstituted in-vitro from full-length proteins. Hsp90 inhibitors, including the proposed PPI inhibitors gedunin and H2-gamendazole, did not affect the interaction of Hsp90 with p50Cdc37 in vitro. Phosphorylation of Hsp90 and p50Cdc37 by casein kinase 2 (CK2) did not alter the thermodynamic signature of complex formation. However, the phosphorylated complex was vulnerable to disruption by ADP (IC50 = 32 µM), while ATP, AMPPNP and Hsp90 inhibitors remained largely ineffective. The differential inhibitory activity of ADP suggests that phosphorylation by CK2 primes the complex for dissociation in response to a drop in ATP/ADP levels. The approach applied herein provides robust assays for a comprehensive biochemical evaluation of potential effectors of the Hsp90-p50Cdc37 complex, such as phosphorylation by a kinase or the interaction with small molecule ligands. PMID:25608045

  2. Origin and fate of repeats in bacteria.

    Science.gov (United States)

    Achaz, G; Rocha, E P C; Netter, P; Coissac, E

    2002-07-01

    We investigated 53 complete bacterial chromosomes for intrachromosomal repeats. In previous studies on eukaryote chromosomes, we proposed a model for the dynamics of repeats based on the continuous genesis of tandem repeats, followed by an active process of high deletion rate, counteracted by rearrangement events that may prevent the repeats from being deleted. The present study of long repeats in the genomes of Bacteria and Archaea suggests that our model of interspersed repeats dynamics may apply to them. Thus the duplication process might be a consequence of very ancient mechanisms shared by all three domains. Moreover, we show that there is a strong negative correlation between nucleotide composition bias and the repeat density of genomes. We hypothesise that in highly biased genomes, non-duplicated small repeats arise more frequently by random effects and are used as primers for duplication mechanisms, leading to a higher density of large repeats.

  3. Improving repeatability by improving quality

    Energy Technology Data Exchange (ETDEWEB)

    Ronen, Shuki; Ackers, Mark; Schlumberger, Geco-Prakla; Brink, Mundy

    1998-12-31

    Time lapse (4-D) seismic is a promising tool for reservoir characterization and monitoring. The method is apparently simple: to acquire data repeatedly over the same reservoir, process and interpret the data sets, then changes between the data sets indicate changes in the reservoir. A problem with time lapse seismic data is that reservoirs are a relatively small part of the earth and important reservoir changes may cause very small differences to the time lapse data. The challenge is to acquire and process economical time lapse data such that reservoir changes can be detected above the noise of varying acquisition and environment. 7 refs., 9 figs.

  4. Coordinated hybrid automatic repeat request

    KAUST Repository

    Makki, Behrooz

    2014-11-01

    We develop a coordinated hybrid automatic repeat request (HARQ) approach. With the proposed scheme, if a user message is correctly decoded in the first HARQ rounds, its spectrum is allocated to other users, to improve the network outage probability and the users\\' fairness. The results, which are obtained for single- and multiple-antenna setups, demonstrate the efficiency of the proposed approach in different conditions. For instance, with a maximum of M retransmissions and single transmit/receive antennas, the diversity gain of a user increases from M to (J+1)(M-1)+1 where J is the number of users helping that user.

  5. Crowding by a repeating pattern.

    Science.gov (United States)

    Rosen, Sarah; Pelli, Denis G

    2015-01-01

    Theinability to recognize a peripheral target among flankers is called crowding. For a foveal target, crowding can be distinguished from overlap masking by its sparing of detection, linear scaling with eccentricity, and invariance with target size.Crowding depends on the proximity and similarity of the flankers to the target. Flankers that are far from or dissimilar to the target do not crowd it. On a gray page, text whose neighboring letters have different colors, alternately black and white, has enough dissimilarity that it might escape crowding. Since reading speed is normally limited by crowding, escape from crowding should allow faster reading. Yet reading speed is unchanged (Chung & Mansfield, 2009). Why? A recent vernier study found that using alternating-color flankers produces strong crowding (Manassi, Sayim, & Herzog, 2012). Might that effect occur with letters and reading? Critical spacing is the minimum center-to-center target-flanker spacing needed to correctly identify the target. We measure it for a target letter surrounded by several equidistant flanker letters of the same polarity, opposite polarity, or mixed polarity: alternately white and black. We find strong crowding in the alternating condition, even though each flanker letter is beyond its own critical spacing (as measured in a separate condition). Thus a periodic repeating pattern can produce crowding even when the individual elements do not. Further, in all conditions we find that, once a periodic pattern repeats (two cycles), further repetition does not affect critical spacing of the innermost flanker.

  6. Automatization and familiarity in repeated checking

    NARCIS (Netherlands)

    Dek, Eliane C P; van den Hout, Marcel A.; Giele, Catharina L.; Engelhard, Iris M.

    2014-01-01

    Repeated checking paradoxically increases memory uncertainty. This study investigated the underlying mechanism of this effect. We hypothesized that as a result of repeated checking, familiarity with stimuli increases, and automatization of the checking procedure occurs, which should result in decrea

  7. CDC Vital Signs: Preventing Repeat Teen Births

    Science.gov (United States)

    ... file Error processing SSI file Preventing Repeat Teen Births Recommend on Facebook Tweet Share Compartir On this ... Too many teens, ages 15–19, have repeat births. Nearly 1 in 5 births to teens, ages ...

  8. Expanded complexity of unstable repeat diseases

    OpenAIRE

    Polak, Urszula; McIvor, Elizabeth; Dent, Sharon Y.R.; Wells, Robert D.; Napierala, Marek.

    2012-01-01

    Unstable Repeat Diseases (URDs) share a common mutational phenomenon of changes in the copy number of short, tandemly repeated DNA sequences. More than 20 human neurological diseases are caused by instability, predominantly expansion, of microsatellite sequences. Changes in the repeat size initiate a cascade of pathological processes, frequently characteristic of a unique disease or a small subgroup of the URDs. Understanding of both the mechanism of repeat instability and molecular consequen...

  9. 酪蛋白激酶2结合并磷酸化ataxin-3%Casein kinase 2 interacts with and phosphorylates ataxin-3

    Institute of Scientific and Technical Information of China (English)

    陶瑞松; 费尔康; 应征; 王洪枫; 王光辉

    2008-01-01

    目的 马查多-约瑟夫病/脊髓小脑共济失调3型,是由MJDI基因产物ataxin-3的C-末端的多聚谷氨酰胺发生重复扩展突变而引起的一种常染色体显性遗传的神经退行性疾病,目前它的发病机制还不清楚.很多研究表明磷酸化修饰作用在很多神经退行性疾病的发病过程中起到重要作用,然而已知可以磷酸化ataxin-3的激酶仍然很少.本研究的目的是探讨酪蛋白激酶2(Casein kinase 2,CK2)对于ataxin-3的磷酸化作用.方法 通过GST pulldown和免疫共沉淀技术鉴定ataxin-3和CK2的相互作用.通过体外磷酸化技术检测CK2对ataxin-3的磷酸化.结果 (1)正常和扩展突变型ataxin-3在体外与CK2α、β亚单位均发生相互作用;(2)在293细胞中正常和扩展突变型ataxin-3只和CK2β亚单位相互作用,而与α亚单位没有结合;(3)正常和扩展突变型ataxin-3都可以被CK2磷酸化.结论 Ataxin-3是蛋白激酶CK2的底物.%Objective Machado-Joseph disease(MJD)/Spinocerebellar ataxia type 3(SCA3)is an autosomal dominant neurodegenerative disorder caused by an expansion of polyglutamine tract near the C-terminus of the MJDI gene product,ataxin-3.The precise mechanism of the MJD/SCA3 pathogenesis remains unclear.A growing body of evidence demonstrates that phosphorylation plays an important role in the pathogenesis of many neurodegenerative diseases.However,few kinases are known to phosphorylate ataxin-3.The present study is to explore whether ataxin-3 is a substrate of casein kinase 2 (CK2).Methods The interaction between ataxin-3 and CK2 was identified by glutathione S-transferase (GST) pull-down assay and co-immunoprecipition assay.The phosphorylation of ataxin-3 by CK2 was measured by in vitro phosphorylation assays.Results (1) Both wild type and expanded ataxin-3 interacted with CK2α and CK2β in vitro.(2) In 293 cells,both wild type and expanded ataxin-3 interacted with CK2β,but not CK2α.(3) CK2 phosphorylated wild type and

  10. Inhibition of Casein kinase-2 induces p53-dependent cell cycle arrest and sensitizes glioblastoma cells to tumor necrosis factor (TNFα)-induced apoptosis through SIRT1 inhibition.

    Science.gov (United States)

    Dixit, D; Sharma, V; Ghosh, S; Mehta, V S; Sen, E

    2012-02-09

    Glioblastoma multiforme (GBM) are resistant to TNFα-induced apoptosis and blockade of TNFα-induced NF-κB activation sensitizes glioma cells to apoptosis. As Casein kinase-2 (CK2) induces aberrant NF-κB activation and as we observed elevated CK2 levels in GBM tumors, we investigated the potential of CK2 inhibitors (CK2-Is) - DRB and Apigenin in sensitizing glioma cells to TNFα-induced apoptosis. CK2-Is and CK2 small interfering RNA (siRNA) reduced glioma cell viability, inhibited TNFα-mediated NF-κB activation, and sensitized cell to TNFα-induced apoptosis. Importantly, CK2-Is activated p53 function in wild-type but not in p53 mutant cells. Activation of p53 function involved its increased transcriptional activation, DNA-binding ability, increased expression of p53 target genes associated with cell cycle progression and apoptosis. Moreover, CK2-Is decreased telomerase activity and increased senescence in a p53-dependent manner. Apoptotic gene profiling indicated that CK2-Is differentially affect p53 and TNFα targets in p53 wild-type and mutant glioma cells. CK2-I decreased MDM2-p53 association and p53 ubiquitination to enhance p53 levels. Interestingly, CK2-Is downregulated SIRT1 activity and over-expression of SIRT1 decreased p53 transcriptional activity and rescued cells from CK2-I-induced apoptosis. This ability of CK2-Is to sensitize glioma to TNFα-induced death via multiple mechanisms involving abrogation of NF-κB activation, reactivation of wild-type p53 function and SIRT1 inhibition warrants investigation.

  11. Casein Kinase 2 Is a Novel Regulator of the Human Organic Anion Transporting Polypeptide 1A2 (OATP1A2) Trafficking.

    Science.gov (United States)

    Chan, Ting; Cheung, Florence Shin Gee; Zheng, Jian; Lu, Xiaoxi; Zhu, Ling; Grewal, Thomas; Murray, Michael; Zhou, Fanfan

    2016-01-04

    Human organic anion transporting polypeptides (OATPs) mediate the influx of many important drugs into cells. Casein kinase 2 (CK2) is a critical protein kinase that phosphorylates >300 protein substrates and is dysregulated in a number of disease states. Among the CK2 substrates are several transporters, although whether this includes human OATPs has not been evaluated. The current study was undertaken to evaluate the regulation of human OATP1A2 by CK2. HEK-239T cells in which OATP1A2 was overexpressed were treated with CK2 specific inhibitors or transfected with CK2 specific siRNA, and the activity, expression, and subcellular trafficking of OATP1A2 was evaluated. CK2 inhibition decreased the uptake of the prototypic OATP1A2 substrate estrone-3-sulfate (E3S). Kinetic studies revealed that this was due to a decrease in the maximum velocity (Vmax) of E3S uptake, while the Michaelis constant was unchanged. The cell surface expression, but not the total cellular expression of OATP1A2, was impaired by CK2 inhibition and knockdown of the catalytic α-subunits of CK2. CK2 inhibition decreased the internalization of OATP1A2 via a clathrin-dependent pathway, decreased OATP1A2 recycling, and likely impaired OATP1A2 targeting to the cell surface. Consistent with these findings, CK2 inhibition also disrupted the colocalization of OATP1A2 and Rab GTPase (Rab)4-, Rab8-, and Rab9-positive endosomal and secretory vesicles. Taken together, CK2 has emerged as a novel regulator of the subcellular trafficking and stability of OATP1A2. Because OATP1A2 transports many molecules of physiological and pharmacological importance, the present data may inform drug selection in patients with diseases in which CK2 and OATP1A2 are dysregulated.

  12. Artocarpus altilis CG-901 alters critical nodes in the JH1-kinase domain of Janus kinase 2 affecting upstream JAK/STAT3 signaling.

    Science.gov (United States)

    Nash, Oyekanmi; Omotuyi, Olaposi; Lee, Joonku; Kwon, Byoung-Mog; Ogbadu, Lucy

    2015-11-01

    As a key step in achieving low-cost, easily accessible anti-cancer therapy for low- and middle-income countries, we recently established the scientific basis for the folkloric use of Artocarpus altilis for the treatment of cancer by investigating the geranyl dihydrochalcone (CG-901) content and its interference with signal transducer and activator of transcription 3 (STAT3) phosphorylation and blockage of further downstream signaling. In the current study, the CG-901 upstream target was queried by chemical fingerprinting similarity assessment, semi-empirical (PM6ESCF) QMMM and molecular dynamics (MD) simulation. Moderate (∼0.4) to high (∼0.7) Tanimoto scores were found when the CG-901 scaffold was compared to ligands co-crystallized with Janus kinases (JAK) 1-3. High negative energy values were obtained when the CG-901 was treated semi-empirically (PM6ESCF) within the classical field of JAK (1-3). Multiple nanosecond MD simulations showed that CG-901 did not cause any large structural perturbations in the nucleotide-binding, activation and catalytic loops within the kinase (JH1) domain of JAK (1-3); however, it reduced the energy required to attain metastability along the path to energy minima conformation. In comparison to JAK1 and Apo-state JAK2, JAK2-bound CG-901 exhibited a highly re-organized key intra-domain protein network; indicating atomic level interference with inter-residue communication. In conclusion, CG-901 isolated from A. altilis represents a broad-spectrum JAK inhibitor, which may underlie the mechanism of STAT3 phosphorylation blockage. Graphical abstract Upper panel Janus kinase 2 upstream signaling pathway. Lower panel Apo-JAK2 (left) and CG-901-bound JAK2 (right).

  13. Pharmacological inhibition of Polo Like Kinase 2 (PLK2) does not cause chromosomal damage or result in the formation of micronuclei

    Energy Technology Data Exchange (ETDEWEB)

    Fitzgerald, Kent, E-mail: Kent.fitzgerald@elan.com [Pharmacological Sciences, Elan Pharmaceuticals Inc., 180 Oyster Point Boulevard, South San Francisco, CA 94080 (United States); Bergeron, Marcelle, E-mail: Marcelle.bergeron@elan.com [Pharmacological Sciences, Elan Pharmaceuticals Inc., 180 Oyster Point Boulevard, South San Francisco, CA 94080 (United States); Willits, Christopher, E-mail: Chris.willits@elan.com [Pharmacological Sciences, Elan Pharmaceuticals Inc., 180 Oyster Point Boulevard, South San Francisco, CA 94080 (United States); Bowers, Simeon, E-mail: Simeon.bowers@elan.com [Chemistry, Elan Pharmaceuticals Inc., 180 Oyster Point Boulevard, South San Francisco, CA 94080 (United States); Aubele, Danielle L., E-mail: Danielle.aubele@elan.com [Chemistry, Elan Pharmaceuticals Inc., 180 Oyster Point Boulevard, South San Francisco, CA 94080 (United States); Goldbach, Erich, E-mail: Erich.goldbach@elan.com [Drug Metabolism and Pharmacokinetics, Elan Pharmaceuticals Inc., 180 Oyster Point Boulevard, South San Francisco, CA 94080 (United States); Tonn, George, E-mail: George.tonn@elan.com [Drug Metabolism and Pharmacokinetics, Elan Pharmaceuticals Inc., 180 Oyster Point Boulevard, South San Francisco, CA 94080 (United States); Ness, Daniel, E-mail: Dan.ness@elan.com [Nonclinical Safety Evaluation, Elan Pharmaceuticals Inc., 180 Oyster Point Boulevard, South San Francisco, CA 94080 (United States); Olaharski, Andrew, E-mail: andrew.olaharski@agios.com [Nonclinical Safety Evaluation, Elan Pharmaceuticals Inc., 180 Oyster Point Boulevard, South San Francisco, CA 94080 (United States)

    2013-05-15

    Polo Like Kinase 2 (PLK2) phosphorylates α-synuclein and is considered a putative therapeutic target for Parkinson's disease. Several lines of evidence indicate that PLK2 is involved with proper centriole duplication and cell cycle regulation, inhibition of which could impact chromosomal integrity during mitosis. The objectives of the series of experiments presented herein were to assess whether specific inhibition of PLK2 is genotoxic and determine if PLK2 could be considered a tractable pharmacological target for Parkinson's disease. Several selective PLK2 inhibitors, ELN 582175 and ELN 582646, and their inactive enantiomers, ELN 582176 and ELN 582647, did not significantly increase the number of micronuclei in the in vitro micronucleus assay. ELN 582646 was administered to male Sprague Dawley rats in an exploratory 14-day study where flow cytometric analysis of peripheral blood identified a dose-dependent increase in the number of micronucleated reticulocytes. A follow-up investigative study demonstrated that ELN 582646 administered to PLK2 deficient and wildtype mice significantly increased the number of peripheral micronucleated reticulocytes in both genotypes, suggesting that ELN 582646-induced genotoxicity is not through the inhibition of PLK2. Furthermore, significant reduction of retinal phosphorylated α-synuclein levels was observed at three non-genotoxic doses, additional data to suggest that pharmacological inhibition of PLK2 is not the cause of the observed genotoxicity. These data, in aggregate, indicate that PLK2 inhibition is a tractable CNS pharmacological target that does not cause genotoxicity at doses and exposures that engage the target in the sensory retina. - Highlights: • Active and inactive enantiomers test negative in the in vitro micronucleus test. • ELN 582646 significantly increased micronuclei at 100 and 300 mg/kg/day doses. • ELN 582646 significantly increased micronuclei in PLK2 knockout mice. • ELN 582646

  14. Parathyroid hormone-related protein enhances human ß-cell proliferation and function with associated induction of cyclin-dependent kinase 2 and cyclin E expression.

    Science.gov (United States)

    Guthalu Kondegowda, Nagesha; Joshi-Gokhale, Sheela; Harb, George; Williams, Katoura; Zhang, Xiao Ying; Takane, Karen K; Zhang, Pili; Scott, Donald K; Stewart, Andrew F; Garcia-Ocaña, Adolfo; Vasavada, Rupangi C

    2010-12-01

    Inducing human β-cell growth while enhancing function is a major goal in the treatment of diabetes. Parathyroid hormone-related protein (PTHrP) enhances rodent β-cell growth and function through the parathyroid hormone-1 receptor (PTH1R). Based on this, we hypothesized that PTH1R is expressed in human β-cells and that PTHrP has the potential to enhance human β-cell proliferation and/or function. PTH1R expression, β-cell proliferation, glucose-stimulated insulin secretion (GSIS), and expression of differentiation and cell-cycle genes were analyzed in human islets transduced with adenoviral PTHrP constructs or treated with PTHrP peptides. The effect of overexpression of late G1/S cell cycle molecules was also assessed on human β-cell proliferation. We found that human β-cells express PTH1R. More importantly, overexpression of PTHrP causes a significant approximately threefold increase in human β-cell proliferation. Furthermore, the amino terminus PTHrP(1-36) peptide is sufficient to increase replication as well as expression of the late G1/S cell-cycle proteins cyclin E and cyclin-dependent kinase 2 (cdk2) in human islets. Notably, PTHrP(1-36) also enhances GSIS. Finally, overexpression of cyclin E alone, but not cdk2, augments human β-cell proliferation, and when both molecules are expressed simultaneously there is a further marked synergistic increase in replication. PTHrP(1-36) peptide enhances human β-cell proliferation as well as function, with associated upregulation of two specific cell-cycle activators that together can induce human β-cell proliferation several fold. The future therapeutic potential of PTHrP(1-36) for the treatment of diabetes is especially relevant given the complementary therapeutic efficacy of PTHrP(1-36) in postmenopausal osteoporosis.

  15. Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice.

    Science.gov (United States)

    Bricambert, Julien; Miranda, Jonatan; Benhamed, Fadila; Girard, Jean; Postic, Catherine; Dentin, Renaud

    2010-12-01

    Obesity and type 2 diabetes are associated with increased lipogenesis in the liver. This results in fat accumulation in hepatocytes, a condition known as hepatic steatosis, which is a form of nonalcoholic fatty liver disease (NAFLD), the most common cause of liver dysfunction in the United States. Carbohydrate-responsive element-binding protein (ChREBP), a transcriptional activator of glycolytic and lipogenic genes, has emerged as a major player in the development of hepatic steatosis in mice. However, the molecular mechanisms enhancing its transcriptional activity remain largely unknown. In this study, we have identified the histone acetyltransferase (HAT) coactivator p300 and serine/threonine kinase salt-inducible kinase 2 (SIK2) as key upstream regulators of ChREBP activity. In cultured mouse hepatocytes, we showed that glucose-activated p300 acetylated ChREBP on Lys672 and increased its transcriptional activity by enhancing its recruitment to its target gene promoters. SIK2 inhibited p300 HAT activity by direct phosphorylation on Ser89, which in turn decreased ChREBP-mediated lipogenesis in hepatocytes and mice overexpressing SIK2. Moreover, both liver-specific SIK2 knockdown and p300 overexpression resulted in hepatic steatosis, insulin resistance, and inflammation, phenotypes reversed by SIK2/p300 co-overexpression. Finally, in mouse models of type 2 diabetes and obesity, low SIK2 activity was associated with increased p300 HAT activity, ChREBP hyperacetylation, and hepatic steatosis. Our findings suggest that inhibition of hepatic p300 activity may be beneficial for treating hepatic steatosis in obesity and type 2 diabetes and identify SIK2 activators and specific p300 inhibitors as potential targets for pharmaceutical intervention.

  16. Minichromosome Maintenance Complex is Required for Checkpoint Kinase 2 Chromatin Loading and its Phosphorylation to DNA Damage Response in SCC-4 Cells.

    Science.gov (United States)

    Li, Liang; Feng, Yi; Luo, Rui

    2017-01-01

    Checkpoint kinase 2 (Chk2) is a significant mediator of diverse responses to DNA damage. The present study was aimed to identify possible interactive proteins of Chk2 and try to clarify the underlying mechanism regarding Chk2 chromatin loading and its phosphorylation to DNA damage response in oral squamous cell carcinoma (OSCC). Differently tagged Chk2 and minichromosome maintenance (MCM) complex (MCM2, MCM3, MCM5, and MCM6) were overexpressed into SCC-4 cells. After 48 h of transfection cell fractionation was performed to localize proteins. In addition, immunoreactive species were detected by immunoprecipitation (IP) and immunoblot (IB) analysis, and protein-protein interaction between Chk2 and MCM complex was ensured by glutathione S-transferase (GST) pull-down assay. Expression of MCM2 and MCM6 was downregulated by small interfering RNA (siRNA), and the chromatin and non-chromatin fraction were analyzed. The expression of Chk2 phosphorylation (pT68-Chk2) was measured after administration of different dosages of siMCM2 (0.5 μg, 1 μg, and 2.5 μg) and camptothecin (CPT). Our results showed that Chk2 directly interacts with MCM2, MCM3, MCM5, and MCM6 in SCC-4 cells. Downregulation of MCM2 and MCM6 markedly reduced Chk2 chromatin fraction, and downregulation of MCM2 decreased the expression of pT68-Chk2 to DNA damage response in a dose manner. Our results suggest that the interaction between Chk2 and MCM complex is required for Chk2 chromatin loading and its phosphorylation to DNA damage response in SCC-4 cells. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  17. Bacillus bombysepticus α-Toxin Binding to G Protein-Coupled Receptor Kinase 2 Regulates cAMP/PKA Signaling Pathway to Induce Host Death.

    Directory of Open Access Journals (Sweden)

    Ping Lin

    2016-03-01

    Full Text Available Bacterial pathogens and their toxins target host receptors, leading to aberrant behavior or host death by changing signaling events through subversion of host intracellular cAMP level. This is an efficient and widespread mechanism of microbial pathogenesis. Previous studies describe toxins that increase cAMP in host cells, resulting in death through G protein-coupled receptor (GPCR signaling pathways by influencing adenylyl cyclase or G protein activity. G protein-coupled receptor kinase 2 (GRK2 has a central role in regulation of GPCR desensitization. However, little information is available about the pathogenic mechanisms of toxins associated with GRK2. Here, we reported a new bacterial toxin-Bacillus bombysepticus (Bb α-toxin that was lethal to host. We showed that Bb α-toxin interacted with BmGRK2. The data demonstrated that Bb α-toxin directly bound to BmGRK2 to promote death by affecting GPCR signaling pathways. This mechanism involved stimulation of Gαs, increase level of cAMP and activation of protein kinase A (PKA. Activated cAMP/PKA signal transduction altered downstream effectors that affected homeostasis and fundamental biological processes, disturbing the structural and functional integrity of cells, resulting in death. Preventing cAMP/PKA signaling transduction by inhibitions (NF449 or H-89 substantially reduced the pathogenicity of Bb α-toxin. The discovery of a toxin-induced host death specifically linked to GRK2 mediated signaling pathway suggested a new model for bacterial toxin action. Characterization of host genes whose expression and function are regulated by Bb α-toxin and GRK2 will offer a deeper understanding of the pathogenesis of infectious diseases caused by pathogens that elevate cAMP.

  18. Recognition of the inner lipoyl-bearing domain of dihydrolipoyl transacetylase and of the blood glucose-lowering compound AZD7545 by pyruvate dehydrogenase kinase 2.

    Science.gov (United States)

    Tuganova, Alina; Klyuyeva, Alla; Popov, Kirill M

    2007-07-24

    Pyruvate dehydrogenase kinase 2 (PDHK2) is a unique mitochondrial protein kinase that regulates the activity of the pyruvate dehydrogenase multienzyme complex (PDC). PDHK2 is an integral component of PDC tightly bound to the inner lipoyl-bearing domains (L2) of the dihydrolipoyl transacetylase component (E2) of PDC. This association has been reported to bring about an up to 10-fold increase in kinase activity. Despite the central role played by E2 in the maintenance of PDHK2 functionality in the PDC-bound state, the molecular mechanisms responsible for the recognition of L2 by PDHK2 and for the E2-dependent PDHK2 activation are largely unknown. In this study, we used a combination of molecular modeling and site-directed mutagenesis to identify the amino acid residues essential for the interaction between PDHK2 and L2 and for the activation of PDHK2 by E2. On the basis of the results of site-directed mutagenesis, it appears that a number of PDHK2 residues located in its R domain (P22, L23, F28, F31, F44, L45, and L160) and in the so-called "cross arm" structure (K368, R372, and K391) are critical in determining the strength of the interaction between PDHK2 and L2. The residues of L2 essential for recognition by PDHK2 include L140, K173, I176, E179, and to a lesser extent D164, D172, and A174. Importantly, certain PDHK2 residues forming interfaces with L2, i.e., K17, P22, F31, F44, R372, and K391, are also critical for the maintenance of enhanced PDHK2 activity in the E2-bound state. Finally, evidence that the blood glucose-lowering compound AZD7545 disrupts the interactions between PDHK2 and L2 and thereby inhibits PDHK2 activity is presented.

  19. Shear stress induces human aortic endothelial cell apoptosis via interleukin‑1 receptor‑associated kinase 2‑induced endoplasmic reticulum stress.

    Science.gov (United States)

    Pan, Longfei; Hong, Zhou; Yu, Lei; Gao, Yanxia; Zhang, Rui; Feng, Hui; Su, Lijuan; Wang, Gang

    2017-09-19

    Atherosclerosis is characterized by localized lesions distributed in the arterial tree due to the shear stress produced by blood flow. Endothelial cells are directly affected by alterations in blood flow. Dysfunction and injury to endothelial cells has been hypothesized to initiate the pathological processes of atherosclerosis. The present study aimed to investigate the mechanism of shear stress‑induced endothelial cellular apoptosis. Shear stress was generated using an artificial device to mimic the impact of disturbed blood flow on cultured human aortic endothelial cells (HAECs). Cellular apoptosis was assessed using a terminal deoxynucleotidyl transferase dUTP nick end labeling assay; an ELISA assay was used to detect the produced interleukin (IL)‑1β; specific small interfering (si)RNA was used to knockdown the expression of interleukin‑1 receptor‑associated kinase 2 (IRAK2) in HAECs and the expression levels of 78 kDa glucose‑regulated protein, DNA damage‑inducible transcript 3 protein (CHOP), IRAK2 and IL‑1β were evaluated using western blotting. The results of the present study demonstrated that artificial shear stress induced endoplasmic reticulum (ER) stress, IL‑1β production and apoptosis in HAECs in a time‑dependent manner. The inhibition of ER stress, and treatment with interleukin‑1 receptor antagonist protein and siRNA against IRAK2 attenuated shear stress‑induced CHOP signaling‑mediated cellular apoptosis. Therefore, overproduction of IL‑1β exacerbated shear stress‑induced ER stress‑mediated apoptosis via the IRAK2/CHOP signaling pathway in endothelial cells.

  20. Glucose restriction induces cell death in parental but not in homeodomain-interacting protein kinase 2-depleted RKO colon cancer cells: molecular mechanisms and implications for tumor therapy.

    Science.gov (United States)

    Garufi, A; Ricci, A; Trisciuoglio, D; Iorio, E; Carpinelli, G; Pistritto, G; Cirone, M; D'Orazi, G

    2013-05-23

    Tumor cell tolerance to nutrient deprivation can be an important factor for tumor progression, and may depend on deregulation of both oncogenes and oncosuppressor proteins. Homeodomain-interacting protein kinase 2 (HIPK2) is an oncosuppressor that, following its activation by several cellular stress, induces cancer cell death via p53-dependent or -independent pathways. Here, we used genetically matched human RKO colon cancer cells harboring wt-HIPK2 (HIPK2(+/+)) or stable HIPK2 siRNA interference (siHIPK2) to investigate in vitro whether HIPK2 influenced cell death in glucose restriction. We found that glucose starvation induced cell death, mainly due to c-Jun NH2-terminal kinase activation, in HIPK2(+/+)cells compared with siHIPK2 cells that did not die. (1)H-nuclear magnetic resonance quantitative metabolic analyses showed a marked glycolytic activation in siHIPK2 cells. However, treatment with glycolysis inhibitor 2-deoxy-D-glucose induced cell death only in HIPK2(+/+) cells but not in siHIPK2 cells. Similarly, siGlut-1 interference did not re-establish siHIPK2 cell death under glucose restriction, whereas marked cell death was reached only after zinc supplementation, a condition known to reactivate misfolded p53 and inhibit the pseudohypoxic phenotype in this setting. Further siHIPK2 cell death was reached with zinc in combination with autophagy inhibitor. We propose that the metabolic changes acquired by cells after HIPK2 silencing may contribute to induce resistance to cell death in glucose restriction condition, and therefore be directly relevant for tumor progression. Moreover, elimination of such a tolerance might serve as a new strategy for cancer therapy.

  1. The plastid casein kinase 2 phosphorylates Rubisco activase at the Thr-78 site but is not essential for regulation of Rubisco activation state

    Directory of Open Access Journals (Sweden)

    Sang Yeol eKim

    2016-03-01

    Full Text Available Rubisco activase (RCA is essential for the activation of Rubisco, the carboxylating enzyme of photosynthesis. In Arabidopsis, RCA is composed of a large RCAα and small RCAβ isoform that are formed by alternative splicing of a single gene (At2g39730. The activity of Rubisco is controlled in response to changes in irradiance by regulation of RCA activity, which is known to involve a redox-sensitive disulfide bond located in the carboxy-terminal extension of the RCAα subunit. Additionally, phosphorylation of RCA threonine-78 (Thr-78 has been reported to occur in the dark suggesting that phosphorylation may also be associated with dark-inactivation of RCA and deactivation of Rubisco. In the present study, we developed site-specific antibodies to monitor phosphorylation of RCA at the Thr-78 site and used non-reducing SDS-PAGE to monitor the redox status of the RCAα subunit. By immunoblotting, phosphorylation of both RCA isoforms occurred at low light and in the dark and feeding peroxide or DTT to leaf segments indicated that redox status of the chloroplast stroma was a critical factor controlling RCA phosphorylation. Use of a knockout mutant identified the plastid-targeted casein kinase 2 (cpCK2α as the major protein kinase involved in RCA phosphorylation. Studies with recombinant cpCK2α and synthetic peptide substrates identified acidic residues at the -1, +2 and +3 positions surrounding Thr-78 as strong positive recognition elements. The cpck2 knockout mutant had strongly reduced phosphorylation at the Thr-78 site but was similar to wild type plants in terms of induction kinetics of photosynthesis following transfer from darkness or low light to high light, suggesting that if phosphorylation of RCA Thr-78 plays a direct role it would be redundant to redox regulation for control of Rubisco activation state under normal conditions.

  2. 47 CFR 97.205 - Repeater station.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Repeater station. 97.205 Section 97.205... SERVICE Special Operations § 97.205 Repeater station. (a) Any amateur station licensed to a holder of a Technician, General, Advanced or Amateur Extra Class operator license may be a repeater. A holder of...

  3. 47 CFR 22.1015 - Repeater operation.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false Repeater operation. 22.1015 Section 22.1015... Offshore Radiotelephone Service § 22.1015 Repeater operation. Offshore central stations may be used as repeater stations provided that the licensee is able to maintain control of the station, and in...

  4. ProtRepeatsDB: a database of amino acid repeats in genomes

    Directory of Open Access Journals (Sweden)

    Chauhan Virander S

    2006-07-01

    Full Text Available Abstract Background Genome wide and cross species comparisons of amino acid repeats is an intriguing problem in biology mainly due to the highly polymorphic nature and diverse functions of amino acid repeats. Innate protein repeats constitute vital functional and structural regions in proteins. Repeats are of great consequence in evolution of proteins, as evident from analysis of repeats in different organisms. In the post genomic era, availability of protein sequences encoded in different genomes provides a unique opportunity to perform large scale comparative studies of amino acid repeats. ProtRepeatsDB http://bioinfo.icgeb.res.in/repeats/ is a relational database of perfect and mismatch repeats, access to which is designed as a resource and collection of tools for detection and cross species comparisons of different types of amino acid repeats. Description ProtRepeatsDB (v1.2 consists of perfect as well as mismatch amino acid repeats in the protein sequences of 141 organisms, the genomes of which are now available. The web interface of ProtRepeatsDB consists of different tools to perform repeat s; based on protein IDs, organism name, repeat sequences, and keywords as in FASTA headers, size, frequency, gene ontology (GO annotation IDs and regular expressions (REGEXP describing repeats. These tools also allow formulation of a variety of simple, complex and logical queries to facilitate mining and large-scale cross-species comparisons of amino acid repeats. In addition to this, the database also contains sequence analysis tools to determine repeats in user input sequences. Conclusion ProtRepeatsDB is a multi-organism database of different types of amino acid repeats present in proteins. It integrates useful tools to perform genome wide queries for rapid screening and identification of amino acid repeats and facilitates comparative and evolutionary studies of the repeats. The database is useful for identification of species or organism specific

  5. PREDICT-PD: An online approach to prospectively identify risk indicators of Parkinson's disease.

    Science.gov (United States)

    Noyce, Alastair J; R'Bibo, Lea; Peress, Luisa; Bestwick, Jonathan P; Adams-Carr, Kerala L; Mencacci, Niccolo E; Hawkes, Christopher H; Masters, Joseph M; Wood, Nicholas; Hardy, John; Giovannoni, Gavin; Lees, Andrew J; Schrag, Anette

    2017-02-01

    A number of early features can precede the diagnosis of Parkinson's disease (PD). To test an online, evidence-based algorithm to identify risk indicators of PD in the UK population. Participants aged 60 to 80 years without PD completed an online survey and keyboard-tapping task annually over 3 years, and underwent smell tests and genotyping for glucocerebrosidase (GBA) and leucine-rich repeat kinase 2 (LRRK2) mutations. Risk scores were calculated based on the results of a systematic review of risk factors and early features of PD, and individuals were grouped into higher (above 15th centile), medium, and lower risk groups (below 85th centile). Previously defined indicators of increased risk of PD ("intermediate markers"), including smell loss, rapid eye movement-sleep behavior disorder, and finger-tapping speed, and incident PD were used as outcomes. The correlation of risk scores with intermediate markers and movement of individuals between risk groups was assessed each year and prospectively. Exploratory Cox regression analyses with incident PD as the dependent variable were performed. A total of 1323 participants were recruited at baseline and >79% completed assessments each year. Annual risk scores were correlated with intermediate markers of PD each year and baseline scores were correlated with intermediate markers during follow-up (all P values risk score (hazard ratio = 4.39, P = .045). GBA variants or G2019S LRRK2 mutations were found in 47 participants, and the predictive power for incident PD was improved by the addition of genetic variants to risk scores. The online PREDICT-PD algorithm is a unique and simple method to identify indicators of PD risk. © 2017 The Authors. Movement Disorders published by Wiley Periodicals, Inc. on behalf of International Parkinson and Movement Disorder Society. © 2016 International Parkinson and Movement Disorder Society.

  6. Pentatricopeptide repeat proteins in plants.

    Science.gov (United States)

    Barkan, Alice; Small, Ian

    2014-01-01

    Pentatricopeptide repeat (PPR) proteins constitute one of the largest protein families in land plants, with more than 400 members in most species. Over the past decade, much has been learned about the molecular functions of these proteins, where they act in the cell, and what physiological roles they play during plant growth and development. A typical PPR protein is targeted to mitochondria or chloroplasts, binds one or several organellar transcripts, and influences their expression by altering RNA sequence, turnover, processing, or translation. Their combined action has profound effects on organelle biogenesis and function and, consequently, on photosynthesis, respiration, plant development, and environmental responses. Recent breakthroughs in understanding how PPR proteins recognize RNA sequences through modular base-specific contacts will help match proteins to potential binding sites and provide a pathway toward designing synthetic RNA-binding proteins aimed at desired targets.

  7. Two-dimensional quantum repeaters

    Science.gov (United States)

    Wallnöfer, J.; Zwerger, M.; Muschik, C.; Sangouard, N.; Dür, W.

    2016-11-01

    The endeavor to develop quantum networks gave rise to a rapidly developing field with far-reaching applications such as secure communication and the realization of distributed computing tasks. This ultimately calls for the creation of flexible multiuser structures that allow for quantum communication between arbitrary pairs of parties in the network and facilitate also multiuser applications. To address this challenge, we propose a two-dimensional quantum repeater architecture to establish long-distance entanglement shared between multiple communication partners in the presence of channel noise and imperfect local control operations. The scheme is based on the creation of self-similar multiqubit entanglement structures at growing scale, where variants of entanglement swapping and multiparty entanglement purification are combined to create high-fidelity entangled states. We show how such networks can be implemented using trapped ions in cavities.

  8. General benchmarks for quantum repeaters

    CERN Document Server

    Pirandola, Stefano

    2015-01-01

    Using a technique based on quantum teleportation, we simplify the most general adaptive protocols for key distribution, entanglement distillation and quantum communication over a wide class of quantum channels in arbitrary dimension. Thanks to this method, we bound the ultimate rates for secret key generation and quantum communication through single-mode Gaussian channels and several discrete-variable channels. In particular, we derive exact formulas for the two-way assisted capacities of the bosonic quantum-limited amplifier and the dephasing channel in arbitrary dimension, as well as the secret key capacity of the qubit erasure channel. Our results establish the limits of quantum communication with arbitrary systems and set the most general and precise benchmarks for testing quantum repeaters in both discrete- and continuous-variable settings.

  9. Hungarian repeat station survey, 2010

    Directory of Open Access Journals (Sweden)

    Péter Kovács

    2013-03-01

    Full Text Available The last Hungarian repeat station survey was completed between October 2010 and February 2011. Declination, inclination and the total field were observed using one-axial DMI fluxgate magnetometer mounted on Zeiss20A theodolite and GSM 19 Overhauser magnetometer. The magnetic elements of the sites were reduced to the epoch of 2010.5 on the basis of the continuous recordings of Tihany Geophysical Observatory. In stations located far from the reference observatory, the observations were carried out in the morning and afternoon in order to decrease the effect of the distant temporal correction. To further increase the accuracy, on-site dIdD variometer has also been installed near the Aggtelek station, in the Baradla cave, during the survey of the easternmost sites. The paper presents the technical details and the results of our last campaign. The improvement of the accuracy of the temporal reduction by the use of the local variometer is also reported.

  10. Quality control during repeated fryings

    Directory of Open Access Journals (Sweden)

    Cuesta, C.

    1998-08-01

    Full Text Available Most of the debate ¡s about how the slow or frequent turnover of fresh fat affects the deterioration, of fat used in frying. Then, the modification of different oils used in repeated fryings of potatoes without or with turnover of fresh oil, under similar frying conditions, was evaluated by two criteria: by measuring the total polar component isolated by column chromatography and by the evaluation of the specific compounds related to thermoxidative and hydrolytic alteration by High Performance Size Exclusion Chromatography (HPSEC. The results indicate that with frequent turnover of fresh oil, the critical level of 25% of polar material is rarely reached, and there are fewer problems with fat deterioration because the frying tended to increase the level of polar material and thermoxidative compounds (polymers and dimers of triglycerides and oxidized triglycerides in the fryer oil during the first fryings, followed by minor changes and a tendency to reach a near-steady state in successive fryings. However, in repeated frying of potatoes using a null turnover the alteration rate was higher being linear the relationship found between polar material or the different thermoxidative compounds and the number of fryings. On the other hand chemical reactions produced during deep-fat frying can be minimized by using proper oils. In addition the increased level of consumers awareness toward fat composition and its impact on human health could had an impact on the selection of fats for snacks and for industry. In this way monoenic fats are the most adequate from a nutritional point of view and for its oxidative stability during frying.

  11. Myocardial Ablation of G Protein-Coupled Receptor Kinase 2 (GRK2 Decreases Ischemia/Reperfusion Injury through an Anti-Intrinsic Apoptotic Pathway.

    Directory of Open Access Journals (Sweden)

    Qian Fan

    Full Text Available Studies from our lab have shown that decreasing myocardial G protein-coupled receptor kinase 2 (GRK2 activity and expression can prevent heart failure progression after myocardial infarction. Since GRK2 appears to also act as a pro-death kinase in myocytes, we investigated the effect of cardiomyocyte-specific GRK2 ablation on the acute response to cardiac ischemia/reperfusion (I/R injury. To do this we utilized two independent lines of GRK2 knockout (KO mice where the GRK2 gene was deleted in only cardiomyocytes either constitutively at birth or in an inducible manner that occurred in adult mice prior to I/R. These GRK2 KO mice and appropriate control mice were subjected to a sham procedure or 30 min of myocardial ischemia via coronary artery ligation followed by 24 hrs reperfusion. Echocardiography and hemodynamic measurements showed significantly improved post-I/R cardiac function in both GRK2 KO lines, which correlated with smaller infarct sizes in GRK2 KO mice compared to controls. Moreover, there was significantly less TUNEL positive myocytes, less caspase-3, and -9 but not caspase-8 activities in GRK2 KO mice compared to control mice after I/R injury. Of note, we found that lowering cardiac GRK2 expression was associated with significantly lower cytosolic cytochrome C levels in both lines of GRK2 KO mice after I/R compared to corresponding control animals. Mechanistically, the anti-apoptotic effects of lowering GRK2 expression were accompanied by increased levels of Bcl-2, Bcl-xl, and increased activation of Akt after I/R injury. These findings were reproduced in vitro in cultured cardiomyocytes and GRK2 mRNA silencing. Therefore, lowering GRK2 expression in cardiomyocytes limits I/R-induced injury and improves post-ischemia recovery by decreasing myocyte apoptosis at least partially via Akt/Bcl-2 mediated mitochondrial protection and implicates mitochondrial-dependent actions, solidifying GRK2 as a pro-death kinase in the heart.

  12. Phosphorylation of hepatitis C virus RNA polymerases ser29 and ser42 by protein kinase C-related kinase 2 regulates viral RNA replication.

    Science.gov (United States)

    Han, Song-Hee; Kim, Seong-Jun; Kim, Eun-Jung; Kim, Tae-Eun; Moon, Jae-Su; Kim, Geon-Woo; Lee, Seung-Hoon; Cho, Kun; Yoo, Jong Shin; Son, Woo Sung; Rhee, Jin-Kyu; Han, Seung Hyun; Oh, Jong-Won

    2014-10-01

    Hepatitis C virus (HCV) nonstructural protein 5B (NS5B), an RNA-dependent RNA polymerase (RdRp), is the key enzyme for HCV RNA replication. We previously showed that HCV RdRp is phosphorylated by protein kinase C-related kinase 2 (PRK2). In the present study, we used biochemical and reverse-genetics approaches to demonstrate that HCV NS5B phosphorylation is crucial for viral RNA replication in cell culture. Two-dimensional phosphoamino acid analysis revealed that PRK2 phosphorylates NS5B exclusively at its serine residues in vitro and in vivo. Using in vitro kinase assays and mass spectrometry, we identified two phosphorylation sites, Ser29 and Ser42, in the Δ1 finger loop region that interacts with the thumb subdomain of NS5B. Colony-forming assays using drug-selectable HCV subgenomic RNA replicons revealed that preventing phosphorylation by Ala substitution at either Ser29 or Ser42 impairs HCV RNA replication. Furthermore, reverse-genetics studies using HCV infectious clones encoding phosphorylation-defective NS5B confirmed the crucial role of these PRK2 phosphorylation sites in viral RNA replication. Molecular-modeling studies predicted that the phosphorylation of NS5B stabilizes the interactions between its Δ1 loop and thumb subdomain, which are required for the formation of the closed conformation of NS5B known to be important for de novo RNA synthesis. Collectively, our results provide evidence that HCV NS5B phosphorylation has a positive regulatory role in HCV RNA replication. While the role of RNA-dependent RNA polymerases (RdRps) in viral RNA replication is clear, little is known about their functional regulation by phosphorylation. In this study, we addressed several important questions about the function and structure of phosphorylated hepatitis C virus (HCV) nonstructural protein 5B (NS5B). Reverse-genetics studies with HCV replicons encoding phosphorylation-defective NS5B mutants and analysis of their RdRp activities revealed previously unidentified

  13. Parathyroid Hormone–Related Protein Enhances Human β-Cell Proliferation and Function With Associated Induction of Cyclin-Dependent Kinase 2 and Cyclin E Expression

    Science.gov (United States)

    Guthalu Kondegowda, Nagesha; Joshi-Gokhale, Sheela; Harb, George; Williams, Katoura; Zhang, Xiao Ying; Takane, Karen K.; Zhang, Pili; Scott, Donald K.; Stewart, Andrew F.; Garcia-Ocaña, Adolfo; Vasavada, Rupangi C.

    2010-01-01

    OBJECTIVE Inducing human β-cell growth while enhancing function is a major goal in the treatment of diabetes. Parathyroid hormone–related protein (PTHrP) enhances rodent β-cell growth and function through the parathyroid hormone-1 receptor (PTH1R). Based on this, we hypothesized that PTH1R is expressed in human β-cells and that PTHrP has the potential to enhance human β-cell proliferation and/or function. RESEARCH DESIGN AND METHODS PTH1R expression, β-cell proliferation, glucose-stimulated insulin secretion (GSIS), and expression of differentiation and cell-cycle genes were analyzed in human islets transduced with adenoviral PTHrP constructs or treated with PTHrP peptides. The effect of overexpression of late G1/S cell cycle molecules was also assessed on human β-cell proliferation. RESULTS We found that human β-cells express PTH1R. More importantly, overexpression of PTHrP causes a significant approximately threefold increase in human β-cell proliferation. Furthermore, the amino terminus PTHrP(1-36) peptide is sufficient to increase replication as well as expression of the late G1/S cell-cycle proteins cyclin E and cyclin-dependent kinase 2 (cdk2) in human islets. Notably, PTHrP(1-36) also enhances GSIS. Finally, overexpression of cyclin E alone, but not cdk2, augments human β-cell proliferation, and when both molecules are expressed simultaneously there is a further marked synergistic increase in replication. CONCLUSIONS PTHrP(1-36) peptide enhances human β-cell proliferation as well as function, with associated upregulation of two specific cell-cycle activators that together can induce human β-cell proliferation several fold. The future therapeutic potential of PTHrP(1-36) for the treatment of diabetes is especially relevant given the complementary therapeutic efficacy of PTHrP(1-36) in postmenopausal osteoporosis. PMID:20876711

  14. Sensitization of human colon cancer cells to sodium butyrate-induced apoptosis by modulation of sphingosine kinase 2 and protein kinase D

    Energy Technology Data Exchange (ETDEWEB)

    Xiao, Min [Department of Occupational Health and Occupational Medicine, School of Public Health and Tropical Medicine, Southern Medical University, Guangzhou 510515 (China); Liu, Yungang [Department of Toxicology, School of Public Health and Tropical Medicine, Southern Medical University, Guangzhou 510515 (China); Zou, Fei, E-mail: ZouFeiMed@gmail.com [Department of Occupational Health and Occupational Medicine, School of Public Health and Tropical Medicine, Southern Medical University, Guangzhou 510515 (China)

    2012-01-01

    Sphingosine kinases (SphKs) have been recognized as important proteins regulating cell proliferation and apoptosis. Of the two isoforms of SphK (SphK1 and SphK2), little is known about the functions of SphK2. Sodium butyrate (NaBT) has been established as a promising chemotherapeutic agent, but the precise mechanism for its effects is unknown. In this study, we investigated the role of SphK2 in NaBT-induced apoptosis of HCT116 colon cancer cells. The results indicated that following NaBT treatment SphK2 was translocated from the nucleus to the cytoplasm, leading to its accumulation in the cytoplasm; in the meantime, only mild apoptosis occurred. However, downregulation of SphK2 resulted in sensitized apoptosis, and overexpression of SphK2 led to even lighter apoptosis; these strongly indicate an inhibitory role of SphK2 in cell apoptosis induced by NaBT. After knocking down protein kinase D (PKD), another protein reported to be critical in cell proliferation/apoptosis process, by using siRNA, blockage of cytoplasmic accumulation of SphK2 and sensitized apoptosis following NaBT treatment were observed. The present study suggests that PKD and SphK2 may form a mechanism for the resistance of cancer cells to tumor chemotherapies, such as HCT116 colon cancer cells to NaBT, and these two proteins may become molecular targets for designation of new tumor-therapeutic drugs. -- Highlights: Black-Right-Pointing-Pointer In the present study sodium butyrate (10 mM) induced mild apoptosis of cancer cells. Black-Right-Pointing-Pointer The apoptosis was negatively regulated by cytoplasmic Sphingosine Kinase 2 (SphK2). Black-Right-Pointing-Pointer Translocation of SphK2 from nucleus to cytoplasm was mediated by protein kinase D. Black-Right-Pointing-Pointer Downregulation of SphK2 or protein kinase D leads to sensitized cell apoptosis.

  15. Sucrose non-ferment 1 related protein kinase 2 (SnRK2) genes could mediate the stress responses in potato (Solanum tuberosum L.).

    Science.gov (United States)

    Bai, Jiangping; Mao, Juan; Yang, Hongyu; Khan, Awais; Fan, Aqi; Liu, Siyan; Zhang, Junlian; Wang, Di; Gao, Huijuan; Zhang, Jinlin

    2017-05-15

    The SnRKs (sucrose non-fermenting 1 related protein kinase) are a gene family coding for Ser/Thr protein kinases and play important roles in linking the tolerance and metabolic responses of plants to abiotic stresses. To date, no genome-wide characterization of the sucrose non-ferment 1 related protein kinase 2 (SnRK2) subfamily has been conducted in potato (Solanum tuberosum L.). In this study, eight StSnRK2 genes (StSnRK2.1- StSnRK2.8) were identified in the genome of the potato (Solanum tuberosum L.) cultivar 'Longshu 3', with similar characteristics to SnRK2 from other plant species in gene structure, motif distribution and secondary structures. The C-terminal regions were highly divergent among StSnRK2s, while they all carried the similar Ser/Thr protein kinase domain. The fluorescence of GFP fused with StSnRK2.1, StSnRK2.2, StSnRK2.6, StSnRK2.7 and StSnRK2.8 was detected in the nucleus and cytoplasm of onion epidermal cells with StSnRK2.3 and StSnRK2.4 mainly associated to the nucleus while StSnRK2.5 to subcellular organelles. Expression level analysis by qRT-PCR showed that StSnRK2.1, 2.2, 2.5 and 2.6 were more than 1 fold higher in the root than in the leaf, tuber and stem tissues. The expressions of StSnRK2.3, 2.7, and 2.8 were at least 1.5 folds higher in the leaf and stem than in the root, but lower in the tuber. The expression of StSnRK2.4 was also significantly (P potato, ABA treatment had a different effect from NaCl and PEG treatments. In the present study, we identified and characterized eight SnRK2s in the potato genome. The eight StSnRK2s exhibit similar gene structure and secondary structures in potato to the SnRK2s found in other plant species. The relative expression of eight genes varied among various tissues (roots, leaves, tubers, and stems) and abiotic stresses (ABA, NaCl and PEG-6000) with the prolongation of treatments. This study provides valuable information for the future functional dissection of potato SnRK2 genes in stress signal

  16. Prenatal stress increased Snk Polo-like kinase 2, SCF β-TrCP ubiquitin ligase and ubiquitination of SPAR in the hippocampus of the offspring at adulthood.

    Science.gov (United States)

    Chutabhakdikul, Naunchan; Surakul, Pornprom

    2013-11-01

    Exposure to excessive glucocorticoids during fetal development period contributes to later life psychopathology. Prenatal stress decreases dendritic spine density and impair LTP in the hippocampus of rat pups, however, the mechanisms regulating these changes are still unclear. Glutamate receptors are localized in the postsynaptic density. PSD-95 is a postsynaptic scaffolding protein that plays a role in synaptic maturation and regulation of the synaptic strength and plasticity. PSD-95 interacts with other proteins to form the protein networks that promote dendritic spine formation. The present study investigated the effect of prenatal stress on the levels of scaffolding proteins of NMDA receptor in the hippocampus in order to explain how prenatal stress alters the amount of NMDA receptor in the pups' brain. Pregnant rats were randomly assigned to either the prenatal stress (PS) or the control group (C). The pregnant rats in the PS group were restrained in a plexiglas restrainer for 4h/day during the GD 14-21. Control rats were left undisturbed for the duration of their pregnancies. The amount of PSD-95, SPAR, NR2A and NR2B, as well as the levels of Snk Polo-like kinase 2 and the SCF β-TrCP ubiquitin ligase were measured in the hippocampus of the offspring. The results show that prenatal stress induces a reduction in the amount of NR2B and NR2A subunits in the hippocampus of rat pups, parallel to the decrease in PSD-95 and SPAR at P40 and P60. Moreover, prenatal stress increases Snk and β-TrCP in the hippocampus of rat pups, and the timing correlates with the decrease of SPAR and PSD-95. Prenatal stress also induces a significantly increases in the level of ubiquitinated SPAR in the hippocampus of rat pups at adulthood. The results suggest that degradation of SPAR via UPS system may contribute to the loss of PSD-95 and NMDA receptor subunits in the hippocampus of rat pups at adulthood. In conclusion, the present work demonstrates that the developing brain is

  17. Mitogen-activated protein kinase-activated protein kinase 2 in angiotensin II-induced inflammation and hypertension: regulation of oxidative stress.

    Science.gov (United States)

    Ebrahimian, Talin; Li, Melissa Wei; Lemarié, Catherine A; Simeone, Stefania M C; Pagano, Patrick J; Gaestel, Matthias; Paradis, Pierre; Wassmann, Sven; Schiffrin, Ernesto L

    2011-02-01

    Vascular oxidative stress and inflammation play an important role in angiotensin II-induced hypertension, and mitogen-activated protein kinases participate in these processes. We questioned whether mitogen-activated protein kinase-activated protein kinase 2 (MK2), a downstream target of p38 mitogen-activated protein kinase, is involved in angiotensin II-induced vascular responses. In vivo experiments were performed in wild-type and Mk2 knockout mice infused intravenously with angiotensin II. Angiotensin II induced a 30 mm Hg increase in mean blood pressure in wild-type that was delayed in Mk2 knockout mice. Angiotensin II increased superoxide production and vascular cell adhesion molecule-1 in blood vessels of wild-type but not in Mk2 knockout mice. Mk2 knockdown by small interfering RNA in mouse mesenteric vascular smooth muscle cells caused a 42% reduction in MK2 protein and blunted the angiotensin II-induced 40% increase of MK2 expression. Mk2 knockdown blunted angiotensin II-induced doubling of intracellular adhesion molecule-1 expression, 2.4-fold increase of nuclear p65, and 1.4-fold increase in Ets-1. Mk2 knockdown abrogated the angiotensin II-induced 4.7-fold and 1.3-fold increase of monocyte chemoattractant protein-1 mRNA and protein. Angiotensin II enhanced reactive oxygen species levels (by 29%) and nicotinamide adenine dinucleotide phosphate oxidase activity (by 48%), both abolished by Mk2 knockdown. Reduction of MK2 blocked angiotensin II-induced p47phox translocation to the membrane, associated with a 53% enhanced catalase expression. Angiotensin II-induced increase of MK2 was prevented by the nicotinamide adenine dinucleotide phosphate oxidase inhibitor Nox2ds-tat. Mk2 small interfering RNA prevented the angiotensin II-induced 30% increase of proliferation. In conclusion, MK2 plays a critical role in angiotensin II signaling, leading to hypertension, oxidative stress via activation of p47phox and inhibition of antioxidants, and vascular inflammation

  18. Internalization and down-regulation of human muscarinic acetylcholine receptor m2 subtypes. Role of third intracellular m2 loop and G protein-coupled receptor kinase 2.

    Science.gov (United States)

    Tsuga, H; Kameyama, K; Haga, T; Honma, T; Lameh, J; Sadée, W

    1998-02-27

    Internalization and down-regulation of human muscarinic acetylcholine m2 receptors (hm2 receptors) and a hm2 receptor mutant lacking a central part of the third intracellular loop (I3-del m2 receptor) were examined in Chinese hamster ovary (CHO-K1) cells stably expressing these receptors and G protein-coupled receptor kinase 2 (GRK2). Agonist-induced internalization of up to 80-90% of hm2 receptors was demonstrated by measuring loss of [3H]N-methylscopolamine binding sites from the cell surface, and transfer of [3H]quinuclidinyl benzilate binding sites from the plasma membrane into the light-vesicle fractions separated by sucrose density gradient centrifugation. Additionally, translocation of hm2 receptors with endocytic vesicles were visualized by immunofluorescence confocal microscopy. Agonist-induced down-regulation of up to 60-70% of hm2 receptors was demonstrated by determining the loss of [3H]quinuclidinyl benzilate binding sites in the cells. The half-time (t1/2) of internalization and down-regulation in the presence of 10(-4) M carbamylcholine was estimated to be 9.5 min and 2.3 h, respectively. The rates of both internalization and down-regulation of hm2 receptors in the presence of 10(-6) M or lower concentrations of carbamylcholine were markedly increased by coexpression of GRK2. Agonist-induced internalization of I3-del m2 receptors was barely detectable upon incubation of cells for 1 h, but agonist-induced down-regulation of up to 40-50% of I3-del m2 receptors occurred upon incubation with 10(-4) M carbamylcholine for 16 h. However, the rate of down-regulation was lower compared with wild type receptors (t1/2 = 9.9 versus 2.3 h). These results indicate that rapid internalization of hm2 receptors is facilitated by their phosphorylation with GRK2 and does not occur in the absence of the third intracellular loop, but down-regulation of hm2 receptors may occur through both GRK2-facilitating pathway and third intracellular loop-independent pathways.

  19. Targeted impairment of thymidine kinase 2 expression in cells induces mitochondrial DNA depletion and reveals molecular mechanisms of compensation of mitochondrial respiratory activity

    Energy Technology Data Exchange (ETDEWEB)

    Villarroya, Joan, E-mail: joanvillarroya@gmail.com [Institut de Recerca, Hospital Universitari de la Vall d' Hebron, Barcelona (Spain); Institut de Recerca l' Hospital de la Santa Creu i Sant Pau, Barcelona (Spain); Lara, Mari-Carmen [Institut de Recerca, Hospital Universitari de la Vall d' Hebron, Barcelona (Spain); Department of Neurology, Columbia University Medical Center, New York, NY (United States); Centro de Investigacion Biomedica en Red de Enfermedades Raras (CIBERER), ISCIII (Spain); Dorado, Beatriz [Department of Neurology, Columbia University Medical Center, New York, NY (United States); Garrido, Marta [Unitat de Biologia Cel.lular i Molecular, IMIM-Hospital del Mar, Barcelona (Spain); Garcia-Arumi, Elena [Institut de Recerca, Hospital Universitari de la Vall d' Hebron, Barcelona (Spain); Centro de Investigacion Biomedica en Red de Enfermedades Raras (CIBERER), ISCIII (Spain); Meseguer, Anna [Institut de Recerca, Hospital Universitari de la Vall d' Hebron, Barcelona (Spain); Hirano, Michio [Department of Neurology, Columbia University Medical Center, New York, NY (United States); Vila, Maya R. [Institut de Recerca, Hospital Universitari de la Vall d' Hebron, Barcelona (Spain)

    2011-04-08

    Highlights: {yields} We impaired TK2 expression in Ost TK1{sup -} cells via siRNA-mediated interference (TK2{sup -}). {yields} TK2 impairment caused severe mitochondrial DNA (mtDNA) depletion in quiescent cells. {yields} Despite mtDNA depletion, TK2{sup -} cells show high cytochrome oxidase activity. {yields} Depletion of mtDNA occurs without imbalance in the mitochondrial dNTP pool. {yields} Nuclear-encoded ENT1, DNA-pol {gamma}, TFAM and TP gene expression is lowered in TK2{sup -} cells. -- Abstract: The mitochondrial DNA (mtDNA) depletion syndrome comprises a clinically heterogeneous group of diseases characterized by reductions of the mtDNA abundance, without associated point mutations or rearrangements. We have developed the first in vitro model to study of mtDNA depletion due to reduced mitochondrial thymidine kinase 2 gene (TK2) expression in order to understand the molecular mechanisms involved in mtDNA depletion syndrome due to TK2 mutations. Small interfering RNA targeting TK2 mRNA was used to decrease TK2 expression in Ost TK1{sup -} cells, a cell line devoid of endogenous thymidine kinase 1 (TK1). Stable TK2-deficient cell lines showed a reduction of TK2 levels close to 80%. In quiescent conditions, TK2-deficient cells showed severe mtDNA depletion, also close to 80% the control levels. However, TK2-deficient clones showed increased cytochrome c oxidase activity, higher cytochrome c oxidase subunit I transcript levels and higher subunit II protein expression respect to control cells. No alterations of the deoxynucleotide pools were found, whereas a reduction in the expression of genes involved in nucleoside/nucleotide homeostasis (human equilibrative nucleoside transporter 1, thymidine phosphorylase) and mtDNA maintenance (DNA-polymerase {gamma}, mitochondrial transcription factor A) was observed. Our findings highlight the importance of cellular compensatory mechanisms that enhance the expression of respiratory components to ensure respiratory activity

  20. Sequence analysis of a Molluscum contagiosum virus DNA region which includes the gene encoding protein kinase 2 and other genes with unique organization.

    Science.gov (United States)

    Martin-Gallardo, A; Moratilla, M; Funes, J M; Agromayor, M; Nuñez, A; Varas, A J; Collado, M; Valencia, A; Lopez-Estebaranz, J L; Esteban, M

    1996-01-01

    The nucleotide sequence of a near left-terminal region from the genome of Molluscum contagiosum virus subtype I (MCVI) was determined. This region was contained within three adjacent BamHI fragments, designated L (2.4 kilobases (kb)), M (1.8 kb), and N (1.6 kb). BamHI cleavage of MCVI DNA produced another 1.6-kb fragment (N'), which had been mapped 30-50 kb from the L,M region. The MCVI restriction fragments were cloned and end-sequenced. The N fragment that maps at the L,M region was identified by the polymerase chain reaction, using primers devised from the sequence of each fragment. The results from this analysis led to establish the relative position of these fragments within the MCVI genome. The analysis of 3.6 kb of DNA sequence revealed the presence of ten open reading frames (ORFs). Comparison of the amino acid sequence of these ORFs to the amino acid sequence of vaccinia virus (VAC) proteins revealed that two complete MCVI ORFs, termed N1L and L1L, showed high degree of homology with VAC F9 and F10 genes, respectively. The F10 gene encodes a 52-kDa serine/threonine protein kinase (protein kinase 2), an essential protein involved in virus morphogenesis. The MCVI homologue (L1L) encoded a putative polypeptide of 443 aa, with a calculated molecular mass of 53 kDa, and 60.5/30.2% sequence identity/similarity to VAC F10. The MCV N1L (213 aa, 24 kDa) showed 42.6/40.6% amino acid sequence identity/similarity to VAC F9, a gene of unknown function encoding a 24-kDa protein with a hydrophobic C-terminal domain, which was conserved in MCVI. The genomic arrangement of MCVI N1L and L1L was equivalent to that of the vaccinia and variola virus homologues. However, the ORFs contained within MCVI fragment M (leftward) showed no homology, neither similarity in genetic organization, to the genes encoded by the corresponding regions of vaccinia and variola viruses.

  1. Strengthening concept learning by repeated testing.

    Science.gov (United States)

    Wiklund-Hörnqvist, Carola; Jonsson, Bert; Nyberg, Lars

    2014-02-01

    The aim of this study was to examine whether repeated testing with feedback benefits learning compared to rereading of introductory psychology key-concepts in an educational context. The testing effect was examined immediately after practice, after 18 days, and at a five-week delay in a sample of undergraduate students (n = 83). The results revealed that repeated testing with feedback significantly enhanced learning compared to rereading at all delays, demonstrating that repeated retrieval enhances retention compared to repeated encoding in the short- and the long-term. In addition, the effect of repeated testing was beneficial for students irrespectively of working memory capacity. It is argued that teaching methods involving repeated retrieval are important to consider by the educational system.

  2. Repeat concussions in the national football league.

    Science.gov (United States)

    Casson, Ira R; Viano, David C; Powell, John W; Pellman, Elliot J

    2011-01-01

    Repeat concussion is an important issue in the National Football League (NFL). An initial description of repeat injuries was published for 6 years (1996-2001). The characteristics and frequency of repeat concussion in the NFL have not changed in the subsequent 6 years (2002-2007). Case control. From 1996 to 2007, concussions were reported using a standardized form documenting signs and symptoms, loss of consciousness and medical action taken. Data on repeat concussions were analyzed for the 12 years and compared between the 2 periods. In 2002-2007, 152 players had repeat concussions (vs 160 in 1996-2001); 44 had 3+ head injuries (vs 52). The positions most often associated with repeat concussion in 2002-2007 were the defensive secondary, kick unit, running back, and linebacker. The odds for repeat concussion were elevated for wide receivers, tight ends, and linebackers but lower than in the earlier period. During 2002-2007, over half of players with repeat concussion were removed from play, and fewer immediately returned (vs 1996-2001). The average duration between concussions was 1.25 years for 2002-2007 and 1.65 years for the 12-year period. Over 12 years, 7.6% of all repeat concussions occurred within 2 weeks of the prior concussion. The defensive secondary, kick unit, running back, and linebacker have the highest incidence of repeat concussion. During 2002-2007, more than half of players with repeat concussion were removed from play, and only a fraction immediately returned. Although concussion was managed more conservatively by team physicians in the recent 6 years, repeat concussions occurred at similar rates during both periods.

  3. Automated quality checks on repeat prescribing.

    OpenAIRE

    Rogers, Jeremy E; Wroe, Christopher J; Roberts, Angus; Swallow, Angela; Stables, David; Cantrill, Judith A; Rector, Alan L.

    2003-01-01

    BACKGROUND: Good clinical practice in primary care includes periodic review of repeat prescriptions. Markers of prescriptions that may need review have been described, but manually checking all repeat prescriptions against the markers would be impractical. AIM: To investigate the feasibility of computerising the application of repeat prescribing quality checks to electronic patient records in United Kingdom (UK) primary care. DESIGN OF STUDY: Software performance test against benchmark manual...

  4. Short Tandem Repeat DNA Internet Database

    Science.gov (United States)

    SRD 130 Short Tandem Repeat DNA Internet Database (Web, free access)   Short Tandem Repeat DNA Internet Database is intended to benefit research and application of short tandem repeat DNA markers for human identity testing. Facts and sequence information on each STR system, population data, commonly used multiplex STR systems, PCR primers and conditions, and a review of various technologies for analysis of STR alleles have been included.

  5. Conformational heterogeneity of the Roc domains in C. tepidum Roc-COR and implications for human LRRK2 Parkinson mutations

    NARCIS (Netherlands)

    Rudi, Katharina; Ho, Franz Y; Gilsbach, Bernd Karl; Pots, Henderikus; Wittinghofer, Alfred; Kortholt, Arjan; Klare, Johann P

    2015-01-01

    Ras of complex proteins (Roc) is a Ras-like GTP binding domain that always occurs in tandem with the C-terminal of Roc (COR) domain, and is found in bacteria, plants and animals. Recently, it has been shown that Roco proteins belong to the family of G-proteins activated by nucleotide-dependent dimer

  6. Repeatability & Workability Evaluation of SIGMOD 2009

    KAUST Repository

    Manegold, Stefan

    2010-12-15

    SIGMOD 2008 was the first database conference that offered to test submitters\\' programs against their data to verify the repeatability of the experiments published [1]. Given the positive feedback concerning the SIGMOD 2008 repeatability initiative, SIGMOD 2009 modified and expanded the initiative with a workability assessment.

  7. Reward modulation of contextual cueing: Repeated context overshadows repeated target location.

    Science.gov (United States)

    Sharifian, Fariba; Contier, Oliver; Preuschhof, Claudia; Pollmann, Stefan

    2017-08-07

    Contextual cueing can be enhanced by reward. However, there is a debate if reward is associated with the repeated target-distractor configurations or with the repeated target locations that occur in both repeated and new displays. Based on neuroimaging evidence, we hypothesized that reward becomes associated with the target location only in new displays, but not in repeated displays, where the repeated target location is overshadowed by the more salient repeated target-distractor configuration. To test this hypothesis, we varied the reward value associated with the same target location in repeated and new displays. The results confirmed the overshadowing hypothesis in that search facilitation in repeated target-distractor configurations was modulated by the variable value associated with the target location. This effect was observed mainly in early learning.

  8. Childhood experiences and repeated suicidal behavior

    DEFF Research Database (Denmark)

    Krarup, Gertrud; Nielsen, Bent; Rask, P

    1991-01-01

    The aim of this study was to elucidate the influence of various events in childhood on suicidal behavior in adult age. For this purpose, 99 patients admitted to the Department of Psychiatry of Odense University Hospital after making a suicide attempt were followed for 5 years, to register repeated...... suicidal behavior. The results showed that three fourths of the patients attempted suicide more than once (62% nonfatal and 14% fatal outcome). The sex distribution was about the same among the first-evers as among the repeaters. Most repeaters were younger people in their twenties and thirties......, and the first-evers on average were past the age of 40. Somewhat unexpectedly, significantly more repeaters than first-evers had grown up with both their parents. However, the results also showed that significantly more repeaters than first-evers had had an unhappy childhood. This indicates...

  9. UK 2009-2010 repeat station report

    Directory of Open Access Journals (Sweden)

    Thomas J.G. Shanahan

    2013-03-01

    Full Text Available The British Geological Survey is responsible for conducting the UK geomagnetic repeat station programme. Measurements made at the UK repeat station sites are used in conjunction with the three UK magnetic observatories: Hartland, Eskdalemuir and Lerwick, to produce a regional model of the local field each year. The UK network of repeat stations comprises 41 stations which are occupied at approximately 3-4 year intervals. Practices for conducting repeat station measurements continue to evolve as advances are made in survey instrumentation and as the usage of the data continues to change. Here, a summary of the 2009 and 2010 UK repeat station surveys is presented, highlighting the measurement process and techniques, density of network, reduction process and recent results.

  10. The child accident repeater: a review.

    Science.gov (United States)

    Jones, J G

    1980-04-01

    The child accident repeater is defined as one who has at least three accidents that come to medical attention within a year. The accident situation has features in common with those of the child who has a single accident through simple "bad luck", but other factors predispose him to repeated injury. In the child who has a susceptible personality, a tendency for accident repetition may be due to a breakdown in adjustment to a stressful environment. Prevention of repeat accidents should involve the usual measures considered appropriate for all children as well as an attempt to provide treatment of significant maladjustment and modification of a stressful environment.

  11. Casein kinase 2 down-regulation and activation by polybasic peptides are mediated by acidic residues in the 55-64 region of the beta-subunit. A study with calmodulin as phosphorylatable substrate

    DEFF Research Database (Denmark)

    Meggio, F; Boldyreff, B; Issinger, O G;

    1994-01-01

    The noncatalytic beta-subunit is responsible for the latency of casein kinase 2 (CK2) activity toward calmodulin. Twenty-one mutants of the beta-subunit bearing either deletions or Ala substitutions for charged residues in the 5-6, 55-70, and 171-178 sequences have been assayed for their ability...... insensitive to 42 nM polylysine, which conversely promotes a more than 10-fold increase of calmodulin phosphorylation with wild-type beta.(ABSTRACT TRUNCATED AT 250 WORDS)...

  12. The Moral Maturity of Repeater Delinquents.

    Science.gov (United States)

    Petronio, Richard J.

    1980-01-01

    Differences in moral development (as conceived by Kohlberg) were examined in a sample of delinquent teenagers. The repeater group was not found, as had been hypothesized, to be lower on moral maturity than those who engaged in less delinquency. (GC)

  13. Star repeaters for fiber optic links.

    Science.gov (United States)

    McMahon, D H; Gravel, R L

    1977-02-01

    A star repeater combines the functions of a passive star coupler and a signal regenerating amplifier. By more effectively utilizing the light power radiated by a light emitting diode, the star repeater can, when used with small diameter channels, couple as much power to all receivers of a multiterminal link as would be coupled to the single receiver of a simple point-to-point link.

  14. Digital repeat analysis; setup and operation.

    Science.gov (United States)

    Nol, J; Isouard, G; Mirecki, J

    2006-06-01

    Since the emergence of digital imaging, there have been questions about the necessity of continuing reject analysis programs in imaging departments to evaluate performance and quality. As a marketing strategy, most suppliers of digital technology focus on the supremacy of the technology and its ability to reduce the number of repeats, resulting in less radiation doses given to patients and increased productivity in the department. On the other hand, quality assurance radiographers and radiologists believe that repeats are mainly related to positioning skills, and repeat analysis is the main tool to plan training needs to up-skill radiographers. A comparative study between conventional and digital imaging was undertaken to compare outcomes and evaluate the need for reject analysis. However, digital technology still being at its early development stages, setting a credible reject analysis program became the major task of the study. It took the department, with the help of the suppliers of the computed radiography reader and the picture archiving and communication system, over 2 years of software enhancement to build a reliable digital repeat analysis system. The results were supportive of both philosophies; the number of repeats as a result of exposure factors was reduced dramatically; however, the percentage of repeats as a result of positioning skills was slightly on the increase for the simple reason that some rejects in the conventional system qualifying for both exposure and positioning errors were classified as exposure error. The ability of digitally adjusting dark or light images reclassified some of those images as positioning errors.

  15. Quantum Key Distribution over Probabilistic Quantum Repeaters

    CERN Document Server

    Amirloo, Jeyran; Majedi, A Hamed

    2010-01-01

    A feasible route towards implementing long-distance quantum key distribution (QKD) systems relies on probabilistic schemes for entanglement distribution and swapping as proposed in the work of Duan, Lukin, Cirac, and Zoller (DLCZ) [Nature 414, 413 (2001)]. Here, we calculate the conditional throughput and fidelity of entanglement for DLCZ quantum repeaters, by accounting for the DLCZ self-purification property, in the presence of multiple excitations in the ensemble memories as well as loss and other sources of inefficiency in the channel and measurement modules. We then use our results to find the generation rate of secure key bits for QKD systems that rely on DLCZ quantum repeaters. We compare the key generation rate per logical memory employed in the two cases of with and without a repeater node. We find the cross-over distance beyond which the repeater system outperforms the non-repeater one. That provides us with the optimum inter-node distancing in quantum repeater systems. We also find the optimal exci...

  16. Remarkable selective constraints on exonic dinucleotide repeats.

    Science.gov (United States)

    Haasl, Ryan J; Payseur, Bret A

    2014-09-01

    Long dinucleotide repeats found in exons present a substantial mutational hazard: mutations at these loci occur often and generate frameshifts. Here, we provide clear and compelling evidence that exonic dinucleotides experience strong selective constraint. In humans, only 18 exonic dinucleotides have repeat lengths greater than six, which contrasts sharply with the genome-wide distribution of dinucleotides. We genotyped each of these dinucleotides in 200 humans from eight 1000 Genomes Project populations and found a near-absence of polymorphism. More remarkably, divergence data demonstrate that repeat lengths have been conserved across the primate phylogeny in spite of what is likely considerable mutational pressure. Coalescent simulations show that even a very low mutation rate at these loci fails to explain the anomalous patterns of polymorphism and divergence. Our data support two related selective constraints on the evolution of exonic dinucleotides: a short-term intolerance for any change to repeat length and a long-term prevention of increases to repeat length. In general, our results implicate purifying selection as the force that eliminates new, deleterious mutants at exonic dinucleotides. We briefly discuss the evolution of the longest exonic dinucleotide in the human genome--a 10 x CA repeat in fibroblast growth factor receptor-like 1 (FGFRL1)--that should possess a considerably greater mutation rate than any other exonic dinucleotide and therefore generate a large number of deleterious variants. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

  17. Dynamic combinatorial libraries of artificial repeat proteins.

    Science.gov (United States)

    Eisenberg, Margarita; Shumacher, Inbal; Cohen-Luria, Rivka; Ashkenasy, Gonen

    2013-06-15

    Repeat proteins are found in almost all cellular systems, where they are involved in diverse molecular recognition processes. Recent studies have suggested that de novo designed repeat proteins may serve as universal binders, and might potentially be used as practical alternative to antibodies. We describe here a novel chemical methodology for producing small libraries of repeat proteins, and screening in parallel the ligand binding of library members. The first stage of this research involved the total synthesis of a consensus-based three-repeat tetratricopeptide (TPR) protein (~14 kDa), via sequential attachment of the respective peptides. Despite the effectiveness of the synthesis and ligation steps, this method was found to be too demanding for the production of proteins containing variable number of repeats. Additionally, the analysis of binding of the individual proteins was time consuming. Therefore, we designed and prepared novel dynamic combinatorial libraries (DCLs), and show that their equilibration can facilitate the formation of TPR proteins containing up to eight repeating units. Interestingly, equilibration of the library building blocks in the presence of the biologically relevant ligands, Hsp90 and Hsp70, induced their oligomerization into forming more of the proteins with large recognition surfaces. We suggest that this work presents a novel simple and rapid tool for the simultaneous screening of protein mixtures with variable binding surfaces, and for identifying new binders for ligands of interest.

  18. Automated genotyping of dinucleotide repeat markers

    Energy Technology Data Exchange (ETDEWEB)

    Perlin, M.W.; Hoffman, E.P. [Carnegie Mellon Univ., Pittsburgh, PA (United States)]|[Univ. of Pittsburgh, PA (United States)

    1994-09-01

    The dinucleotide repeats (i.e., microsatellites) such as CA-repeats are a highly polymorphic, highly abundant class of PCR-amplifiable markers that have greatly streamlined genetic mapping experimentation. It is expected that over 30,000 such markers (including tri- and tetranucleotide repeats) will be characterized for routine use in the next few years. Since only size determination, and not sequencing, is required to determine alleles, in principle, dinucleotide repeat genotyping is easily performed on electrophoretic gels, and can be automated using DNA sequencers. Unfortunately, PCR stuttering with these markers generates not one band for each allele, but a pattern of bands. Since closely spaced alleles must be disambiguated by human scoring, this poses a key obstacle to full automation. We have developed methods that overcome this obstacle. Our model is that the observed data is generated by arithmetic superposition (i.e., convolution) of multiple allele patterns. By quantitatively measuring the size of each component band, and exploiting the unique stutter pattern associated with each marker, closely spaced alleles can be deconvolved; this unambiguously reconstructs the {open_quotes}true{close_quotes} allele bands, with stutter artifact removed. We used this approach in a system for automated diagnosis of (X-linked) Duchenne muscular dystrophy; four multiplexed CA-repeats within the dystrophin gene were assayed on a DNA sequencer. Our method accurately detected small variations in gel migration that shifted the allele size estimate. In 167 nonmutated alleles, 89% (149/167) showed no size variation, 9% (15/167) showed 1 bp variation, and 2% (3/167) showed 2 bp variation. We are currently developing a library of dinucleotide repeat patterns; together with our deconvolution methods, this library will enable fully automated genotyping of dinucleotide repeats from sizing data.

  19. Mining of simple sequence repeats in the Genome of Gentianaceae

    Directory of Open Access Journals (Sweden)

    R Sathishkumar

    2011-01-01

    Full Text Available Simple sequence repeats (SSRs or short tandem repeats are short repeat motifs that show high level of length polymorphism due to insertion or deletion mutations of one or more repeat types. Here, we present the detection and abundance of microsatellites or SSRs in nucleotide sequences of Gentianaceae family. A total of 545 SSRs were mined in 4698 nucleotide sequences downloaded from the National Center for Biotechnology Information (NCBI. Among the SSR sequences, the frequency of repeat type was about 429 -mono repeats, 99 -di repeats, 15 -tri repeats, and 2 --hexa repeats. Mononucleotide repeats were found to be abundant repeat types, about 78%, followed by dinucleotide repeats (18.16% among the SSR sequences. An attempt was made to design primer pairs for 545 identified SSRs but these were found only for 169 sequences.

  20. PolyQ repeat expansions in ATXN2 associated with ALS are CAA interrupted repeats.

    Directory of Open Access Journals (Sweden)

    Zhenming Yu

    Full Text Available Amyotrophic lateral sclerosis (ALS is a devastating, rapidly progressive disease leading to paralysis and death. Recently, intermediate length polyglutamine (polyQ repeats of 27-33 in ATAXIN-2 (ATXN2, encoding the ATXN2 protein, were found to increase risk for ALS. In ATXN2, polyQ expansions of ≥ 34, which are pure CAG repeat expansions, cause spinocerebellar ataxia type 2. However, similar length expansions that are interrupted with other codons, can present atypically with parkinsonism, suggesting that configuration of the repeat sequence plays an important role in disease manifestation in ATXN2 polyQ expansion diseases. Here we determined whether the expansions in ATXN2 associated with ALS were pure or interrupted CAG repeats, and defined single nucleotide polymorphisms (SNPs rs695871 and rs695872 in exon 1 of the gene, to assess haplotype association. We found that the expanded repeat alleles of 40 ALS patients and 9 long-repeat length controls were all interrupted, bearing 1-3 CAA codons within the CAG repeat. 21/21 expanded ALS chromosomes with 3CAA interruptions arose from one haplotype (GT, while 18/19 expanded ALS chromosomes with <3CAA interruptions arose from a different haplotype (CC. Moreover, age of disease onset was significantly earlier in patients bearing 3 interruptions vs fewer, and was distinct between haplotypes. These results indicate that CAG repeat expansions in ATXN2 associated with ALS are uniformly interrupted repeats and that the nature of the repeat sequence and haplotype, as well as length of polyQ repeat, may play a role in the neurological effect conferred by expansions in ATXN2.

  1. Repeatability of peripheral aberrations in young emmetropes.

    Science.gov (United States)

    Baskaran, Karthikeyan; Theagarayan, Baskar; Carius, Staffan; Gustafsson, Jörgen

    2010-10-01

    The purpose of this study is to assess the intrasession repeatability of ocular aberration measurements in the peripheral visual field with a commercially available Shack-Hartmann aberrometer (complete ophthalmic analysis system-high definition-vision research). The higher-order off-axis aberrations data in young healthy emmetropic eyes are also reported. The aberrations of the right eye of 18 emmetropes were measured using an aberrometer with an open field of view that allows peripheral measurements. Five repeated measures of ocular aberrations were obtained and assessed in steps of 10° out to ±40° in the horizontal visual field (nasal + and temporal -) and -20° in the inferior visual field. The coefficient of repeatability, coefficient of variation, and the intraclass correlation coefficient were calculated as a measure of intrasession repeatability. In all eccentric angles, the repeatability of the third- and fourth-order aberrations was better than the fifth and sixth order aberrations. The coefficient of variation was coefficient was >0.90 for the third and fourth order but reduced gradually for higher orders. There was no statistical significant difference in variance of total higher-order root mean square between on- and off-axis measurements (p > 0.05). The aberration data in this group of young emmetropes showed that the horizontal coma (C(3)(1)) was most positive at 40° in the temporal field, decreasing linearly toward negative values with increasing off-axis angle into the nasal field, whereas all other higher-order aberrations showed little or no change. The complete ophthalmic analysis system-high definition-vision research provides fast, repeatable, and valid peripheral aberration measurements and can be used efficiently to measure off-axis aberrations in the peripheral visual field.

  2. Safety of Repeated Yttrium-90 Radioembolization

    Energy Technology Data Exchange (ETDEWEB)

    Lam, Marnix G. E. H.; Louie, John D. [Stanford University School of Medicine, Division of Interventional Radiology (United States); Iagaru, Andrei H.; Goris, Michael L. [Stanford University School of Medicine, Division of Nuclear Medicine (United States); Sze, Daniel Y., E-mail: dansze@stanford.edu [Stanford University School of Medicine, Division of Interventional Radiology (United States)

    2013-10-15

    Purpose: Repeated radioembolization (RE) treatments carry theoretically higher risk of radiation-induced hepatic injury because of the liver's cumulative memory of previous exposure. We performed a retrospective safety analysis on patients who underwent repeated RE. Methods: From 2004 to 2011, a total of 247 patients were treated by RE. Eight patients (5 men, 3 women, age range 51-71 years) underwent repeated treatment of a targeted territory, all with resin microspheres (SIR-Spheres; Sirtex, Lane Cove, Australia). Adverse events were graded during a standardized follow-up. In addition, the correlation between the occurrence of RE-induced liver disease (REILD) and multiple variables was investigated in univariate and multivariate analyses in all 247 patients who received RE. Results: Two patients died shortly after the second treatment (at 84 and 107 days) with signs and symptoms of REILD. Both patients underwent whole liver treatment twice (cumulative doses 3.08 and 2.66 GBq). The other 6 patients demonstrated only minor toxicities after receiving cumulative doses ranging from 2.41 to 3.88 GBq. All patients experienced objective tumor responses. In the whole population, multifactorial analysis identified three risk factors associated with REILD: repeated RE (p = 0.036), baseline serum total bilirubin (p = 0.048), and baseline serum aspartate aminotransferase (p = 0.043). Repeated RE proved to be the only independent risk factor for REILD in multivariate analysis (odds ratio 9.6; p = 0.002). Additionally, the administered activity per target volume (in GBq/L) was found to be an independent risk factor for REILD, but only in whole liver treatments (p = 0.033). Conclusion: The risk of REILD appears to be elevated for repeated RE. Objective tumor responses were observed, but establishment of safety limits will require improvement in dosimetric measurement and prediction.

  3. Repeat Gamma Knife Radiosurgery for Trigeminal Neuralgia

    Energy Technology Data Exchange (ETDEWEB)

    Aubuchon, Adam C., E-mail: acaubuchon@gmail.com [Department of Radiation Oncology, Wake Forest University School of Medicine, Winston-Salem, NC (United States); Chan, Michael D. [Department of Radiation Oncology, Wake Forest University School of Medicine, Winston-Salem, NC (United States); Lovato, James F. [Department of Public Health Sciences, Wake Forest University School of Medicine, Winston-Salem, NC (United States); Balamucki, Christopher J. [Department of Radiation Oncology, University of Florida, Gainesville, FL (United States); Ellis, Thomas L.; Tatter, Stephen B. [Department of Neurosurgery, Wake Forest University School of Medicine, Winston-Salem, NC (United States); McMullen, Kevin P.; Munley, Michael T.; Deguzman, Allan F.; Ekstrand, Kenneth E.; Bourland, J. Daniel; Shaw, Edward G. [Department of Radiation Oncology, Wake Forest University School of Medicine, Winston-Salem, NC (United States)

    2011-11-15

    Purpose: Repeat gamma knife stereotactic radiosurgery (GKRS) for recurrent or persistent trigeminal neuralgia induces an additional response but at the expense of an increased incidence of facial numbness. The present series summarized the results of a repeat treatment series at Wake Forest University Baptist Medical Center, including a multivariate analysis of the data to identify the prognostic factors for treatment success and toxicity. Methods and Materials: Between January 1999 and December 2007, 37 patients underwent a second GKRS application because of treatment failure after a first GKRS treatment. The mean initial dose in the series was 87.3 Gy (range, 80-90). The mean retreatment dose was 84.4 Gy (range, 60-90). The dosimetric variables recorded included the dorsal root entry zone dose, pons surface dose, and dose to the distal nerve. Results: Of the 37 patients, 81% achieved a >50% pain relief response to repeat GKRS, and 57% experienced some form of trigeminal dysfunction after repeat GKRS. Two patients (5%) experienced clinically significant toxicity: one with bothersome numbness and one with corneal dryness requiring tarsorraphy. A dorsal root entry zone dose at repeat treatment of >26.6 Gy predicted for treatment success (61% vs. 32%, p = .0716). A cumulative dorsal root entry zone dose of >84.3 Gy (72% vs. 44%, p = .091) and a cumulative pons surface dose of >108.5 Gy (78% vs. 44%, p = .018) predicted for post-GKRS numbness. The presence of any post-GKRS numbness predicted for a >50% decrease in pain intensity (100% vs. 60%, p = .0015). Conclusion: Repeat GKRS is a viable treatment option for recurrent trigeminal neuralgia, although the patient assumes a greater risk of nerve dysfunction to achieve maximal pain relief.

  4. Copy number of tandem direct repeats within the inverted repeats of Marek's disease virus DNA.

    Science.gov (United States)

    Kanamori, A; Nakajima, K; Ikuta, K; Ueda, S; Kato, S; Hirai, K

    1986-12-01

    We previously reported that DNA of the oncogenic strain BC-1 of Marek's disease virus serotype 1 (MDV1) contains three units of tandem direct repeats with 132 base pair (bp) repeats within the inverted repeats of the long regions of the MDV1 genome, whereas the attenuated, nononcogenic viral DNA contains multiple units of tandem direct repeats (Maotani et al., 1986). In the present study, the difference in the copy numbers of 132 bp repeats of oncogenic and nononcogenic MDV1 DNAs in other strains of MDV1 was investigated by Southern blot hybridization. The main copy numbers in different oncogenic MDV1 strains differed: those of BC-1, JM and highly oncogenic Md5 were 3, 5 to 12 and 2, respectively. The viral DNA population with two units of repeats was small, but detectable, in cells infected with either the oncogenic BC-1 or JM strain. The MDV1 DNA in various MD cell lines contained either two units or both two and three units of repeats. The significance of the copy number of repeats in oncogenicity of MDV1 is discussed.

  5. Y Se Repite = And It Repeats Itself

    Science.gov (United States)

    Katzew, Adriana

    2010-01-01

    In this article, the author discusses Y Se Repite [And It Repeats Itself], a project she conceptualized due to the growing number of Latino/a Mexican migrant workers in dairy farms in the state of Vermont. In 2006, approximately 2,000 Latinos/as--most of them undocumented Mexican migrant workers--worked throughout the state's dairy farms, yet…

  6. Repeater For A Digital-Communication Bus

    Science.gov (United States)

    Torres-Guzman, Esteban; Olson, Stephen; Heaps, Tim

    1993-01-01

    Digital repeater circuit designed to extend range of communication on MIL-STD-1553 bus beyond original maximum allowable length of 300 ft. Circuit provides two-way communication, one way at time, and conforms to specifications of MIL-STD-1553. Crosstalk and instability eliminated.

  7. Episodes of repeated sudden deafness following pregnancies.

    Science.gov (United States)

    Pawlak-Osinska, Katarzyna; Burduk, Pawel K; Kopczynski, Andrzej

    2009-04-01

    Sex hormones influence and provoke changes in hearing levels. Sudden deafness is rarely observed in pregnant women. The effective treatment of sudden deafness in pregnant women is a challenging problem. We present a case of repeatable, completely regressed sudden deafness in a woman during her first and second pregnancies.

  8. Repeated sprint training in normobaric hypoxia.

    Science.gov (United States)

    Galvin, Harvey M; Cooke, Karl; Sumners, David P; Mileva, Katya N; Bowtell, Joanna L

    2013-12-01

    Repeated sprint ability (RSA) is a critical success factor for intermittent sport performance. Repeated sprint training has been shown to improve RSA, we hypothesised that hypoxia would augment these training adaptations. Thirty male well-trained academy rugby union and rugby league players (18.4 ± 1.5 years, 1.83 ± 0.07 m, 88.1 ± 8.9 kg) participated in this single-blind repeated sprint training study. Participants completed 12 sessions of repeated sprint training (10 × 6 s, 30 s recovery) over 4 weeks in either hypoxia (13% FiO₂) or normoxia (21% FiO₂). Pretraining and post-training, participants completed sports specific endurance and sprint field tests and a 10 × 6 s RSA test on a non-motorised treadmill while measuring speed, heart rate, capillary blood lactate, muscle and cerebral deoxygenation and respiratory measures. Yo-Yo Intermittent Recovery Level 1 test performance improved after RS training in both groups, but gains were significantly greater in the hypoxic (33 ± 12%) than the normoxic group (14 ± 10%, prepeated aerobic high intensity workout than an equivalent normoxic training. Performance gains are evident in the short term (4 weeks), a period similar to a preseason training block.

  9. Adaptation and complexity in repeated games

    DEFF Research Database (Denmark)

    Maenner, Eliot Alexander

    2008-01-01

    The paper presents a learning model for two-player infinitely repeated games. In an inference step players construct minimally complex inferences of strategies based on observed play, and in an adaptation step players choose minimally complex best responses to an inference. When players randomly ...

  10. A Structured Group Program for Repeat Dieters.

    Science.gov (United States)

    McNamara, Kathleen

    1989-01-01

    Describes a structured group program for women who repeatedly diet and may be at risk of developing more serious eating disorders. Discusses sessions focusing on eating behavior as well as internal factors that contribute to low body esteem and food and weight preoccupation. Evaluates effectiveness of program by self-reports of members of two…

  11. Why Do Students Repeat Admissions Tests?

    Science.gov (United States)

    Jones, Martha S.

    Attitudes and beliefs about the admissions process, especially the role of standardized testing in admissions, were examined for students who took a standardized admissions test more than once. Their attitudes were compared with those of students who did not repeat the test. About 200 preveterinary students who had taken the Veterinary Aptitude…

  12. The Effect of Repeaters on Equating

    Science.gov (United States)

    Kim, HeeKyoung; Kolen, Michael J.

    2010-01-01

    Test equating might be affected by including in the equating analyses examinees who have taken the test previously. This study evaluated the effect of including such repeaters on Medical College Admission Test (MCAT) equating using a population invariance approach. Three-parameter logistic (3-PL) item response theory (IRT) true score and…

  13. Triggering of repeating earthquakes in central California

    Science.gov (United States)

    Wu, Chunquan; Gomberg, Joan; Ben-Naim, Eli; Johnson, Paul

    2014-01-01

    Dynamic stresses carried by transient seismic waves have been found capable of triggering earthquakes instantly in various tectonic settings. Delayed triggering may be even more common, but the mechanisms are not well understood. Catalogs of repeating earthquakes, earthquakes that recur repeatedly at the same location, provide ideal data sets to test the effects of transient dynamic perturbations on the timing of earthquake occurrence. Here we employ a catalog of 165 families containing ~2500 total repeating earthquakes to test whether dynamic perturbations from local, regional, and teleseismic earthquakes change recurrence intervals. The distance to the earthquake generating the perturbing waves is a proxy for the relative potential contributions of static and dynamic deformations, because static deformations decay more rapidly with distance. Clear changes followed the nearby 2004 Mw6 Parkfield earthquake, so we study only repeaters prior to its origin time. We apply a Monte Carlo approach to compare the observed number of shortened recurrence intervals following dynamic perturbations with the distribution of this number estimated for randomized perturbation times. We examine the comparison for a series of dynamic stress peak amplitude and distance thresholds. The results suggest a weak correlation between dynamic perturbations in excess of ~20 kPa and shortened recurrence intervals, for both nearby and remote perturbations.

  14. A Repeater in the Language Laboratory

    Science.gov (United States)

    Griffiths, B. T.

    1969-01-01

    Discusses the feasilility of the use of repeater devices in the language laboratory in order to enable the student to "recapitulate effortlessly and and indefinitely any utterance of any length which is causing him difficulty or is of special interest. (FWB)

  15. The Differential Effects of Repeating Kindergarten

    Science.gov (United States)

    Burkam, David T.; LoGerfo, Laura; Ready, Doug; Lee, Valerie E.

    2007-01-01

    We use the Early Childhood Longitudinal Study to investigate national patterns addressing (a) who repeats kindergarten, and (b) the subsequent cognitive effects of this event. Using OLS regression techniques, we investigate 1st-time kindergartners who are promoted, 1st-time kindergartners who are retained, and children who are already repeating…

  16. Preventing Repeat Teen Births PSA (:60)

    Centers for Disease Control (CDC) Podcasts

    2013-04-02

    This 60 second public service announcement is based on the April 2013 CDC Vital Signs report, which discusses repeat teen births and ways teens, parents and guardians, health care providers, and communities can help prevent them.  Created: 4/2/2013 by Centers for Disease Control and Prevention (CDC).   Date Released: 4/2/2013.

  17. Epigenetics and triplet repeat neurological diseases

    Directory of Open Access Journals (Sweden)

    Sathiji eNageshwaran

    2015-12-01

    Full Text Available The term ‘junk DNA’ has been reconsidered following the delineation of the functional significance of repetitive DNA regions. Typically associated with centromeres and telomeres, DNA repeats are found in nearly all organisms throughout their genomes. Repetitive regions are frequently heterchromatinised resulting in silencing of intrinsic and nearby genes. However, this is not a uniform rule, with several genes known to require such an environment to permit transcription. Repetitive regions frequently exist as dinucleotide, trinucleotide and tetranucleotide repeats. The association between repetitive regions and disease was emphasised following the discovery of abnormal trinucleotide repeats underlying spinal and bulbar muscular atrophy (Kennedy’s disease and fragile X syndrome of mental retardation (FRAXA in 1991. In this review we provide a brief overview of epigenetic mechanisms and then focus on several diseases caused by DNA triplet-repeat expansions, which exhibit diverse epigenetic effects. It is clear that the emerging field of epigenetics is already generating novel potential therapeutic avenues for this group of largely incurable diseases.

  18. Costly renegotiation in repeated Bertand games

    DEFF Research Database (Denmark)

    Andersson, Ola; Wengström, Erik Roland

    2010-01-01

    This paper extends the concept of weak renegotiation-proof equilibrium (WRP) to allow for costly renegotiation and shows that even small renegotiation costs can have dramatic effects on the set of equilibria. More specifically, the paper analyzes the infinitely repeated Bertrand game. It is shown...

  19. EVOLUTION AND RECOMBINATION OF BOVINE DNA REPEATS

    NARCIS (Netherlands)

    JOBSE, C; BUNTJER, JB; HAAGSMA, N; BREUKELMAN, HJ; BEINTEMA, JJ; LENSTRA, JA

    The history of the abundant repeat elements in the bovine genome has been studied by comparative hybridization and PCR. The Bov-A and Bov-B SINE elements both emerged just after the divergence of the Camelidae and the true ruminants. A 31-bp subrepeat motif in satellites of the Bovidae species

  20. Building Fluency through the Repeated Reading Method

    Science.gov (United States)

    Cohen, Joshua

    2011-01-01

    For the last two years the author has used Repeated Reading (RR) to teach reading fluency in English as a Foreign Language classrooms in colleges and universities in Japan. RR is a method where the student reads and rereads a text silently or aloud from two to four times to reach a predetermined level of speed, accuracy, and comprehension. RR…

  1. History repeats itself: genomic divergence in copepods.

    Science.gov (United States)

    Renaut, Sébastien; Dion-Côté, Anne-Marie

    2016-04-01

    Press stop, erase everything from now till some arbitrary time in the past and start recording life as it evolves once again. Would you see the same tape of life playing itself over and over, or would a different story unfold every time? The late Steven Jay Gould called this experiment replaying the tape of life and argued that any replay of the tape would lead evolution down a pathway radically different from the road actually taken (Gould 1989). This thought experiment has puzzled evolutionary biologists for a long time: how repeatable are evolutionary events? And if history does indeed repeat itself, what are the factors that may help us predict the path taken? A powerful means to address these questions at a small evolutionary scale is to study closely related populations that have evolved independently, under similar environmental conditions. This is precisely what Pereira et al. (2016) set out to do using marine copepods Tigriopus californicus, and present their results in this issue of Molecular Ecology. They show that evolution can be repeatable and even partly predictable, at least at the molecular level. As expected from theory, patterns of divergence were shaped by natural selection. At the same time, strong genetic drift due to small population sizes also constrained evolution down a similar evolutionary road, and probably contributed to repeatable patterns of genomic divergence.

  2. Costly renegotiation in repeated Bertand games

    DEFF Research Database (Denmark)

    Andersson, Ola; Wengström, Erik Roland

    2010-01-01

    This paper extends the concept of weak renegotiation-proof equilibrium (WRP) to allow for costly renegotiation and shows that even small renegotiation costs can have dramatic effects on the set of equilibria. More specifically, the paper analyzes the infinitely repeated Bertrand game. It is shown...

  3. Photometric Repeatability of Scanned Imagery: UVIS

    Science.gov (United States)

    Shanahan, Clare E.; McCullough, Peter; Baggett, Sylvia

    2017-08-01

    We provide the preliminary results of a study on the photometric repeatability of spatial scans of bright, isolated white dwarf stars with the UVIS channel of the Wide Field Camera 3 (WFC3) on the Hubble Space Telescope (HST). We analyze straight-line scans from the first pair of identical orbits of HST program 14878 to assess if sub 0.1% repeatability can be attained with WFC3/UVIS. This study is motivated by the desire to achieve better signal-to-noise in the UVIS contamination and stability monitor, in which observations of standard stars in staring mode have been taken from the installation of WFC3 in 2009 to the present to assess temporal photometric stability. Higher signal to noise in this program would greatly benefit the sensitivity to detect contamination, and to better characterize the observed small throughput drifts over time. We find excellent repeatability between identical visits of program 14878, with sub 0.1% repeatability achieved in most filters. These! results support the initiative to transition the staring mode UVIS contamination and photometric stability monitor from staring mode images to spatial scans.

  4. Repeat surgery after failed midurethral slings

    DEFF Research Database (Denmark)

    Foss Hansen, Margrethe; Lose, Gunnar; Kesmodel, Ulrik Schiøler

    2016-01-01

    MUS from 1998 through 2007. The outcome was repeat surgery with any subsequent procedure code for urinary incontinence within a 5-year period of the first procedure. RESULTS: A total of 5,820 women (mean age 55.4 years, ± 12.1) were registered with a synthetic MUS, and 354 (6 %) underwent reoperation...

  5. EVOLUTION AND RECOMBINATION OF BOVINE DNA REPEATS

    NARCIS (Netherlands)

    JOBSE, C; BUNTJER, JB; HAAGSMA, N; BREUKELMAN, HJ; BEINTEMA, JJ; LENSTRA, JA

    1995-01-01

    The history of the abundant repeat elements in the bovine genome has been studied by comparative hybridization and PCR. The Bov-A and Bov-B SINE elements both emerged just after the divergence of the Camelidae and the true ruminants. A 31-bp subrepeat motif in satellites of the Bovidae species cattl

  6. Multivariate linear models and repeated measurements revisited

    DEFF Research Database (Denmark)

    Dalgaard, Peter

    2009-01-01

    Methods for generalized analysis of variance based on multivariate normal theory have been known for many years. In a repeated measurements context, it is most often of interest to consider transformed responses, typically within-subject contrasts or averages. Efficiency considerations leads...

  7. On balanced minimal repeated measurements designs

    Directory of Open Access Journals (Sweden)

    Shakeel Ahmad Mir

    2014-10-01

    Full Text Available Repeated Measurements designs are concerned with scientific experiments in which each experimental unit is assigned more than once to a treatment either different or identical. This class of designs has the property that the unbiased estimators for elementary contrasts among direct and residual effects are obtainable. Afsarinejad (1983 provided a method of constructing balanced Minimal Repeated Measurements designs p < t , when t is an odd or prime power, one or more than one treatment may occur more than once in some sequences and  designs so constructed no longer remain uniform in periods. In this paper an attempt has been made to provide a new method to overcome this drawback. Specifically, two cases have been considered                RM[t,n=t(t-t/(p-1,p], λ2=1 for balanced minimal repeated measurements designs and  RM[t,n=2t(t-t/(p-1,p], λ2=2 for balanced  repeated measurements designs. In addition , a method has been provided for constructing              extra-balanced minimal designs for special case RM[t,n=t2/(p-1,p], λ2=1.

  8. The effect of polylysine on casein-kinase-2 activity is influenced by both the structure of the protein/peptide substrates and the subunit composition of the enzyme

    DEFF Research Database (Denmark)

    Meggio, F; Boldyreff, B; Marin, O

    1992-01-01

    phosphorylated by either CK2 holoenzyme or the recombinant alpha subunit with 5.8-fold and 2.8-fold stimulation by polylysine, respectively. The recombinant beta subunit of CK2 is itself a good exogenous substrate for the enzyme, its phosphorylation, however, is inhibited rather than enhanced by polylysine...... alpha subunit. The concentration of polylysine required for half-maximal stimulation is comparable to CK2 concentration and increases by increasing CK2 concentration, suggesting that polylysine primarily interacts with the enzyme, rather than with the peptide substrate.......The mechanism by which polybasic peptides stimulate the activity of casein kinase 2 (CK2) has been studied by comparing the effect of polylysine on the phosphorylation of a variety of protein and peptide substrates by the native CK2 holoenzyme and by its recombinant catalytic alpha subunit, either...

  9. The effect of polylysine on casein-kinase-2 activity is influenced by both the structure of the protein/peptide substrates and the subunit composition of the enzyme

    DEFF Research Database (Denmark)

    Meggio, F; Boldyreff, B; Marin, O;

    1992-01-01

    alpha subunit. The concentration of polylysine required for half-maximal stimulation is comparable to CK2 concentration and increases by increasing CK2 concentration, suggesting that polylysine primarily interacts with the enzyme, rather than with the peptide substrate.......The mechanism by which polybasic peptides stimulate the activity of casein kinase 2 (CK2) has been studied by comparing the effect of polylysine on the phosphorylation of a variety of protein and peptide substrates by the native CK2 holoenzyme and by its recombinant catalytic alpha subunit, either...... phosphorylated by either CK2 holoenzyme or the recombinant alpha subunit with 5.8-fold and 2.8-fold stimulation by polylysine, respectively. The recombinant beta subunit of CK2 is itself a good exogenous substrate for the enzyme, its phosphorylation, however, is inhibited rather than enhanced by polylysine...

  10. RepeatsDB 2.0: improved annotation, classification, search and visualization of repeat protein structures

    Science.gov (United States)

    Paladin, Lisanna; Hirsh, Layla; Piovesan, Damiano; Andrade-Navarro, Miguel A.; Kajava, Andrey V.; Tosatto, Silvio C.E.

    2017-01-01

    RepeatsDB 2.0 (URL: http://repeatsdb.bio.unipd.it/) is an update of the database of annotated tandem repeat protein structures. Repeat proteins are a widespread class of non-globular proteins carrying heterogeneous functions involved in several diseases. Here we provide a new version of RepeatsDB with an improved classification schema including high quality annotations for ∼5400 protein structures. RepeatsDB 2.0 features information on start and end positions for the repeat regions and units for all entries. The extensive growth of repeat unit characterization was possible by applying the novel ReUPred annotation method over the entire Protein Data Bank, with data quality is guaranteed by an extensive manual validation for >60% of the entries. The updated web interface includes a new search engine for complex queries and a fully re-designed entry page for a better overview of structural data. It is now possible to compare unit positions, together with secondary structure, fold information and Pfam domains. Moreover, a new classification level has been introduced on top of the existing scheme as an independent layer for sequence similarity relationships at 40%, 60% and 90% identity. PMID:27899671

  11. 47 CFR 80.1179 - On-board repeater limitations.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false On-board repeater limitations. 80.1179 Section... On-board repeater limitations. When an on-board repeater is used, the following limitations must be met: (a) The on-board repeater antenna must be located no higher than 3 meters (10 feet) above...

  12. Implications of genetics on the diagnosis and care of patients with Parkinson disease.

    Science.gov (United States)

    Klein, Christine

    2006-03-01

    The identification of several monogenic forms has established Parkinson disease (PD) as a movement disorder with a considerable genetic origin in at least a subset of patients. Four of the known forms, Parkin-, PINK1 (PTEN-induced putative kinase 1)-, DJ1-, and LRRK2 (leucine-rich repeat kinase 2)-linked PD, may present clinically as "idiopathic PD" and account for at least 1% of all cases of PD. However, all known monogenic forms combined explain about only 20% of early-onset PD and less than 3% of late-onset PD at best. Although the individual clinical course cannot be predicted, overall, many cases of genetic PD will progress more slowly and respond better to treatment than patients without mutations. Genetic testing frequently yields inconclusive results, is expensive, and should be used for diagnostic purposes only after careful consideration in selected cases at specialty centers. While genetic findings have greatly advanced our understanding of the pathophysiology of PD, we are faced with many novel challenges. These include the definition of the phenotypic and genotypic spectrum of the monogenic forms, a revised terminology and classification of parkinsonian syndromes, identification of genetic susceptibility factors, and development of guidelines for genetic testing and of new treatment options for PD.

  13. Diversity in the Regulation of Autophagy and Mitophagy: Lessons from Parkinson's Disease

    Directory of Open Access Journals (Sweden)

    Charleen T. Chu

    2011-01-01

    Full Text Available Selective mitochondrial degradation through autophagy (mitophagy has emerged as an important homeostatic mechanism in a variety of organisms and contexts. Complete clearance of mitochondria can be observed during normal maturation of certain mammalian cell types, and during certain forms of neuronal cell death. In recent years, autophagy dysregulation has been implicated in toxin-injured dopaminergic neurons as well as in major genetic models of Parkinson's disease (PD, including α-synuclein, leucine-rich repeat kinase 2 (LRRK2, parkin, PTEN-induced kinase 1 (PINK1, and DJ-1. Indeed, PINK1-parkin interactions may form the basis of a mechanism by which dissipation of the inner mitochondrial membrane potential can trigger selective mitochondrial targeting for autophagy. Multiple signals are likely to exist, however, depending upon the trigger for mitophagy. Similarly, the regulation of basal or injury-induced autophagy does not always follow canonical pathways described for nutrient deprivation. Implications of this regulatory diversity are discussed in the context of neuronal function and survival. Further studies are needed to address whether alterations in autophagy regulation play a directly injurious role in PD pathogenesis, or if the observed changes reflect impaired, appropriate, or excessive autophagic responses to other forms of cellular injury.

  14. The Progress of Induced Pluripotent Stem Cells as Models of Parkinson’s Disease

    Directory of Open Access Journals (Sweden)

    Ji-feng Kang

    2016-01-01

    Full Text Available In recent years, induced pluripotent stem cells (iPSCs were widely used for investigating the mechanisms of Parkinson’s disease (PD. Somatic cells from patients with SNCA (α-synuclein, LRRK2 (leucine-rich repeat kinase 2, PINK1 (PTEN induced putative kinase 1, Parkin mutations, and at-risk individuals carrying GBA (β-glucocerebrosidase mutations have been successfully induced to iPSCs and subsequently differentiated into dopaminergic (DA neurons. Importantly, some PD-related cell phenotypes, including α-synuclein aggregation, mitophagy, damaged mitochondrial DNA, and mitochondrial dysfunction, have been described in these iPSCs models, which further investigated the pathogenesis of PD. In 2007, Takahashi et al. and Vodyanik et al. generated iPSCs from human somatic cells for the first time. Since then, patients derived iPSCs were applied for disease modeling, drug discovery and screening, autologous cell replacement therapy, and other biological applications. iPSC research has now become a hot topic in a wide range of fields. This review summarizes the recent progress of PD patients derived iPSC models in pathogenic mechanism investigation and potential clinical applications, especially their promising strategy in pharmacological study and DA neurons transplantation therapy. However, the challenges of iPSC transplantation still exist, and it has a long way to go before it can be used in clinical application.

  15. Stability of dental waxes following repeated heatings.

    Science.gov (United States)

    Kotsiomiti, E; McCabe, J F

    1995-02-01

    The flow and strength properties of dental waxes were examined following excessive and repeated heatings of the materials. For one product, the flow at 40 +/- 0.5 degrees C was reduced by 25.3% following heating above 200 degrees C. A decrease of the elastic modulus at 20 +/- 1 degree C by approximately 66% was observed in some cases after the heating temperature had been increased to 300 degrees C. Property variations were related to compositional changes, which were investigated by infrared spectoscopy and thermal analysis. Exposure of dental waxes to temperatures higher than 200 degrees C, particularly if it is repeated, may affect the composition and properties, resulting in inferior materials.

  16. Learning with repeated-game strategies.

    Science.gov (United States)

    Ioannou, Christos A; Romero, Julian

    2014-01-01

    We use the self-tuning Experience Weighted Attraction model with repeated-game strategies as a computer testbed to examine the relative frequency, speed of convergence and progression of a set of repeated-game strategies in four symmetric 2 × 2 games: Prisoner's Dilemma, Battle of the Sexes, Stag-Hunt, and Chicken. In the Prisoner's Dilemma game, we find that the strategy with the most occurrences is the "Grim-Trigger." In the Battle of the Sexes game, a cooperative pair that alternates between the two pure-strategy Nash equilibria emerges as the one with the most occurrences. In the Stag-Hunt and Chicken games, the "Win-Stay, Lose-Shift" and "Grim-Trigger" strategies are the ones with the most occurrences. Overall, the pairs that converged quickly ended up at the cooperative outcomes, whereas the ones that were extremely slow to reach convergence ended up at non-cooperative outcomes.

  17. Learning With Repeated-Game Strategies

    Directory of Open Access Journals (Sweden)

    Christos A. Ioannou

    2014-07-01

    Full Text Available We use the self-tuning Experience Weighted Attraction model with repeated-game strategies as a computer testbed to examine the relative frequency, speed of convergence and progression of a set of repeated-game strategies in four symmetric 2x2 games: Prisoner's Dilemma, Battle of the Sexes, Stag-Hunt, and Chicken. In the Prisoner's Dilemma game, we fi□nd that the strategy with the most occurrences is the Grim-Trigger. In the Battle of the Sexes game, a cooperative pair that alternates between the two pure-strategy Nash equilibria emerges as the one with the most occurrences. In the Stag-Hunt and Chicken games, the Win-Stay, Lose-Shift and Grim-Trigger strategies are the ones with the most occurrences. Overall, the pairs that converged quickly ended up at the cooperative outcomes, whereas the ones that were extremely slow to reach convergence ended up at non-cooperative outcomes.

  18. Quantum repeaters with entangled coherent states

    CERN Document Server

    Sangouard, Nicolas; Gisin, Nicolas; Laurat, Julien; Tualle-Brouri, Rosa; Grangier, Philippe

    2009-01-01

    Entangled coherent states can be prepared remotely by subtracting non-locally a single photon from two quantum superpositions of coherent states, the so-called "Schroedinger's cat" state. Such entanglement can further be distributed over longer distances by successive entanglement swapping operations using linear optics and photon-number resolving detectors. The aim of this paper is to evaluate the performance of this approach to quantum repeaters for long distance quantum communications. Despite many attractive features at first sight, we show that, when using state-of-the-art photon counters and quantum memories, they do not achieve higher entanglement generation rates than repeaters based on single-photon entanglement. We discuss potential developments which may take better advantage of the richness of entanglement based on continuous variables, including in particular efficient parity measurements.

  19. Quantum repeaters based on heralded qubit amplifiers

    CERN Document Server

    Minář, Jiří; Sangouard, Nicolas

    2011-01-01

    We present a quantum repeater scheme based on the recently proposed qubit amplifier [N. Gisin, S. Pironio and N. Sangouard, Phys. Rev. Lett. 105, 070501 (2010)]. It relies on a on-demand entangled-photon pair source which uses on-demand single-photon sources, linear optical elements and atomic ensembles. Interestingly, the imperfections affecting the states created from this source, caused e.g. by detectors with non-unit efficiencies, are systematically purified from an entanglement swapping operation based on a two-photon detection. This allows the distribution of entanglement over very long distances with a high fidelity, i.e. without vacuum components and multiphoton errors. Therefore, the resulting quantum repeater architecture does not necessitate final postselections and thus achieves high entanglement distribution rates. This also provides unique opportunities for device-independent quantum key distribution over long distances with linear optics and atomic ensembles.

  20. Nonparametric additive regression for repeatedly measured data

    KAUST Repository

    Carroll, R. J.

    2009-05-20

    We develop an easily computed smooth backfitting algorithm for additive model fitting in repeated measures problems. Our methodology easily copes with various settings, such as when some covariates are the same over repeated response measurements. We allow for a working covariance matrix for the regression errors, showing that our method is most efficient when the correct covariance matrix is used. The component functions achieve the known asymptotic variance lower bound for the scalar argument case. Smooth backfitting also leads directly to design-independent biases in the local linear case. Simulations show our estimator has smaller variance than the usual kernel estimator. This is also illustrated by an example from nutritional epidemiology. © 2009 Biometrika Trust.

  1. Repeat-PPM Super-Symbol Synchronization

    Science.gov (United States)

    Connelly, J.

    2016-11-01

    To attain a wider range of data rates in pulse position modulation (PPM) schemes with constrained pulse durations, the sender can repeat a PPM symbol multiple times, forming a super-symbol. In addition to the slot and symbol synchronization typically required for PPM, the receiver must also properly align the noisy super-symbols. We present a low-complexity approximation of the maximum-likelihood method for performing super-symbol synchronization without use of synchronization sequences. We provide simulation results demonstrating performance advantage when PPM symbols are spread by a pseudo-noise sequence, as opposed to simply repeating. Additionally, the results suggest that this super-symbol synchronization technique requires signal levels below those required for reliable communication. This validates that the PPM spreading approach proposed to CCSDS can work properly as part of the overall scheme.

  2. High-bandwidth hybrid quantum repeater.

    Science.gov (United States)

    Munro, W J; Van Meter, R; Louis, Sebastien G R; Nemoto, Kae

    2008-07-25

    We present a physical- and link-level design for the creation of entangled pairs to be used in quantum repeater applications where one can control the noise level of the initially distributed pairs. The system can tune dynamically, trading initial fidelity for success probability, from high fidelity pairs (F=0.98 or above) to moderate fidelity pairs. The same physical resources that create the long-distance entanglement are used to implement the local gates required for entanglement purification and swapping, creating a homogeneous repeater architecture. Optimizing the noise properties of the initially distributed pairs significantly improves the rate of generating long-distance Bell pairs. Finally, we discuss the performance trade-off between spatial and temporal resources.

  3. Do Gamma-Ray Burst Sources Repeat?

    OpenAIRE

    Meegan, Charles A.; Hartmann, Dieter H.; Brainerd, J. J.; Briggs, Michael S.; Paciesas, William S.; Pendleton, Geoffrey; Kouveliotou, Chryssa; Fishman, Gerald; Blumenthal, George; Brock, Martin

    1995-01-01

    The demonstration of repeated gamma-ray bursts from an individual source would severely constrain burst source models. Recent reports (Quashnock and Lamb 1993; Wang and Lingenfelter 1993) of evidence for repetition in the first BATSE burst catalog have generated renewed interest in this issue. Here, we analyze the angular distribution of 585 bursts of the second BATSE catalog (Meegan et al. 1994). We search for evidence of burst recurrence using the nearest and farthest neighbor statistic and...

  4. 2D Metals by Repeated Size Reduction.

    Science.gov (United States)

    Liu, Hanwen; Tang, Hao; Fang, Minghao; Si, Wenjie; Zhang, Qinghua; Huang, Zhaohui; Gu, Lin; Pan, Wei; Yao, Jie; Nan, Cewen; Wu, Hui

    2016-10-01

    A general and convenient strategy for manufacturing freestanding metal nanolayers is developed on large scale. By the simple process of repeatedly folding and calendering stacked metal sheets followed by chemical etching, free-standing 2D metal (e.g., Ag, Au, Fe, Cu, and Ni) nanosheets are obtained with thicknesses as small as 1 nm and with sizes of the order of several micrometers.

  5. Repeatability and Workability Evaluation of SIGMOD 2011

    DEFF Research Database (Denmark)

    Bonnet, Philippe

    2011-01-01

    SIGMOD has offered, since 2008, to verify the experiments published in the papers accepted at the conference. This year, we have been in charge of reproducing the experiments provided by the authors (repeatability), and exploring changes to experiment parameters (workability). In this paper, we a...... find that most experiments are distributed as Linux packages accompanied by instructions on how to setup and run the experiments. We are still far from the vision of executable papers...

  6. Repeatability of Response to Asthma Medications

    Science.gov (United States)

    Wu, Ann; Tantisira, Kelan; Li, Lingling; Schuemann, Brooke; Weiss, Scott

    2010-01-01

    Background Pharmacogenetic studies of drug response in asthma assume that patients respond consistently to a treatment but that treatment response varies across patients, however, no formal studies have demonstrated this. Objective To determine the repeatability of commonly used outcomes for treatment response to asthma medications: bronchodilator response, forced expiratory volume in 1 second (FEV1), and provocative concentration of methacholine producing a 20% decline in FEV1 (PC20). Methods The Childhood Asthma Management Program (CAMP) was a multi-center clinical trial of children randomized to receiving budesonide, nedocromil, or placebo. We determined the intraclass correlation coefficient (ICC) for each outcome over repeated visits over four years in CAMP using mixed effects regression models. We adjusted for the covariates: age, race/ethnicity, height, family income, parental education, and symptom score. We incorporated each outcome for each child as repeated outcome measurements and stratified by treatment group. Results The ICC for bronchodilator response was 0.31 in the budesonide group, 0.35 in the nedocromil group, and 0.40 in the placebo group, after adjusting for covariates. The ICC for FEV1 was 0.71 in the budesonide group, 0.60 in the nedocromil group, and 0.69 in the placebo group, after adjusting for covariates. The ICC for PC20 was 0.67 in the budesonide and placebo groups and 0.73 in the nedocromil group, after adjusting for covariates. Conclusion The within treatment group repeatability of FEV1 and PC20 are high; thus these phenotypes are heritable. FEV1 and PC20 may be better phenotypes than bronchodilator response for studies of treatment response in asthma. PMID:19064281

  7. Repeated extraction of DNA from FTA cards

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Ferrero, Laura; Børsting, Claus

    2011-01-01

    Extraction of DNA using magnetic bead based techniques on automated DNA extraction instruments provides a fast, reliable and reproducible method for DNA extraction from various matrices. However, the yield of extracted DNA from FTA-cards is typically low. Here, we demonstrate that it is possible...... to repeatedly extract DNA from the processed FTA-disk. The method increases the yield from the nanogram range to the microgram range....

  8. Repeated extraction of DNA from FTA cards

    OpenAIRE

    Stangegaard, Michael; Ferrero, Laura; Børsting, Claus; Frank-Hansen, Rune; Hansen, Anders Johannes; Morling, Niels

    2011-01-01

    Extraction of DNA using magnetic bead based techniques on automated DNA extraction instruments provides a fast, reliable and reproducible method for DNA extraction from various matrices. However, the yield of extracted DNA from FTA-cards is typically low. Here, we demonstrate that it is possible to repeatedly extract DNA from the processed FTA-disk. The method increases the yield from the nanogram range to the microgram range.

  9. Repeated extraction of DNA from FTA cards

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Ferrero, Laura; Børsting, Claus

    2011-01-01

    Extraction of DNA using magnetic bead based techniques on automated DNA extraction instruments provides a fast, reliable and reproducible method for DNA extraction from various matrices. However, the yield of extracted DNA from FTA-cards is typically low. Here, we demonstrate that it is possible...... to repeatedly extract DNA from the processed FTA-disk. The method increases the yield from the nanogram range to the microgram range....

  10. A Central Limit Theorem for Repeating Patterns

    CERN Document Server

    Abrams, Aaron; Landau, Henry; Landau, Zeph; Pommersheim, James

    2012-01-01

    This note gives a central limit theorem for the length of the longest subsequence of a random permutation which follows some repeating pattern. This includes the case of any fixed pattern of ups and downs which has at least one of each, such as the alternating case considered by Stanley in [2] and Widom in [3]. In every case considered the convergence in the limit of long permutations is to normal with mean and variance linear in the length of the permutations.

  11. Repeatability and Workability Evaluation of SIGMOD 2011

    DEFF Research Database (Denmark)

    Bonnet, Philippe

    2011-01-01

    SIGMOD has offered, since 2008, to verify the experiments published in the papers accepted at the conference. This year, we have been in charge of reproducing the experiments provided by the authors (repeatability), and exploring changes to experiment parameters (workability). In this paper, we a...... find that most experiments are distributed as Linux packages accompanied by instructions on how to setup and run the experiments. We are still far from the vision of executable papers...

  12. Epigenetics and Triplet-Repeat Neurological Diseases

    OpenAIRE

    Nageshwaran, Sathiji; Festenstein, Richard

    2015-01-01

    The term “junk DNA” has been reconsidered following the delineation of the functional significance of repetitive DNA regions. Typically associated with centromeres and telomeres, DNA repeats are found in nearly all organisms throughout their genomes. Repetitive regions are frequently heterochromatinized resulting in silencing of intrinsic and nearby genes. However, this is not a uniform rule, with several genes known to require such an environment to permit transcription. Repetitive regions f...

  13. Epigenetics and triplet repeat neurological diseases

    OpenAIRE

    Sathiji eNageshwaran; Richard eFestenstein

    2015-01-01

    The term ‘junk DNA’ has been reconsidered following the delineation of the functional significance of repetitive DNA regions. Typically associated with centromeres and telomeres, DNA repeats are found in nearly all organisms throughout their genomes. Repetitive regions are frequently heterchromatinised resulting in silencing of intrinsic and nearby genes. However, this is not a uniform rule, with several genes known to require such an environment to permit transcription. Repetitive regions fr...

  14. Repeated-sprint ability and aerobic fitness.

    Science.gov (United States)

    Thébault, Nicolas; Léger, Luc A; Passelergue, Philippe

    2011-10-01

    The purpose of this study was to reinvestigate the relationship between aerobic fitness and fatigue indices of repeated-sprint ability (RSA), with special attention to methodological normalization. Soldiers were divided into low (n = 10) and high (n = 9) fitness groups according to a preset maximal aerobic speed (MAS) of 17 km·h(-1) (∼60 ml O2·kg(-1)·min) measured with the University of Montreal Track Test (UMTT). Subjects' assessment included the RSA test (3 sets of 5 40-m sprints with 1-minute rest between sprints and 1.5 minutes between sets), a 40-m sprint (criterion test used in the computation of fatigue indices for the RSA test), strength and power measurement of the lower limbs, and the 20-m shuttle run test (20-m SRT) and the UMTT, which are measures of maximal aerobic power. The highest correlation with the RSA fatigue indices was obtained with the 20-m SRT (r = 0.90, p = 0.0001, n = 19), a test with 180° direction changes and accelerations and decelerations. The lower correlation (r = 0.66, p repeated sprints and achieved better recovery between series. A MAS of at least 17 km·h(-1) favors constant and high speed level during repeated sprints. From a practical point of view, a high aerobic fitness is a precious asset in counteracting fatigue in sports with numerous sprint repetitions.

  15. Histone deacetylase complexes promote trinucleotide repeat expansions.

    Directory of Open Access Journals (Sweden)

    Kim Debacker

    2012-02-01

    Full Text Available Expansions of DNA trinucleotide repeats cause at least 17 inherited neurodegenerative diseases, such as Huntington's disease. Expansions can occur at frequencies approaching 100% in affected families and in transgenic mice, suggesting that specific cellular proteins actively promote (favor expansions. The inference is that expansions arise due to the presence of these promoting proteins, not their absence, and that interfering with these proteins can suppress expansions. The goal of this study was to identify novel factors that promote expansions. We discovered that specific histone deacetylase complexes (HDACs promote CTG•CAG repeat expansions in budding yeast and human cells. Mutation or inhibition of yeast Rpd3L or Hda1 suppressed up to 90% of expansions. In cultured human astrocytes, expansions were suppressed by 75% upon inhibition or knockdown of HDAC3, whereas siRNA against the histone acetyltransferases CBP/p300 stimulated expansions. Genetic and molecular analysis both indicated that HDACs act at a distance from the triplet repeat to promote expansions. Expansion assays with nuclease mutants indicated that Sae2 is one of the relevant factors regulated by Rpd3L and Hda1. The causal relationship between HDACs and expansions indicates that HDACs can promote mutagenesis at some DNA sequences. This relationship further implies that HDAC3 inhibitors being tested for relief of expansion-associated gene silencing may also suppress somatic expansions that contribute to disease progression.

  16. Landauer's Principle in Repeated Interaction Systems

    Science.gov (United States)

    Hanson, Eric P.; Joye, Alain; Pautrat, Yan; Raquépas, Renaud

    2017-01-01

    We study Landauer's Principle for Repeated Interaction Systems (RIS) consisting of a reference quantum system S in contact with a structured environment E made of a chain of independent quantum probes; S interacts with each probe, for a fixed duration, in sequence. We first adapt Landauer's lower bound, which relates the energy variation of the environment E to a decrease of entropy of the system S during the evolution, to the peculiar discrete time dynamics of RIS. Then we consider RIS with a structured environment E displaying small variations of order {T^{-1}} between the successive probes encountered by S, after {n ˜eq T} interactions, in keeping with adiabatic scaling. We establish a discrete time non-unitary adiabatic theorem to approximate the reduced dynamics of S in this regime, in order to tackle the adiabatic limit of Landauer's bound. We find that saturation of Landauer's bound is related to a detailed balance condition on the repeated interaction system, reflecting the non-equilibrium nature of the repeated interaction system dynamics. This is to be contrasted with the generic saturation of Landauer's bound known to hold for continuous time evolution of an open quantum system interacting with a single thermal reservoir in the adiabatic regime.

  17. A Unified Model for Repeating and Non-repeating Fast Radio Bursts

    Science.gov (United States)

    Bagchi, Manjari

    2017-04-01

    The model that fast radio bursts (FRBs) are caused by plunges of asteroids onto neutron stars can explain both repeating and non-repeating bursts. If a neutron star passes through an asteroid belt around another star, there would be a series of bursts caused by a series of asteroid impacts. Moreover, the neutron star would cross the same belt repetitively if it were in a binary with the star hosting the asteroid belt, leading to a repeated series of bursts. I explore the properties of neutron star binaries that could lead to the only known repeating FRB so far (FRB121102). In this model, the next two epochs of bursts are expected around 2017 February 27 and 2017 December 18. On the other hand, if the asteroid belt is located around the neutron star itself, then a chance fall of an asteroid from that belt onto the neutron star would lead to a non-repeating burst. Even a neutron star grazing an asteroid belt can lead to a non-repeating burst caused by just one asteroid plunge during the grazing. This is possible even when the neutron star is in a binary with the asteroid-hosting star, if the belt and the neutron star orbit are non-coplanar.

  18. ERK2在胃黏膜病变中的表达及其与Hp感染的关系%The Relationship between Extracellular Regulated Protein Kinases 2 Expression and Helicobacter Pylori Infection in Gastric Cancer and Precancerous Lesion

    Institute of Scientific and Technical Information of China (English)

    雷琳; 黄亚平; 朱庆茹; 江霞

    2012-01-01

    目的 探讨胃癌前病变及胃癌组织中细胞外调节蛋白激酶2(extracellular regulated protein kinases 2,ERK2)表达与幽门螺旋杆菌(helicobacter pylori,Hp)感染的相关性,及Hp感染与胃癌发生的关系.方法 收集慢性浅表性胃炎(chronic superficial gastritis,CSG)、慢性萎缩性胃炎伴中重度肠上皮化生(intestinal metaplasia,IM)、慢性萎缩性胃炎伴中重度不典型增生(dysplasia,Dys)各30例及胃癌(gastric cancer,GC)40例,采用SP免疫组化法,检测4组中ERK2蛋白的表达.结果 CSG、IM、Dys、GC组织中,Hp感染患者胃黏膜组织中ERK2表达水平高于无Hp感染患者(P<0.05).结论 Hp感染可能通过上调ERK2表达水平,从而在胃癌发生、发展过程中发挥重要作用.%Objective To explore the relationship between the extracellular regulated protein kinases 2 and Helicobacter pylori ( Hp ) infection in the pathogenesis of gastric cancel. Methods The expression of ERK2 was determined by immunohisto-chemical method in 130 gastric specimens including 30 cases of chronic superficial gastritis ( CSG ) ,30 cases of intestinal metaplasia (IM ),30 cases of dysplasia ( Dys ) and 40 cases of gastric carcinomas ( GC ). Results The expression level of ERK2 was significantly higher in the tissues from patients with Hp infection than those without Hp infection in patients with CSG,IM,Dys, GC ( P <0. 05 ). Conclusion The expression of ERK2 in Hp positive group was significantly higher than that in Hp negative group.

  19. Repeatability and Reproducibility of Virtual Subjective Refraction.

    Science.gov (United States)

    Perches, Sara; Collados, M Victoria; Ares, Jorge

    2016-10-01

    To establish the repeatability and reproducibility of a virtual refraction process using simulated retinal images. With simulation software, aberrated images corresponding with each step of the refraction process were calculated following the typical protocol of conventional subjective refraction. Fifty external examiners judged simulated retinal images until the best sphero-cylindrical refraction and the best visual acuity were achieved starting from the aberrometry data of three patients. Data analyses were performed to assess repeatability and reproducibility of the virtual refraction as a function of pupil size and aberrometric profile of different patients. SD values achieved in three components of refraction (M, J0, and J45) are lower than 0.25D in repeatability analysis. Regarding reproducibility, we found SD values lower than 0.25D in the most cases. When the results of virtual refraction with different pupil diameters (4 and 6 mm) were compared, the mean of differences (MoD) obtained were not clinically significant (less than 0.25D). Only one of the aberrometry profiles with high uncorrected astigmatism shows poor results for the M component in reproducibility and pupil size dependence analysis. In all cases, vision achieved was better than 0 logMAR. A comparison between the compensation obtained with virtual and conventional subjective refraction was made as an example of this application, showing good quality retinal images in both processes. The present study shows that virtual refraction has similar levels of precision as conventional subjective refraction. Moreover, virtual refraction has also shown that when high low order astigmatism is present, the refraction result is less precise and highly dependent on pupil size.

  20. Oxygen uptake during repeated-sprint exercise.

    Science.gov (United States)

    McGawley, Kerry; Bishop, David J

    2015-03-01

    Repeated-sprint ability appears to be influenced by oxidative metabolism, with reductions in fatigue and improved sprint times related to markers of aerobic fitness. The aim of the current study was to measure the oxygen uptake (VO₂) during the first and last sprints during two, 5 × 6-s repeated-sprint bouts. Cross-sectional study. Eight female soccer players performed two, consecutive, 5 × 6-s maximal sprint bouts (B1 and B2) on five separate occasions, in order to identify the minimum time (trec) required to recover total work done (Wtot) in B1. On a sixth occasion, expired air was collected during the first and last sprint of B1 and B2, which were separated by trec. The trec was 10.9 ± 1.1 min. The VO₂ during the first sprint was significantly less than the last sprint in each bout (psprint (measured in kJ) was significantly related to VO₂max in both B1 (r=0.81, p=0.015) and B2 (r=0.93, p=0.001). In addition, the VO₂ attained in the final sprint was not significantly different from VO₂max in B1 (p=0.284) or B2 (p=0.448). The current study shows that the VO₂ increases from the first to the last of 5 × 6-s sprints and that VO₂max may be a limiting factor to performance in latter sprints. Increasing V˙O₂max in team-sport athletes may enable increased aerobic energy delivery, and consequently work done, during a bout of repeated sprints. Copyright © 2014 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  1. Mechanical processes with repeated attenuated impacts

    CERN Document Server

    Nagaev, R F

    1999-01-01

    This book is devoted to considering in the general case - using typical concrete examples - the motion of machines and mechanisms of impact and vibro-impact action accompanied by a peculiar phenomenon called "impact collapse". This phenomenon is that after the initial collision, a sequence of repeated gradually quickening collisions of decreasing-to-zero intensity occurs, with the final establishment of protracted contact between the interacting bodies. The initiation conditions of the impact collapse are determined and calculation techniques for the quantitative characteristics of the corresp

  2. Source coding model for repeated snapshot imaging

    CERN Document Server

    Li, Junhui; Yang, Dongyue; wu, Guohua; Yin, Longfei; Guo, Hong

    2016-01-01

    Imaging based on successive repeated snapshot measurement is modeled as a source coding process in information theory. The necessary number of measurement to maintain a certain level of error rate is depicted as the rate-distortion function of the source coding. Quantitative formula of the error rate versus measurement number relation is derived, based on the information capacity of imaging system. Second order fluctuation correlation imaging (SFCI) experiment with pseudo-thermal light verifies this formula, which paves the way for introducing information theory into the study of ghost imaging (GI), both conventional and computational.

  3. REPEAT facility. Report for May, June, July

    Science.gov (United States)

    Winn, C. B.

    1981-08-01

    The construction of the REPEAT facility, a test facility for passive and hybrid solar heating systems is reported. The development of a simulation program for envelope type passive solar systems, constructing an envelope test cell, collecting data to validate the program, and application of the program to determine the best envelope type design are discussed. A low cost monitoring system using a dedicated microprocessor system, an inexpensive, high accuracy A/D converter, and minimum system hardware is developed. A method to determine the average temperature and the average daily temperature variation inside a passively heated solar building is presented.

  4. Cataractogenesis after Repeat Laser in situ Keratomileusis

    Directory of Open Access Journals (Sweden)

    Ahmad M. Mansour

    2012-08-01

    Full Text Available There has been the unsubstantiated clinical impression that laser refractive surgery accelerates cataract development along with solid experimental data about the cataractogenic effects of excimer laser treatment. We present the first documented case of significant cataract formation in a young myope after repeat excimer laser ablation necessitating phacoemulsification with a posterior chamber implant. Proposed explanations include focusing of the ablation wave on the posterior capsule (acoustic wave lens epithelial damage, photooxidative stress of the lens (ultraviolet and inflammatory oxidative stress, and corticosteroid-induced cataract (lens toxicity.

  5. Multiplicatively Repeated Non-Binary LDPC Codes

    CERN Document Server

    Kasai, Kenta; Poulliat, Charly; Sakaniwa, Kohichi

    2010-01-01

    We propose non-binary LDPC codes concatenated with multiplicative repetition codes. By multiplicatively repeating the (2,3)-regular non-binary LDPC mother code of rate 1/3, we construct rate-compatible codes of lower rates 1/6, 1/9, 1/12,... Surprisingly, such simple low-rate non-binary LDPC codes outperform the best low-rate binary LDPC codes so far. Moreover, we propose the decoding algorithm for the proposed codes, which can be decoded with almost the same computational complexity as that of the mother code.

  6. Improving repeated sprint ability in young elite soccer players: repeated shuttle sprints vs. explosive strength training.

    Science.gov (United States)

    Buchheit, Martin; Mendez-Villanueva, Alberto; Delhomel, Gregory; Brughelli, Matt; Ahmaidi, Said

    2010-10-01

    To compare the effects of explosive strength (ExpS) vs. repeated shuttle sprint (RS) training on repeated sprint ability (RSA) in young elite soccer players, 15 elite male adolescents (14.5 ± 0.5 years) performed, in addition to their soccer training program, RS (n = 7) or ExpS (n = 8) training once a week for a total of 10 weeks. RS training consisted of 2-3 sets of 5-6 × 15- to 20-m repeated shuttle sprints interspersed with 14 seconds of passive or 23 seconds of active recovery (≈2 m·s⁻¹); ExpS training consisted of 4-6 series of 4-6 exercises (e.g., maximal unilateral countermovement jumps (CMJs), calf and squat plyometric jumps, and short sprints). Before and after training, performance was assessed by 10 and 30 m (10 and 30 m) sprint times, best (RSAbest) and mean (RSAmean) times on a repeated shuttle sprint ability test, a CMJ, and a hopping (Hop) test. After training, except for 10 m (p = 0.22), all performances were significantly improved in both groups (all p's repeated shuttle sprint test were only observed after RS training, whereas CMJ height was only increased after ExpS. Because RS and ExpS were equally efficient at enhancing maximal sprinting speed, RS training-induced improvements in RSA were likely more related to progresses in the ability to change direction.

  7. Repeated vitrification/warming of human sperm gives better results than repeated slow programmable freezing

    Institute of Scientific and Technical Information of China (English)

    Teraporn Vutyavanich; Worashorn Lattiwongsakorn; Waraporn Piromlertamorn; Sudarat Samchimchom

    2012-01-01

    In this study,we compared the effects of repeated freezing/thawing of human sperm by our in-house method of rapid freezing with slow programmable freezing.Sperm samples from 11 normozoospermic subjects were processed through density gradients and divided into three aliquots:non-frozen,rapid freezing and slow programmable freezing.Sperm in the rapid freezing group had better motility and viability than those in the slow freezing group (P<O.01) after the first,second and third cycles of freezing/thawing,but there was no difference in morphology.In the second experiment,rapid freezing was repeated three times in 20 subjects.The samples from each thawing cycle were evaluated for DNA fragmentation using the alkaline comet assay.DNA fragmentation began to increase considerably after the second cycle of freezing/thawing,but to a level that was not clinically important.In the third experiment,rapid freezing was done repeatedly in 10 subjects,until no motile sperm were observed after thawing.The median number of repeated freezing/thawing that yielded no motile sperm was seven (range:5-8,mean:6.8).In conclusion,we demonstrated that repeated freezing/thawing of processed semen using our rapid freezing method gave better results than standard slow programmable freezing.This method can help maximize the usage of precious cryopreserved sperm samples in assisted reproduction technology.

  8. Comparative genomics and molecular dynamics of DNA repeats in eukaryotes.

    Science.gov (United States)

    Richard, Guy-Franck; Kerrest, Alix; Dujon, Bernard

    2008-12-01

    Repeated elements can be widely abundant in eukaryotic genomes, composing more than 50% of the human genome, for example. It is possible to classify repeated sequences into two large families, "tandem repeats" and "dispersed repeats." Each of these two families can be itself divided into subfamilies. Dispersed repeats contain transposons, tRNA genes, and gene paralogues, whereas tandem repeats contain gene tandems, ribosomal DNA repeat arrays, and satellite DNA, itself subdivided into satellites, minisatellites, and microsatellites. Remarkably, the molecular mechanisms that create and propagate dispersed and tandem repeats are specific to each class and usually do not overlap. In the present review, we have chosen in the first section to describe the nature and distribution of dispersed and tandem repeats in eukaryotic genomes in the light of complete (or nearly complete) available genome sequences. In the second part, we focus on the molecular mechanisms responsible for the fast evolution of two specific classes of tandem repeats: minisatellites and microsatellites. Given that a growing number of human neurological disorders involve the expansion of a particular class of microsatellites, called trinucleotide repeats, a large part of the recent experimental work on microsatellites has focused on these particular repeats, and thus we also review the current knowledge in this area. Finally, we propose a unified definition for mini- and microsatellites that takes into account their biological properties and try to point out new directions that should be explored in a near future on our road to understanding the genetics of repeated sequences.

  9. Extending Teach and Repeat to Pivoting Wheelchairs

    Directory of Open Access Journals (Sweden)

    Guillermo Del Castillo

    2003-02-01

    Full Text Available The paper extends the teach-and-repeat paradigm that has been successful for the control of holonomic robots to nonholonomic wheelchairs which may undergo pivoting action over the course of their taught movement. Due to the nonholonomic nature of the vehicle kinematics, estimation is required -- in the example given herein, based upon video detection of wall-mounted cues -- both in the teaching and the tracking events. In order to accommodate motion that approaches pivoting action as well as motion that approaches straight-line action, the estimation equations of the Extended Kalman Filter and the control equations are formulated using two different definitions of a nontemporal independent variable. The paper motivates the need for pivoting action in real-life settings by reporting extensively on the abilities and limitations of estimation-based teach-and-repeat action where pivoting and near-pivoting action is disallowed. Following formulation of the equations in the near-pivot mode, the paper reports upon experiments where taught trajectories which entail a seamless mix of near-straight and near-pivot action are tracked.

  10. The Perpetual Repeater: an Educative Musical Experience.

    Directory of Open Access Journals (Sweden)

    Svetlana Skriagina

    2014-05-01

    Full Text Available To commemorate the 40th anniversary of the Music Undergraduate Program of the Universidad Pedagógica Nacional (National Pedagogic University, two musical events were planned: an original work written for choir, soloists and symphonic band, and an opera for children. As a result, the cantata ‘The Perpetual Repeater” has been created as an adaptation of a work named “50 Milions de Segons” (50 Millions of Seconds, staged by the CATANIA project of the Barcelona Servei Educatiu de L’Auditori. This work tells the story of those school teachers who, paradoxically enough repeat the same course year after year. After visiting L’Auditori of Barcelona to participate in the pedagogic musical work carried out with school children, we considered the possibility of developing an analogous project, in a similar sociocultural and educational environment, within our Music Undergraduate Program. So, this article deals with two fundamental moments which are essential to understand the educational work implemented with the ISPA students of sixth degree, as well as with a group of the program’s students: The Purpose, which describes in detail the planning of the musical work for children, and The Experience, in which the way the process of The Perpetual Repeater Cantatawas carried out is described.

  11. Airborne Radar Interferometric Repeat-Pass Processing

    Science.gov (United States)

    Hensley, Scott; Michel, Thierry R.; Jones, Cathleen E.; Muellerschoen, Ronald J.; Chapman, Bruce D.; Fore, Alexander; Simard, Marc; Zebker, Howard A.

    2011-01-01

    Earth science research often requires crustal deformation measurements at a variety of time scales, from seconds to decades. Although satellites have been used for repeat-track interferometric (RTI) synthetic-aperture-radar (SAR) mapping for close to 20 years, RTI is much more difficult to implement from an airborne platform owing to the irregular trajectory of the aircraft compared with microwave imaging radar wavelengths. Two basic requirements for robust airborne repeat-pass radar interferometry include the ability to fly the platform to a desired trajectory within a narrow tube and the ability to have the radar beam pointed in a desired direction to a fraction of a beam width. Uninhabited Aerial Vehicle Synthetic Aperture Radar (UAVSAR) is equipped with a precision auto pilot developed by NASA Dryden that allows the platform, a Gulfstream III, to nominally fly within a 5 m diameter tube and with an electronically scanned antenna to position the radar beam to a fraction of a beam width based on INU (inertial navigation unit) attitude angle measurements.

  12. Aggregating quantum repeaters for the quantum internet

    Science.gov (United States)

    Azuma, Koji; Kato, Go

    2017-09-01

    The quantum internet holds promise for accomplishing quantum teleportation and unconditionally secure communication freely between arbitrary clients all over the globe, as well as the simulation of quantum many-body systems. For such a quantum internet protocol, a general fundamental upper bound on the obtainable entanglement or secret key has been derived [K. Azuma, A. Mizutani, and H.-K. Lo, Nat. Commun. 7, 13523 (2016), 10.1038/ncomms13523]. Here we consider its converse problem. In particular, we present a universal protocol constructible from any given quantum network, which is based on running quantum repeater schemes in parallel over the network. For arbitrary lossy optical channel networks, our protocol has no scaling gap with the upper bound, even based on existing quantum repeater schemes. In an asymptotic limit, our protocol works as an optimal entanglement or secret-key distribution over any quantum network composed of practical channels such as erasure channels, dephasing channels, bosonic quantum amplifier channels, and lossy optical channels.

  13. Automated Planning in Repeated Adversarial Games

    CERN Document Server

    de Cote, Enrique Munoz; Sykulski, Adam M; Jennings, Nicholas R

    2012-01-01

    Game theory's prescriptive power typically relies on full rationality and/or self-play interactions. In contrast, this work sets aside these fundamental premises and focuses instead on heterogeneous autonomous interactions between two or more agents. Specifically, we introduce a new and concise representation for repeated adversarial (constant-sum) games that highlight the necessary features that enable an automated planing agent to reason about how to score above the game's Nash equilibrium, when facing heterogeneous adversaries. To this end, we present TeamUP, a model-based RL algorithm designed for learning and planning such an abstraction. In essence, it is somewhat similar to R-max with a cleverly engineered reward shaping that treats exploration as an adversarial optimization problem. In practice, it attempts to find an ally with which to tacitly collude (in more than two-player games) and then collaborates on a joint plan of actions that can consistently score a high utility in adversarial repeated gam...

  14. Chromosome-specific DNA Repeat Probes

    Energy Technology Data Exchange (ETDEWEB)

    Baumgartner, Adolf; Weier, Jingly Fung; Weier, Heinz-Ulrich G.

    2006-03-16

    In research as well as in clinical applications, fluorescence in situ hybridization (FISH) has gained increasing popularity as a highly sensitive technique to study cytogenetic changes. Today, hundreds of commercially available DNA probes serve the basic needs of the biomedical research community. Widespread applications, however, are often limited by the lack of appropriately labeled, specific nucleic acid probes. We describe two approaches for an expeditious preparation of chromosome-specific DNAs and the subsequent probe labeling with reporter molecules of choice. The described techniques allow the preparation of highly specific DNA repeat probes suitable for enumeration of chromosomes in interphase cell nuclei or tissue sections. In addition, there is no need for chromosome enrichment by flow cytometry and sorting or molecular cloning. Our PCR-based method uses either bacterial artificial chromosomes or human genomic DNA as templates with {alpha}-satellite-specific primers. Here we demonstrate the production of fluorochrome-labeled DNA repeat probes specific for human chromosomes 17 and 18 in just a few days without the need for highly specialized equipment and without the limitation to only a few fluorochrome labels.

  15. Repeat-induced gene silencing in mammals.

    Science.gov (United States)

    Garrick, D; Fiering, S; Martin, D I; Whitelaw, E

    1998-01-01

    In both plants and Drosophila melanogaster, expression from a transgenic locus may be silenced when repeated transgene copies are arranged as a concatameric array. This repeat-induced gene silencing is frequently manifested as a decrease in the proportion of cells that express the transgene, resulting in a variegated pattern of expression. There is also some indication that, in transgenic mammals, the number of transgene copies within an array can exert a repressive influence on expression, with several mouse studies reporting a decrease in the level of expression per copy as copy number increases. However, because these studies compare different sites of transgene integration as well as arrays with different numbers of copies, the expression levels observed may be subject to varying position effects as well as the influence of the multicopy array. Here we describe use of the lox/Cre system of site-specific recombination to generate transgenic mouse lines in which different numbers of a transgene are present at the same chromosomal location, thereby eliminating the contribution of position effects and allowing analysis of the effect of copy number alone on transgene silencing. Reduction in copy number results in a marked increase in expression of the transgene and is accompanied by decreased chromatin compaction and decreased methylation at the transgene locus. These findings establish that the presence of multiple homologous copies of a transgene within a concatameric array can have a repressive effect upon gene expression in mammalian systems.

  16. c-Jun N-terminal kinase 2 prevents luminal cell commitment in normal mammary glands and tumors by inhibiting p53/Notch1 and breast cancer gene 1 expression.

    Science.gov (United States)

    Cantrell, Michael A; Ebelt, Nancy D; Pfefferle, Adam D; Perou, Charles M; Van Den Berg, Carla Lynn

    2015-05-20

    Breast cancer is a heterogeneous disease with several subtypes carrying unique prognoses. Patients with differentiated luminal tumors experience better outcomes, while effective treatments are unavailable for poorly differentiated tumors, including the basal-like subtype. Mechanisms governing mammary tumor subtype generation could prove critical to developing better treatments. C-Jun N-terminal kinase 2 (JNK2) is important in mammary tumorigenesis and tumor progression. Using a variety of mouse models, human breast cancer cell lines and tumor expression data, studies herein support that JNK2 inhibits cell differentiation in normal and cancer-derived mammary cells. JNK2 prevents precocious pubertal mammary development and inhibits Notch-dependent expansion of luminal cell populations. Likewise, JNK2 suppresses luminal populations in a p53-competent Polyoma Middle T-antigen tumor model where jnk2 knockout causes p53-dependent upregulation of Notch1 transcription. In a p53 knockout model, JNK2 restricts luminal populations independently of Notch1, by suppressing Brca1 expression and promoting epithelial to mesenchymal transition. JNK2 also inhibits estrogen receptor (ER) expression and confers resistance to fulvestrant, an ER inhibitor, while stimulating tumor progression. These data suggest that therapies inhibiting JNK2 in breast cancer may promote tumor differentiation, improve endocrine therapy response, and inhibit metastasis.

  17. miR-140-5p attenuates chemotherapeutic drug-induced cell death by regulating autophagy through inositol 1,4,5-trisphosphate kinase 2 (IP3k2) in human osteosarcoma cells

    Science.gov (United States)

    Wei, Renxiong; Cao, Gang; Deng, Zhouming; Su, Jiajia; Cai, Lin

    2016-01-01

    Acquisition of drug-resistant phenotypes is often associated with chemotherapy in osteosarcoma. A number of studies have demonstrated a critical role for autophagy in osteosarcoma development, therapy and drug resistance. However, the molecular mechanisms underlying the autophagy-mediated chemotherapy resistance of osteosarcoma cells remain largely unknown. In the present study, we determined the autophagy and microRNA-140 (miR-140-5p, miRBase ID: MIMAT0000431) expression induced by chemotherapeutic drugs in osteosarcoma cells. Then we determined the promotory role of miR-140-5p to the chemotherapy-induced autophagy. Our results demonstrated that miR-140-5p expression was highly induced during chemotherapy of osteosarcoma cells, and this was accompanied by up-regulated autophagy. The increased miR-140-5p expression levels up-regulated anticancer drug-induced autophagy in osteosarcoma cells and ameliorated the anticancer drug-induced cell proliferation and viability decrease. Importantly, miR-140-5p regulates this context-specific autophagy through its target, inositol 1,4,5-trisphosphate kinase 2 (IP3k2). Therefore, the results of the present study demonstrated that miR-140-5p mediated drug-resistance in osteosarcoma cells by inducing autophagy. The present study provides evidence of miRNA regulation of autophagy through modulation of IP3 signalling. The present study recognized a novel mechanism of chemoresistance in osteosarcoma cancers. PMID:27582507

  18. Discrepancies in reporting the CAG repeat lengths for Huntington's disease

    DEFF Research Database (Denmark)

    Quarrell, Oliver W; Handley, Olivia; O'Donovan, Kirsty

    2011-01-01

    Huntington's disease results from a CAG repeat expansion within the Huntingtin gene; this is measured routinely in diagnostic laboratories. The European Huntington's Disease Network REGISTRY project centrally measures CAG repeat lengths on fresh samples; these were compared with the original...

  19. 47 CFR 90.247 - Mobile repeater stations.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Mobile repeater stations. 90.247 Section 90.247... MOBILE RADIO SERVICES Non-Voice and Other Specialized Operations § 90.247 Mobile repeater stations. A... repeater to extend the communications range of hand-carried units subject to the following: (a)...

  20. Polymorphic GGC repeat differentially regulates human reelin gene expression levels.

    Science.gov (United States)

    Persico, A M; Levitt, P; Pimenta, A F

    2006-10-01

    The human gene encoding Reelin (RELN), a pivotal protein in neurodevelopment, includes a polymorphic GGC repeat in its 5' untranslated region (UTR). CHO cells transfected with constructs encompassing the RELN 5'UTR with 4-to-13 GGC repeats upstream of the luciferase reporter gene show declining luciferase activity with increasing GGC repeat number (P autism.

  1. CGG repeat in the FMR1 gene: Size matters

    NARCIS (Netherlands)

    R.A. Willemsen (Ralph); G.J. Levenga (Josien); B.A. Oostra (Ben)

    2011-01-01

    textabstractThe FMR1 gene contains a CGG repeat present in the 5'-untranslated region which can be unstable upon transmission to the next generation. The repeat is up to 55 CGGs long in the normal population. In patients with fragile X syndrome (FXS), a repeat length exceeding 200 CGGs (full

  2. Repeat Testing Effects on Credentialing Exams: Are Repeaters Misinformed or Uninformed?

    Science.gov (United States)

    Feinberg, Richard A.; Raymond, Mark R.; Haist, Steven A.

    2015-01-01

    To mitigate security concerns and unfair score gains, credentialing programs routinely administer new test material to examinees retesting after an initial failing attempt. Counterintuitively, a small but growing body of recent research suggests that repeating the identical form does not create an unfair advantage. This study builds upon and…

  3. Who Repeats Algebra, and How Does Initial Performance Relate to Improvement When the Course Is Repeated?

    Science.gov (United States)

    Fong, Anthony; Jaquet, Karina; Finkelstein, Neal

    2016-01-01

    The information provided in this report shows how students perform when they repeat algebra I and how the level of improvement varies depending on initial course performance and the academic measure (course grades or CST scores). This information can help inform decisions and policies regarding whether and under what circumstances students should…

  4. Hybrid quantum repeater using bright coherent light.

    Science.gov (United States)

    van Loock, P; Ladd, T D; Sanaka, K; Yamaguchi, F; Nemoto, Kae; Munro, W J; Yamamoto, Y

    2006-06-23

    We describe a quantum repeater protocol for long-distance quantum communication. In this scheme, entanglement is created between qubits at intermediate stations of the channel by using a weak dispersive light-matter interaction and distributing the outgoing bright coherent-light pulses among the stations. Noisy entangled pairs of electronic spin are then prepared with high success probability via homodyne detection and postselection. The local gates for entanglement purification and swapping are deterministic and measurement-free, based upon the same coherent-light resources and weak interactions as for the initial entanglement distribution. Finally, the entanglement is stored in a nuclear-spin-based quantum memory. With our system, qubit-communication rates approaching 100 Hz over 1280 km with fidelities near 99% are possible for reasonable local gate errors.

  5. Potential of repeated polymer well treatments

    Energy Technology Data Exchange (ETDEWEB)

    Lakatos, I.; Lakatos-Szabo, J. (Hungarian Academy of Sciences, Budapest (Hungary)); Munkacsi, I.; Troemboeczki, S.

    1993-11-01

    This paper analyzes field results obtained by routine application of a polymer/silicate well treatment technique at the Algyo-2 field in Hungary. First, the reservoir is described briefly; then, the basic concept of the method is outlined. Reference is made to the multifunctioning chemical mechanism of gelation and the favorable rheological properties of the treating fluids that jointly result in a highly selective placement and an efficient permeability reduction in the target reservoir space. Application of the method 17 times in 16 producing wells yielded more than 90,000 Mg of incremental oil production. Typical well behaviors also are illustrated. Finally, the potential of repeated treatments is discussed, taking laboratory and field results into account.

  6. Quantum repeaters using continuous-variable teleportation

    Science.gov (United States)

    Dias, Josephine; Ralph, T. C.

    2017-02-01

    Quantum optical states are fragile and can become corrupted when passed through a lossy communication channel. Unlike for classical signals, optical amplifiers cannot be used to recover quantum signals. Quantum repeaters have been proposed as a way of reducing errors and hence increasing the range of quantum communications. Current protocols target specific discrete encodings, for example quantum bits encoded on the polarization of single photons. We introduce a more general approach that can reduce the effect of loss on any quantum optical encoding, including those based on continuous variables such as the field amplitudes. We show that in principle the protocol incurs a resource cost that scales polynomially with distance. We analyze the simplest implementation and find that while its range is limited it can still achieve useful improvements in the distance over which quantum entanglement of field amplitudes can be distributed.

  7. Statistical Properties of repeating FRB 121102

    CERN Document Server

    Wang, F Y

    2016-01-01

    Fast radio bursts (FRBs) are millisecond-duration radio signals possibly occurring at cosmological distances. However the physical model of FRBs is mystery, many models have been proposed. Here we study the frequency distributions of peak flux, fluence, duration and waiting time for repeating FRB 121102. The cumulative distributions of peak flux, fluence and duration show power-law forms. The waiting time distribution also shows power-law distribution, and is consistent with a non-stationary Poisson process. We also use the statistical results to test the proposed models for FRBs. Comparing with the model predications, we find that the theoretical models proposed by Dai et al. (2016) and Katz (2016) are favored. These distributions are consistent with the predications from avalanche models of driven systems.

  8. Simple sequence repeats in mycobacterial genomes

    Indian Academy of Sciences (India)

    Vattipally B Sreenu; Pankaj Kumar; Javaregowda Nagaraju; Hampapathalu A Nagarajaram

    2007-01-01

    Simple sequence repeats (SSRs) or microsatellites are the repetitive nucleotide sequences of motifs of length 1–6 bp. They are scattered throughout the genomes of all the known organisms ranging from viruses to eukaryotes. Microsatellites undergo mutations in the form of insertions and deletions (INDELS) of their repeat units with some bias towards insertions that lead to microsatellite tract expansion. Although prokaryotic genomes derive some plasticity due to microsatellite mutations they have in-built mechanisms to arrest undue expansions of microsatellites and one such mechanism is constituted by post-replicative DNA repair enzymes MutL, MutH and MutS. The mycobacterial genomes lack these enzymes and as a null hypothesis one could expect these genomes to harbour many long tracts. It is therefore interesting to analyse the mycobacterial genomes for distribution and abundance of microsatellites tracts and to look for potentially polymorphic microsatellites. Available mycobacterial genomes, Mycobacterium avium, M. leprae, M. bovis and the two strains of M. tuberculosis (CDC1551 and H37Rv) were analysed for frequencies and abundance of SSRs. Our analysis revealed that the SSRs are distributed throughout the mycobacterial genomes at an average of 220–230 SSR tracts per kb. All the mycobacterial genomes contain few regions that are conspicuously denser or poorer in microsatellites compared to their expected genome averages. The genomes distinctly show scarcity of long microsatellites despite the absence of a post-replicative DNA repair system. Such severe scarcity of long microsatellites could arise as a result of strong selection pressures operating against long and unstable sequences although influence of GC-content and role of point mutations in arresting microsatellite expansions can not be ruled out. Nonetheless, the long tracts occasionally found in coding as well as non-coding regions may account for limited genome plasticity in these genomes.

  9. Repeat Gamma Knife surgery for vestibular schwannomas

    Science.gov (United States)

    Lonneville, Sarah; Delbrouck, Carine; Renier, Cécile; Devriendt, Daniel; Massager, Nicolas

    2015-01-01

    Background: Gamma Knife (GK) surgery is a recognized treatment option for the management of small to medium-sized vestibular schwannoma (VS) associated with high-tumor control and low morbidity. When a radiosurgical treatment fails to stop tumor growth, repeat GK surgery can be proposed in selected cases. Methods: A series of 27 GK retreatments was performed in 25 patients with VS; 2 patients underwent three procedures. The median time interval between GK treatments was 45 months. The median margin dose used for the first, second, and third GK treatments was 12 Gy, 12 Gy, and 14 Gy, respectively. Six patients (4 patients for the second irradiation and 2 patients for the third irradiation) with partial tumor regrowth were treated only on the growing part of the tumor using a median margin dose of 13 Gy. The median tumor volume was 0.9, 2.3, and 0.7 cc for the first, second, and third treatments, respectively. Stereotactic positron emission tomography (PET) guidance was used for dose planning in 6 cases. Results: Mean follow-up duration was 46 months (range 24–110). At the last follow-up, 85% of schwannomas were controlled. The tumor volume decreased, remained unchanged, or increased after retreatment in 15, 8, and 4 cases, respectively. Four patients had PET during follow-up, and all showed a significant metabolic decrease of the tumor. Hearing was not preserved after retreatment in any patients. New facial or trigeminal palsy did not occur after retreatment. Conclusions: Our results support the long-term efficacy and low morbidity of repeat GK treatment for selected patients with tumor growth after initial treatment. PMID:26500799

  10. The excess of small inverted repeats in prokaryotes.

    Science.gov (United States)

    Ladoukakis, Emmanuel D; Eyre-Walker, Adam

    2008-09-01

    Recent analyses have shown that there is a large excess of perfect inverted repeats in many prokaryotic genomes but not in eukaryotic ones. This difference could be due to a genuine difference between prokaryotes and eukaryotes or to differences in the methods and types of data analyzed--full genome versus protein coding sequences. We used simulations to show that the method used previously tends to underestimate the expected number of inverted repeats. However, this bias is not large and cannot explain the excess of inverted repeats observed in real data. In contrast, our method is unbiased. When both methods are applied to bacterial protein coding sequences they both detect an excess of inverted repeats, which is much lower than previously reported in whole prokaryotic genomes. This suggests that the reported large excess of inverted repeats is due to repeats found in intergenic regions. These repeats could be due to transcription factor binding sites, or other types of repetitive DNA, on opposite strands of the DNA sequence. In contrast, the smaller, but significant, excess of inverted repeats that we report in protein coding sequences may be due to sequence-directed mutagenesis (SDM). SDM is a process where one copy of a small, imperfect, inverted repeat corrects the other copy via strand misalignment, resulting in a perfect repeat and a series of mutations. We show by simulation that even very low levels of SDM, relative to the rate of point mutation, can generate a substantial excess of inverted repeats.

  11. Studies of an expanded trinucleotide repeat in transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Bingham, P.; Wang, S.; Merry, D. [Univ. of Pennsylvania, Philadelphia, PA (United States)

    1994-09-01

    Spinal and bulbar muscular atrophy (SBMA) is a progressive motor neuron disease caused by expansion of a trinucleotide repeat in the androgen receptor gene (AR{sup exp}). AR{sup exp} repeats expand further or contract in approximately 25% of transmissions. Analogous {open_quotes}dynamic mutations{close_quotes} have been reported in other expanded trinucleotide repeat disorders. We have been developing a mouse model of this disease using a transgenic approach. Expression of the SBMA AR was documented in transgenic mice with an inducible promoter. No phenotypic effects of transgene expression were observed. We have extended our previous results on stability of the expanded trinucleotide repeat in transgenic mice in two lines carrying AR{sup exp}. Tail DNA was amplified by PCR using primers spanning the repeat on 60 AR{sup exp} transgenic mice from four different transgenic lines. Migration of the PCR product through an acrylamide gel showed no change of the 45 CAG repeat length in any progeny. Similarly, PCR products from 23 normal repeat transgenics showed no change from the repeat length of the original construct. Unlike the disease allele in humans, the expanded repeat AR cDNA in transgenic mice showed no change in repeat length with transmission. The relative stability of CAG repeats seen in the transgenic mice may indicate either differences in the fidelity of replicative enzymes, or differences in error identification and repair between mice and humans. Integration site or structural properties of the transgene itself might also play a role.

  12. Role of DNA Polymerases in Repeat-Mediated Genome Instability

    Directory of Open Access Journals (Sweden)

    Kartik A. Shah

    2012-11-01

    Full Text Available Expansions of simple DNA repeats cause numerous hereditary diseases in humans. We analyzed the role of DNA polymerases in the instability of Friedreich’s ataxia (GAAn repeats in a yeast experimental system. The elementary step of expansion corresponded to ∼160 bp in the wild-type strain, matching the size of Okazaki fragments in yeast. This step increased when DNA polymerase α was mutated, suggesting a link between the scale of expansions and Okazaki fragment size. Expandable repeats strongly elevated the rate of mutations at substantial distances around them, a phenomenon we call repeat-induced mutagenesis (RIM. Notably, defects in the replicative DNA polymerases δ and ∊ strongly increased rates for both repeat expansions and RIM. The increases in repeat-mediated instability observed in DNA polymerase δ mutants depended on translesion DNA polymerases. We conclude that repeat expansions and RIM are two sides of the same replicative mechanism.

  13. Structure-Based Assignment of Ile, Leu, and Val Methyl Groups in the Active and Inactive Forms of the Mitogen-Activated Protein Kinase Extracellular Signal-Regulated Kinase 2.

    Science.gov (United States)

    Xiao, Yao; Warner, Lisa R; Latham, Michael P; Ahn, Natalie G; Pardi, Arthur

    2015-07-21

    Resonance assignments are the first step in most NMR studies of protein structure, function, and dynamics. Standard protein assignment methods employ through-bond backbone experiments on uniformly (13)C/(15)N-labeled proteins. For larger proteins, this through-bond assignment procedure often breaks down due to rapid relaxation and spectral overlap. The challenges involved in studies of larger proteins led to efficient methods for (13)C labeling of side chain methyl groups, which have favorable relaxation properties and high signal-to-noise. These methyls are often still assigned by linking them to the previously assigned backbone, thus limiting the applications for larger proteins. Here, a structure-based procedure is described for assignment of (13)C(1)H3-labeled methyls by comparing distance information obtained from three-dimensional methyl-methyl nuclear Overhauser effect (NOE) spectroscopy with the X-ray structure. The Ile, Leu, or Val (ILV) methyl type is determined by through-bond experiments, and the methyl-methyl NOE data are analyzed in combination with the known structure. A hierarchical approach was employed that maps the largest observed "NOE-methyl cluster" onto the structure. The combination of identification of ILV methyl type with mapping of the NOE-methyl clusters greatly simplifies the assignment process. This method was applied to the inactive and active forms of the 42-kDa ILV (13)C(1)H3-methyl labeled extracellular signal-regulated kinase 2 (ERK2), leading to assignment of 60% of the methyls, including 90% of Ile residues. A series of ILV to Ala mutants were analyzed, which helped confirm the assignments. These assignments were used to probe the local and long-range effects of ligand binding to inactive and active ERK2.

  14. Identification of Open Stomata1-Interacting Proteins Reveals Interactions with Sucrose Non-fermenting1-Related Protein Kinases2 and with Type 2A Protein Phosphatases That Function in Abscisic Acid Responses.

    Science.gov (United States)

    Waadt, Rainer; Manalansan, Bianca; Rauniyar, Navin; Munemasa, Shintaro; Booker, Matthew A; Brandt, Benjamin; Waadt, Christian; Nusinow, Dmitri A; Kay, Steve A; Kunz, Hans-Henning; Schumacher, Karin; DeLong, Alison; Yates, John R; Schroeder, Julian I

    2015-09-01

    The plant hormone abscisic acid (ABA) controls growth and development and regulates plant water status through an established signaling pathway. In the presence of ABA, pyrabactin resistance/regulatory component of ABA receptor proteins inhibit type 2C protein phosphatases (PP2Cs). This, in turn, enables the activation of Sucrose Nonfermenting1-Related Protein Kinases2 (SnRK2). Open Stomata1 (OST1)/SnRK2.6/SRK2E is a major SnRK2-type protein kinase responsible for mediating ABA responses. Arabidopsis (Arabidopsis thaliana) expressing an epitope-tagged OST1 in the recessive ost1-3 mutant background was used for the copurification and identification of OST1-interacting proteins after osmotic stress and ABA treatments. These analyses, which were confirmed using bimolecular fluorescence complementation and coimmunoprecipitation, unexpectedly revealed homo- and heteromerization of OST1 with SnRK2.2, SnRK2.3, OST1, and SnRK2.8. Furthermore, several OST1-complexed proteins were identified as type 2A protein phosphatase (PP2A) subunits and as proteins involved in lipid and galactolipid metabolism. More detailed analyses suggested an interaction network between ABA-activated SnRK2-type protein kinases and several PP2A-type protein phosphatase regulatory subunits. pp2a double mutants exhibited a reduced sensitivity to ABA during seed germination and stomatal closure and an enhanced ABA sensitivity in root growth regulation. These analyses add PP2A-type protein phosphatases as another class of protein phosphatases to the interaction network of SnRK2-type protein kinases.

  15. Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study.

    Science.gov (United States)

    Kittler, L; Baguley, B C; Löber, G; Waring, M J

    1999-01-01

    A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

  16. Molecular markers for granulovacuolar degeneration are present in rimmed vacuoles.

    Directory of Open Access Journals (Sweden)

    Masahiro Nakamori

    Full Text Available BACKGROUND: Rimmed vacuoles (RVs are round-oval cytoplasmic inclusions, detected in muscle cells of patients with myopathies, such as inclusion body myositis (IBM and distal myopathy with RVs (DMRV. Granulovacuolar degeneration (GVD bodies are spherical vacuoles containing argentophilic and hematoxyphilic granules, and are one of the pathological hallmarks commonly found in hippocampal pyramidal neurons of patients with aging-related neurodegenerative diseases, such as Alzheimer's disease and Parkinson's disease. These diseases are common in the elderly and share some pathological features. Therefore, we hypothesized that mechanisms of vacuolar formation in RVs and GVD bodies are common despite their role in two differing pathologies. We explored the components of RVs by immunohistochemistry, using antibodies for GVD markers. METHODS: Subjects included one AD case, eight cases of sporadic IBM, and three cases of DMRV. We compared immunoreactivity and staining patterns for GVD markers. These markers included: (1 tau-modifying proteins (caspase 3, cyclin-dependent kinase 5 [CDK5], casein kinase 1δ [CK1δ], and c-jun N-terminal kinase [JNK], (2 lipid raft-associated materials (annexin 2, leucine-rich repeat kinase 2 [LRRK2], and flotillin-1, and (3 other markers (charged multi-vesicular body protein 2B [CHMP2B] and phosphorylated transactive response DNA binding protein-43 [pTDP43] in both GVD bodies and RVs. Furthermore, we performed double staining of each GVD marker with pTDP43 to verify the co-localization. RESULTS: GVD markers, including lipid raft-associated proteins and tau kinases, were detected in RVs. CHMP2B, pTDP43, caspase 3, LRRK2, annexin 2 and flotillin-1 were detected on the rim and were diffusely distributed in the cytoplasm of RV-positive fibers. CDK5, CK1δ and JNK were detected only on the rim. In double staining experiments, all GVD markers colocalized with pTDP43 in RVs. CONCLUSIONS: These results suggest that RVs of muscle

  17. REPdenovo: Inferring De Novo Repeat Motifs from Short Sequence Reads.

    Directory of Open Access Journals (Sweden)

    Chong Chu

    Full Text Available Repeat elements are important components of eukaryotic genomes. One limitation in our understanding of repeat elements is that most analyses rely on reference genomes that are incomplete and often contain missing data in highly repetitive regions that are difficult to assemble. To overcome this problem we develop a new method, REPdenovo, which assembles repeat sequences directly from raw shotgun sequencing data. REPdenovo can construct various types of repeats that are highly repetitive and have low sequence divergence within copies. We show that REPdenovo is substantially better than existing methods both in terms of the number and the completeness of the repeat sequences that it recovers. The key advantage of REPdenovo is that it can reconstruct long repeats from sequence reads. We apply the method to human data and discover a number of potentially new repeats sequences that have been missed by previous repeat annotations. Many of these sequences are incorporated into various parasite genomes, possibly because the filtering process for host DNA involved in the sequencing of the parasite genomes failed to exclude the host derived repeat sequences. REPdenovo is a new powerful computational tool for annotating genomes and for addressing questions regarding the evolution of repeat families. The software tool, REPdenovo, is available for download at https://github.com/Reedwarbler/REPdenovo.

  18. Repeated-sprint and effort ability in rugby league players.

    Science.gov (United States)

    Johnston, Rich D; Gabbett, Tim J

    2011-10-01

    The aim of this study was to (a) investigate the influence of tackling on repeated-sprint performance; (b) determine whether repeated-sprint ability (RSA) and repeated-effort ability (REA) are 2 distinct qualities; and (c) assess the test-retest reliability of repeated-sprint and repeated-effort tests in rugby league. Twelve rugby league players performed a repeated-sprint (12 × 20-m sprints performed on a 20-second cycle) and a repeated-effort (12 × 20-m sprints with intermittent tackling, performed on a 20-second cycle) test 7 days apart. The test-retest reliability of these tests was also established. Heart rate and rating of perceived exertion were recorded throughout the tests. There was a significantly greater (p ≤ 0.05) and large effect size (ES) differences for total sprint time (ES = 1.19), average heart rate (ES = 1.64), peak heart rate (ES = 1.35), and perceived exertion (ES = 3.39) for the repeated-effort test compared with the repeated-sprint test. A large difference (ES = 1.02, p = 0.06) was detected for percentage decrement between the 2 tests. No significant relationship was found between the repeated-sprint and repeated-effort tests for any of the dependent variables. Both tests proved reliable, with total sprint time being the most reliable method of assessing performance. This study demonstrates that the addition of tackling significantly increases the physiological response to repeated-sprint exercise and reduces repeated-sprint performance in rugby league players. Furthermore, RSA and REA appear to be 2 distinct qualities that can be reliably assessed with total time being the most reliable measure of performance.

  19. Multineuronal Spike Sequences Repeat with Millisecond Precision

    Directory of Open Access Journals (Sweden)

    Koki eMatsumoto

    2013-06-01

    Full Text Available Cortical microcircuits are nonrandomly wired by neurons. As a natural consequence, spikes emitted by microcircuits are also nonrandomly patterned in time and space. One of the prominent spike organizations is a repetition of fixed patterns of spike series across multiple neurons. However, several questions remain unsolved, including how precisely spike sequences repeat, how the sequences are spatially organized, how many neurons participate in sequences, and how different sequences are functionally linked. To address these questions, we monitored spontaneous spikes of hippocampal CA3 neurons ex vivo using a high-speed functional multineuron calcium imaging technique that allowed us to monitor spikes with millisecond resolution and to record the location of spiking and nonspiking neurons. Multineuronal spike sequences were overrepresented in spontaneous activity compared to the statistical chance level. Approximately 75% of neurons participated in at least one sequence during our observation period. The participants were sparsely dispersed and did not show specific spatial organization. The number of sequences relative to the chance level decreased when larger time frames were used to detect sequences. Thus, sequences were precise at the millisecond level. Sequences often shared common spikes with other sequences; parts of sequences were subsequently relayed by following sequences, generating complex chains of multiple sequences.

  20. Modelling repeatedly flaring delta-sunspots

    CERN Document Server

    Chatterjee, Piyali; Carlsson, Mats

    2016-01-01

    Active regions (AR) appearing on the surface of the Sun are classified into $\\alpha$, $\\beta$, $\\gamma$, and $\\delta$ by the rules of the Mount Wilson Observatory, California on the basis of their topological complexity. Amongst these, the $\\delta$-sunspots are known to be super-active and produce the most X-ray flares. Here, we present results from a simulation of the Sun by mimicking the upper layers and the corona, but starting at a more primitive stage than any earlier treatment. We find that this initial state consisting of only a thin sub-photospheric magnetic sheet breaks into multiple flux-tubes which evolve into a colliding-merging system of spots of opposite polarity upon surface emergence, similar to those often seen on the Sun. The simulation goes on to produce many exotic $\\delta$-sunspot associated phenomena: repeated flaring in the range of typical solar flare energy release and ejective helical flux ropes with embedded cool-dense plasma filaments resembling solar coronal mass ejections.

  1. A Repeated Signal Difference for Recognising Patterns

    Directory of Open Access Journals (Sweden)

    Kieran Greer

    2016-08-01

    Full Text Available This paper describes a new mechanism that might help with defining pattern sequences, by the fact that it can produce an upper bound on the ensemble value that can persistently oscillate with the actual values produced from each pattern. With every firing event, a node also receives an on/off feedback switch. If the node fires then it sends a feedback result depending on the input signal strength. If the input signal is positive or larger, it can store an ‘on’ switch feedback for the next iteration. If the signal is negative or smaller it can store an ‘off’ switch feedback for the next iteration. If the node does not fire, then it does not affect the current feedback situation and receives the switch command produced by the last active pattern event for the same neuron. The upper bound therefore also represents the largest or most enclosing pattern set and the lower value is for the actual set of firing patterns. If the pattern sequence repeats, it will oscillate between the two values, allowing them to be recognised and measured more easily, over time. Tests show that changing the sequence ordering produces different value sets, which can also be measured.

  2. Hypoxic Repeat Sprint Training Improves Rugby Player's Repeated Sprint but Not Endurance Performance.

    Science.gov (United States)

    Hamlin, Michael J; Olsen, Peter D; Marshall, Helen C; Lizamore, Catherine A; Elliot, Catherine A

    2017-01-01

    This study aims to investigate the performance changes in 19 well-trained male rugby players after repeat-sprint training (six sessions of four sets of 5 × 5 s sprints with 25 s and 5 min of active recovery between reps and sets, respectively) in either normobaric hypoxia (HYP; n = 9; FIO2 = 14.5%) or normobaric normoxia (NORM; n = 10; FIO2 = 20.9%). Three weeks after the intervention, 2 additional repeat-sprint training sessions in hypoxia (FIO2 = 14.5%) was investigated in both groups to gauge the efficacy of using "top-up" sessions for previously hypoxic-trained subjects and whether a small hypoxic dose would be beneficial for the previously normoxic-trained group. Repeated sprint (8 × 20 m) and Yo-Yo Intermittent Recovery Level 1 (YYIR1) performances were tested twice at baseline (Pre 1 and Pre 2) and weekly after (Post 1-3) the initial intervention (intervention 1) and again weekly after the second "top-up" intervention (Post 4-5). After each training set, heart rate, oxygen saturation, and rate of perceived exertion were recorded. Compared to baseline (mean of Pre 1 and Pre 2), both the hypoxic and normoxic groups similarly lowered fatigue over the 8 sprints 1 week after the intervention (Post 1: -1.8 ± 1.6%, -1.5 ± 1.4%, mean change ± 90% CI in HYP and NORM groups, respectively). However, from Post 2 onwards, only the hypoxic group maintained the performance improvement compared to baseline (Post 2: -2.1 ± 1.8%, Post 3: -2.3 ± 1.7%, Post 4: -1.9 ± 1.8%, and Post 5: -1.2 ± 1.7%). Compared to the normoxic group, the hypoxic group was likely to have substantially less fatigue at Post 3-5 (-2.0 ± 2.4%, -2.2 ± 2.4%, -1.6 ± 2.4% Post 3, Post 4, Post 5, respectively). YYIR1 performances improved throughout the recovery period in both groups (13-37% compared to baseline) with unclear differences found between groups. The addition of two sessions of "top-up" training after intervention 1, had little effect on either group. Repeat-sprint training in

  3. Hypoxic Repeat Sprint Training Improves Rugby Player's Repeated Sprint but Not Endurance Performance

    Science.gov (United States)

    Hamlin, Michael J.; Olsen, Peter D.; Marshall, Helen C.; Lizamore, Catherine A.; Elliot, Catherine A.

    2017-01-01

    This study aims to investigate the performance changes in 19 well-trained male rugby players after repeat-sprint training (six sessions of four sets of 5 × 5 s sprints with 25 s and 5 min of active recovery between reps and sets, respectively) in either normobaric hypoxia (HYP; n = 9; FIO2 = 14.5%) or normobaric normoxia (NORM; n = 10; FIO2 = 20.9%). Three weeks after the intervention, 2 additional repeat-sprint training sessions in hypoxia (FIO2 = 14.5%) was investigated in both groups to gauge the efficacy of using “top-up” sessions for previously hypoxic-trained subjects and whether a small hypoxic dose would be beneficial for the previously normoxic-trained group. Repeated sprint (8 × 20 m) and Yo-Yo Intermittent Recovery Level 1 (YYIR1) performances were tested twice at baseline (Pre 1 and Pre 2) and weekly after (Post 1–3) the initial intervention (intervention 1) and again weekly after the second “top-up” intervention (Post 4–5). After each training set, heart rate, oxygen saturation, and rate of perceived exertion were recorded. Compared to baseline (mean of Pre 1 and Pre 2), both the hypoxic and normoxic groups similarly lowered fatigue over the 8 sprints 1 week after the intervention (Post 1: −1.8 ± 1.6%, −1.5 ± 1.4%, mean change ± 90% CI in HYP and NORM groups, respectively). However, from Post 2 onwards, only the hypoxic group maintained the performance improvement compared to baseline (Post 2: −2.1 ± 1.8%, Post 3: −2.3 ± 1.7%, Post 4: −1.9 ± 1.8%, and Post 5: −1.2 ± 1.7%). Compared to the normoxic group, the hypoxic group was likely to have substantially less fatigue at Post 3–5 (−2.0 ± 2.4%, −2.2 ± 2.4%, −1.6 ± 2.4% Post 3, Post 4, Post 5, respectively). YYIR1 performances improved throughout the recovery period in both groups (13–37% compared to baseline) with unclear differences found between groups. The addition of two sessions of “top-up” training after intervention 1, had little effect on either

  4. An Expanded CAG Repeat in Huntingtin Causes +1 Frameshifting.

    Science.gov (United States)

    Saffert, Paul; Adamla, Frauke; Schieweck, Rico; Atkins, John F; Ignatova, Zoya

    2016-08-26

    Maintenance of triplet decoding is crucial for the expression of functional protein because deviations either into the -1 or +1 reading frames are often non-functional. We report here that expression of huntingtin (Htt) exon 1 with expanded CAG repeats, implicated in Huntington pathology, undergoes a sporadic +1 frameshift to generate from the CAG repeat a trans-frame AGC repeat-encoded product. This +1 recoding is exclusively detected in pathological Htt variants, i.e. those with expanded repeats with more than 35 consecutive CAG codons. An atypical +1 shift site, UUC C at the 5' end of CAG repeats, which has some resemblance to the influenza A virus shift site, triggers the +1 frameshifting and is enhanced by the increased propensity of the expanded CAG repeats to form a stem-loop structure. The +1 trans-frame-encoded product can directly influence the aggregation of the parental Htt exon 1.

  5. Repeats in transforming acidic coiled-coil (TACC) genes.

    Science.gov (United States)

    Trivedi, Seema

    2013-06-01

    Transforming acidic coiled-coil proteins (TACC1, 2, and 3) are essential proteins associated with the assembly of spindle microtubules and maintenance of bipolarity. Dysregulation of TACCs is associated with tumorigenesis, but studies of microsatellite instability in TACC genes have not been extensive. Microsatellite or simple sequence repeat instability is known to cause many types of cancer. The present in silico analysis of SSRs in human TACC gene sequences shows the presence of mono- to hexa-nucleotide repeats, with the highest densities found for mono- and di-nucleotide repeats. Density of repeats is higher in introns than in exons. Some of the repeats are present in regulatory regions and retained introns. Human TACC genes show conservation of many repeat classes. Microsatellites in TACC genes could be valuable markers for monitoring numerical chromosomal aberrations and or cancer.

  6. Survey of simple sequence repeats in woodland strawberry (Fragaria vesca).

    Science.gov (United States)

    Guan, L; Huang, J F; Feng, G Q; Wang, X W; Wang, Y; Chen, B Y; Qiao, Y S

    2013-07-30

    The use of simple sequence repeats (SSRs), or microsatellites, as genetic markers has become popular due to their abundance and variation in length among individuals. In this study, we investigated linkage groups (LGs) in the woodland strawberry (Fragaria vesca) and demonstrated variation in the abundances, densities, and relative densities of mononucleotide, dinucleotide, and trinucleotide repeats. Mononucleotide, dinucleotide, and trinucleotide repeats were more common than longer repeats in all LGs examined. Perfect SSRs were the predominant SSR type found and their abundance was extremely stable among LGs and chloroplasts. Abundances of mononucleotide, dinucleotide, and trinucleotide repeats were positively correlated with LG size, whereas those of tetranucleotide and hexanucleotide SSRs were not. Generally, in each LG, the abundance, relative abundance, relative density, and the proportion of each unique SSR all declined rapidly as the repeated unit increased. Furthermore, the lengths and frequencies of SSRs varied among different LGs.

  7. Quasimonomorphic Mononucleotide Repeats for High-Level Microsatellite Instability Analysis

    Directory of Open Access Journals (Sweden)

    Olivier Buhard

    2004-01-01

    Full Text Available Microsatellite instability (MSI analysis is becoming more and more important to detect sporadic primary tumors of the MSI phenotype as well as in helping to determine Hereditary Non-Polyposis Colorectal Cancer (HNPCC cases. After some years of conflicting data due to the absence of consensus markers for the MSI phenotype, a meeting held in Bethesda to clarify the situation proposed a set of 5 microsatellites (2 mononucleotide repeats and 3 dinucleotide repeats to determine MSI tumors. A second Bethesda consensus meeting was held at the end of 2002. It was discussed here that the 1998 microsatellite panel could underestimate high-level MSI tumors and overestimate low-level MSI tumors. Amongst the suggested changes was the exclusive use of mononucleotide repeats in place of dinucleotide repeats. We have already proposed a pentaplex MSI screening test comprising 5 quasimonomorphic mononucleotide repeats. This article compares the advantages of mono or dinucleotide repeats in determining microsatellite instability.

  8. Zinc-finger directed double-strand breaks within CAG repeat tracts promote repeat instability in human cells.

    Science.gov (United States)

    Mittelman, David; Moye, Christopher; Morton, Jason; Sykoudis, Kristen; Lin, Yunfu; Carroll, Dana; Wilson, John H

    2009-06-16

    Expanded triplet repeats have been identified as the genetic basis for a growing number of neurological and skeletal disorders. To examine the contribution of double-strand break repair to CAG x CTG repeat instability in mammalian systems, we developed zinc finger nucleases (ZFNs) that recognize and cleave CAG repeat sequences. Engineered ZFNs use a tandem array of zinc fingers, fused to the FokI DNA cleavage domain, to direct double-strand breaks (DSBs) in a site-specific manner. We first determined that the ZFNs cleave CAG repeats in vitro. Then, using our previously described tissue culture assay for identifying modifiers of CAG repeat instability, we found that transfection of ZFN-expression vectors induced up to a 15-fold increase in changes to the CAG repeat in human and rodent cell lines, and that longer repeats were much more sensitive to cleavage than shorter ones. Analysis of individual colonies arising after treatment revealed a spectrum of events consistent with ZFN-induced DSBs and dominated by repeat contractions. We also found that expressing a dominant-negative form of RAD51 in combination with a ZFN, dramatically reduced the effect of the nuclease, suggesting that DSB-induced repeat instability is mediated, in part, through homology directed repair. These studies identify a ZFN as a useful reagent for characterizing the effects of DSBs on CAG repeats in cells.

  9. Assembly of Repeat Content Using Next Generation Sequencing Data

    Energy Technology Data Exchange (ETDEWEB)

    labutti, Kurt; Kuo, Alan; Grigoriev, Igor; Copeland, Alex

    2014-03-17

    Repetitive organisms pose a challenge for short read assembly, and typically only unique regions and repeat regions shorter than the read length, can be accurately assembled. Recently, we have been investigating the use of Pacific Biosciences reads for de novo fungal assembly. We will present an assessment of the quality and degree of repeat reconstruction possible in a fungal genome using long read technology. We will also compare differences in assembly of repeat content using short read and long read technology.

  10. Neuropathological diagnosis and CAG repeat expansion in Huntington's disease.

    OpenAIRE

    Xuereb, J H; MacMillan, J C; Snell, R; Davies, P.; Harper, P S

    1996-01-01

    OBJECTIVE--To correlate the degree of CAG repeat expansion with neuropathological findings in Huntington's disease. METHODS--The CAG repeat polymorphism was analysed in a large series of brain samples from 268 patients with a clinical diagnosis of Huntington's disease in which full neuropathological data was available. RESULTS--Analysis by polymerase chain reaction was successful in 63% of samples (169 of 268). Repeat expansions were detected in 152 of 153 (99%) samples with a neuropathologic...

  11. The evolution of filamin – A protein domain repeat perspective

    OpenAIRE

    Light, Sara; Sagit, Rauan; Ithychanda, Sujay S.; Qin, Jun; Elofsson, Arne

    2012-01-01

    Particularly in higher eukaryotes, some protein domains are found in tandem repeats, performing broad functions often related to cellular organization. For instance, the eukaryotic protein filamin interacts with many proteins and is crucial for the cytoskeleton. The functional properties of long repeat domains are governed by the specific properties of each individual domain as well as by the repeat copy number. To provide better understanding of the evolutionary and functional history of rep...

  12. Repeated fecal microbiota transplantation in a child with ulcerative colitis.

    Science.gov (United States)

    Shimizu, Hirotaka; Arai, Katsuhiro; Abe, Jun; Nakabayashi, Kazuhiko; Yoshioka, Takako; Hosoi, Kenji; Kuroda, Makoto

    2016-08-01

    We report the case of an 11-year-old girl with ulcerative colitis refractory to conventional therapy, who was subsequently treated successfully with repeated fecal microbiota transplantation (FMT). The patient was steroid dependent despite several infliximab treatments, and colectomy was proposed to improve quality of life. After repeated FMT, she was able to maintain remission with on minimal dose of steroid. Although her fecal microbiota was dysbiotic before FMT, it was restored to a similar pattern as the donor after repeated FMT.

  13. Artificial leucine rich repeats as new scaffolds for protein design.

    Science.gov (United States)

    Baabur-Cohen, Hemda; Dayalan, Subashini; Shumacher, Inbal; Cohen-Luria, Rivka; Ashkenasy, Gonen

    2011-04-15

    The leucine rich repeat (LRR) motif that participates in many biomolecular recognition events in cells was suggested as a general scaffold for producing artificial receptors. We describe here the design and first total chemical synthesis of small LRR proteins, and their structural analysis. When evaluating the tertiary structure as a function of different number of repeating units (1-3), we were able to find that the 3-repeats sequence, containing 90 amino acids, folds into the expected structure.

  14. Coexistence of 3G repeaters with LTE base stations.

    Science.gov (United States)

    Yeo, Woon-Young; Lee, Sang-Min; Hwang, Gyung-Ho; Kim, Jae-Hoon

    2013-01-01

    Repeaters have been an attractive solution for mobile operators to upgrade their wireless networks at low cost and to extend network coverage effectively. Since the first LTE commercial deployment in 2009, many mobile operators have launched LTE networks by upgrading their 3G and legacy networks. Because all 3G frequency bands are shared with the frequency bands for LTE deployment and 3G mobile operators have an enormous number of repeaters, reusing 3G repeaters in LTE networks is definitely a practical and cost-efficient solution. However, 3G repeaters usually do not support spatial multiplexing with multiple antennas, and thus it is difficult to reuse them directly in LTE networks. In order to support spatial multiplexing of LTE, the role of 3G repeaters should be replaced with small LTE base stations or MIMO-capable repeaters. In this paper, a repeater network is proposed to reuse 3G repeaters in LTE deployment while still supporting multilayer transmission of LTE. Interestingly, the proposed network has a higher cluster throughput than an LTE network with MIMO-capable repeaters.

  15. Mononucleotide repeats are asymmetrically distributed in fungal genes

    Directory of Open Access Journals (Sweden)

    de Graaff Leo H

    2008-12-01

    Full Text Available Abstract Background Systematic analyses of sequence features have resulted in a better characterisation of the organisation of the genome. A previous study in prokaryotes on the distribution of sequence repeats, which are notoriously variable and can disrupt the reading frame in genes, showed that these motifs are skewed towards gene termini, specifically the 5' end of genes. For eukaryotes no such intragenic analysis has been performed, though this could indicate the pervasiveness of this distribution bias, thereby helping to expose the selective pressures causing it. Results In fungal gene repertoires we find a similar 5' bias of intragenic mononucleotide repeats, most notably for Candida spp., whereas e.g. Coccidioides spp. display no such bias. With increasing repeat length, ever larger discrepancies are observed in genome repertoire fractions containing such repeats, with up to an 80-fold difference in gene fractions at repeat lengths of 10 bp and longer. This species-specific difference in gene fractions containing large repeats could be attributed to variations in intragenic repeat tolerance. Furthermore, long transcripts experience an even more prominent bias towards the gene termini, with possibly a more adaptive role for repeat-containing short transcripts. Conclusion Mononucleotide repeats are intragenically biased in numerous fungal genomes, similar to earlier studies on prokaryotes, indicative of a similar selective pressure in gene organization.

  16. Huntington's disease as caused by 34 CAG repeats.

    Science.gov (United States)

    Andrich, Jürgen; Arning, Larissa; Wieczorek, Stefan; Kraus, Peter H; Gold, Ralf; Saft, Carsten

    2008-04-30

    Huntington's disease (HD) is an autosomal dominantly inherited neurodegenerative disorder caused by an abnormal expansion of a polymorphic stretch of CAG repeats in the coding 5' part of the HD gene on chromosome 4p. Expansions of CAG blocks beyond 35 repeats are associated with the clinical presentation of HD. There is an intermediate range of rare alleles between 27 and 35 CAG repeats with a higher risk for further expansion in subsequent generations. Here, we report a 75-year-old male with clinical features of HD and 34 CAG repeat units.

  17. Intragenic tandem repeat variation between Legionella pneumophila strains

    Directory of Open Access Journals (Sweden)

    Jarraud Sophie

    2008-12-01

    Full Text Available Abstract Background Bacterial genomes harbour a large number of tandem repeats, yet the possible phenotypic effects of those found within the coding region of genes are only beginning to be examined. Evidence exists from other organisms that these repeats can be involved in the evolution of new genes, gene regulation, adaptation, resistance to environmental stresses, and avoidance of the immune system. Results In this study, we have investigated the presence and variability in copy number of intragenic tandemly repeated sequences in the genome of Legionella pneumophila, the etiological agent of a severe pneumonia known as Legionnaires' disease. Within the genome of the Philadelphia strain, we have identified 26 intragenic tandem repeat sequences using conservative selection criteria. Of these, seven were "polymorphic" in terms of repeat copy number between a large number of L. pneumophila serogroup 1 strains. These strains were collected from a wide variety of environments and patients in several geographical regions. Within this panel of strains, all but one of these seven genes exhibited statistically different patterns in repeat copy number between samples from different origins (environmental, clinical, and hot springs. Conclusion These results support the hypothesis that intragenic tandem repeats could play a role in virulence and adaptation to different environments. While tandem repeats are an increasingly popular focus of molecular typing studies in prokaryotes, including in L. pneumophila, this study is the first examining the difference in tandem repeat distribution as a function of clinical or environmental origin.

  18. Genus-specific protein binding to the large clusters of DNA repeats (short regularly spaced repeats) present in Sulfolobus genomes

    DEFF Research Database (Denmark)

    Peng, Xu; Brügger, Kim; Shen, Biao

    2003-01-01

    Short regularly spaced repeats (SRSRs) occur in multiple large clusters in archaeal chromosomes and as smaller clusters in some archaeal conjugative plasmids and bacterial chromosomes. The sequence, size, and spacing of the repeats are generally constant within a cluster but vary between clusters...... that are identical in sequence to one of the