WorldWideScience

Sample records for repeat kinase-2 follistatin

  1. Parkinson's disease: leucine-rich repeat kinase 2 and autophagy, intimate enemies.

    Science.gov (United States)

    Bravo-San Pedro, José M; Gómez-Sánchez, Rubén; Pizarro-Estrella, Elisa; Niso-Santano, Mireia; González-Polo, Rosa A; Fuentes Rodríguez, José M

    2012-01-01

    Parkinson's disease is the second common neurodegenerative disorder, after Alzheimer's disease. It is a clinical syndrome characterized by loss of dopamine-generating cells in the substancia nigra, a region of the midbrain. The etiology of Parkinson's disease has long been through to involve both genetic and environmental factors. Mutations in the leucine-rich repeat kinase 2 gene cause late-onset Parkinson's disease with a clinical appearance indistinguishable from Parkinson's disease idiopathic. Autophagy is an intracellular catabolic mechanism whereby a cell recycles or degrades damage proteins and cytoplasmic organelles. This degradative process has been associated with cellular dysfunction in neurodegenerative processes including Parkinson's disease. We discuss the role of leucine-rich repeat kinase 2 in autophagy, and how the deregulations of this degradative mechanism in cells can be implicated in the Parkinson's disease etiology.

  2. Leucine-rich repeat kinase 2 mutations and Parkinson’s disease: three questions

    OpenAIRE

    Elisa Greggio; Cookson, Mark R

    2009-01-01

    Mutations in the gene encoding LRRK2 (leucine-rich repeat kinase 2) were first identified in 2004 and have since been shown to be the single most common cause of inherited Parkinson's disease. The protein is a large GTP-regulated serine/threonine kinase that additionally contains several protein–protein interaction domains. In the present review, we discuss three important, but unresolved, questions concerning LRRK2. We first ask: what is the normal function of LRRK2? Related to this, we disc...

  3. Measuring the Activity of Leucine-Rich Repeat Kinase 2: A Kinase Involved in Parkinson's Disease

    Science.gov (United States)

    Lee, Byoung Dae; Li, Xiaojie; Dawson, Ted M.; Dawson, Valina L.

    2015-01-01

    Mutations in the LRRK2 (Leucine-Rich Repeat Kinase 2) gene are the most common cause of autosomal dominant Parkinson's disease. LRRK2 has multiple functional domains including a kinase domain. The kinase activity of LRRK2 is implicated in the pathogenesis of Parkinson's disease. Developing an assay to understand the mechanisms of LRRK2 kinase activity is important for the development of pharmacologic and therapeutic applications. Here, we describe how to measure in vitro LRRK2 kinase activity and its inhibition. PMID:21960214

  4. mTOR independent regulation of macroautophagy by Leucine Rich Repeat Kinase 2 via Beclin-1

    Science.gov (United States)

    Manzoni, Claudia; Mamais, Adamantios; Roosen, Dorien A.; Dihanich, Sybille; Soutar, Marc P. M.; Plun-Favreau, Helene; Bandopadhyay, Rina; Hardy, John; Tooze, Sharon A.; Cookson, Mark R.; Lewis, Patrick A.

    2016-01-01

    Leucine rich repeat kinase 2 is a complex enzyme with both kinase and GTPase activities, closely linked to the pathogenesis of several human disorders including Parkinson’s disease, Crohn’s disease, leprosy and cancer. LRRK2 has been implicated in numerous cellular processes; however its physiological function remains unclear. Recent reports suggest that LRRK2 can act to regulate the cellular catabolic process of macroautophagy, although the precise mechanism whereby this occurs has not been identified. To investigate the signalling events through which LRRK2 acts to influence macroautophagy, the mammalian target of rapamycin (mTOR)/Unc-51-like kinase 1 (ULK1) and Beclin-1/phosphatidylinositol 3-kinase (PI3K) pathways were evaluated in astrocytic cell models in the presence and absence of LRRK2 kinase inhibitors. Chemical inhibition of LRRK2 kinase activity resulted in the stimulation of macroautophagy in a non-canonical fashion, independent of mTOR and ULK1, but dependent upon the activation of Beclin 1-containing class III PI3-kinase. PMID:27731364

  5. Leucine-rich repeat kinase 2 inhibitors: a patent review (2014-2016).

    Science.gov (United States)

    Galatsis, Paul

    2017-06-01

    Leucine-rich repeat kinase 2 (LRRK2) is a member of the Tyrosine Kinase-Like (TKL) branch of the kinome tree and is a multi-domain protein that includes GTPase and kinase activity. While genome-wide association studies (GWAS) has linked LRRK2 with Crohn's disease and leprosy, it has received the greatest attention due to it being implicated as one of the genetic loci associated with autosomal dominant inheritance in Parkinson's disease (PD). Areas covered: In this review, the small molecule patent literature from 2014-2016 with a focus on composition of matter and use patents was surveyed. Scifinder was primarily searched using 'LRRK2' as the query to identify all relevant literature and then triaged for small molecule patents. Expert opinion: The patent landscape around LRRK2 continues to develop. The early patents covered using existing kinase inhibitors for use against LRRK2. This evolved to compounds specifically designed for selectivity against LRRK2, but key exemplified compounds lacked sufficient brain exposure to affect sufficient efficacy. More recent compounds have addressed this deficiency and show greater potential for treating PD. While potency will be necessary to generate medicines with low human daily doses, brain penetration and safety will be the key differentiators for ultimately determining the most effective LRRK2 disease-modifying treatment for PD.

  6. Cerebral pathological and compensatory mechanisms in the premotor phase of leucine-rich repeat kinase 2 parkinsonism.

    Science.gov (United States)

    van Nuenen, Bart F L; Helmich, Rick C; Ferraye, Murielle; Thaler, Avner; Hendler, Talma; Orr-Urtreger, Avi; Mirelman, Anat; Bressman, Susan; Marder, Karen S; Giladi, Nir; van de Warrenburg, Bart P C; Bloem, Bastiaan R; Toni, Ivan

    2012-12-01

    Compensatory cerebral mechanisms can delay motor symptom onset in Parkinson's disease. We aim to characterize these compensatory mechanisms and early disease-related changes by quantifying movement-related cerebral function in subjects at significantly increased risk of developing Parkinson's disease, namely carriers of a leucine-rich repeat kinase 2-G2019S mutation associated with dominantly inherited parkinsonism. Functional magnetic resonance imaging was used to examine cerebral activity evoked during internal selection of motor representations, a core motor deficit in clinically overt Parkinson's disease. Thirty-nine healthy first-degree relatives of Ashkenazi Jewish patients with Parkinson's disease, who carry the leucine-rich repeat kinase 2-G2019S mutation, participated in this study. Twenty-one carriers of the leucine-rich repeat kinase 2-G2019S mutation and 18 non-carriers of this mutation were engaged in a motor imagery task (laterality judgements of left or right hands) known to be sensitive to motor control parameters. Behavioural performance of both groups was matched. Mutation carriers and non-carriers were equally sensitive to the extent and biomechanical constraints of the imagined movements in relation to the current posture of the participants' hands. Cerebral activity differed between groups, such that leucine-rich repeat kinase 2-G2019S carriers had reduced imagery-related activity in the right caudate nucleus and increased activity in the right dorsal premotor cortex. More severe striatal impairment was associated with stronger effective connectivity between the right dorsal premotor cortex and the right extrastriate body area. These findings suggest that altered movement-related activity in the caudate nuclei of leucine-rich repeat kinase 2-G2019S carriers might remain behaviourally latent by virtue of cortical compensatory mechanisms involving long-range connectivity between the dorsal premotor cortex and posterior sensory regions. These

  7. The prodromal phase of leucine-rich repeat kinase 2-associated Parkinson disease: Clinical and imaging Studies.

    Science.gov (United States)

    Pont-Sunyer, Claustre; Tolosa, Eduardo; Caspell-Garcia, Chelsea; Coffey, Christopher; Alcalay, Roy N; Chan, Piu; Duda, John E; Facheris, Maurizio; Fernández-Santiago, Rubén; Marek, Kenneth; Lomeña, Francisco; Marras, Connie; Mondragon, Elisabet; Saunders-Pullman, Rachel; Waro, Bjorg

    2017-05-01

    Asymptomatic, nonmanifesting carriers of leucine-rich repeat kinase 2 mutations are at increased risk of developing PD. Clinical and neuroimaging features may be associated with gene carriage and/or may demarcate individuals at greater risk for phenoconversion to PD. To investigate clinical and dopamine transporter single-photon emission computed tomography imaging characteristics of leucine-rich repeat kinase 2 asymptomatic carriers. A total of 342 carriers' and 259 noncarriers' relatives of G2019S leucine-rich repeat kinase 2/PD patients and 39 carriers' and 31 noncarriers' relatives of R1441G leucine-rich repeat kinase 2/PD patients were evaluated. Motor and nonmotor symptoms were assessed using specific scales and questionnaires. Neuroimaging quantitative data were obtained in 81 carriers and compared with 41 noncarriers. G2019S carriers scored higher in motor scores and had lower radioligand uptake compared to noncarriers, but no differences in nonmotor symptoms scores were observed. R1441G carriers scored higher in motor scores, had lower radioligand uptake, and had higher scores in depression, dysautonomia, and Rapid Eye Movements Sleep Behavior Disorder Screening Questionnaire scores, but had better cognition scores than noncarriers. Among G2019S carriers, a group with "mild motor signs" was identified, and was significantly older, with worse olfaction and lower radioligand uptake. G2019S and R1441G carriers differ from their noncarriers' relatives in higher motor scores and slightly lower radioligand uptake. Nonmotor symptoms were mild, and different nonmotor profiles were observed in G2019S carriers compared to R1441G carriers. A group of G2019S carriers with known prodromal features was identified. Longitudinal studies are required to determine whether such individuals are at short-term risk of developing overt parkinsonism. © 2017 International Parkinson and Movement Disorder Society. © 2017 International Parkinson and Movement Disorder Society.

  8. Mood and cognition in leucine-rich repeat kinase 2 G2019S Parkinson's disease.

    Science.gov (United States)

    Shanker, Vicki; Groves, Mark; Heiman, Gary; Palmese, Christina; Saunders-Pullman, Rachel; Ozelius, Laurie; Raymond, Deborah; Bressman, Susan

    2011-08-15

    The behavioral and cognitive features of the leucine-rich repeat kinase G2019S mutation in Parkinson's disease in the Ashkenazi Jewish population are not well described; therefore, we sought to more systematically characterize these features using a semistructured psychiatric interview and neuropsychological testing. Twenty-one Ashkenazi Jewish patients having the leucine-rich repeat kinase G2019S mutation were compared with age- and sex-matched Ashkenazi Jewish patients with Parkinson's disease without mutations. Although overall rates of affective disorders were not greater in mutation carriers, the carriers exhibited a 6-fold increased risk of premorbid affective disorders (odds ratio, 6.0; P = .10), as determined by the Structured Clinical Interview for the Diagnostic and Statistical Manual of Mental Disorders-IV. Of interest, we identified 2 leucine-rich repeat kinase carriers with bipolar disorder; no mutation-negative subjects had this diagnosis. Performance on the Hopkins Verbal Learning Test-Revised, Judgment of Line Orientation, and Frontal Assessment Battery was consistent with previous reports and did not differ between groups. Study findings suggest a possible association between premorbid mood disorders and leucine-rich repeat kinase Parkinson's disease, warranting further evaluation.

  9. Leucine rich repeat kinase 2 (LRRK2) as a potential therapeutic target for Parkinson’s disease

    Science.gov (United States)

    Lee, Byoung Dae; Dawson, Valina L.; Dawson, Ted M.

    2012-01-01

    Parkinson’s disease (PD) is caused by the progressive degeneration of dopaminergic neurons in the substantia nigra. Although the etiology for most PD remains elusive, the identification of specific genetic defects in familial cases of PD and the signaling pathways governed by these genes has provided tremendous insight into PD pathogenesis. Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene are frequently found in familial and sporadic PD. Although current knowledge regarding the regulatory mechanisms of LRRK2 activation is limited, it is becoming increasingly evident that aberrant kinase activity of the pathologic mutants of LRRK2 is associated with neurodegeneration, suggesting that the kinase activity of LRRK2 is a potential therapeutic target. In addition, LRRK2 inhibitors might provide valuable tools to understand the pathophysiological and physiological roles of LRRK2 as well as the etiology of PD. We discuss here the potential and feasibility of targeting LRRK2 as a therapeutic strategy for PD. PMID:22578536

  10. Leucine-rich repeat kinase 2 modulates retinoic acid-induced neuronal differentiation of murine embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Cathrin Schulz

    Full Text Available BACKGROUND: Dominant mutations in the leucine-rich repeat kinase 2 (LRRK2 gene are the most prevalent cause of Parkinson's disease, however, little is known about the biological function of LRRK2 protein. LRRK2 is expressed in neural precursor cells suggesting a role in neurodevelopment. METHODOLOGY/PRINCIPAL FINDINGS: In the present study, differential gene expression profiling revealed a faster silencing of pluripotency-associated genes, like Nanog, Oct4, and Lin28, during retinoic acid-induced neuronal differentiation of LRRK2-deficient mouse embryonic stem cells compared to wildtype cultures. By contrast, expression of neurotransmitter receptors and neurotransmitter release was increased in LRRK2+/- cultures indicating that LRRK2 promotes neuronal differentiation. Consistently, the number of neural progenitor cells was higher in the hippocampal dentate gyrus of adult LRRK2-deficient mice. Alterations in phosphorylation of the putative LRRK2 substrates, translation initiation factor 4E binding protein 1 and moesin, do not appear to be involved in altered differentiation, rather there is indirect evidence that a regulatory signaling network comprising retinoic acid receptors, let-7 miRNA and downstream target genes/mRNAs may be affected in LRRK2-deficient stem cells in culture. CONCLUSION/SIGNIFICANCE: Parkinson's disease-linked LRRK2 mutations that associated with enhanced kinase activity may affect retinoic acid receptor signaling during neurodevelopment and/or neuronal maintenance as has been shown in other mouse models of chronic neurodegenerative diseases.

  11. Interplay between Leucine-Rich Repeat Kinase 2 (LRRK2) and p62/SQSTM-1 in Selective Autophagy

    Science.gov (United States)

    Park, Sangwook; Han, Seulki; Choi, Insup; Kim, Beomsue; Park, Seung Pyo; Joe, Eun-Hye; Suh, Young Ho

    2016-01-01

    The deposit of polyubiquitinated aggregates has been implicated in the pathophysiology of Parkinson’s disease (PD), and growing evidence indicates that selective autophagy plays a critical role in the clearance of ubiquitin-positive protein aggregates by autophagosomes. The selective autophagic receptor p62/SQSTM-1, which associates directly with both ubiquitin and LC3, transports ubiquitin conjugates to autophagosomes for degradation. Leucine-rich repeat kinase 2 (LRRK2), a PD-associated protein kinase, is tightly controlled by autophagy-lysosome degradation as well as by the ubiquitin-proteasome pathway. However, little is known about the degradation of ubiquitinated LRRK2 via selective autophagy. In the present study, we found that p62/SQSTM-1 physically interacts with LRRK2 as a selective autophagic receptor. The overexpression of p62 leads to the robust degradation of LRRK2 through the autophagy-lysosome pathway. In addition, LRRK2 indirectly regulates Ser351 and Ser403 phosphorylation of p62. Of particular interest, the interaction between phosphorylated p62 and Keap1 is reduced by LRRK2 overexpression. Therefore, we propose that the interplay between LRRK2 and p62 may contribute to the pathophysiological function and homeostasis of LRRK2 protein. PMID:27631370

  12. ARHGEF7 (Beta-PIX acts as guanine nucleotide exchange factor for leucine-rich repeat kinase 2.

    Directory of Open Access Journals (Sweden)

    Karina Haebig

    Full Text Available BACKGROUND: Mutations within the leucine-rich repeat kinase 2 (LRRK2 gene are a common cause of familial and sporadic Parkinson's disease. The multidomain protein LRRK2 exhibits overall low GTPase and kinase activity in vitro. METHODOLOGY/PRINCIPAL FINDINGS: Here, we show that the rho guanine nucleotide exchange factor ARHGEF7 and the small GTPase CDC42 are interacting with LRRK2 in vitro and in vivo. GTPase activity of full-length LRRK2 increases in the presence of recombinant ARHGEF7. Interestingly, LRRK2 phosphorylates ARHGEF7 in vitro at previously unknown phosphorylation sites. We provide evidence that ARHGEF7 might act as a guanine nucleotide exchange factor for LRRK2 and that R1441C mutant LRRK2 with reduced GTP hydrolysis activity also shows reduced binding to ARHGEF7. CONCLUSIONS/SIGNIFICANCE: Downstream effects of phosphorylation of ARHGEF7 through LRRK2 could be (i a feedback control mechanism for LRRK2 activity as well as (ii an impact of LRRK2 on actin cytoskeleton regulation. A newly identified familial mutation N1437S, localized within the GTPase domain of LRRK2, further underlines the importance of the GTPase domain of LRRK2 in Parkinson's disease pathogenesis.

  13. Chemical genetic approach identifies microtubule affinity-regulating kinase 1 as a leucine-rich repeat kinase 2 substrate.

    Science.gov (United States)

    Krumova, Petranka; Reyniers, Lauran; Meyer, Marc; Lobbestael, Evy; Stauffer, Daniela; Gerrits, Bertran; Muller, Lionel; Hoving, Sjouke; Kaupmann, Klemens; Voshol, Johannes; Fabbro, Doriano; Bauer, Andreas; Rovelli, Giorgio; Taymans, Jean-Marc; Bouwmeester, Tewis; Baekelandt, Veerle

    2015-07-01

    Mutations in leucine-rich repeat kinase 2 (LRRK2) are the most common cause of autosomal-dominant forms of Parkinson's disease. LRRK2 is a modular, multidomain protein containing 2 enzymatic domains, including a kinase domain, as well as several protein-protein interaction domains, pointing to a role in cellular signaling. Although enormous efforts have been made, the exact pathophysiologic mechanisms of LRRK2 are still not completely known. In this study, we used a chemical genetics approach to identify LRRK2 substrates from mouse brain. This approach allows the identification of substrates of 1 particular kinase in a complex cellular environment. Several of the identified peptides are involved in the regulation of microtubule (MT) dynamics, including microtubule-associating protein (MAP)/microtubule affinity-regulating kinase 1 (MARK1). MARK1 is a serine/threonine kinase known to phosphorylate MT-binding proteins such as Tau, MAP2, and MAP4 at KXGS motifs leading to MT destabilization. In vitro kinase assays and metabolic-labeling experiments in living cells confirmed MARK1 as an LRRK2 substrate. Moreover, we also showed that LRRK2 and MARK1 are interacting in eukaryotic cells. Our findings contribute to the identification of physiologic LRRK2 substrates and point to a potential mechanism explaining the reported effects of LRRK2 on neurite morphology.

  14. A Direct Interaction between Leucine-rich Repeat Kinase 2 and Specific β-Tubulin Isoforms Regulates Tubulin Acetylation*

    Science.gov (United States)

    Law, Bernard M. H.; Spain, Victoria A.; Leinster, Veronica H. L.; Chia, Ruth; Beilina, Alexandra; Cho, Hyun J.; Taymans, Jean-Marc; Urban, Mary K.; Sancho, Rosa M.; Ramírez, Marian Blanca; Biskup, Saskia; Baekelandt, Veerle; Cai, Huaibin; Cookson, Mark R.; Berwick, Daniel C.; Harvey, Kirsten

    2014-01-01

    Mutations in LRRK2, encoding the multifunctional protein leucine-rich repeat kinase 2 (LRRK2), are a common cause of Parkinson disease. LRRK2 has been suggested to influence the cytoskeleton as LRRK2 mutants reduce neurite outgrowth and cause an accumulation of hyperphosphorylated Tau. This might cause alterations in the dynamic instability of microtubules suggested to contribute to the pathogenesis of Parkinson disease. Here, we describe a direct interaction between LRRK2 and β-tubulin. This interaction is conferred by the LRRK2 Roc domain and is disrupted by the familial R1441G mutation and artificial Roc domain mutations that mimic autophosphorylation. LRRK2 selectively interacts with three β-tubulin isoforms: TUBB, TUBB4, and TUBB6, one of which (TUBB4) is mutated in the movement disorder dystonia type 4 (DYT4). Binding specificity is determined by lysine 362 and alanine 364 of β-tubulin. Molecular modeling was used to map the interaction surface to the luminal face of microtubule protofibrils in close proximity to the lysine 40 acetylation site in α-tubulin. This location is predicted to be poorly accessible within mature stabilized microtubules, but exposed in dynamic microtubule populations. Consistent with this finding, endogenous LRRK2 displays a preferential localization to dynamic microtubules within growth cones, rather than adjacent axonal microtubule bundles. This interaction is functionally relevant to microtubule dynamics, as mouse embryonic fibroblasts derived from LRRK2 knock-out mice display increased microtubule acetylation. Taken together, our data shed light on the nature of the LRRK2-tubulin interaction, and indicate that alterations in microtubule stability caused by changes in LRRK2 might contribute to the pathogenesis of Parkinson disease. PMID:24275654

  15. Development of inducible leucine-rich repeat kinase 2 (LRRK2) cell lines for therapeutics development in Parkinson's disease.

    Science.gov (United States)

    Huang, Liang; Shimoji, Mika; Wang, Juan; Shah, Salim; Kamila, Sukanta; Biehl, Edward R; Lim, Seung; Chang, Allison; Maguire-Zeiss, Kathleen A; Su, Xiaomin; Federoff, Howard J

    2013-10-01

    The pathogenic mechanism(s) contributing to loss of dopamine neurons in Parkinson's disease (PD) remain obscure. Leucine-rich repeat kinase 2 (LRRK2) mutations are linked, as a causative gene, to PD. LRRK2 mutations are estimated to account for 10% of familial and between 1 % and 3 % of sporadic PD. LRRK2 proximate single nucleotide polymorphisms have also been significantly associated with idiopathic/sporadic PD by genome-wide association studies. LRRK2 is a multidomain-containing protein and belongs to the protein kinase super-family. We constructed two inducible dopaminergic cell lines expressing either human-LRRK2-wild-type or human-LRRK2-mutant (G2019S). Phenotypes of these LRRK2 cell lines were examined with respect to cell viability, morphology, and protein function with or without induction of LRRK2 gene expression. The overexpression of G2019S gene promoted (1) low cellular metabolic activity without affecting cell viability, (2) blunted neurite extension, and (3) increased phosphorylation at S910 and S935. Our observations are consistent with reported general phenotypes in LRRK2 cell lines by other investigators. We used these cell lines to interrogate the biological function of LRRK2, to evaluate their potential as a drug-screening tool, and to investigate screening for small hairpin RNA-mediated LRRK2 G2019S gene knockdown as a potential therapeutic strategy. A proposed LRRK2 kinase inhibitor (i.e., IN-1) decreased LRRK2 S910 and S935 phosphorylation in our MN9DLRRK2 cell lines in a dose-dependent manner. Lentivirus-mediated transfer of LRRK2 G2019S allele-specific small hairpin RNA reversed the blunting of neurite extension caused by LRRK2 G2019S overexpression. Taken together, these inducible LRRK2 cell lines are suitable reagents for LRRK2 functional studies, and the screening of potential LRRK2 therapeutics.

  16. Unbiased screen for interactors of leucine-rich repeat kinase 2 supports a common pathway for sporadic and familial Parkinson disease

    Science.gov (United States)

    Beilina, Alexandria; Rudenko, Iakov N.; Kaganovich, Alice; Civiero, Laura; Chau, Hien; Kalia, Suneil K.; Kalia, Lorraine V.; Lobbestael, Evy; Chia, Ruth; Ndukwe, Kelechi; Ding, Jinhui; Nalls, Mike A.; Olszewski, Maciej; Hauser, David N.; Kumaran, Ravindran; Lozano, Andres M.; Baekelandt, Veerle; Greene, Lois E.; Taymans, Jean-Marc; Greggio, Elisa; Cookson, Mark R.; Nalls, Mike A.; Plagnol, Vincent; Martinez, Maria; Hernandez, Dena G; Sharma, Manu; Sheerin, Una-Marie; Saad, Mohamad; Simón-Sánchez, Javier; Schulte, Claudia; Lesage, Suzanne; Sveinbjörnsdóttir, Sigurlaug; Arepalli, Sampath; Barker, Roger; Ben-Shlomo, Yoav; Berendse, Henk W; Berg, Daniela; Bhatia, Kailash; de Bie, Rob M A; Biffi, Alessandro; Bloem, Bas; Bochdanovits, Zoltan; Bonin, Michael; Bras, Jose M; Brockmann, Kathrin; Brooks, Janet; Burn, David J; Charlesworth, Gavin; Chen, Honglei; Chong, Sean; Clarke, Carl E; Cookson, Mark R; Cooper, J Mark; Corvol, Jean Christophe; Counsell, Carl; Damier, Philippe; Dartigues, Jean-François; Deloukas, Panos; Deuschl, Günther; Dexter, David T; van Dijk, Karin D; Dillman, Allissa; Durif, Frank; Dürr, Alexandra; Edkins, Sarah; Evans, Jonathan R; Foltynie, Thomas; Gao, Jianjun; Gardner, Michelle; Gibbs, J Raphael; Goate, Alison; Gray, Emma; Guerreiro, Rita; Gústafsson, Ómar; Harris, Clare; van Hilten, Jacobus J; Hofman, Albert; Hollenbeck, Albert; Holton, Janice; Hu, Michele; Huang, Xuemei; Huber, Heiko; Hudson, Gavin; Hunt, Sarah E; Huttenlocher, Johanna; Illig, Thomas; München, Helmholtz Zentrum; Jónsson, Pálmi V; Lambert, Jean-Charles; Langford, Cordelia; Lees, Andrew; Lichtner, Peter; München, Helmholtz Zentrum; Limousin, Patricia; Lopez, Grisel; Lorenz, Delia; McNeill, Alisdair; Moorby, Catriona; Moore, Matthew; Morris, Huw R; Morrison, Karen E; Mudanohwo, Ese; O’Sullivan, Sean S; Pearson, Justin; Perlmutter, Joel S; Pétursson, Hjörvar; Pollak, Pierre; Post, Bart; Potter, Simon; Ravina, Bernard; Revesz, Tamas; Riess, Olaf; Rivadeneira, Fernando; Rizzu, Patrizia; Ryten, Mina; Sawcer, Stephen; Schapira, Anthony; Scheffer, Hans; Shaw, Karen; Shoulson, Ira; Sidransky, Ellen; Smith, Colin; Spencer, Chris C A; Stefánsson, Hreinn; Steinberg, Stacy; Stockton, Joanna D; Strange, Amy; Talbot, Kevin; Tanner, Carlie M; Tashakkori-Ghanbaria, Avazeh; Tison, François; Trabzuni, Daniah; Traynor, Bryan J; Uitterlinden, André G; Velseboer, Daan; Vidailhet, Marie; Walker, Robert; van de Warrenburg, Bart; Wickremaratchi, Mirdhu; Williams, Nigel; Williams-Gray, Caroline H; Winder-Rhodes, Sophie; Stefánsson, Kári; Hardy, John; Heutink, Peter; Brice, Alexis; Gasser, Thomas; Singleton, Andrew B; Wood, Nicholas W; Chinnery, Patrick F; Arepalli, Sampath; Cookson, Mark R; Dillman, Allissa; Ferrucci, Luigi; Gibbs, J Raphael; Hernandez, Dena G; Johnson, Robert; Longo, Dan L; Majounie, Elisa; Nalls, Michael A; O’Brien, Richard; Singleton, Andrew B; Traynor, Bryan J; Troncoso, Juan; van der Brug, Marcel; Zielke, H Ronald; Zonderman, Alan B

    2014-01-01

    Mutations in leucine-rich repeat kinase 2 (LRRK2) cause inherited Parkinson disease (PD), and common variants around LRRK2 are a risk factor for sporadic PD. Using protein–protein interaction arrays, we identified BCL2-associated athanogene 5, Rab7L1 (RAB7, member RAS oncogene family-like 1), and Cyclin-G–associated kinase as binding partners of LRRK2. The latter two genes are candidate genes for risk for sporadic PD identified by genome-wide association studies. These proteins form a complex that promotes clearance of Golgi-derived vesicles through the autophagy–lysosome system both in vitro and in vivo. We propose that three different genes for PD have a common biological function. More generally, data integration from multiple unbiased screens can provide insight into human disease mechanisms. PMID:24510904

  17. The I2020T Leucine-rich repeat kinase 2 transgenic mouse exhibits impaired locomotive ability accompanied by dopaminergic neuron abnormalities

    Directory of Open Access Journals (Sweden)

    Maekawa Tatsunori

    2012-04-01

    Full Text Available Abstract Background Leucine-rich repeat kinase 2 (LRRK2 is the gene responsible for autosomal-dominant Parkinson’s disease (PD, PARK8, but the mechanism by which LRRK2 mutations cause neuronal dysfunction remains unknown. In the present study, we investigated for the first time a transgenic (TG mouse strain expressing human LRRK2 with an I2020T mutation in the kinase domain, which had been detected in the patients of the original PARK8 family. Results The TG mouse expressed I2020T LRRK2 in dopaminergic (DA neurons of the substantia nigra, ventral tegmental area, and olfactory bulb. In both the beam test and rotarod test, the TG mice exhibited impaired locomotive ability in comparison with their non-transgenic (NTG littermates. Although there was no obvious loss of DA neurons in either the substantia nigra or striatum, the TG brain showed several neurological abnormalities such as a reduced striatal dopamine content, fragmentation of the Golgi apparatus in DA neurons, and an increased degree of microtubule polymerization. Furthermore, the tyrosine hydroxylase-positive primary neurons derived from the TG mouse showed an increased frequency of apoptosis and had neurites with fewer branches and decreased outgrowth in comparison with those derived from the NTG controls. Conclusions The I2020T LRRK2 TG mouse exhibited impaired locomotive ability accompanied by several dopaminergic neuron abnormalities. The TG mouse should provide valuable clues to the etiology of PD caused by the LRRK2 mutation.

  18. Mutant of leucine-rich repeat kinase 2 is not associated with non-motor symptoms in Chinese Parkinson's disease patients.

    Science.gov (United States)

    Hao, Maolin; Pan, Ning; Zhang, Qinghua; Wang, Xiaohong

    2014-01-01

    Non-motor symptoms (NMS) are common in patients with Parkinson's disease (PD). However, little is known about NMS in patients with mutant of leucine-rich repeat kinase 2 (LRRK2). This study aimed to elucidate the relationship between NMS in Chinese PD patients and to ascertain if there were differences in NMS between PD patients and mutant of LRRK2. 200 sporadic PD (sPD) patients were recruited from a Provincial Hospital Affiliated to Shandong University. The Non-motor Symptom Questionnaire (NMSQ) was used to screen for the presence of NMS. A mean of 9.73 NMS (SD=4.53) was reported per patient. Forgetfulness, constipation and daytime sleepiness were found to be the most frequent NMS. No differences were found in 9 domains analysis between PD with and without LRRK2 variants. Non-motor symptoms in PD are too important to remain undetected. There are no Clinical characteristics of NMS tend to be similar between LRRK2 variants carriers and non-carriers in Chinese sPD patients.

  19. Transcriptional responses to loss or gain of function of the leucine-rich repeat kinase 2 (LRRK2) gene uncover biological processes modulated by LRRK2 activity

    Science.gov (United States)

    Nikonova, Elena V.; Xiong, Yulan; Tanis, Keith Q.; Dawson, Valina L.; Vogel, Robert L.; Finney, Eva M.; Stone, David J.; Reynolds, Ian J.; Kern, Jonathan T.; Dawson, Ted M.

    2012-01-01

    Mutations in the leucine-rich repeat kinase 2 gene (LRRK2) are the most common genetic cause of Parkinson's disease (PD) and cause both autosomal dominant familial and sporadic PD. Currently, the physiological and pathogenic activities of LRRK2 are poorly understood. To decipher the biological functions of LRRK2, including the genes and pathways modulated by LRRK2 kinase activity in vivo, we assayed genome-wide mRNA expression in the brain and peripheral tissues from LRRK2 knockout (KO) and kinase hyperactive G2019S (G2019S) transgenic mice. Subtle but significant differences in mRNA expression were observed relative to wild-type (WT) controls in the cortex, striatum and kidney of KO animals, but only in the striatum in the G2019S model. In contrast, robust, consistent and highly significant differences were identified by the direct comparison of KO and G2019S profiles in the cortex, striatum, kidney and muscle, indicating opposite effects on mRNA expression by the two models relative to WT. Ribosomal and glycolytic biological functions were consistently and significantly up-regulated in LRRK2 G2019S compared with LRRK2 KO tissues. Genes involved in membrane-bound organelles, oxidative phosphorylation, mRNA processing and the endoplasmic reticulum were down-regulated in LRRK2 G2019S mice compared with KO. We confirmed the expression patterns of 35 LRRK2-regulated genes using quantitative reverse transcription polymerase chain reaction. These findings provide the first description of the transcriptional responses to genetically modified LRRK2 activity and provide preclinical target engagement and/or pharmacodynamic biomarker strategies for LRRK2 and may inform future therapeutic strategies for LRRK2-associated PD. PMID:21972245

  20. Circulating follistatin in relation to energy metabolism

    DEFF Research Database (Denmark)

    Hansen, Jakob Schiøler; Plomgaard, Peter

    2016-01-01

    Recently, substantial evidence has emerged that the liver contributes significantly to the circulating levels of follistatin and that circulating follistatin is tightly regulated by the glucagon-to-insulin ratio. Both observations are based on investigations of healthy subjects. These novel...... a relation to energy metabolism. In this narrative review, we attempt to reconcile the existing findings on circulating follistatin with the novel concept that circulating follistatin is a liver-derived molecule regulated by the glucagon-to-insulin ratio. The picture emerging is that conditions associated...... with elevated levels of circulating follistatin have a metabolic denominator with decreased insulin sensitivity and/or hyperglucagoneimia....

  1. Plasma follistatin is elevated in patients with type 2 diabetes

    DEFF Research Database (Denmark)

    Hansen, J; Rinnov, Anders Rasmussen; Krogh-Madsen, Rikke

    2013-01-01

    Plasma follistatin is elevated in patients with low-grade inflammation and insulin resistance as observed with polycystic ovary syndrome. In the present study, we evaluated plasma follistatin in patients with type 2 diabetes characterised by low-grade inflammation and assessed the acute effects o...

  2. Exercise induces a marked increase in plasma follistatin: evidence that follistatin is a contraction-induced hepatokine

    DEFF Research Database (Denmark)

    Hansen, Jakob; Brandt, Claus; Nielsen, Anders Rinnov

    2011-01-01

    Follistatin is a member of the TGF-ß super family and inhibits the action of myostatin to regulate skeletal muscle growth. The regulation of follistatin during physical exercise is unclear but may be important because physical activity is a major intervention to prevent age-related sarcopenia...

  3. Circulating follistatin is liver-derived and regulated by the glucagon-to-insulin ratio

    DEFF Research Database (Denmark)

    Hansen, Jakob S; Rutti, Sabine; Arous, Caroline;

    2016-01-01

    increase in circulating follistatin in response to exercise suggests that it may function as an endocrine signal. OBJECTIVE: Here, we assessed origin and regulation of circulating follistatin in humans. Design /interventions: First, we assessed arterial-to-venous difference of follistatin over...

  4. Role of IGF-I in follistatin-induced skeletal muscle hypertrophy

    Science.gov (United States)

    Kalista, Stéphanie; Loumaye, Audrey; Ritvos, Olli; Lause, Pascale; Ferracin, Benjamin; Thissen, Jean-Paul

    2015-01-01

    Follistatin, a physiological inhibitor of myostatin, induces a dramatic increase in skeletal muscle mass, requiring the type 1 IGF-I receptor/Akt/mTOR pathway. The aim of the present study was to investigate the role of IGF-I and insulin, two ligands of the IGF-I receptor, in the follistatin hypertrophic action on skeletal muscle. In a first step, we showed that follistatin increases muscle mass while being associated with a downregulation of muscle IGF-I expression. In addition, follistatin retained its full hypertrophic effect toward muscle in hypophysectomized animals despite very low concentrations of circulating and muscle IGF-I. Furthermore, follistatin did not increase muscle sensitivity to IGF-I in stimulating phosphorylation of Akt but, surprisingly, decreased it once hypertrophy was present. Taken together, these observations indicate that increased muscle IGF-I production or sensitivity does not contribute to the muscle hypertrophy caused by follistatin. Unlike low IGF-I, low insulin, as obtained by streptozotocin injection, attenuated the hypertrophic action of follistatin on skeletal muscle. Moreover, the full anabolic response to follistatin was restored in this condition by insulin but also by IGF-I infusion. Therefore, follistatin-induced muscle hypertrophy requires the activation of the insulin/IGF-I pathway by either insulin or IGF-I. When insulin or IGF-I alone is missing, follistatin retains its full anabolic effect, but when both are deficient, as in streptozotocin-treated animals, follistatin fails to stimulate muscle growth. PMID:26219865

  5. Pre- and Peri-/Post-Compaction Follistatin Treatment Increases In Vitro Production of Cattle Embryos.

    Science.gov (United States)

    Zhenhua, Guo; Rajput, Sandeep K; Folger, Joseph K; Di, Liu; Knott, Jason G; Smith, George W

    2017-01-01

    Our previous studies demonstrated that maternal (oocyte derived) follistatin (FST) expression is positively associated with bovine oocyte competence and exogenous follistatin treatment during the pre-compaction period of development (d 1-3 post insemination) is stimulatory to bovine early embryogenesis in vitro [blastocyst rates and cell numbers/allocation to trophectoderm (TE)]. In the present study, bovine embryos were treated with exogenous follistatin during d 1-3, d 4-7 and d 1-7 post insemination to test the hypothesis that embryotropic effects of exogenous follistatin are specific to the pre-compaction period (d 1-3) of early embryogenesis. Follistatin treatment during d 4-7 (peri-/post-compaction period) of embryo culture increased proportion of embryos reaching blastocyst and expanded blastocyst stage and total cell numbers compared to controls, but blastocyst rates and total cell numbers were lower than observed following d 1-3 (pre-compaction) follistatin treatment. Follistatin supplementation during d 1-7 of embryo culture increased development to blastocyst and expanded blastocyst stages and blastocyst total cell numbers compared to d 1-3 and d 4-7 follistatin treatment and untreated controls. A similar increase in blastocyst CDX2 mRNA and protein (TE cell marker) was observed in response to d 1-3, d 4-7 and d 1-7 follistatin treatment. However, an elevation in blastocyst BMP4 protein (TE cell regulator) was observed in response to d 1-3 and d 1-7, but not d 4-7 (peri-/post-compaction) follistatin treatment. In summary, our study revealed the potential utility of follistatin treatment for increasing the success rate of in vitro embryo production in cattle. Such results also expand our understanding of the embryotropic actions of follistatin and demonstrate that follistatin actions on blastocyst development and cell allocation to the TE layer are not specific to the pre-compaction period.

  6. Regulation of Muscle Mass by Follistatin and Activins

    Science.gov (United States)

    Lee, Se-Jin; Lee, Yun-Sil; Zimmers, Teresa A.; Soleimani, Arshia; Matzuk, Martin M.; Tsuchida, Kunihiro; Cohn, Ronald D.; Barton, Elisabeth R.

    2010-01-01

    Myostatin is a TGF-β family member that normally acts to limit skeletal muscle mass. Follistatin is a myostatin-binding protein that can inhibit myostatin activity in vitro and promote muscle growth in vivo. Mice homozygous for a mutation in the Fst gene have been shown to die immediately after birth but have a reduced amount of muscle tissue, consistent with a role for follistatin in regulating myogenesis. Here, we show that Fst mutant mice exhibit haploinsufficiency, with muscles of Fst heterozygotes having significantly reduced size, a shift toward more oxidative fiber types, an impairment of muscle remodeling in response to cardiotoxin-induced injury, and a reduction in tetanic force production yet a maintenance of specific force. We show that the effect of heterozygous loss of Fst is at least partially retained in a Mstn-null background, implying that follistatin normally acts to inhibit other TGF-β family members in addition to myostatin to regulate muscle size. Finally, we present genetic evidence suggesting that activin A may be one of the ligands that is regulated by follistatin and that functions with myostatin to limit muscle mass. These findings potentially have important implications with respect to the development of therapeutics targeting this signaling pathway to preserve muscle mass and prevent muscle atrophy in a variety of inherited and acquired forms of muscle degeneration. PMID:20810712

  7. A novel role for fibronectin type I domain in the regulation of human hematopoietic cell adhesiveness through binding to follistatin domains of FLRG and follistatin.

    Science.gov (United States)

    Maguer-Satta, Véronique; Forissier, Stéphanie; Bartholin, Laurent; Martel, Sylvie; Jeanpierre, Sandrine; Bachelard, Elodie; Rimokh, Ruth

    2006-02-15

    FLRG and follistatin belong to the family of follistatin proteins involved in the regulation of various biological effects, such as hematopoiesis, mediated by their binding to activin and BMP, both members of the TGFbeta family. To further characterize the function of FLRG, we searched for other possible functional partners using a yeast two-hybrid screen. We identified human fibronectin as a new partner for both FLRG and follistatin. We also demonstrated that their physical interaction is mediated by type I motifs of fibronectin and follistatin domains. We then analyzed the biological consequences of these protein interactions on the regulation of hematopoiesis. For the first time, we associated a biological effect with the regulation of human hematopoietic cell adhesiveness of both the type I motifs of fibronectin and the follistatin domains of FLRG and follistatin. Indeed, we observed a significant and specific dose-dependent increase of cell adhesion to fibronectin in the presence of FLRG or follistatin, using either a human hematopoietic cell line or primary cells. In particular, we observed a significantly increased adhesion of immature hematopoietic precursors (CFC, LTC-IC). Altogether these results highlight a new mechanism by which FLRG and follistatin regulate human hematopoiesis.

  8. Tissue absence initiates regeneration through follistatin-mediated inhibition of activin signaling.

    Science.gov (United States)

    Gaviño, Michael A; Wenemoser, Danielle; Wang, Irving E; Reddien, Peter W

    2013-09-10

    Regeneration is widespread, but mechanisms that activate regeneration remain mysterious. Planarians are capable of whole-body regeneration and mount distinct molecular responses to wounds that result in tissue absence and those that do not. A major question is how these distinct responses are activated. We describe a follistatin homolog (Smed-follistatin) required for planarian regeneration. Smed-follistatin inhibition blocks responses to tissue absence but does not prevent normal tissue turnover. Two activin homologs (Smed-activin-1 and Smed-activin-2) are required for the Smed-follistatin phenotype. Finally, Smed-follistatin is wound-induced and expressed at higher levels following injuries that cause tissue absence. These data suggest that Smed-follistatin inhibits Smed-Activin proteins to trigger regeneration specifically following injuries involving tissue absence and identify a mechanism critical for regeneration initiation, a process important across the animal kingdom. DOI:http://dx.doi.org/10.7554/eLife.00247.001.

  9. Role of IGF-I in follistatin-induced skeletal muscle hypertrophy.

    Science.gov (United States)

    Barbé, Caroline; Kalista, Stéphanie; Loumaye, Audrey; Ritvos, Olli; Lause, Pascale; Ferracin, Benjamin; Thissen, Jean-Paul

    2015-09-15

    Follistatin, a physiological inhibitor of myostatin, induces a dramatic increase in skeletal muscle mass, requiring the type 1 IGF-I receptor/Akt/mTOR pathway. The aim of the present study was to investigate the role of IGF-I and insulin, two ligands of the IGF-I receptor, in the follistatin hypertrophic action on skeletal muscle. In a first step, we showed that follistatin increases muscle mass while being associated with a downregulation of muscle IGF-I expression. In addition, follistatin retained its full hypertrophic effect toward muscle in hypophysectomized animals despite very low concentrations of circulating and muscle IGF-I. Furthermore, follistatin did not increase muscle sensitivity to IGF-I in stimulating phosphorylation of Akt but, surprisingly, decreased it once hypertrophy was present. Taken together, these observations indicate that increased muscle IGF-I production or sensitivity does not contribute to the muscle hypertrophy caused by follistatin. Unlike low IGF-I, low insulin, as obtained by streptozotocin injection, attenuated the hypertrophic action of follistatin on skeletal muscle. Moreover, the full anabolic response to follistatin was restored in this condition by insulin but also by IGF-I infusion. Therefore, follistatin-induced muscle hypertrophy requires the activation of the insulin/IGF-I pathway by either insulin or IGF-I. When insulin or IGF-I alone is missing, follistatin retains its full anabolic effect, but when both are deficient, as in streptozotocin-treated animals, follistatin fails to stimulate muscle growth. Copyright © 2015 the American Physiological Society.

  10. Serum activin A and follistatin levels in gestational diabetes and the association of the Activin A-Follistatin system with anthropometric parameters in offspring.

    Directory of Open Access Journals (Sweden)

    Silvia Näf

    Full Text Available CONTEXT: The Activin A-Follistatin system has emerged as an important regulator of lipid and glucose metabolism with possible repercussions on fetal growth. OBJECTIVE: To analyze circulating activin A, follistatin and follistatin-like-3 (FSTL3 levels and their relationship with glucose metabolism in pregnant women and their influence on fetal growth and neonatal adiposity. DESIGN AND METHODS: A prospective cohort was studied comprising 207 pregnant women, 129 with normal glucose tolerance (NGT and 78 with gestational diabetes mellitus (GDM and their offspring. Activin A, follistatin and FSTL3 levels were measured in maternal serum collected in the early third trimester of pregnancy. Serial fetal ultrasounds were performed during the third trimester to evaluate fetal growth. Neonatal anthropometry was measured to assess neonatal adiposity. RESULTS: Serum follistatin levels were significantly lower in GDM than in NGT pregnant women (8.21±2.32 ng/mL vs 9.22±3.41, P = 0.012 whereas serum FSTL3 and activin A levels were comparable between the two groups. Serum follistatin concentrations were negatively correlated with HOMA-IR and positively with ultrasound growth parameters such as fractional thigh volume estimation in the middle of the third trimester and percent fat mass at birth. Also, in the stepwise multiple linear regression analysis serum follistatin levels were negatively associated with HOMA-IR (β = -0.199, P = 0.008 and the diagnosis of gestational diabetes (β = -0.138, P = 0.049. Likewise, fractional thigh volume estimation in the middle of third trimester and percent fat mass at birth were positively determined by serum follistatin levels (β = 0.214, P = 0.005 and β = 0.231, P = 0.002, respectively. CONCLUSIONS: Circulating follistatin levels are reduced in GDM compared with NGT pregnant women and they are positively associated with fetal growth and neonatal adiposity. These data suggest a role of

  11. Follistatin-like 3 across gestation in preeclampsia and uncomplicated pregnancies among lean and obese women.

    Science.gov (United States)

    Founds, Sandra A; Ren, Dianxu; Roberts, James M; Jeyabalan, Arun; Powers, Robert W

    2015-04-01

    The purpose of this study was to examine circulating maternal follistatin-like 3 (FSTL-3) by gestational age and obesity in pregnancy and preeclampsia. FSTL-3 was quantified in maternal plasma collected in each trimester from prepregnancy body mass index-determined groups: 15 lean and 24 obese controls and 20 obese women who developed preeclampsia. Repeated measures mixed models and logistic regression were conducted (P ≤ .05). FSTL-3 was not related to maternal adiposity. FSTL-3 changed across pregnancy in lean controls and obese preeclampsia but not in obese controls. FSTL-3 was higher in preeclampsia in the second trimester compared to lean controls and in the third trimester compared to both control groups. Elevated FSTL-3 at mid-gestation was associated with an increased odds of preeclampsia (odds ratio 3.15; 95% confidence interval 1.19-8.36; P = .02). Elevated FSTL-3 concentrations were attributable to preeclampsia and were associated with increased likelihood of later developing preeclampsia, suggesting further study as a biomarker prior to clinically evident disease. © The Author(s) 2014.

  12. Follistatin-mediated skeletal muscle hypertrophy is regulated by Smad3 and mTOR independently of myostatin

    Science.gov (United States)

    Winbanks, Catherine E.; Weeks, Kate L.; Thomson, Rachel E.; Sepulveda, Patricio V.; Beyer, Claudia; Qian, Hongwei; Chen, Justin L.; Allen, James M.; Lancaster, Graeme I.; Febbraio, Mark A.; Harrison, Craig A.; McMullen, Julie R.; Chamberlain, Jeffrey S.

    2012-01-01

    Follistatin is essential for skeletal muscle development and growth, but the intracellular signaling networks that regulate follistatin-mediated effects are not well defined. We show here that the administration of an adeno-associated viral vector expressing follistatin-288aa (rAAV6:Fst-288) markedly increased muscle mass and force-producing capacity concomitant with increased protein synthesis and mammalian target of rapamycin (mTOR) activation. These effects were attenuated by inhibition of mTOR or deletion of S6K1/2. Furthermore, we identify Smad3 as the critical intracellular link that mediates the effects of follistatin on mTOR signaling. Expression of constitutively active Smad3 not only markedly prevented skeletal muscle growth induced by follistatin but also potently suppressed follistatin-induced Akt/mTOR/S6K signaling. Importantly, the regulation of Smad3- and mTOR-dependent events by follistatin occurred independently of overexpression or knockout of myostatin, a key repressor of muscle development that can regulate Smad3 and mTOR signaling and that is itself inhibited by follistatin. These findings identify a critical role of Smad3/Akt/mTOR/S6K/S6RP signaling in follistatin-mediated muscle growth that operates independently of myostatin-driven mechanisms. PMID:22711699

  13. Keratinocyte-derived follistatin regulates epidermal homeostasis and wound repair

    Science.gov (United States)

    Antsiferova, Maria; Klatte, Jennifer E; Bodó, Enikö; Paus, Ralf; Jorcano, José L; Matzuk, Martin M; Werner, Sabine; Kögel, Heidi

    2014-01-01

    Activin is a growth and differentiation factor that controls development and repair of several tissues and organs. Transgenic mice overexpressing activin in the skin were characterized by strongly enhanced wound healing, but also by excessive scarring. In this study, we explored the consequences of targeted activation of activin in the epidermis and hair follicles by generation of mice lacking the activin antagonist follistatin in keratinocytes. We observed enhanced keratinocyte proliferation in the tail epidermis of these animals. After skin injury, an earlier onset of keratinocyte hyperproliferation at the wound edge was observed in the mutant mice, resulting in an enlarged hyperproliferative epithelium. However, granulation tissue formation and scarring were not affected. These results demonstrate that selective activation of activin in the epidermis enhances reepithelialization without affecting the quality of the healed wound. PMID:19079322

  14. Follistatin concentrations in maternal and fetal fluids during the oestrous cycle, gestation and parturition in Merino sheep.

    Science.gov (United States)

    McFarlane, J R; Xia, Y; O'Shea, T; Hayward, S; O'Connor, A E; De Kretser, D M

    2002-08-01

    The aim of this study was to investigate the changes in follistatin, an activin binding protein, during the oestrous cycle, gestation and parturition in ewes using a radioimmunoassay for total follistatin, which uses dissociating reagents to remove the interference of activin. Follistatin concentrations remained unchanged (2.7 +/- 0.2 ng ml(-1)) during the oestrous cycle and decreased as pregnancy progressed. Follistatin concentrations in allantoic fluid also decreased during gestation, whereas in amniotic fluid follistatin concentrations reached a peak at day 75 of gestation (9.8 ng ml(-1)) and had decreased to 4.4 ng ml(-1) at day 140. Follistatin concentrations in fetal blood (7.0 +/- 0.5 ng ml(-1)) did not change from day 50 to day 140 of gestation but were significantly higher than in matched maternal samples (3.1 +/- 0.3 ng ml(-1)). Circulating follistatin in ewes was significantly increased on the day of parturition (5.6 +/- 0.6 ng ml(-1)) compared with the days before parturition (2.7 +/- 0.4 ng ml(-1)), but had decreased by day 2 after birth. Blood samples from newborn lambs showed that plasma follistatin concentration (13.4 +/- 2.3 ng ml(-1)) was significantly higher than that of the mothers and remained high for at least 7 days after birth. These data support previous studies of the human menstrual cycle indicating that follistatin is not an endocrine signal from the ovary; however, in contrast to human pregnancies, follistatin concentrations in sheep decreased and become high only after or during parturition. This difference observed between species may reflect different physiological effects of follistatin or may be the result of measurement of different isoforms.

  15. Casein kinase-2 structure-function relationship

    DEFF Research Database (Denmark)

    Boldyreff, B; Meggio, F; Pinna, L A

    1992-01-01

    Nine mutants of human casein kinase-2 beta subunit have been created and assayed for their ability to assemble with the catalytic alpha subunit to give, at a 1:1 molar ratio, a fully competent CK-2 holoenzyme as judged by the following criteria: 1) the generation of an active heterotetrameric form...... of CK-2 exhibiting the expected sedimentation coefficient and 2) the enhancement of catalytic activity of CK-2 alpha. Extended deletions of 71 and 44 residues from the C-terminal end, but not a 7 residue deletion (including the cdc2 phosphorylation site) prevent both reconstitution of the holoenzyme and......-70 sequence give rise to mutants that still assemble with the alpha subunit to give a tetrameric holoenzyme. However, in the case of the mutants A57,59, A63,64, A59-61,63,64 in vitro assembly with the CK-2 alpha subunit was not complete. There were also intermediate complexes, free alpha-subunit and beta...

  16. Modulation of follistatin and myostatin propeptide by anabolic steroids and gender.

    Science.gov (United States)

    Mosler, S; Geisler, S; Hengevoss, J; Schiffer, T; Piechotta, M; Adler, M; Diel, P

    2013-07-01

    The purpose of this pilot study was to investigate the impact of training, anabolic steroids and endogenous hormones on myostatin-interacting proteins in order to identify manipulations of myostatin signalling. To identify whether analysis of the myostatin interacting proteins follistatin and myostatin propeptide is suitable to detect the abuse of anabolic steroids, their serum concentrations were monitored in untrained males, bodybuilders using anabolic steroids and natural bodybuilders. In addition, we analysed follistatin and myostatin propeptide serum proteins in females during menstrual cycle. Our results showed increased follistatin concentrations in response to anabolic steroids. Furthermore, variations of sex steroid levels during the menstrual cycle had no impact on the expression of follistatin and myostatin propetide. In addition, we identified gender differences in the basal expression of the investigated proteins. In general, follistatin and myostatin propeptide concentrations were relatively stable within the same individual both in males and females. In conclusion, the current findings provide an insight into gender differences in myostatin-interacting proteins and their regulation in response to anabolic steroids and endogenous hormones. Therefore our data provide new aspects for the development of doping prevention strategies.

  17. Substantial Increases Occur in Serum Activins and Follistatin during Lung Transplantation.

    Directory of Open Access Journals (Sweden)

    David M de Kretser

    Full Text Available Lung transplantation exposes the donated lung to a period of anoxia. Re-establishing the circulation after ischemia stimulates inflammation causing organ damage. Since our published data established that activin A is a key pro-inflammatory cytokine, we assessed the roles of activin A and B, and their binding protein, follistatin, in patients undergoing lung transplantation.Sera from 46 patients participating in a published study of remote ischemia conditioning in lung transplantation were used. Serum activin A and B, follistatin and 11 other cytokines were measured in samples taken immediately after anaesthesia induction, after remote ischemia conditioning or sham treatment undertaken just prior to allograft reperfusion and during the subsequent 24 hours.Substantial increases in serum activin A, B and follistatin occurred after the baseline sample, taken before anaesthesia induction and peaked immediately after the remote ischemia conditioning/sham treatment. The levels remained elevated 15 minutes after lung transplantation declining thereafter reaching baseline 2 hours post-transplant. Activin B and follistatin concentrations were lower in patients receiving remote ischemia conditioning compared to sham treated patients but the magnitude of the decrease did not correlate with early transplant outcomes.We propose that the increases in the serum activin A, B and follistatin result from a combination of factors; the acute phase response, the reperfusion response and the use of heparin-based anti-coagulants.

  18. Follistatin is critical for mouse uterine receptivity and decidualization.

    Science.gov (United States)

    Fullerton, Paul T; Monsivais, Diana; Kommagani, Ramakrishna; Matzuk, Martin M

    2017-06-13

    Embryo implantation remains a significant challenge for assisted reproductive technology, with implantation failure occurring in ∼50% of in vitro fertilization attempts. Understanding the molecular mechanisms underlying uterine receptivity will enable the development of new interventions and biomarkers. TGFβ family signaling in the uterus is critical for establishing and maintaining pregnancy. Follistatin (FST) regulates TGFβ family signaling by selectively binding TGFβ family ligands and sequestering them. In humans, FST is up-regulated in the decidua during early pregnancy, and women with recurrent miscarriage have lower endometrial expression of FST during the luteal phase. Because global knockout of Fst is perinatal lethal in mice, we generated a conditional knockout (cKO) of Fst in the uterus using progesterone receptor-cre to study the roles of uterine Fst during pregnancy. Uterine Fst-cKO mice demonstrate severe fertility defects and deliver only 2% of the number of pups delivered by control females. In Fst-cKO mice, the uterine luminal epithelium does not respond properly to estrogen and progesterone signals and remains unreceptive to embryo attachment by continuing to proliferate and failing to differentiate. The uterine stroma of Fst-cKO mice also responds poorly to artificial decidualization, with lower levels of proliferation and differentiation. In the absence of uterine FST, activin B expression and signaling are up-regulated, and bone morphogenetic protein (BMP) signals are impaired. Our findings support a model in which repression of activin signaling by FST enables uterine receptivity by preserving critical BMP signaling.

  19. Regulation of brown adipocyte metabolism by myostatin/follistatin signaling

    Directory of Open Access Journals (Sweden)

    Rajan eSingh

    2014-10-01

    Full Text Available Obesity develops from perturbations of cellular bioenergetics, when energy uptake exceeds energy expenditure, and represents a major risk factor for the development of type 2 diabetes, dyslipidemia, cardiovascular disease, cancer, and other conditions. Brown adipose tissue (BAT has long been known to dissipate energy as heat and contribute to energy expenditure, but its presence and physiological role in adult human physiology has been questioned for years. Recent demonstrations of metabolically active brown fat depots in adult humans have revolutionized current therapeutic approaches for obesity-related diseases. The balance between white adipose tissue (WAT and BAT affects the systemic energy balance and is widely believed to be the key determinant in the development of obesity and related metabolic diseases. Members of the transforming growth factor-beta (TGF-β superfamily play an important role in regulating overall energy homeostasis by modulation of brown adipocyte characteristics. Inactivation of TGF-β/Smad3/myostatin (Mst signaling promotes browning of white adipocytes, increases mitochondrial biogenesis and protects mice from diet-induced obesity, suggesting the need for development of a novel class of TGF-β/Mst antagonists for the treatment of obesity and related metabolic diseases. We recently described an important role of follistatin (Fst, a soluble glycoprotein that is known to bind and antagonize Mst actions, during brown fat differentiation and the regulation of cellular metabolism. Here we highlight various investigations performed using different in vitro and in vivo models to support the contention that targeting TGF-β/Mst signaling enhances brown adipocyte functions and regulates energy balance, reducing insulin resistance and curbing the development of obesity and diabetes.

  20. Follistatin is a novel biomarker for lung adenocarcinoma in humans.

    Directory of Open Access Journals (Sweden)

    Fangfang Chen

    Full Text Available Follistatin (FST, a single chain glycoprotein, is originally isolated from follicular fluid of ovary. Previous studies have revealed that serum FST served as a biomarker for pregnancy and ovarian mucinous tumor. However, whether FST can serve as a biomarker for diagnosis in lung adenocarcinoma of humans remains unclear.The study population consisted of 80 patients with lung adenocarcinoma, 40 patients with ovarian adenocarcinoma and 80 healthy subjects. Serum FST levels in patients and healthy subjects were measured using ELISA. The results showed that the positive ratio of serum FST levels was 51.3% (41/80, which was comparable to the sensitivity of FST in 40 patients with ovarian adenocarcinoma (60%, 24/40 using the 95th confidence interval for the healthy subject group as the cut-off value. FST expressions in lung adenocarcinoma were examined by immunohistochemical staining, we found that lung adenocarcinoma could produce FST and there was positive correlation between the level of FST expression and the differential degree of lung adenocarcinoma. Furthermore, the results showed that primary cultured lung adenocarcinoma cells could secrete FST, while cells derived from non-tumor lung tissues almost did not produce FST. In addition, the results of CCK8 assay and flow cytometry showed that using anti-FST monoclonal antibody to neutralize endogenous FST significantly augmented activin A-induced lung adenocarcinoma cells apoptosis.These data indicate that lung adenocarcinoma cells can secret FST into serum, which may be beneficial to the survival of adenocarcinoma cells by neutralizing activin A action. Thus, FST can serve as a promising biomarker for diagnosis of lung adenocarcinoma and a useful biotherapy target for lung adenocarcinoma.

  1. Exercise does not influence myostatin and follistatin messenger RNA expression in young women.

    Science.gov (United States)

    Jensky, Nicole E; Sims, Jennifer K; Dieli-Conwright, Christina M; Sattler, Fred R; Rice, Judd C; Schroeder, E Todd

    2010-02-01

    We evaluated changes in myostatin, follistatin, and MyoD messenger RNA (mRNA) gene expression using eccentric exercise (EE) and concentric exercise (CE) as probes to better understand the mechanisms of muscle hypertrophy in young women. Twelve women performed single-leg maximal eccentric (n = 6, 25 +/- 1 years, 59 +/- 7 kg) or concentric (n = 6, 24 +/- 1 years, 65 +/- 7 kg) isokinetic knee extension exercise for 7 sessions. Muscle biopsies were taken from the vastus lateralis at baseline, 8 hours after the first exercise session, and 8 hours after the seventh exercise session. In the EE group, there were no changes in myostatin and follistatin (p > or = 0.17); however, MyoD expression increased after 1 exercise bout (p = 0.02). In the CE group, there were no changes in myostatin, follistatin, or MyoD mRNA gene expression (p > or = 0.07). Differences between the EE and CE groups were not significant (p > or = 0.05). These data suggest that a single bout or multiple bouts of maximal EE or CE may not significantly alter myostatin or follistatin mRNA gene expression in young women. However, MyoD mRNA expression seems to increase only after EE.

  2. Differential expression of follistatin and FLRG in human breast proliferative disorders

    Directory of Open Access Journals (Sweden)

    Amaral Vania F

    2009-09-01

    Full Text Available Abstract Background Activins are growth factors acting on cell growth and differentiation. Activins are expressed in high grade breast tumors and they display an antiproliferative effect inducing G0/G1 cell cycle arrest in breast cancer cell lines. Follistatin and follistatin- related gene (FLRG bind and neutralize activins. In order to establish if these activin binding proteins are involved in breast tumor progression, the present study evaluated follistatin and FLRG pattern of mRNA and protein expression in normal human breast tissue and in different breast proliferative diseases. Methods Paraffin embedded specimens of normal breast (NB - n = 8; florid hyperplasia without atypia (FH - n = 17; fibroadenoma (FIB - n = 17; ductal carcinoma in situ (DCIS - n = 10 and infiltrating ductal carcinoma (IDC - n = 15 were processed for follistatin and FLRG immunohistochemistry and in situ hybridization. The area and intensity of chromogen epithelial and stromal staining were analyzed semi-quantitatively. Results Follistatin and FLRG were expressed both in normal tissue and in all the breast diseases investigated. Follistatin staining was detected in the epithelial cytoplasm and nucleus in normal, benign and malignant breast tissue, with a stronger staining intensity in the peri-alveolar stromal cells of FIB at both mRNA and protein levels. Conversely, FLRG area and intensity of mRNA and protein staining were higher both in the cytoplasm and in the nucleus of IDC epithelial cells when compared to NB, while no significant changes in the stromal intensity were observed in all the proliferative diseases analyzed. Conclusion The present findings suggest a role for follistatin in breast benign disease, particularly in FIB, where its expression was increased in stromal cells. The up regulation of FLRG in IDC suggests a role for this protein in the progression of breast malignancy. As activin displays an anti-proliferative effect in human mammary cells, the

  3. Inhibin subunits, follistatin and activin receptors in the human teratocarcinoma cell line Tera-2.

    Science.gov (United States)

    de Jong, F H; de Winter, J P; Wesseling, J G; Timmerman, M A; van Genesen, S; van den Eijnden-van Raaij, A J; van Zoelen, E J

    1993-05-14

    The expression of mRNAs for inhibin subunits was studied in the human teratocarcinoma cell line Tera-2 clone 13 before and after differentiation with retinoic acid (RA). Both alpha- and beta B-subunits of inhibin were expressed. Subsequently, inhibin bio- and immunoactivity in the conditioned media of the Tera-2 cells were determined by studying the release of follicle-stimulating hormone from rat pituitary cells, by immunoassay and by immunoprecipitation using inhibin alpha- and beta B-subunit specific antibodies. Strikingly dissimilar high bio- and low immuno-activities were found. The ensuing hypothesis that the high bioactivity might be due to the presence of the activin-binding protein follistatin was confirmed by immunoprecipitation of 34 and 37 kDa labelled proteins, using a polyclonal anti-follistatin antiserum after culture of the Tera-2 cells with [35S]-methionine. Furthermore, expression of activin receptor types II and IIB mRNA was found in the cells. Addition of 5 microM RA to monolayer cultures of Tera-2 cells resulted in differentiation to flat endoderm-like cells and caused a slight suppression of the expression of the mRNA encoding the inhibin alpha- and beta B-subunits. The expression of follistatin and activin receptor type IIB was strongly suppressed, whereas the expression of the activin receptor type II was not affected. We conclude that Tera-2 cells secrete follistatin and express inhibin subunits and activin receptors differentially during RA-induced differentiation. The role of the decreased expression of follistatin and activin receptor IIB mRNA after addition of RA in the mechanism of RA-induced differentiation remains to be elucidated.

  4. Amygdalin isolated from Semen Persicae (Tao Ren) extracts induces the expression of follistatin in HepG2 and C2C12 cell lines

    OpenAIRE

    Yang, Chuanbin; Li, Xuechen; Rong, Jianhui

    2014-01-01

    Background The Chinese medicine formulation ISF-1 (also known as Bu-Yang-Huan-Wu-Tang) for post-stroke rehabilitation could increase the expression of growth-regulating protein follistatin by approximately 4-fold. This study aims to identify the active compounds of ISF-1 for the induction of follistatin expression. Methods Active compounds in ISF-1 responsible for induction of follistatin were identified by a bioactivity-guided fractionation procedure involving liquid-liquid extraction, HPLC ...

  5. Evaluation of follistatin as a therapeutic in models of skeletal muscle atrophy associated with denervation and tenotomy.

    Science.gov (United States)

    Sepulveda, Patricio V; Lamon, Séverine; Hagg, Adam; Thomson, Rachel E; Winbanks, Catherine E; Qian, Hongwei; Bruce, Clinton R; Russell, Aaron P; Gregorevic, Paul

    2015-12-11

    Follistatin is an inhibitor of TGF-β superfamily ligands that repress skeletal muscle growth and promote muscle wasting. Accordingly, follistatin has emerged as a potential therapeutic to ameliorate the deleterious effects of muscle atrophy. However, it remains unclear whether the anabolic effects of follistatin are conserved across different modes of non-degenerative muscle wasting. In this study, the delivery of a recombinant adeno-associated viral vector expressing follistatin (rAAV:Fst) to the hind-limb musculature of mice two weeks prior to denervation or tenotomy promoted muscle hypertrophy that was sufficient to preserve muscle mass comparable to that of untreated sham-operated muscles. However, administration of rAAV:Fst to muscles at the time of denervation or tenotomy did not prevent subsequent muscle wasting. Administration of rAAV:Fst to innervated or denervated muscles increased protein synthesis, but markedly reduced protein degradation only in innervated muscles. Phosphorylation of the signalling proteins mTOR and S6RP, which are associated with protein synthesis, was increased in innervated muscles administered rAAV:Fst, but not in treated denervated muscles. These results demonstrate that the anabolic effects of follistatin are influenced by the interaction between muscle fibres and motor nerves. These findings have important implications for understanding the potential efficacy of follistatin-based therapies for non-degenerative muscle wasting.

  6. Expression of casein kinase 2 during mouse embryogenesis

    DEFF Research Database (Denmark)

    Mestres, P; Boldyreff, B; Ebensperger, C;

    1994-01-01

    This paper deals with the expression and distribution of casein kinase 2 (CK-2) subunits in mouse embryos at different developmental stages. Expression was investigated at the mRNA level of CK-2 alpha- and beta-subunits by in situ hybridization and distribution at the protein level by immunohisto......This paper deals with the expression and distribution of casein kinase 2 (CK-2) subunits in mouse embryos at different developmental stages. Expression was investigated at the mRNA level of CK-2 alpha- and beta-subunits by in situ hybridization and distribution at the protein level...

  7. Janus Kinase 2: An Epigenetic 'Writer' that Activates Leukemogenic Genes

    Institute of Scientific and Technical Information of China (English)

    Jin He; Yi Zhang

    2010-01-01

    @@ Activation of Janus kinase 2 (JAK2) plays a critical role in normal hematopoiesis and leukemogenesis. Dawson et al. (2009; JAK2 phosphorylates histone H3Y41 and excludes Hplalpha from chromatin. Nature 461, 819-822) report that JAK2 performs this function by displacing the heterochromatin protein HP1α from chromatin through phosphorylation of histone H3.

  8. Exercise Does Not Influence Myostatin and Follistatin mRNA expression in Young Women

    OpenAIRE

    Jensky, Nicole E.; Sims, Jennifer K.; Dieli-Conwright, Christina M.; Sattler, Fred R.; Rice, Judd C.; Schroeder, E. Todd

    2010-01-01

    We evaluated changes in myostatin, follistatin and MyoD mRNA gene expression using eccentric exercise (EE) and concentric exercise (CE) as probes to better understand the mechanisms of muscle hypertrophy in young women. Twelve women performed single-leg maximal eccentric (n=6, 25±1yr, 59±7kg) or concentric (n=6, 24±1 yr, 65±7kg) isokinetic knee extension exercise for 7 sessions. Muscle biopsies were taken from the vastus lateralis at baseline, 8hrs after the first exercise session, and 8hrs a...

  9. Effects of the Activin A–Follistatin System on Myocardial Cell Apoptosis through the Endoplasmic Reticulum Stress Pathway in Heart Failure

    Science.gov (United States)

    Liu, Miao; Mao, Cuiying; Li, Jiayu; Han, Fanglei; Yang, Ping

    2017-01-01

    Background: A previous study suggested that activin A inhibited myocardial cell apoptosis. This study thus aimed to explore the effects of the activin A–follistatin system on myocardial cell apoptosis in heart failure (HF) rats in order to determine whether or not the mechanism operates through the endoplasmic reticulum stress (ERS) pathway. Methods: Myocardial infarction (MI) by vascular deprivation was used to induce HF. The enzyme-linked immunosorbent assay was used to detect activin A, follistatin and brain natriuretic peptide (BNP) contents in serum. Immunohistochemical staining for activin A, follistatin, CCAAT-enhancer-binding protein (C/EBP) homologous protein (CHOP) and caspase-3 was performed on the myocardial tissue. The activin A-stimulated apoptosis of H9c2 cells was tested by flow cytometry. Western blot was used to detect the expression levels of activin A, follistatin and ERS-related proteins. Results: It was found that the high expression of activin A could cause activin A–follistatin system imbalance, inducing myocardial cell apoptosis via ERS in vivo. When HF developed to a certain stage, the expression of follistatin was upregulated to antagonize the expression of activin A. Activin A inhibited cardiomyocyte apoptosis with a low concentration and promoted apoptosis with a high concentration in vitro, also via ERS. Conclusion: Activin A–follistatin system participated in ERS-mediated myocardial cell apoptosis in HF. PMID:28208629

  10. Exercise-Induced Secretion of FGF21 and Follistatin Are Blocked by Pancreatic Clamp and Impaired in Type 2 Diabetes

    DEFF Research Database (Denmark)

    Hansen, Jakob Schiøler; Pedersen, Bente Klarlund; Xu, Guowang

    2016-01-01

    CONTEXT: Hepatokines have emerged as liver-derived hormone-like factors. Plasma fibroblast growth factor (FGF)-21 and follistatin increase with a high glucagon to insulin ratio and exercise, and resting levels are elevated in patients with type 2 diabetes (T2D). OBJECTIVE: The objective of the st...

  11. Uterine-embryonic interaction in pit : activin, follistatin, and activin receptor II in uterus and embryo during early gestation

    NARCIS (Netherlands)

    Pavert, van de S.A.; Boerjan, M.L.; Stroband, H.W.J.; Taverne, M.A.M.; Hurk, van der R.

    2001-01-01

    The mRNA expression patterns of activin A and follistatin in the uterus and embryo, the mRNA expression of the activin receptor II in the embryo, and the localization in the uterus of the immunoreactive activin A and the receptor II proteins in the uterus were examined at gestation days 7-12 after o

  12. Follistatin288 Regulates Germ Cell Cyst Breakdown and Primordial Follicle Assembly in the Mouse Ovary.

    Science.gov (United States)

    Wang, Zhengpin; Niu, Wanbao; Wang, Yijing; Teng, Zhen; Wen, Jia; Xia, Guoliang; Wang, Chao

    2015-01-01

    In mammals, the primordial follicle pool represents the entire reproductive potential of a female. The transforming growth factor-β (TGF-β) family member activin (ACT) contributes to folliculogenesis, although the exact mechanism is not known. The role of FST288, the strongest ACT-neutralizing isoform of follistatin (FST), during cyst breakdown and primordial follicle formation in the fetal mice ovary was assessed using an in vitro culture system. FST was continuously expressed in the oocytes as well as the cuboidal granulosa cells of growing follicles in perinatal mouse ovaries. Treatment with FST288 delayed germ cell nest breakdown, particularly near the periphery of the ovary, and dramatically decreased the percentage of primordial follicles. In addition, there was a dramatic decrease in proliferation of granulosa cells and somatic cell expression of Notch signaling was impaired. In conclusion, FST288 impacts germ cell nest breakdown and primordial follicle assembly by inhibiting somatic cell proliferation.

  13. Follistatin288 Regulates Germ Cell Cyst Breakdown and Primordial Follicle Assembly in the Mouse Ovary.

    Directory of Open Access Journals (Sweden)

    Zhengpin Wang

    Full Text Available In mammals, the primordial follicle pool represents the entire reproductive potential of a female. The transforming growth factor-β (TGF-β family member activin (ACT contributes to folliculogenesis, although the exact mechanism is not known. The role of FST288, the strongest ACT-neutralizing isoform of follistatin (FST, during cyst breakdown and primordial follicle formation in the fetal mice ovary was assessed using an in vitro culture system. FST was continuously expressed in the oocytes as well as the cuboidal granulosa cells of growing follicles in perinatal mouse ovaries. Treatment with FST288 delayed germ cell nest breakdown, particularly near the periphery of the ovary, and dramatically decreased the percentage of primordial follicles. In addition, there was a dramatic decrease in proliferation of granulosa cells and somatic cell expression of Notch signaling was impaired. In conclusion, FST288 impacts germ cell nest breakdown and primordial follicle assembly by inhibiting somatic cell proliferation.

  14. Obesity and Low-Grade Inflammation Increase Plasma Follistatin-Like 3 in Humans

    DEFF Research Database (Denmark)

    Brandt, Claus; Pedersen, Maria; Rinnov, Anders;

    2014-01-01

    BACKGROUND: Rodent models suggest that follistatin-like 3 (fstl3) is associated with diabetes and obesity. In humans, plasma fstl3 is reduced with gestational diabetes. In vitro, TNF-α induces fstl3 secretion, which suggests a link to inflammation. OBJECTIVE: To elucidate the association between...... plasma fstl3 and obesity, insulin resistance, and low-grade inflammation in humans. STUDY DESIGN: Plasma fstl3 levels were determined in a cross-sectional study including three groups: patients with type 2 diabetes, impaired glucose tolerance, and healthy controls. In addition, lipopolysaccharide (LPS......), TNF-α, or interleukin-6 (IL-6) as well as a hyperinsulinemic euglycemic clamp were used to examine if plasma fstl3 was acutely regulated in humans. RESULTS: Plasma fstl3 was increased in obese subjects independent of glycemic state. Moreover, plasma fstl3 was positively correlated with fat mass...

  15. Follistatin like 1 Regulates Hypertrophy in Heart Failure with Preserved Ejection Fraction

    Science.gov (United States)

    Wilson, Richard M.; Essick, Eric E.; Fowler, Conor T.; Nakamura, Kazuto; van den Hoff, Maurice; Ouchi, Noriyuki; Sam, Flora

    2016-01-01

    Objective We sought to determine whether Fstl1 plays a role in the regulation of cardiac hypertrophy in HFpEF. Background Heart failure (HF) with preserved ejection fraction (HFpEF), accounts for ~50% of all clinical presentations of HF and its prevalence is expected to increase. However, there are no evidence-based therapies for HFpEF; thus, HFpEF represents a major unmet need. Although hypertension is the single most important risk factor for HFpEF, with a prevalence of 60-89% from clinical trials and human HF registries, blood pressure therapy alone is insufficient to prevent and treat HFpEF. Follistatin like 1 (Fstl1), a divergent member of the follistatin family of extracellular glycoproteins, has previously been shown to be elevated in HF with reduced ejection fraction (HFrEF) and associated with increased left ventricular mass. Methods and Results In this study, blood levels of Fstl1 were increased in humans with HFpEF. This increase was also evident in mice with hypertension-induced HFpEF and adult rat ventricular myocytes stimulated with aldosterone. Treatment with recombinant Fstl1 abrogated aldosterone-induced cardiac myocyte hypertrophy, suggesting a role for Fstl1 in the regulation of hypertrophy in HFpEF. There was also a reduction in the E/A ratio, a measure of diastolic dysfunction. Furthermore, HFpEF induced in a mouse model that specifically ablates Fstl1 in cardiac myocytes (cFstl1-KO), showed exacerbation of HFpEF with worsened diastolic dysfunction. In addition, cFstl1-KO-HFpEF mice demonstrated more marked cardiac myocyte hypertrophy with increased molecular markers of anp and bnp expression. Conclusions These findings indicate that Fstl1exerts therapeutic effects by modulating cardiac hypertrophy in HFpEF. PMID:27430031

  16. Follistatin in chondrocytes: the link between TRPV4 channelopathies and skeletal malformations

    Science.gov (United States)

    Leddy, Holly A.; McNulty, Amy L.; Lee, Suk Hee; Rothfusz, Nicole E.; Gloss, Bernd; Kirby, Margaret L.; Hutson, Mary R.; Cohn, Daniel H.; Guilak, Farshid; Liedtke, Wolfgang

    2014-01-01

    Point mutations in the calcium-permeable TRPV4 ion channel have been identified as the cause of autosomal-dominant human motor neuropathies, arthropathies, and skeletal malformations of varying severity. The objective of this study was to determine the mechanism by which TRPV4 channelopathy mutations cause skeletal dysplasia. The human TRPV4V620I channelopathy mutation was transfected into primary porcine chondrocytes and caused significant (2.6-fold) up-regulation of follistatin (FST) expression levels. Pore altering mutations that prevent calcium influx through the channel prevented significant FST up-regulation (1.1-fold). We generated a mouse model of theTRPV4V620I mutation, and found significant skeletal deformities (e.g., shortening of tibiae and digits, similar to the human disease brachyolmia) and increases in Fst/TRPV4 mRNA levels (2.8-fold). FST was significantly up-regulated in primary chondrocytes transfected with 3 different dysplasia-causing TRPV4 mutations (2- to 2.3-fold), but was not affected by an arthropathy mutation (1.1-fold). Furthermore, FST-loaded microbeads decreased bone ossification in developing chick femora (6%) and tibiae (11%). FST gene and protein levels were also increased 4-fold in human chondrocytes from an individual natively expressing the TRPV4T89I mutation. Taken together, these data strongly support that up-regulation of FST in chondrocytes by skeletal dysplasia-inducing TRPV4 mutations contributes to disease pathogenesis.—Leddy, H. A., McNulty, A. L., Lee, S. H., Rothfusz, N. E., Gloss, B., Kirby, M. L., Hutson, M. R., Cohn, D. H., Guilak, F., Liedtke, W. Follistatin in chondrocytes: the link between TRPV4 channelopathies and skeletal malformations. PMID:24577120

  17. Mayaro virus infection cycle relies on casein kinase 2 activity.

    Science.gov (United States)

    Barroso, Madalena M S; Lima, Carla S; Silva-Neto, Mário A C; Da Poian, Andrea T

    2002-09-06

    Replication of Mayaro virus in Vero cells induces dramatic cytopathic effects and cell death. In this study, we have evaluated the role of casein kinase 2 (CK2) during Mayaro virus infection cycle. We found that CK2 was activated during the initial stages of infection ( approximately 36% after 4h). This activation was further confirmed when the enzyme was partially purified from the cellular lysate either by Mono Q 5/5Hr column or heparin-agarose column. Using this later column, we found that the elution profile of CK2 activity from infected cells was different from that obtained for control cell enzyme, suggesting a structural modification of CK2 after infection. Treatment of infected cells with a cell-permeable inhibitor of CK2, dichloro-1-(beta-D-ribofuranosyl)benzimidazole (DRB), abolished the cytopathic effect in a dose-dependent manner. Together this set of data demonstrates for the first time that CK2 activity in host cells is required in Mayaro virus infection cycle.

  18. Myostatin and its association with abdominal obesity, androgen and follistatin levels in women with polycystic ovary syndrome.

    Science.gov (United States)

    Chen, Mei-Jou; Han, Der-Sheng; Yang, Jehn-Hsiahn; Yang, Yu-Shih; Ho, Hong-Nerng; Yang, Wei-Shiung

    2012-08-01

    What is the role of myostatin and its relationship with obesity, androgens and follistatin levels in women with polycystic ovary syndrome (PCOS)? SUMMARY ANSWERS: The myostatin level was positively correlated to the risk of abdominal obesity, but negatively associated with circulating levels of dehydroepiandrosterone sulfate (DHEAS) and follistatin in women with PCOS. Myostatin is a well-known negative regulator of skeletal muscle and is involved in metabolism; however, little is known about the role of myostatin in women with PCOS. In this study, we found that the myostatin level was positively related to the risk of abdominal obesity, but negatively related to the circulating levels of DHEAS and follistatin in women with PCOS. Such a relationship might imply a potential regulatory role of androgens and follistatin in the metabolism of skeletal muscle in women with PCOS. A cross-sectional case-control study. A total of 239 untreated, consecutive women with PCOS and 38 healthy volunteer women without PCOS were enrolled and studied in a tertiary medical center. Myostatin level was higher in women with PCOS than those without PCOS (16.6±15.6 and 14.2±9.7, P=0.025), but were not significantly different between non-obese women with and without PCOS after considering the effect of obesity (P=0.09). Stepwise multivariate regression analysis in women revealed that only the presence of PCOS (β=0.256, P=0.0001), total testosterone (β=0.159, P=0.031), DHEAS (β=-0.188, P=0.0003) and follistatin (β=-0.171, P=0.0001) levels were left in the final model and were significantly related to the myostatin level after considering all the explanatory variables. By using stepwise multivariate regression analysis, the total testosterone levels (β=0.196, P=0.003) were positively, but the DHEAS (β=-0.196, Pobesity after further adjusting the androgens and follistatin levels in women with PCOS. This study is a cross-sectional case-control design, and therefore, cannot answer the

  19. Amygdalin isolated from Semen Persicae (Tao Ren) extracts induces the expression of follistatin in HepG2 and C2C12 cell lines.

    Science.gov (United States)

    Yang, Chuanbin; Li, Xuechen; Rong, Jianhui

    2014-01-01

    The Chinese medicine formulation ISF-1 (also known as Bu-Yang-Huan-Wu-Tang) for post-stroke rehabilitation could increase the expression of growth-regulating protein follistatin by approximately 4-fold. This study aims to identify the active compounds of ISF-1 for the induction of follistatin expression. Active compounds in ISF-1 responsible for induction of follistatin were identified by a bioactivity-guided fractionation procedure involving liquid-liquid extraction, HPLC separation and RT-PCR detection. The aqueous extracts of seven ISF-1 ingredients including Semen Persicae (Tao Ren) and the S. Persicae-derived fractions were assayed for the induction of follistatin mRNA expression in human hepatocarcinoma HepG2 cells by RT-PCR. The concentrations of isolated compounds were proportionally normalized to the reported IC50 concentration (5.8 mg/mL) of the formulation ISF-1 in HepG2. The active fractions were characterized by reverse-phase HPLC on a C18 column and identified by mass spectrometry. Three ingredients of ISF-1, namely S. Persicae (Tao Ren), Pheretima (Di Long), and Flos Carthami (Hong Hua), induced the expression of follistatin mRNA. Among these, the ingredient S. Persicae were the most active, and amygdalin from S. Persicae extract was identified as a novel follistatin inducer. Amygdalin stimulated the growth of skeletal muscle cell line C2C12 cells in a concentration-dependent manner. Amygdalin isolated from S. Persicae extract in ISF-1 through a bioactivity-guided fractionation procedure induced the expression of follistatin in HepG2 and C2C12 cell lines.

  20. Testicular activin and follistatin levels are elevated during the course of experimental autoimmune epididymo–orchitis in mice

    Science.gov (United States)

    Nicolas, Nour; Michel, Vera; Bhushan, Sudhanshu; Wahle, Eva; Hayward, Susan; Ludlow, Helen; de Kretser, David M.; Loveland, Kate L.; Schuppe, Hans-Christian; Meinhardt, Andreas; Hedger, Mark P.; Fijak, Monika

    2017-01-01

    Experimental autoimmune epididymo-orchitis (EAEO) is a model of chronic inflammation, induced by immunisation with testicular antigens, which reproduces the pathology of some types of human infertility. Activins A and B regulate spermatogenesis and steroidogenesis, but are also pro-inflammatory, pro-fibrotic cytokines. Expression of the activins and their endogenous antagonists, inhibin and follistatin, was examined in murine EAEO. Adult untreated and adjuvant-treated control mice showed no pathology. All mice immunised with testis antigens developed EAEO by 50 days, characterised by loss of germ cells, immune cell infiltration and fibrosis in the testis, similar to biopsies from human inflamed testis. An increase of total CD45+ leukocytes, comprising CD3+ T cells, CD4 + CD8− and CD4 + CD25+ T cells, and a novel population of CD4 + CD8+ double positive T cells was also detected in EAEO testes. This was accompanied by increased expression of TNF, MCP-1 and IL-10. Activin A and B and follistatin protein levels were elevated in EAEO testes, with peak activin expression during the active phase of the disease, whereas mRNA expression of the inhibin B subunits (Inha and Inhbb) and activin receptor subunits (Acvr1b and Acvr2b) were downregulated. These data suggest that activin–follistatin regulation may play a role during the development of EAEO. PMID:28205525

  1. Sphingosine kinase 2-deficiency mediated changes in spinal pain processing

    Directory of Open Access Journals (Sweden)

    Jastrow eCanlas

    2015-08-01

    Full Text Available Chronic pain is one of the most burdensome health issues facing the planet (as costly as diabetes and cancer combined, and in desperate need for new diagnostic targets leading to better therapies. The bioactive lipid sphingosine 1-phosphate (S1P and its receptors have recently been shown to modulate nociceptive signalling at the level of peripheral nociceptors and central neurons. However, the exact role of S1P generating enzymes, in particular sphingosine kinase 2 (Sphk2, in nociception remains unknown. We found that both sphingosine kinases, Sphk1 and Sphk2, were expressed in spinal cord with higher levels of Sphk2 mRNA compared to Sphk1. All three Sphk2 mRNA-isoforms were present with the Sphk2.1 mRNA showing the highest relative expression. Mice deficient in Sphk2 (Sphk2-/- showed in contrast to mice deficient in Sphk1 (Sphk1-/- substantially lower spinal S1P levels compared to wild-type C57BL/6 mice. In the formalin model of acute peripheral inflammatory pain, Sphk2-/- mice showed facilitation of nociceptive transmission during the late response, whereas responses to early acute pain, and the number of c-Fos immunoreactive dorsal horn neurons were not different between Sphk2-/- and wild-type mice. Chronic peripheral inflammation (CPI caused a bilateral increase in mechanical sensitivity in Sphk2-/- mice. Additionally, CPI increased the relative mRNA expression of P2X4 receptor, brain-derived neurotrophic factor and inducible nitric oxide synthase in the ipsilateral spinal cord of wild-type but not Sphk2-/- mice. Similarly, Sphk2-/- mice showed in contrast to wild-type no CPI-dependent increase in areas of the dorsal horn immunoreactive for the microglia marker Iba-1 and the astrocyte marker GFAP. Our results suggest that the tightly regulated cell signalling enzyme Sphk2 may be a key component for facilitation of nociceptive circuits in the CNS leading to central sensitization and pain memory formation.

  2. Helicobacter pylori induces cell migration and invasion through casein kinase 2 in gastric epithelial cells.

    Science.gov (United States)

    Lee, Yeo Song; Lee, Do Yeon; Yu, Da Yeon; Kim, Shin; Lee, Yong Chan

    2014-12-01

    Chronic infection with Helicobacter pylori (H. pylori) is causally linked with gastric carcinogenesis. Virulent H. pylori strains deliver bacterial CagA into gastric epithelial cells. Induction of high motility and an elongated phenotype is considered to be CagA-dependent process. Casein kinase 2 plays a critical role in carcinogenesis through signaling pathways related to the epithelial mesenchymal transition. This study was aimed to investigate the effect of H. pylori infection on the casein kinase 2-mediated migration and invasion in gastric epithelial cells. AGS or MKN28 cells as human gastric epithelial cells and H. pylori strains Hp60190 (ATCC 49503, CagA(+)) and Hp8822 (CagA(-)) were used. Cells were infected with H. pylori at multiplicity of infection of 100 : 1 for various times. We measured in vitro kinase assay to examine casein kinase 2 activity and performed immunofluorescent staining to observe E-cadherin complex. We also examined β-catenin transactivation through promoter assay and MMP7 expression by real-time PCR and ELISA. H. pylori upregulates casein kinase 2 activity and inhibition of casein kinase 2 in H. pylori-infected cells profoundly suppressed cell invasiveness and motility. We confirmed that casein kinase 2 mediates membranous α-catenin depletion through dissociation of the α-/β-catenin complex in H. pylori-infected cells. We also found that H. pylori induces β-catenin nuclear translocation and increases MMP7 expressions mediated through casein kinase 2. We show for the first time that CagA(+) H. pylori upregulates cellular invasiveness and motility through casein kinase 2. The demonstration of a mechanistic interplay between H. pylori and casein kinase 2 provides important insights into the role of CagA(+) H. pylori in the gastric cancer invasion and metastasis. © 2014 John Wiley & Sons Ltd.

  3. The structure of myostatin:follistatin 288: insights into receptor utilization and heparin binding

    Energy Technology Data Exchange (ETDEWEB)

    Cash, Jennifer N.; Rejon, Carlis A.; McPherron, Alexandra C.; Bernard, Daniel J.; Thompson, Thomas B.; (UCIN); (McGill); (NIH)

    2009-09-29

    Myostatin is a member of the transforming growth factor-{beta} (TGF-{beta}) family and a strong negative regulator of muscle growth. Here, we present the crystal structure of myostatin in complex with the antagonist follistatin 288 (Fst288). We find that the prehelix region of myostatin very closely resembles that of TGF-{beta} class members and that this region alone can be swapped into activin A to confer signalling through the non-canonical type I receptor Alk5. Furthermore, the N-terminal domain of Fst288 undergoes conformational rearrangements to bind myostatin and likely acts as a site of specificity for the antagonist. In addition, a unique continuous electropositive surface is created when myostatin binds Fst288, which significantly increases the affinity for heparin. This translates into stronger interactions with the cell surface and enhanced myostatin degradation in the presence of either Fst288 or Fst315. Overall, we have identified several characteristics unique to myostatin that will be paramount to the rational design of myostatin inhibitors that could be used in the treatment of muscle-wasting disorders.

  4. Obesity and Low-Grade Inflammation Increase Plasma Follistatin-Like 3 in Humans

    Directory of Open Access Journals (Sweden)

    Claus Brandt

    2014-01-01

    Full Text Available Background. Rodent models suggest that follistatin-like 3 (fstl3 is associated with diabetes and obesity. In humans, plasma fstl3 is reduced with gestational diabetes. In vitro, TNF-α induces fstl3 secretion, which suggests a link to inflammation. Objective. To elucidate the association between plasma fstl3 and obesity, insulin resistance, and low-grade inflammation in humans. Study Design. Plasma fstl3 levels were determined in a cross-sectional study including three groups: patients with type 2 diabetes, impaired glucose tolerance, and healthy controls. In addition, lipopolysaccharide (LPS, TNF-α, or interleukin-6 (IL-6 as well as a hyperinsulinemic euglycemic clamp were used to examine if plasma fstl3 was acutely regulated in humans. Results. Plasma fstl3 was increased in obese subjects independent of glycemic state. Moreover, plasma fstl3 was positively correlated with fat mass, plasma leptin, fasting insulin, and HOMA B and negatively with HOMA S. Furthermore plasma fstl3 correlated positively with plasma TNF-α and IL-6 levels. Infusion of LPS and TNF-α, but not IL-6 and insulin, increased plasma fstl3 in humans. Conclusion. Plasma fstl3 is increased in obese subjects and associated with fat mass and low-grade inflammation. Furthermore, TNF-α increased plasma fstl3, suggesting that TNF-α is one of the inflammatory drivers of increased systemic levels of fstl3.

  5. Placental expression of myostatin and follistatin-like-3 protein in a model of developmental programming.

    Science.gov (United States)

    Peiris, Hassendrini N; Ponnampalam, Anna P; Osepchook, Claire C; Mitchell, Murray D; Green, Mark P

    2010-04-01

    Maternal undernutrition during gestation is known to be detrimental to fetal development, leading to a propensity for metabolic disorders later in the adult lives of the offspring. Identifying possible mediators and physiological processes involved in modulating nutrient transport within the placenta is essential to prevent and/or develop treatments for the effects of aberrant nutrition, nutrient transfer, and detrimental changes to fetal development. A potential role for myostatin as a mediator of nutrient uptake and transport from the mother to the fetus was shown through the recent finding that myostatin acts within the human placenta to modulate glucose uptake and therefore homeostasis. The mRNA and protein expression of myostatin and its inhibitor, follistatin-like-3 (FSTL3), was studied in the placenta and skeletal muscle of a transgenerational Wistar rat model of gestational maternal undernutrition in which the F2 offspring postweaning consumed a high-fat (HF) diet. Alterations in placental characteristics and offspring phenotype, specifically glucose homeostasis, were evident in the transgenerationally undernourished (UNAD) group. Myostatin and FSTL3 protein expression were also higher (P UNAD compared with the control group. At maturity, UNAD HF-fed animals had higher (P < 0.05) skeletal muscle expression of FSTL3 than control animals. In summary, maternal undernutrition during gestation results in the aberrant regulation of myostatin and FSTL3 in the placenta and skeletal muscle of subsequent generations. Myostatin, through the disruption of maternal nutrient supply to the fetus, may thus be a potential mediator of offspring phenotype.

  6. Follistatin in chondrocytes: the link between TRPV4 channelopathies and skeletal malformations.

    Science.gov (United States)

    Leddy, Holly A; McNulty, Amy L; Lee, Suk Hee; Rothfusz, Nicole E; Gloss, Bernd; Kirby, Margaret L; Hutson, Mary R; Cohn, Daniel H; Guilak, Farshid; Liedtke, Wolfgang

    2014-06-01

    Point mutations in the calcium-permeable TRPV4 ion channel have been identified as the cause of autosomal-dominant human motor neuropathies, arthropathies, and skeletal malformations of varying severity. The objective of this study was to determine the mechanism by which TRPV4 channelopathy mutations cause skeletal dysplasia. The human TRPV4(V620I) channelopathy mutation was transfected into primary porcine chondrocytes and caused significant (2.6-fold) up-regulation of follistatin (FST) expression levels. Pore altering mutations that prevent calcium influx through the channel prevented significant FST up-regulation (1.1-fold). We generated a mouse model of the TRPV4(V620I) mutation, and found significant skeletal deformities (e.g., shortening of tibiae and digits, similar to the human disease brachyolmia) and increases in Fst/TRPV4 mRNA levels (2.8-fold). FST was significantly up-regulated in primary chondrocytes transfected with 3 different dysplasia-causing TRPV4 mutations (2- to 2.3-fold), but was not affected by an arthropathy mutation (1.1-fold). Furthermore, FST-loaded microbeads decreased bone ossification in developing chick femora (6%) and tibiae (11%). FST gene and protein levels were also increased 4-fold in human chondrocytes from an individual natively expressing the TRPV4(T89I) mutation. Taken together, these data strongly support that up-regulation of FST in chondrocytes by skeletal dysplasia-inducing TRPV4 mutations contributes to disease pathogenesis. © FASEB.

  7. Ser2 is the autophosphorylation site in the beta subunit from bicistronically expressed human casein kinase-2 and from native rat liver casein kinase-2 beta

    DEFF Research Database (Denmark)

    Boldyreff, B; James, P; Staudenmann, W;

    1993-01-01

    Human casein kinase-2 (CK-2) subunits alpha and beta were bicistronically expressed in bacteria. The recombinant holoenzyme shared all investigated properties with the native CK-2 from mammalian sources (rat liver, Krebs II mouse ascites tumour cells). Contrary to recombinant human CK-2 produced...

  8. Female Infertility and Disrupted Angiogenesis Are Actions of Specific Follistatin Isoforms

    Science.gov (United States)

    Lin, Shyr-Yeu; Craythorn, Rebecca G.; O’Connor, Anne E.; Matzuk, Martin M.; Girling, Jane E.; Morrison, John R.; de Kretser, David M.

    2008-01-01

    The circulating and tissue-bound forms of follistatin (FST315 and FST288, respectively) modulate the actions of activins. FST knockout (KO/null) mice, lacking both isoforms, die perinatally with defects in lung, skin, and the musculoskeletal system. Using constructs of the human FST gene engineered to enable expression of each isoform under the control of natural regulatory elements, transgenic mouse lines were created and crossed with FST null mice to attempt to rescue the neonatal lethality. FST288 expression alone did not rescue the neonatal lethality, but mice expressing FST315 on the KO background survived to adulthood with normal lung and skin morphology and partial reversal of the musculoskeletal defects noted in FST KO mice. The FST315 rescue mice displayed a short period of neonatal growth retardation, impaired tail growth, and female infertility. The latter may be due to failure of corpus luteum formation, a decline in the ovarian follicular population, and an augmented uterine inflammatory response to mating. Failure of corpus luteum formation and impaired tail growth indicate abnormal vascularization and suggest that FST288 is required for the promotion of angiogenesis. The augmented uterine inflammatory response may result from the failure of FST315 to modulate the proinflammatory actions of activin A in the uterus or may result from the altered steroid milieu associated with the ovarian abnormalities. Although we cannot definitively conclude that the remaining defects are due to the absence of a particular isoform or due to variable expression of each, these models have demonstrated novel physiological processes that are influenced by FST. PMID:17932109

  9. Expression of myostatin, myostatin receptors and follistatin in diabetic rats submitted to exercise.

    Science.gov (United States)

    Dutra, Daniela B; Bueno, Patrícia G; Silva, Rafaella N; Nakahara, Natália H; Selistre-Araújo, Heloísa S; Nonaka, Keico O; Leal, Angela Mo

    2012-05-01

    Myostatin (MSTN) has been implicated in metabolic adaptation to physiological stimuli, such as physical exercise, which is linked to improved glucose homeostasis. The aim of the present study was to evaluate the influence of exercise on the expression of MSTN, MSTN receptors (ActRIIB and ALK4) and follistatin (FS) in the muscle and fat of streptozotocin-induced diabetic rats. Control and diabetic rats were randomly assigned to a swimming training group (EC and ED, respectively) and a sedentary group (SC and SD, respectively). Exercising animals swam for 45 min at 0900 and 1700 hours, 5 day/week, for 4 weeks. The mRNA expression of MSTN, ActRIIB, ALK4 and FS mRNA was quantified by real-time reverse transcription-polymerase chain reaction. Expression of MSTN and FS mRNA increased in the muscle and subcutaneous fat of SD compared with SC rats. Expression of ActRIIB mRNA was increased in the muscle, mesenteric fat and brown adipose tissue (BAT) of SD compared with SC rats, whereas ALK4 mRNA expression was only increased in the BAT of SD compared with SC rats. After training, MSTN and ActRIIB expression was lower in the BAT of EC compared with SC rats. Expression of MSTN mRNA increased in the mesenteric fat of ED compared with SD rats, whereas FS mRNA expression decreased in the muscle, mesenteric and subcutaneous fat and BAT. Lower ALK4 mRNA expression was noted in the BAT of ED compared with SD rats. These results indicate that MSTN, its receptors and FS expression change in both the muscle and fat of diabetic rats and that the expression of these factors can be modulated by exercise in diabetes.

  10. Follistatin N terminus differentially regulates muscle size and fat in vivo.

    Science.gov (United States)

    Zheng, Hui; Qiao, Chunping; Tang, Ruhang; Li, Jianbin; Bulaklak, Karen; Huang, Zhenhua; Zhao, Chunxia; Dai, Yi; Li, Juan; Xiao, Xiao

    2017-09-15

    Delivery of follistatin (FST) represents a promising strategy for both muscular dystrophies and diabetes, as FST is a robust antagonist of myostatin and activin, which are critical regulators of skeletal muscle and adipose tissues. FST is a multi-domain protein, and deciphering the function of different domains will facilitate novel designs for FST-based therapy. Our study aims to investigate the role of the N-terminal domain (ND) of FST in regulating muscle and fat mass in vivo. Different FST constructs were created and packaged into the adeno-associated viral vector (AAV). Overexpression of wild-type FST in normal mice greatly increased muscle mass while decreasing fat accumulation, whereas overexpression of an N terminus mutant or N terminus-deleted FST had no effect on muscle mass but moderately decreased fat mass. In contrast, FST-I-I containing the complete N terminus and double domain I without domain II and III had no effect on fat but increased skeletal muscle mass. The effects of different constructs on differentiated C2C12 myotubes were consistent with the in vivo finding. We hypothesized that ND was critical for myostatin blockade, mediating the increase in muscle mass, and was less pivotal for activin binding, which accounts for the decrease in the fat tissue. An in vitro TGF-beta1-responsive reporter assay revealed that FST-I-I and N terminus-mutated or -deleted FST showed differential responses to blockade of activin and myostatin. Our study provided direct in vivo evidence for a role of the ND of FST, shedding light on future potential molecular designs for FST-based gene therapy.

  11. Effect of physical training on liver expression of activin A and follistatin in a nonalcoholic fatty liver disease model in rats

    Energy Technology Data Exchange (ETDEWEB)

    Silva, R.N. [Departamento de Fisioterapia, Universidade Federal de São Carlos, São Carlos, SP (Brazil); Bueno, P.G. [Departamento de Ciências Fisiológicas, Universidade Federal de São Carlos, São Carlos, SP (Brazil); Avó, L.R.S. [Departamento de Medicina, Universidade Federal de São Carlos, São Carlos, SP (Brazil); Nonaka, K.O.; Selistre-Araújo, H.S. [Departamento de Ciências Fisiológicas, Universidade Federal de São Carlos, São Carlos, SP (Brazil); Leal, A.M.O. [Departamento de Medicina, Universidade Federal de São Carlos, São Carlos, SP (Brazil)

    2014-07-25

    Nonalcoholic fatty liver disease (NAFLD) is characterized by fat accumulation in the liver and is associated with obesity and insulin resistance. Activin A is a member of the transforming growth factor beta (TGF)-β superfamily and inhibits hepatocyte growth. Follistatin antagonizes the biological actions of activin. Exercise is an important therapeutic strategy to reduce the metabolic effects of obesity. We evaluated the pattern of activin A and follistatin liver expression in obese rats subjected to swimming exercise. Control rats (C) and high-fat (HF) diet-fed rats were randomly assigned to a swimming training group (C-Swim and HF-Swim) or a sedentary group (C-Sed and HF-Sed). Activin βA subunit mRNA expression was significantly higher in HF-Swim than in HF-Sed rats. Follistatin mRNA expression was significantly lower in C-Swim and HF-Swim than in either C-Sed or HF-Sed animals. There was no evidence of steatosis or inflammation in C rats. In contrast, in HF animals the severity of steatosis ranged from grade 1 to grade 3. The extent of liver parenchyma damage was less in HF-Swim animals, with the severity of steatosis ranging from grade 0 to grade 1. These data showed that exercise may reduce the deleterious effects of a high-fat diet on the liver, suggesting that the local expression of activin-follistatin may be involved.

  12. Effect of physical training on liver expression of activin A and follistatin in a nonalcoholic fatty liver disease model in rats.

    Science.gov (United States)

    Silva, R N; Bueno, P G; Avó, L R S; Nonaka, K O; Selistre-Araújo, H S; Leal, A M O

    2014-09-01

    Nonalcoholic fatty liver disease (NAFLD) is characterized by fat accumulation in the liver and is associated with obesity and insulin resistance. Activin A is a member of the transforming growth factor beta (TGF)-β superfamily and inhibits hepatocyte growth. Follistatin antagonizes the biological actions of activin. Exercise is an important therapeutic strategy to reduce the metabolic effects of obesity. We evaluated the pattern of activin A and follistatin liver expression in obese rats subjected to swimming exercise. Control rats (C) and high-fat (HF) diet-fed rats were randomly assigned to a swimming training group (C-Swim and HF-Swim) or a sedentary group (C-Sed and HF-Sed). Activin βA subunit mRNA expression was significantly higher in HF-Swim than in HF-Sed rats. Follistatin mRNA expression was significantly lower in C-Swim and HF-Swim than in either C-Sed or HF-Sed animals. There was no evidence of steatosis or inflammation in C rats. In contrast, in HF animals the severity of steatosis ranged from grade 1 to grade 3. The extent of liver parenchyma damage was less in HF-Swim animals, with the severity of steatosis ranging from grade 0 to grade 1. These data showed that exercise may reduce the deleterious effects of a high-fat diet on the liver, suggesting that the local expression of activin-follistatin may be involved.

  13. Effect of physical training on liver expression of activin A and follistatin in a nonalcoholic fatty liver disease model in rats

    Directory of Open Access Journals (Sweden)

    R.N. Silva

    2014-09-01

    Full Text Available Nonalcoholic fatty liver disease (NAFLD is characterized by fat accumulation in the liver and is associated with obesity and insulin resistance. Activin A is a member of the transforming growth factor beta (TGF-β superfamily and inhibits hepatocyte growth. Follistatin antagonizes the biological actions of activin. Exercise is an important therapeutic strategy to reduce the metabolic effects of obesity. We evaluated the pattern of activin A and follistatin liver expression in obese rats subjected to swimming exercise. Control rats (C and high-fat (HF diet-fed rats were randomly assigned to a swimming training group (C-Swim and HF-Swim or a sedentary group (C-Sed and HF-Sed. Activin βA subunit mRNA expression was significantly higher in HF-Swim than in HF-Sed rats. Follistatin mRNA expression was significantly lower in C-Swim and HF-Swim than in either C-Sed or HF-Sed animals. There was no evidence of steatosis or inflammation in C rats. In contrast, in HF animals the severity of steatosis ranged from grade 1 to grade 3. The extent of liver parenchyma damage was less in HF-Swim animals, with the severity of steatosis ranging from grade 0 to grade 1. These data showed that exercise may reduce the deleterious effects of a high-fat diet on the liver, suggesting that the local expression of activin-follistatin may be involved.

  14. Amygdalin isolated from Semen Persicae (Tao Ren) extracts induces the expression of follistatin in HepG2 and C2C12 cell lines

    National Research Council Canada - National Science Library

    Yang, Chuanbin; Li, Xuechen; Rong, Jianhui

    2014-01-01

    .... The aqueous extracts of seven ISF-1 ingredients including Semen Persicae (Tao Ren) and the S. Persicae-derived fractions were assayed for the induction of follistatin mRNA expression in human hepatocarcinoma HepG2 cells by RT-PCR...

  15. Cerebral pathological and compensatory mechanisms in the premotor phase of leucine-rich repeat kinase 2 parkinsonism

    NARCIS (Netherlands)

    Nuenen, B.F.L. van; Helmich, R.C.G.; Ferraye, M.; Thaler, A.; Hendler, T.; Orr-Urtreger, A.; Mirelman, A.; Bressman, S.; Marder, K.S.; Giladi, N.; Warrenburg, B.P.C. van de; Bloem, B.R.; Toni, I.

    2012-01-01

    Compensatory cerebral mechanisms can delay motor symptom onset in Parkinson's disease. We aim to characterize these compensatory mechanisms and early disease-related changes by quantifying movement-related cerebral function in subjects at significantly increased risk of developing Parkinson's diseas

  16. Leucine-rich repeat kinase 2 and alpha-synuclein: intersecting pathways in the pathogenesis of Parkinson's disease?

    Directory of Open Access Journals (Sweden)

    Civiero Laura

    2011-01-01

    Full Text Available Abstract Although Parkinson's disease (PD is generally a sporadic neurological disorder, the discovery of monogenic, hereditable forms of the disease has been crucial in delineating the molecular pathways that lead to this pathology. Genes responsible for familial PD can be ascribed to two categories based both on their mode of inheritance and their suggested biological function. Mutations in parkin, PINK1 and DJ-1 cause of recessive Parkinsonism, with a variable pathology often lacking the characteristic Lewy bodies (LBs in the surviving neurons. Intriguingly, recent findings highlight a converging role of all these genes in mitochondria function, suggesting a common molecular pathway for recessive Parkinsonism. Mutations in a second group of genes, encoding alpha-synuclein (α-syn and LRRK2, are transmitted in a dominant fashion and generally lead to LB pathology, with α-syn being the major component of these proteinaceous aggregates. In experimental systems, overexpression of mutant proteins is toxic, as predicted for dominant mutations, but the normal function of both proteins is still elusive. The fact that α-syn is heavily phosphorylated in LBs and that LRRK2 is a protein kinase, suggests that a link, not necessarily direct, exists between the two. What are the experimental data supporting a common molecular pathway for dominant PD genes? Do α-syn and LRRK2 target common molecules? Does LRRK2 act upstream of α-syn? In this review we will try to address these of questions based on the recent findings available in the literature.

  17. Assignment of casein kinase 2 alpha sequences to two different human chromosomes

    DEFF Research Database (Denmark)

    Boldyreff, B; Klett, C; Göttert, E

    1992-01-01

    Human casein kinase 2 alpha gene (CK-2-alpha) sequences have been localized within the human genome by in situ hybridization and somatic cell hybrid analysis using a CK-2 alpha cDNA as a probe. By in situ hybridization, the CK-2 alpha cDNA could be assigned to two different loci, one on 11p15.1-ter...

  18. Phosphorylation of nm23/nucleoside diphosphate kinase by casein kinase 2 in vitro

    DEFF Research Database (Denmark)

    Engel, M; Issinger, O G; Lascu, I;

    1994-01-01

    We have investigated phosphorylation of human nucleoside diphosphate kinase (NDPK) and of homologous NDPK from different species by human casein kinase 2 (CK-2). The human NDPK isotypes A and B were phosphorylated by CK-2 in vitro both when the purified proteins and total lysate of HL-60 leukemia...

  19. Cloning and sequencing of the casein kinase 2 alpha subunit from Zea mays

    DEFF Research Database (Denmark)

    Dobrowolska, G; Boldyreff, B; Issinger, O G

    1991-01-01

    The nucleotide sequence of the cDNA coding for the alpha subunit of casein kinase 2 of Zea mays has been determined. The cDNA clone contains an open reading frame of 996 nucleotides encoding a polypeptide comprising 332 amino acids. The primary amino acid sequence exhibits 75% identity to the alpha...

  20. G protein-coupled receptor kinase 2 positively regulates epithelial cell migration

    NARCIS (Netherlands)

    Penela, Petronila; Ribas, Catalina; Aymerich, Ivette; Eijkelkamp, Niels; Barreiro, Olga; Heijnen, Cobi J.; Kavelaars, Annemieke; Sanchez-Madrid, Francisco; Mayor, Federico

    2008-01-01

    Cell migration requires integration of signals arising from both the extracellular matrix and messengers acting through G protein-coupled receptors (GPCRs). We find that increased levels of G protein-coupled receptor kinase 2 (GRK2), a key player in GPCR regulation, poteniate migration of epithelial

  1. Checkpoint kinase 2-mediated phosphorylation of BRCA1 regulates the fidelity of nonhomologous end-joining

    NARCIS (Netherlands)

    J. Zhuang; J. Zhang (Shuzhong); H. Willers; H. Wang (Hong); J.H. Chung; D.C. van Gent (Dik); D.E. Hallahan; S.N. Powell; F. Xia

    2006-01-01

    textabstractThe tumor suppressor gene BRCA1 maintains genomic integrity by protecting cells from the deleterious effects of DNA double-strand breaks (DSBs). Through its interactions with the checkpoint kinase 2 (Chk2) kinase and Rad51, BRCA1 promotes homologous recombination, which

  2. Nuclear Targeting of Cyclin-Dependent Kinase 2 Reveals Essential Roles of Cyclin-Dependent Kinase 2 Localization and Cyclin E in Vitamin D-Mediated Growth Inhibition

    OpenAIRE

    Flores, Omar; Wang, Zhengying; Knudsen, Karen E; Burnstein, Kerry L.

    2010-01-01

    1,25-Dihydroxyvitamin D3 (1,25-(OH)2D3), inhibits proliferation of a variety of cell types including adenocarcinoma of the prostate. We have previously shown that 1,25-(OH)2D3 increases the stability of the cyclin-dependent kinase inhibitor p27KIP1, decreases cyclin-dependent kinase 2 (CDK2) activity, and promotes G1 phase accumulation in human prostate cancer cells. These effects correlate with cytoplasmic relocalization of CDK2. In this study, we investigated the role of CDK2 cytoplasmic re...

  3. Combinatory microarray and SuperSAGE analyses identify pairing-dependently transcribed genes in Schistosoma mansoni males, including follistatin.

    Directory of Open Access Journals (Sweden)

    Silke Leutner

    2013-11-01

    Full Text Available BACKGROUND: Schistosomiasis is a disease of world-wide importance and is caused by parasitic flatworms of the genus Schistosoma. These parasites exhibit a unique reproduction biology as the female's sexual maturation depends on a constant pairing-contact to the male. Pairing leads to gonad differentiation in the female, and even gene expression of some gonad-associated genes is controlled by pairing. In contrast, no morphological changes have been observed in males, although first data indicated an effect of pairing also on gene transcription in males. METHODOLOGY/PRINCIPAL FINDINGS: To investigate the influence of pairing on males, we performed a combinatory approach applying SuperSAGE and microarray hybridization, generating the most comprehensive data-set on differential transcription available to date. Of 6,326 sense transcripts detected by both analyses, 29 were significantly differentially transcribed. Besides mutual confirmation, the two methods complemented each other as shown by data comparison and real-time PCR, which revealed a number of genes with consistent regulation across all methods. One of the candidate genes, follistatin of S. mansoni (SmFst was characterized in more detail by in situ hybridization and yeast two-hybrid (Y2H interaction analyses with potential binding partners. CONCLUSIONS/SIGNIFICANCE: Beyond confirming previously hypothesized differences in metabolic processes between pairing-experienced (EM and pairing-unexperienced males (UM, our data indicate that neuronal processes are involved in male-female interaction but also TGFβ-signaling. One candidate revealing significant down-regulation in EM was the TGFβ-pathway controlling molecule follistatin (SmFst. First functional analyses demonstrated SmFst interaction with the S. mansoni TGFβ-receptor agonists inhibin/activin (SmInAct and bone morphogenic protein (SmBMP, and all molecules colocalized in the testes. This indicates a yet unknown role of the TGF

  4. Analysis of the effects of androgens and training on myostatin propeptide and follistatin concentrations in blood and skeletal muscle using highly sensitive Immuno PCR

    OpenAIRE

    2010-01-01

    Abstract Myostatin propeptide (MYOPRO) and follistatin (FOLLI) are potent myostatin inhibitors. In this study we analysed effects of training and androgens on MYOPRO and FOLLI concentrations in blood and skeletal muscle using Immuno PCR. Young healthy males performed either a 3-month endurance-training or a strength-training. Blood and biopsy samples were analysed. Training did not significantly affect MYOPRO and FOLLI concentrations in serum and muscle. To investigate whether tota...

  5. Relationships among body composition, circulating concentrations of leptin and follistatin, and the onset of puberty and fertility in young female sheep.

    Science.gov (United States)

    Rosales Nieto, C A; Thompson, A N; Macleay, C A; Briegel, J R; Hedger, M P; Ferguson, M B; Martin, G B

    2014-12-30

    The onset of puberty depends on the attainment of critical body mass, so should also be affected by increases in the rate of accumulation of muscle and adipose tissue. Adipose tissue and reproduction are linked by leptin. For muscle, a link has not yet been identified, although one possibility is follistatin. We assessed the relationships among circulating concentrations of follistatin and leptin and the rates of growth and accumulation of muscle and fat during pubertal development in female sheep. We used 326 animals with known phenotypic values for live weight (LW), depths of eye muscle (EMD) and fat (FAT), and known breeding values at post-weaning age for body mass (PWT) and depths of eye muscle (PEMD) and fat (PFAT). Leptin concentration was positively correlated with values for EMD, PEMD, FAT, PFAT, LW and PWT (PLeptin concentration was negatively related to age and positively related to live weight at first oestrus and the proportion of females that attained puberty (P≤0.05), and to fertility and reproductive rate (Pleptin concentration, and between muscle accumulation and reproductive performance. We conclude that leptin and follistatin are probably both involved in effects of accelerated accumulation of muscle and adipose tissues on the onset of puberty. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Deployment Repeatability

    Science.gov (United States)

    2016-04-01

    controlled to great precision, but in a Cubesat , there may be no attitude determination at all. Such a Cubesat might treat sun angle and tumbling rates as...could be sensitive to small differences in motor controller timing. In these cases, the analyst might choose to model the entire deployment path, with...knowledge of the material damage model or motor controller timing precision. On the other hand, if many repeated and environmentally representative

  7. Inositol hexakisphosphate kinase-2 acts as an effector of the vertebrate Hedgehog pathway

    OpenAIRE

    Sarmah, Bhaskarjyoti; Wente, Susan R.

    2010-01-01

    Inositol phosphate (IP) kinases constitute an emerging class of cellular kinases linked to multiple cellular activities. Here, we report a previously uncharacterized cellular function in Hedgehog (Hh) signaling for the IP kinase designated inositol hexakisphosphate kinase-2 (IP6K2) that produces diphosphoryl inositol phosphates (PP-IPs). In zebrafish embryos, IP6K2 activity was required for normal development of craniofacial structures, somites, and neural crest cells. ip6k2 depletion in both...

  8. Extracellular-regulated kinase 2 is activated by the enhancement of hinge flexibility.

    OpenAIRE

    Sours, Kevin M.; Xiao,Yao; Ahn, Natalie G.

    2014-01-01

    Protein motions underlie conformational and entropic contributions to enzyme catalysis; however, relatively little is known about the ways in which this occurs. Studies of the mitogen-activated protein kinase ERK2 (extracellular-regulated protein kinase 2) by hydrogen-exchange mass spectrometry suggest that activation enhances backbone flexibility at the linker between N- and C-terminal domains while altering nucleotide binding mode. Here, we address the hypothesis that enhanced backbone flex...

  9. Injection of duck recombinant follistatin fusion protein into duck muscle tissues stimulates satellite cell proliferation and muscle fiber hypertrophy.

    Science.gov (United States)

    Liu, He-he; Wang, Ji-wen; Yu, Hai-yue; Zhang, Rong-ping; Chen, Xi; Jin, Hai-bo; Dai, Fei; Li, Liang; Xu, Feng

    2012-06-01

    Follistatin (FST) can inhibit the expression of myostatin, which is a predominant inhibitor of muscle development. The potential application of myostatin-based technology has been prompted in different ways in agriculture. We previously constructed an expression vector of duck FST and isolated the FST fusion protein. After the protein was purified and refolded, it was added to the medium of duck myoblasts cultured in vitro. The results show that the 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide value of the myoblasts in the duck FST treatment group is higher than that in the control group, which indicates that the duck FST fusion protein exhibits the biological activities that can accelerate myoblast proliferation. To further investigate the roles of duck FST on muscle development, we injected the protein into the duck muscle tissues in vivo. The results show that both the duck muscle fiber cross-sectional area and the satellite cell activation frequency are influenced more in the FST treatment group than they are in the control group. In addition to these phenomena, expression of MyoD and Myf5 were increased, and the expression of myostatin was decreased. Together, these results suggest the potential for using duck FST fusion protein to inhibit myostatin activity and subsequently to enhance muscle growth in vivo. The mechanism by which FST regulates muscle development in the duck is similar to that in mammals and fishes.

  10. Cloning and expression of follistatin gene in half-smooth tongue sole Cynoglossus semilaevis during the reproduction cycle

    Science.gov (United States)

    Wen, Haishen; Si, Yufeng; Zhang, Yuanqing; He, Feng; Li, Jifang

    2015-03-01

    Follistatin (FST) is a monomeric glycoprotein highly enriched in cysteines and belongs to TGF-β superfamily. FST can suppress the secretion of follicle-stimulating hormone and plays a vital role in the reproduction of vertebrates. We used rapid amplification of cDNA ends technology to clone the FST gene of half-smooth tongue sole, Cynoglossus semilaevis. We characterized its phylogenetic context and expression patterns to elucidate its function in the breeding season. The full-length sequence of FST is 1 455 bp and encodes a protein of 321 amino acids. We investigated the expression pattern of FST in C. semilaevis at different stages of reproduction using reverse transcription-polymerase chain reaction (RTPCR). FST mRNA was expressed in all 13 tissues analyzed, and was expressed at high levels in gonad and at slightly lower levels in gill and brain. During the reproductive cycle of C. semilaevis, the transcript level of FST was the highest in the perinucleolus stage, decreased in the primary yolk stage, slightly increased in the tertiary yolk stage, and then reduced to a minimal level in the atretic follicles stage of the ovary. We concluded that FST suppressed follicle-stimulating hormone, which stimulated oocyte development. However, no significant variation was observed across all stages of testis development, although the expression level in the spermatogenesis stage was relatively low, which may result from the regulation of FST by aromatase.

  11. Selective androgen receptor modulator, YK11, regulates myogenic differentiation of C2C12 myoblasts by follistatin expression.

    Science.gov (United States)

    Kanno, Yuichiro; Ota, Rumi; Someya, Kousuke; Kusakabe, Taichi; Kato, Keisuke; Inouye, Yoshio

    2013-01-01

    The myogenic differentiation of C2C12 myoblast cells is induced by the novel androgen receptor (AR) partial agonist, (17α,20E)-17,20-[(1-methoxyethylidene)bis-(oxy)]-3-oxo-19-norpregna-4,20-diene-21-carboxylic acid methyl ester (YK11), as well as by dihydrotestosterone (DHT). YK11 is a selective androgen receptor modulator (SARM), which activates AR without the N/C interaction. In this study, we further investigated the mechanism by which YK11 induces myogenic differentiation of C2C12 cells. The induction of key myogenic regulatory factors (MRFs), such as myogenic differentiation factor (MyoD), myogenic factor 5 (Myf5) and myogenin, was more significant in the presence of YK11 than in the presence of DHT. YK11 treatment of C2C12 cells, but not DHT, induced the expression of follistatin (Fst), and the YK11-mediated myogenic differentiation was reversed by anti-Fst antibody. These results suggest that the induction of Fst is important for the anabolic effect of YK11.

  12. EFFECTS OF CONCENTRIC AND ECCENTRIC MUSCLE ACTIONS ON SERUM MYOSTATIN AND FOLLISTATIN-LIKE RELATED GENE LEVELS

    Directory of Open Access Journals (Sweden)

    Lemuel Taylor

    2004-12-01

    Full Text Available The present study determined the effects of concentric and eccentric muscle actions on the contents of serum myostatin and follistatin-like related gene (FLRG. Eight untrained males performed one exercise bout with each leg, separated by three weeks. One bout consisted of 7 sets of 10 repetitions of eccentric muscle actions of the knee extensors at 150% of the concentric 1-RM while the other bout consisted of 7 sets of 10 repetitions of concentric muscle actions at 75% 1-RM. The legs used and the bouts performed were randomized. Five days prior to each exercise bout, baseline measurements were taken for muscle strength. For both bouts, a venous blood sample was obtained immediately prior to exercise and again at 6, 24, and 48 hr post-exercise. Data were analyzed with 2 X 4 (bout x test ANOVA (p < 0.05. Increases in serum myostatin and FLRG occurred with each exercise bout and, excluding 48 hr post-exercise, were significantly correlated to one another (p < 0.05. After eccentric exercise, peak increases of 68% and 50% (p < 0.05 were observed for myostatin and FLRG, respectively. Similar increases of 54% and 44% (p < 0.05 were observed after concentric muscle actions. There was no significant difference in expression of myostatin or FLRG as a function of muscle action type. Our results suggest that a single bout of exercise with either eccentric or concentric muscle actions appear to elicit a similar increase in serum myostatin and FLRG. Therefore, the type of muscle action may not be as much a mitigating factor for increasing serum myostatin and FLRG rather than the muscle action per se.

  13. Does follistatin gene have any direct role in the manifestation of polycystic ovary syndrome in Indian women?

    Directory of Open Access Journals (Sweden)

    S Dasgupta

    2012-01-01

    Full Text Available Background: Out of a panel of 37 candidate genes tested for linkage with polycystic ovary syndrome (PCOS, the strongest evidence of linkage was reported in the follistatin (FST gene region. Subsequently, a couple of studies outside India investigated the FST gene for the presence of any mutations and its association with PCOS and the results were found to be largely inconsistent probably due to differences in the ethnic backgrounds and small sample sizes. Aims: To screen the FST gene for mutations and to establish their association pattern with PCOS among a large cohort of South Indian women. Settings and Design: Case-control study. Materials and Methods: PCOS cases were recruited according to the 2003 Rotterdam diagnostic criteria. All the exons of the FST gene were amplified and analyzed in all the cases and controls for the presence of mutations using polymerase chain reaction (PCR and direct DNA sequencing. Results: A total of 549 women consisting of 250 PCOS cases and 299 controls were recruited for the study. No mutations were found in any of the exons of the FST gene in our Indian sample which is consistent with an earlier finding among the Asian women from Singapore. Although three of the four cohorts of Caucasian background studied earlier reported variants, none of them could establish a strong association with PCOS. Conclusions: The occurrence of the exonic variants of FST gene seems to be dependent on the ethnic background of the subjects under study and its role in the PCOS pathophysiology cannot be established with hitherto available evidence.

  14. Follistatin modulates a BMP autoregulatory loop to control the size and patterning of sensory domains in the developing tongue.

    Science.gov (United States)

    Beites, Crestina L; Hollenbeck, Piper L W; Kim, Joon; Lovell-Badge, Robin; Lander, Arthur D; Calof, Anne L

    2009-07-01

    The regenerative capacity of many placode-derived epithelial structures makes them of interest for understanding the molecular control of epithelial stem cells and their niches. Here, we investigate the interaction between the developing epithelium and its surrounding mesenchyme in one such system, the taste papillae and sensory taste buds of the mouse tongue. We identify follistatin (FST) as a mesenchymal factor that controls size, patterning and gustatory cell differentiation in developing taste papillae. FST limits expansion and differentiation of Sox2-expressing taste progenitor cells and negatively regulates the development of taste papillae in the lingual epithelium: in Fst(-/-) tongue, there is both ectopic development of Sox2-expressing taste progenitors and accelerated differentiation of gustatory cells. Loss of Fst leads to elevated activity and increased expression of epithelial Bmp7; the latter effect is consistent with BMP7 positive autoregulation, a phenomenon we demonstrate directly. We show that FST and BMP7 influence the activity and expression of other signaling systems that play important roles in the development of taste papillae and taste buds. In addition, using computational modeling, we show how aberrations in taste papillae patterning in Fst(-/-) mice could result from disruption of an FST-BMP7 regulatory circuit that normally suppresses noise in a process based on diffusion-driven instability. Because inactivation of Bmp7 rescues many of the defects observed in Fst(-/-) tongue, we conclude that interactions between mesenchyme-derived FST and epithelial BMP7 play a central role in the morphogenesis, innervation and maintenance of taste buds and their stem/progenitor cells.

  15. A genetic polymorphism affects the risk and prognosis of renal cell carcinoma: association with follistatin-like protein 1 expression

    Science.gov (United States)

    Liu, Yan; Han, Xue; Yu, Yongwei; Ding, Yibo; Ni, Chong; Liu, Wenbin; Hou, Xiaomei; Li, Zixiong; Hou, Jianguo; Shen, Dan; Yin, Jianhua; Zhang, Hongwei; Thompson, Timothy C.; Tan, Xiaojie; Cao, Guangwen

    2016-01-01

    Few single nucleotide polymorphisms (SNPs) associated with the risk of renal cell carcinoma (RCC) have been identified, yet genetic predisposition contributes significantly to this malignancy. We previously showed that follistatin-like 1 (FSTL1) was significantly down-regulated in clear cell RCC (ccRCC), in particular metastatic ccRCC. In the present study, we systemically investigated the associations of the 6 SNPs within FSTL1-coding genomic region with RCC risk and postoperative prognosis. Age- and gender-matched case-control study (417 vs 855) indicated that rs1259293 variant genotype CC was significantly associated with an increased risk of RCC, with an odds ratio of 2.004 (95% confidence internal [CI] = 1.190–3.375). Multivariate Cox regression analysis in 309 of 417 cases showed that rs1259293 genotype (CC vs TT + CT) independently predicted an unfavorable prognosis, with a hazard ratio of 2.531 (95% CI = 1.052–6.086). Expression of FSTL1 was significantly higher in adjacent renal tissues than in tumors, and significantly higher in the tissues with rs1259293 TT genotype than in those with rs1259293 TC+CC genotypes. rs1259293 C allele might generate a CTCF binding site that blocks trans-activation of FSTL1 expression. Our results indicate that rs1259293 is associated with an increased risk and unfavorable postoperative prognosis of RCC, possibly by down-regulating FSTL1 expression in renal tissues. PMID:27225192

  16. Over-expression of Follistatin-like 3 attenuates fat accumulation and improves insulin sensitivity in mice.

    Science.gov (United States)

    Brandt, Claus; Hansen, Rasmus Hvass; Hansen, Jakob Bondo; Olsen, Caroline Holkmann; Galle, Pia; Mandrup-Poulsen, Thomas; Gehl, Julie; Pedersen, Bente Klarlund; Hojman, Pernille

    2015-02-01

    Follistatin-like 3 (fstl3), a natural inhibitor of members of the TGF-β family, increases during resistance training in human plasma. Fstl3 primarily binds myostatin and activin A, and thereby inhibits their functions. We hypothesize that blocking myostatin and activin A signalling through systemic fstl3 over-expression protects against diet-induced obesity and insulin resistance. Fstl3 was over-expressed by DNA electrotransfer in tibialis anterior, quadriceps and gastrocnemius muscles in female C57BL/C mice, and the mice were subsequently randomized to chow or high-fat feeding. Body weight, food intake, fat accumulation by MR scanning, and glucose, insulin and glucagon tolerance were evaluated, as was the response in body weight and metabolic parameters to 24h fasting. Effects of fstl3 on pancreatic insulin and glucagon content, and pancreatic islet morphology were determined. Fstl3 over-expression reduced fat accumulation during high-fat feeding by 16%, and liver fat by 50%, as determined by MRI. No changes in body weight were observed, while the weight of the transfected muscles increased by 10%. No transcriptional changes were found in the subcutaneous adipose tissue. Fstl3 mice displayed improved insulin sensitivity and muscle insulin signalling. In contrast, glucose tolerance was impaired in high-fat fed fstl3 mice, which was explained by increased hepatic glucagon sensitivity and glucose output, as well as a decrease in the pancreatic insulin/glucagon ratio. Accordingly, fstl3 transfection improved counter-regulation to 24h fasting. Fstl3 over-expression regulates insulin and glucagon sensitivities through increased muscular insulin action, as well as increased hepatic glucagon sensitivity and pancreatic glucagon content. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Damage-induced DNA replication stalling relies on MAPK-activated protein kinase 2 activity

    DEFF Research Database (Denmark)

    Köpper, Frederik; Bierwirth, Cathrin; Schön, Margarete

    2013-01-01

    DNA damage can obstruct replication forks, resulting in replicative stress. By siRNA screening, we identified kinases involved in the accumulation of phosphohistone 2AX (γH2AX) upon UV irradiation-induced replication stress. Surprisingly, the strongest reduction of phosphohistone 2AX followed...... replication impaired by gemcitabine or by Chk1 inhibition. This rescue strictly depended on translesion DNA polymerases. In conclusion, instead of being an unavoidable consequence of DNA damage, alterations of replication speed and origin firing depend on MK2-mediated signaling....... knockdown of the MAP kinase-activated protein kinase 2 (MK2), a kinase currently implicated in p38 stress signaling and G2 arrest. Depletion or inhibition of MK2 also protected cells from DNA damage-induced cell death, and mice deficient for MK2 displayed decreased apoptosis in the skin upon UV irradiation...

  18. Pyrrolopyridine inhibitors of mitogen-activated protein kinase-activated protein kinase 2 (MK-2).

    Science.gov (United States)

    Anderson, David R; Meyers, Marvin J; Vernier, William F; Mahoney, Matthew W; Kurumbail, Ravi G; Caspers, Nicole; Poda, Gennadiy I; Schindler, John F; Reitz, David B; Mourey, Robert J

    2007-05-31

    A new class of potent kinase inhibitors selective for mitogen-activated protein kinase-activated protein kinase 2 (MAPKAP-K2 or MK-2) for the treatment of rheumatoid arthritis has been prepared and evaluated. These inhibitors have IC50 values as low as 10 nM against the target and have good selectivity profiles against a number of kinases including CDK2, ERK, JNK, and p38. These MK-2 inhibitors have been shown to suppress TNFalpha production in U397 cells and to be efficacious in an acute inflammation model. The structure-activity relationships of this series, the selectivity for MK-2 and their activity in both in vitro and in vivo models are discussed. The observed selectivity is discussed with the aid of an MK-2/inhibitor crystal structure.

  19. Identifying allosteric fluctuation transitions between different protein conformational states as applied to Cyclin Dependent Kinase 2

    Directory of Open Access Journals (Sweden)

    Gu Jenny

    2007-02-01

    Full Text Available Abstract Background The mechanisms underlying protein function and associated conformational change are dominated by a series of local entropy fluctuations affecting the global structure yet are mediated by only a few key residues. Transitional Dynamic Analysis (TDA is a new method to detect these changes in local protein flexibility between different conformations arising from, for example, ligand binding. Additionally, Positional Impact Vertex for Entropy Transfer (PIVET uses TDA to identify important residue contact changes that have a large impact on global fluctuation. We demonstrate the utility of these methods for Cyclin-dependent kinase 2 (CDK2, a system with crystal structures of this protein in multiple functionally relevant conformations and experimental data revealing the importance of local fluctuation changes for protein function. Results TDA and PIVET successfully identified select residues that are responsible for conformation specific regional fluctuation in the activation cycle of Cyclin Dependent Kinase 2 (CDK2. The detected local changes in protein flexibility have been experimentally confirmed to be essential for the regulation and function of the kinase. The methodologies also highlighted possible errors in previous molecular dynamic simulations that need to be resolved in order to understand this key player in cell cycle regulation. Finally, the use of entropy compensation as a possible allosteric mechanism for protein function is reported for CDK2. Conclusion The methodologies embodied in TDA and PIVET provide a quick approach to identify local fluctuation change important for protein function and residue contacts that contributes to these changes. Further, these approaches can be used to check for possible errors in protein dynamic simulations and have the potential to facilitate a better understanding of the contribution of entropy to protein allostery and function.

  20. Role of the beta subunit of casein kinase-2 on the stability and specificity of the recombinant reconstituted holoenzyme

    DEFF Research Database (Denmark)

    Meggio, F; Boldyreff, B; Marin, O;

    1992-01-01

    Recombinant human alpha subunit from casein kinase-2 (CK-2) was subjected, either alone or in combination with recombinant human beta subunit, to high temperature, tryptic digestion and urea treatment. In all three cases, it was shown that the presence of the beta subunit could drastically reduce...

  1. Extracellular signal-regulated kinases control expression of G protein-coupled receptor kinase 2 (GRK2)

    DEFF Research Database (Denmark)

    Theilade, Juliane; Lerche Hansen, Jakob; Haunsø, Stig;

    2002-01-01

    G protein-coupled receptor kinase 2 (GRK2) phosphorylates G protein-coupled receptors resulting in uncoupling from G proteins. Receptors modulate GRK2 expression, however the mechanistic basis for this effect is largely unknown. Here we report a novel mechanism by which receptors use...

  2. Calcium calmodulin dependent kinase kinase 2 - a novel therapeutic target for gastric adenocarcinoma

    Science.gov (United States)

    Subbannayya, Yashwanth; Syed, Nazia; Barbhuiya, Mustafa A; Raja, Remya; Marimuthu, Arivusudar; Sahasrabuddhe, Nandini; Pinto, Sneha M; Manda, Srikanth Srinivas; Renuse, Santosh; Manju, HC; Zameer, Mohammed Abdul Lateef; Sharma, Jyoti; Brait, Mariana; Srikumar, Kotteazeth; Roa, Juan Carlos; Vijaya Kumar, M; Kumar, KV Veerendra; Prasad, TS Keshava; Ramaswamy, Girija; Kumar, Rekha Vijay; Pandey, Akhilesh; Gowda, Harsha; Chatterjee, Aditi

    2015-01-01

    Gastric cancer is one of the most common gastrointestinal malignancies and is associated with poor prognosis. Exploring alterations in the proteomic landscape of gastric cancer is likely to provide potential biomarkers for early detection and molecules for targeted therapeutic intervention. Using iTRAQ-based quantitative proteomic analysis, we identified 22 proteins that were overexpressed and 17 proteins that were downregulated in gastric tumor tissues as compared to the adjacent normal tissue. Calcium/calmodulin-dependent protein kinase kinase 2 (CAMKK2) was found to be 7-fold overexpressed in gastric tumor tissues. Immunohistochemical labeling of tumor tissue microarrays for validation of CAMKK2 overexpression revealed that it was indeed overexpressed in 94% (92 of 98) of gastric cancer cases. Silencing of CAMKK2 using siRNA significantly reduced cell proliferation, colony formation and invasion of gastric cancer cells. Our results demonstrate that CAMKK2 signals in gastric cancer through AMPK activation and suggest that CAMKK2 could be a novel therapeutic target in gastric cancer. PMID:25756516

  3. Casein Kinase 2 Reverses Tail-Independent Inactivation of Kinesin-1

    Science.gov (United States)

    Xu, Jing; Reddy, Babu J. N.; Anand, Preetha; Shu, Zhanyong; Cermelli, Silvia; Mattson, Michelle K.; Tripathy, Suvranta K.; Hoss, Matthew T.; James, Nikita S.; King, Stephen J.; Huang, Lan; Bardwell, Lee; Gross, Steven P.

    2013-01-01

    Kinesin-1 is a plus-end microtubule-based motor, and defects in kinesin-based transport are linked to diseases including neurodegeneration. Kinesin can auto-inhibit via a head-tail interaction, but is believed to be active otherwise. Here we report a tail-independent inactivation of kinesin, reversible by the disease-relevant signaling protein, casein kinase 2 (CK2). The majority of initially active kinesin (native or tail-less) loses its ability to interact with microtubules in vitro, and CK2 reverses this inactivation (~ 4-fold) without altering kinesin’s single motor properties. This activation pathway does not require motor phosphorylation, and is independent of head-tail auto-inhibition. In cultured mammalian cells, reducing CK2 expression, but not its kinase activity, decreases the force required to stall lipid droplet transport, consistent with a decreased number of active kinesin motors. Our results provide the first direct evidence of a protein kinase up-regulating kinesin-based transport, and suggest a novel pathway for regulating the activity of cargo-bound kinesin. PMID:22453827

  4. Regulation of Ikaros function by casein kinase 2 and protein phosphatase 1

    Institute of Scientific and Technical Information of China (English)

    Amy; K; Erbe; Aleksandar; Savic; Sinisa; Dovat

    2011-01-01

    The Ikaros gene encodes a zinc finger,DNA-binding protein that regulates gene transcription and chromatin remodeling.Ikaros is a master regulator of hematopoiesis and an established tumor suppressor.Moderate alteration of Ikaros activity (e.g.haploinsufficiency) appears to be sufficient to promote malignant transformation in human hematopoietic cells.This raises questions about the mechanisms that normally regulate Ikaros function and the potential of these mechanisms to contribute to the development of leukemia.The focus of this review is the regulation of Ikaros function by phosphorylation/dephosphorylation.Site-specific phosphorylation of Ikaros by casein kinase 2 (CK2) controls Ikaros DNA-binding ability and subcellular localization.As a consequence,the ability of Ikaros to regulate cell cycle progression,chromatin remodeling,target gene expression,and thymocyte differentiation are controlled by CK2.In addition,hyperphosphorylation of Ikaros by CK2 leads to decreased Ikaros levels due to ubiquitinmediated degradation.Dephosphorylation of Ikaros by protein phosphatase 1 (PP1) acts in opposition to CK2 to increase Ikaros stability and restore Ikaros DNA binding ability and pericentromeric localization.Thus,the CK2 and PP1 pathways act in concert to regulate Ikaros activity in hematopoiesis and as a tumor suppressor.This highlights the importance of these signal transduction pathways as potential mediators of leukemogenesis via their role in regulating the activities of Ikaros.

  5. G-protein-coupled receptor kinase 2 and endothelial dysfunction: molecular insights and pathophysiological mechanisms.

    Science.gov (United States)

    Taguchi, Kumiko; Matsumoto, Takayuki; Kobayashi, Tsuneo

    2015-01-01

    Smooth muscle cells (SMC) and endothelial cells are the major cell types in blood vessels. The principal function of vascular SMC in the body is to regulate blood flow and pressure through contraction and relaxation. The endothelium performs a crucial role in maintaining vascular integrity by achieving whole-organ metabolic homeostasis via the production of factors associated with vasoconstriction or vasorelaxation. In this review, we have focused on the production of nitric oxide (NO), a vasorelaxation factor. The extent of NO production represents a key marker in vascular health. A decrease in NO is capable of inducing pathological conditions associated with endothelial dysfunction, such as obesity, diabetes, cardiovascular disease, and atherosclerosis. Recent studies have strongly implicated the involvement of G-protein-coupled receptor kinase 2 (GRK2) in the progression of cardiovascular disease. Vasculature which is affected by insulin resistance and type 2 diabetes expresses high levels of GRK2, which may induce endothelial dysfunction by reducing intracellular NO. GRK2 activation also induces changes in the subcellular localization of GRK2 itself and also of β-arrestin 2, a downstream protein. In this review, we describe the pathophysiological mechanisms of insulin resistance and diabetes, focusing on the signal transduction for NO production via GRK2 and β-arrestin 2, providing novel insights into the potential field of translational investigation in the treatment of diabetic complications.

  6. Adenylate kinase 2 (AK2 promotes cell proliferation in insect development

    Directory of Open Access Journals (Sweden)

    Chen Ru-Ping

    2012-09-01

    Full Text Available Abstract Background Adenylate kinase 2 (AK2 is a phosphotransferase that catalyzes the reversible reaction 2ADP(GDP ↔ ATP(GTP + AMP and influences cellular energy homeostasis. However, the role of AK2 in regulating cell proliferation remains unclear because AK2 has been reported to be involved in either cell proliferation or cell apoptosis in different cell types of various organisms. Results This study reports AK2 promotion of cell proliferation using the lepidopteran insect Helicoverpa armigera and its epidermal cell line HaEpi as models. Western blot analysis indicates that AK2 constitutively expresses in various tissues during larval development. Immunocytochemistry analysis indicates that AK2 localizes in the mitochondria. The recombinant expressed AK2 in E. coli promotes cell growth and viability of HaEpi cell line by 3-(4, 5-Dimethylthiazol-2-yl-2, 5-diphenyltetrazolium bromide (MTT assay. AK2 knockdown in larvae by RNA interference causes larval growth defects, including body weight decrease and development delay. AK2 knockdown in larvae also decreases the number of circulating haemocytes. The mechanism for such effects might be the suppression of gene transcription involved in insect development caused by AK2 knockdown. Conclusion These results show that AK2 regulates cell growth, viability, and proliferation in insect growth and development.

  7. MAPKAP kinase 2 (MK2)-dependent and independent models of blister formation in pemphigus vulgaris

    Science.gov (United States)

    Mao, Xuming; Li, Hong; Sano, Yasuyo; Gaestel, Matthias; Park, Jin Mo; Payne, Aimee S.

    2013-01-01

    Pemphigus vulgaris (PV) is an autoimmune blistering disease characterized by autoantibodies to the keratinocyte adhesion protein desmoglein (Dsg) 3. Previous studies suggest that PV pathogenesis involves p38 mitogen activated protein kinase-dependent and -independent pathways. However, p38 is a difficult protein to study and therapeutically target because it has four isoforms and multiple downstream effectors. In the current study, we identify MAPKAP kinase 2 (MK2) as a downstream effector of p38 signaling in PV and describe MK2-dependent and -independent mechanisms of blister formation using passive transfer of human anti-Dsg IgG4 mAbs to neonatal mice. In human keratinocytes, PV mAbs activate MK2 in a dose-dependent manner. MK2 is also activated in human pemphigus skin blisters, causing translocation of MK2 from the nucleus to the cytosol. Small molecule inhibition of MK2 and silencing of MK2 expression block PV mAb-induced Dsg3 endocytosis in human keratinocytes. Additionally, small molecule inhibition and genetic deletion of p38α and MK2 inhibit spontaneous, but not induced, suprabasal blisters by PV mAbs in mouse passive transfer models. Collectively, these data suggest that MK2 is a key downstream effector of p38 that can modulate PV autoantibody pathogenicity. MK2 inhibition may be a valuable adjunctive therapy for control of pemphigus blistering. PMID:23657501

  8. Reconstitution of normal and hyperactivated forms of casein kinase-2 by variably mutated beta-subunits

    DEFF Research Database (Denmark)

    Boldyreff, B; Meggio, F; Pinna, L A

    1993-01-01

    an altered sedimentation coefficient. The holoenzymes reconstituted with substituted mutants beta A 55,57, beta A55-57, and, to a lesser extent, beta A 59-61, beta A63,64, and beta A5,6 display a basal activity which is higher (up to 4-fold) than that of the wild type holoenzyme.(ABSTRACT TRUNCATED AT 250......Twenty-one mutants of the noncatalytic beta-subunit of human casein kinase-2 have been created, expressed in Escherichia coli, and purified to homogeneity. They are either modified at the autophosphorylation site (mutants beta delta 1-4 and beta A 5,6) or bear variable deletions in their C......-terminal part (mutants beta delta 209-215, beta delta 194-215, beta delta 181-215, beta delta 171-215, beta delta 150-215) or have undergone Ala substitutions for the acidic and basic residues which are concentrated in the sequences 55-70 and 171-180, respectively. All these mutants have been examined...

  9. Regulation of Ceramide Synthase by Casein Kinase 2-dependent Phosphorylation in Saccharomyces cerevisiae*

    Science.gov (United States)

    Fresques, Tara; Niles, Brad; Aronova, Sofia; Mogri, Huzefa; Rakhshandehroo, Taha; Powers, Ted

    2015-01-01

    Complex sphingolipids are important components of eukaryotic cell membranes and, together with their biosynthetic precursors, including sphingoid long chain bases and ceramides, have important signaling functions crucial for cell growth and survival. Ceramides are produced at the endoplasmic reticulum (ER) membrane by a multicomponent enzyme complex termed ceramide synthase (CerS). In budding yeast, this complex is composed of two catalytic subunits, Lac1 and Lag1, as well as an essential regulatory subunit, Lip1. Proper formation of ceramides by CerS has been shown previously to require the Cka2 subunit of casein kinase 2 (CK2), a ubiquitous enzyme with multiple cellular functions, but the precise mechanism involved has remained unidentified. Here we present evidence that Lac1 and Lag1 are direct targets for CK2 and that phosphorylation at conserved positions within the C-terminal cytoplasmic domain of each protein is required for optimal CerS activity. Our data suggest that phosphorylation of Lac1 and Lag1 is important for proper localization and distribution of CerS within the ER membrane and that phosphorylation of these sites is functionally linked to the COP I-dependent C-terminal dilysine ER retrieval pathway. Together, our data identify CK2 as an important regulator of sphingolipid metabolism, and additionally, because both ceramides and CK2 have been implicated in the regulation of cancer, our findings may lead to an enhanced understanding of their relationship in health and disease. PMID:25429105

  10. Regulation of ceramide synthase by casein kinase 2-dependent phosphorylation in Saccharomyces cerevisiae.

    Science.gov (United States)

    Fresques, Tara; Niles, Brad; Aronova, Sofia; Mogri, Huzefa; Rakhshandehroo, Taha; Powers, Ted

    2015-01-16

    Complex sphingolipids are important components of eukaryotic cell membranes and, together with their biosynthetic precursors, including sphingoid long chain bases and ceramides, have important signaling functions crucial for cell growth and survival. Ceramides are produced at the endoplasmic reticulum (ER) membrane by a multicomponent enzyme complex termed ceramide synthase (CerS). In budding yeast, this complex is composed of two catalytic subunits, Lac1 and Lag1, as well as an essential regulatory subunit, Lip1. Proper formation of ceramides by CerS has been shown previously to require the Cka2 subunit of casein kinase 2 (CK2), a ubiquitous enzyme with multiple cellular functions, but the precise mechanism involved has remained unidentified. Here we present evidence that Lac1 and Lag1 are direct targets for CK2 and that phosphorylation at conserved positions within the C-terminal cytoplasmic domain of each protein is required for optimal CerS activity. Our data suggest that phosphorylation of Lac1 and Lag1 is important for proper localization and distribution of CerS within the ER membrane and that phosphorylation of these sites is functionally linked to the COP I-dependent C-terminal dilysine ER retrieval pathway. Together, our data identify CK2 as an important regulator of sphingolipid metabolism, and additionally, because both ceramides and CK2 have been implicated in the regulation of cancer, our findings may lead to an enhanced understanding of their relationship in health and disease.

  11. Modulation of Janus kinase 2 by p53 in ovarian cancer cells.

    Science.gov (United States)

    Reid, Thomas; Jin, Xiaohong; Song, Hui; Tang, Huai-Jing; Reynolds, R Kevin; Lin, Jiayuh

    2004-08-20

    The constitutive activation of the Janus kinase 2 (JAK2) and mutation of the p53 tumor suppressor are both detected in human cancer. We examined the potential regulation of JAK2 phosphorylation by wild-type (wt) p53 in human ovarian cancer cell lines, Caov-3 and MDAH2774, which harbor mutant form of p53 tumor suppressor gene and high levels of phosphorylated JAK2. The wt p53 gene was re-introduced into the cells using an adenovirus vector. In addition to wt p53, mutant p53 22/23, mutant p53-175, and NCV (negative control virus) were introduced into the cells in the control groups. Expression of wt p53, but not that of p53-175 mutant, diminished JAK2 tyrosine phosphorylation in MDAH2774 and Caov-3 cell lines. Expression of wt p53 or p53 22/23 mutant did not cause a reduction in the phosphorylation of unrelated protein kinases, ERK1 and ERK2 (ERK1/2). The inhibition of JAK2 tyrosine phosphorylation can be reversed by tyrosine phosphatase inhibitor, sodium orthovanadate. Protein tyrosine phosphatase 1-B levels increased with introduction of wt p53 and may be involved in the dephosphorylation of JAK2. These findings present a possible p53-dependent cellular process of modulating JAK2 tyrosine phosphorylation in ovarian cancer cell lines.

  12. Crystal structure of the polo-box domain of polo-like kinase 2.

    Science.gov (United States)

    Shan, Hong-Mei; Wang, Tao; Quan, Jun-Min

    2015-01-16

    Polo-like kinase 2 (PLK2) is a crucial regulator in cell cycle progression, DNA damage response, and neuronal activity. PLK2 is characterized by the conserved N-terminal kinase domain and the unique C-terminal polo-box domain (PBD). The PBD mediates diverse functions of PLK2 by binding phosphorylated Ser-pSer/pThr motifs of its substrates. Here, we report the first crystal structure of the PBD of PLK2. The overall structure of the PLK2 PBD is similar to that of the PLK1 PBD, which is composed by two polo boxes each contain β6α structures that form a 12-stranded β sandwich domain. The edge of the interface between the two polo boxes forms the phosphorylated Ser-pSer/pThr motifs binding cleft. On the hand, the peripheral regions around the core binding cleft of the PLK2 PBD is distinct from that of the PLK1 PBD, which might confer the substrate specificity of the PBDs of the polo-like kinase family. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. P90 Ribosomal s6 kinase 2 negatively regulates axon growth in motoneurons.

    Science.gov (United States)

    Fischer, Matthias; Pereira, Patricia Marques; Holtmann, Bettina; Simon, Christian M; Hanauer, Andre; Heisenberg, Martin; Sendtner, Michael

    2009-10-01

    Mutations in Ribosomal s6 kinase 2 (Rsk2) are associated with severe neuronal dysfunction in Coffin-Lowry syndrome (CLS) patients, flies and mice. So far, the mechanisms of how Rsk2 regulates development, maintenance and activity of neurons are not understood. We have investigated the consequences of Rsk2 deficiency in mouse spinal motoneurons. Survival of isolated Rsk2 deficient motoneurons is not reduced, but these cells grow significantly longer neurites. Conversely, overexpression of a constitutively active form of Rsk2 leads to reduced axon growth. Increased axon growth in Rsk2 deficient neurons was accompanied by higher Erk 1/2 phosphorylation, and the knockout phenotype could be rescued by pharmacological inhibition of MAPK/Erk kinase (Mek). These data indicate that Rsk2 negatively regulates axon elongation via the MAPK pathway. Thus, the functional defects observed in the nervous system of CLS patients and animal models with Rsk2 deficiency might be caused by dysregulated neurite growth rather than primary neurodegeneration.

  14. Janus kinase 2 mutations in cases with BCR-ABL-negative chronic myeloproliferative disorders from Turkey

    Science.gov (United States)

    Yildiz, Ismail; Yokuş, Osman; Gedik, Habip

    2017-01-01

    Objective: We aimed to investigate the frequency of Janus kinase 2 (JAK2) mutations in cases with chronic myeloproliferative disorders (CMDs), and the relationship between the presence of JAK2 mutation and leukocytosis and splenomegaly, retrospectively. Materials and Methods: Patients, who were diagnosed with BCR-ABL-negative CMDs according to diagnosis criteria of the World Health Organization and followed up at the hematology clinic between 2013 and 2015, were investigated in terms of the frequency of JAK2 mutation in cases with CMDs, and the relationship between the presence of JAK2 mutation and leukocytosis and splenomegaly, retrospectively. Results: In total, 100 patients, who were diagnosed with BCR-ABL-negative CMDs, were evaluated retrospectively. The mean age of the patients with JAK2 positivity was significantly higher compared to patients with negative. JAK2-positivity rates in the age groups were significantly different. Gender, diagnosis, splenomegaly, and leukocytosis were not statistically different for JAK2 positivity between the groups. Conclusion: JAK2 V617F mutation is more commonly seen in older age as a risk for complications related to CDMS. Splenomegaly and leukocytosis are not associated with JAK2 V617F mutation. PMID:28182037

  15. Extracellular-regulated kinase 2 is activated by the enhancement of hinge flexibility.

    Science.gov (United States)

    Sours, Kevin M; Xiao, Yao; Ahn, Natalie G

    2014-05-01

    Protein motions underlie conformational and entropic contributions to enzyme catalysis; however, relatively little is known about the ways in which this occurs. Studies of the mitogen-activated protein kinase ERK2 (extracellular-regulated protein kinase 2) by hydrogen-exchange mass spectrometry suggest that activation enhances backbone flexibility at the linker between N- and C-terminal domains while altering nucleotide binding mode. Here, we address the hypothesis that enhanced backbone flexibility within the hinge region facilitates kinase activation. We show that hinge mutations enhancing flexibility promote changes in the nucleotide binding mode consistent with domain movement, without requiring phosphorylation. They also lead to the activation of monophosphorylated ERK2, a form that is normally inactive. The hinge mutations bypass the need for pTyr but not pThr, suggesting that Tyr phosphorylation controls hinge motions. In agreement, monophosphorylation of pTyr enhances both hinge flexibility and nucleotide binding mode, measured by hydrogen-exchange mass spectrometry. Our findings demonstrate that regulated protein motions underlie kinase activation. Our working model is that constraints to domain movement in ERK2 are overcome by phosphorylation at pTyr, which increases hinge dynamics to promote the active conformation of the catalytic site.

  16. Investigation of the Rho-kinase 2 gene Thr431Asn polymorphism in migraine

    Directory of Open Access Journals (Sweden)

    Samiye Uslu Kuzudisli

    2014-01-01

    Full Text Available Background: Migraine has a complex etiology determined by genetic and environmental factors, but the molecular mechanisms and genetics of this disease have not yet been fully clarified. Aim: This case/control study was designed to analyze the genotype distributions and allele frequencies for the Rho-kinase 2 (ROCK2 gene Thr431Asn polymorphism among the migraine patients. Materials and Methods: A total of 155 migraine patients and 155 healthy age and sex matched controls were included in this study. Genomic deoxyribonucleic acid from migraine patients and controls was analyzed by real-time polymerase chain reaction. Results: Neither genotype distributions nor the allele frequencies for the Thr431Asn polymorphism showed a significant difference between the groups. In addition, there were no marked differences in genotype and allele frequencies for the migraine without aura and migraine with aura subgroups when compared with control group. Conclusion: This is the first study to show that the ROCK2 gene Thr431Asn polymorphism is not a risk factor for the migraine in the Turkish population.

  17. Complex regulation of CREB-binding protein by homeodomain-interacting protein kinase 2

    KAUST Repository

    Kovács, Krisztián A.

    2015-11-01

    CREB-binding protein (CBP) and p300 are transcriptional coactivators involved in numerous biological processes that affect cell growth, transformation, differentiation, and development. In this study, we provide evidence of the involvement of homeodomain-interacting protein kinase 2 (HIPK2) in the regulation of CBP activity. We show that HIPK2 interacts with and phosphorylates several regions of CBP. We demonstrate that serines 2361, 2363, 2371, 2376, and 2381 are responsible for the HIPK2-induced mobility shift of CBP C-terminal activation domain. Moreover, we show that HIPK2 strongly potentiates the transcriptional activity of CBP. However, our data suggest that HIPK2 activates CBP mainly by counteracting the repressive action of cell cycle regulatory domain 1 (CRD1), located between amino acids 977 and 1076, independently of CBP phosphorylation. Our findings thus highlight a complex regulation of CBP activity by HIPK2, which might be relevant for the control of specific sets of target genes involved in cellular proliferation, differentiation and apoptosis. © 2015 Elsevier Inc.

  18. MAPKAP kinase 2 (MK2)-dependent and -independent models of blister formation in pemphigus vulgaris.

    Science.gov (United States)

    Mao, Xuming; Li, Hong; Sano, Yasuyo; Gaestel, Matthias; Mo Park, Jin; Payne, Aimee S

    2014-01-01

    Pemphigus vulgaris (PV) is an autoimmune blistering disease characterized by autoantibodies to the keratinocyte adhesion protein desmoglein 3 (Dsg3). Previous studies suggest that PV pathogenesis involves p38 mitogen-activated protein kinase-dependent and -independent pathways. However, p38 is a difficult protein to study and therapeutically target because it has four isoforms and multiple downstream effectors. In this study, we identify MAPKAP (mitogen-activated protein kinase-activated protein) kinase 2 (MK2) as a downstream effector of p38 signaling in PV and describe MK2-dependent and -independent mechanisms of blister formation using passive transfer of human anti-Dsg IgG4 mAbs to neonatal mice. In human keratinocytes, PV mAbs activate MK2 in a dose-dependent manner. MK2 is also activated in human pemphigus skin blisters, causing translocation of MK2 from the nucleus to the cytosol. Small-molecule inhibition of MK2 and silencing of MK2 expression block PV mAb-induced Dsg3 endocytosis in human keratinocytes. In addition, small-molecule inhibition and genetic deletion of p38α and MK2 inhibit spontaneous but not induced suprabasal blisters by PV mAbs in mouse passive transfer models. Collectively, these data suggest that MK2 is a key downstream effector of p38 that can modulate PV autoantibody pathogenicity. MK2 inhibition may be a valuable adjunctive therapy for control of pemphigus blistering.

  19. Repeat-until-success quantum repeaters

    Science.gov (United States)

    Bruschi, David Edward; Barlow, Thomas M.; Razavi, Mohsen; Beige, Almut

    2014-09-01

    We propose a repeat-until-success protocol to improve the performance of probabilistic quantum repeaters. Conventionally, these rely on passive static linear-optics elements and photodetectors to perform Bell-state measurements (BSMs) with a maximum success rate of 50%. This is a strong impediment for entanglement swapping between distant quantum memories. Every time a BSM fails, entanglement needs to be redistributed between the corresponding memories in the repeater link. The key ingredients of our scheme are repeatable BSMs. Under ideal conditions, these turn probabilistic quantum repeaters into deterministic ones. Under realistic conditions, our protocol too might fail. However, using additional threshold detectors now allows us to improve the entanglement generation rate by almost orders of magnitude, at a nominal distance of 1000 km, compared to schemes that rely on conventional BSMs. This improvement is sufficient to make the performance of our scheme comparable to the expected performance of some deterministic quantum repeaters.

  20. Hormonal and photoperiodic modulation of testicular mRNAs coding for inhibin/activin subunits and follistatin in Clethrionomys glareolus, Schreber.

    Science.gov (United States)

    Tähkä, K M; Kaipia, A; Toppari, J; Tähkä, S; Tuuri, T; Tuohimaa, P

    1998-07-01

    Photoperiodic and hormonal modulation of mRNAs for testicular inhibin/activin subunits and follistatin were studied in a seasonally breeding rodent, the bank vole (Clethrionomys glareolus). Photoperiod-induced testicular regression had no effect on the relatively low steady-state levels of follistatin mRNA. Inhibin alpha (I alpha) and beta B (I beta B) mRNA levels were significantly higher in regressed than in active gonads, but inhibin beta A was undetectable. The effect of gonadotropin administration on testicular weight and mRNA concentrations differed between the sexually active and quiescent voles. Neither FSH (1.2 U/kg; s.c. for 5 days) nor hCG (600 IU/kg; s.c. for 5 days) affected testicular weight in sexually active voles, whereas both gonadotropins significantly increased testicular weight in photo-regressed individuals. FSH had no effect on I alpha or I beta B mRNA concentrations in the active testes, whereas excessive hCG challenge induced a decrease in the steady-state levels of these mRNAs. FSH induced an increase in I alpha mRNA concentrations in the regressed gonad, whereas both gonadotropins concomitantly down-regulated I beta B mRNA levels. In conclusion, the high expression of I alpha and I beta B mRNA in the regressed testis imply autocrine and paracrine roles for inhibin/activin in the quiescent gonad of seasonal breeders. Inhibin alpha-subunit expression is at least partly under the control of FSH in the bank vole testis.

  1. G Protein–Coupled Receptor Kinase 2 Plays a Relevant Role in Insulin Resistance and Obesity

    Science.gov (United States)

    Garcia-Guerra, Lucia; Nieto-Vazquez, Iria; Vila-Bedmar, Rocio; Jurado-Pueyo, María; Zalba, Guillermo; Díez, Javier; Murga, Cristina; Fernández-Veledo, Sonia; Mayor, Federico; Lorenzo, Margarita

    2010-01-01

    OBJECTIVE Insulin resistance is associated with the pathogenesis of metabolic disorders as type 2 diabetes and obesity. Given the emerging role of signal transduction in these syndromes, we set out to explore the possible role that G protein–coupled receptor kinase 2 (GRK2), first identified as a G protein–coupled receptor regulator, could have as a modulator of insulin responses. RESEARCH DESIGN AND METHODS We analyzed the influence of GRK2 levels in insulin signaling in myoblasts and adipocytes with experimentally increased or silenced levels of GRK2, as well as in GRK2 hemizygous animals expressing 50% lower levels of this kinase in three different models of insulin resistance: tumor necrosis factor-α (TNF-α) infusion, aging, and high-fat diet (HFD). Glucose transport, whole-body glucose and insulin tolerance, the activation status of insulin pathway components, and the circulating levels of important mediators were measured. The development of obesity and adipocyte size with age and HFD was analyzed. RESULTS Altering GRK2 levels markedly modifies insulin-mediated signaling in cultured adipocytes and myocytes. GRK2 levels are increased by ∼2-fold in muscle and adipose tissue in the animal models tested, as well as in lymphocytes from metabolic syndrome patients. In contrast, hemizygous GRK2 mice show enhanced insulin sensitivity and do not develop insulin resistance by TNF-α, aging, or HFD. Furthermore, reduced GRK2 levels induce a lean phenotype and decrease age-related adiposity. CONCLUSIONS Overall, our data identify GRK2 as an important negative regulator of insulin effects, key to the etiopathogenesis of insulin resistance and obesity, which uncovers this protein as a potential therapeutic target in the treatment of these disorders. PMID:20627936

  2. Purification and characterization of a casein kinase 2-type protein kinase from pea nuclei

    Science.gov (United States)

    Li, H.; Roux, S. J.

    1992-01-01

    Almost all the polyamine-stimulated protein kinase activity associated with the chromatin fraction of nuclei purified from etiolated pea (Pisum sativum L.) plumules is present in a single enzyme that can be extracted from chromatin by 0.35 molar NaCl. This protein kinase can be further purified over 2000-fold by salt fractionation and anion-exchange and casein-agarose column chromatography, after which it is more than 90% pure. The purified kinase has a specific activity of about 650 nanomoles per minute per milligram protein in the absence of polyamines, with either ATP or GTP as phosphoryl donor. Spermidine can stimulate its activity fourfold, with half-maximal activation at about 2 millimolar. Spermine and putrescine also stimulate activity, although somewhat less effectively. This kinase has a tetrameric alpha 2 beta 2 structure with a native molecular weight of 130,000, and subunit molecular weights of 36,000 for the catalytic subunit (alpha) and 29,000 for the regulatory subunit (beta). In western blot analyses, only the alpha subunit reacts strongly with polyclonal antibodies to a Drosophila casein kinase II. The pea kinase can use casein and phosvitin as artificial substrates, phosphorylating both the serine and threonine residues of casein. It has a pH optimum near 8.0, a Vmax of 1.5 micromoles per minute per milligram protein, and a Km for ATP of approximately 75 micromolar. Its activity can be almost completely inhibited by heparin at 5 micrograms per milliliter, but is relatively insensitive to concentrations of staurosporine, K252a, and chlorpromazine that strongly antagonize Ca(2+) -regulated protein kinases. These results are discussed in relation to recent findings that casein kinase 2-type kinases may phosphorylate trans-acting factors that bind to light-regulated promoters in plants.

  3. Regulation of vascular endothelial growth factor expression by homeodomain-interacting protein kinase-2

    Directory of Open Access Journals (Sweden)

    D'Orazi Gabriella

    2008-07-01

    Full Text Available Abstract Background Homeodomain-interacting protein kinase-2 (HIPK2 plays an essential role in restraining tumor progression as it may regulate, by itself or within multiprotein complexes, many proteins (mainly transcription factors involved in cell growth and apoptosis. This study takes advantage of the recent finding that HIPK2 may repress the β-catenin transcription activity. Thus, we investigated whether HIPK2 overexpression may down-regulate vascular endothelial growth factor (VEGF levels (a β-catenin target gene and the role of β-catenin in this regulation, in order to consider HIPK2 as a tool for novel anti-tumoral therapeutical approaches. Methods The regulation of VEGF expression by HIPK2 was evaluated by using luciferase assay with VEGF reporter construct, after overexpression of the β-catenin transcription factor. Relative quantification of VEGF and β-catenin mRNAs were assessed by reverse-transcriptase-PCR (RT-PCR analyses, following HIPK2 overexpression, while β-catenin protein levels were evaluated by western immunoblotting. Results HIPK2 overexpression in tumor cells downregulated VEGF mRNA levels and VEGF promoter activity. The VEGF downregulation was partly depending on HIPK2-mediated β-catenin regulation. Thus, HIPK2 could induce β-catenin protein degradation that was prevented by cell treatment with proteasome inhibitor MG132. The β-catenin degradation was dependent on HIPK2 catalytic activity and independent of p53 and glycogen synthase kinase 3β (GSK-3β activities. Conclusion These results suggest that VEGF might be a target of HIPK2, at least in part, through regulation of β-catenin activity. These findings support the function of HIPK2 as tumor suppressor and hypothesise a role for HIPK2 as antiangiogenic tool in tumor therapy approaches.

  4. Activin-Like Kinase 2 Functions in Peri-implantation Uterine Signaling in Mice and Humans

    Science.gov (United States)

    Clementi, Caterina; Tripurani, Swamy K.; Large, Michael J.; Edson, Mark A.; Creighton, Chad J.; Hawkins, Shannon M.; Kovanci, Ertug; Kaartinen, Vesa; Lydon, John P.; Pangas, Stephanie A.; DeMayo, Francesco J.; Matzuk, Martin M.

    2013-01-01

    Implantation of a blastocyst in the uterus is a multistep process tightly controlled by an intricate regulatory network of interconnected ovarian, uterine, and embryonic factors. Bone morphogenetic protein (BMP) ligands and receptors are expressed in the uterus of pregnant mice, and BMP2 has been shown to be a key regulator of implantation. In this study, we investigated the roles of the BMP type 1 receptor, activin-like kinase 2 (ALK2), during mouse pregnancy by producing mice carrying a conditional ablation of Alk2 in the uterus (Alk2 cKO mice). In the absence of ALK2, embryos demonstrate delayed invasion into the uterine epithelium and stroma, and upon implantation, stromal cells fail to undergo uterine decidualization, resulting in sterility. Mechanistically, microarray analysis revealed that CCAAT/enhancer-binding protein β (Cebpb) expression is suppressed during decidualization in Alk2 cKO females. These findings and the similar phenotypes of Cebpb cKO and Alk2 cKO mice lead to the hypothesis that BMPs act upstream of CEBPB in the stroma to regulate decidualization. To test this hypothesis, we knocked down ALK2 in human uterine stromal cells (hESC) and discovered that ablation of ALK2 alters hESC decidualization and suppresses CEBPB mRNA and protein levels. Chromatin immunoprecipitation (ChIP) analysis of decidualizing hESC confirmed that BMP signaling proteins, SMAD1/5, directly regulate expression of CEBPB by binding a distinct regulatory sequence in the 3′ UTR of this gene; CEBPB, in turn, regulates the expression of progesterone receptor (PGR). Our work clarifies the conserved mechanisms through which BMPs regulate peri-implantation in rodents and primates and, for the first time, uncovers a linear pathway of BMP signaling through ALK2 to regulate CEBPB and, subsequently, PGR during decidualization. PMID:24244176

  5. Mutation analysis of the checkpoint kinase 2 gene in colorectal cancer cell lines

    Institute of Scientific and Technical Information of China (English)

    LIU Wei-dong; ZHONG Bai-yun; ZHANG Yang-de; CHOI Gyu-seog

    2007-01-01

    Background Checkpoint kinase 2 (CHK2) is a DNA damage-activated protein kinase which is involved in cell cycle checkpoint control.CHK2 gene could be a candidate gene for colorectal cancer susceptibility.But there are few systematic repots on mutation of CHK2 in colorectal cancer.Methods The mutations of all 14 exons of CHK2 in 56 colorecfal cancer cell lines were screened systematically.using denaturing high-performance liquid chromatography (DHPLC) to screen the mismatches of the CHK2 exons amplified products,and then the suspected mutant cell lines were scanned by nucleotide sequence analysis.Results VACO400 in CHK2 exon 1a was suspected to have mutation by DHPLC and confirmed by sequence,but this was nonsense mutation.C106,CX-1,HT-29,SK01,SW480,SW620 and VACO400 in CHK2 exon 1b were confirmed to have the same nonsense mutation in 11609 A>G.DLD-1 and HCT-15 in CHK2 exon 2 were confirmed to have missense mutation R145W.which was heterozygous C>T missense mutation at nucleotide 433.leading to an Arg>Trp substitution within the FHA domain.Conclusions The CHK2 mutation in colorectal cancer is a low frequency event.There are just 10 cell lines to have sequence variations in all the 14 exons in 56 colorectal cancer cell lines and only DLD-1/HCT-15 had heterozygous missense mutation.These findings may give useful information of susceptibility of colorectal cancer as single nucleotide polymorphysim.

  6. Phosphoglycerate kinase 2 (PGK2) is essential for sperm function and male fertility in mice.

    Science.gov (United States)

    Danshina, Polina V; Geyer, Christopher B; Dai, Qunsheng; Goulding, Eugenia H; Willis, William D; Kitto, G Barrie; McCarrey, John R; Eddy, E M; O'Brien, Deborah A

    2010-01-01

    Phosphoglycerate kinase 2 (PGK2), an isozyme that catalyzes the first ATP-generating step in the glycolytic pathway, is encoded by an autosomal retrogene that is expressed only during spermatogenesis. It replaces the ubiquitously expressed phosphoglycerate kinase 1 (PGK1) isozyme following repression of Pgk1 transcription by meiotic sex chromosome inactivation during meiotic prophase and by postmeiotic sex chromatin during spermiogenesis. The targeted disruption of Pgk2 by homologous recombination eliminates PGK activity in sperm and severely impairs male fertility, but does not block spermatogenesis. Mating behavior, reproductive organ weights (testis, excurrent ducts, and seminal vesicles), testis histology, sperm counts, and sperm ultrastructure were indistinguishable between Pgk2(-/-) and wild-type mice. However, sperm motility and ATP levels were markedly reduced in males lacking PGK2. These defects in sperm function were slightly less severe than observed in males lacking glyceraldehyde-3-phosphate dehydrogenase, spermatogenic (GAPDHS), the isozyme that catalyzes the step preceding PGK2 in the sperm glycolytic pathway. Unlike Gapdhs(-/-) males, the Pgk2(-/-) males also sired occasional pups. Alternative pathways that bypass the PGK step of glycolysis exist. We determined that one of these bypass enzymes, acylphosphatase, is active in mouse sperm, perhaps contributing to phenotypic differences between mice lacking GAPDHS or PGK2. This study determined that PGK2 is not required for the completion of spermatogenesis, but is essential for sperm motility and male fertility. In addition to confirming the importance of the glycolytic pathway for sperm function, distinctive phenotypic characteristics of Pgk2(-/-) mice may provide further insights into the regulation of sperm metabolism.

  7. Inositol Hexakisphosphate Kinase 2 Promotes Cell Death in Cells with Cytoplasmic TDP-43 Aggregation.

    Science.gov (United States)

    Nagata, Eiichiro; Nonaka, Takashi; Moriya, Yusuke; Fujii, Natsuko; Okada, Yoshinori; Tsukamoto, Hideo; Itoh, Johbu; Okada, Chisa; Satoh, Tadayuki; Arai, Tetsuaki; Hasegawa, Masato; Takizawa, Shunya

    2016-10-01

    TAR DNA-binding protein 43 (TDP-43) has been identified as a major component of ubiquitin-positive inclusions in the brains and spinal cords of patients with frontotemporal lobar degeneration with ubiquitinated inclusions (FTLD-U) or amyotrophic lateral sclerosis (ALS). The phosphorylated C-terminal fragment of TDP-43 forms aggregates in the neuronal cytoplasm, possibly resulting in neuronal cell death in patients with FTLD-U or ALS. The inositol pyrophosphate known as diphosphoinositol pentakisphosphate (InsP7) contains highly energetic pyrophosphate bonds. We previously reported that inositol hexakisphosphate kinase type 2 (InsP6K2), which converts inositol hexakisphosphate (InsP6) to InsP7, mediates cell death in mammalian cells. Moreover, InsP6K2 is translocated from the nucleus to the cytosol during apoptosis. In this study, we verified that phosphorylated TDP-43 co-localized and co-bound with InsP6K2 in the cytoplasm of anterior horn cells of the spinal cord. Furthermore, we verified that cell death was augmented in the presence of cytoplasmic TDP-43 aggregations and activated InsP6K2. However, cells with only cytoplasmic TDP-43 aggregation survived because Akt activity increased. In the presence of both TDP-43 aggregation and activated InsP6K2 in the cytoplasm of cells, the expression levels of HSP90 and casein kinase 2 decreased, as the activity of Akt decreased. These conditions may promote cell death. Thus, InsP6K2 could cause neuronal cell death in patients with FTLD-U or ALS. Moreover, InsP6K2 plays an important role in a novel cell death pathway present in FTLD-U and ALS.

  8. Activin-like kinase 2 functions in peri-implantation uterine signaling in mice and humans.

    Science.gov (United States)

    Clementi, Caterina; Tripurani, Swamy K; Large, Michael J; Edson, Mark A; Creighton, Chad J; Hawkins, Shannon M; Kovanci, Ertug; Kaartinen, Vesa; Lydon, John P; Pangas, Stephanie A; DeMayo, Francesco J; Matzuk, Martin M

    2013-11-01

    Implantation of a blastocyst in the uterus is a multistep process tightly controlled by an intricate regulatory network of interconnected ovarian, uterine, and embryonic factors. Bone morphogenetic protein (BMP) ligands and receptors are expressed in the uterus of pregnant mice, and BMP2 has been shown to be a key regulator of implantation. In this study, we investigated the roles of the BMP type 1 receptor, activin-like kinase 2 (ALK2), during mouse pregnancy by producing mice carrying a conditional ablation of Alk2 in the uterus (Alk2 cKO mice). In the absence of ALK2, embryos demonstrate delayed invasion into the uterine epithelium and stroma, and upon implantation, stromal cells fail to undergo uterine decidualization, resulting in sterility. Mechanistically, microarray analysis revealed that CCAAT/enhancer-binding protein β (Cebpb) expression is suppressed during decidualization in Alk2 cKO females. These findings and the similar phenotypes of Cebpb cKO and Alk2 cKO mice lead to the hypothesis that BMPs act upstream of CEBPB in the stroma to regulate decidualization. To test this hypothesis, we knocked down ALK2 in human uterine stromal cells (hESC) and discovered that ablation of ALK2 alters hESC decidualization and suppresses CEBPB mRNA and protein levels. Chromatin immunoprecipitation (ChIP) analysis of decidualizing hESC confirmed that BMP signaling proteins, SMAD1/5, directly regulate expression of CEBPB by binding a distinct regulatory sequence in the 3' UTR of this gene; CEBPB, in turn, regulates the expression of progesterone receptor (PGR). Our work clarifies the conserved mechanisms through which BMPs regulate peri-implantation in rodents and primates and, for the first time, uncovers a linear pathway of BMP signaling through ALK2 to regulate CEBPB and, subsequently, PGR during decidualization.

  9. Activin-like kinase 2 functions in peri-implantation uterine signaling in mice and humans.

    Directory of Open Access Journals (Sweden)

    Caterina Clementi

    2013-11-01

    Full Text Available Implantation of a blastocyst in the uterus is a multistep process tightly controlled by an intricate regulatory network of interconnected ovarian, uterine, and embryonic factors. Bone morphogenetic protein (BMP ligands and receptors are expressed in the uterus of pregnant mice, and BMP2 has been shown to be a key regulator of implantation. In this study, we investigated the roles of the BMP type 1 receptor, activin-like kinase 2 (ALK2, during mouse pregnancy by producing mice carrying a conditional ablation of Alk2 in the uterus (Alk2 cKO mice. In the absence of ALK2, embryos demonstrate delayed invasion into the uterine epithelium and stroma, and upon implantation, stromal cells fail to undergo uterine decidualization, resulting in sterility. Mechanistically, microarray analysis revealed that CCAAT/enhancer-binding protein β (Cebpb expression is suppressed during decidualization in Alk2 cKO females. These findings and the similar phenotypes of Cebpb cKO and Alk2 cKO mice lead to the hypothesis that BMPs act upstream of CEBPB in the stroma to regulate decidualization. To test this hypothesis, we knocked down ALK2 in human uterine stromal cells (hESC and discovered that ablation of ALK2 alters hESC decidualization and suppresses CEBPB mRNA and protein levels. Chromatin immunoprecipitation (ChIP analysis of decidualizing hESC confirmed that BMP signaling proteins, SMAD1/5, directly regulate expression of CEBPB by binding a distinct regulatory sequence in the 3' UTR of this gene; CEBPB, in turn, regulates the expression of progesterone receptor (PGR. Our work clarifies the conserved mechanisms through which BMPs regulate peri-implantation in rodents and primates and, for the first time, uncovers a linear pathway of BMP signaling through ALK2 to regulate CEBPB and, subsequently, PGR during decidualization.

  10. Virtual Screening for Potential Allosteric Inhibitors of Cyclin-Dependent Kinase 2 from Traditional Chinese Medicine

    Directory of Open Access Journals (Sweden)

    Fang Lu

    2016-09-01

    Full Text Available Cyclin-dependent kinase 2 (CDK2, a member of Cyclin-dependent kinases (CDKs, plays an important role in cell division and DNA replication. It is regarded as a desired target to treat cancer and tumor by interrupting aberrant cell proliferation. Compared to lower subtype selectivity of CDK2 ATP-competitive inhibitors, CDK2 allosteric inhibitor with higher subtype selectivity has been used to treat CDK2-related diseases. Recently, the first crystal structure of CDK2 with allosteric inhibitor has been reported, which provides new opportunities to design pure allosteric inhibitors of CDK2. The binding site of the ATP-competition inhibitors and the allosteric inhibitors are partially overlapped in space position, so the same compound might interact with the two binding sites. Thus a novel screening strategy was essential for the discovery of pure CDK2 allosteric inhibitors. In this study, pharmacophore and molecular docking were used to screen potential CDK2 allosteric inhibitors and ATP-competition inhibitors from Traditional Chinese Medicine (TCM. In the docking result of the allosteric site, the compounds which can act with the CDK2 ATP site were discarded, and the remaining compounds were regarded as the potential pure allosteric inhibitors. Among the results, prostaglandin E1 and nordihydroguaiaretic acid (NDGA were available and their growth inhibitory effect on human HepG2 cell lines was determined by MTT assay. The two compounds could substantially inhibit the growth of HepG2 cell lines with an estimated IC50 of 41.223 μmol/L and 45.646 μmol/L. This study provides virtual screening strategy of allosteric compounds and a reliable method to discover potential pure CDK2 allosteric inhibitors from TCM. Prostaglandin E1 and NDGA could be regarded as promising candidates for CDK2 allosteric inhibitors.

  11. Receptor interacting protein kinase-2 inhibition by CYLD impairs anti-bacterial immune responses in macrophages

    Directory of Open Access Journals (Sweden)

    Katharina eWex

    2016-01-01

    Full Text Available Upon infection with intracellular bacteria, nucleotide oligomerization domain protein 2 (NOD2 recognizes bacterial muramyl dipeptide and binds, subsequently, to receptor-interacting serine/threonine kinase 2 (RIPK2. RIPK2 mediates the activation of immune responses via the nuclear factor-κB (NF-κB and extracellular-signal regulated kinase (ERK pathways. Previously, it has been shown that RIPK2 activation dependens on its K63-ubiquitination by the E3 ligases pellino-3 and ITCH, whereas the deubiquitinating enzyme A20 counter-regulates RIPK2 activity by cleaving K63-polyubiquitin chains from RIPK2. Here, we newly identify the deubiquitinating enzyme CYLD as a new interacting partner and inhibitor of RIPK2. We show that CYLD binds to and removes K63-polyubiquitin chains from RIPK2 in Listeria monocytogenes (Lm infected bone-marrow-derived macrophages (BMDM. CYLD-mediated K63-deubiquitination of RIPK2 resulted in an impaired activation of both NF-κB and ERK1/2 pathways, reduced production of proinflammatory cytokines (IL-6, IL-12, anti-listerial ROS and NO, and, finally, impaired pathogen control. In turn, RIPK2 inhibition by siRNA prevented activation of NF-κB and ERK1/2 and completely abolished the protective effect of CYLD-deficiency with respect to the production of IL-6, NO, ROS and pathogen control. Noteworthy, CYLD also inhibited autophagy of Listeria in a RIPK2-ERK1/2 dependent manner.The protective function of CYLD-deficiency was dependent on IFN-γ pre-stimulation of infected macrophages. Interestingly, the reduced NF-κB activation in CYLD-expressing macrophages limited the protective effect of IFN-γ by reducing NF-κB-dependent STAT1 activation. Taken together, our study identifies CYLD as an important inhibitor of RIPK2-dependent anti-bacterial immune responses in macrophages.

  12. Ca2+-dependent inhibition of G protein-coupled receptor kinase 2 by calmodulin.

    Science.gov (United States)

    Haga, K; Tsuga, H; Haga, T

    1997-02-11

    Agonist- or light-dependent phosphorylation of muscarinic acetylcholine receptor m2 subtypes (m2 receptors) or rhodopsin by G protein-coupled receptor kinase 2 (GRK2) was found to be inhibited by calmodulin in a Ca2+-dependent manner. The phosphorylation was fully inhibited in the absence of G protein betagamma subunits and partially inhibited in the presence of betagamma subunits. The dose-response curve for stimulation by betagamma subunits of the m2 and rhodopsin phosphorylation was shifted to the higher concentration of betagamma subunits by addition of Ca2+-calmodulin. The phosphorylation by GRK2 of a glutathione S-transferase fusion protein containing a peptide corresponding to the central part of the third intracellular loop of m2 receptors (I3-GST) was not affected by Ca2+-calmodulin in the presence or absence of betagamma subunits, but the agonist-dependent stimulation of I3-GST phosphorylation by an I3-deleted m2 receptor mutant in the presence of betagamma subunits was suppressed by Ca2+-calmodulin. These results indicate that Ca2+-calmodulin does not directly interact with the catalytic site of GRK2 but inhibits the kinase activity of GRK2 by interfering with the activation of GRK2 by agonist-bound m2 receptors and G protein betagamma subunits. In agreement with the assumption that GRK2 activity is suppressed by the increase in intracellular Ca2+, the sequestration of m2 receptors expressed in Chinese hamster ovary cells was found to be attenuated by the treatment with a Ca2+ ionophore, A23187.

  13. Drosophila mbm is a nucleolar myc and casein kinase 2 target required for ribosome biogenesis and cell growth of central brain neuroblasts.

    Science.gov (United States)

    Hovhanyan, Anna; Herter, Eva K; Pfannstiel, Jens; Gallant, Peter; Raabe, Thomas

    2014-05-01

    Proper cell growth is a prerequisite for maintaining repeated cell divisions. Cells need to translate information about intracellular nutrient availability and growth cues from energy-sensing organs into growth-promoting processes, such as sufficient supply with ribosomes for protein synthesis. Mutations in the mushroom body miniature (mbm) gene impair proliferation of neural progenitor cells (neuroblasts) in the central brain of Drosophila melanogaster. Yet the molecular function of Mbm has so far been unknown. Here we show that mbm does not affect the molecular machinery controlling asymmetric cell division of neuroblasts but instead decreases their cell size. Mbm is a nucleolar protein required for small ribosomal subunit biogenesis in neuroblasts. Accordingly, levels of protein synthesis are reduced in mbm neuroblasts. Mbm expression is transcriptionally regulated by Myc, which, among other functions, relays information from nutrient-dependent signaling pathways to ribosomal gene expression. At the posttranslational level, Mbm becomes phosphorylated by casein kinase 2 (CK2), which has an impact on localization of the protein. We conclude that Mbm is a new part of the Myc target network involved in ribosome biogenesis, which, together with CK2-mediated signals, enables neuroblasts to synthesize sufficient amounts of proteins required for proper cell growth.

  14. Structure of Human G Protein-Coupled Receptor Kinase 2 in Complex with the Kinase Inhibitor Balanol

    Energy Technology Data Exchange (ETDEWEB)

    Tesmer, John J.G.; Tesmer, Valerie M.; Lodowski, David T.; Steinhagen, Henning; Huber, Jochen (Sanofi); (Michigan); (Texas)

    2010-07-19

    G protein-coupled receptor kinase 2 (GRK2) is a pharmaceutical target for the treatment of cardiovascular diseases such as congestive heart failure, myocardial infarction, and hypertension. To better understand how nanomolar inhibition and selectivity for GRK2 might be achieved, we have determined crystal structures of human GRK2 in complex with G{beta}{gamma} in the presence and absence of the AGC kinase inhibitor balanol. The selectivity of balanol among human GRKs is assessed.

  15. Design and synthesis of carbazole carboxamides as promising inhibitors of Bruton's tyrosine kinase (BTK) and Janus kinase 2 (JAK2).

    Science.gov (United States)

    Liu, Qingjie; Batt, Douglas G; Lippy, Jonathan S; Surti, Neha; Tebben, Andrew J; Muckelbauer, Jodi K; Chen, Lin; An, Yongmi; Chang, Chiehying; Pokross, Matt; Yang, Zheng; Wang, Haiqing; Burke, James R; Carter, Percy H; Tino, Joseph A

    2015-10-01

    Four series of disubstituted carbazole-1-carboxamides were designed and synthesised as inhibitors of Bruton's tyrosine kinase (BTK). 4,7- and 4,6-disubstituted carbazole-1-carboxamides were potent and selective inhibitors of BTK, while 3,7- and 3,6-disubstituted carbazole-1-carboxamides were potent and selective inhibitors of Janus kinase 2 (JAK2). Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Inhibition of sphingosine kinase-2 suppresses inflammation and attenuates graft injury after liver transplantation in rats.

    Directory of Open Access Journals (Sweden)

    Qinlong Liu

    Full Text Available Inflammation mediates/promotes graft injury after liver transplantation (LT. This study investigated the roles of sphingosine kinase-2 (SK2 in inflammation after LT. Liver grafts were stored in UW solution with and without ABC294640 (100 µM, a selective inhibitor of SK2, before implantation. Hepatic sphingosine-1-phosphate (S1P levels increased ∼4-fold after LT, which was blunted by 40% by ABC294640. Hepatic toll-like receptor-4 (TLR4 expression and nuclear factor-κB (NF-κB p65 subunit phosphorylation elevated substantially after transplantation. The pro-inflammatory cytokines/chemokines tumor necrosis factor-α, interleukin-1β and C-X-C motif chemokine 10 mRNAs increased 5.9-fold, 6.1-fold and 16-fold, respectively following transplantation, while intrahepatic adhesion molecule-1 increased 5.7-fold and monocytes/macrophage and neutrophil infiltration and expansion of residential macrophage population increased 7.8-13.4 fold, indicating enhanced inflammation. CD4+ T cell infiltration and interferon-γ production also increased. ABC294640 blunted TLR4 expression by 60%, NF-κB activation by 84%, proinflammatory cytokine/chemokine production by 45-72%, adhesion molecule expression by 54% and infiltration of monocytes/macrophages and neutrophils by 62-67%. ABC294640 also largely blocked CD4+ T cell infiltration and interferon-γ production. Focal necrosis and apoptosis occurred after transplantation with serum alanine aminotransferase (ALT reaching ∼6000 U/L and serum total bilirubin elevating to ∼1.5 mg/dL. Inhibition of SK2 by ABC294640 blunted necrosis by 57%, apoptosis by 74%, ALT release by ∼68%, and hyperbilirubinemia by 74%. Most importantly, ABC294640 also increased survival from ∼25% to ∼85%. In conclusion, SK2 plays an important role in hepatic inflammation responses and graft injury after cold storage/transplantation and represents a new therapeutic target for liver graft failure.

  17. Leucine-rich repeat kinase 2 (LRRK2-deficient rats exhibit renal tubule injury and perturbations in metabolic and immunological homeostasis.

    Directory of Open Access Journals (Sweden)

    Daniel Ness

    Full Text Available Genetic evidence links mutations in the LRRK2 gene with an increased risk of Parkinson's disease, for which no neuroprotective or neurorestorative therapies currently exist. While the role of LRRK2 in normal cellular function has yet to be fully described, evidence suggests involvement with immune and kidney functions. A comparative study of LRRK2-deficient and wild type rats investigated the influence that this gene has on the phenotype of these rats. Significant weight gain in the LRRK2 null rats was observed and was accompanied by significant increases in insulin and insulin-like growth factors. Additionally, LRRK2-deficient rats displayed kidney morphological and histopathological alterations in the renal tubule epithelial cells of all animals assessed. These perturbations in renal morphology were accompanied by significant decreases of lipocalin-2, in both the urine and plasma of knockout animals. Significant alterations in the cellular composition of the spleen between LRRK2 knockout and wild type animals were identified by immunophenotyping and were associated with subtle differences in response to dual infection with rat-adapted influenza virus (RAIV and Streptococcus pneumoniae. Ontological pathway analysis of LRRK2 across metabolic and kidney processes and pathological categories suggested that the thioredoxin network may play a role in perturbing these organ systems. The phenotype of the LRRK2 null rat is suggestive of a complex biology influencing metabolism, immune function and kidney homeostasis. These data need to be extended to better understand the role of the kinase domain or other biological functions of the gene to better inform the development of pharmacological inhibitors.

  18. Leucine-rich repeat kinase 2 (LRRK2)-deficient rats exhibit renal tubule injury and perturbations in metabolic and immunological homeostasis.

    Science.gov (United States)

    Ness, Daniel; Ren, Zhao; Gardai, Shyra; Sharpnack, Douglas; Johnson, Victor J; Brennan, Richard J; Brigham, Elizabeth F; Olaharski, Andrew J

    2013-01-01

    Genetic evidence links mutations in the LRRK2 gene with an increased risk of Parkinson's disease, for which no neuroprotective or neurorestorative therapies currently exist. While the role of LRRK2 in normal cellular function has yet to be fully described, evidence suggests involvement with immune and kidney functions. A comparative study of LRRK2-deficient and wild type rats investigated the influence that this gene has on the phenotype of these rats. Significant weight gain in the LRRK2 null rats was observed and was accompanied by significant increases in insulin and insulin-like growth factors. Additionally, LRRK2-deficient rats displayed kidney morphological and histopathological alterations in the renal tubule epithelial cells of all animals assessed. These perturbations in renal morphology were accompanied by significant decreases of lipocalin-2, in both the urine and plasma of knockout animals. Significant alterations in the cellular composition of the spleen between LRRK2 knockout and wild type animals were identified by immunophenotyping and were associated with subtle differences in response to dual infection with rat-adapted influenza virus (RAIV) and Streptococcus pneumoniae. Ontological pathway analysis of LRRK2 across metabolic and kidney processes and pathological categories suggested that the thioredoxin network may play a role in perturbing these organ systems. The phenotype of the LRRK2 null rat is suggestive of a complex biology influencing metabolism, immune function and kidney homeostasis. These data need to be extended to better understand the role of the kinase domain or other biological functions of the gene to better inform the development of pharmacological inhibitors.

  19. Curcumin exposure induces expression of the Parkinson's disease-associated leucine-rich repeat kinase 2 (LRRK2) in rat mesencephalic cells.

    Science.gov (United States)

    Ortiz-Ortiz, Miguel A; Morán, José M; Ruiz-Mesa, Luz M; Niso-Santano, Mireia; Bravo-SanPedro, José M; Gómez-Sánchez, Rubén; González-Polo, Rosa A; Fuentes, José M

    2010-01-04

    Turmeric (curry powder), an essential ingredient of culinary preparations of Southeast Asia, contains a major polyphenolic compound known as curcumin or diferuloylmethane. Curcumin is a widely studied phytochemical with a variety of biological activities. In addition to its anti-inflammatory and antimicrobial/antiviral properties, curcumin is considered as a cancer chemopreventive agent as well as a modulator of gene expression and a potent antioxidant. Since oxidative stress has been implicated in the degeneration of dopaminergic neurons in the substantia nigra in Parkinson's disease (PD), curcumin has been proposed to have potential therapeutic value for the treatment of neurodegenerative diseases such as PD. Following age, a family history of PD is the most commonly reported risk factor, suggesting a genetic component of the disease in a subgroup of patients. The LRRK2 gene has emerged as the gene most commonly associated with both familial and sporadic PD. Here, we report that exposure of rat mesencephalic cells to curcumin induces the expression of LRRK2 mRNA and protein in a time-dependent manner. The expression of other PD-related genes, such alpha-synuclein and parkin, was not affected by exposure to curcumin, and PTEN-induced putative kinase 1 (PINK1) was not expressed in rat mesencephalic cells. As LRRK2 overexpression is strongly associated with the pathological inclusions found in several neurodegenerative disorders, further studies are needed to evaluate the effects of curcumin as a therapeutic agent for neurodegenerative diseases.

  20. Leucine-Rich Repeat Kinase 2 (Lrrk2) Deficiency Diminishes the Development of Experimental Autoimmune Uveitis (EAU) and the Adaptive Immune Response.

    Science.gov (United States)

    Wandu, Wambui S; Tan, Cuiyan; Ogbeifun, Osato; Vistica, Barbara P; Shi, Guangpu; Hinshaw, Samuel J H; Xie, Chengsong; Chen, Xi; Klinman, Dennis M; Cai, Huaibin; Gery, Igal

    2015-01-01

    Mutations in LRRK2 are related to certain forms of Parkinson's disease and, possibly, to the pathogenesis of Crohn's disease. In both these diseases inflammatory processes participate in the pathogenic process. LRRK2 is expressed in lymphoid cells and, interestingly, Lrrk2 (-/-) mice were reported to develop more severe experimental colitis than their wild type (WT) controls. Here, we examined the possible involvement of LRRK2 in the pathogenesis of experimental autoimmune uveitis (EAU), an animal model for human uveitis, by testing Lrrk2 (-/-) mice for their capacity to develop this experimental eye disease and related immune responses. Lrrk2 (-/-) mice and their WT controls (C57Bl/6) were immunized with interphotoreceptor retinoid-binding protein (IRBP) and compared for their development of EAU, delayed type hypersensitivity (DTH) by skin tests, production of cytokines in culture, and expression of interferon (IFN)-γ, interleukin (IL)-17 and FoxP3 by spleen cells, using flow cytometry. Peritoneal macrophages were examined for their production of cytokines/chemokines in culture following stimulation with LPS or the oligodeoxynucleotide CpG. The Lrrk2 (-/-) and WT mice were also compared for their response to bovine serum albumin (BSA). The Lrrk2 (-/-) mice developed lower levels of EAU, DTH responses and cytokine production by lymphocytes than did their WT controls. Intracellular expression of IFN-γ and IL-17, by spleen cells, and secretion of cytokines/chemokines by activated peritoneal macrophages of Lrrk2 (-/-) mice trended toward diminished levels, although variabilities were noted. The expression levels of FoxP3 by Lrrk2 (-/-) spleen cells, however, were similar to those seen in WT controls. Consistent with their low response to IRBP, Lrrk2 (-/-) mice responded to BSA less vigorously than their WT controls. Lrrk2 deficiency in mice diminished the development of EAU and the related adaptive immune responses to IRBP as compared to the WT controls.

  1. Leucine-Rich Repeat Kinase 2 interacts with Parkin, DJ-1 and PINK-1 in a Drosophila melanogaster model of Parkinson's disease.

    Science.gov (United States)

    Venderova, Katerina; Kabbach, Ghassan; Abdel-Messih, Elizabeth; Zhang, Yi; Parks, Robin J; Imai, Yuzuru; Gehrke, Stephan; Ngsee, Johnny; Lavoie, Matthew J; Slack, Ruth S; Rao, Yong; Zhang, Zhuohua; Lu, Bingwei; Haque, M Emdadul; Park, David S

    2009-11-15

    Mutations in the LRRK2 gene are the most common genetic cause of familial Parkinson's disease (PD). However, its physiological and pathological functions are unknown. Therefore, we generated several independent Drosophila lines carrying WT or mutant human LRRK2 (mutations in kinase, COR or LRR domains, resp.). Ectopic expression of WT or mutant LRRK2 in dopaminergic neurons caused their significant loss accompanied by complex age-dependent changes in locomotor activity. Overall, the ubiquitous expression of LRRK2 increased lifespan and fertility of the flies. However, these flies were more sensitive to rotenone. LRRK2 expression in the eye exacerbated retinal degeneration. Importantly, in double transgenic flies, various indices of the eye and dopaminergic survival were modified in a complex fashion by a concomitant expression of PINK1, DJ-1 or Parkin. This evidence suggests a genetic interaction between these PD-relevant genes.

  2. Gene Cloning and Construction of Bovine Follistatin Expression Vector%牛卵泡抑素基因克隆及真核表达载体构建

    Institute of Scientific and Technical Information of China (English)

    康峰; 苏广华; 苏建国; 段彪; 王子东; 李光鹏

    2011-01-01

    【Objective】To clone and construct the eukaryotic expression vector containing the bovine follistatin cDNA sequence.【Methods】Total RNA was extracted from bovine ovary by Trizol total RNA Extract Kit,and the whole coding region of bovine follistatin cDNA gene was cloned by RT-PCR using specific primers containing restriction enzyme cutting site.The purified bovine follistatin cDNA was inserted into pMD18-T vector and was then sequenced,then subclone the correct follistatin cDNA to eukaryotic expression vector pIRES-AcGFP.Double-enzyme cleavage and PCR test were used to identify the vector.【Results】Double-enzyme cleavage and PCR test showed that FSTN was successfully cloned into eukaryotic expression vector.【Conclusion】We successfully constructed the eukaryotic expression vector pIRES2-AcGFP1-FSTN.This study provided the foundation for fostering high beef quality transgenic cattle of promoting muscle growth.%[目的]克隆牛的卵泡抑素基因(Follistatin,FSTN)基因,构建真核表达载体。[方法]用Trizol法从牛的卵巢中提取总RNA,反转录成cDNA,用带有酶切位点牛FSTN的特异性引物扩增其完整编码区序列,连接到T载体、测序,序列无误后亚克隆入真核表达载体pIRES2-AcGFP1中,酶切及PCR鉴定载体。[结果]经酶切及PCR鉴定表明成功构建了真核表达载体pIRES2-AcGFP1-FSTN。[结论]成功构建了真核表达载体pIRES2-AcGFP1-FSTN,为促进肌肉生长的转基因优质肉牛品种培育奠定了基础。

  3. Eukaryotic Expression of Swamp Buffalo Follistatin%沼泽型水牛卵泡抑素基因的真核表达研究

    Institute of Scientific and Technical Information of China (English)

    邓继贤; 杨秀荣; 韦英明; 蒋和生

    2011-01-01

    In this study,follistatin gene was chosen as the candidate gene affecting the reproductive ability in buffalo. Re-combinant plasmid pEGFP-bFS was conducted and expressed in both buffalo fetal fibroblast (BFF) and BHK cells. pMD-bFS and pEGFP-Ni were digested with Xho Ⅰ ,Sac Ⅱ ,then eukaryotic expression vector-pEGFP-bFS was constructed. Buffalo fetal fibroblast and BHK cells were cultured with pEGFP-bFS intermixing LipofectamineTM 2000 in carbon dioxide incubator with 37 ℃ ,5% CO2 ,100% humidity. After 24 h,expression levels of recombinant vector were verified through observing directly under phase contrast fluorescence microscope, RT-PCR and Western blotting. The results indicated that bFST expressed in both buffalo fibroblast and BHK cells. This study was a very significance to produce bioactive bFS engineered plasmid and research effects of bFS on reproductive ability.%试验通过候选基因法,选定卵泡抑素(follistatin,FS)作为影响水牛繁殖性能的主要候选基因,通过基因工程的方法,用Xho Ⅰ、Sac Ⅱ双酶切广西大学动物遗传育种与繁殖实验室克隆的添加有ACC的Kozaka序列的pMD-bFS质粒和pEGFP-N1,构建pEGFP-bFS真核表达质粒,将其与阳离子脂质体混匀后,分别转染体外培养的水牛胎儿成纤维(BFF)细胞和仓鼠肾(BHK)细胞系,经过48 h培养后,在相差荧光显微镜下观察绿色荧光蛋白的表达水平,用RT-PCR和Western blotting方法对转入质粒表达进行定性鉴定.结果显示,本研究成功构建了添加有ACC的Kozaka序列的pEGFP-bFS真核表达质粒,该重组质粒在BFF和HBK两种细胞均表达,但在HBK细胞系的表达量稍高.本研究结果将为下一步制备具有生物活性的bFS工程疫苗,研究bFS对水牛繁殖性能的影响提供参考.

  4. Characterization of the alpha and beta subunits of casein kinase 2 by far-UV CD spectroscopy

    DEFF Research Database (Denmark)

    Issinger, O G; Brockel, C; Boldyreff, B;

    1992-01-01

    Although Chou-Fasman calculations of the secondary structure of recombinant casein kinase 2 subunits alpha and beta suggest they have a similar overall conformation, circular dichroism (CD) studies show that substantial differences in the conformation of the two subunits exist. In addition......, no changes in the far-UV CD spectrum of the alpha subunit are observed in the presence of casein or the synthetic decapeptide substrate RRRDDDSDDD. Furthermore, the alpha-helical structure of the alpha subunit (but not the beta subunit) can be increased in the presence of stoichiometric amounts of heparin...

  5. Quantum repeated games revisited

    CERN Document Server

    Frackiewicz, Piotr

    2011-01-01

    We present a scheme for playing quantum repeated 2x2 games based on the Marinatto and Weber's approach to quantum games. As a potential application, we study twice repeated Prisoner's Dilemma game. We show that results not available in classical game can be obtained when the game is played in the quantum way. Before we present our idea, we comment on the previous scheme of playing quantum repeated games.

  6. Testosterone inhibits transforming growth factor-β signaling during myogenic differentiation and proliferation of mouse satellite cells: potential role of follistatin in mediating testosterone action.

    Science.gov (United States)

    Braga, Melissa; Bhasin, Shalender; Jasuja, Ravi; Pervin, Shehla; Singh, Rajan

    2012-03-05

    Testosterone (T) administration is associated with increased satellite cell number and skeletal muscle hypertrophy, although there is considerable heterogeneity in the response of different skeletal muscle groups to T in vivo. We investigated the effects of T on the growth and differentiation of satellite cells isolated from levator ani (LA) and gastrocnemius (gastroc) muscles. T up regulated follistatin (Fst) expression, but down regulated the mRNA and protein expression of a number of genes in the transforming growth factor-beta (TGF-β)-signaling pathway. Inhibition of Fst expression by small interfering RNA (siRNA) inhibited myogenic differentiation and blocked the pro-myogenic effects of T. Treatment of satellite cells with T or Fst up regulated the expression of Pax7 and PCNA, and increased their proliferation. T and Fst blocked TGF-β induced inhibition of growth and myogenic differentiation and down regulated TGF-β-dependent transcriptome in both LA and gastroc cells. We conclude that T stimulation of satellite cell proliferation and myogenic differentiation are associated with up regulation of Fst and inhibition of TGF-β-signaling.

  7. A 90-day subchronic study of rats fed lean pork from genetically modified pigs with muscle-specific expression of recombinant follistatin.

    Science.gov (United States)

    Zou, Shiying; Tang, Min; He, Xiaoyun; Cao, Yuan; Zhao, Jie; Xu, Wentao; Liang, Zhihong; Huang, Kunlun

    2015-11-01

    Because cardiovascular disease incidence has rapidly increased in recent years, people are choosing relatively healthier diets with low animal fat. A transgenic pig with low fat and a high percentage of lean meat was created in 2011; this pig overexpresses the follistatin (FST) gene. To evaluate the safety of lean pork derived from genetically modified (GM) pigs, a subchronic oral toxicity study was conducted using Sprague-Dawley rats. GM pork and non-GM pork were incorporated into the diet at levels of 3.75%, 7.5%, and 15% (w/w), and the main nutrients of the various diets were subsequently balanced. The safety of GM pork was assessed by comparison of the toxicology response variables in Sprague-Dawley rats consuming diets containing GM pork with those consuming non-GM pork. No treatment-related adverse or toxic effects were observed based on an examination of the daily clinical signs, body weight, food consumption, hematology, serum biochemistry, and organ weight or based on gross and histopathological examination. The results demonstrate that GM pork is as safe for consumption as conventional pork.

  8. Matrix attachment regions included in a bicistronic vector enhances and stabilizes follistatin gene expressions in both transgenic cells and transgenic mice

    Directory of Open Access Journals (Sweden)

    Xiaoming HU,Jing GUO,Chunling BAI,Zhuying WEI,Li GAO,Tingmao HU,Shorgan BOU,Guangpeng LI

    2016-03-01

    Full Text Available In the present study, follistatin (FST gene expression vectors with either a bicistronic gene transfer cassette alone, or a bicistron gene cassette carrying a matrix attachment region (MAR were constructed and transfected to bovine fetal fibroblasts. Evaluations of both the integration and expression of exogenous FST indicated that the pMAR-CAG-FST-IRES-AcGFP1-polyA-MAR (pMAR-FST vector had higher capacity to form monoclonal transgenic cells than the vector without MAR, though transient transfection and integration efficiency were similar with either construct. Remarkably, protein expression in transgenic cells with the pMAR-FST vector was significantly higher than that from the bicistronic vector. Exogenous FST was expressed in all of the pMAR-FST transgenic mice at F0, F1 and F2. Total muscle growth in F0 mice was significantly greater than in wild-type mice, with larger muscles in fore and hind limbs of transgenic mice. pMAR-FST transgenic mice were also found with more evenly distributed muscle bundles and thinner spaces between sarcolemma, which suggests a correlation between transgene expression-associated muscle development and the trend of muscle growth. In conclusion, a pMAR-FST vector, which excluded the resistant genes and frame structure, enhances and stabilizes FST gene expressions in both transfected cells and transgenic mice.

  9. Upregulation of Na+,Cl--Coupled Betaine/ γ-Amino-Butyric Acid Transporter BGT1 by Tau Tubulin Kinase 2

    Directory of Open Access Journals (Sweden)

    Ahmad Almilaji

    2013-08-01

    Full Text Available Background/Aims: The serine/threonine kinase Tau-tubulin-kinase 2 (TTBK2 is expressed in various tissues including kidney, liver and brain. Loss of function mutations of TTBK2 lead to autosomal dominant spinocerebellar ataxia type 11 (SCA11. Cell survival is fostered by cellular accumulation of organic osmolytes. Carriers accomplishing cellular accumulation of organic osmolytes include the Na+, Cl--coupled betaine/γ-amino-butyric acid transporter BGT1. The present study explored whether TTBK2 participates in the regulation of BGT1 activity. Methods: Electrogenic transport of GABA was determined in Xenopus oocytes expressing BGT1 with or without wild-type TTBK2, truncated TTBK2[1-450] or kinase inactive mutants TTBK2- KD and TTBK2[1-450]-KD. Results: Coexpression of wild-type TTBK2, but not of TTBK2[1-450], TTBK2-KD or TTBK2[1-450]-KD, increased electrogenic GABA transport. Wildtype TTBK2 increased the maximal transport rate without significantly modifying affinity of the carrier. Coexpression of wild-type TTBK2 significantly delayed the decline of transport following inhibition of carrier insertion with brefeldin A, indicating that wild-type TTBK2 increased carrier stability in the cell membrane. Conclusion: Tau-tubulin-kinase 2 TTBK2 is a powerful stimulator of the osmolyte and GABA transporter BGT1.

  10. Reconfigurable multiport EPON repeater

    Science.gov (United States)

    Oishi, Masayuki; Inohara, Ryo; Agata, Akira; Horiuchi, Yukio

    2009-11-01

    An extended reach EPON repeater is one of the solutions to effectively expand FTTH service areas. In this paper, we propose a reconfigurable multi-port EPON repeater for effective accommodation of multiple ODNs with a single OLT line card. The proposed repeater, which has multi-ports in both OLT and ODN sides, consists of TRs, BTRs with the CDR function and a reconfigurable electrical matrix switch, can accommodate multiple ODNs to a single OLT line card by controlling the connection of the matrix switch. Although conventional EPON repeaters require full OLT line cards to accommodate subscribers from the initial installation stage, the proposed repeater can dramatically reduce the number of required line cards especially when the number of subscribers is less than a half of the maximum registerable users per OLT. Numerical calculation results show that the extended reach EPON system with the proposed EPON repeater can save 17.5% of the initial installation cost compared with a conventional repeater, and can be less expensive than conventional systems up to the maximum subscribers especially when the percentage of ODNs in lightly-populated areas is higher.

  11. Revisiting the TALE repeat.

    Science.gov (United States)

    Deng, Dong; Yan, Chuangye; Wu, Jianping; Pan, Xiaojing; Yan, Nieng

    2014-04-01

    Transcription activator-like (TAL) effectors specifically bind to double stranded (ds) DNA through a central domain of tandem repeats. Each TAL effector (TALE) repeat comprises 33-35 amino acids and recognizes one specific DNA base through a highly variable residue at a fixed position in the repeat. Structural studies have revealed the molecular basis of DNA recognition by TALE repeats. Examination of the overall structure reveals that the basic building block of TALE protein, namely a helical hairpin, is one-helix shifted from the previously defined TALE motif. Here we wish to suggest a structure-based re-demarcation of the TALE repeat which starts with the residues that bind to the DNA backbone phosphate and concludes with the base-recognition hyper-variable residue. This new numbering system is consistent with the α-solenoid superfamily to which TALE belongs, and reflects the structural integrity of TAL effectors. In addition, it confers integral number of TALE repeats that matches the number of bound DNA bases. We then present fifteen crystal structures of engineered dHax3 variants in complex with target DNA molecules, which elucidate the structural basis for the recognition of bases adenine (A) and guanine (G) by reported or uncharacterized TALE codes. Finally, we analyzed the sequence-structure correlation of the amino acid residues within a TALE repeat. The structural analyses reported here may advance the mechanistic understanding of TALE proteins and facilitate the design of TALEN with improved affinity and specificity.

  12. Recursive quantum repeater networks

    CERN Document Server

    Van Meter, Rodney; Horsman, Clare

    2011-01-01

    Internet-scale quantum repeater networks will be heterogeneous in physical technology, repeater functionality, and management. The classical control necessary to use the network will therefore face similar issues as Internet data transmission. Many scalability and management problems that arose during the development of the Internet might have been solved in a more uniform fashion, improving flexibility and reducing redundant engineering effort. Quantum repeater network development is currently at the stage where we risk similar duplication when separate systems are combined. We propose a unifying framework that can be used with all existing repeater designs. We introduce the notion of a Quantum Recursive Network Architecture, developed from the emerging classical concept of 'recursive networks', extending recursive mechanisms from a focus on data forwarding to a more general distributed computing request framework. Recursion abstracts independent transit networks as single relay nodes, unifies software layer...

  13. Sphingosine kinase 2 is a chikungunya virus host factor co-localized with the viral replication complex.

    Science.gov (United States)

    Reid, St Patrick; Tritsch, Sarah R; Kota, Krishna; Chiang, Chih-Yuan; Dong, Lian; Kenny, Tara; Brueggemann, Ernest E; Ward, Michael D; Cazares, Lisa H; Bavari, Sina

    2015-10-01

    Chikungunya virus (CHIKV) is a re-emerging alphavirus which causes severe and prolonged arthralgic febrile illness. The recent global spread of the virus and lack of approved therapeutic options makes it imperative to gain greater insight into the molecular mechanisms underlying CHIKV pathogenesis, in particular host factors recruited by the virus. In the current study, we identify sphingosine kinase 2 (SK2) as a CHIKV host factor co-localized with the viral replication complex (VRC) during infection. SK2 was demonstrated to co-localize with viral RNA and nonstructural proteins. Targeted impairment of SK2 expression or function significantly inhibited CHIKV infection. Furthermore, affinity purification-mass spectrometry studies revealed that SK2 associates with a number of proteins involved in cellular gene expression specifically during viral infection, suggesting a role in replication. Collectively these results identify SK2 as a novel CHIKV host factor.

  14. Molecular Mechanism for Inhibition of G Protein-Coupled Receptor Kinase 2 by a Selective RNA Aptamer

    Energy Technology Data Exchange (ETDEWEB)

    Tesmer, Valerie M.; Lennarz, Sabine; Mayer, Günter; Tesmer, John J.G. (Bonn); (Michigan)

    2012-08-31

    Cardiovascular homeostasis is maintained in part by the rapid desensitization of activated heptahelical receptors that have been phosphorylated by G protein-coupled receptor kinase 2 (GRK2). However, during chronic heart failure GRK2 is upregulated and believed to contribute to disease progression. We have determined crystallographic structures of GRK2 bound to an RNA aptamer that potently and selectively inhibits kinase activity. Key to the mechanism of inhibition is the positioning of an adenine nucleotide into the ATP-binding pocket and interactions with the basic {alpha}F-{alpha}G loop region of the GRK2 kinase domain. Constraints imposed on the RNA by the terminal stem of the aptamer also play a role. These results highlight how a high-affinity aptamer can be used to selectively trap a novel conformational state of a protein kinase.

  15. The human Na(+)/H(+) exchanger 1 is a membrane scaffold protein for extracellular signal-regulated kinase 2

    DEFF Research Database (Denmark)

    Hendus-Altenburger, Ruth; Pedraz-Cuesta, Elena; Olesen, Christina W;

    2016-01-01

    BACKGROUND: Extracellular signal-regulated kinase 2 (ERK2) is an S/T kinase with more than 200 known substrates, and with critical roles in regulation of cell growth and differentiation and currently no membrane proteins have been linked to ERK2 scaffolding. METHODS AND RESULTS: Here, we identify...... the human Na(+)/H(+) exchanger 1 (hNHE1) as a membrane scaffold protein for ERK2 and show direct hNHE1-ERK1/2 interaction in cellular contexts. Using nuclear magnetic resonance (NMR) spectroscopy and immunofluorescence analysis we demonstrate that ERK2 scaffolding by hNHE1 occurs by one of three D...... and ERK2, and provides a molecular mechanism for the important ERK2 scaffolding function of the membrane protein hNHE1, which regulates the phosphorylation of both hNHE1 and ERK2....

  16. The human Na+/H+ exchanger 1 is a membrane scaffold protein for extracellular signal-regulated kinase 2

    DEFF Research Database (Denmark)

    Hendus-Altenburger, Ruth; Pedraz Cuesta, Elena; Olesen, Christina Wilkens

    2016-01-01

    BACKGROUND: Extracellular signal-regulated kinase 2 (ERK2) is an S/T kinase with more than 200 known substrates, and with critical roles in regulation of cell growth and differentiation and currently no membrane proteins have been linked to ERK2 scaffolding. METHODS AND RESULTS: Here, we identify...... the human Na(+)/H(+) exchanger 1 (hNHE1) as a membrane scaffold protein for ERK2 and show direct hNHE1-ERK1/2 interaction in cellular contexts. Using nuclear magnetic resonance (NMR) spectroscopy and immunofluorescence analysis we demonstrate that ERK2 scaffolding by hNHE1 occurs by one of three D...... in vitro, in a distinct temporal order, with the phosphorylation rates at the individual sites being modulated by the docking sites in a distant dependent manner. CONCLUSIONS: This work characterizes a new type of scaffolding complex, which we term a "shuffle complex", between the disordered hNHE1-tail...

  17. The Pentapeptide Repeat Proteins

    Energy Technology Data Exchange (ETDEWEB)

    Vetting,M.; Hegde, S.; Fajardo, J.; Fiser, A.; Roderick, S.; Takiff, H.; Blanchard, J.

    2006-01-01

    The Pentapeptide Repeat Protein (PRP) family has over 500 members in the prokaryotic and eukaryotic kingdoms. These proteins are composed of, or contain domains composed of, tandemly repeated amino acid sequences with a consensus sequence of [S, T,A, V][D, N][L, F]-[S, T,R][G]. The biochemical function of the vast majority of PRP family members is unknown. The three-dimensional structure of the first member of the PRP family was determined for the fluoroquinolone resistance protein (MfpA) from Mycobacterium tuberculosis. The structure revealed that the pentapeptide repeats encode the folding of a novel right-handed quadrilateral {beta}-helix. MfpA binds to DNA gyrase and inhibits its activity. The rod-shaped, dimeric protein exhibits remarkable size, shape and electrostatic similarity to DNA.

  18. Repeating the Past

    Science.gov (United States)

    Moore, John W.

    1998-05-01

    As part of the celebration of the Journal 's 75th year, we are scanning each Journal issue from 25, 50, and 74 years ago. Many of the ideas and practices described are so similar to present-day "innovations" that George Santayana's adage (1) "Those who cannot remember the past are condemned to repeat it" comes to mind. But perhaps "condemned" is too strong - sometimes it may be valuable to repeat something that was done long ago. One example comes from the earliest days of the Division of Chemical Education and of the Journal.

  19. All-optical repeater.

    Science.gov (United States)

    Silberberg, Y

    1986-06-01

    An all-optical device containing saturable gain, saturable loss, and unsaturable loss is shown to transform weak, distorted optical pulses into uniform standard-shape pulses. The proposed device performs thresholding, amplification, and pulse shaping as required from an optical repeater. It is shown that such a device could be realized by existing semiconductor technology.

  20. Bidirectional Manchester repeater

    Science.gov (United States)

    Ferguson, J.

    1980-01-01

    Bidirectional Manchester repeater is inserted at periodic intervals along single bidirectional twisted pair transmission line to detect, amplify, and transmit bidirectional Manchester 11 code signals. Requiring only 18 TTL 7400 series IC's, some line receivers and drivers, and handful of passive components, circuit is simple and relatively inexpensive to build.

  1. Casein kinase 2α regulates multidrug resistance-associated protein 1 function via phosphorylation of Thr249.

    Science.gov (United States)

    Stolarczyk, Elzbieta I; Reiling, Cassandra J; Pickin, Kerry A; Coppage, Ryan; Knecht, Marc R; Paumi, Christian M

    2012-09-01

    We have shown previously that the function of Ycf1p, yeast ortholog of multidrug resistance-associated protein 1 (MRP1), is regulated by yeast casein kinase 2α (Cka1p) via phosphorylation at Ser251. In this study, we explored whether casein kinase 2α (CK2α), the human homolog of Cka1p, regulates MRP1 by phosphorylation at the semiconserved site Thr249. Knockdown of CK2α in MCF7-derived cells expressing MRP1 [MRP1 CK2α(-)] resulted in increased doxorubicin sensitivity. MRP1-dependent transport of leukotriene C(4) and estradiol-17β-d-glucuronide into vesicles derived from MRP1 CK2α(-) cells was decreased compared with MRP1 vesicles. Moreover, mutation of Thr249 to alanine (MRP1-T249A) also resulted in decreased MRP1-dependent transport, whereas a phosphomimicking mutation (MRP1-T249E) led to dramatic increase in MRP1-dependent transport. Studies in tissue culture confirmed these findings, showing increased intracellular doxorubicin accumulation in MRP1 CK2α(-) and MRP1-T249A cells compared with MRP1 cells. Inhibition of CK2 kinase by 2-dimethylamino-4,5,6,7-tetrabromo-1H-benzimidazole resulted in increased doxorubicin accumulation in MRP1 cells, but not in MRP1 CK2α(-), MRP1-T249A, or MRP1-T249E cells, suggesting that CK2α regulates MRP1 function via phosphorylation of Thr249. Indeed, CK2α and MRP1 interact physically, and recombinant CK2 phosphorylates MRP1-derived peptide in vitro in a Thr249-dependent manner, whereas knockdown of CK2α results in decreased phosphorylation at MRP1-Thr249. The role of CK2 in regulating MRP1 was confirmed in other cancer cell lines where CK2 inhibition decreased MRP1-mediated efflux of doxorubicin and increased doxorubicin cytotoxicity. This study supports a model in which CK2α potentiates MRP1 function via direct phosphorylation of Thr249.

  2. The autophosphorylation and p34cdc2 phosphorylation sites of casein kinase-2 beta-subunit are not essential for reconstituting the fully-active heterotetrameric holoenzyme

    DEFF Research Database (Denmark)

    Meggio, F; Boldyreff, B; Issinger, O G;

    1993-01-01

    Two mutants of human casein kinase-2 beta-subunit with short deletions at either their amino (delta 1-4) or carboxy (delta 209-215) terminal side have been created that have lost the capability to undergo autophosphorylation and p34cdc2 mediated phosphorylation, respectively. Both mutants give rise...

  3. Mitogen-Activated Protein Kinase-Activated Protein Kinase 2 Deficiency Reduces Insulin Sensitivity in High-Fat Diet-Fed Mice

    NARCIS (Netherlands)

    de Boer, Jan Freark; Dikkers, Arne; Jurdzinski, Angelika; von Felden, Johann; Gaestel, Matthias; Bavendiek, Udo; Tietge, Uwe J. F.

    2014-01-01

    Adipose tissue inflammation is considered an important contributor to insulin resistance. Mitogen-activated protein kinase-activated protein kinase 2 (MK2) is a major downstream target of p38 MAPK and enhances inflammatory processes. In line with the role of MK2 as contributor to inflammation,

  4. Mitogen-Activated Protein Kinase-Activated Protein Kinase 2 Deficiency Reduces Insulin Sensitivity in High-Fat Diet-Fed Mice

    NARCIS (Netherlands)

    de Boer, Jan Freark; Dikkers, Arne; Jurdzinski, Angelika; von Felden, Johann; Gaestel, Matthias; Bavendiek, Udo; Tietge, Uwe J. F.

    2014-01-01

    Adipose tissue inflammation is considered an important contributor to insulin resistance. Mitogen-activated protein kinase-activated protein kinase 2 (MK2) is a major downstream target of p38 MAPK and enhances inflammatory processes. In line with the role of MK2 as contributor to inflammation, MK2(-

  5. Adrenal incidentaloma and the Janus Kinase 2 V617F mutation: A case-based review of the literature

    Directory of Open Access Journals (Sweden)

    Mustafa Unubol

    2013-01-01

    Full Text Available Adrenal incidentaloma was detected in an 81-year-old male patient and a 37-year-old female patient who had been diagnosed with essential thrombocytosis. Each patient′s Janus Kinase 2 (JAK2 V617F mutation was positive, and they were evaluated as having non-functional adrenal incidentaloma. The JAK2 activates the signal transducers and activators of transcription (STAT proteins which then activate the phosphoinositol-3 kinases, Ras, mitogen-activated protein (MAP kinases, and transcription. Constitutive activation causes cell proliferation and dysregulation of apoptosis. It is thought that STAT3 activation-mediated JAK family kinases have a central role in the solid tumor cell series. Permanent activation of STAT3 and STAT5 causes tumor cell proliferation, survival, metastasis, and an increase in tumor-mediated inflammation in solid and hematologic tumors. According to our literature screening, irregular JAK signaling, seen at the pathogenesis of many solid and hematologic tumors, has not been previously evaluated with regard to adrenal tumors. As a result, our cases are the first coexistence of JAK V617F mutation with adrenal incidentaloma in the literature. Because of this, we think that JAK2 mutation must be evaluated to clarify the etiology of adrenal incidentalomas.

  6. Gene expression analysis of microtubule affinity-regulating kinase 2 in non-small cell lung cancer

    Directory of Open Access Journals (Sweden)

    Erin A. Marshall

    2015-12-01

    Full Text Available Lung cancer is the leading cause of cancer death worldwide, and has a five-year survival rate of 18% [1]. MARK2 is a serine/threonine-protein kinase, and is a key component in the phosphorylation of microtubule-associated proteins [2,3]. A recent study published by Hubaux et al. found that microtubule affinity-regulating kinase 2 (MARK2 showed highly frequent DNA and RNA level disruption in lung cancer cell lines and independent non-small cell lung cancer (NSCLC cohorts [4]. These alterations result in the acquisition of oncogenic properties in cell lines, such as increased viability and anchorage-independent growth. Furthermore, a microarray-based transcriptome analysis of three short hairpin RNA (shRNA-mediated MARK2 knockdown lung adenocarcinoma cell lines (GEO#: GSE57966 revealed an association between MARK2 gene expression and cell cycle activation and DNA damage response. Here, we present a detailed description of transcriptome analysis to support the described role of MARK2 in promoting a malignant phenotype.

  7. Casein kinase 2 (CK2) phosphorylates the deubiquitylase OTUB1 at Ser16 to trigger its nuclear localization.

    Science.gov (United States)

    Herhaus, Lina; Perez-Oliva, Ana B; Cozza, Giorgio; Gourlay, Robert; Weidlich, Simone; Campbell, David G; Pinna, Lorenzo A; Sapkota, Gopal P

    2015-04-14

    The deubiquitylating enzyme OTUB1 is present in all tissues and targets many substrates, in both the cytosol and nucleus. We found that casein kinase 2 (CK2) phosphorylated OTUB1 at Ser(16) to promote its nuclear accumulation in cells. Pharmacological inhibition or genetic ablation of CK2 blocked the phosphorylation of OTUB1 at Ser(16), causing its nuclear exclusion in various cell types. Whereas we detected unphosphorylated OTUB1 mainly in the cytosol, we detected Ser(16)-phosphorylated OTUB1 only in the nucleus. In vitro, Ser(16)-phosphorylated OTUB1 and nonphosphorylated OTUB1 exhibited similar catalytic activity, bound K63-linked ubiquitin chains, and interacted with the E2 enzyme UBE2N. CK2-mediated phosphorylation and subsequent nuclear localization of OTUB1 promoted the formation of 53BP1 (p53-binding protein 1) DNA repair foci in the nucleus of osteosarcoma cells exposed to ionizing radiation. Our findings indicate that the activity of CK2 is necessary for the nuclear translocation and subsequent function of OTUB1 in DNA damage repair. Copyright © 2015, American Association for the Advancement of Science.

  8. Anticancer screening of medicinal plant phytochemicals against Cyclin-Dependent Kinase-2 (CDK2: An in-silico approach

    Directory of Open Access Journals (Sweden)

    Wajahat Khan

    2017-08-01

    Full Text Available Background: Cyclin-Dependent Kinase-2 (CDK2 is a member of serine/threonine protein kinases family and plays an important role in regulation of various eukaryotic cell division events. Over-expression of CDK2 during cell cycle may lead to several cellular functional aberrations including diverse types of cancers (lung cancer, primary colorectal carcinoma, ovarian cancer, melanoma and pancreatic carcinoma in humans. Medicinal plants phytochemicals which have anticancer potential can be used as an alternative drug resource. Methods: This study was designed to find out anticancer phytochemicals from medicinal plants which could inhibit CDK2 with the help of molecular docking technique. Molecular Operating Environment (MOE v2009 software was used to dock 2300 phytochemicals in this study. Results: The outcome of this study shows that four phytochemicals Kushenol T, Remangiflavanone B, Neocalyxins A and Elenoside showed the lowest S-score (-17.83, -17.57, -17.26, -17.17 respectively and binds strongly with all eight active residues Tyr15, Lys33, Ileu52, Lys56, Leu78, phe80, Asp145 and Phe146 of CDK2 binding site. These phytochemicals could successfully inhibit the CDK2. Conclusion: These phytochemicals can be considered as potential anticancer agents and used in drug development against CDK2. We anticipate that this study would pave way for phytochemical based novel small molecules as more efficacious and selective anti-cancer therapeutic compounds.

  9. Lemur tyrosine kinase-2 signalling regulates kinesin-1 light chain-2 phosphorylation and binding of Smad2 cargo.

    LENUS (Irish Health Repository)

    Manser, C

    2012-05-31

    A recent genome-wide association study identified the gene encoding lemur tyrosine kinase-2 (LMTK2) as a susceptibility gene for prostate cancer. The identified genetic alteration is within intron 9, but the mechanisms by which LMTK2 may impact upon prostate cancer are not clear because the functions of LMTK2 are poorly understood. Here, we show that LMTK2 regulates a known pathway that controls phosphorylation of kinesin-1 light chain-2 (KLC2) by glycogen synthase kinase-3β (GSK3β). KLC2 phosphorylation by GSK3β induces the release of cargo from KLC2. LMTK2 signals via protein phosphatase-1C (PP1C) to increase inhibitory phosphorylation of GSK3β on serine-9 that reduces KLC2 phosphorylation and promotes binding of the known KLC2 cargo Smad2. Smad2 signals to the nucleus in response to transforming growth factor-β (TGFβ) receptor stimulation and transport of Smad2 by kinesin-1 is required for this signalling. We show that small interfering RNA loss of LMTK2 not only reduces binding of Smad2 to KLC2, but also inhibits TGFβ-induced Smad2 signalling. Thus, LMTK2 may regulate the activity of kinesin-1 motor function and Smad2 signalling.

  10. Contribution of casein kinase 2 and spleen tyrosine kinase to CFTR trafficking and protein kinase A-induced activity.

    Science.gov (United States)

    Luz, Simão; Kongsuphol, Patthara; Mendes, Ana Isabel; Romeiras, Francisco; Sousa, Marisa; Schreiber, Rainer; Matos, Paulo; Jordan, Peter; Mehta, Anil; Amaral, Margarida D; Kunzelmann, Karl; Farinha, Carlos M

    2011-11-01

    Previously, the pleiotropic "master kinase" casein kinase 2 (CK2) was shown to interact with CFTR, the protein responsible for cystic fibrosis (CF). Moreover, CK2 inhibition abolished CFTR conductance in cell-attached membrane patches, native epithelial ducts, and Xenopus oocytes. CFTR possesses two CK2 phosphorylation sites (S422 and T1471), with unclear impact on its processing and trafficking. Here, we investigated the effects of mutating these CK2 sites on CFTR abundance, maturation, and degradation coupled to effects on ion channel activity and surface expression. We report that CK2 inhibition significantly decreased processing of wild-type (wt) CFTR, with no effect on F508del CFTR. Eliminating phosphorylation at S422 and T1471 revealed antagonistic roles in CFTR trafficking: S422 activation versus T1471 inhibition, as evidenced by a severe trafficking defect for the T1471D mutant. Notably, mutation of Y512, a consensus sequence for the spleen tyrosine kinase (SYK) possibly acting in a CK2 context adjacent to the common CF-causing defect F508del, had a strong effect on both maturation and CFTR currents, allowing the identification of this kinase as a novel regulator of CFTR. These results reinforce the importance of CK2 and the S422 and T1471 residues for regulation of CFTR and uncover a novel regulation of CFTR by SYK, a recognized controller of inflammation.

  11. Polo-like kinase 2-dependent phosphorylation of NPM/B23 on serine 4 triggers centriole duplication.

    Science.gov (United States)

    Krause, Annekatrin; Hoffmann, Ingrid

    2010-03-24

    Duplication of the centrosome is well controlled during faithful cell division while deregulation of this process leads to supernumary centrosomes, chromosome missegregation and aneuploidy, a hallmark of many cancer cells. We previously reported that Polo-like kinase 2 (Plk2) is activated near the G1/S phase transition, and regulates the reproduction of centrosomes. In search for Plk2 interacting proteins we have identified NPM/B23 (Nucleophosmin) as a novel Plk2 binding partner. We find that Plk2 and NPM/B23 interact in vitro in a Polo-box dependent manner. An association between both proteins was also observed in vivo. Moreover, we show that Plk2 phosphorylates NPM/B23 on serine 4 in vivo in S-phase. Notably, expression of a non-phosphorylatable NPM/B23 S4A mutant interferes with centriole reduplication in S-phase arrested cells and leads to a dilution of centriole numbers in unperturbed U2OS cells. The corresponding phospho-mimicking mutants have the opposite effect and their expression leads to the accumulation of centrioles. These findings suggest that NPM/B23 is a direct target of Plk2 in the regulation of centriole duplication and that phosphorylation on serine 4 can trigger this process.

  12. Polo-like kinase 2-dependent phosphorylation of NPM/B23 on serine 4 triggers centriole duplication.

    Directory of Open Access Journals (Sweden)

    Annekatrin Krause

    Full Text Available Duplication of the centrosome is well controlled during faithful cell division while deregulation of this process leads to supernumary centrosomes, chromosome missegregation and aneuploidy, a hallmark of many cancer cells. We previously reported that Polo-like kinase 2 (Plk2 is activated near the G1/S phase transition, and regulates the reproduction of centrosomes. In search for Plk2 interacting proteins we have identified NPM/B23 (Nucleophosmin as a novel Plk2 binding partner. We find that Plk2 and NPM/B23 interact in vitro in a Polo-box dependent manner. An association between both proteins was also observed in vivo. Moreover, we show that Plk2 phosphorylates NPM/B23 on serine 4 in vivo in S-phase. Notably, expression of a non-phosphorylatable NPM/B23 S4A mutant interferes with centriole reduplication in S-phase arrested cells and leads to a dilution of centriole numbers in unperturbed U2OS cells. The corresponding phospho-mimicking mutants have the opposite effect and their expression leads to the accumulation of centrioles. These findings suggest that NPM/B23 is a direct target of Plk2 in the regulation of centriole duplication and that phosphorylation on serine 4 can trigger this process.

  13. Inhibition of Pyruvate Dehydrogenase Kinase 2 Protects Against Hepatic Steatosis Through Modulation of Tricarboxylic Acid Cycle Anaplerosis and Ketogenesis.

    Science.gov (United States)

    Go, Younghoon; Jeong, Ji Yun; Jeoung, Nam Ho; Jeon, Jae-Han; Park, Bo-Yoon; Kang, Hyeon-Ji; Ha, Chae-Myeong; Choi, Young-Keun; Lee, Sun Joo; Ham, Hye Jin; Kim, Byung-Gyu; Park, Keun-Gyu; Park, So Young; Lee, Chul-Ho; Choi, Cheol Soo; Park, Tae-Sik; Lee, W N Paul; Harris, Robert A; Lee, In-Kyu

    2016-10-01

    Hepatic steatosis is associated with increased insulin resistance and tricarboxylic acid (TCA) cycle flux, but decreased ketogenesis and pyruvate dehydrogenase complex (PDC) flux. This study examined whether hepatic PDC activation by inhibition of pyruvate dehydrogenase kinase 2 (PDK2) ameliorates these metabolic abnormalities. Wild-type mice fed a high-fat diet exhibited hepatic steatosis, insulin resistance, and increased levels of pyruvate, TCA cycle intermediates, and malonyl-CoA but reduced ketogenesis and PDC activity due to PDK2 induction. Hepatic PDC activation by PDK2 inhibition attenuated hepatic steatosis, improved hepatic insulin sensitivity, reduced hepatic glucose production, increased capacity for β-oxidation and ketogenesis, and decreased the capacity for lipogenesis. These results were attributed to altered enzymatic capacities and a reduction in TCA anaplerosis that limited the availability of oxaloacetate for the TCA cycle, which promoted ketogenesis. The current study reports that increasing hepatic PDC activity by inhibition of PDK2 ameliorates hepatic steatosis and insulin sensitivity by regulating TCA cycle anaplerosis and ketogenesis. The findings suggest PDK2 is a potential therapeutic target for nonalcoholic fatty liver disease.

  14. An Activin Receptor IA/Activin-Like Kinase-2 (R206H Mutation in Fibrodysplasia Ossificans Progressiva

    Directory of Open Access Journals (Sweden)

    Rafael Herrera-Esparza

    2013-01-01

    Full Text Available Fibrodysplasia ossificans progressiva (FOP is an exceptionally rare genetic disease that is characterised by congenital malformations of the great toes and progressive heterotopic ossification (HO in specific anatomical areas. This disease is caused by a mutation in activin receptor IA/activin-like kinase-2 (ACVR1/ALK2. A Mexican family with one member affected by FOP was studied. The patient is a 19-year-old female who first presented with symptoms of FOP at 8 years old; she developed spontaneous and painful swelling of the right scapular area accompanied by functional limitation of movement. Mutation analysis was performed in which genomic DNA as PCR amplified using primers flanking exons 4 and 6, and PCR products were digested with Cac8I and HphI restriction enzymes. The most informative results were obtained with the exon 4 flanking primers and the Cac8I restriction enzyme, which generated a 253 bp product that carries the ACVR1 617G>A mutation, which causes an amino acid substitution of histidine for arginine at position 206 of the glycine-serine (GS domain, and its mutation results in the dysregulation of bone morphogenetic protein (BMP signalling that causes FOP.

  15. Paroxetine Is a Direct Inhibitor of G Protein-Coupled Receptor Kinase 2 and Increases Myocardial Contractility

    Energy Technology Data Exchange (ETDEWEB)

    Thal, David M. [Univ. of Michigan, Ann Arbor, MI (United States); Homan, Kristoff T. [Univ. of Michigan, Ann Arbor, MI (United States); Chen, Jun [Univ. of New Mexico Health Sciences Center, Albuquerque, NM (United States); Wu, Emily K. [Univ. of Michigan, Ann Arbor, MI (United States); Hinkle, Patricia M. [Univ. of Rochester Medical Center, Rochester, NY (United States); Huang, Z. Maggie [Temple Univ. School of Medicine, Philadelphia, Pennsylvania (United States); Chuprun, J. Kurt [Temple Univ. School of Medicine, Philadelphia, Pennsylvania (United States); Song, Jianliang [Temple Univ. School of Medicine, Philadelphia, Pennsylvania (United States); Gao, Erhe [Temple Univ. School of Medicine, Philadelphia, Pennsylvania (United States); Cheung, Joseph Y. [Temple Univ. School of Medicine, Philadelphia, Pennsylvania (United States); Sklar, Larry A. [Univ. of New Mexico Health Sciences Center, Albuquerque, NM (United States); Koch, Walter J. [Temple Univ. School of Medicine, Philadelphia, Pennsylvania (United States); Tesmer, John J.G. [Univ. of Michigan, Ann Arbor, MI (United States)

    2012-08-10

    G protein-coupled receptor kinase 2 (GRK2) is a well-established therapeutic target for the treatment of heart failure. In this paper we identify the selective serotonin reuptake inhibitor (SSRI) paroxetine as a selective inhibitor of GRK2 activity both in vitro and in living cells. In the crystal structure of the GRK2·paroxetine–Gβγ complex, paroxetine binds in the active site of GRK2 and stabilizes the kinase domain in a novel conformation in which a unique regulatory loop forms part of the ligand binding site. Isolated cardiomyocytes show increased isoproterenol-induced shortening and contraction amplitude in the presence of paroxetine, and pretreatment of mice with paroxetine before isoproterenol significantly increases left ventricular inotropic reserve in vivo with no significant effect on heart rate. Neither is observed in the presence of the SSRI fluoxetine. Our structural and functional results validate a widely available drug as a selective chemical probe for GRK2 and represent a starting point for the rational design of more potent and specific GRK2 inhibitors.

  16. Activated CaMKII Couples GluN2B and Casein Kinase 2 to Control Synaptic NMDA Receptors

    Directory of Open Access Journals (Sweden)

    Antonio Sanz-Clemente

    2013-03-01

    Full Text Available Synaptic activity triggers a profound reorganization of the molecular composition of excitatory synapses. For example, NMDA receptors are removed from synapses in an activity- and calcium-dependent manner, via casein kinase 2 (CK2 phosphorylation of the PDZ ligand of the GluN2B subunit (S1480. However, how synaptic activity drives this process remains unclear because CK2 is a constitutively active kinase, which is not directly regulated by calcium. We show here that activated CaMKII couples GluN2B and CK2 to form a trimolecular complex and increases CK2-mediated phosphorylation of GluN2B S1480. In addition, a GluN2B mutant, which contains an insert to mimic the GluN2A sequence and cannot bind to CaMKII, displays reduced S1480 phosphorylation and increased surface expression. We find that although disrupting GluN2B/CaMKII binding reduces synapse number, it increases synaptic-GluN2B content. Therefore, the GluN2B/CaMKII association controls synapse density and PSD composition in an activity-dependent manner, including recruitment of CK2 for the removal of GluN2B from synapses.

  17. MAPK-activated protein kinase 2 is required for mouse meiotic spindle assembly and kinetochore-microtubule attachment.

    Directory of Open Access Journals (Sweden)

    Ju Yuan

    Full Text Available MAPK-activated protein kinase 2 (MK2, a direct substrate of p38 MAPK, plays key roles in multiple physiological functions in mitosis. Here, we show for the first time the unique distribution pattern of MK2 in meiosis. Phospho-MK2 was localized on bipolar spindle minus ends and along the interstitial axes of homologous chromosomes extending over centromere regions and arm regions at metaphase of first meiosis (MI stage in mouse oocytes. At metaphase of second meiosis (MII stage, p-MK2 was localized on the bipolar spindle minus ends and at the inner centromere region of sister chromatids as dots. Knockdown or inhibition of MK2 resulted in spindle defects. Spindles were surrounded by irregular nondisjunction chromosomes, which were arranged in an amphitelic or syntelic/monotelic manner, or chromosomes detached from the spindles. Kinetochore-microtubule attachments were impaired in MK2-deficient oocytes because spindle microtubules became unstable in response to cold treatment. In addition, homologous chromosome segregation and meiosis progression were inhibited in these oocytes. Our data suggest that MK2 may be essential for functional meiotic bipolar spindle formation, chromosome segregation and proper kinetochore-microtubule attachments.

  18. Role of the ATM-checkpoint kinase 2 pathway in CDT-mediated apoptosis of gingival epithelial cells.

    Science.gov (United States)

    Alaoui-El-Azher, Mounia; Mans, Jeffrey J; Baker, Henry V; Chen, Casey; Progulske-Fox, Ann; Lamont, Richard J; Handfield, Martin

    2010-07-23

    The cytolethal distending toxin (CDT) of the oral pathogen Aggregatibacter actinomycetemcomitans induces cell cycle arrest and apoptosis in various cell types. Western analysis, pharmacological inhibition and siRNA silencing were performed in human immortalized gingival keratinocytes (HIGK) to dissect the functional role of the ataxia telangiectasia mutated (ATM) pathway in the signal transduction steps triggered by the CDT. Infection of HIGK was associated with a time-dependent induction of cytoplasmic histone-associated DNA fragmentation. However, in the absence of CDT, infected HIGK underwent reversible DNA strand breaks but not apoptosis, while caspase 3 activity, p21 levels, and HIGK viability were unaffected. Caspase 9 activity was attenuated in the CDT mutant-infected HIGK compared to wild-type infected cells. Pharmacological inhibition and siRNA-silencing of the ATM downstream effector, the protein kinase checkpoint kinase 2 (Chk2), significantly impacted CDT-mediated apoptosis. Together, these findings provide insight on the specificity of the ATM-Chk2 pathway in response to the CDT of A. actinomycetemcomitans in oral epithelial cells, which ultimately leads to apoptosis. We further propose the existence of an unidentified factor that is distinct from the CDT, and involved with a reversible DNA fragmentation that does not trigger terminal apoptosis in oral epithelial cells. This model potentially explains conflicting reports on the biological activity of the A. actinomycetemcomitans CDT.

  19. Role of the ATM-checkpoint kinase 2 pathway in CDT-mediated apoptosis of gingival epithelial cells.

    Directory of Open Access Journals (Sweden)

    Mounia Alaoui-El-Azher

    Full Text Available The cytolethal distending toxin (CDT of the oral pathogen Aggregatibacter actinomycetemcomitans induces cell cycle arrest and apoptosis in various cell types. Western analysis, pharmacological inhibition and siRNA silencing were performed in human immortalized gingival keratinocytes (HIGK to dissect the functional role of the ataxia telangiectasia mutated (ATM pathway in the signal transduction steps triggered by the CDT. Infection of HIGK was associated with a time-dependent induction of cytoplasmic histone-associated DNA fragmentation. However, in the absence of CDT, infected HIGK underwent reversible DNA strand breaks but not apoptosis, while caspase 3 activity, p21 levels, and HIGK viability were unaffected. Caspase 9 activity was attenuated in the CDT mutant-infected HIGK compared to wild-type infected cells. Pharmacological inhibition and siRNA-silencing of the ATM downstream effector, the protein kinase checkpoint kinase 2 (Chk2, significantly impacted CDT-mediated apoptosis. Together, these findings provide insight on the specificity of the ATM-Chk2 pathway in response to the CDT of A. actinomycetemcomitans in oral epithelial cells, which ultimately leads to apoptosis. We further propose the existence of an unidentified factor that is distinct from the CDT, and involved with a reversible DNA fragmentation that does not trigger terminal apoptosis in oral epithelial cells. This model potentially explains conflicting reports on the biological activity of the A. actinomycetemcomitans CDT.

  20. Brief Communication: Sexual dimorphic expression of myostatin and follistatin like-3 in a rat trans-generational under-nutrition model

    Directory of Open Access Journals (Sweden)

    Mitchell Murray D

    2010-05-01

    Full Text Available Abstract The detrimental effects of maternal under-nutrition during gestation on fetal development are well known with an increased propensity of metabolic disorders identified in the adult offspring. Understanding exactly how and by which molecular pathways inadequate nutrition can impact upon offspring phenotype is critical and necessary for the development of treatment methods and ultimately prevention of any negative health effects. Myostatin, a negative regulator of muscle development, has recently been shown to effect glucose homeostasis and fat deposition. The involvement of myostatin in glucose metabolism and adipogenesis thus supports its ability to act in the continued alterations to the postnatal phenotype of the offspring. This hypothesis was examined in the current study using a trans-generational gestationally under-nourished rat model exposed to a high-fat (HF diet post-weaning. The body weight, body fat, plasma glucose and insulin concentrations of the offspring, both male and female, were investigated in relation to the protein expression of myostatin and its main inhibitor; follistatin like-3 (FSTL-3, in skeletal muscle of mature offspring. Sexual dimorphism was clearly evident in the majority of these measures, including myostatin and FSTL-3 expression. Generally males displayed higher (P myostatin precursor and dimer expression than females, which was especially apparent (P in both chow and HF trans-generationally undernourished (UNAD groups. In females only, myostatin precursor and dimer expression was altered by both trans-generational under-nutrition and postnatal diet. Overall FSTL-3 expression did not differ between sexes, although difference between sexes within certain treatments and diets were evident. Most notably, HF fed UNAD females had higher (P FSTL-3 expression than HF fed UNAD males. The former group also displayed higher (P FSTL-3 expression compared to all other female groups. In summary, myostatin may prove

  1. Brief Communication: Sexual dimorphic expression of myostatin and follistatin like-3 in a rat trans-generational under-nutrition model.

    Science.gov (United States)

    Peiris, Hassendrini N; Ponnampalam, Anna P; Mitchell, Murray D; Green, Mark P

    2010-05-20

    The detrimental effects of maternal under-nutrition during gestation on fetal development are well known with an increased propensity of metabolic disorders identified in the adult offspring. Understanding exactly how and by which molecular pathways inadequate nutrition can impact upon offspring phenotype is critical and necessary for the development of treatment methods and ultimately prevention of any negative health effects. Myostatin, a negative regulator of muscle development, has recently been shown to effect glucose homeostasis and fat deposition. The involvement of myostatin in glucose metabolism and adipogenesis thus supports its ability to act in the continued alterations to the postnatal phenotype of the offspring. This hypothesis was examined in the current study using a trans-generational gestationally under-nourished rat model exposed to a high-fat (HF) diet post-weaning. The body weight, body fat, plasma glucose and insulin concentrations of the offspring, both male and female, were investigated in relation to the protein expression of myostatin and its main inhibitor; follistatin like-3 (FSTL-3), in skeletal muscle of mature offspring. Sexual dimorphism was clearly evident in the majority of these measures, including myostatin and FSTL-3 expression. Generally males displayed higher (P UNAD) groups. In females only, myostatin precursor and dimer expression was altered by both trans-generational under-nutrition and postnatal diet. Overall FSTL-3 expression did not differ between sexes, although difference between sexes within certain treatments and diets were evident. Most notably, HF fed UNAD females had higher (P UNAD males. The former group also displayed higher (P < 0.01) FSTL-3 expression compared to all other female groups. In summary, myostatin may prove to be a key mediator of the effects of inadequate prenatal nutrition, independently or in combination with a high-fat postnatal diet on offspring phenotype. Consequently, further study of

  2. Duct Leakage Repeatability Testing

    Energy Technology Data Exchange (ETDEWEB)

    Walker, Iain [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Sherman, Max [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2014-01-01

    Duct leakage often needs to be measured to demonstrate compliance with requirements or to determine energy or Indoor Air Quality (IAQ) impacts. Testing is often done using standards such as ASTM E1554 (ASTM 2013) or California Title 24 (California Energy Commission 2013 & 2013b), but there are several choices of methods available within the accepted standards. Determining which method to use or not use requires an evaluation of those methods in the context of the particular needs. Three factors that are important considerations are the cost of the measurement, the accuracy of the measurement and the repeatability of the measurement. The purpose of this report is to evaluate the repeatability of the three most significant measurement techniques using data from the literature and recently obtained field data. We will also briefly discuss the first two factors. The main question to be answered by this study is to determine if differences in the repeatability of these tests methods is sufficient to indicate that any of these methods is so poor that it should be excluded from consideration as an allowed procedure in codes and standards.

  3. Identification of four genomic loci highly related to casein-kinase-2-alpha cDNA and characterization of a casein kinase-2-alpha pseudogene within the mouse genome

    DEFF Research Database (Denmark)

    Boldyreff, B; Wehr, K; Hecht, R;

    1992-01-01

    positive clone was further analyzed by sequencing a 3.1 kb XbaI fragment. This clone displays the characteristics of a pseudogene, i.e. lack of introns and several nucleotide insertions and deletions. In its 3' region it contains a 91 bp large CT-rich stretch which consists of (CCTT) and (CT) repeats...

  4. S-Nitrosylation of proline-rich tyrosine kinase 2 involves its activation induced by oxygen-glucose deprivation.

    Science.gov (United States)

    Yan, Xian-Liang; Liu, Dong-Hai; Zhang, Gong-Liang; Hu, Shu-Qun; Chen, Yu-Guo; Xu, Tie

    2015-06-15

    Previous studies have demonstrated that activation of proline-rich tyrosine kinase 2 (PYK2) in cerebral ischemia is involved in the modulation of N-methyl-d-aspartate-type (NMDA) glutamate receptor activity and Ca(2+) dynamics, resulting in ischemic neuron death ultimately. A number of reports indicate that PYK2 is a redox sensitive kinase that must be activated by an estrogen-induced reactive oxygen species (ROS). However, the mechanism of PYK2 activation remains incompletely illustrated. Accumulating attention is focused on nitric oxide (NO, a free radical) which plays a critical role in cellular signal transduction through stimulus-coupled S-nitrosylation of cysteine residues. Here we reported that PYK2 over-expressed in human embryonic kidney (HEK293) cells was S-nitrosylated (forming SNO-PYK2) by reacting with GSNO, an exogenous NO donor, at one critical cysteine residue (Cys534) with a biotin switch assay. Moreover, our results showed that S-nitrosylation and phosphorylation of PYK2 over-expressed in SH-SY5Y cells was significantly increased after oxygen-glucose deprivation (OGD). We further investigated whether the activation (phosphorylation) of PYK2 was associated with S-nitrosylation following SH-SY5Y cells OGD. Our results showed that the cysteine534 residue (site of S-nitrosylation) mutant PYK2 over-expressed in SH-SY5Y cells diminished S-nitrosylation of PYK2 and inhibited its phosphorylation induced by OGD. In addition, overexpression of the mutant PYK2 protein could prevent nuclear accumulation and abrogate neuronal cell death compared to wild type PYK2 in SH-SY5Y cells induced by OGD. These data suggest that the activation of PYK2 following OGD may be modulated by S-nitrosylation, which provides a new avenue for stroke therapy by targeting the post-translational modification machinery.

  5. TNFα inhibits IGFBP-3 through activation of p38α and casein kinase 2 in human retinal endothelial cells.

    Directory of Open Access Journals (Sweden)

    Qiuhua Zhang

    Full Text Available We recently reported a reciprocal relationship between tumor necrosis factor alpha (TNFα and insulin-like receptor growth factor binding protein 3 (IGFBP-3 in whole retina of normal and IGFBP-3 knockout mice. A similar relationship was also observed in cultured retinal endothelial cells (REC. We found that TNFα significantly reduced IGFBP-3 levels and vice-versa, IGFBP-3 can lower TNFα and TNFα receptor expression. Since IGFBP-3 is protective to the diabetic retina and TNFα is causative in the development of diabetic retinopathy, we wanted to better understand the cellular mechanisms by which TNFα can reduce IGFBP-3 levels. For these studies, primary human retinal endothelial cells (REC were used since these cells undergo TNFα-mediated apoptosis under conditions of high glucose conditions and contribute to diabetic retinopathy. We first cultured REC in normal or high glucose, treated with exogenous TNFα, then measured changes in potential signaling pathways, with a focus on P38 mitogen-activated protein kinase alpha (P38α and casein kinase 2 (CK2 as these pathways have been linked to both TNFα and IGFBP-3. We found that TNFα significantly increased phosphorylation of P38α and CK2. Furthermore, specific inhibitors of P38α or CK2 blocked TNFα inhibition of IGFBP-3 expression, demonstrating that TNFα reduces IGFBP-3 through activation of P38α and CK2. Since TNFα and IGFBP-3 are key mediators of retinal damage and protection respectively in diabetic retinopathy, increased understanding of the relationship between these two proteins will offer new therapeutic options for treatment.

  6. Molecular clone and characterization of c-Jun N-terminal kinases 2 from orange-spotted grouper, Epinephelus coioides.

    Science.gov (United States)

    Guo, Minglan; Wei, Jingguang; Zhou, Yongcan; Qin, Qiwei

    2016-02-01

    c-Jun N-terminal kinase 2 (JNK2) is a multifunctional mitogen-activated protein kinases involving in cell differentiation and proliferation, apoptosis, immune response and inflammatory conditions. In this study, we reported a new JNK2 (Ec-JNK2) derived from orange-spotted grouper, Epinephelus coioides. The full-length cDNA of Ec-JNK2 was 1920 bp in size, containing a 174 bp 5'-untranslated region (UTR), 483 bp 3'-UTR, and a 1263 bp open reading frame (ORF), which encoded a putative protein of 420 amino acids. The deduced protein sequence of Ec-JNK2 contained a conserved Thr-Pro-Tyr (TPY) motif in the domain of serine/threonine protein kinase (S-TKc). Ec-JNK2 has been found to involve in the immune response to pathogen challenges in vivo, and the infection of Singapore grouper iridovirus (SGIV) in vitro. Immunofluorescence staining showed that Ec-JNK2 was localized in the cytoplasm of grouper spleen (GS) cells, and moved to the nucleus after infecting with SGIV. Ec-JNK2 distributed in all immune-related tissues examined. After challenging with lipopolysaccharide (LPS), SGIV and polyriboinosinic polyribocytidylic acid (poly I:C), the mRNA expression of Ec-JNK2 was significantly (P orange-spotted grouper. Over-expressing Ec-JNK2 in fathead minnow (FHM) cells increased the SGIV infection and replication, while over-expressing the dominant-negative Ec-JNK2Δ181-183 mutant decreased it. These results indicated that Ec-JNK2 could be an important molecule in the successful infection and evasion of SGIV.

  7. Structural diversity of the active N-terminal kinase domain of p90 ribosomal S6 kinase 2.

    Directory of Open Access Journals (Sweden)

    Margarita Malakhova

    Full Text Available The p90 ribosomal protein kinase 2 (RSK2 is a highly expressed Ser/Thr kinase activated by growth factors and is involved in cancer cell proliferation and tumor promoter-induced cell transformation. RSK2 possesses two non-identical kinase domains, and the structure of its N-terminal domain (NTD, which is responsible for phosphorylation of a variety of substrates, is unknown. The crystal structure of the NTD RSK2 was determined at 1.8 A resolution in complex with AMP-PNP. The N-terminal kinase domain adopted a unique active conformation showing a significant structural diversity of the kinase domain compared to other kinases. The NTD RSK2 possesses a three-stranded betaB-sheet inserted in the N-terminal lobe, resulting in displacement of the alphaC-helix and disruption of the Lys-Glu interaction, classifying the kinase conformation as inactive. The purified protein was phosphorylated at Ser227 in the T-activation loop and exhibited in vitro kinase activity. A key characteristic is the appearance of a new contact between Lys216 (betaB-sheet and the beta-phosphate of AMP-PNP. Mutation of this lysine to alanine impaired both NTDs in vitro and full length RSK2 ex vivo activity, emphasizing the importance of this interaction. Even though the N-terminal lobe undergoes structural re-arrangement, it possesses an intact hydrophobic groove formed between the alphaC-helix, the beta4-strand, and the betaB-sheet junction, which is occupied by the N-terminal tail. The presence of a unique betaB-sheet insert in the N-lobe suggests a different type of activation mechanism for RSK2.

  8. WP1066 disrupts Janus kinase-2 and induces caspase-dependent apoptosis in acute myelogenous leukemia cells.

    Science.gov (United States)

    Ferrajoli, Alessandra; Faderl, Stefan; Van, Quin; Koch, Patricia; Harris, David; Liu, Zhiming; Hazan-Halevy, Inbal; Wang, Yongtao; Kantarjian, Hagop M; Priebe, Waldemar; Estrov, Zeev

    2007-12-01

    Several cytokines and growth factors that stimulate the proliferation of acute myelogenous leukemia (AML) cells transduce their signals by activating the transcription factor Janus-activated kinase 2 (JAK2). Accordingly, the inhibition of JAK2 or of its downstream signaling pathways suppresses the proliferation of AML cells. Because (E)-3(6-bromopyridin-2-yl)-2-cyano-N-((S0-1-phenylethyl)acrylamide) (WP1066) is a novel analogue of the JAK2 inhibitor AG490, we tested its activity in AML cells and investigated its mechanism of action. Using clonogenic assays, we found that although WP1066 had a marginal effect on normal marrow progenitors, it inhibited the proliferation of AML colony-forming cells obtained from patients with newly diagnosed AML and that of the AML cell lines OCIM2 and K562. WP1066 inhibited OCIM2 cell multiplication by inducing accumulation of cells at the G(0)-G(1) phase of the cell cycle. Similar to its parent compound AG490, WP1066 inhibited the phosphorylation of JAK2, but unlike AG490, WP1066 also degraded JAK2 protein, thereby blocking its downstream signal transducer and activator of transcription (STAT) and phosphoinositide-3-kinase pathways. These effects resulted in the activation of the caspase pathway. Incubation of both OCIM2 and K562 cells with WP1066 activated caspase-3, induced cleavage of poly(ADP-ribose) polymerase, and caused caspase-dependent apoptotic cell death. Thus, WP1066 is a potent JAK2 inhibitor whose effects in AML and other hematologic malignancies merit further investigation.

  9. Impaired angiogenesis during fracture healing in GPCR kinase 2 interacting protein-1 (GIT1 knock out mice.

    Directory of Open Access Journals (Sweden)

    Guoyong Yin

    Full Text Available G protein coupled receptor kinase 2 (GRK2 interacting protein-1 (GIT1, is a scaffold protein that plays an important role in angiogenesis and osteoclast activity. We have previously demonstrated that GIT1 knockout (GIT1 KO mice have impaired angiogenesis and dysregulated osteoclast podosome formation leading to a reduction in the bone resorbing ability of these cells. Since both angiogenesis and osteoclast-mediated bone remodeling are involved in the fracture healing process, we hypothesized that GIT1 participates in the normal progression of repair following bone injury. In the present study, comparison of fracture healing in wild type (WT and GIT1 KO mice revealed altered healing in mice with loss of GIT1 function. Alcian blue staining of fracture callus indicated a persistence of cartilagenous matrix in day 21 callus samples from GIT1 KO mice which was temporally correlated with increased type 2 collagen immunostaining. GIT1 KO mice also showed a decrease in chondrocyte proliferation and apoptosis at days 7 and 14, as determined by PCNA and TUNEL staining. Vascular microcomputed tomography analysis of callus samples at days 7, 14 and 21 revealed decreased blood vessel volume, number, and connection density in GIT1 KO mice compared to WT controls. Correlating with this, VEGF-A, phospho-VEGFR2 and PECAM1 (CD31 were decreased in GIT1 KO mice, indicating reduced angiogenesis with loss of GIT1. Finally, calluses from GIT1 KO mice displayed a reduced number of tartrate resistant acid phosphatase-positive osteoclasts at days 14 and 21. Collectively, these results indicate that GIT1 is an important signaling participant in fracture healing, with gene ablation leading to reduced callus vascularity and reduced osteoclast number in the healing callus.

  10. Casein kinase 2α regulates glioblastoma brain tumor-initiating cell growth through the β-catenin pathway.

    Science.gov (United States)

    Nitta, R T; Gholamin, S; Feroze, A H; Agarwal, M; Cheshier, S H; Mitra, S S; Li, G

    2015-07-01

    Glioblastoma (GBM) is the most common and fatal primary brain tumor in humans, and it is essential that new and better therapies are developed to treat this disease. Previous research suggests that casein kinase 2 (CK2) may be a promising therapeutic target for GBMs. CK2 has enhanced expression or activity in numerous cancers, including GBM, and it has been demonstrated that inhibitors of CK2 regressed tumor growth in GBM xenograft mouse models. Our studies demonstrate that the CK2 subunit, CK2α, is overexpressed in and has an important role in regulating brain tumor-initiating cells (BTIC) in GBM. Initial studies showed that two GBM cell lines (U87-MG and U138) transduced with CK2α had enhanced proliferation and anchorage-independent growth. Inhibition of CKα using siRNA or small-molecule inhibitors (TBBz, CX-4945) reduced cell growth, decreased tumor size, and increased survival rates in GBM xenograft mouse models. We also verified that inhibition of CK2α decreased the activity of a well-known GBM-initiating cell regulator, β-catenin. Loss of CK2α decreased two β-catenin-regulated genes that are involved in GBM-initiating cell growth, OCT4 and NANOG. To determine the importance of CK2α in GBM stem cell maintenance, we reduced CK2α activity in primary GBM samples and tumor spheres derived from GBM patients. We discovered that loss of CK2α activity reduced the sphere-forming capacity of BTIC and decreased numerous GBM stem cell markers, including CD133, CD90, CD49f and A2B5. Our study suggests that CK2α is involved in GBM tumorigenesis by maintaining BTIC through the regulation of β-catenin.

  11. A novel role of protein tyrosine kinase2 in mediating chloride secretion in human airway epithelial cells.

    Directory of Open Access Journals (Sweden)

    Lihua Liang

    Full Text Available Ca(2+ activated Cl(- channels (CaCC are up-regulated in cystic fibrosis (CF airway surface epithelia. The presence and functional properties of CaCC make it a possible therapeutic target to compensate for the deficiency of Cl(- secretion in CF epithelia. CaCC is activated by an increase in cytosolic Ca(2+, which not only activates epithelial CaCCs, but also inhibits epithelial Na(+ hyperabsorption, which may also be beneficial in CF. Our previous study has shown that spiperone, a known antipsychotic drug, activates CaCCs and stimulates Cl(- secretion in polarized human non-CF and CF airway epithelial cell monolayers in vitro, and in Cystic Fibrosis Transmembrane Conductance Regulator (CFTR knockout mice in vivo. Spiperone activates CaCC not by acting in its well-known role as an antagonist of either 5-HT2 or D2 receptors, but through a protein tyrosine kinase-coupled phospholipase C-dependent pathway. Moreover, spiperone independently activates CFTR through a novel mechanism. Herein, we performed a mass spectrometry analysis and identified the signaling molecule that mediates the spiperone effect in activating chloride secretion through CaCC and CFTR. Proline-rich tyrosine kinase 2 (PYK2 is a non-receptor protein tyrosine kinase, which belongs to the focal adhesion kinase family. The inhibition of PYK2 notably reduced the ability of spiperone to increase intracellular Ca(2+ and Cl(- secretion. In conclusion, we have identified the tyrosine kinase, PYK2, as the modulator, which plays a crucial role in the activation of CaCC and CFTR by spiperone. The identification of this novel role of PYK2 reveals a new signaling pathway in human airway epithelial cells.

  12. Repeatability of Cryogenic Multilayer Insulation

    Science.gov (United States)

    Johnson, W. L.; Vanderlaan, M.; Wood, J. J.; Rhys, N. O.; Guo, W.; Van Sciver, S.; Chato, D. J.

    2017-01-01

    Due to the variety of requirements across aerospace platforms, and one off projects, the repeatability of cryogenic multilayer insulation has never been fully established. The objective of this test program is to provide a more basic understanding of the thermal performance repeatability of MLI systems that are applicable to large scale tanks. There are several different types of repeatability that can be accounted for: these include repeatability between multiple identical blankets, repeatability of installation of the same blanket, and repeatability of a test apparatus. The focus of the work in this report is on the first two types of repeatability. Statistically, repeatability can mean many different things. In simplest form, it refers to the range of performance that a population exhibits and the average of the population. However, as more and more identical components are made (i.e. the population of concern grows), the simple range morphs into a standard deviation from an average performance. Initial repeatability testing on MLI blankets has been completed at Florida State University. Repeatability of five GRC provided coupons with 25 layers was shown to be +/- 8.4 whereas repeatability of repeatedly installing a single coupon was shown to be +/- 8.0. A second group of 10 coupons have been fabricated by Yetispace and tested by Florida State University, through the first 4 tests, the repeatability has been shown to be +/- 16. Based on detailed statistical analysis, the data has been shown to be statistically significant.

  13. Diagnostic value of serum activin A and follistatin levels indifferent types of endometriosis%激活素A和卵泡抑素在子宫内膜异位症中的诊断价值

    Institute of Scientific and Technical Information of China (English)

    徐小艳; 洛若愚; 邢辉

    2015-01-01

    目的:探讨人激活素 A 和卵泡抑素在腹膜型,卵巢型及深部浸润型子宫内膜异位症中的临床诊断价值。方法子宫内膜异位症患者139例,分成腹膜型内异症组28例,卵巢型内异症组61例,深部浸润型内异症组50例,月经规律的健康女性(对照组)75例,均采集外周静脉血,采用酶联免疫测定试剂盒分析血清中激活素A 和卵泡抑素。结果卵巢内异症组激活素 A 水平[(0.22±0.01)ng/ml]明显高于对照组[(0.17±0.01)ng/ml]、腹膜型内异症组[(0.19±0.01)ng/ml]及深部浸润型内异症组[(0.16±0.02)ng/ml],差异有统计学意义;子宫内膜异位症患者卵泡抑素与对照组比较,差异无统计学意义;深部浸润型内异症组卵泡抑素水平[(1.50±0.17)ng/ml]低于腹膜型内异症组[(2.24±0.42)ng/ml]和卵巢内异症组[(2.34±0.32)ng/ml],差异有统计学意义;激活素 A和卵泡抑素诊断卵巢内异症的 ROC 曲线下面积分别为0.700(95% CI 为0.605~0.794)和0.620(95% CI 为0.510~0.730),二者联合应用不能提高子宫内膜异位症的诊断特异度和灵敏度。结论激活素 A 和卵泡抑素水平在腹膜型内异症和深部浸润型内异症中无明显改变,对诊断卵巢型内异症的准确率有限。%Objective To explore the clinical value of activin A and follistatin levels in women with peritoneal, ovarian and deep inltrating endometriosis. Methods One hundred and thirty﹣nine patients with endometriosis were divided into three groups:peritoneal endometriosis (n =28),ovarian endometrioma (n =61 ),and deep inltrating endometriosis (n =50).Seventy﹣five health women were included as the control group.Peripheral vein blood samples were collected for activin A and follistatin assessment by enzyme immunoassay kits. Results The ovarian endometrioma group [(0.22 ±0.01)ng/ml]had serum

  14. Mitogen-Activated Protein Kinase–Activated Protein Kinase 2 in Angiotensin II–Induced Inflammation and Hypertension

    Science.gov (United States)

    Ebrahimian, Talin; Li, Melissa Wei; Lemarié, Catherine A.; Simeone, Stefania M.C.; Pagano, Patrick J.; Gaestel, Matthias; Paradis, Pierre; Wassmann, Sven; Schiffrin, Ernesto L.

    2015-01-01

    Vascular oxidative stress and inflammation play an important role in angiotensin II–induced hypertension, and mitogen-activated protein kinases participate in these processes. We questioned whether mitogen-activated protein kinase–activated protein kinase 2 (MK2), a downstream target of p38 mitogen–activated protein kinase, is involved in angiotensin II–induced vascular responses. In vivo experiments were performed in wild-type and Mk2 knockout mice infused intravenously with angiotensin II. Angiotensin II induced a 30 mm Hg increase in mean blood pressure in wild-type that was delayed in Mk2 knockout mice. Angiotensin II increased superoxide production and vascular cell adhesion molecule-1 in blood vessels of wild-type but not in Mk2 knockout mice. Mk2 knockdown by small interfering RNA in mouse mesenteric vascular smooth muscle cells caused a 42% reduction in MK2 protein and blunted the angiotensin II–induced 40% increase of MK2 expression. Mk2 knockdown blunted angiotensin II–induced doubling of intracellular adhesion molecule-1 expression, 2.4-fold increase of nuclear p65, and 1.4-fold increase in Ets-1. Mk2 knockdown abrogated the angiotensin II–induced 4.7-fold and 1.3-fold increase of monocyte chemoattractant protein-1 mRNA and protein. Angiotensin II enhanced reactive oxygen species levels (by 29%) and nicotinamide adenine dinucleotide phosphate oxidase activity (by 48%), both abolished by Mk2 knockdown. Reduction of MK2 blocked angiotensin II–induced p47phox translocation to the membrane, associated with a 53% enhanced catalase expression. Angiotensin II–induced increase of MK2 was prevented by the nicotinamide adenine dinucleotide phosphate oxidase inhibitor Nox2ds-tat. Mk2 small interfering RNA prevented the angiotensin II–induced 30% increase of proliferation. In conclusion, MK2 plays a critical role in angiotensin II signaling, leading to hypertension, oxidative stress via activation of p47phox and inhibition of antioxidants, and

  15. Polo-like kinase 2 acting as a promoter in human tumor cells with an abundance of TAp73

    Directory of Open Access Journals (Sweden)

    Hu ZB

    2015-11-01

    Full Text Available ZhengBo Hu,1,* ZunYing Xu,1,* XiaoHong Liao,2,* Xiao Yang,1 Cao Dong,1 KuaDi Luk,3 AnMin Jin,1,* Hai Lu4,5,* 1Department of Orthopedics, Zhujiang Hospital of Southern Medical University, 2The State Key Laboratory of Respiratory Diseases, the First Affiliated Hospital of Guangzhou Medical University, Guangzhou, Guangdong, 3Department of Orthopedics and Traumatology, The University of Hong Kong, Hong Kong, SAR, 4Department of Orthopedics, the Third Affiliated Hospital of the Southern Medical University, Guangzhou, Guangdong, 5Academy of Orthopedics, Guangdong Province, People’s Republic of China *These authors contributed equally to this work Background: TAp73, a member of the p53 tumor suppressor family, is frequently overexpressed in malignant tumors in humans. TAp73 abundance and phosphorylation modification result in variations in transcriptional activity. In a previous study, we found that the antitumor function of TAp73 was reactivated by dephosphorylation in head and neck squamous cell carcinomas. Polo-like kinase 2 (PLK2 displayed a close relationship with the p53 family in affecting the fate of cells. Herein, we investigate the hypothesis that PLK2 phosphorylates TAp73 and inhibits TAp73 function.Materials and methods: Head and neck squamous cell carcinoma cell lines and osteosarcoma cell lines were used as natural models of the different expression levels of TAp73. Phosphorylation predictor software Scansite 3.0 and the predictor GPS-polo 1.0 were used to analyze the phosphorylation sites. Coimmunoprecipitation, phosphor-tag Western blot, metabolic labeling, and indirect immunofluorescence assays were used to determine the interactions between PLK2 and TAp73. TAp73 activity was assessed by Western blot and reverse transcription polymerase chain reaction, which we used to detect P21 and PUMA, both downstream genes of TAp73. The physiological effects of PLK2 cross talk with TAp73 on cell cycle progress and apoptosis were observed by

  16. Expansion of protein domain repeats.

    Directory of Open Access Journals (Sweden)

    Asa K Björklund

    2006-08-01

    Full Text Available Many proteins, especially in eukaryotes, contain tandem repeats of several domains from the same family. These repeats have a variety of binding properties and are involved in protein-protein interactions as well as binding to other ligands such as DNA and RNA. The rapid expansion of protein domain repeats is assumed to have evolved through internal tandem duplications. However, the exact mechanisms behind these tandem duplications are not well-understood. Here, we have studied the evolution, function, protein structure, gene structure, and phylogenetic distribution of domain repeats. For this purpose we have assigned Pfam-A domain families to 24 proteomes with more sensitive domain assignments in the repeat regions. These assignments confirmed previous findings that eukaryotes, and in particular vertebrates, contain a much higher fraction of proteins with repeats compared with prokaryotes. The internal sequence similarity in each protein revealed that the domain repeats are often expanded through duplications of several domains at a time, while the duplication of one domain is less common. Many of the repeats appear to have been duplicated in the middle of the repeat region. This is in strong contrast to the evolution of other proteins that mainly works through additions of single domains at either terminus. Further, we found that some domain families show distinct duplication patterns, e.g., nebulin domains have mainly been expanded with a unit of seven domains at a time, while duplications of other domain families involve varying numbers of domains. Finally, no common mechanism for the expansion of all repeats could be detected. We found that the duplication patterns show no dependence on the size of the domains. Further, repeat expansion in some families can possibly be explained by shuffling of exons. However, exon shuffling could not have created all repeats.

  17. DWI Repeaters and Non-Repeaters: A Comparison.

    Science.gov (United States)

    Weeber, Stan

    1981-01-01

    Discussed how driving-while-intoxicated (DWI) repeaters differed signigicantly from nonrepeaters on 4 of 23 variables tested. Repeaters were more likely to have zero or two dependent children, attend church frequently, drink occasionally and have one or more arrests for public intoxication. (Author)

  18. To Repeat or Not to Repeat a Course

    Science.gov (United States)

    Armstrong, Michael J.; Biktimirov, Ernest N.

    2013-01-01

    The difficult transition from high school to university means that many students need to repeat (retake) 1 or more of their university courses. The authors examine the performance of students repeating first-year core courses in an undergraduate business program. They used data from university records for 116 students who took a total of 232…

  19. Nifty Nines and Repeating Decimals

    Science.gov (United States)

    Brown, Scott A.

    2016-01-01

    The traditional technique for converting repeating decimals to common fractions can be found in nearly every algebra textbook that has been published, as well as in many precalculus texts. However, students generally encounter repeating decimal numerals earlier than high school when they study rational numbers in prealgebra classes. Therefore, how…

  20. Nifty Nines and Repeating Decimals

    Science.gov (United States)

    Brown, Scott A.

    2016-01-01

    The traditional technique for converting repeating decimals to common fractions can be found in nearly every algebra textbook that has been published, as well as in many precalculus texts. However, students generally encounter repeating decimal numerals earlier than high school when they study rational numbers in prealgebra classes. Therefore, how…

  1. CK2(beta)tes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster

    DEFF Research Database (Denmark)

    Kalmykova, Alla I; Shevelyov, Yuri Y; Polesskaya, Oksana O

    2002-01-01

    An earlier described CK2(beta)tes gene of Drosophila melanogaster is shown to encode a male germline specific isoform of regulatory beta subunit of casein kinase 2. Western-analysis using anti-CK2(beta)tes Ig revealed CK2(beta)tes protein in Drosophila testes extract. Expression of a CK2(beta...... and coimmunoprecipitation analysis of protein extract from Drosophila testes, we demonstrated an association between CK2(beta)tes and CK2alpha. Northern-analysis has shown that another regulatory (beta') subunit found recently in D. melanogaster genome is also testis-specific. Thus, we describe the first example of two...

  2. Retraction: Open and closed conformations reveal induced fit movements in butyrate kinase 2 activation. J. Diao, Y. D. Ma, and M. S. Hasson.

    Science.gov (United States)

    2012-06-01

    The following article from Proteins: Structure, Function, and Bioinformatics, "Open and closed conformations reveal induced fit movements in butyrate kinase 2 activation," by Jiasheng Diao, Yunglin D. Ma, and Miriam S. Hasson, published online on 21 October 2010 in Wiley Online Library (onlinelibrary.wiley.com), has been retracted by agreement between the journal Editor in Chief, Bertrand Garcia-Moreno, and Wiley Periodicals. The retraction has been agreed because it was established by internal investigation performed by Purdue University that the authors of this article are not the owners of the data and have no right to publication.

  3. Concurrent Deletion of Cyclin E1 and Cyclin-Dependent Kinase 2 in Hepatocytes Inhibits DNA Replication and Liver Regeneration in Mice

    OpenAIRE

    Hu W; Nevzorova YA; Haas U; Moro N.; Sicinski P; Geng Y; Barbacid M; Trautwein C; Liedtke C.

    2014-01-01

    The liver has a strong regenerative capacity. After injury, quiescent hepatocytes can reenter the mitotic cell cycle to restore tissue homeostasis. This G0/G1-S cell-cycle transition of primed hepatocytes is regulated by complexes of cyclin-dependent kinase 2 (Cdk2) with E-type cyclins (CcnE1 or CcnE2). However, single genetic ablation of either E-cyclin or Cdk2 does not affect overall liver regeneration. Here, we systematically investigated the contribution of CcnE1, CcnE2, and Cdk2 for live...

  4. All-photonic quantum repeaters

    Science.gov (United States)

    Azuma, Koji; Tamaki, Kiyoshi; Lo, Hoi-Kwong

    2015-01-01

    Quantum communication holds promise for unconditionally secure transmission of secret messages and faithful transfer of unknown quantum states. Photons appear to be the medium of choice for quantum communication. Owing to photon losses, robust quantum communication over long lossy channels requires quantum repeaters. It is widely believed that a necessary and highly demanding requirement for quantum repeaters is the existence of matter quantum memories. Here we show that such a requirement is, in fact, unnecessary by introducing the concept of all-photonic quantum repeaters based on flying qubits. In particular, we present a protocol based on photonic cluster-state machine guns and a loss-tolerant measurement equipped with local high-speed active feedforwards. We show that, with such all-photonic quantum repeaters, the communication efficiency scales polynomially with the channel distance. Our result paves a new route towards quantum repeaters with efficient single-photon sources rather than matter quantum memories. PMID:25873153

  5. Analysis of repeated measures data

    CERN Document Server

    Islam, M Ataharul

    2017-01-01

    This book presents a broad range of statistical techniques to address emerging needs in the field of repeated measures. It also provides a comprehensive overview of extensions of generalized linear models for the bivariate exponential family of distributions, which represent a new development in analysing repeated measures data. The demand for statistical models for correlated outcomes has grown rapidly recently, mainly due to presence of two types of underlying associations: associations between outcomes, and associations between explanatory variables and outcomes. The book systematically addresses key problems arising in the modelling of repeated measures data, bearing in mind those factors that play a major role in estimating the underlying relationships between covariates and outcome variables for correlated outcome data. In addition, it presents new approaches to addressing current challenges in the field of repeated measures and models based on conditional and joint probabilities. Markov models of first...

  6. Crystal structure of human cyclin-dependent kinase-2 complex with MK2 inhibitor TEI-I01800: insight into the selectivity

    Energy Technology Data Exchange (ETDEWEB)

    Fujino, Aiko; Fukushima, Kei; Kubota, Takaharu; Kosugi, Tomomi; Takimoto-Kamimura, Midori, E-mail: m.kamimura@teijin.co.jp [Teijin Pharma Limited, 4-3-2 Asahigaoka, Hino-shi, Tokyo 191-8512 (Japan)

    2013-11-01

    The Gly-rich loop of cyclin-dependent kinase 2 (CDK2) bound to TEI-I01800 as an MK2 specific inhibitor forms a β-sheet which is a common structure in CDK2–ligand complexes. Here, the reason why TEI-I01800 does not become a strong inhibitor against CDK2 based on the conformation of TEI-I01800 is presented. Mitogen-activated protein kinase-activated protein kinase 2 (MK2 or MAPKAP-K2) is a Ser/Thr kinase from the p38 mitogen-activated protein kinase signalling pathway and plays an important role in inflammatory diseases. The crystal structure of the MK2–TEI-I01800 complex has been reported; its Gly-rich loop was found to form an α-helix, not a β-sheet as has been observed for other Ser/Thr kinases. TEI-I01800 is 177-fold selective against MK2 compared with CDK2; in order to understand the inhibitory mechanism of TEI-I01800, the cyclin-dependent kinase 2 (CDK2) complex structure with TEI-I01800 was determined at 2.0 Å resolution. Interestingly, the Gly-rich loop of CDK2 formed a β-sheet that was different from that of MK2. In MK2, TEI-I01800 changed the secondary structure of the Gly-rich loop from a β-sheet to an α-helix by collision between Leu70 and a p-ethoxyphenyl group at the 7-position and bound to MK2. However, for CDK2, TEI-I01800 bound to CDK2 without this structural change and lost the interaction with the substituent at the 7-position. In summary, the results of this study suggest that the reason for the selectivity of TEI-I01800 is the favourable conformation of TEI-I01800 itself, making it suitable for binding to the α-form MK2.

  7. High mobility group A-interacting proteins in cancer: focus on chromobox protein homolog 7, homeodomain interacting protein kinase 2 and PATZ

    Directory of Open Access Journals (Sweden)

    Monica Fedele

    2012-03-01

    Full Text Available The High Mobility Group A (HMGA proteins, a family of DNA architectural factors, by interacting with different proteins play crucial roles in neoplastic transformation of a wide range of tissues. Therefore, the search for HMGA-interacting partners was carried out by several laboratories in order to investigate the mechanisms underlying HMGA-dependent tumorigenesis. Three of the several HMGA-binding proteins are discussed in this review. These are the Chromobox family protein (chromobox protein homolog 7, CBX7, the homeodomain interacting protein kinase 2 (HIPK2 and the POZ/domain and Kruppel zinc finger family member, PATZ. All of them play a critical role in tumorigenesis, and may also be independent markers of cancer. Their activities are linked to cell cycle, apoptosis and senescence. In this review, we discuss the properties of each protein, including their effect on HMGA1 functions, and propose a model accounting for how their activities might be coordinated.

  8. Circulating irisin levels are lower in patients with either stable coronary artery disease (CAD) or myocardial infarction (MI) versus healthy controls, whereas follistatin and activin A levels are higher and can discriminate MI from CAD with similar to CK-MB accuracy.

    Science.gov (United States)

    Anastasilakis, Athanasios D; Koulaxis, Dimitrios; Kefala, Nikoleta; Polyzos, Stergios A; Upadhyay, Jagriti; Pagkalidou, Eirini; Economou, Fotios; Anastasilakis, Chrysostomos D; Mantzoros, Christos S

    2017-08-01

    Several myokines are produced by cardiac muscle. We investigated changes in myokine levels at the time of acute myocardial infarction (MI) and following reperfusion in relation to controls. Patients with MI (MI Group, n=31) treated with percutaneous coronary intervention (PCI) were compared to patients with stable coronary artery disease (CAD) subjected to scheduled PCI (CAD Group, n=40) and controls with symptoms mimicking CAD without stenosis in angiography (Control Group, n=43). The number and degree of stenosis were recorded. Irisin, follistatin, follistatin-like 3, activin A and B, ALT, AST, CK and CK-MB were measured at baseline and 6 or 24h after the intervention. MI and CAD patients had lower irisin than controls (pCAD patients and controls (all p≤0.001). None of the myokines changed following reperfusion. Circulating irisin was associated with the degree of stenosis in all patients (p=0.05). Irisin was not inferior to CK-MB in predicting MI while folistatin and activin A could discriminate MI from CAD patients with similar to CK-MB accuracy. None of these myokines was altered following PCI in contrast to CK-MB. Irisin levels are lower in MI and CAD implying that their production may depend on myocadial blood supply. Follistatin and activin A are higher in MI than in CAD suggesting increased release due to myocardial necrosis. They can predict MI with accuracy similar to CK-MB and their role in the diagnosis of MI remains to be confirmed by prospective large clinical studies. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Limitations on quantum key repeaters.

    Science.gov (United States)

    Bäuml, Stefan; Christandl, Matthias; Horodecki, Karol; Winter, Andreas

    2015-04-23

    A major application of quantum communication is the distribution of entangled particles for use in quantum key distribution. Owing to noise in the communication line, quantum key distribution is, in practice, limited to a distance of a few hundred kilometres, and can only be extended to longer distances by use of a quantum repeater, a device that performs entanglement distillation and quantum teleportation. The existence of noisy entangled states that are undistillable but nevertheless useful for quantum key distribution raises the question of the feasibility of a quantum key repeater, which would work beyond the limits of entanglement distillation, hence possibly tolerating higher noise levels than existing protocols. Here we exhibit fundamental limits on such a device in the form of bounds on the rate at which it may extract secure key. As a consequence, we give examples of states suitable for quantum key distribution but unsuitable for the most general quantum key repeater protocol.

  10. Hysteresis of magnetostructural transitions: Repeatable and non-repeatable processes

    Energy Technology Data Exchange (ETDEWEB)

    Provenzano, Virgil [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States); Della Torre, Edward; Bennett, Lawrence H. [Department of Electrical and Computer Engineering, The George Washington University, Washington, DC 20052 (United States); ElBidweihy, Hatem, E-mail: Hatem@gwmail.gwu.edu [Department of Electrical and Computer Engineering, The George Washington University, Washington, DC 20052 (United States)

    2014-02-15

    The Gd{sub 5}Ge{sub 2}Si{sub 2} alloy and the off-stoichiometric Ni{sub 50}Mn{sub 35}In{sub 15} Heusler alloy belong to a special class of metallic materials that exhibit first-order magnetostructural transitions near room temperature. The magnetic properties of this class of materials have been extensively studied due to their interesting magnetic behavior and their potential for a number of technological applications such as refrigerants for near-room-temperature magnetic refrigeration. The thermally driven first-order transitions in these materials can be field-induced in the reverse order by applying a strong enough field. The field-induced transitions are typically accompanied by the presence of large magnetic hysteresis, the characteristics of which are a complicated function of temperature, field, and magneto-thermal history. In this study we show that the virgin curve, the major loop, and sequentially measured MH loops are the results of both repeatable and non-repeatable processes, in which the starting magnetostructural state, prior to the cycling of field, plays a major role. Using the Gd{sub 5}Ge{sub 2}Si{sub 2} and Ni{sub 50}Mn{sub 35}In{sub 15} alloys, as model materials, we show that a starting single phase state results in fully repeatable processes and large magnetic hysteresis, whereas a mixed phase starting state results in non-repeatable processes and smaller hysteresis.

  11. EAMJ Dec. Repeatability.indd

    African Journals Online (AJOL)

    2008-12-12

    Dec 12, 2008 ... Results:Kappa values for four-week repeatability for the wheeze and asthma questions were 0.61 ... for logistic, cultural and ethical reasons, to use ... individual with baseline forced expiratory volume in .... period is likely to also include the effects of true ... data, the writing of the manuscript or the decision.

  12. Directionality switchable gain stabilized linear repeater

    Science.gov (United States)

    Ota, Takayuki; Ohmachi, Tadashi; Aida, Kazuo

    2004-10-01

    We propose a new approach to realize a bidirectional linear repeater suitable for future optical internet networks and fault location in repeater chain with OTDR. The proposed approach is the linear repeater of simple configuration whose directionality is rearranged dynamically by electrical control signal. The repeater is composed of a magneto-optical switch, a circulator, a dynamically gain stabilized unidirectional EDFA, and control circuits. The repeater directionality is rearranged as fast as 0.1ms by an electrical control pulse. It is experimentally confirmed that OTDR with the directionality switchable repeater is feasible for repeater chain. The detailed design and performance of the repeater are also discussed, including the multi-pass interference (MPI) which may arise in the proposed repeater, the effect of the MPI on SNR degradation of the repeater chain and the feed-forward EDFA gain control circuit.

  13. Measurement-based quantum repeaters

    CERN Document Server

    Zwerger, M; Briegel, H J

    2012-01-01

    We introduce measurement-based quantum repeaters, where small-scale measurement-based quantum processors are used to perform entanglement purification and entanglement swapping in a long-range quantum communication protocol. In the scheme, pre-prepared entangled states stored at intermediate repeater stations are coupled with incoming photons by simple Bell-measurements, without the need of performing additional quantum gates or measurements. We show how to construct the required resource states, and how to minimize their size. We analyze the performance of the scheme under noise and imperfections, with focus on small-scale implementations involving entangled states of few qubits. We find measurement-based purification protocols with significantly improved noise thresholds. Furthermore we show that already resource states of small size suffice to significantly increase the maximal communication distance. We also discuss possible advantages of our scheme for different set-ups.

  14. A Repeating Fast Radio Burst

    CERN Document Server

    Spitler, L G; Hessels, J W T; Bogdanov, S; Brazier, A; Camilo, F; Chatterjee, S; Cordes, J M; Crawford, F; Deneva, J; Ferdman, R D; Freire, P C C; Kaspi, V M; Lazarus, P; Lynch, R; Madsen, E C; McLaughlin, M A; Patel, C; Ransom, S M; Seymour, A; Stairs, I H; Stappers, B W; van Leeuwen, J; Zhu, W W

    2016-01-01

    Fast Radio Bursts are millisecond-duration astronomical radio pulses of unknown physical origin that appear to come from extragalactic distances. Previous follow-up observations have failed to find additional bursts at the same dispersion measures (i.e. integrated column density of free electrons between source and telescope) and sky position as the original detections. The apparent non-repeating nature of the fast radio bursts has led several authors to hypothesise that they originate in cataclysmic astrophysical events. Here we report the detection of ten additional bursts from the direction of FRB121102, using the 305-m Arecibo telescope. These new bursts have dispersion measures and sky positions consistent with the original burst. This unambiguously identifies FRB121102 as repeating and demonstrates that its source survives the energetic events that cause the bursts. Additionally, the bursts from FRB121102 show a wide range of spectral shapes that appear to be predominantly intrinsic to the source and wh...

  15. Repeatability of Harris Corner Detector

    Institute of Scientific and Technical Information of China (English)

    HU Lili

    2003-01-01

    Interest point detectors are commonly employed to reduce the amount of data to be processed. The ideal interest point detector would robustly select those features which are most appropriate or salient for the application and data at hand. This paper shows that interest points are geometrically stable under different transformations.This property makes interest points very successful in the context of image matching. To measure this property quantatively, we introduce a evaluation criterion: repeatability rate.

  16. Involvement of nucleotide diphosphate kinase 2 in the reopening of the sensitive period of filial imprinting of domestic chicks (Gallus gallus domesticus).

    Science.gov (United States)

    Yamaguchi, Shinji; Aoki, Naoya; Takehara, Akihiko; Mori, Masaru; Kanai, Akio; Matsushima, Toshiya; Homma, Koichi J

    2016-01-26

    Filial imprinting is a behavior characterized by the sensitive or critical period restricted to the first few days after hatching. Once the sensitive period is closed, it is widely believed that chicks can never be imprinted under natural conditions. Previously, we showed that the exogenous injection of T3 reopened the sensitive period which was already closed. That study suggested that T3 functioned by way of a rapid non-genomic action; however, the molecular mechanism of how T3 reopens the sensitive period remains unknown. Here, we show that the phosphorylation level of nucleotide diphosphate kinase 2 (NDPK2) was upregulated following T3 injection. Pharmacological deprivation of the kinase activity of NDPK hampered the molecular process prerequisite for the reopening of the sensitive period of filial imprinting. Moreover, it is shown that the kinase activity of NDPK2 participates in the priming process by T3 signaling which endows the potential for learning. Our data indicate that NDPK2 plays a crucial role downstream of T3 action and that its phosphorylation is involved in the non-genomic signaling during imprinting. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  17. Extracellular signal-regulated kinase 2 (ERK2) phosphorylation sites and docking domain on the nuclear pore complex protein Tpr cooperatively regulate ERK2-Tpr interaction.

    Science.gov (United States)

    Vomastek, Tomás; Iwanicki, Marcin P; Burack, W Richard; Tiwari, Divya; Kumar, Devanand; Parsons, J Thomas; Weber, Michael J; Nandicoori, Vinay Kumar

    2008-11-01

    Identifying direct substrates of mitogen-activated protein kinases (MAPKs) and understanding how those substrates are selected is central to understanding how these ubiquitously activated enzymes generate diverse biological responses. In previous work, we identified several new candidate substrates for the MAPK ERK2 (extracellular signal-regulated kinase 2), including the nuclear pore complex protein Tpr (translocated promoter region). In this report, we identify sites on Tpr for ERK2 phosphorylation and binding and demonstrate their functional interaction. ERK2 phosphorylation and dimerization are necessary for ERK2-Tpr binding, and this occurs through a DEF (docking site for ERK2, FXF) domain on Tpr. Surprisingly, the DEF domain and the phosphorylation sites displayed positive cooperativity to promote ERK2 binding to Tpr, in contrast to substrates where phosphorylation reduces binding. Ectopic expression or depletion of Tpr resulted in decreased movement of activated ERK2 from the cytoplasm to the nucleus, implying a role for Tpr in ERK2 translocation. Collectively, the data provide direct evidence that a component of the nuclear pore complex is a bona fide substrate of ERK2 in vivo and that activated ERK2 stably associates with this substrate after phosphorylation, where it could play a continuing role in nuclear pore function. We propose that Tpr is both a substrate and a scaffold for activated ERKs.

  18. Stability of the human Hsp90-p50Cdc37 chaperone complex against nucleotides and Hsp90 inhibitors, and the influence of phosphorylation by casein kinase 2.

    Science.gov (United States)

    Olesen, Sanne H; Ingles, Donna J; Zhu, Jin-Yi; Martin, Mathew P; Betzi, Stephane; Georg, Gunda I; Tash, Joseph S; Schönbrunn, Ernst

    2015-01-19

    The molecular chaperone Hsp90 is regulated by co-chaperones such as p50Cdc37, which recruits a wide selection of client protein kinases. Targeted disruption of the Hsp90-p50Cdc37 complex by protein-protein interaction (PPI) inhibitors has emerged as an alternative strategy to treat diseases characterized by aberrant Hsp90 activity. Using isothermal microcalorimetry, ELISA and GST-pull down assays we evaluated reported Hsp90 inhibitors and nucleotides for their ability to inhibit formation of the human Hsp90β-p50Cdc37 complex, reconstituted in vitro from full-length proteins. Hsp90 inhibitors, including the proposed PPI inhibitors gedunin and H2-gamendazole, did not affect the interaction of Hsp90 with p50Cdc37 in vitro. Phosphorylation of Hsp90 and p50Cdc37 by casein kinase 2 (CK2) did not alter the thermodynamic signature of complex formation. However, the phosphorylated complex was vulnerable to disruption by ADP (IC50 = 32 µM), while ATP, AMPPNP and Hsp90 inhibitors remained largely ineffective. The differential inhibitory activity of ADP suggests that phosphorylation by CK2 primes the complex for dissociation in response to a drop in ATP/ADP levels. The approach applied herein provides robust assays for a comprehensive biochemical evaluation of potential effectors of the Hsp90-p50Cdc37 complex, such as phosphorylation by a kinase or the interaction with small molecule ligands.

  19. Structural Characterization of Proline-rich Tyrosine Kinase 2 (PYK2) Reveals a Unique (DFG-out) Conformation and Enables Inhibitor Design

    Energy Technology Data Exchange (ETDEWEB)

    Han, Seungil; Mistry, Anil; Chang, Jeanne S.; Cunningham, David; Griffor, Matt; Bonnette, Peter C.; Wang, Hong; Chrunyk, Boris A.; Aspnes, Gary E.; Walker, Daniel P.; Brosius, Arthur D.; Buckbinder, Leonard; Pfizer

    2009-05-21

    Proline-rich tyrosine kinase 2 (PYK2) is a cytoplasmic, non-receptor tyrosine kinase implicated in multiple signaling pathways. It is a negative regulator of osteogenesis and considered a viable drug target for osteoporosis treatment. The high-resolution structures of the human PYK2 kinase domain with different inhibitor complexes establish the conventional bilobal kinase architecture and show the conformational variability of the DFG loop. The basis for the lack of selectivity for the classical kinase inhibitor, PF-431396, within the FAK family is explained by our structural analyses. Importantly, the novel DFG-out conformation with two diarylurea inhibitors (BIRB796, PF-4618433) reveals a distinct subclass of non-receptor tyrosine kinases identifiable by the gatekeeper Met-502 and the unique hinge loop conformation of Leu-504. This is the first example of a leucine residue in the hinge loop that blocks the ATP binding site in the DFG-out conformation. Our structural, biophysical, and pharmacological studies suggest that the unique features of the DFG motif, including Leu-504 hinge-loop variability, can be exploited for the development of selective protein kinase inhibitors.

  20. New scoring functions for virtual screening from molecular dynamics simulations with a quantum-refined force-field (QRFF-MD). Application to cyclin-dependent kinase 2.

    Science.gov (United States)

    Ferrara, Ph; Curioni, A; Vangrevelinghe, E; Meyer, T; Mordasini, T; Andreoni, W; Acklin, P; Jacoby, E

    2006-01-01

    A recently introduced new methodology based on ultrashort (50-100 ps) molecular dynamics simulations with a quantum-refined force-field (QRFF-MD) is here evaluated in its ability both to predict protein-ligand binding affinities and to discriminate active compounds from inactive ones. Physically based scoring functions are derived from this approach, and their performance is compared to that of several standard knowledge-based scoring functions. About 40 inhibitors of cyclin-dependent kinase 2 (CDK2) representing a broad chemical diversity were considered. The QRFF-MD method achieves a correlation coefficient, R(2), of 0.55, which is significantly better than that obtained by a number of traditional approaches in virtual screening but only slightly better than that obtained by consensus scoring (R(2) = 0.50). Compounds from the Available Chemical Directory, along with the known active compounds, were docked into the ATP binding site of CDK2 using the program Glide, and the 650 ligands from the top scored poses were considered for a QRFF-MD analysis. Combined with structural information extracted from the simulations, the QRFF-MD methodology results in similar enrichment of known actives compared to consensus scoring. Moreover, a new scoring function is introduced that combines a QRFF-MD based scoring function with consensus scoring, which results in substantial improvement on the enrichment profile.

  1. IκB Kinase 2 Is Essential for IgE-Induced Mast Cell De Novo Cytokine Production but Not for Degranulation

    Directory of Open Access Journals (Sweden)

    Katrin Peschke

    2014-09-01

    Full Text Available The immunoglobulin E (IgE-mediated mast cell (MC response is central to the pathogenesis of type I allergy and asthma. IκB kinase 2 (IKK2 was reported to couple IgE-induced signals to MC degranulation by phosphorylating the SNARE protein SNAP23. We investigated MC responses in mice with MC-specific inactivation of IKK2 or NF-κB essential modulator (NEMO, or animals with MC-specific expression of a mutant, constitutively active IKK2. We show that the IgE-induced late-phase cytokine response is reduced in mice lacking IKK2 or NEMO in MCs. However, anaphylactic in vivo responses of these animals are not different from those of control mice, and in vitro IKK2-deficient MCs readily phosphorylate SNAP23 and degranulate similarly to control cells in response to allergen or calcium ionophore. Constitutive overactivation of the NF-κB pathway has only slight effects on allergen-triggered MC responses. Thus, IKK2 is dispensable for MC degranulation, and the important question how IgE-induced signals trigger MC vesicle fusion remains open.

  2. Identification of a novel crosstalk between casein kinase 2α and NPM-ALK in ALK-positive anaplastic large cell lymphoma.

    Science.gov (United States)

    Armanious, Hanan; Gelebart, Pascal; Anand, Mona; Lai, Raymond

    2013-02-01

    It was previously reported that β-catenin contributes to the tumorigenesis of ALK-positive anaplastic large cell lymphoma (ALK(+)ALCL), and the oncogenic effects of β-catenin in these tumors are promoted by NPM-ALK, an abnormal fusion protein characteristic of ALK(+)ALCL. In this study, we hypothesized that NPM-ALK promotes the oncogenic activity of β-catenin via its functional interactions with the Wnt canonical pathway (WCP). To test this hypothesis, we examined if NPM-ALK modulates the gene expression of various members in the WCP. Using a Wnt pathway-specific oligonucleotide array and Western blots, we found that the expression of casein kinase 2α (CK2α) was substantially downregulated in ALK(+)ALCL cells in response to siRNA knockdown of NPM-ALK. CK2α is biologically important in ALK(+)ALCL, as its inhibition using 4,5,6,7-tetrabromobenzotriazole or siRNA resulted in a significant decrease in cell growth and a substantial decrease in the β-catenin protein level. Furthermore, CK2α co-immunoprecipitated with NPM-ALK and regulated its level of serine phosphorylation, a feature previously shown to correlate with the oncogenic potential of this fusion protein. To conclude, this study has revealed a novel crosstalk between NPM-ALK and CK2α, and our data supports the model that these two molecules work synergistically to promote the tumorigenicity of these lymphomas.

  3. Cdc2-like kinase 2 suppresses hepatic fatty acid oxidation and ketogenesis through disruption of the PGC-1α and MED1 complex.

    Science.gov (United States)

    Tabata, Mitsuhisa; Rodgers, Joseph T; Hall, Jessica A; Lee, Yoonjin; Jedrychowski, Mark P; Gygi, Steven P; Puigserver, Pere

    2014-05-01

    Hepatic ketogenesis plays an important role in catabolism of fatty acids during fasting along with dietary lipid overload, but the mechanisms regulating this process remain poorly understood. Here, we show that Cdc2-like kinase 2 (Clk2) suppresses fatty acid oxidation and ketone body production during diet-induced obesity. In lean mice, hepatic Clk2 protein is very low during fasting and strongly increased during feeding; however, in diet-induced obese mice, Clk2 protein remains elevated through both fed and fasted states. Liver-specific Clk2 knockout mice fed a high-fat diet exhibit increased fasting levels of blood ketone bodies, reduced respiratory exchange ratio, and increased gene expression of fatty acid oxidation and ketogenic pathways. This effect of Clk2 is cell-autonomous, because manipulation of Clk2 in hepatocytes controls genes and rates of fatty acid utilization. Clk2 phosphorylation of peroxisome proliferator-activated receptor γ coactivator (PGC-1α) disrupts its interaction with Mediator subunit 1, which leads to a suppression of PGC-1α activation of peroxisome proliferator-activated receptor α target genes in fatty acid oxidation and ketogenesis. These data demonstrate the importance of Clk2 in the regulation of fatty acid metabolism in vivo and suggest that inhibition of hepatic Clk2 could provide new therapies in the treatment of fatty liver disease.

  4. Combined use of pharmacokinetic modeling and a steady-state delivery approach allows early assessment of IkappaB kinase-2 (IKK-2) target safety and efficacy.

    Science.gov (United States)

    Chiang, Po-Chang; Kishore, Nandini N; Thompson, David C

    2010-03-01

    NF-kappaB activation is clearly linked to the pathogenesis of multiple inflammatory diseases including arthritis. The prominent role of IkappaB kinase-2 (IKK-2) in regulating NF-kappaB signaling in response to proinflammatory stimuli has made IKK-2 a primary anti-inflammation therapeutic target. PHA-408, a potent and selective IKK-2 inhibitor, was identified internally and used for our studies to assess this target. In early in vivo studies, PHA-408 demonstrated efficacy at high doses; however, the correlation between PHA-408 exposure and efficacy could not be established using standard dosing paradigms for the rat disease models. Similar concerns arose from early in vivo safety studies where appropriate NOAEL margins were not achieved. Following a full investigation of the physicochemical properties of the molecule and pharmacokinetic modeling, an oral steady-state delivery strategy was designed to administer PHA-408 to the rat for both efficacy and safety studies. Using this steady-state delivery, a clear dose-response relationship was established between plasma concentrations of PHA-408 and efficacy in the rat arthritis model. The same steady-state delivery approach was used to demonstrate the target safety. In summary, a combination of pharmacokinetic modeling with a steady-state delivery approach allowed us to establish confidence in both the mechanism and safety of the target.

  5. Association of factor V Leiden, Janus kinase 2, prothrombin, and MTHFR mutations with primary Budd-Chiari syndrome in Egyptian patients.

    Science.gov (United States)

    El Sebay, Hatem M; Safan, Manal A; Daoud, Ashraf A; Tayel, Safaa I; Nouh, Mohamed A; El Shafie, Shymaa

    2016-01-01

    Budd-Chiari syndrome (BCS) is defined as obstruction of hepatic venous outflow anywhere from the small hepatic veins to the suprahepatic inferior vena cava. The pathogenesis of BCS is still not fully understood. This study aimed to evaluate the association of factor V Leiden (FVL), Janus kinase 2 (JAK2), prothrombin, and methylene tetrahydrofolate reductase (MTHFR) mutations with primary BCS. The study was carried out on 35 patients with primary BCS and 15 age and gender matched healthy individuals as a control group. Genotyping of FVL, prothrombin, and MTHFR mutations was determined by GENEQUALITY AB-THROMBO TYPE kit based on the reverse hybridization principle. JAK2 mutation was determined by polymerase chain reaction-restriction fragment length polymorphism. There was a statistically significant difference between patients and controls regarding FVL, MTHFR C677T, and MTHFR A1298C mutations with odds ratio of 1.83, 2.0, and 1.79, respectively. Hetero MTHFR C677T, hetero FVL, and hetero MTHFR A1298C were the most common etiological factors being responsible for 57.1, 42.9, and 42.9% of primary BCS cases, respectively. It could be concluded that BCS is a multifactorial disease; in the current study, MTHFR C677T mutation was the most common cause of disease. Identification of one cause of BCS should not eliminate investigations for detection of other etiological factors. © 2015 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

  6. Pharmacological and safety evaluation of CIGB-300, a casein kinase 2 inhibitor peptide, administered intralesionally to patients with cervical cancer stage IB2/II

    Directory of Open Access Journals (Sweden)

    Soriano-García JL

    2013-08-01

    Full Text Available CIGB-300 is a pro-apoptotic casein kinase 2 inhibitor peptide with potential anticancer action. An open-label and dose scaling Phase I trial was carried out to investigate the peptide tumor uptake, pharmacokinetics, toxicity, and levels of a CIGB-300 response biomarker in patients with cervical cancer stage IB2/II. Fourteen patients were included; six of them received 35 mg, 6 received 70 mg and the two remaining patients received 245 mg of CIGB-300 prior chemoradiotherapy. CIGB-300 was applied by intratumor injections during 5-consecutive days. For pharmacokinetic and biodistribution studies, the peptide was radiolabeled with 99mTc in the first administration and whole body gammagraphy and plasma testing were done during 48 h. Data showed that the maximum tolerated dose was 70 mg for CIGB-300 in this clinical setting. Furthermore, an allergic-like syndrome was identified as the dose limiting toxicity, which was well-correlated with plasmatic histamine levels. Importantly, the mean tumor uptake was 14.9 mg and 10.4 mg for CIGB-300 doses of 35 and 70 mg, respectively. Also, the kidneys were the main target organ for drug elimination. Finally, treatment with CIGB-300 significantly reduced the B23/nucleophosmin levels in tumor specimens. CIGB-300 meets potentialities to be tested in future trials in a neoadjuvant setting prior to chemoradiotherapy in cervical cancer.

  7. Modulation of adrenal catecholamine secretion by in vivo gene transfer and manipulation of G protein-coupled receptor kinase-2 activity.

    Science.gov (United States)

    Lymperopoulos, Anastasios; Rengo, Giuseppe; Zincarelli, Carmela; Soltys, Stephen; Koch, Walter J

    2008-02-01

    We recently reported that the upregulation of adrenal G protein-coupled receptor kinase-2 (GRK2) causes enhanced catecholamine (CA) secretion by desensitizing sympatho-inhibitory alpha (2)-adrenergic receptors (alpha (2)ARs) of chromaffin cells, and thereby aggravating heart failure (HF). In this study, we sought to develop an efficient and reproducible in vivo adrenal gene transfer method to determine whether manipulation of adrenal GRK2 levels/activity regulates physiological CA secretion in rats. We specifically investigated two different in vivo gene delivery methods: direct injection into the suprarenal glands, and retrograde delivery through the suprarenal veins. We delivered adenoviral (Ad) vectors containing either GRK2 or an inhibitor of GRK2 activity, the beta ARKct. We found both delivery approaches equally effective at supporting robust (>80% of the whole organ) and adrenal-restricted transgene expression, in the cortical region as well as in the medullar region. Additionally, rats with AdGRK2-infected adrenals exhibit enhanced plasma CA levels when compared with control rats (AdGFP-injected adrenals), whereas plasma CA levels after Ad beta ARKct infection were significantly lower. Finally, in isolated chromaffin cells, alpha (2)ARs of AdGRK2-infected cells failed to inhibit CA secretion whereas Ad beta ARKct-infected cells showed normal alpha (2)AR responsiveness. These results not only indicate that in vivo adrenal gene transfer is an effective way of manipulating adrenal gland signalling, but also identify GRK2 as a critically important molecule involved in CA secretion.

  8. Expression, Purification, and Characterization of a Sucrose Nonfermenting 1-Related Protein Kinases 2 of Arabidopsis thaliana in E. coli-Based Cell-Free System

    Directory of Open Access Journals (Sweden)

    Xu Zhang

    2016-01-01

    Full Text Available The plant-specific sucrose nonfermenting 1-related protein kinase 2 (SnRK2 family is considered an important regulator of plant responses to abiotic stresses such as drought, cold, salinity, and nutrition deficiency. However, little information is available on how SnRK2s regulate sulfur deprivation responses in Arabidopsis. Large-scale production of SnRK2 kinases in vitro can help to elucidate the biochemical properties and physiological functions of this protein family. However, heterogenous expression of SnRK2s usually leads to inactive proteins. In this study, we expressed a recombinant Arabidopsis SnRK2.1 in a modified E. coli cell-free system, which combined two kinds of extracts allowing for a convenient and affordable protein preparation. The recombinant SnRK2.1 was produced in large-scale and the autophosphorylation activity of purified SnRK2.1 was characterized, allowing for further biochemical and substrate binding analysis in sulfur signaling. The application of this improved E. coli cell-free system provides us a promising and convenient platform to enhance expression of the target proteins economically.

  9. Stability of the Human Hsp90-p50Cdc37 Chaperone Complex against Nucleotides and Hsp90 Inhibitors, and the Influence of Phosphorylation by Casein Kinase 2

    Directory of Open Access Journals (Sweden)

    Sanne H. Olesen

    2015-01-01

    Full Text Available The molecular chaperone Hsp90 is regulated by co-chaperones such as p50Cdc37, which recruits a wide selection of client protein kinases. Targeted disruption of the Hsp90-p50Cdc37 complex by protein–protein interaction (PPI inhibitors has emerged as an alternative strategy to treat diseases characterized by aberrant Hsp90 activity. Using isothermal microcalorimetry, ELISA and GST-pull down assays we evaluated reported Hsp90 inhibitors and nucleotides for their ability to inhibit formation of the human Hsp90β-p50Cdc37 complex, reconstituted in vitro from full-length proteins. Hsp90 inhibitors, including the proposed PPI inhibitors gedunin and H2-gamendazole, did not affect the interaction of Hsp90 with p50Cdc37 in vitro. Phosphorylation of Hsp90 and p50Cdc37 by casein kinase 2 (CK2 did not alter the thermodynamic signature of complex formation. However, the phosphorylated complex was vulnerable to disruption by ADP (IC50 = 32 µM, while ATP, AMPPNP and Hsp90 inhibitors remained largely ineffective. The differential inhibitory activity of ADP suggests that phosphorylation by CK2 primes the complex for dissociation in response to a drop in ATP/ADP levels. The approach applied herein provides robust assays for a comprehensive biochemical evaluation of potential effectors of the Hsp90-p50Cdc37 complex, such as phosphorylation by a kinase or the interaction with small molecule ligands.

  10. Quantitative assay for the detection of the V617F variant in the Janus kinase 2 (JAK2 gene using the Luminex xMAP technology

    Directory of Open Access Journals (Sweden)

    Gaudet Daniel

    2010-04-01

    Full Text Available Abstract Background The availability of clinically valid biomarkers contribute to improve the diagnosis and clinical management of diseases. A valine-to-phenylalanine substitution at position 617 (V617F in the Janus kinase 2 (JAK2 gene has been recently associated with key signaling abnormalities in the transduction of haemopoietic growth-factor receptors and is now considered as a useful clinical marker of myeloproliferative neoplasms. Several methods have recently been reported to detect the JAK2 V617F point mutation and show variable sensitivity. Methods Using the Luminex xMAP technology, we developed a quantitative assay to detect the JAK2V617F variant. The method was based on polymerase chain reaction (PCR followed by hybridization to specific probes coupled with internally dyed microspheres. The assay comprises 3 steps: genomic DNA extraction, end point PCR reaction, direct hybridization of PCR fragments and quantification. It has been tested with different sources of nucleic acid. Results Applied to whole blood samples, this quantitative assay showed a limit of detection of 2%. A highly sensitive allele-specific primer extension reaction performed in parallel allowed to validate the results and to identify the specimens with values below 2%. Conclusion Direct hybridization assay using the Luminex xMAP technology allows sensitive quantification of JAK2V617F from blood spots. It is simple and can be easily performed in a clinical setting.

  11. Stability of the Human Hsp90-p50Cdc37 Chaperone Complex against Nucleotides and Hsp90 Inhibitors, and the Influence of Phosphorylation by Casein Kinase 2

    Science.gov (United States)

    Olesen, Sanne H.; Ingles, Donna J.; Zhu, Jin-Yi; Martin, Mathew P.; Betzi, Stephane; Georg, Gunda I.; Tash, Joseph S.; Schönbrunn, Ernst

    2015-01-01

    The molecular chaperone Hsp90 is regulated by co-chaperones such as p50Cdc37, which recruits a wide selection of client protein kinases. Targeted disruption of the Hsp90-p50Cdc37 complex by protein-protein interaction (PPI) inhibitors has emerged as an alternative strategy to treat diseases characterized by aberrant Hsp90 activity. Using isothermal microcalorimetry, ELISA and GST-pull down assays we evaluated reported Hsp90 inhibitors and nucleotides for their ability to inhibit formation of the human Hsp90β-p50Cdc37 complex, reconstituted in-vitro from full-length proteins. Hsp90 inhibitors, including the proposed PPI inhibitors gedunin and H2-gamendazole, did not affect the interaction of Hsp90 with p50Cdc37 in vitro. Phosphorylation of Hsp90 and p50Cdc37 by casein kinase 2 (CK2) did not alter the thermodynamic signature of complex formation. However, the phosphorylated complex was vulnerable to disruption by ADP (IC50 = 32 µM), while ATP, AMPPNP and Hsp90 inhibitors remained largely ineffective. The differential inhibitory activity of ADP suggests that phosphorylation by CK2 primes the complex for dissociation in response to a drop in ATP/ADP levels. The approach applied herein provides robust assays for a comprehensive biochemical evaluation of potential effectors of the Hsp90-p50Cdc37 complex, such as phosphorylation by a kinase or the interaction with small molecule ligands. PMID:25608045

  12. Origin and fate of repeats in bacteria.

    Science.gov (United States)

    Achaz, G; Rocha, E P C; Netter, P; Coissac, E

    2002-07-01

    We investigated 53 complete bacterial chromosomes for intrachromosomal repeats. In previous studies on eukaryote chromosomes, we proposed a model for the dynamics of repeats based on the continuous genesis of tandem repeats, followed by an active process of high deletion rate, counteracted by rearrangement events that may prevent the repeats from being deleted. The present study of long repeats in the genomes of Bacteria and Archaea suggests that our model of interspersed repeats dynamics may apply to them. Thus the duplication process might be a consequence of very ancient mechanisms shared by all three domains. Moreover, we show that there is a strong negative correlation between nucleotide composition bias and the repeat density of genomes. We hypothesise that in highly biased genomes, non-duplicated small repeats arise more frequently by random effects and are used as primers for duplication mechanisms, leading to a higher density of large repeats.

  13. Improving repeatability by improving quality

    Energy Technology Data Exchange (ETDEWEB)

    Ronen, Shuki; Ackers, Mark; Schlumberger, Geco-Prakla; Brink, Mundy

    1998-12-31

    Time lapse (4-D) seismic is a promising tool for reservoir characterization and monitoring. The method is apparently simple: to acquire data repeatedly over the same reservoir, process and interpret the data sets, then changes between the data sets indicate changes in the reservoir. A problem with time lapse seismic data is that reservoirs are a relatively small part of the earth and important reservoir changes may cause very small differences to the time lapse data. The challenge is to acquire and process economical time lapse data such that reservoir changes can be detected above the noise of varying acquisition and environment. 7 refs., 9 figs.

  14. Coordinated hybrid automatic repeat request

    KAUST Repository

    Makki, Behrooz

    2014-11-01

    We develop a coordinated hybrid automatic repeat request (HARQ) approach. With the proposed scheme, if a user message is correctly decoded in the first HARQ rounds, its spectrum is allocated to other users, to improve the network outage probability and the users\\' fairness. The results, which are obtained for single- and multiple-antenna setups, demonstrate the efficiency of the proposed approach in different conditions. For instance, with a maximum of M retransmissions and single transmit/receive antennas, the diversity gain of a user increases from M to (J+1)(M-1)+1 where J is the number of users helping that user.

  15. Crowding by a repeating pattern.

    Science.gov (United States)

    Rosen, Sarah; Pelli, Denis G

    2015-01-01

    Theinability to recognize a peripheral target among flankers is called crowding. For a foveal target, crowding can be distinguished from overlap masking by its sparing of detection, linear scaling with eccentricity, and invariance with target size.Crowding depends on the proximity and similarity of the flankers to the target. Flankers that are far from or dissimilar to the target do not crowd it. On a gray page, text whose neighboring letters have different colors, alternately black and white, has enough dissimilarity that it might escape crowding. Since reading speed is normally limited by crowding, escape from crowding should allow faster reading. Yet reading speed is unchanged (Chung & Mansfield, 2009). Why? A recent vernier study found that using alternating-color flankers produces strong crowding (Manassi, Sayim, & Herzog, 2012). Might that effect occur with letters and reading? Critical spacing is the minimum center-to-center target-flanker spacing needed to correctly identify the target. We measure it for a target letter surrounded by several equidistant flanker letters of the same polarity, opposite polarity, or mixed polarity: alternately white and black. We find strong crowding in the alternating condition, even though each flanker letter is beyond its own critical spacing (as measured in a separate condition). Thus a periodic repeating pattern can produce crowding even when the individual elements do not. Further, in all conditions we find that, once a periodic pattern repeats (two cycles), further repetition does not affect critical spacing of the innermost flanker.

  16. Automatization and familiarity in repeated checking

    NARCIS (Netherlands)

    Dek, Eliane C P; van den Hout, Marcel A.; Giele, Catharina L.; Engelhard, Iris M.

    2014-01-01

    Repeated checking paradoxically increases memory uncertainty. This study investigated the underlying mechanism of this effect. We hypothesized that as a result of repeated checking, familiarity with stimuli increases, and automatization of the checking procedure occurs, which should result in decrea

  17. CDC Vital Signs: Preventing Repeat Teen Births

    Science.gov (United States)

    ... file Error processing SSI file Preventing Repeat Teen Births Recommend on Facebook Tweet Share Compartir On this ... Too many teens, ages 15–19, have repeat births. Nearly 1 in 5 births to teens, ages ...

  18. Expanded complexity of unstable repeat diseases

    OpenAIRE

    Polak, Urszula; McIvor, Elizabeth; Dent, Sharon Y.R.; Wells, Robert D.; Napierala, Marek.

    2012-01-01

    Unstable Repeat Diseases (URDs) share a common mutational phenomenon of changes in the copy number of short, tandemly repeated DNA sequences. More than 20 human neurological diseases are caused by instability, predominantly expansion, of microsatellite sequences. Changes in the repeat size initiate a cascade of pathological processes, frequently characteristic of a unique disease or a small subgroup of the URDs. Understanding of both the mechanism of repeat instability and molecular consequen...

  19. 酪蛋白激酶2结合并磷酸化ataxin-3%Casein kinase 2 interacts with and phosphorylates ataxin-3

    Institute of Scientific and Technical Information of China (English)

    陶瑞松; 费尔康; 应征; 王洪枫; 王光辉

    2008-01-01

    目的 马查多-约瑟夫病/脊髓小脑共济失调3型,是由MJDI基因产物ataxin-3的C-末端的多聚谷氨酰胺发生重复扩展突变而引起的一种常染色体显性遗传的神经退行性疾病,目前它的发病机制还不清楚.很多研究表明磷酸化修饰作用在很多神经退行性疾病的发病过程中起到重要作用,然而已知可以磷酸化ataxin-3的激酶仍然很少.本研究的目的是探讨酪蛋白激酶2(Casein kinase 2,CK2)对于ataxin-3的磷酸化作用.方法 通过GST pulldown和免疫共沉淀技术鉴定ataxin-3和CK2的相互作用.通过体外磷酸化技术检测CK2对ataxin-3的磷酸化.结果 (1)正常和扩展突变型ataxin-3在体外与CK2α、β亚单位均发生相互作用;(2)在293细胞中正常和扩展突变型ataxin-3只和CK2β亚单位相互作用,而与α亚单位没有结合;(3)正常和扩展突变型ataxin-3都可以被CK2磷酸化.结论 Ataxin-3是蛋白激酶CK2的底物.%Objective Machado-Joseph disease(MJD)/Spinocerebellar ataxia type 3(SCA3)is an autosomal dominant neurodegenerative disorder caused by an expansion of polyglutamine tract near the C-terminus of the MJDI gene product,ataxin-3.The precise mechanism of the MJD/SCA3 pathogenesis remains unclear.A growing body of evidence demonstrates that phosphorylation plays an important role in the pathogenesis of many neurodegenerative diseases.However,few kinases are known to phosphorylate ataxin-3.The present study is to explore whether ataxin-3 is a substrate of casein kinase 2 (CK2).Methods The interaction between ataxin-3 and CK2 was identified by glutathione S-transferase (GST) pull-down assay and co-immunoprecipition assay.The phosphorylation of ataxin-3 by CK2 was measured by in vitro phosphorylation assays.Results (1) Both wild type and expanded ataxin-3 interacted with CK2α and CK2β in vitro.(2) In 293 cells,both wild type and expanded ataxin-3 interacted with CK2β,but not CK2α.(3) CK2 phosphorylated wild type and

  20. Inhibition of Casein kinase-2 induces p53-dependent cell cycle arrest and sensitizes glioblastoma cells to tumor necrosis factor (TNFα)-induced apoptosis through SIRT1 inhibition.

    Science.gov (United States)

    Dixit, D; Sharma, V; Ghosh, S; Mehta, V S; Sen, E

    2012-02-09

    Glioblastoma multiforme (GBM) are resistant to TNFα-induced apoptosis and blockade of TNFα-induced NF-κB activation sensitizes glioma cells to apoptosis. As Casein kinase-2 (CK2) induces aberrant NF-κB activation and as we observed elevated CK2 levels in GBM tumors, we investigated the potential of CK2 inhibitors (CK2-Is) - DRB and Apigenin in sensitizing glioma cells to TNFα-induced apoptosis. CK2-Is and CK2 small interfering RNA (siRNA) reduced glioma cell viability, inhibited TNFα-mediated NF-κB activation, and sensitized cell to TNFα-induced apoptosis. Importantly, CK2-Is activated p53 function in wild-type but not in p53 mutant cells. Activation of p53 function involved its increased transcriptional activation, DNA-binding ability, increased expression of p53 target genes associated with cell cycle progression and apoptosis. Moreover, CK2-Is decreased telomerase activity and increased senescence in a p53-dependent manner. Apoptotic gene profiling indicated that CK2-Is differentially affect p53 and TNFα targets in p53 wild-type and mutant glioma cells. CK2-I decreased MDM2-p53 association and p53 ubiquitination to enhance p53 levels. Interestingly, CK2-Is downregulated SIRT1 activity and over-expression of SIRT1 decreased p53 transcriptional activity and rescued cells from CK2-I-induced apoptosis. This ability of CK2-Is to sensitize glioma to TNFα-induced death via multiple mechanisms involving abrogation of NF-κB activation, reactivation of wild-type p53 function and SIRT1 inhibition warrants investigation.

  1. Casein Kinase 2 Is a Novel Regulator of the Human Organic Anion Transporting Polypeptide 1A2 (OATP1A2) Trafficking.

    Science.gov (United States)

    Chan, Ting; Cheung, Florence Shin Gee; Zheng, Jian; Lu, Xiaoxi; Zhu, Ling; Grewal, Thomas; Murray, Michael; Zhou, Fanfan

    2016-01-04

    Human organic anion transporting polypeptides (OATPs) mediate the influx of many important drugs into cells. Casein kinase 2 (CK2) is a critical protein kinase that phosphorylates >300 protein substrates and is dysregulated in a number of disease states. Among the CK2 substrates are several transporters, although whether this includes human OATPs has not been evaluated. The current study was undertaken to evaluate the regulation of human OATP1A2 by CK2. HEK-239T cells in which OATP1A2 was overexpressed were treated with CK2 specific inhibitors or transfected with CK2 specific siRNA, and the activity, expression, and subcellular trafficking of OATP1A2 was evaluated. CK2 inhibition decreased the uptake of the prototypic OATP1A2 substrate estrone-3-sulfate (E3S). Kinetic studies revealed that this was due to a decrease in the maximum velocity (Vmax) of E3S uptake, while the Michaelis constant was unchanged. The cell surface expression, but not the total cellular expression of OATP1A2, was impaired by CK2 inhibition and knockdown of the catalytic α-subunits of CK2. CK2 inhibition decreased the internalization of OATP1A2 via a clathrin-dependent pathway, decreased OATP1A2 recycling, and likely impaired OATP1A2 targeting to the cell surface. Consistent with these findings, CK2 inhibition also disrupted the colocalization of OATP1A2 and Rab GTPase (Rab)4-, Rab8-, and Rab9-positive endosomal and secretory vesicles. Taken together, CK2 has emerged as a novel regulator of the subcellular trafficking and stability of OATP1A2. Because OATP1A2 transports many molecules of physiological and pharmacological importance, the present data may inform drug selection in patients with diseases in which CK2 and OATP1A2 are dysregulated.

  2. Artocarpus altilis CG-901 alters critical nodes in the JH1-kinase domain of Janus kinase 2 affecting upstream JAK/STAT3 signaling.

    Science.gov (United States)

    Nash, Oyekanmi; Omotuyi, Olaposi; Lee, Joonku; Kwon, Byoung-Mog; Ogbadu, Lucy

    2015-11-01

    As a key step in achieving low-cost, easily accessible anti-cancer therapy for low- and middle-income countries, we recently established the scientific basis for the folkloric use of Artocarpus altilis for the treatment of cancer by investigating the geranyl dihydrochalcone (CG-901) content and its interference with signal transducer and activator of transcription 3 (STAT3) phosphorylation and blockage of further downstream signaling. In the current study, the CG-901 upstream target was queried by chemical fingerprinting similarity assessment, semi-empirical (PM6ESCF) QMMM and molecular dynamics (MD) simulation. Moderate (∼0.4) to high (∼0.7) Tanimoto scores were found when the CG-901 scaffold was compared to ligands co-crystallized with Janus kinases (JAK) 1-3. High negative energy values were obtained when the CG-901 was treated semi-empirically (PM6ESCF) within the classical field of JAK (1-3). Multiple nanosecond MD simulations showed that CG-901 did not cause any large structural perturbations in the nucleotide-binding, activation and catalytic loops within the kinase (JH1) domain of JAK (1-3); however, it reduced the energy required to attain metastability along the path to energy minima conformation. In comparison to JAK1 and Apo-state JAK2, JAK2-bound CG-901 exhibited a highly re-organized key intra-domain protein network; indicating atomic level interference with inter-residue communication. In conclusion, CG-901 isolated from A. altilis represents a broad-spectrum JAK inhibitor, which may underlie the mechanism of STAT3 phosphorylation blockage. Graphical abstract Upper panel Janus kinase 2 upstream signaling pathway. Lower panel Apo-JAK2 (left) and CG-901-bound JAK2 (right).

  3. Pharmacological inhibition of Polo Like Kinase 2 (PLK2) does not cause chromosomal damage or result in the formation of micronuclei

    Energy Technology Data Exchange (ETDEWEB)

    Fitzgerald, Kent, E-mail: Kent.fitzgerald@elan.com [Pharmacological Sciences, Elan Pharmaceuticals Inc., 180 Oyster Point Boulevard, South San Francisco, CA 94080 (United States); Bergeron, Marcelle, E-mail: Marcelle.bergeron@elan.com [Pharmacological Sciences, Elan Pharmaceuticals Inc., 180 Oyster Point Boulevard, South San Francisco, CA 94080 (United States); Willits, Christopher, E-mail: Chris.willits@elan.com [Pharmacological Sciences, Elan Pharmaceuticals Inc., 180 Oyster Point Boulevard, South San Francisco, CA 94080 (United States); Bowers, Simeon, E-mail: Simeon.bowers@elan.com [Chemistry, Elan Pharmaceuticals Inc., 180 Oyster Point Boulevard, South San Francisco, CA 94080 (United States); Aubele, Danielle L., E-mail: Danielle.aubele@elan.com [Chemistry, Elan Pharmaceuticals Inc., 180 Oyster Point Boulevard, South San Francisco, CA 94080 (United States); Goldbach, Erich, E-mail: Erich.goldbach@elan.com [Drug Metabolism and Pharmacokinetics, Elan Pharmaceuticals Inc., 180 Oyster Point Boulevard, South San Francisco, CA 94080 (United States); Tonn, George, E-mail: George.tonn@elan.com [Drug Metabolism and Pharmacokinetics, Elan Pharmaceuticals Inc., 180 Oyster Point Boulevard, South San Francisco, CA 94080 (United States); Ness, Daniel, E-mail: Dan.ness@elan.com [Nonclinical Safety Evaluation, Elan Pharmaceuticals Inc., 180 Oyster Point Boulevard, South San Francisco, CA 94080 (United States); Olaharski, Andrew, E-mail: andrew.olaharski@agios.com [Nonclinical Safety Evaluation, Elan Pharmaceuticals Inc., 180 Oyster Point Boulevard, South San Francisco, CA 94080 (United States)

    2013-05-15

    Polo Like Kinase 2 (PLK2) phosphorylates α-synuclein and is considered a putative therapeutic target for Parkinson's disease. Several lines of evidence indicate that PLK2 is involved with proper centriole duplication and cell cycle regulation, inhibition of which could impact chromosomal integrity during mitosis. The objectives of the series of experiments presented herein were to assess whether specific inhibition of PLK2 is genotoxic and determine if PLK2 could be considered a tractable pharmacological target for Parkinson's disease. Several selective PLK2 inhibitors, ELN 582175 and ELN 582646, and their inactive enantiomers, ELN 582176 and ELN 582647, did not significantly increase the number of micronuclei in the in vitro micronucleus assay. ELN 582646 was administered to male Sprague Dawley rats in an exploratory 14-day study where flow cytometric analysis of peripheral blood identified a dose-dependent increase in the number of micronucleated reticulocytes. A follow-up investigative study demonstrated that ELN 582646 administered to PLK2 deficient and wildtype mice significantly increased the number of peripheral micronucleated reticulocytes in both genotypes, suggesting that ELN 582646-induced genotoxicity is not through the inhibition of PLK2. Furthermore, significant reduction of retinal phosphorylated α-synuclein levels was observed at three non-genotoxic doses, additional data to suggest that pharmacological inhibition of PLK2 is not the cause of the observed genotoxicity. These data, in aggregate, indicate that PLK2 inhibition is a tractable CNS pharmacological target that does not cause genotoxicity at doses and exposures that engage the target in the sensory retina. - Highlights: • Active and inactive enantiomers test negative in the in vitro micronucleus test. • ELN 582646 significantly increased micronuclei at 100 and 300 mg/kg/day doses. • ELN 582646 significantly increased micronuclei in PLK2 knockout mice. • ELN 582646

  4. Parathyroid hormone-related protein enhances human ß-cell proliferation and function with associated induction of cyclin-dependent kinase 2 and cyclin E expression.

    Science.gov (United States)

    Guthalu Kondegowda, Nagesha; Joshi-Gokhale, Sheela; Harb, George; Williams, Katoura; Zhang, Xiao Ying; Takane, Karen K; Zhang, Pili; Scott, Donald K; Stewart, Andrew F; Garcia-Ocaña, Adolfo; Vasavada, Rupangi C

    2010-12-01

    Inducing human β-cell growth while enhancing function is a major goal in the treatment of diabetes. Parathyroid hormone-related protein (PTHrP) enhances rodent β-cell growth and function through the parathyroid hormone-1 receptor (PTH1R). Based on this, we hypothesized that PTH1R is expressed in human β-cells and that PTHrP has the potential to enhance human β-cell proliferation and/or function. PTH1R expression, β-cell proliferation, glucose-stimulated insulin secretion (GSIS), and expression of differentiation and cell-cycle genes were analyzed in human islets transduced with adenoviral PTHrP constructs or treated with PTHrP peptides. The effect of overexpression of late G1/S cell cycle molecules was also assessed on human β-cell proliferation. We found that human β-cells express PTH1R. More importantly, overexpression of PTHrP causes a significant approximately threefold increase in human β-cell proliferation. Furthermore, the amino terminus PTHrP(1-36) peptide is sufficient to increase replication as well as expression of the late G1/S cell-cycle proteins cyclin E and cyclin-dependent kinase 2 (cdk2) in human islets. Notably, PTHrP(1-36) also enhances GSIS. Finally, overexpression of cyclin E alone, but not cdk2, augments human β-cell proliferation, and when both molecules are expressed simultaneously there is a further marked synergistic increase in replication. PTHrP(1-36) peptide enhances human β-cell proliferation as well as function, with associated upregulation of two specific cell-cycle activators that together can induce human β-cell proliferation several fold. The future therapeutic potential of PTHrP(1-36) for the treatment of diabetes is especially relevant given the complementary therapeutic efficacy of PTHrP(1-36) in postmenopausal osteoporosis.

  5. Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice.

    Science.gov (United States)

    Bricambert, Julien; Miranda, Jonatan; Benhamed, Fadila; Girard, Jean; Postic, Catherine; Dentin, Renaud

    2010-12-01

    Obesity and type 2 diabetes are associated with increased lipogenesis in the liver. This results in fat accumulation in hepatocytes, a condition known as hepatic steatosis, which is a form of nonalcoholic fatty liver disease (NAFLD), the most common cause of liver dysfunction in the United States. Carbohydrate-responsive element-binding protein (ChREBP), a transcriptional activator of glycolytic and lipogenic genes, has emerged as a major player in the development of hepatic steatosis in mice. However, the molecular mechanisms enhancing its transcriptional activity remain largely unknown. In this study, we have identified the histone acetyltransferase (HAT) coactivator p300 and serine/threonine kinase salt-inducible kinase 2 (SIK2) as key upstream regulators of ChREBP activity. In cultured mouse hepatocytes, we showed that glucose-activated p300 acetylated ChREBP on Lys672 and increased its transcriptional activity by enhancing its recruitment to its target gene promoters. SIK2 inhibited p300 HAT activity by direct phosphorylation on Ser89, which in turn decreased ChREBP-mediated lipogenesis in hepatocytes and mice overexpressing SIK2. Moreover, both liver-specific SIK2 knockdown and p300 overexpression resulted in hepatic steatosis, insulin resistance, and inflammation, phenotypes reversed by SIK2/p300 co-overexpression. Finally, in mouse models of type 2 diabetes and obesity, low SIK2 activity was associated with increased p300 HAT activity, ChREBP hyperacetylation, and hepatic steatosis. Our findings suggest that inhibition of hepatic p300 activity may be beneficial for treating hepatic steatosis in obesity and type 2 diabetes and identify SIK2 activators and specific p300 inhibitors as potential targets for pharmaceutical intervention.

  6. Minichromosome Maintenance Complex is Required for Checkpoint Kinase 2 Chromatin Loading and its Phosphorylation to DNA Damage Response in SCC-4 Cells.

    Science.gov (United States)

    Li, Liang; Feng, Yi; Luo, Rui

    2017-01-01

    Checkpoint kinase 2 (Chk2) is a significant mediator of diverse responses to DNA damage. The present study was aimed to identify possible interactive proteins of Chk2 and try to clarify the underlying mechanism regarding Chk2 chromatin loading and its phosphorylation to DNA damage response in oral squamous cell carcinoma (OSCC). Differently tagged Chk2 and minichromosome maintenance (MCM) complex (MCM2, MCM3, MCM5, and MCM6) were overexpressed into SCC-4 cells. After 48 h of transfection cell fractionation was performed to localize proteins. In addition, immunoreactive species were detected by immunoprecipitation (IP) and immunoblot (IB) analysis, and protein-protein interaction between Chk2 and MCM complex was ensured by glutathione S-transferase (GST) pull-down assay. Expression of MCM2 and MCM6 was downregulated by small interfering RNA (siRNA), and the chromatin and non-chromatin fraction were analyzed. The expression of Chk2 phosphorylation (pT68-Chk2) was measured after administration of different dosages of siMCM2 (0.5 μg, 1 μg, and 2.5 μg) and camptothecin (CPT). Our results showed that Chk2 directly interacts with MCM2, MCM3, MCM5, and MCM6 in SCC-4 cells. Downregulation of MCM2 and MCM6 markedly reduced Chk2 chromatin fraction, and downregulation of MCM2 decreased the expression of pT68-Chk2 to DNA damage response in a dose manner. Our results suggest that the interaction between Chk2 and MCM complex is required for Chk2 chromatin loading and its phosphorylation to DNA damage response in SCC-4 cells. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  7. Bacillus bombysepticus α-Toxin Binding to G Protein-Coupled Receptor Kinase 2 Regulates cAMP/PKA Signaling Pathway to Induce Host Death.

    Directory of Open Access Journals (Sweden)

    Ping Lin

    2016-03-01

    Full Text Available Bacterial pathogens and their toxins target host receptors, leading to aberrant behavior or host death by changing signaling events through subversion of host intracellular cAMP level. This is an efficient and widespread mechanism of microbial pathogenesis. Previous studies describe toxins that increase cAMP in host cells, resulting in death through G protein-coupled receptor (GPCR signaling pathways by influencing adenylyl cyclase or G protein activity. G protein-coupled receptor kinase 2 (GRK2 has a central role in regulation of GPCR desensitization. However, little information is available about the pathogenic mechanisms of toxins associated with GRK2. Here, we reported a new bacterial toxin-Bacillus bombysepticus (Bb α-toxin that was lethal to host. We showed that Bb α-toxin interacted with BmGRK2. The data demonstrated that Bb α-toxin directly bound to BmGRK2 to promote death by affecting GPCR signaling pathways. This mechanism involved stimulation of Gαs, increase level of cAMP and activation of protein kinase A (PKA. Activated cAMP/PKA signal transduction altered downstream effectors that affected homeostasis and fundamental biological processes, disturbing the structural and functional integrity of cells, resulting in death. Preventing cAMP/PKA signaling transduction by inhibitions (NF449 or H-89 substantially reduced the pathogenicity of Bb α-toxin. The discovery of a toxin-induced host death specifically linked to GRK2 mediated signaling pathway suggested a new model for bacterial toxin action. Characterization of host genes whose expression and function are regulated by Bb α-toxin and GRK2 will offer a deeper understanding of the pathogenesis of infectious diseases caused by pathogens that elevate cAMP.

  8. Recognition of the inner lipoyl-bearing domain of dihydrolipoyl transacetylase and of the blood glucose-lowering compound AZD7545 by pyruvate dehydrogenase kinase 2.

    Science.gov (United States)

    Tuganova, Alina; Klyuyeva, Alla; Popov, Kirill M

    2007-07-24

    Pyruvate dehydrogenase kinase 2 (PDHK2) is a unique mitochondrial protein kinase that regulates the activity of the pyruvate dehydrogenase multienzyme complex (PDC). PDHK2 is an integral component of PDC tightly bound to the inner lipoyl-bearing domains (L2) of the dihydrolipoyl transacetylase component (E2) of PDC. This association has been reported to bring about an up to 10-fold increase in kinase activity. Despite the central role played by E2 in the maintenance of PDHK2 functionality in the PDC-bound state, the molecular mechanisms responsible for the recognition of L2 by PDHK2 and for the E2-dependent PDHK2 activation are largely unknown. In this study, we used a combination of molecular modeling and site-directed mutagenesis to identify the amino acid residues essential for the interaction between PDHK2 and L2 and for the activation of PDHK2 by E2. On the basis of the results of site-directed mutagenesis, it appears that a number of PDHK2 residues located in its R domain (P22, L23, F28, F31, F44, L45, and L160) and in the so-called "cross arm" structure (K368, R372, and K391) are critical in determining the strength of the interaction between PDHK2 and L2. The residues of L2 essential for recognition by PDHK2 include L140, K173, I176, E179, and to a lesser extent D164, D172, and A174. Importantly, certain PDHK2 residues forming interfaces with L2, i.e., K17, P22, F31, F44, R372, and K391, are also critical for the maintenance of enhanced PDHK2 activity in the E2-bound state. Finally, evidence that the blood glucose-lowering compound AZD7545 disrupts the interactions between PDHK2 and L2 and thereby inhibits PDHK2 activity is presented.

  9. Shear stress induces human aortic endothelial cell apoptosis via interleukin‑1 receptor‑associated kinase 2‑induced endoplasmic reticulum stress.

    Science.gov (United States)

    Pan, Longfei; Hong, Zhou; Yu, Lei; Gao, Yanxia; Zhang, Rui; Feng, Hui; Su, Lijuan; Wang, Gang

    2017-09-19

    Atherosclerosis is characterized by localized lesions distributed in the arterial tree due to the shear stress produced by blood flow. Endothelial cells are directly affected by alterations in blood flow. Dysfunction and injury to endothelial cells has been hypothesized to initiate the pathological processes of atherosclerosis. The present study aimed to investigate the mechanism of shear stress‑induced endothelial cellular apoptosis. Shear stress was generated using an artificial device to mimic the impact of disturbed blood flow on cultured human aortic endothelial cells (HAECs). Cellular apoptosis was assessed using a terminal deoxynucleotidyl transferase dUTP nick end labeling assay; an ELISA assay was used to detect the produced interleukin (IL)‑1β; specific small interfering (si)RNA was used to knockdown the expression of interleukin‑1 receptor‑associated kinase 2 (IRAK2) in HAECs and the expression levels of 78 kDa glucose‑regulated protein, DNA damage‑inducible transcript 3 protein (CHOP), IRAK2 and IL‑1β were evaluated using western blotting. The results of the present study demonstrated that artificial shear stress induced endoplasmic reticulum (ER) stress, IL‑1β production and apoptosis in HAECs in a time‑dependent manner. The inhibition of ER stress, and treatment with interleukin‑1 receptor antagonist protein and siRNA against IRAK2 attenuated shear stress‑induced CHOP signaling‑mediated cellular apoptosis. Therefore, overproduction of IL‑1β exacerbated shear stress‑induced ER stress‑mediated apoptosis via the IRAK2/CHOP signaling pathway in endothelial cells.

  10. Glucose restriction induces cell death in parental but not in homeodomain-interacting protein kinase 2-depleted RKO colon cancer cells: molecular mechanisms and implications for tumor therapy.

    Science.gov (United States)

    Garufi, A; Ricci, A; Trisciuoglio, D; Iorio, E; Carpinelli, G; Pistritto, G; Cirone, M; D'Orazi, G

    2013-05-23

    Tumor cell tolerance to nutrient deprivation can be an important factor for tumor progression, and may depend on deregulation of both oncogenes and oncosuppressor proteins. Homeodomain-interacting protein kinase 2 (HIPK2) is an oncosuppressor that, following its activation by several cellular stress, induces cancer cell death via p53-dependent or -independent pathways. Here, we used genetically matched human RKO colon cancer cells harboring wt-HIPK2 (HIPK2(+/+)) or stable HIPK2 siRNA interference (siHIPK2) to investigate in vitro whether HIPK2 influenced cell death in glucose restriction. We found that glucose starvation induced cell death, mainly due to c-Jun NH2-terminal kinase activation, in HIPK2(+/+)cells compared with siHIPK2 cells that did not die. (1)H-nuclear magnetic resonance quantitative metabolic analyses showed a marked glycolytic activation in siHIPK2 cells. However, treatment with glycolysis inhibitor 2-deoxy-D-glucose induced cell death only in HIPK2(+/+) cells but not in siHIPK2 cells. Similarly, siGlut-1 interference did not re-establish siHIPK2 cell death under glucose restriction, whereas marked cell death was reached only after zinc supplementation, a condition known to reactivate misfolded p53 and inhibit the pseudohypoxic phenotype in this setting. Further siHIPK2 cell death was reached with zinc in combination with autophagy inhibitor. We propose that the metabolic changes acquired by cells after HIPK2 silencing may contribute to induce resistance to cell death in glucose restriction condition, and therefore be directly relevant for tumor progression. Moreover, elimination of such a tolerance might serve as a new strategy for cancer therapy.

  11. The plastid casein kinase 2 phosphorylates Rubisco activase at the Thr-78 site but is not essential for regulation of Rubisco activation state

    Directory of Open Access Journals (Sweden)

    Sang Yeol eKim

    2016-03-01

    Full Text Available Rubisco activase (RCA is essential for the activation of Rubisco, the carboxylating enzyme of photosynthesis. In Arabidopsis, RCA is composed of a large RCAα and small RCAβ isoform that are formed by alternative splicing of a single gene (At2g39730. The activity of Rubisco is controlled in response to changes in irradiance by regulation of RCA activity, which is known to involve a redox-sensitive disulfide bond located in the carboxy-terminal extension of the RCAα subunit. Additionally, phosphorylation of RCA threonine-78 (Thr-78 has been reported to occur in the dark suggesting that phosphorylation may also be associated with dark-inactivation of RCA and deactivation of Rubisco. In the present study, we developed site-specific antibodies to monitor phosphorylation of RCA at the Thr-78 site and used non-reducing SDS-PAGE to monitor the redox status of the RCAα subunit. By immunoblotting, phosphorylation of both RCA isoforms occurred at low light and in the dark and feeding peroxide or DTT to leaf segments indicated that redox status of the chloroplast stroma was a critical factor controlling RCA phosphorylation. Use of a knockout mutant identified the plastid-targeted casein kinase 2 (cpCK2α as the major protein kinase involved in RCA phosphorylation. Studies with recombinant cpCK2α and synthetic peptide substrates identified acidic residues at the -1, +2 and +3 positions surrounding Thr-78 as strong positive recognition elements. The cpck2 knockout mutant had strongly reduced phosphorylation at the Thr-78 site but was similar to wild type plants in terms of induction kinetics of photosynthesis following transfer from darkness or low light to high light, suggesting that if phosphorylation of RCA Thr-78 plays a direct role it would be redundant to redox regulation for control of Rubisco activation state under normal conditions.

  12. 47 CFR 97.205 - Repeater station.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Repeater station. 97.205 Section 97.205... SERVICE Special Operations § 97.205 Repeater station. (a) Any amateur station licensed to a holder of a Technician, General, Advanced or Amateur Extra Class operator license may be a repeater. A holder of...

  13. 47 CFR 22.1015 - Repeater operation.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false Repeater operation. 22.1015 Section 22.1015... Offshore Radiotelephone Service § 22.1015 Repeater operation. Offshore central stations may be used as repeater stations provided that the licensee is able to maintain control of the station, and in...

  14. ProtRepeatsDB: a database of amino acid repeats in genomes

    Directory of Open Access Journals (Sweden)

    Chauhan Virander S

    2006-07-01

    Full Text Available Abstract Background Genome wide and cross species comparisons of amino acid repeats is an intriguing problem in biology mainly due to the highly polymorphic nature and diverse functions of amino acid repeats. Innate protein repeats constitute vital functional and structural regions in proteins. Repeats are of great consequence in evolution of proteins, as evident from analysis of repeats in different organisms. In the post genomic era, availability of protein sequences encoded in different genomes provides a unique opportunity to perform large scale comparative studies of amino acid repeats. ProtRepeatsDB http://bioinfo.icgeb.res.in/repeats/ is a relational database of perfect and mismatch repeats, access to which is designed as a resource and collection of tools for detection and cross species comparisons of different types of amino acid repeats. Description ProtRepeatsDB (v1.2 consists of perfect as well as mismatch amino acid repeats in the protein sequences of 141 organisms, the genomes of which are now available. The web interface of ProtRepeatsDB consists of different tools to perform repeat s; based on protein IDs, organism name, repeat sequences, and keywords as in FASTA headers, size, frequency, gene ontology (GO annotation IDs and regular expressions (REGEXP describing repeats. These tools also allow formulation of a variety of simple, complex and logical queries to facilitate mining and large-scale cross-species comparisons of amino acid repeats. In addition to this, the database also contains sequence analysis tools to determine repeats in user input sequences. Conclusion ProtRepeatsDB is a multi-organism database of different types of amino acid repeats present in proteins. It integrates useful tools to perform genome wide queries for rapid screening and identification of amino acid repeats and facilitates comparative and evolutionary studies of the repeats. The database is useful for identification of species or organism specific

  15. Pentatricopeptide repeat proteins in plants.

    Science.gov (United States)

    Barkan, Alice; Small, Ian

    2014-01-01

    Pentatricopeptide repeat (PPR) proteins constitute one of the largest protein families in land plants, with more than 400 members in most species. Over the past decade, much has been learned about the molecular functions of these proteins, where they act in the cell, and what physiological roles they play during plant growth and development. A typical PPR protein is targeted to mitochondria or chloroplasts, binds one or several organellar transcripts, and influences their expression by altering RNA sequence, turnover, processing, or translation. Their combined action has profound effects on organelle biogenesis and function and, consequently, on photosynthesis, respiration, plant development, and environmental responses. Recent breakthroughs in understanding how PPR proteins recognize RNA sequences through modular base-specific contacts will help match proteins to potential binding sites and provide a pathway toward designing synthetic RNA-binding proteins aimed at desired targets.

  16. Two-dimensional quantum repeaters

    Science.gov (United States)

    Wallnöfer, J.; Zwerger, M.; Muschik, C.; Sangouard, N.; Dür, W.

    2016-11-01

    The endeavor to develop quantum networks gave rise to a rapidly developing field with far-reaching applications such as secure communication and the realization of distributed computing tasks. This ultimately calls for the creation of flexible multiuser structures that allow for quantum communication between arbitrary pairs of parties in the network and facilitate also multiuser applications. To address this challenge, we propose a two-dimensional quantum repeater architecture to establish long-distance entanglement shared between multiple communication partners in the presence of channel noise and imperfect local control operations. The scheme is based on the creation of self-similar multiqubit entanglement structures at growing scale, where variants of entanglement swapping and multiparty entanglement purification are combined to create high-fidelity entangled states. We show how such networks can be implemented using trapped ions in cavities.

  17. General benchmarks for quantum repeaters

    CERN Document Server

    Pirandola, Stefano

    2015-01-01

    Using a technique based on quantum teleportation, we simplify the most general adaptive protocols for key distribution, entanglement distillation and quantum communication over a wide class of quantum channels in arbitrary dimension. Thanks to this method, we bound the ultimate rates for secret key generation and quantum communication through single-mode Gaussian channels and several discrete-variable channels. In particular, we derive exact formulas for the two-way assisted capacities of the bosonic quantum-limited amplifier and the dephasing channel in arbitrary dimension, as well as the secret key capacity of the qubit erasure channel. Our results establish the limits of quantum communication with arbitrary systems and set the most general and precise benchmarks for testing quantum repeaters in both discrete- and continuous-variable settings.

  18. Hungarian repeat station survey, 2010

    Directory of Open Access Journals (Sweden)

    Péter Kovács

    2013-03-01

    Full Text Available The last Hungarian repeat station survey was completed between October 2010 and February 2011. Declination, inclination and the total field were observed using one-axial DMI fluxgate magnetometer mounted on Zeiss20A theodolite and GSM 19 Overhauser magnetometer. The magnetic elements of the sites were reduced to the epoch of 2010.5 on the basis of the continuous recordings of Tihany Geophysical Observatory. In stations located far from the reference observatory, the observations were carried out in the morning and afternoon in order to decrease the effect of the distant temporal correction. To further increase the accuracy, on-site dIdD variometer has also been installed near the Aggtelek station, in the Baradla cave, during the survey of the easternmost sites. The paper presents the technical details and the results of our last campaign. The improvement of the accuracy of the temporal reduction by the use of the local variometer is also reported.

  19. Quality control during repeated fryings

    Directory of Open Access Journals (Sweden)

    Cuesta, C.

    1998-08-01

    Full Text Available Most of the debate ¡s about how the slow or frequent turnover of fresh fat affects the deterioration, of fat used in frying. Then, the modification of different oils used in repeated fryings of potatoes without or with turnover of fresh oil, under similar frying conditions, was evaluated by two criteria: by measuring the total polar component isolated by column chromatography and by the evaluation of the specific compounds related to thermoxidative and hydrolytic alteration by High Performance Size Exclusion Chromatography (HPSEC. The results indicate that with frequent turnover of fresh oil, the critical level of 25% of polar material is rarely reached, and there are fewer problems with fat deterioration because the frying tended to increase the level of polar material and thermoxidative compounds (polymers and dimers of triglycerides and oxidized triglycerides in the fryer oil during the first fryings, followed by minor changes and a tendency to reach a near-steady state in successive fryings. However, in repeated frying of potatoes using a null turnover the alteration rate was higher being linear the relationship found between polar material or the different thermoxidative compounds and the number of fryings. On the other hand chemical reactions produced during deep-fat frying can be minimized by using proper oils. In addition the increased level of consumers awareness toward fat composition and its impact on human health could had an impact on the selection of fats for snacks and for industry. In this way monoenic fats are the most adequate from a nutritional point of view and for its oxidative stability during frying.

  20. Myocardial Ablation of G Protein-Coupled Receptor Kinase 2 (GRK2 Decreases Ischemia/Reperfusion Injury through an Anti-Intrinsic Apoptotic Pathway.

    Directory of Open Access Journals (Sweden)

    Qian Fan

    Full Text Available Studies from our lab have shown that decreasing myocardial G protein-coupled receptor kinase 2 (GRK2 activity and expression can prevent heart failure progression after myocardial infarction. Since GRK2 appears to also act as a pro-death kinase in myocytes, we investigated the effect of cardiomyocyte-specific GRK2 ablation on the acute response to cardiac ischemia/reperfusion (I/R injury. To do this we utilized two independent lines of GRK2 knockout (KO mice where the GRK2 gene was deleted in only cardiomyocytes either constitutively at birth or in an inducible manner that occurred in adult mice prior to I/R. These GRK2 KO mice and appropriate control mice were subjected to a sham procedure or 30 min of myocardial ischemia via coronary artery ligation followed by 24 hrs reperfusion. Echocardiography and hemodynamic measurements showed significantly improved post-I/R cardiac function in both GRK2 KO lines, which correlated with smaller infarct sizes in GRK2 KO mice compared to controls. Moreover, there was significantly less TUNEL positive myocytes, less caspase-3, and -9 but not caspase-8 activities in GRK2 KO mice compared to control mice after I/R injury. Of note, we found that lowering cardiac GRK2 expression was associated with significantly lower cytosolic cytochrome C levels in both lines of GRK2 KO mice after I/R compared to corresponding control animals. Mechanistically, the anti-apoptotic effects of lowering GRK2 expression were accompanied by increased levels of Bcl-2, Bcl-xl, and increased activation of Akt after I/R injury. These findings were reproduced in vitro in cultured cardiomyocytes and GRK2 mRNA silencing. Therefore, lowering GRK2 expression in cardiomyocytes limits I/R-induced injury and improves post-ischemia recovery by decreasing myocyte apoptosis at least partially via Akt/Bcl-2 mediated mitochondrial protection and implicates mitochondrial-dependent actions, solidifying GRK2 as a pro-death kinase in the heart.

  1. Phosphorylation of hepatitis C virus RNA polymerases ser29 and ser42 by protein kinase C-related kinase 2 regulates viral RNA replication.

    Science.gov (United States)

    Han, Song-Hee; Kim, Seong-Jun; Kim, Eun-Jung; Kim, Tae-Eun; Moon, Jae-Su; Kim, Geon-Woo; Lee, Seung-Hoon; Cho, Kun; Yoo, Jong Shin; Son, Woo Sung; Rhee, Jin-Kyu; Han, Seung Hyun; Oh, Jong-Won

    2014-10-01

    Hepatitis C virus (HCV) nonstructural protein 5B (NS5B), an RNA-dependent RNA polymerase (RdRp), is the key enzyme for HCV RNA replication. We previously showed that HCV RdRp is phosphorylated by protein kinase C-related kinase 2 (PRK2). In the present study, we used biochemical and reverse-genetics approaches to demonstrate that HCV NS5B phosphorylation is crucial for viral RNA replication in cell culture. Two-dimensional phosphoamino acid analysis revealed that PRK2 phosphorylates NS5B exclusively at its serine residues in vitro and in vivo. Using in vitro kinase assays and mass spectrometry, we identified two phosphorylation sites, Ser29 and Ser42, in the Δ1 finger loop region that interacts with the thumb subdomain of NS5B. Colony-forming assays using drug-selectable HCV subgenomic RNA replicons revealed that preventing phosphorylation by Ala substitution at either Ser29 or Ser42 impairs HCV RNA replication. Furthermore, reverse-genetics studies using HCV infectious clones encoding phosphorylation-defective NS5B confirmed the crucial role of these PRK2 phosphorylation sites in viral RNA replication. Molecular-modeling studies predicted that the phosphorylation of NS5B stabilizes the interactions between its Δ1 loop and thumb subdomain, which are required for the formation of the closed conformation of NS5B known to be important for de novo RNA synthesis. Collectively, our results provide evidence that HCV NS5B phosphorylation has a positive regulatory role in HCV RNA replication. While the role of RNA-dependent RNA polymerases (RdRps) in viral RNA replication is clear, little is known about their functional regulation by phosphorylation. In this study, we addressed several important questions about the function and structure of phosphorylated hepatitis C virus (HCV) nonstructural protein 5B (NS5B). Reverse-genetics studies with HCV replicons encoding phosphorylation-defective NS5B mutants and analysis of their RdRp activities revealed previously unidentified

  2. Parathyroid Hormone–Related Protein Enhances Human β-Cell Proliferation and Function With Associated Induction of Cyclin-Dependent Kinase 2 and Cyclin E Expression

    Science.gov (United States)

    Guthalu Kondegowda, Nagesha; Joshi-Gokhale, Sheela; Harb, George; Williams, Katoura; Zhang, Xiao Ying; Takane, Karen K.; Zhang, Pili; Scott, Donald K.; Stewart, Andrew F.; Garcia-Ocaña, Adolfo; Vasavada, Rupangi C.

    2010-01-01

    OBJECTIVE Inducing human β-cell growth while enhancing function is a major goal in the treatment of diabetes. Parathyroid hormone–related protein (PTHrP) enhances rodent β-cell growth and function through the parathyroid hormone-1 receptor (PTH1R). Based on this, we hypothesized that PTH1R is expressed in human β-cells and that PTHrP has the potential to enhance human β-cell proliferation and/or function. RESEARCH DESIGN AND METHODS PTH1R expression, β-cell proliferation, glucose-stimulated insulin secretion (GSIS), and expression of differentiation and cell-cycle genes were analyzed in human islets transduced with adenoviral PTHrP constructs or treated with PTHrP peptides. The effect of overexpression of late G1/S cell cycle molecules was also assessed on human β-cell proliferation. RESULTS We found that human β-cells express PTH1R. More importantly, overexpression of PTHrP causes a significant approximately threefold increase in human β-cell proliferation. Furthermore, the amino terminus PTHrP(1-36) peptide is sufficient to increase replication as well as expression of the late G1/S cell-cycle proteins cyclin E and cyclin-dependent kinase 2 (cdk2) in human islets. Notably, PTHrP(1-36) also enhances GSIS. Finally, overexpression of cyclin E alone, but not cdk2, augments human β-cell proliferation, and when both molecules are expressed simultaneously there is a further marked synergistic increase in replication. CONCLUSIONS PTHrP(1-36) peptide enhances human β-cell proliferation as well as function, with associated upregulation of two specific cell-cycle activators that together can induce human β-cell proliferation several fold. The future therapeutic potential of PTHrP(1-36) for the treatment of diabetes is especially relevant given the complementary therapeutic efficacy of PTHrP(1-36) in postmenopausal osteoporosis. PMID:20876711

  3. Sensitization of human colon cancer cells to sodium butyrate-induced apoptosis by modulation of sphingosine kinase 2 and protein kinase D

    Energy Technology Data Exchange (ETDEWEB)

    Xiao, Min [Department of Occupational Health and Occupational Medicine, School of Public Health and Tropical Medicine, Southern Medical University, Guangzhou 510515 (China); Liu, Yungang [Department of Toxicology, School of Public Health and Tropical Medicine, Southern Medical University, Guangzhou 510515 (China); Zou, Fei, E-mail: ZouFeiMed@gmail.com [Department of Occupational Health and Occupational Medicine, School of Public Health and Tropical Medicine, Southern Medical University, Guangzhou 510515 (China)

    2012-01-01

    Sphingosine kinases (SphKs) have been recognized as important proteins regulating cell proliferation and apoptosis. Of the two isoforms of SphK (SphK1 and SphK2), little is known about the functions of SphK2. Sodium butyrate (NaBT) has been established as a promising chemotherapeutic agent, but the precise mechanism for its effects is unknown. In this study, we investigated the role of SphK2 in NaBT-induced apoptosis of HCT116 colon cancer cells. The results indicated that following NaBT treatment SphK2 was translocated from the nucleus to the cytoplasm, leading to its accumulation in the cytoplasm; in the meantime, only mild apoptosis occurred. However, downregulation of SphK2 resulted in sensitized apoptosis, and overexpression of SphK2 led to even lighter apoptosis; these strongly indicate an inhibitory role of SphK2 in cell apoptosis induced by NaBT. After knocking down protein kinase D (PKD), another protein reported to be critical in cell proliferation/apoptosis process, by using siRNA, blockage of cytoplasmic accumulation of SphK2 and sensitized apoptosis following NaBT treatment were observed. The present study suggests that PKD and SphK2 may form a mechanism for the resistance of cancer cells to tumor chemotherapies, such as HCT116 colon cancer cells to NaBT, and these two proteins may become molecular targets for designation of new tumor-therapeutic drugs. -- Highlights: Black-Right-Pointing-Pointer In the present study sodium butyrate (10 mM) induced mild apoptosis of cancer cells. Black-Right-Pointing-Pointer The apoptosis was negatively regulated by cytoplasmic Sphingosine Kinase 2 (SphK2). Black-Right-Pointing-Pointer Translocation of SphK2 from nucleus to cytoplasm was mediated by protein kinase D. Black-Right-Pointing-Pointer Downregulation of SphK2 or protein kinase D leads to sensitized cell apoptosis.

  4. Sucrose non-ferment 1 related protein kinase 2 (SnRK2) genes could mediate the stress responses in potato (Solanum tuberosum L.).

    Science.gov (United States)

    Bai, Jiangping; Mao, Juan; Yang, Hongyu; Khan, Awais; Fan, Aqi; Liu, Siyan; Zhang, Junlian; Wang, Di; Gao, Huijuan; Zhang, Jinlin

    2017-05-15

    The SnRKs (sucrose non-fermenting 1 related protein kinase) are a gene family coding for Ser/Thr protein kinases and play important roles in linking the tolerance and metabolic responses of plants to abiotic stresses. To date, no genome-wide characterization of the sucrose non-ferment 1 related protein kinase 2 (SnRK2) subfamily has been conducted in potato (Solanum tuberosum L.). In this study, eight StSnRK2 genes (StSnRK2.1- StSnRK2.8) were identified in the genome of the potato (Solanum tuberosum L.) cultivar 'Longshu 3', with similar characteristics to SnRK2 from other plant species in gene structure, motif distribution and secondary structures. The C-terminal regions were highly divergent among StSnRK2s, while they all carried the similar Ser/Thr protein kinase domain. The fluorescence of GFP fused with StSnRK2.1, StSnRK2.2, StSnRK2.6, StSnRK2.7 and StSnRK2.8 was detected in the nucleus and cytoplasm of onion epidermal cells with StSnRK2.3 and StSnRK2.4 mainly associated to the nucleus while StSnRK2.5 to subcellular organelles. Expression level analysis by qRT-PCR showed that StSnRK2.1, 2.2, 2.5 and 2.6 were more than 1 fold higher in the root than in the leaf, tuber and stem tissues. The expressions of StSnRK2.3, 2.7, and 2.8 were at least 1.5 folds higher in the leaf and stem than in the root, but lower in the tuber. The expression of StSnRK2.4 was also significantly (P potato, ABA treatment had a different effect from NaCl and PEG treatments. In the present study, we identified and characterized eight SnRK2s in the potato genome. The eight StSnRK2s exhibit similar gene structure and secondary structures in potato to the SnRK2s found in other plant species. The relative expression of eight genes varied among various tissues (roots, leaves, tubers, and stems) and abiotic stresses (ABA, NaCl and PEG-6000) with the prolongation of treatments. This study provides valuable information for the future functional dissection of potato SnRK2 genes in stress signal

  5. Prenatal stress increased Snk Polo-like kinase 2, SCF β-TrCP ubiquitin ligase and ubiquitination of SPAR in the hippocampus of the offspring at adulthood.

    Science.gov (United States)

    Chutabhakdikul, Naunchan; Surakul, Pornprom

    2013-11-01

    Exposure to excessive glucocorticoids during fetal development period contributes to later life psychopathology. Prenatal stress decreases dendritic spine density and impair LTP in the hippocampus of rat pups, however, the mechanisms regulating these changes are still unclear. Glutamate receptors are localized in the postsynaptic density. PSD-95 is a postsynaptic scaffolding protein that plays a role in synaptic maturation and regulation of the synaptic strength and plasticity. PSD-95 interacts with other proteins to form the protein networks that promote dendritic spine formation. The present study investigated the effect of prenatal stress on the levels of scaffolding proteins of NMDA receptor in the hippocampus in order to explain how prenatal stress alters the amount of NMDA receptor in the pups' brain. Pregnant rats were randomly assigned to either the prenatal stress (PS) or the control group (C). The pregnant rats in the PS group were restrained in a plexiglas restrainer for 4h/day during the GD 14-21. Control rats were left undisturbed for the duration of their pregnancies. The amount of PSD-95, SPAR, NR2A and NR2B, as well as the levels of Snk Polo-like kinase 2 and the SCF β-TrCP ubiquitin ligase were measured in the hippocampus of the offspring. The results show that prenatal stress induces a reduction in the amount of NR2B and NR2A subunits in the hippocampus of rat pups, parallel to the decrease in PSD-95 and SPAR at P40 and P60. Moreover, prenatal stress increases Snk and β-TrCP in the hippocampus of rat pups, and the timing correlates with the decrease of SPAR and PSD-95. Prenatal stress also induces a significantly increases in the level of ubiquitinated SPAR in the hippocampus of rat pups at adulthood. The results suggest that degradation of SPAR via UPS system may contribute to the loss of PSD-95 and NMDA receptor subunits in the hippocampus of rat pups at adulthood. In conclusion, the present work demonstrates that the developing brain is

  6. Mitogen-activated protein kinase-activated protein kinase 2 in angiotensin II-induced inflammation and hypertension: regulation of oxidative stress.

    Science.gov (United States)

    Ebrahimian, Talin; Li, Melissa Wei; Lemarié, Catherine A; Simeone, Stefania M C; Pagano, Patrick J; Gaestel, Matthias; Paradis, Pierre; Wassmann, Sven; Schiffrin, Ernesto L

    2011-02-01

    Vascular oxidative stress and inflammation play an important role in angiotensin II-induced hypertension, and mitogen-activated protein kinases participate in these processes. We questioned whether mitogen-activated protein kinase-activated protein kinase 2 (MK2), a downstream target of p38 mitogen-activated protein kinase, is involved in angiotensin II-induced vascular responses. In vivo experiments were performed in wild-type and Mk2 knockout mice infused intravenously with angiotensin II. Angiotensin II induced a 30 mm Hg increase in mean blood pressure in wild-type that was delayed in Mk2 knockout mice. Angiotensin II increased superoxide production and vascular cell adhesion molecule-1 in blood vessels of wild-type but not in Mk2 knockout mice. Mk2 knockdown by small interfering RNA in mouse mesenteric vascular smooth muscle cells caused a 42% reduction in MK2 protein and blunted the angiotensin II-induced 40% increase of MK2 expression. Mk2 knockdown blunted angiotensin II-induced doubling of intracellular adhesion molecule-1 expression, 2.4-fold increase of nuclear p65, and 1.4-fold increase in Ets-1. Mk2 knockdown abrogated the angiotensin II-induced 4.7-fold and 1.3-fold increase of monocyte chemoattractant protein-1 mRNA and protein. Angiotensin II enhanced reactive oxygen species levels (by 29%) and nicotinamide adenine dinucleotide phosphate oxidase activity (by 48%), both abolished by Mk2 knockdown. Reduction of MK2 blocked angiotensin II-induced p47phox translocation to the membrane, associated with a 53% enhanced catalase expression. Angiotensin II-induced increase of MK2 was prevented by the nicotinamide adenine dinucleotide phosphate oxidase inhibitor Nox2ds-tat. Mk2 small interfering RNA prevented the angiotensin II-induced 30% increase of proliferation. In conclusion, MK2 plays a critical role in angiotensin II signaling, leading to hypertension, oxidative stress via activation of p47phox and inhibition of antioxidants, and vascular inflammation

  7. Internalization and down-regulation of human muscarinic acetylcholine receptor m2 subtypes. Role of third intracellular m2 loop and G protein-coupled receptor kinase 2.

    Science.gov (United States)

    Tsuga, H; Kameyama, K; Haga, T; Honma, T; Lameh, J; Sadée, W

    1998-02-27

    Internalization and down-regulation of human muscarinic acetylcholine m2 receptors (hm2 receptors) and a hm2 receptor mutant lacking a central part of the third intracellular loop (I3-del m2 receptor) were examined in Chinese hamster ovary (CHO-K1) cells stably expressing these receptors and G protein-coupled receptor kinase 2 (GRK2). Agonist-induced internalization of up to 80-90% of hm2 receptors was demonstrated by measuring loss of [3H]N-methylscopolamine binding sites from the cell surface, and transfer of [3H]quinuclidinyl benzilate binding sites from the plasma membrane into the light-vesicle fractions separated by sucrose density gradient centrifugation. Additionally, translocation of hm2 receptors with endocytic vesicles were visualized by immunofluorescence confocal microscopy. Agonist-induced down-regulation of up to 60-70% of hm2 receptors was demonstrated by determining the loss of [3H]quinuclidinyl benzilate binding sites in the cells. The half-time (t1/2) of internalization and down-regulation in the presence of 10(-4) M carbamylcholine was estimated to be 9.5 min and 2.3 h, respectively. The rates of both internalization and down-regulation of hm2 receptors in the presence of 10(-6) M or lower concentrations of carbamylcholine were markedly increased by coexpression of GRK2. Agonist-induced internalization of I3-del m2 receptors was barely detectable upon incubation of cells for 1 h, but agonist-induced down-regulation of up to 40-50% of I3-del m2 receptors occurred upon incubation with 10(-4) M carbamylcholine for 16 h. However, the rate of down-regulation was lower compared with wild type receptors (t1/2 = 9.9 versus 2.3 h). These results indicate that rapid internalization of hm2 receptors is facilitated by their phosphorylation with GRK2 and does not occur in the absence of the third intracellular loop, but down-regulation of hm2 receptors may occur through both GRK2-facilitating pathway and third intracellular loop-independent pathways.

  8. Targeted impairment of thymidine kinase 2 expression in cells induces mitochondrial DNA depletion and reveals molecular mechanisms of compensation of mitochondrial respiratory activity

    Energy Technology Data Exchange (ETDEWEB)

    Villarroya, Joan, E-mail: joanvillarroya@gmail.com [Institut de Recerca, Hospital Universitari de la Vall d' Hebron, Barcelona (Spain); Institut de Recerca l' Hospital de la Santa Creu i Sant Pau, Barcelona (Spain); Lara, Mari-Carmen [Institut de Recerca, Hospital Universitari de la Vall d' Hebron, Barcelona (Spain); Department of Neurology, Columbia University Medical Center, New York, NY (United States); Centro de Investigacion Biomedica en Red de Enfermedades Raras (CIBERER), ISCIII (Spain); Dorado, Beatriz [Department of Neurology, Columbia University Medical Center, New York, NY (United States); Garrido, Marta [Unitat de Biologia Cel.lular i Molecular, IMIM-Hospital del Mar, Barcelona (Spain); Garcia-Arumi, Elena [Institut de Recerca, Hospital Universitari de la Vall d' Hebron, Barcelona (Spain); Centro de Investigacion Biomedica en Red de Enfermedades Raras (CIBERER), ISCIII (Spain); Meseguer, Anna [Institut de Recerca, Hospital Universitari de la Vall d' Hebron, Barcelona (Spain); Hirano, Michio [Department of Neurology, Columbia University Medical Center, New York, NY (United States); Vila, Maya R. [Institut de Recerca, Hospital Universitari de la Vall d' Hebron, Barcelona (Spain)

    2011-04-08

    Highlights: {yields} We impaired TK2 expression in Ost TK1{sup -} cells via siRNA-mediated interference (TK2{sup -}). {yields} TK2 impairment caused severe mitochondrial DNA (mtDNA) depletion in quiescent cells. {yields} Despite mtDNA depletion, TK2{sup -} cells show high cytochrome oxidase activity. {yields} Depletion of mtDNA occurs without imbalance in the mitochondrial dNTP pool. {yields} Nuclear-encoded ENT1, DNA-pol {gamma}, TFAM and TP gene expression is lowered in TK2{sup -} cells. -- Abstract: The mitochondrial DNA (mtDNA) depletion syndrome comprises a clinically heterogeneous group of diseases characterized by reductions of the mtDNA abundance, without associated point mutations or rearrangements. We have developed the first in vitro model to study of mtDNA depletion due to reduced mitochondrial thymidine kinase 2 gene (TK2) expression in order to understand the molecular mechanisms involved in mtDNA depletion syndrome due to TK2 mutations. Small interfering RNA targeting TK2 mRNA was used to decrease TK2 expression in Ost TK1{sup -} cells, a cell line devoid of endogenous thymidine kinase 1 (TK1). Stable TK2-deficient cell lines showed a reduction of TK2 levels close to 80%. In quiescent conditions, TK2-deficient cells showed severe mtDNA depletion, also close to 80% the control levels. However, TK2-deficient clones showed increased cytochrome c oxidase activity, higher cytochrome c oxidase subunit I transcript levels and higher subunit II protein expression respect to control cells. No alterations of the deoxynucleotide pools were found, whereas a reduction in the expression of genes involved in nucleoside/nucleotide homeostasis (human equilibrative nucleoside transporter 1, thymidine phosphorylase) and mtDNA maintenance (DNA-polymerase {gamma}, mitochondrial transcription factor A) was observed. Our findings highlight the importance of cellular compensatory mechanisms that enhance the expression of respiratory components to ensure respiratory activity

  9. Sequence analysis of a Molluscum contagiosum virus DNA region which includes the gene encoding protein kinase 2 and other genes with unique organization.

    Science.gov (United States)

    Martin-Gallardo, A; Moratilla, M; Funes, J M; Agromayor, M; Nuñez, A; Varas, A J; Collado, M; Valencia, A; Lopez-Estebaranz, J L; Esteban, M

    1996-01-01

    The nucleotide sequence of a near left-terminal region from the genome of Molluscum contagiosum virus subtype I (MCVI) was determined. This region was contained within three adjacent BamHI fragments, designated L (2.4 kilobases (kb)), M (1.8 kb), and N (1.6 kb). BamHI cleavage of MCVI DNA produced another 1.6-kb fragment (N'), which had been mapped 30-50 kb from the L,M region. The MCVI restriction fragments were cloned and end-sequenced. The N fragment that maps at the L,M region was identified by the polymerase chain reaction, using primers devised from the sequence of each fragment. The results from this analysis led to establish the relative position of these fragments within the MCVI genome. The analysis of 3.6 kb of DNA sequence revealed the presence of ten open reading frames (ORFs). Comparison of the amino acid sequence of these ORFs to the amino acid sequence of vaccinia virus (VAC) proteins revealed that two complete MCVI ORFs, termed N1L and L1L, showed high degree of homology with VAC F9 and F10 genes, respectively. The F10 gene encodes a 52-kDa serine/threonine protein kinase (protein kinase 2), an essential protein involved in virus morphogenesis. The MCVI homologue (L1L) encoded a putative polypeptide of 443 aa, with a calculated molecular mass of 53 kDa, and 60.5/30.2% sequence identity/similarity to VAC F10. The MCV N1L (213 aa, 24 kDa) showed 42.6/40.6% amino acid sequence identity/similarity to VAC F9, a gene of unknown function encoding a 24-kDa protein with a hydrophobic C-terminal domain, which was conserved in MCVI. The genomic arrangement of MCVI N1L and L1L was equivalent to that of the vaccinia and variola virus homologues. However, the ORFs contained within MCVI fragment M (leftward) showed no homology, neither similarity in genetic organization, to the genes encoded by the corresponding regions of vaccinia and variola viruses.

  10. Strengthening concept learning by repeated testing.

    Science.gov (United States)

    Wiklund-Hörnqvist, Carola; Jonsson, Bert; Nyberg, Lars

    2014-02-01

    The aim of this study was to examine whether repeated testing with feedback benefits learning compared to rereading of introductory psychology key-concepts in an educational context. The testing effect was examined immediately after practice, after 18 days, and at a five-week delay in a sample of undergraduate students (n = 83). The results revealed that repeated testing with feedback significantly enhanced learning compared to rereading at all delays, demonstrating that repeated retrieval enhances retention compared to repeated encoding in the short- and the long-term. In addition, the effect of repeated testing was beneficial for students irrespectively of working memory capacity. It is argued that teaching methods involving repeated retrieval are important to consider by the educational system.

  11. Repeat concussions in the national football league.

    Science.gov (United States)

    Casson, Ira R; Viano, David C; Powell, John W; Pellman, Elliot J

    2011-01-01

    Repeat concussion is an important issue in the National Football League (NFL). An initial description of repeat injuries was published for 6 years (1996-2001). The characteristics and frequency of repeat concussion in the NFL have not changed in the subsequent 6 years (2002-2007). Case control. From 1996 to 2007, concussions were reported using a standardized form documenting signs and symptoms, loss of consciousness and medical action taken. Data on repeat concussions were analyzed for the 12 years and compared between the 2 periods. In 2002-2007, 152 players had repeat concussions (vs 160 in 1996-2001); 44 had 3+ head injuries (vs 52). The positions most often associated with repeat concussion in 2002-2007 were the defensive secondary, kick unit, running back, and linebacker. The odds for repeat concussion were elevated for wide receivers, tight ends, and linebackers but lower than in the earlier period. During 2002-2007, over half of players with repeat concussion were removed from play, and fewer immediately returned (vs 1996-2001). The average duration between concussions was 1.25 years for 2002-2007 and 1.65 years for the 12-year period. Over 12 years, 7.6% of all repeat concussions occurred within 2 weeks of the prior concussion. The defensive secondary, kick unit, running back, and linebacker have the highest incidence of repeat concussion. During 2002-2007, more than half of players with repeat concussion were removed from play, and only a fraction immediately returned. Although concussion was managed more conservatively by team physicians in the recent 6 years, repeat concussions occurred at similar rates during both periods.

  12. Automated quality checks on repeat prescribing.

    OpenAIRE

    Rogers, Jeremy E; Wroe, Christopher J; Roberts, Angus; Swallow, Angela; Stables, David; Cantrill, Judith A; Rector, Alan L.

    2003-01-01

    BACKGROUND: Good clinical practice in primary care includes periodic review of repeat prescriptions. Markers of prescriptions that may need review have been described, but manually checking all repeat prescriptions against the markers would be impractical. AIM: To investigate the feasibility of computerising the application of repeat prescribing quality checks to electronic patient records in United Kingdom (UK) primary care. DESIGN OF STUDY: Software performance test against benchmark manual...

  13. Short Tandem Repeat DNA Internet Database

    Science.gov (United States)

    SRD 130 Short Tandem Repeat DNA Internet Database (Web, free access)   Short Tandem Repeat DNA Internet Database is intended to benefit research and application of short tandem repeat DNA markers for human identity testing. Facts and sequence information on each STR system, population data, commonly used multiplex STR systems, PCR primers and conditions, and a review of various technologies for analysis of STR alleles have been included.

  14. Repeatability & Workability Evaluation of SIGMOD 2009

    KAUST Repository

    Manegold, Stefan

    2010-12-15

    SIGMOD 2008 was the first database conference that offered to test submitters\\' programs against their data to verify the repeatability of the experiments published [1]. Given the positive feedback concerning the SIGMOD 2008 repeatability initiative, SIGMOD 2009 modified and expanded the initiative with a workability assessment.

  15. Reward modulation of contextual cueing: Repeated context overshadows repeated target location.

    Science.gov (United States)

    Sharifian, Fariba; Contier, Oliver; Preuschhof, Claudia; Pollmann, Stefan

    2017-08-07

    Contextual cueing can be enhanced by reward. However, there is a debate if reward is associated with the repeated target-distractor configurations or with the repeated target locations that occur in both repeated and new displays. Based on neuroimaging evidence, we hypothesized that reward becomes associated with the target location only in new displays, but not in repeated displays, where the repeated target location is overshadowed by the more salient repeated target-distractor configuration. To test this hypothesis, we varied the reward value associated with the same target location in repeated and new displays. The results confirmed the overshadowing hypothesis in that search facilitation in repeated target-distractor configurations was modulated by the variable value associated with the target location. This effect was observed mainly in early learning.

  16. Childhood experiences and repeated suicidal behavior

    DEFF Research Database (Denmark)

    Krarup, Gertrud; Nielsen, Bent; Rask, P

    1991-01-01

    The aim of this study was to elucidate the influence of various events in childhood on suicidal behavior in adult age. For this purpose, 99 patients admitted to the Department of Psychiatry of Odense University Hospital after making a suicide attempt were followed for 5 years, to register repeated...... suicidal behavior. The results showed that three fourths of the patients attempted suicide more than once (62% nonfatal and 14% fatal outcome). The sex distribution was about the same among the first-evers as among the repeaters. Most repeaters were younger people in their twenties and thirties......, and the first-evers on average were past the age of 40. Somewhat unexpectedly, significantly more repeaters than first-evers had grown up with both their parents. However, the results also showed that significantly more repeaters than first-evers had had an unhappy childhood. This indicates...

  17. UK 2009-2010 repeat station report

    Directory of Open Access Journals (Sweden)

    Thomas J.G. Shanahan

    2013-03-01

    Full Text Available The British Geological Survey is responsible for conducting the UK geomagnetic repeat station programme. Measurements made at the UK repeat station sites are used in conjunction with the three UK magnetic observatories: Hartland, Eskdalemuir and Lerwick, to produce a regional model of the local field each year. The UK network of repeat stations comprises 41 stations which are occupied at approximately 3-4 year intervals. Practices for conducting repeat station measurements continue to evolve as advances are made in survey instrumentation and as the usage of the data continues to change. Here, a summary of the 2009 and 2010 UK repeat station surveys is presented, highlighting the measurement process and techniques, density of network, reduction process and recent results.

  18. The child accident repeater: a review.

    Science.gov (United States)

    Jones, J G

    1980-04-01

    The child accident repeater is defined as one who has at least three accidents that come to medical attention within a year. The accident situation has features in common with those of the child who has a single accident through simple "bad luck", but other factors predispose him to repeated injury. In the child who has a susceptible personality, a tendency for accident repetition may be due to a breakdown in adjustment to a stressful environment. Prevention of repeat accidents should involve the usual measures considered appropriate for all children as well as an attempt to provide treatment of significant maladjustment and modification of a stressful environment.

  19. Casein kinase 2 down-regulation and activation by polybasic peptides are mediated by acidic residues in the 55-64 region of the beta-subunit. A study with calmodulin as phosphorylatable substrate

    DEFF Research Database (Denmark)

    Meggio, F; Boldyreff, B; Issinger, O G;

    1994-01-01

    The noncatalytic beta-subunit is responsible for the latency of casein kinase 2 (CK2) activity toward calmodulin. Twenty-one mutants of the beta-subunit bearing either deletions or Ala substitutions for charged residues in the 5-6, 55-70, and 171-178 sequences have been assayed for their ability...... insensitive to 42 nM polylysine, which conversely promotes a more than 10-fold increase of calmodulin phosphorylation with wild-type beta.(ABSTRACT TRUNCATED AT 250 WORDS)...

  20. The Moral Maturity of Repeater Delinquents.

    Science.gov (United States)

    Petronio, Richard J.

    1980-01-01

    Differences in moral development (as conceived by Kohlberg) were examined in a sample of delinquent teenagers. The repeater group was not found, as had been hypothesized, to be lower on moral maturity than those who engaged in less delinquency. (GC)

  1. Star repeaters for fiber optic links.

    Science.gov (United States)

    McMahon, D H; Gravel, R L

    1977-02-01

    A star repeater combines the functions of a passive star coupler and a signal regenerating amplifier. By more effectively utilizing the light power radiated by a light emitting diode, the star repeater can, when used with small diameter channels, couple as much power to all receivers of a multiterminal link as would be coupled to the single receiver of a simple point-to-point link.

  2. Digital repeat analysis; setup and operation.

    Science.gov (United States)

    Nol, J; Isouard, G; Mirecki, J

    2006-06-01

    Since the emergence of digital imaging, there have been questions about the necessity of continuing reject analysis programs in imaging departments to evaluate performance and quality. As a marketing strategy, most suppliers of digital technology focus on the supremacy of the technology and its ability to reduce the number of repeats, resulting in less radiation doses given to patients and increased productivity in the department. On the other hand, quality assurance radiographers and radiologists believe that repeats are mainly related to positioning skills, and repeat analysis is the main tool to plan training needs to up-skill radiographers. A comparative study between conventional and digital imaging was undertaken to compare outcomes and evaluate the need for reject analysis. However, digital technology still being at its early development stages, setting a credible reject analysis program became the major task of the study. It took the department, with the help of the suppliers of the computed radiography reader and the picture archiving and communication system, over 2 years of software enhancement to build a reliable digital repeat analysis system. The results were supportive of both philosophies; the number of repeats as a result of exposure factors was reduced dramatically; however, the percentage of repeats as a result of positioning skills was slightly on the increase for the simple reason that some rejects in the conventional system qualifying for both exposure and positioning errors were classified as exposure error. The ability of digitally adjusting dark or light images reclassified some of those images as positioning errors.

  3. Quantum Key Distribution over Probabilistic Quantum Repeaters

    CERN Document Server

    Amirloo, Jeyran; Majedi, A Hamed

    2010-01-01

    A feasible route towards implementing long-distance quantum key distribution (QKD) systems relies on probabilistic schemes for entanglement distribution and swapping as proposed in the work of Duan, Lukin, Cirac, and Zoller (DLCZ) [Nature 414, 413 (2001)]. Here, we calculate the conditional throughput and fidelity of entanglement for DLCZ quantum repeaters, by accounting for the DLCZ self-purification property, in the presence of multiple excitations in the ensemble memories as well as loss and other sources of inefficiency in the channel and measurement modules. We then use our results to find the generation rate of secure key bits for QKD systems that rely on DLCZ quantum repeaters. We compare the key generation rate per logical memory employed in the two cases of with and without a repeater node. We find the cross-over distance beyond which the repeater system outperforms the non-repeater one. That provides us with the optimum inter-node distancing in quantum repeater systems. We also find the optimal exci...

  4. Remarkable selective constraints on exonic dinucleotide repeats.

    Science.gov (United States)

    Haasl, Ryan J; Payseur, Bret A

    2014-09-01

    Long dinucleotide repeats found in exons present a substantial mutational hazard: mutations at these loci occur often and generate frameshifts. Here, we provide clear and compelling evidence that exonic dinucleotides experience strong selective constraint. In humans, only 18 exonic dinucleotides have repeat lengths greater than six, which contrasts sharply with the genome-wide distribution of dinucleotides. We genotyped each of these dinucleotides in 200 humans from eight 1000 Genomes Project populations and found a near-absence of polymorphism. More remarkably, divergence data demonstrate that repeat lengths have been conserved across the primate phylogeny in spite of what is likely considerable mutational pressure. Coalescent simulations show that even a very low mutation rate at these loci fails to explain the anomalous patterns of polymorphism and divergence. Our data support two related selective constraints on the evolution of exonic dinucleotides: a short-term intolerance for any change to repeat length and a long-term prevention of increases to repeat length. In general, our results implicate purifying selection as the force that eliminates new, deleterious mutants at exonic dinucleotides. We briefly discuss the evolution of the longest exonic dinucleotide in the human genome--a 10 x CA repeat in fibroblast growth factor receptor-like 1 (FGFRL1)--that should possess a considerably greater mutation rate than any other exonic dinucleotide and therefore generate a large number of deleterious variants. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

  5. Dynamic combinatorial libraries of artificial repeat proteins.

    Science.gov (United States)

    Eisenberg, Margarita; Shumacher, Inbal; Cohen-Luria, Rivka; Ashkenasy, Gonen

    2013-06-15

    Repeat proteins are found in almost all cellular systems, where they are involved in diverse molecular recognition processes. Recent studies have suggested that de novo designed repeat proteins may serve as universal binders, and might potentially be used as practical alternative to antibodies. We describe here a novel chemical methodology for producing small libraries of repeat proteins, and screening in parallel the ligand binding of library members. The first stage of this research involved the total synthesis of a consensus-based three-repeat tetratricopeptide (TPR) protein (~14 kDa), via sequential attachment of the respective peptides. Despite the effectiveness of the synthesis and ligation steps, this method was found to be too demanding for the production of proteins containing variable number of repeats. Additionally, the analysis of binding of the individual proteins was time consuming. Therefore, we designed and prepared novel dynamic combinatorial libraries (DCLs), and show that their equilibration can facilitate the formation of TPR proteins containing up to eight repeating units. Interestingly, equilibration of the library building blocks in the presence of the biologically relevant ligands, Hsp90 and Hsp70, induced their oligomerization into forming more of the proteins with large recognition surfaces. We suggest that this work presents a novel simple and rapid tool for the simultaneous screening of protein mixtures with variable binding surfaces, and for identifying new binders for ligands of interest.

  6. Automated genotyping of dinucleotide repeat markers

    Energy Technology Data Exchange (ETDEWEB)

    Perlin, M.W.; Hoffman, E.P. [Carnegie Mellon Univ., Pittsburgh, PA (United States)]|[Univ. of Pittsburgh, PA (United States)

    1994-09-01

    The dinucleotide repeats (i.e., microsatellites) such as CA-repeats are a highly polymorphic, highly abundant class of PCR-amplifiable markers that have greatly streamlined genetic mapping experimentation. It is expected that over 30,000 such markers (including tri- and tetranucleotide repeats) will be characterized for routine use in the next few years. Since only size determination, and not sequencing, is required to determine alleles, in principle, dinucleotide repeat genotyping is easily performed on electrophoretic gels, and can be automated using DNA sequencers. Unfortunately, PCR stuttering with these markers generates not one band for each allele, but a pattern of bands. Since closely spaced alleles must be disambiguated by human scoring, this poses a key obstacle to full automation. We have developed methods that overcome this obstacle. Our model is that the observed data is generated by arithmetic superposition (i.e., convolution) of multiple allele patterns. By quantitatively measuring the size of each component band, and exploiting the unique stutter pattern associated with each marker, closely spaced alleles can be deconvolved; this unambiguously reconstructs the {open_quotes}true{close_quotes} allele bands, with stutter artifact removed. We used this approach in a system for automated diagnosis of (X-linked) Duchenne muscular dystrophy; four multiplexed CA-repeats within the dystrophin gene were assayed on a DNA sequencer. Our method accurately detected small variations in gel migration that shifted the allele size estimate. In 167 nonmutated alleles, 89% (149/167) showed no size variation, 9% (15/167) showed 1 bp variation, and 2% (3/167) showed 2 bp variation. We are currently developing a library of dinucleotide repeat patterns; together with our deconvolution methods, this library will enable fully automated genotyping of dinucleotide repeats from sizing data.

  7. Mining of simple sequence repeats in the Genome of Gentianaceae

    Directory of Open Access Journals (Sweden)

    R Sathishkumar

    2011-01-01

    Full Text Available Simple sequence repeats (SSRs or short tandem repeats are short repeat motifs that show high level of length polymorphism due to insertion or deletion mutations of one or more repeat types. Here, we present the detection and abundance of microsatellites or SSRs in nucleotide sequences of Gentianaceae family. A total of 545 SSRs were mined in 4698 nucleotide sequences downloaded from the National Center for Biotechnology Information (NCBI. Among the SSR sequences, the frequency of repeat type was about 429 -mono repeats, 99 -di repeats, 15 -tri repeats, and 2 --hexa repeats. Mononucleotide repeats were found to be abundant repeat types, about 78%, followed by dinucleotide repeats (18.16% among the SSR sequences. An attempt was made to design primer pairs for 545 identified SSRs but these were found only for 169 sequences.

  8. PolyQ repeat expansions in ATXN2 associated with ALS are CAA interrupted repeats.

    Directory of Open Access Journals (Sweden)

    Zhenming Yu

    Full Text Available Amyotrophic lateral sclerosis (ALS is a devastating, rapidly progressive disease leading to paralysis and death. Recently, intermediate length polyglutamine (polyQ repeats of 27-33 in ATAXIN-2 (ATXN2, encoding the ATXN2 protein, were found to increase risk for ALS. In ATXN2, polyQ expansions of ≥ 34, which are pure CAG repeat expansions, cause spinocerebellar ataxia type 2. However, similar length expansions that are interrupted with other codons, can present atypically with parkinsonism, suggesting that configuration of the repeat sequence plays an important role in disease manifestation in ATXN2 polyQ expansion diseases. Here we determined whether the expansions in ATXN2 associated with ALS were pure or interrupted CAG repeats, and defined single nucleotide polymorphisms (SNPs rs695871 and rs695872 in exon 1 of the gene, to assess haplotype association. We found that the expanded repeat alleles of 40 ALS patients and 9 long-repeat length controls were all interrupted, bearing 1-3 CAA codons within the CAG repeat. 21/21 expanded ALS chromosomes with 3CAA interruptions arose from one haplotype (GT, while 18/19 expanded ALS chromosomes with <3CAA interruptions arose from a different haplotype (CC. Moreover, age of disease onset was significantly earlier in patients bearing 3 interruptions vs fewer, and was distinct between haplotypes. These results indicate that CAG repeat expansions in ATXN2 associated with ALS are uniformly interrupted repeats and that the nature of the repeat sequence and haplotype, as well as length of polyQ repeat, may play a role in the neurological effect conferred by expansions in ATXN2.

  9. Repeatability of peripheral aberrations in young emmetropes.

    Science.gov (United States)

    Baskaran, Karthikeyan; Theagarayan, Baskar; Carius, Staffan; Gustafsson, Jörgen

    2010-10-01

    The purpose of this study is to assess the intrasession repeatability of ocular aberration measurements in the peripheral visual field with a commercially available Shack-Hartmann aberrometer (complete ophthalmic analysis system-high definition-vision research). The higher-order off-axis aberrations data in young healthy emmetropic eyes are also reported. The aberrations of the right eye of 18 emmetropes were measured using an aberrometer with an open field of view that allows peripheral measurements. Five repeated measures of ocular aberrations were obtained and assessed in steps of 10° out to ±40° in the horizontal visual field (nasal + and temporal -) and -20° in the inferior visual field. The coefficient of repeatability, coefficient of variation, and the intraclass correlation coefficient were calculated as a measure of intrasession repeatability. In all eccentric angles, the repeatability of the third- and fourth-order aberrations was better than the fifth and sixth order aberrations. The coefficient of variation was coefficient was >0.90 for the third and fourth order but reduced gradually for higher orders. There was no statistical significant difference in variance of total higher-order root mean square between on- and off-axis measurements (p > 0.05). The aberration data in this group of young emmetropes showed that the horizontal coma (C(3)(1)) was most positive at 40° in the temporal field, decreasing linearly toward negative values with increasing off-axis angle into the nasal field, whereas all other higher-order aberrations showed little or no change. The complete ophthalmic analysis system-high definition-vision research provides fast, repeatable, and valid peripheral aberration measurements and can be used efficiently to measure off-axis aberrations in the peripheral visual field.

  10. Safety of Repeated Yttrium-90 Radioembolization

    Energy Technology Data Exchange (ETDEWEB)

    Lam, Marnix G. E. H.; Louie, John D. [Stanford University School of Medicine, Division of Interventional Radiology (United States); Iagaru, Andrei H.; Goris, Michael L. [Stanford University School of Medicine, Division of Nuclear Medicine (United States); Sze, Daniel Y., E-mail: dansze@stanford.edu [Stanford University School of Medicine, Division of Interventional Radiology (United States)

    2013-10-15

    Purpose: Repeated radioembolization (RE) treatments carry theoretically higher risk of radiation-induced hepatic injury because of the liver's cumulative memory of previous exposure. We performed a retrospective safety analysis on patients who underwent repeated RE. Methods: From 2004 to 2011, a total of 247 patients were treated by RE. Eight patients (5 men, 3 women, age range 51-71 years) underwent repeated treatment of a targeted territory, all with resin microspheres (SIR-Spheres; Sirtex, Lane Cove, Australia). Adverse events were graded during a standardized follow-up. In addition, the correlation between the occurrence of RE-induced liver disease (REILD) and multiple variables was investigated in univariate and multivariate analyses in all 247 patients who received RE. Results: Two patients died shortly after the second treatment (at 84 and 107 days) with signs and symptoms of REILD. Both patients underwent whole liver treatment twice (cumulative doses 3.08 and 2.66 GBq). The other 6 patients demonstrated only minor toxicities after receiving cumulative doses ranging from 2.41 to 3.88 GBq. All patients experienced objective tumor responses. In the whole population, multifactorial analysis identified three risk factors associated with REILD: repeated RE (p = 0.036), baseline serum total bilirubin (p = 0.048), and baseline serum aspartate aminotransferase (p = 0.043). Repeated RE proved to be the only independent risk factor for REILD in multivariate analysis (odds ratio 9.6; p = 0.002). Additionally, the administered activity per target volume (in GBq/L) was found to be an independent risk factor for REILD, but only in whole liver treatments (p = 0.033). Conclusion: The risk of REILD appears to be elevated for repeated RE. Objective tumor responses were observed, but establishment of safety limits will require improvement in dosimetric measurement and prediction.

  11. Repeat Gamma Knife Radiosurgery for Trigeminal Neuralgia

    Energy Technology Data Exchange (ETDEWEB)

    Aubuchon, Adam C., E-mail: acaubuchon@gmail.com [Department of Radiation Oncology, Wake Forest University School of Medicine, Winston-Salem, NC (United States); Chan, Michael D. [Department of Radiation Oncology, Wake Forest University School of Medicine, Winston-Salem, NC (United States); Lovato, James F. [Department of Public Health Sciences, Wake Forest University School of Medicine, Winston-Salem, NC (United States); Balamucki, Christopher J. [Department of Radiation Oncology, University of Florida, Gainesville, FL (United States); Ellis, Thomas L.; Tatter, Stephen B. [Department of Neurosurgery, Wake Forest University School of Medicine, Winston-Salem, NC (United States); McMullen, Kevin P.; Munley, Michael T.; Deguzman, Allan F.; Ekstrand, Kenneth E.; Bourland, J. Daniel; Shaw, Edward G. [Department of Radiation Oncology, Wake Forest University School of Medicine, Winston-Salem, NC (United States)

    2011-11-15

    Purpose: Repeat gamma knife stereotactic radiosurgery (GKRS) for recurrent or persistent trigeminal neuralgia induces an additional response but at the expense of an increased incidence of facial numbness. The present series summarized the results of a repeat treatment series at Wake Forest University Baptist Medical Center, including a multivariate analysis of the data to identify the prognostic factors for treatment success and toxicity. Methods and Materials: Between January 1999 and December 2007, 37 patients underwent a second GKRS application because of treatment failure after a first GKRS treatment. The mean initial dose in the series was 87.3 Gy (range, 80-90). The mean retreatment dose was 84.4 Gy (range, 60-90). The dosimetric variables recorded included the dorsal root entry zone dose, pons surface dose, and dose to the distal nerve. Results: Of the 37 patients, 81% achieved a >50% pain relief response to repeat GKRS, and 57% experienced some form of trigeminal dysfunction after repeat GKRS. Two patients (5%) experienced clinically significant toxicity: one with bothersome numbness and one with corneal dryness requiring tarsorraphy. A dorsal root entry zone dose at repeat treatment of >26.6 Gy predicted for treatment success (61% vs. 32%, p = .0716). A cumulative dorsal root entry zone dose of >84.3 Gy (72% vs. 44%, p = .091) and a cumulative pons surface dose of >108.5 Gy (78% vs. 44%, p = .018) predicted for post-GKRS numbness. The presence of any post-GKRS numbness predicted for a >50% decrease in pain intensity (100% vs. 60%, p = .0015). Conclusion: Repeat GKRS is a viable treatment option for recurrent trigeminal neuralgia, although the patient assumes a greater risk of nerve dysfunction to achieve maximal pain relief.

  12. Copy number of tandem direct repeats within the inverted repeats of Marek's disease virus DNA.

    Science.gov (United States)

    Kanamori, A; Nakajima, K; Ikuta, K; Ueda, S; Kato, S; Hirai, K

    1986-12-01

    We previously reported that DNA of the oncogenic strain BC-1 of Marek's disease virus serotype 1 (MDV1) contains three units of tandem direct repeats with 132 base pair (bp) repeats within the inverted repeats of the long regions of the MDV1 genome, whereas the attenuated, nononcogenic viral DNA contains multiple units of tandem direct repeats (Maotani et al., 1986). In the present study, the difference in the copy numbers of 132 bp repeats of oncogenic and nononcogenic MDV1 DNAs in other strains of MDV1 was investigated by Southern blot hybridization. The main copy numbers in different oncogenic MDV1 strains differed: those of BC-1, JM and highly oncogenic Md5 were 3, 5 to 12 and 2, respectively. The viral DNA population with two units of repeats was small, but detectable, in cells infected with either the oncogenic BC-1 or JM strain. The MDV1 DNA in various MD cell lines contained either two units or both two and three units of repeats. The significance of the copy number of repeats in oncogenicity of MDV1 is discussed.

  13. Y Se Repite = And It Repeats Itself

    Science.gov (United States)

    Katzew, Adriana

    2010-01-01

    In this article, the author discusses Y Se Repite [And It Repeats Itself], a project she conceptualized due to the growing number of Latino/a Mexican migrant workers in dairy farms in the state of Vermont. In 2006, approximately 2,000 Latinos/as--most of them undocumented Mexican migrant workers--worked throughout the state's dairy farms, yet…

  14. Repeater For A Digital-Communication Bus

    Science.gov (United States)

    Torres-Guzman, Esteban; Olson, Stephen; Heaps, Tim

    1993-01-01

    Digital repeater circuit designed to extend range of communication on MIL-STD-1553 bus beyond original maximum allowable length of 300 ft. Circuit provides two-way communication, one way at time, and conforms to specifications of MIL-STD-1553. Crosstalk and instability eliminated.

  15. Episodes of repeated sudden deafness following pregnancies.

    Science.gov (United States)

    Pawlak-Osinska, Katarzyna; Burduk, Pawel K; Kopczynski, Andrzej

    2009-04-01

    Sex hormones influence and provoke changes in hearing levels. Sudden deafness is rarely observed in pregnant women. The effective treatment of sudden deafness in pregnant women is a challenging problem. We present a case of repeatable, completely regressed sudden deafness in a woman during her first and second pregnancies.

  16. Repeated sprint training in normobaric hypoxia.

    Science.gov (United States)

    Galvin, Harvey M; Cooke, Karl; Sumners, David P; Mileva, Katya N; Bowtell, Joanna L

    2013-12-01

    Repeated sprint ability (RSA) is a critical success factor for intermittent sport performance. Repeated sprint training has been shown to improve RSA, we hypothesised that hypoxia would augment these training adaptations. Thirty male well-trained academy rugby union and rugby league players (18.4 ± 1.5 years, 1.83 ± 0.07 m, 88.1 ± 8.9 kg) participated in this single-blind repeated sprint training study. Participants completed 12 sessions of repeated sprint training (10 × 6 s, 30 s recovery) over 4 weeks in either hypoxia (13% FiO₂) or normoxia (21% FiO₂). Pretraining and post-training, participants completed sports specific endurance and sprint field tests and a 10 × 6 s RSA test on a non-motorised treadmill while measuring speed, heart rate, capillary blood lactate, muscle and cerebral deoxygenation and respiratory measures. Yo-Yo Intermittent Recovery Level 1 test performance improved after RS training in both groups, but gains were significantly greater in the hypoxic (33 ± 12%) than the normoxic group (14 ± 10%, prepeated aerobic high intensity workout than an equivalent normoxic training. Performance gains are evident in the short term (4 weeks), a period similar to a preseason training block.

  17. Adaptation and complexity in repeated games

    DEFF Research Database (Denmark)

    Maenner, Eliot Alexander

    2008-01-01

    The paper presents a learning model for two-player infinitely repeated games. In an inference step players construct minimally complex inferences of strategies based on observed play, and in an adaptation step players choose minimally complex best responses to an inference. When players randomly ...

  18. A Structured Group Program for Repeat Dieters.

    Science.gov (United States)

    McNamara, Kathleen

    1989-01-01

    Describes a structured group program for women who repeatedly diet and may be at risk of developing more serious eating disorders. Discusses sessions focusing on eating behavior as well as internal factors that contribute to low body esteem and food and weight preoccupation. Evaluates effectiveness of program by self-reports of members of two…

  19. Why Do Students Repeat Admissions Tests?

    Science.gov (United States)

    Jones, Martha S.

    Attitudes and beliefs about the admissions process, especially the role of standardized testing in admissions, were examined for students who took a standardized admissions test more than once. Their attitudes were compared with those of students who did not repeat the test. About 200 preveterinary students who had taken the Veterinary Aptitude…

  20. The Effect of Repeaters on Equating

    Science.gov (United States)

    Kim, HeeKyoung; Kolen, Michael J.

    2010-01-01

    Test equating might be affected by including in the equating analyses examinees who have taken the test previously. This study evaluated the effect of including such repeaters on Medical College Admission Test (MCAT) equating using a population invariance approach. Three-parameter logistic (3-PL) item response theory (IRT) true score and…

  1. Triggering of repeating earthquakes in central California

    Science.gov (United States)

    Wu, Chunquan; Gomberg, Joan; Ben-Naim, Eli; Johnson, Paul

    2014-01-01

    Dynamic stresses carried by transient seismic waves have been found capable of triggering earthquakes instantly in various tectonic settings. Delayed triggering may be even more common, but the mechanisms are not well understood. Catalogs of repeating earthquakes, earthquakes that recur repeatedly at the same location, provide ideal data sets to test the effects of transient dynamic perturbations on the timing of earthquake occurrence. Here we employ a catalog of 165 families containing ~2500 total repeating earthquakes to test whether dynamic perturbations from local, regional, and teleseismic earthquakes change recurrence intervals. The distance to the earthquake generating the perturbing waves is a proxy for the relative potential contributions of static and dynamic deformations, because static deformations decay more rapidly with distance. Clear changes followed the nearby 2004 Mw6 Parkfield earthquake, so we study only repeaters prior to its origin time. We apply a Monte Carlo approach to compare the observed number of shortened recurrence intervals following dynamic perturbations with the distribution of this number estimated for randomized perturbation times. We examine the comparison for a series of dynamic stress peak amplitude and distance thresholds. The results suggest a weak correlation between dynamic perturbations in excess of ~20 kPa and shortened recurrence intervals, for both nearby and remote perturbations.

  2. A Repeater in the Language Laboratory

    Science.gov (United States)

    Griffiths, B. T.

    1969-01-01

    Discusses the feasilility of the use of repeater devices in the language laboratory in order to enable the student to "recapitulate effortlessly and and indefinitely any utterance of any length which is causing him difficulty or is of special interest. (FWB)

  3. The Differential Effects of Repeating Kindergarten

    Science.gov (United States)

    Burkam, David T.; LoGerfo, Laura; Ready, Doug; Lee, Valerie E.

    2007-01-01

    We use the Early Childhood Longitudinal Study to investigate national patterns addressing (a) who repeats kindergarten, and (b) the subsequent cognitive effects of this event. Using OLS regression techniques, we investigate 1st-time kindergartners who are promoted, 1st-time kindergartners who are retained, and children who are already repeating…

  4. Preventing Repeat Teen Births PSA (:60)

    Centers for Disease Control (CDC) Podcasts

    2013-04-02

    This 60 second public service announcement is based on the April 2013 CDC Vital Signs report, which discusses repeat teen births and ways teens, parents and guardians, health care providers, and communities can help prevent them.  Created: 4/2/2013 by Centers for Disease Control and Prevention (CDC).   Date Released: 4/2/2013.

  5. Epigenetics and triplet repeat neurological diseases

    Directory of Open Access Journals (Sweden)

    Sathiji eNageshwaran

    2015-12-01

    Full Text Available The term ‘junk DNA’ has been reconsidered following the delineation of the functional significance of repetitive DNA regions. Typically associated with centromeres and telomeres, DNA repeats are found in nearly all organisms throughout their genomes. Repetitive regions are frequently heterchromatinised resulting in silencing of intrinsic and nearby genes. However, this is not a uniform rule, with several genes known to require such an environment to permit transcription. Repetitive regions frequently exist as dinucleotide, trinucleotide and tetranucleotide repeats. The association between repetitive regions and disease was emphasised following the discovery of abnormal trinucleotide repeats underlying spinal and bulbar muscular atrophy (Kennedy’s disease and fragile X syndrome of mental retardation (FRAXA in 1991. In this review we provide a brief overview of epigenetic mechanisms and then focus on several diseases caused by DNA triplet-repeat expansions, which exhibit diverse epigenetic effects. It is clear that the emerging field of epigenetics is already generating novel potential therapeutic avenues for this group of largely incurable diseases.

  6. Costly renegotiation in repeated Bertand games

    DEFF Research Database (Denmark)

    Andersson, Ola; Wengström, Erik Roland

    2010-01-01

    This paper extends the concept of weak renegotiation-proof equilibrium (WRP) to allow for costly renegotiation and shows that even small renegotiation costs can have dramatic effects on the set of equilibria. More specifically, the paper analyzes the infinitely repeated Bertrand game. It is shown...

  7. EVOLUTION AND RECOMBINATION OF BOVINE DNA REPEATS

    NARCIS (Netherlands)

    JOBSE, C; BUNTJER, JB; HAAGSMA, N; BREUKELMAN, HJ; BEINTEMA, JJ; LENSTRA, JA

    The history of the abundant repeat elements in the bovine genome has been studied by comparative hybridization and PCR. The Bov-A and Bov-B SINE elements both emerged just after the divergence of the Camelidae and the true ruminants. A 31-bp subrepeat motif in satellites of the Bovidae species

  8. Building Fluency through the Repeated Reading Method

    Science.gov (United States)

    Cohen, Joshua

    2011-01-01

    For the last two years the author has used Repeated Reading (RR) to teach reading fluency in English as a Foreign Language classrooms in colleges and universities in Japan. RR is a method where the student reads and rereads a text silently or aloud from two to four times to reach a predetermined level of speed, accuracy, and comprehension. RR…

  9. History repeats itself: genomic divergence in copepods.

    Science.gov (United States)

    Renaut, Sébastien; Dion-Côté, Anne-Marie

    2016-04-01

    Press stop, erase everything from now till some arbitrary time in the past and start recording life as it evolves once again. Would you see the same tape of life playing itself over and over, or would a different story unfold every time? The late Steven Jay Gould called this experiment replaying the tape of life and argued that any replay of the tape would lead evolution down a pathway radically different from the road actually taken (Gould 1989). This thought experiment has puzzled evolutionary biologists for a long time: how repeatable are evolutionary events? And if history does indeed repeat itself, what are the factors that may help us predict the path taken? A powerful means to address these questions at a small evolutionary scale is to study closely related populations that have evolved independently, under similar environmental conditions. This is precisely what Pereira et al. (2016) set out to do using marine copepods Tigriopus californicus, and present their results in this issue of Molecular Ecology. They show that evolution can be repeatable and even partly predictable, at least at the molecular level. As expected from theory, patterns of divergence were shaped by natural selection. At the same time, strong genetic drift due to small population sizes also constrained evolution down a similar evolutionary road, and probably contributed to repeatable patterns of genomic divergence.

  10. Costly renegotiation in repeated Bertand games

    DEFF Research Database (Denmark)

    Andersson, Ola; Wengström, Erik Roland

    2010-01-01

    This paper extends the concept of weak renegotiation-proof equilibrium (WRP) to allow for costly renegotiation and shows that even small renegotiation costs can have dramatic effects on the set of equilibria. More specifically, the paper analyzes the infinitely repeated Bertrand game. It is shown...

  11. Photometric Repeatability of Scanned Imagery: UVIS

    Science.gov (United States)

    Shanahan, Clare E.; McCullough, Peter; Baggett, Sylvia

    2017-08-01

    We provide the preliminary results of a study on the photometric repeatability of spatial scans of bright, isolated white dwarf stars with the UVIS channel of the Wide Field Camera 3 (WFC3) on the Hubble Space Telescope (HST). We analyze straight-line scans from the first pair of identical orbits of HST program 14878 to assess if sub 0.1% repeatability can be attained with WFC3/UVIS. This study is motivated by the desire to achieve better signal-to-noise in the UVIS contamination and stability monitor, in which observations of standard stars in staring mode have been taken from the installation of WFC3 in 2009 to the present to assess temporal photometric stability. Higher signal to noise in this program would greatly benefit the sensitivity to detect contamination, and to better characterize the observed small throughput drifts over time. We find excellent repeatability between identical visits of program 14878, with sub 0.1% repeatability achieved in most filters. These! results support the initiative to transition the staring mode UVIS contamination and photometric stability monitor from staring mode images to spatial scans.

  12. Repeat surgery after failed midurethral slings

    DEFF Research Database (Denmark)

    Foss Hansen, Margrethe; Lose, Gunnar; Kesmodel, Ulrik Schiøler

    2016-01-01

    MUS from 1998 through 2007. The outcome was repeat surgery with any subsequent procedure code for urinary incontinence within a 5-year period of the first procedure. RESULTS: A total of 5,820 women (mean age 55.4 years, ± 12.1) were registered with a synthetic MUS, and 354 (6 %) underwent reoperation...

  13. EVOLUTION AND RECOMBINATION OF BOVINE DNA REPEATS

    NARCIS (Netherlands)

    JOBSE, C; BUNTJER, JB; HAAGSMA, N; BREUKELMAN, HJ; BEINTEMA, JJ; LENSTRA, JA

    1995-01-01

    The history of the abundant repeat elements in the bovine genome has been studied by comparative hybridization and PCR. The Bov-A and Bov-B SINE elements both emerged just after the divergence of the Camelidae and the true ruminants. A 31-bp subrepeat motif in satellites of the Bovidae species cattl

  14. Multivariate linear models and repeated measurements revisited

    DEFF Research Database (Denmark)

    Dalgaard, Peter

    2009-01-01

    Methods for generalized analysis of variance based on multivariate normal theory have been known for many years. In a repeated measurements context, it is most often of interest to consider transformed responses, typically within-subject contrasts or averages. Efficiency considerations leads...

  15. On balanced minimal repeated measurements designs

    Directory of Open Access Journals (Sweden)

    Shakeel Ahmad Mir

    2014-10-01

    Full Text Available Repeated Measurements designs are concerned with scientific experiments in which each experimental unit is assigned more than once to a treatment either different or identical. This class of designs has the property that the unbiased estimators for elementary contrasts among direct and residual effects are obtainable. Afsarinejad (1983 provided a method of constructing balanced Minimal Repeated Measurements designs p < t , when t is an odd or prime power, one or more than one treatment may occur more than once in some sequences and  designs so constructed no longer remain uniform in periods. In this paper an attempt has been made to provide a new method to overcome this drawback. Specifically, two cases have been considered                RM[t,n=t(t-t/(p-1,p], λ2=1 for balanced minimal repeated measurements designs and  RM[t,n=2t(t-t/(p-1,p], λ2=2 for balanced  repeated measurements designs. In addition , a method has been provided for constructing              extra-balanced minimal designs for special case RM[t,n=t2/(p-1,p], λ2=1.

  16. The effect of polylysine on casein-kinase-2 activity is influenced by both the structure of the protein/peptide substrates and the subunit composition of the enzyme

    DEFF Research Database (Denmark)

    Meggio, F; Boldyreff, B; Marin, O

    1992-01-01

    phosphorylated by either CK2 holoenzyme or the recombinant alpha subunit with 5.8-fold and 2.8-fold stimulation by polylysine, respectively. The recombinant beta subunit of CK2 is itself a good exogenous substrate for the enzyme, its phosphorylation, however, is inhibited rather than enhanced by polylysine...... alpha subunit. The concentration of polylysine required for half-maximal stimulation is comparable to CK2 concentration and increases by increasing CK2 concentration, suggesting that polylysine primarily interacts with the enzyme, rather than with the peptide substrate.......The mechanism by which polybasic peptides stimulate the activity of casein kinase 2 (CK2) has been studied by comparing the effect of polylysine on the phosphorylation of a variety of protein and peptide substrates by the native CK2 holoenzyme and by its recombinant catalytic alpha subunit, either...

  17. The effect of polylysine on casein-kinase-2 activity is influenced by both the structure of the protein/peptide substrates and the subunit composition of the enzyme

    DEFF Research Database (Denmark)

    Meggio, F; Boldyreff, B; Marin, O;

    1992-01-01

    alpha subunit. The concentration of polylysine required for half-maximal stimulation is comparable to CK2 concentration and increases by increasing CK2 concentration, suggesting that polylysine primarily interacts with the enzyme, rather than with the peptide substrate.......The mechanism by which polybasic peptides stimulate the activity of casein kinase 2 (CK2) has been studied by comparing the effect of polylysine on the phosphorylation of a variety of protein and peptide substrates by the native CK2 holoenzyme and by its recombinant catalytic alpha subunit, either...... phosphorylated by either CK2 holoenzyme or the recombinant alpha subunit with 5.8-fold and 2.8-fold stimulation by polylysine, respectively. The recombinant beta subunit of CK2 is itself a good exogenous substrate for the enzyme, its phosphorylation, however, is inhibited rather than enhanced by polylysine...

  18. RepeatsDB 2.0: improved annotation, classification, search and visualization of repeat protein structures

    Science.gov (United States)

    Paladin, Lisanna; Hirsh, Layla; Piovesan, Damiano; Andrade-Navarro, Miguel A.; Kajava, Andrey V.; Tosatto, Silvio C.E.

    2017-01-01

    RepeatsDB 2.0 (URL: http://repeatsdb.bio.unipd.it/) is an update of the database of annotated tandem repeat protein structures. Repeat proteins are a widespread class of non-globular proteins carrying heterogeneous functions involved in several diseases. Here we provide a new version of RepeatsDB with an improved classification schema including high quality annotations for ∼5400 protein structures. RepeatsDB 2.0 features information on start and end positions for the repeat regions and units for all entries. The extensive growth of repeat unit characterization was possible by applying the novel ReUPred annotation method over the entire Protein Data Bank, with data quality is guaranteed by an extensive manual validation for >60% of the entries. The updated web interface includes a new search engine for complex queries and a fully re-designed entry page for a better overview of structural data. It is now possible to compare unit positions, together with secondary structure, fold information and Pfam domains. Moreover, a new classification level has been introduced on top of the existing scheme as an independent layer for sequence similarity relationships at 40%, 60% and 90% identity. PMID:27899671

  19. 47 CFR 80.1179 - On-board repeater limitations.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false On-board repeater limitations. 80.1179 Section... On-board repeater limitations. When an on-board repeater is used, the following limitations must be met: (a) The on-board repeater antenna must be located no higher than 3 meters (10 feet) above...

  20. Stability of dental waxes following repeated heatings.

    Science.gov (United States)

    Kotsiomiti, E; McCabe, J F

    1995-02-01

    The flow and strength properties of dental waxes were examined following excessive and repeated heatings of the materials. For one product, the flow at 40 +/- 0.5 degrees C was reduced by 25.3% following heating above 200 degrees C. A decrease of the elastic modulus at 20 +/- 1 degree C by approximately 66% was observed in some cases after the heating temperature had been increased to 300 degrees C. Property variations were related to compositional changes, which were investigated by infrared spectoscopy and thermal analysis. Exposure of dental waxes to temperatures higher than 200 degrees C, particularly if it is repeated, may affect the composition and properties, resulting in inferior materials.

  1. Learning with repeated-game strategies.

    Science.gov (United States)

    Ioannou, Christos A; Romero, Julian

    2014-01-01

    We use the self-tuning Experience Weighted Attraction model with repeated-game strategies as a computer testbed to examine the relative frequency, speed of convergence and progression of a set of repeated-game strategies in four symmetric 2 × 2 games: Prisoner's Dilemma, Battle of the Sexes, Stag-Hunt, and Chicken. In the Prisoner's Dilemma game, we find that the strategy with the most occurrences is the "Grim-Trigger." In the Battle of the Sexes game, a cooperative pair that alternates between the two pure-strategy Nash equilibria emerges as the one with the most occurrences. In the Stag-Hunt and Chicken games, the "Win-Stay, Lose-Shift" and "Grim-Trigger" strategies are the ones with the most occurrences. Overall, the pairs that converged quickly ended up at the cooperative outcomes, whereas the ones that were extremely slow to reach convergence ended up at non-cooperative outcomes.

  2. Learning With Repeated-Game Strategies

    Directory of Open Access Journals (Sweden)

    Christos A. Ioannou

    2014-07-01

    Full Text Available We use the self-tuning Experience Weighted Attraction model with repeated-game strategies as a computer testbed to examine the relative frequency, speed of convergence and progression of a set of repeated-game strategies in four symmetric 2x2 games: Prisoner's Dilemma, Battle of the Sexes, Stag-Hunt, and Chicken. In the Prisoner's Dilemma game, we fi□nd that the strategy with the most occurrences is the Grim-Trigger. In the Battle of the Sexes game, a cooperative pair that alternates between the two pure-strategy Nash equilibria emerges as the one with the most occurrences. In the Stag-Hunt and Chicken games, the Win-Stay, Lose-Shift and Grim-Trigger strategies are the ones with the most occurrences. Overall, the pairs that converged quickly ended up at the cooperative outcomes, whereas the ones that were extremely slow to reach convergence ended up at non-cooperative outcomes.

  3. Quantum repeaters with entangled coherent states

    CERN Document Server

    Sangouard, Nicolas; Gisin, Nicolas; Laurat, Julien; Tualle-Brouri, Rosa; Grangier, Philippe

    2009-01-01

    Entangled coherent states can be prepared remotely by subtracting non-locally a single photon from two quantum superpositions of coherent states, the so-called "Schroedinger's cat" state. Such entanglement can further be distributed over longer distances by successive entanglement swapping operations using linear optics and photon-number resolving detectors. The aim of this paper is to evaluate the performance of this approach to quantum repeaters for long distance quantum communications. Despite many attractive features at first sight, we show that, when using state-of-the-art photon counters and quantum memories, they do not achieve higher entanglement generation rates than repeaters based on single-photon entanglement. We discuss potential developments which may take better advantage of the richness of entanglement based on continuous variables, including in particular efficient parity measurements.

  4. Quantum repeaters based on heralded qubit amplifiers

    CERN Document Server

    Minář, Jiří; Sangouard, Nicolas

    2011-01-01

    We present a quantum repeater scheme based on the recently proposed qubit amplifier [N. Gisin, S. Pironio and N. Sangouard, Phys. Rev. Lett. 105, 070501 (2010)]. It relies on a on-demand entangled-photon pair source which uses on-demand single-photon sources, linear optical elements and atomic ensembles. Interestingly, the imperfections affecting the states created from this source, caused e.g. by detectors with non-unit efficiencies, are systematically purified from an entanglement swapping operation based on a two-photon detection. This allows the distribution of entanglement over very long distances with a high fidelity, i.e. without vacuum components and multiphoton errors. Therefore, the resulting quantum repeater architecture does not necessitate final postselections and thus achieves high entanglement distribution rates. This also provides unique opportunities for device-independent quantum key distribution over long distances with linear optics and atomic ensembles.

  5. Nonparametric additive regression for repeatedly measured data

    KAUST Repository

    Carroll, R. J.

    2009-05-20

    We develop an easily computed smooth backfitting algorithm for additive model fitting in repeated measures problems. Our methodology easily copes with various settings, such as when some covariates are the same over repeated response measurements. We allow for a working covariance matrix for the regression errors, showing that our method is most efficient when the correct covariance matrix is used. The component functions achieve the known asymptotic variance lower bound for the scalar argument case. Smooth backfitting also leads directly to design-independent biases in the local linear case. Simulations show our estimator has smaller variance than the usual kernel estimator. This is also illustrated by an example from nutritional epidemiology. © 2009 Biometrika Trust.

  6. Repeat-PPM Super-Symbol Synchronization

    Science.gov (United States)

    Connelly, J.

    2016-11-01

    To attain a wider range of data rates in pulse position modulation (PPM) schemes with constrained pulse durations, the sender can repeat a PPM symbol multiple times, forming a super-symbol. In addition to the slot and symbol synchronization typically required for PPM, the receiver must also properly align the noisy super-symbols. We present a low-complexity approximation of the maximum-likelihood method for performing super-symbol synchronization without use of synchronization sequences. We provide simulation results demonstrating performance advantage when PPM symbols are spread by a pseudo-noise sequence, as opposed to simply repeating. Additionally, the results suggest that this super-symbol synchronization technique requires signal levels below those required for reliable communication. This validates that the PPM spreading approach proposed to CCSDS can work properly as part of the overall scheme.

  7. High-bandwidth hybrid quantum repeater.

    Science.gov (United States)

    Munro, W J; Van Meter, R; Louis, Sebastien G R; Nemoto, Kae

    2008-07-25

    We present a physical- and link-level design for the creation of entangled pairs to be used in quantum repeater applications where one can control the noise level of the initially distributed pairs. The system can tune dynamically, trading initial fidelity for success probability, from high fidelity pairs (F=0.98 or above) to moderate fidelity pairs. The same physical resources that create the long-distance entanglement are used to implement the local gates required for entanglement purification and swapping, creating a homogeneous repeater architecture. Optimizing the noise properties of the initially distributed pairs significantly improves the rate of generating long-distance Bell pairs. Finally, we discuss the performance trade-off between spatial and temporal resources.

  8. Do Gamma-Ray Burst Sources Repeat?

    OpenAIRE

    Meegan, Charles A.; Hartmann, Dieter H.; Brainerd, J. J.; Briggs, Michael S.; Paciesas, William S.; Pendleton, Geoffrey; Kouveliotou, Chryssa; Fishman, Gerald; Blumenthal, George; Brock, Martin

    1995-01-01

    The demonstration of repeated gamma-ray bursts from an individual source would severely constrain burst source models. Recent reports (Quashnock and Lamb 1993; Wang and Lingenfelter 1993) of evidence for repetition in the first BATSE burst catalog have generated renewed interest in this issue. Here, we analyze the angular distribution of 585 bursts of the second BATSE catalog (Meegan et al. 1994). We search for evidence of burst recurrence using the nearest and farthest neighbor statistic and...

  9. 2D Metals by Repeated Size Reduction.

    Science.gov (United States)

    Liu, Hanwen; Tang, Hao; Fang, Minghao; Si, Wenjie; Zhang, Qinghua; Huang, Zhaohui; Gu, Lin; Pan, Wei; Yao, Jie; Nan, Cewen; Wu, Hui

    2016-10-01

    A general and convenient strategy for manufacturing freestanding metal nanolayers is developed on large scale. By the simple process of repeatedly folding and calendering stacked metal sheets followed by chemical etching, free-standing 2D metal (e.g., Ag, Au, Fe, Cu, and Ni) nanosheets are obtained with thicknesses as small as 1 nm and with sizes of the order of several micrometers.

  10. Repeatability and Workability Evaluation of SIGMOD 2011

    DEFF Research Database (Denmark)

    Bonnet, Philippe

    2011-01-01

    SIGMOD has offered, since 2008, to verify the experiments published in the papers accepted at the conference. This year, we have been in charge of reproducing the experiments provided by the authors (repeatability), and exploring changes to experiment parameters (workability). In this paper, we a...... find that most experiments are distributed as Linux packages accompanied by instructions on how to setup and run the experiments. We are still far from the vision of executable papers...

  11. Repeatability of Response to Asthma Medications

    Science.gov (United States)

    Wu, Ann; Tantisira, Kelan; Li, Lingling; Schuemann, Brooke; Weiss, Scott

    2010-01-01

    Background Pharmacogenetic studies of drug response in asthma assume that patients respond consistently to a treatment but that treatment response varies across patients, however, no formal studies have demonstrated this. Objective To determine the repeatability of commonly used outcomes for treatment response to asthma medications: bronchodilator response, forced expiratory volume in 1 second (FEV1), and provocative concentration of methacholine producing a 20% decline in FEV1 (PC20). Methods The Childhood Asthma Management Program (CAMP) was a multi-center clinical trial of children randomized to receiving budesonide, nedocromil, or placebo. We determined the intraclass correlation coefficient (ICC) for each outcome over repeated visits over four years in CAMP using mixed effects regression models. We adjusted for the covariates: age, race/ethnicity, height, family income, parental education, and symptom score. We incorporated each outcome for each child as repeated outcome measurements and stratified by treatment group. Results The ICC for bronchodilator response was 0.31 in the budesonide group, 0.35 in the nedocromil group, and 0.40 in the placebo group, after adjusting for covariates. The ICC for FEV1 was 0.71 in the budesonide group, 0.60 in the nedocromil group, and 0.69 in the placebo group, after adjusting for covariates. The ICC for PC20 was 0.67 in the budesonide and placebo groups and 0.73 in the nedocromil group, after adjusting for covariates. Conclusion The within treatment group repeatability of FEV1 and PC20 are high; thus these phenotypes are heritable. FEV1 and PC20 may be better phenotypes than bronchodilator response for studies of treatment response in asthma. PMID:19064281

  12. Repeated extraction of DNA from FTA cards

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Ferrero, Laura; Børsting, Claus

    2011-01-01

    Extraction of DNA using magnetic bead based techniques on automated DNA extraction instruments provides a fast, reliable and reproducible method for DNA extraction from various matrices. However, the yield of extracted DNA from FTA-cards is typically low. Here, we demonstrate that it is possible...... to repeatedly extract DNA from the processed FTA-disk. The method increases the yield from the nanogram range to the microgram range....

  13. Repeated extraction of DNA from FTA cards

    OpenAIRE

    Stangegaard, Michael; Ferrero, Laura; Børsting, Claus; Frank-Hansen, Rune; Hansen, Anders Johannes; Morling, Niels

    2011-01-01

    Extraction of DNA using magnetic bead based techniques on automated DNA extraction instruments provides a fast, reliable and reproducible method for DNA extraction from various matrices. However, the yield of extracted DNA from FTA-cards is typically low. Here, we demonstrate that it is possible to repeatedly extract DNA from the processed FTA-disk. The method increases the yield from the nanogram range to the microgram range.

  14. Repeated extraction of DNA from FTA cards

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Ferrero, Laura; Børsting, Claus

    2011-01-01

    Extraction of DNA using magnetic bead based techniques on automated DNA extraction instruments provides a fast, reliable and reproducible method for DNA extraction from various matrices. However, the yield of extracted DNA from FTA-cards is typically low. Here, we demonstrate that it is possible...... to repeatedly extract DNA from the processed FTA-disk. The method increases the yield from the nanogram range to the microgram range....

  15. A Central Limit Theorem for Repeating Patterns

    CERN Document Server

    Abrams, Aaron; Landau, Henry; Landau, Zeph; Pommersheim, James

    2012-01-01

    This note gives a central limit theorem for the length of the longest subsequence of a random permutation which follows some repeating pattern. This includes the case of any fixed pattern of ups and downs which has at least one of each, such as the alternating case considered by Stanley in [2] and Widom in [3]. In every case considered the convergence in the limit of long permutations is to normal with mean and variance linear in the length of the permutations.

  16. Repeatability and Workability Evaluation of SIGMOD 2011

    DEFF Research Database (Denmark)

    Bonnet, Philippe

    2011-01-01

    SIGMOD has offered, since 2008, to verify the experiments published in the papers accepted at the conference. This year, we have been in charge of reproducing the experiments provided by the authors (repeatability), and exploring changes to experiment parameters (workability). In this paper, we a...... find that most experiments are distributed as Linux packages accompanied by instructions on how to setup and run the experiments. We are still far from the vision of executable papers...

  17. Epigenetics and Triplet-Repeat Neurological Diseases

    OpenAIRE

    Nageshwaran, Sathiji; Festenstein, Richard

    2015-01-01

    The term “junk DNA” has been reconsidered following the delineation of the functional significance of repetitive DNA regions. Typically associated with centromeres and telomeres, DNA repeats are found in nearly all organisms throughout their genomes. Repetitive regions are frequently heterochromatinized resulting in silencing of intrinsic and nearby genes. However, this is not a uniform rule, with several genes known to require such an environment to permit transcription. Repetitive regions f...

  18. Epigenetics and triplet repeat neurological diseases

    OpenAIRE

    Sathiji eNageshwaran; Richard eFestenstein

    2015-01-01

    The term ‘junk DNA’ has been reconsidered following the delineation of the functional significance of repetitive DNA regions. Typically associated with centromeres and telomeres, DNA repeats are found in nearly all organisms throughout their genomes. Repetitive regions are frequently heterchromatinised resulting in silencing of intrinsic and nearby genes. However, this is not a uniform rule, with several genes known to require such an environment to permit transcription. Repetitive regions fr...

  19. Repeated-sprint ability and aerobic fitness.

    Science.gov (United States)

    Thébault, Nicolas; Léger, Luc A; Passelergue, Philippe

    2011-10-01

    The purpose of this study was to reinvestigate the relationship between aerobic fitness and fatigue indices of repeated-sprint ability (RSA), with special attention to methodological normalization. Soldiers were divided into low (n = 10) and high (n = 9) fitness groups according to a preset maximal aerobic speed (MAS) of 17 km·h(-1) (∼60 ml O2·kg(-1)·min) measured with the University of Montreal Track Test (UMTT). Subjects' assessment included the RSA test (3 sets of 5 40-m sprints with 1-minute rest between sprints and 1.5 minutes between sets), a 40-m sprint (criterion test used in the computation of fatigue indices for the RSA test), strength and power measurement of the lower limbs, and the 20-m shuttle run test (20-m SRT) and the UMTT, which are measures of maximal aerobic power. The highest correlation with the RSA fatigue indices was obtained with the 20-m SRT (r = 0.90, p = 0.0001, n = 19), a test with 180° direction changes and accelerations and decelerations. The lower correlation (r = 0.66, p repeated sprints and achieved better recovery between series. A MAS of at least 17 km·h(-1) favors constant and high speed level during repeated sprints. From a practical point of view, a high aerobic fitness is a precious asset in counteracting fatigue in sports with numerous sprint repetitions.

  20. Histone deacetylase complexes promote trinucleotide repeat expansions.

    Directory of Open Access Journals (Sweden)

    Kim Debacker

    2012-02-01

    Full Text Available Expansions of DNA trinucleotide repeats cause at least 17 inherited neurodegenerative diseases, such as Huntington's disease. Expansions can occur at frequencies approaching 100% in affected families and in transgenic mice, suggesting that specific cellular proteins actively promote (favor expansions. The inference is that expansions arise due to the presence of these promoting proteins, not their absence, and that interfering with these proteins can suppress expansions. The goal of this study was to identify novel factors that promote expansions. We discovered that specific histone deacetylase complexes (HDACs promote CTG•CAG repeat expansions in budding yeast and human cells. Mutation or inhibition of yeast Rpd3L or Hda1 suppressed up to 90% of expansions. In cultured human astrocytes, expansions were suppressed by 75% upon inhibition or knockdown of HDAC3, whereas siRNA against the histone acetyltransferases CBP/p300 stimulated expansions. Genetic and molecular analysis both indicated that HDACs act at a distance from the triplet repeat to promote expansions. Expansion assays with nuclease mutants indicated that Sae2 is one of the relevant factors regulated by Rpd3L and Hda1. The causal relationship between HDACs and expansions indicates that HDACs can promote mutagenesis at some DNA sequences. This relationship further implies that HDAC3 inhibitors being tested for relief of expansion-associated gene silencing may also suppress somatic expansions that contribute to disease progression.

  1. Landauer's Principle in Repeated Interaction Systems

    Science.gov (United States)

    Hanson, Eric P.; Joye, Alain; Pautrat, Yan; Raquépas, Renaud

    2017-01-01

    We study Landauer's Principle for Repeated Interaction Systems (RIS) consisting of a reference quantum system S in contact with a structured environment E made of a chain of independent quantum probes; S interacts with each probe, for a fixed duration, in sequence. We first adapt Landauer's lower bound, which relates the energy variation of the environment E to a decrease of entropy of the system S during the evolution, to the peculiar discrete time dynamics of RIS. Then we consider RIS with a structured environment E displaying small variations of order {T^{-1}} between the successive probes encountered by S, after {n ˜eq T} interactions, in keeping with adiabatic scaling. We establish a discrete time non-unitary adiabatic theorem to approximate the reduced dynamics of S in this regime, in order to tackle the adiabatic limit of Landauer's bound. We find that saturation of Landauer's bound is related to a detailed balance condition on the repeated interaction system, reflecting the non-equilibrium nature of the repeated interaction system dynamics. This is to be contrasted with the generic saturation of Landauer's bound known to hold for continuous time evolution of an open quantum system interacting with a single thermal reservoir in the adiabatic regime.

  2. A Unified Model for Repeating and Non-repeating Fast Radio Bursts

    Science.gov (United States)

    Bagchi, Manjari

    2017-04-01

    The model that fast radio bursts (FRBs) are caused by plunges of asteroids onto neutron stars can explain both repeating and non-repeating bursts. If a neutron star passes through an asteroid belt around another star, there would be a series of bursts caused by a series of asteroid impacts. Moreover, the neutron star would cross the same belt repetitively if it were in a binary with the star hosting the asteroid belt, leading to a repeated series of bursts. I explore the properties of neutron star binaries that could lead to the only known repeating FRB so far (FRB121102). In this model, the next two epochs of bursts are expected around 2017 February 27 and 2017 December 18. On the other hand, if the asteroid belt is located around the neutron star itself, then a chance fall of an asteroid from that belt onto the neutron star would lead to a non-repeating burst. Even a neutron star grazing an asteroid belt can lead to a non-repeating burst caused by just one asteroid plunge during the grazing. This is possible even when the neutron star is in a binary with the asteroid-hosting star, if the belt and the neutron star orbit are non-coplanar.

  3. ERK2在胃黏膜病变中的表达及其与Hp感染的关系%The Relationship between Extracellular Regulated Protein Kinases 2 Expression and Helicobacter Pylori Infection in Gastric Cancer and Precancerous Lesion

    Institute of Scientific and Technical Information of China (English)

    雷琳; 黄亚平; 朱庆茹; 江霞

    2012-01-01

    目的 探讨胃癌前病变及胃癌组织中细胞外调节蛋白激酶2(extracellular regulated protein kinases 2,ERK2)表达与幽门螺旋杆菌(helicobacter pylori,Hp)感染的相关性,及Hp感染与胃癌发生的关系.方法 收集慢性浅表性胃炎(chronic superficial gastritis,CSG)、慢性萎缩性胃炎伴中重度肠上皮化生(intestinal metaplasia,IM)、慢性萎缩性胃炎伴中重度不典型增生(dysplasia,Dys)各30例及胃癌(gastric cancer,GC)40例,采用SP免疫组化法,检测4组中ERK2蛋白的表达.结果 CSG、IM、Dys、GC组织中,Hp感染患者胃黏膜组织中ERK2表达水平高于无Hp感染患者(P<0.05).结论 Hp感染可能通过上调ERK2表达水平,从而在胃癌发生、发展过程中发挥重要作用.%Objective To explore the relationship between the extracellular regulated protein kinases 2 and Helicobacter pylori ( Hp ) infection in the pathogenesis of gastric cancel. Methods The expression of ERK2 was determined by immunohisto-chemical method in 130 gastric specimens including 30 cases of chronic superficial gastritis ( CSG ) ,30 cases of intestinal metaplasia (IM ),30 cases of dysplasia ( Dys ) and 40 cases of gastric carcinomas ( GC ). Results The expression level of ERK2 was significantly higher in the tissues from patients with Hp infection than those without Hp infection in patients with CSG,IM,Dys, GC ( P <0. 05 ). Conclusion The expression of ERK2 in Hp positive group was significantly higher than that in Hp negative group.

  4. Repeatability and Reproducibility of Virtual Subjective Refraction.

    Science.gov (United States)

    Perches, Sara; Collados, M Victoria; Ares, Jorge

    2016-10-01

    To establish the repeatability and reproducibility of a virtual refraction process using simulated retinal images. With simulation software, aberrated images corresponding with each step of the refraction process were calculated following the typical protocol of conventional subjective refraction. Fifty external examiners judged simulated retinal images until the best sphero-cylindrical refraction and the best visual acuity were achieved starting from the aberrometry data of three patients. Data analyses were performed to assess repeatability and reproducibility of the virtual refraction as a function of pupil size and aberrometric profile of different patients. SD values achieved in three components of refraction (M, J0, and J45) are lower than 0.25D in repeatability analysis. Regarding reproducibility, we found SD values lower than 0.25D in the most cases. When the results of virtual refraction with different pupil diameters (4 and 6 mm) were compared, the mean of differences (MoD) obtained were not clinically significant (less than 0.25D). Only one of the aberrometry profiles with high uncorrected astigmatism shows poor results for the M component in reproducibility and pupil size dependence analysis. In all cases, vision achieved was better than 0 logMAR. A comparison between the compensation obtained with virtual and conventional subjective refraction was made as an example of this application, showing good quality retinal images in both processes. The present study shows that virtual refraction has similar levels of precision as conventional subjective refraction. Moreover, virtual refraction has also shown that when high low order astigmatism is present, the refraction result is less precise and highly dependent on pupil size.

  5. Oxygen uptake during repeated-sprint exercise.

    Science.gov (United States)

    McGawley, Kerry; Bishop, David J

    2015-03-01

    Repeated-sprint ability appears to be influenced by oxidative metabolism, with reductions in fatigue and improved sprint times related to markers of aerobic fitness. The aim of the current study was to measure the oxygen uptake (VO₂) during the first and last sprints during two, 5 × 6-s repeated-sprint bouts. Cross-sectional study. Eight female soccer players performed two, consecutive, 5 × 6-s maximal sprint bouts (B1 and B2) on five separate occasions, in order to identify the minimum time (trec) required to recover total work done (Wtot) in B1. On a sixth occasion, expired air was collected during the first and last sprint of B1 and B2, which were separated by trec. The trec was 10.9 ± 1.1 min. The VO₂ during the first sprint was significantly less than the last sprint in each bout (psprint (measured in kJ) was significantly related to VO₂max in both B1 (r=0.81, p=0.015) and B2 (r=0.93, p=0.001). In addition, the VO₂ attained in the final sprint was not significantly different from VO₂max in B1 (p=0.284) or B2 (p=0.448). The current study shows that the VO₂ increases from the first to the last of 5 × 6-s sprints and that VO₂max may be a limiting factor to performance in latter sprints. Increasing V˙O₂max in team-sport athletes may enable increased aerobic energy delivery, and consequently work done, during a bout of repeated sprints. Copyright © 2014 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  6. Mechanical processes with repeated attenuated impacts

    CERN Document Server

    Nagaev, R F

    1999-01-01

    This book is devoted to considering in the general case - using typical concrete examples - the motion of machines and mechanisms of impact and vibro-impact action accompanied by a peculiar phenomenon called "impact collapse". This phenomenon is that after the initial collision, a sequence of repeated gradually quickening collisions of decreasing-to-zero intensity occurs, with the final establishment of protracted contact between the interacting bodies. The initiation conditions of the impact collapse are determined and calculation techniques for the quantitative characteristics of the corresp

  7. Source coding model for repeated snapshot imaging

    CERN Document Server

    Li, Junhui; Yang, Dongyue; wu, Guohua; Yin, Longfei; Guo, Hong

    2016-01-01

    Imaging based on successive repeated snapshot measurement is modeled as a source coding process in information theory. The necessary number of measurement to maintain a certain level of error rate is depicted as the rate-distortion function of the source coding. Quantitative formula of the error rate versus measurement number relation is derived, based on the information capacity of imaging system. Second order fluctuation correlation imaging (SFCI) experiment with pseudo-thermal light verifies this formula, which paves the way for introducing information theory into the study of ghost imaging (GI), both conventional and computational.

  8. REPEAT facility. Report for May, June, July

    Science.gov (United States)

    Winn, C. B.

    1981-08-01

    The construction of the REPEAT facility, a test facility for passive and hybrid solar heating systems is reported. The development of a simulation program for envelope type passive solar systems, constructing an envelope test cell, collecting data to validate the program, and application of the program to determine the best envelope type design are discussed. A low cost monitoring system using a dedicated microprocessor system, an inexpensive, high accuracy A/D converter, and minimum system hardware is developed. A method to determine the average temperature and the average daily temperature variation inside a passively heated solar building is presented.

  9. Cataractogenesis after Repeat Laser in situ Keratomileusis

    Directory of Open Access Journals (Sweden)

    Ahmad M. Mansour

    2012-08-01

    Full Text Available There has been the unsubstantiated clinical impression that laser refractive surgery accelerates cataract development along with solid experimental data about the cataractogenic effects of excimer laser treatment. We present the first documented case of significant cataract formation in a young myope after repeat excimer laser ablation necessitating phacoemulsification with a posterior chamber implant. Proposed explanations include focusing of the ablation wave on the posterior capsule (acoustic wave lens epithelial damage, photooxidative stress of the lens (ultraviolet and inflammatory oxidative stress, and corticosteroid-induced cataract (lens toxicity.

  10. Multiplicatively Repeated Non-Binary LDPC Codes

    CERN Document Server

    Kasai, Kenta; Poulliat, Charly; Sakaniwa, Kohichi

    2010-01-01

    We propose non-binary LDPC codes concatenated with multiplicative repetition codes. By multiplicatively repeating the (2,3)-regular non-binary LDPC mother code of rate 1/3, we construct rate-compatible codes of lower rates 1/6, 1/9, 1/12,... Surprisingly, such simple low-rate non-binary LDPC codes outperform the best low-rate binary LDPC codes so far. Moreover, we propose the decoding algorithm for the proposed codes, which can be decoded with almost the same computational complexity as that of the mother code.

  11. Improving repeated sprint ability in young elite soccer players: repeated shuttle sprints vs. explosive strength training.

    Science.gov (United States)

    Buchheit, Martin; Mendez-Villanueva, Alberto; Delhomel, Gregory; Brughelli, Matt; Ahmaidi, Said

    2010-10-01

    To compare the effects of explosive strength (ExpS) vs. repeated shuttle sprint (RS) training on repeated sprint ability (RSA) in young elite soccer players, 15 elite male adolescents (14.5 ± 0.5 years) performed, in addition to their soccer training program, RS (n = 7) or ExpS (n = 8) training once a week for a total of 10 weeks. RS training consisted of 2-3 sets of 5-6 × 15- to 20-m repeated shuttle sprints interspersed with 14 seconds of passive or 23 seconds of active recovery (≈2 m·s⁻¹); ExpS training consisted of 4-6 series of 4-6 exercises (e.g., maximal unilateral countermovement jumps (CMJs), calf and squat plyometric jumps, and short sprints). Before and after training, performance was assessed by 10 and 30 m (10 and 30 m) sprint times, best (RSAbest) and mean (RSAmean) times on a repeated shuttle sprint ability test, a CMJ, and a hopping (Hop) test. After training, except for 10 m (p = 0.22), all performances were significantly improved in both groups (all p's repeated shuttle sprint test were only observed after RS training, whereas CMJ height was only increased after ExpS. Because RS and ExpS were equally efficient at enhancing maximal sprinting speed, RS training-induced improvements in RSA were likely more related to progresses in the ability to change direction.

  12. Repeated vitrification/warming of human sperm gives better results than repeated slow programmable freezing

    Institute of Scientific and Technical Information of China (English)

    Teraporn Vutyavanich; Worashorn Lattiwongsakorn; Waraporn Piromlertamorn; Sudarat Samchimchom

    2012-01-01

    In this study,we compared the effects of repeated freezing/thawing of human sperm by our in-house method of rapid freezing with slow programmable freezing.Sperm samples from 11 normozoospermic subjects were processed through density gradients and divided into three aliquots:non-frozen,rapid freezing and slow programmable freezing.Sperm in the rapid freezing group had better motility and viability than those in the slow freezing group (P<O.01) after the first,second and third cycles of freezing/thawing,but there was no difference in morphology.In the second experiment,rapid freezing was repeated three times in 20 subjects.The samples from each thawing cycle were evaluated for DNA fragmentation using the alkaline comet assay.DNA fragmentation began to increase considerably after the second cycle of freezing/thawing,but to a level that was not clinically important.In the third experiment,rapid freezing was done repeatedly in 10 subjects,until no motile sperm were observed after thawing.The median number of repeated freezing/thawing that yielded no motile sperm was seven (range:5-8,mean:6.8).In conclusion,we demonstrated that repeated freezing/thawing of processed semen using our rapid freezing method gave better results than standard slow programmable freezing.This method can help maximize the usage of precious cryopreserved sperm samples in assisted reproduction technology.

  13. Comparative genomics and molecular dynamics of DNA repeats in eukaryotes.

    Science.gov (United States)

    Richard, Guy-Franck; Kerrest, Alix; Dujon, Bernard

    2008-12-01

    Repeated elements can be widely abundant in eukaryotic genomes, composing more than 50% of the human genome, for example. It is possible to classify repeated sequences into two large families, "tandem repeats" and "dispersed repeats." Each of these two families can be itself divided into subfamilies. Dispersed repeats contain transposons, tRNA genes, and gene paralogues, whereas tandem repeats contain gene tandems, ribosomal DNA repeat arrays, and satellite DNA, itself subdivided into satellites, minisatellites, and microsatellites. Remarkably, the molecular mechanisms that create and propagate dispersed and tandem repeats are specific to each class and usually do not overlap. In the present review, we have chosen in the first section to describe the nature and distribution of dispersed and tandem repeats in eukaryotic genomes in the light of complete (or nearly complete) available genome sequences. In the second part, we focus on the molecular mechanisms responsible for the fast evolution of two specific classes of tandem repeats: minisatellites and microsatellites. Given that a growing number of human neurological disorders involve the expansion of a particular class of microsatellites, called trinucleotide repeats, a large part of the recent experimental work on microsatellites has focused on these particular repeats, and thus we also review the current knowledge in this area. Finally, we propose a unified definition for mini- and microsatellites that takes into account their biological properties and try to point out new directions that should be explored in a near future on our road to understanding the genetics of repeated sequences.

  14. Extending Teach and Repeat to Pivoting Wheelchairs

    Directory of Open Access Journals (Sweden)

    Guillermo Del Castillo

    2003-02-01

    Full Text Available The paper extends the teach-and-repeat paradigm that has been successful for the control of holonomic robots to nonholonomic wheelchairs which may undergo pivoting action over the course of their taught movement. Due to the nonholonomic nature of the vehicle kinematics, estimation is required -- in the example given herein, based upon video detection of wall-mounted cues -- both in the teaching and the tracking events. In order to accommodate motion that approaches pivoting action as well as motion that approaches straight-line action, the estimation equations of the Extended Kalman Filter and the control equations are formulated using two different definitions of a nontemporal independent variable. The paper motivates the need for pivoting action in real-life settings by reporting extensively on the abilities and limitations of estimation-based teach-and-repeat action where pivoting and near-pivoting action is disallowed. Following formulation of the equations in the near-pivot mode, the paper reports upon experiments where taught trajectories which entail a seamless mix of near-straight and near-pivot action are tracked.

  15. The Perpetual Repeater: an Educative Musical Experience.

    Directory of Open Access Journals (Sweden)

    Svetlana Skriagina

    2014-05-01

    Full Text Available To commemorate the 40th anniversary of the Music Undergraduate Program of the Universidad Pedagógica Nacional (National Pedagogic University, two musical events were planned: an original work written for choir, soloists and symphonic band, and an opera for children. As a result, the cantata ‘The Perpetual Repeater” has been created as an adaptation of a work named “50 Milions de Segons” (50 Millions of Seconds, staged by the CATANIA project of the Barcelona Servei Educatiu de L’Auditori. This work tells the story of those school teachers who, paradoxically enough repeat the same course year after year. After visiting L’Auditori of Barcelona to participate in the pedagogic musical work carried out with school children, we considered the possibility of developing an analogous project, in a similar sociocultural and educational environment, within our Music Undergraduate Program. So, this article deals with two fundamental moments which are essential to understand the educational work implemented with the ISPA students of sixth degree, as well as with a group of the program’s students: The Purpose, which describes in detail the planning of the musical work for children, and The Experience, in which the way the process of The Perpetual Repeater Cantatawas carried out is described.

  16. Airborne Radar Interferometric Repeat-Pass Processing

    Science.gov (United States)

    Hensley, Scott; Michel, Thierry R.; Jones, Cathleen E.; Muellerschoen, Ronald J.; Chapman, Bruce D.; Fore, Alexander; Simard, Marc; Zebker, Howard A.

    2011-01-01

    Earth science research often requires crustal deformation measurements at a variety of time scales, from seconds to decades. Although satellites have been used for repeat-track interferometric (RTI) synthetic-aperture-radar (SAR) mapping for close to 20 years, RTI is much more difficult to implement from an airborne platform owing to the irregular trajectory of the aircraft compared with microwave imaging radar wavelengths. Two basic requirements for robust airborne repeat-pass radar interferometry include the ability to fly the platform to a desired trajectory within a narrow tube and the ability to have the radar beam pointed in a desired direction to a fraction of a beam width. Uninhabited Aerial Vehicle Synthetic Aperture Radar (UAVSAR) is equipped with a precision auto pilot developed by NASA Dryden that allows the platform, a Gulfstream III, to nominally fly within a 5 m diameter tube and with an electronically scanned antenna to position the radar beam to a fraction of a beam width based on INU (inertial navigation unit) attitude angle measurements.

  17. Aggregating quantum repeaters for the quantum internet

    Science.gov (United States)

    Azuma, Koji; Kato, Go

    2017-09-01

    The quantum internet holds promise for accomplishing quantum teleportation and unconditionally secure communication freely between arbitrary clients all over the globe, as well as the simulation of quantum many-body systems. For such a quantum internet protocol, a general fundamental upper bound on the obtainable entanglement or secret key has been derived [K. Azuma, A. Mizutani, and H.-K. Lo, Nat. Commun. 7, 13523 (2016), 10.1038/ncomms13523]. Here we consider its converse problem. In particular, we present a universal protocol constructible from any given quantum network, which is based on running quantum repeater schemes in parallel over the network. For arbitrary lossy optical channel networks, our protocol has no scaling gap with the upper bound, even based on existing quantum repeater schemes. In an asymptotic limit, our protocol works as an optimal entanglement or secret-key distribution over any quantum network composed of practical channels such as erasure channels, dephasing channels, bosonic quantum amplifier channels, and lossy optical channels.

  18. Automated Planning in Repeated Adversarial Games

    CERN Document Server

    de Cote, Enrique Munoz; Sykulski, Adam M; Jennings, Nicholas R

    2012-01-01

    Game theory's prescriptive power typically relies on full rationality and/or self-play interactions. In contrast, this work sets aside these fundamental premises and focuses instead on heterogeneous autonomous interactions between two or more agents. Specifically, we introduce a new and concise representation for repeated adversarial (constant-sum) games that highlight the necessary features that enable an automated planing agent to reason about how to score above the game's Nash equilibrium, when facing heterogeneous adversaries. To this end, we present TeamUP, a model-based RL algorithm designed for learning and planning such an abstraction. In essence, it is somewhat similar to R-max with a cleverly engineered reward shaping that treats exploration as an adversarial optimization problem. In practice, it attempts to find an ally with which to tacitly collude (in more than two-player games) and then collaborates on a joint plan of actions that can consistently score a high utility in adversarial repeated gam...

  19. Chromosome-specific DNA Repeat Probes

    Energy Technology Data Exchange (ETDEWEB)

    Baumgartner, Adolf; Weier, Jingly Fung; Weier, Heinz-Ulrich G.

    2006-03-16

    In research as well as in clinical applications, fluorescence in situ hybridization (FISH) has gained increasing popularity as a highly sensitive technique to study cytogenetic changes. Today, hundreds of commercially available DNA probes serve the basic needs of the biomedical research community. Widespread applications, however, are often limited by the lack of appropriately labeled, specific nucleic acid probes. We describe two approaches for an expeditious preparation of chromosome-specific DNAs and the subsequent probe labeling with reporter molecules of choice. The described techniques allow the preparation of highly specific DNA repeat probes suitable for enumeration of chromosomes in interphase cell nuclei or tissue sections. In addition, there is no need for chromosome enrichment by flow cytometry and sorting or molecular cloning. Our PCR-based method uses either bacterial artificial chromosomes or human genomic DNA as templates with {alpha}-satellite-specific primers. Here we demonstrate the production of fluorochrome-labeled DNA repeat probes specific for human chromosomes 17 and 18 in just a few days without the need for highly specialized equipment and without the limitation to only a few fluorochrome labels.

  20. Repeat-induced gene silencing in mammals.

    Science.gov (United States)

    Garrick, D; Fiering, S; Martin, D I; Whitelaw, E

    1998-01-01

    In both plants and Drosophila melanogaster, expression from a transgenic locus may be silenced when repeated transgene copies are arranged as a concatameric array. This repeat-induced gene silencing is frequently manifested as a decrease in the proportion of cells that express the transgene, resulting in a variegated pattern of expression. There is also some indication that, in transgenic mammals, the number of transgene copies within an array can exert a repressive influence on expression, with several mouse studies reporting a decrease in the level of expression per copy as copy number increases. However, because these studies compare different sites of transgene integration as well as arrays with different numbers of copies, the expression levels observed may be subject to varying position effects as well as the influence of the multicopy array. Here we describe use of the lox/Cre system of site-specific recombination to generate transgenic mouse lines in which different numbers of a transgene are present at the same chromosomal location, thereby eliminating the contribution of position effects and allowing analysis of the effect of copy number alone on transgene silencing. Reduction in copy number results in a marked increase in expression of the transgene and is accompanied by decreased chromatin compaction and decreased methylation at the transgene locus. These findings establish that the presence of multiple homologous copies of a transgene within a concatameric array can have a repressive effect upon gene expression in mammalian systems.

  1. c-Jun N-terminal kinase 2 prevents luminal cell commitment in normal mammary glands and tumors by inhibiting p53/Notch1 and breast cancer gene 1 expression.

    Science.gov (United States)

    Cantrell, Michael A; Ebelt, Nancy D; Pfefferle, Adam D; Perou, Charles M; Van Den Berg, Carla Lynn

    2015-05-20

    Breast cancer is a heterogeneous disease with several subtypes carrying unique prognoses. Patients with differentiated luminal tumors experience better outcomes, while effective treatments are unavailable for poorly differentiated tumors, including the basal-like subtype. Mechanisms governing mammary tumor subtype generation could prove critical to developing better treatments. C-Jun N-terminal kinase 2 (JNK2) is important in mammary tumorigenesis and tumor progression. Using a variety of mouse models, human breast cancer cell lines and tumor expression data, studies herein support that JNK2 inhibits cell differentiation in normal and cancer-derived mammary cells. JNK2 prevents precocious pubertal mammary development and inhibits Notch-dependent expansion of luminal cell populations. Likewise, JNK2 suppresses luminal populations in a p53-competent Polyoma Middle T-antigen tumor model where jnk2 knockout causes p53-dependent upregulation of Notch1 transcription. In a p53 knockout model, JNK2 restricts luminal populations independently of Notch1, by suppressing Brca1 expression and promoting epithelial to mesenchymal transition. JNK2 also inhibits estrogen receptor (ER) expression and confers resistance to fulvestrant, an ER inhibitor, while stimulating tumor progression. These data suggest that therapies inhibiting JNK2 in breast cancer may promote tumor differentiation, improve endocrine therapy response, and inhibit metastasis.

  2. miR-140-5p attenuates chemotherapeutic drug-induced cell death by regulating autophagy through inositol 1,4,5-trisphosphate kinase 2 (IP3k2) in human osteosarcoma cells

    Science.gov (United States)

    Wei, Renxiong; Cao, Gang; Deng, Zhouming; Su, Jiajia; Cai, Lin

    2016-01-01

    Acquisition of drug-resistant phenotypes is often associated with chemotherapy in osteosarcoma. A number of studies have demonstrated a critical role for autophagy in osteosarcoma development, therapy and drug resistance. However, the molecular mechanisms underlying the autophagy-mediated chemotherapy resistance of osteosarcoma cells remain largely unknown. In the present study, we determined the autophagy and microRNA-140 (miR-140-5p, miRBase ID: MIMAT0000431) expression induced by chemotherapeutic drugs in osteosarcoma cells. Then we determined the promotory role of miR-140-5p to the chemotherapy-induced autophagy. Our results demonstrated that miR-140-5p expression was highly induced during chemotherapy of osteosarcoma cells, and this was accompanied by up-regulated autophagy. The increased miR-140-5p expression levels up-regulated anticancer drug-induced autophagy in osteosarcoma cells and ameliorated the anticancer drug-induced cell proliferation and viability decrease. Importantly, miR-140-5p regulates this context-specific autophagy through its target, inositol 1,4,5-trisphosphate kinase 2 (IP3k2). Therefore, the results of the present study demonstrated that miR-140-5p mediated drug-resistance in osteosarcoma cells by inducing autophagy. The present study provides evidence of miRNA regulation of autophagy through modulation of IP3 signalling. The present study recognized a novel mechanism of chemoresistance in osteosarcoma cancers. PMID:27582507

  3. Discrepancies in reporting the CAG repeat lengths for Huntington's disease

    DEFF Research Database (Denmark)

    Quarrell, Oliver W; Handley, Olivia; O'Donovan, Kirsty

    2011-01-01

    Huntington's disease results from a CAG repeat expansion within the Huntingtin gene; this is measured routinely in diagnostic laboratories. The European Huntington's Disease Network REGISTRY project centrally measures CAG repeat lengths on fresh samples; these were compared with the original...

  4. 47 CFR 90.247 - Mobile repeater stations.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Mobile repeater stations. 90.247 Section 90.247... MOBILE RADIO SERVICES Non-Voice and Other Specialized Operations § 90.247 Mobile repeater stations. A... repeater to extend the communications range of hand-carried units subject to the following: (a)...

  5. Polymorphic GGC repeat differentially regulates human reelin gene expression levels.

    Science.gov (United States)

    Persico, A M; Levitt, P; Pimenta, A F

    2006-10-01

    The human gene encoding Reelin (RELN), a pivotal protein in neurodevelopment, includes a polymorphic GGC repeat in its 5' untranslated region (UTR). CHO cells transfected with constructs encompassing the RELN 5'UTR with 4-to-13 GGC repeats upstream of the luciferase reporter gene show declining luciferase activity with increasing GGC repeat number (P autism.

  6. CGG repeat in the FMR1 gene: Size matters

    NARCIS (Netherlands)

    R.A. Willemsen (Ralph); G.J. Levenga (Josien); B.A. Oostra (Ben)

    2011-01-01

    textabstractThe FMR1 gene contains a CGG repeat present in the 5'-untranslated region which can be unstable upon transmission to the next generation. The repeat is up to 55 CGGs long in the normal population. In patients with fragile X syndrome (FXS), a repeat length exceeding 200 CGGs (full

  7. Repeat Testing Effects on Credentialing Exams: Are Repeaters Misinformed or Uninformed?

    Science.gov (United States)

    Feinberg, Richard A.; Raymond, Mark R.; Haist, Steven A.

    2015-01-01

    To mitigate security concerns and unfair score gains, credentialing programs routinely administer new test material to examinees retesting after an initial failing attempt. Counterintuitively, a small but growing body of recent research suggests that repeating the identical form does not create an unfair advantage. This study builds upon and…

  8. Who Repeats Algebra, and How Does Initial Performance Relate to Improvement When the Course Is Repeated?

    Science.gov (United States)

    Fong, Anthony; Jaquet, Karina; Finkelstein, Neal

    2016-01-01

    The information provided in this report shows how students perform when they repeat algebra I and how the level of improvement varies depending on initial course performance and the academic measure (course grades or CST scores). This information can help inform decisions and policies regarding whether and under what circumstances students should…

  9. Hybrid quantum repeater using bright coherent light.

    Science.gov (United States)

    van Loock, P; Ladd, T D; Sanaka, K; Yamaguchi, F; Nemoto, Kae; Munro, W J; Yamamoto, Y

    2006-06-23

    We describe a quantum repeater protocol for long-distance quantum communication. In this scheme, entanglement is created between qubits at intermediate stations of the channel by using a weak dispersive light-matter interaction and distributing the outgoing bright coherent-light pulses among the stations. Noisy entangled pairs of electronic spin are then prepared with high success probability via homodyne detection and postselection. The local gates for entanglement purification and swapping are deterministic and measurement-free, based upon the same coherent-light resources and weak interactions as for the initial entanglement distribution. Finally, the entanglement is stored in a nuclear-spin-based quantum memory. With our system, qubit-communication rates approaching 100 Hz over 1280 km with fidelities near 99% are possible for reasonable local gate errors.

  10. Potential of repeated polymer well treatments

    Energy Technology Data Exchange (ETDEWEB)

    Lakatos, I.; Lakatos-Szabo, J. (Hungarian Academy of Sciences, Budapest (Hungary)); Munkacsi, I.; Troemboeczki, S.

    1993-11-01

    This paper analyzes field results obtained by routine application of a polymer/silicate well treatment technique at the Algyo-2 field in Hungary. First, the reservoir is described briefly; then, the basic concept of the method is outlined. Reference is made to the multifunctioning chemical mechanism of gelation and the favorable rheological properties of the treating fluids that jointly result in a highly selective placement and an efficient permeability reduction in the target reservoir space. Application of the method 17 times in 16 producing wells yielded more than 90,000 Mg of incremental oil production. Typical well behaviors also are illustrated. Finally, the potential of repeated treatments is discussed, taking laboratory and field results into account.

  11. Quantum repeaters using continuous-variable teleportation

    Science.gov (United States)

    Dias, Josephine; Ralph, T. C.

    2017-02-01

    Quantum optical states are fragile and can become corrupted when passed through a lossy communication channel. Unlike for classical signals, optical amplifiers cannot be used to recover quantum signals. Quantum repeaters have been proposed as a way of reducing errors and hence increasing the range of quantum communications. Current protocols target specific discrete encodings, for example quantum bits encoded on the polarization of single photons. We introduce a more general approach that can reduce the effect of loss on any quantum optical encoding, including those based on continuous variables such as the field amplitudes. We show that in principle the protocol incurs a resource cost that scales polynomially with distance. We analyze the simplest implementation and find that while its range is limited it can still achieve useful improvements in the distance over which quantum entanglement of field amplitudes can be distributed.

  12. Statistical Properties of repeating FRB 121102

    CERN Document Server

    Wang, F Y

    2016-01-01

    Fast radio bursts (FRBs) are millisecond-duration radio signals possibly occurring at cosmological distances. However the physical model of FRBs is mystery, many models have been proposed. Here we study the frequency distributions of peak flux, fluence, duration and waiting time for repeating FRB 121102. The cumulative distributions of peak flux, fluence and duration show power-law forms. The waiting time distribution also shows power-law distribution, and is consistent with a non-stationary Poisson process. We also use the statistical results to test the proposed models for FRBs. Comparing with the model predications, we find that the theoretical models proposed by Dai et al. (2016) and Katz (2016) are favored. These distributions are consistent with the predications from avalanche models of driven systems.

  13. Simple sequence repeats in mycobacterial genomes

    Indian Academy of Sciences (India)

    Vattipally B Sreenu; Pankaj Kumar; Javaregowda Nagaraju; Hampapathalu A Nagarajaram

    2007-01-01

    Simple sequence repeats (SSRs) or microsatellites are the repetitive nucleotide sequences of motifs of length 1–6 bp. They are scattered throughout the genomes of all the known organisms ranging from viruses to eukaryotes. Microsatellites undergo mutations in the form of insertions and deletions (INDELS) of their repeat units with some bias towards insertions that lead to microsatellite tract expansion. Although prokaryotic genomes derive some plasticity due to microsatellite mutations they have in-built mechanisms to arrest undue expansions of microsatellites and one such mechanism is constituted by post-replicative DNA repair enzymes MutL, MutH and MutS. The mycobacterial genomes lack these enzymes and as a null hypothesis one could expect these genomes to harbour many long tracts. It is therefore interesting to analyse the mycobacterial genomes for distribution and abundance of microsatellites tracts and to look for potentially polymorphic microsatellites. Available mycobacterial genomes, Mycobacterium avium, M. leprae, M. bovis and the two strains of M. tuberculosis (CDC1551 and H37Rv) were analysed for frequencies and abundance of SSRs. Our analysis revealed that the SSRs are distributed throughout the mycobacterial genomes at an average of 220–230 SSR tracts per kb. All the mycobacterial genomes contain few regions that are conspicuously denser or poorer in microsatellites compared to their expected genome averages. The genomes distinctly show scarcity of long microsatellites despite the absence of a post-replicative DNA repair system. Such severe scarcity of long microsatellites could arise as a result of strong selection pressures operating against long and unstable sequences although influence of GC-content and role of point mutations in arresting microsatellite expansions can not be ruled out. Nonetheless, the long tracts occasionally found in coding as well as non-coding regions may account for limited genome plasticity in these genomes.

  14. Repeat Gamma Knife surgery for vestibular schwannomas

    Science.gov (United States)

    Lonneville, Sarah; Delbrouck, Carine; Renier, Cécile; Devriendt, Daniel; Massager, Nicolas

    2015-01-01

    Background: Gamma Knife (GK) surgery is a recognized treatment option for the management of small to medium-sized vestibular schwannoma (VS) associated with high-tumor control and low morbidity. When a radiosurgical treatment fails to stop tumor growth, repeat GK surgery can be proposed in selected cases. Methods: A series of 27 GK retreatments was performed in 25 patients with VS; 2 patients underwent three procedures. The median time interval between GK treatments was 45 months. The median margin dose used for the first, second, and third GK treatments was 12 Gy, 12 Gy, and 14 Gy, respectively. Six patients (4 patients for the second irradiation and 2 patients for the third irradiation) with partial tumor regrowth were treated only on the growing part of the tumor using a median margin dose of 13 Gy. The median tumor volume was 0.9, 2.3, and 0.7 cc for the first, second, and third treatments, respectively. Stereotactic positron emission tomography (PET) guidance was used for dose planning in 6 cases. Results: Mean follow-up duration was 46 months (range 24–110). At the last follow-up, 85% of schwannomas were controlled. The tumor volume decreased, remained unchanged, or increased after retreatment in 15, 8, and 4 cases, respectively. Four patients had PET during follow-up, and all showed a significant metabolic decrease of the tumor. Hearing was not preserved after retreatment in any patients. New facial or trigeminal palsy did not occur after retreatment. Conclusions: Our results support the long-term efficacy and low morbidity of repeat GK treatment for selected patients with tumor growth after initial treatment. PMID:26500799

  15. The excess of small inverted repeats in prokaryotes.

    Science.gov (United States)

    Ladoukakis, Emmanuel D; Eyre-Walker, Adam

    2008-09-01

    Recent analyses have shown that there is a large excess of perfect inverted repeats in many prokaryotic genomes but not in eukaryotic ones. This difference could be due to a genuine difference between prokaryotes and eukaryotes or to differences in the methods and types of data analyzed--full genome versus protein coding sequences. We used simulations to show that the method used previously tends to underestimate the expected number of inverted repeats. However, this bias is not large and cannot explain the excess of inverted repeats observed in real data. In contrast, our method is unbiased. When both methods are applied to bacterial protein coding sequences they both detect an excess of inverted repeats, which is much lower than previously reported in whole prokaryotic genomes. This suggests that the reported large excess of inverted repeats is due to repeats found in intergenic regions. These repeats could be due to transcription factor binding sites, or other types of repetitive DNA, on opposite strands of the DNA sequence. In contrast, the smaller, but significant, excess of inverted repeats that we report in protein coding sequences may be due to sequence-directed mutagenesis (SDM). SDM is a process where one copy of a small, imperfect, inverted repeat corrects the other copy via strand misalignment, resulting in a perfect repeat and a series of mutations. We show by simulation that even very low levels of SDM, relative to the rate of point mutation, can generate a substantial excess of inverted repeats.

  16. Studies of an expanded trinucleotide repeat in transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Bingham, P.; Wang, S.; Merry, D. [Univ. of Pennsylvania, Philadelphia, PA (United States)

    1994-09-01

    Spinal and bulbar muscular atrophy (SBMA) is a progressive motor neuron disease caused by expansion of a trinucleotide repeat in the androgen receptor gene (AR{sup exp}). AR{sup exp} repeats expand further or contract in approximately 25% of transmissions. Analogous {open_quotes}dynamic mutations{close_quotes} have been reported in other expanded trinucleotide repeat disorders. We have been developing a mouse model of this disease using a transgenic approach. Expression of the SBMA AR was documented in transgenic mice with an inducible promoter. No phenotypic effects of transgene expression were observed. We have extended our previous results on stability of the expanded trinucleotide repeat in transgenic mice in two lines carrying AR{sup exp}. Tail DNA was amplified by PCR using primers spanning the repeat on 60 AR{sup exp} transgenic mice from four different transgenic lines. Migration of the PCR product through an acrylamide gel showed no change of the 45 CAG repeat length in any progeny. Similarly, PCR products from 23 normal repeat transgenics showed no change from the repeat length of the original construct. Unlike the disease allele in humans, the expanded repeat AR cDNA in transgenic mice showed no change in repeat length with transmission. The relative stability of CAG repeats seen in the transgenic mice may indicate either differences in the fidelity of replicative enzymes, or differences in error identification and repair between mice and humans. Integration site or structural properties of the transgene itself might also play a role.

  17. Role of DNA Polymerases in Repeat-Mediated Genome Instability

    Directory of Open Access Journals (Sweden)

    Kartik A. Shah

    2012-11-01

    Full Text Available Expansions of simple DNA repeats cause numerous hereditary diseases in humans. We analyzed the role of DNA polymerases in the instability of Friedreich’s ataxia (GAAn repeats in a yeast experimental system. The elementary step of expansion corresponded to ∼160 bp in the wild-type strain, matching the size of Okazaki fragments in yeast. This step increased when DNA polymerase α was mutated, suggesting a link between the scale of expansions and Okazaki fragment size. Expandable repeats strongly elevated the rate of mutations at substantial distances around them, a phenomenon we call repeat-induced mutagenesis (RIM. Notably, defects in the replicative DNA polymerases δ and ∊ strongly increased rates for both repeat expansions and RIM. The increases in repeat-mediated instability observed in DNA polymerase δ mutants depended on translesion DNA polymerases. We conclude that repeat expansions and RIM are two sides of the same replicative mechanism.

  18. Structure-Based Assignment of Ile, Leu, and Val Methyl Groups in the Active and Inactive Forms of the Mitogen-Activated Protein Kinase Extracellular Signal-Regulated Kinase 2.

    Science.gov (United States)

    Xiao, Yao; Warner, Lisa R; Latham, Michael P; Ahn, Natalie G; Pardi, Arthur

    2015-07-21

    Resonance assignments are the first step in most NMR studies of protein structure, function, and dynamics. Standard protein assignment methods employ through-bond backbone experiments on uniformly (13)C/(15)N-labeled proteins. For larger proteins, this through-bond assignment procedure often breaks down due to rapid relaxation and spectral overlap. The challenges involved in studies of larger proteins led to efficient methods for (13)C labeling of side chain methyl groups, which have favorable relaxation properties and high signal-to-noise. These methyls are often still assigned by linking them to the previously assigned backbone, thus limiting the applications for larger proteins. Here, a structure-based procedure is described for assignment of (13)C(1)H3-labeled methyls by comparing distance information obtained from three-dimensional methyl-methyl nuclear Overhauser effect (NOE) spectroscopy with the X-ray structure. The Ile, Leu, or Val (ILV) methyl type is determined by through-bond experiments, and the methyl-methyl NOE data are analyzed in combination with the known structure. A hierarchical approach was employed that maps the largest observed "NOE-methyl cluster" onto the structure. The combination of identification of ILV methyl type with mapping of the NOE-methyl clusters greatly simplifies the assignment process. This method was applied to the inactive and active forms of the 42-kDa ILV (13)C(1)H3-methyl labeled extracellular signal-regulated kinase 2 (ERK2), leading to assignment of 60% of the methyls, including 90% of Ile residues. A series of ILV to Ala mutants were analyzed, which helped confirm the assignments. These assignments were used to probe the local and long-range effects of ligand binding to inactive and active ERK2.

  19. Identification of Open Stomata1-Interacting Proteins Reveals Interactions with Sucrose Non-fermenting1-Related Protein Kinases2 and with Type 2A Protein Phosphatases That Function in Abscisic Acid Responses.

    Science.gov (United States)

    Waadt, Rainer; Manalansan, Bianca; Rauniyar, Navin; Munemasa, Shintaro; Booker, Matthew A; Brandt, Benjamin; Waadt, Christian; Nusinow, Dmitri A; Kay, Steve A; Kunz, Hans-Henning; Schumacher, Karin; DeLong, Alison; Yates, John R; Schroeder, Julian I

    2015-09-01

    The plant hormone abscisic acid (ABA) controls growth and development and regulates plant water status through an established signaling pathway. In the presence of ABA, pyrabactin resistance/regulatory component of ABA receptor proteins inhibit type 2C protein phosphatases (PP2Cs). This, in turn, enables the activation of Sucrose Nonfermenting1-Related Protein Kinases2 (SnRK2). Open Stomata1 (OST1)/SnRK2.6/SRK2E is a major SnRK2-type protein kinase responsible for mediating ABA responses. Arabidopsis (Arabidopsis thaliana) expressing an epitope-tagged OST1 in the recessive ost1-3 mutant background was used for the copurification and identification of OST1-interacting proteins after osmotic stress and ABA treatments. These analyses, which were confirmed using bimolecular fluorescence complementation and coimmunoprecipitation, unexpectedly revealed homo- and heteromerization of OST1 with SnRK2.2, SnRK2.3, OST1, and SnRK2.8. Furthermore, several OST1-complexed proteins were identified as type 2A protein phosphatase (PP2A) subunits and as proteins involved in lipid and galactolipid metabolism. More detailed analyses suggested an interaction network between ABA-activated SnRK2-type protein kinases and several PP2A-type protein phosphatase regulatory subunits. pp2a double mutants exhibited a reduced sensitivity to ABA during seed germination and stomatal closure and an enhanced ABA sensitivity in root growth regulation. These analyses add PP2A-type protein phosphatases as another class of protein phosphatases to the interaction network of SnRK2-type protein kinases.

  20. Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study.

    Science.gov (United States)

    Kittler, L; Baguley, B C; Löber, G; Waring, M J

    1999-01-01

    A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

  1. REPdenovo: Inferring De Novo Repeat Motifs from Short Sequence Reads.

    Directory of Open Access Journals (Sweden)

    Chong Chu

    Full Text Available Repeat elements are important components of eukaryotic genomes. One limitation in our understanding of repeat elements is that most analyses rely on reference genomes that are incomplete and often contain missing data in highly repetitive regions that are difficult to assemble. To overcome this problem we develop a new method, REPdenovo, which assembles repeat sequences directly from raw shotgun sequencing data. REPdenovo can construct various types of repeats that are highly repetitive and have low sequence divergence within copies. We show that REPdenovo is substantially better than existing methods both in terms of the number and the completeness of the repeat sequences that it recovers. The key advantage of REPdenovo is that it can reconstruct long repeats from sequence reads. We apply the method to human data and discover a number of potentially new repeats sequences that have been missed by previous repeat annotations. Many of these sequences are incorporated into various parasite genomes, possibly because the filtering process for host DNA involved in the sequencing of the parasite genomes failed to exclude the host derived repeat sequences. REPdenovo is a new powerful computational tool for annotating genomes and for addressing questions regarding the evolution of repeat families. The software tool, REPdenovo, is available for download at https://github.com/Reedwarbler/REPdenovo.

  2. Repeated-sprint and effort ability in rugby league players.

    Science.gov (United States)

    Johnston, Rich D; Gabbett, Tim J

    2011-10-01

    The aim of this study was to (a) investigate the influence of tackling on repeated-sprint performance; (b) determine whether repeated-sprint ability (RSA) and repeated-effort ability (REA) are 2 distinct qualities; and (c) assess the test-retest reliability of repeated-sprint and repeated-effort tests in rugby league. Twelve rugby league players performed a repeated-sprint (12 × 20-m sprints performed on a 20-second cycle) and a repeated-effort (12 × 20-m sprints with intermittent tackling, performed on a 20-second cycle) test 7 days apart. The test-retest reliability of these tests was also established. Heart rate and rating of perceived exertion were recorded throughout the tests. There was a significantly greater (p ≤ 0.05) and large effect size (ES) differences for total sprint time (ES = 1.19), average heart rate (ES = 1.64), peak heart rate (ES = 1.35), and perceived exertion (ES = 3.39) for the repeated-effort test compared with the repeated-sprint test. A large difference (ES = 1.02, p = 0.06) was detected for percentage decrement between the 2 tests. No significant relationship was found between the repeated-sprint and repeated-effort tests for any of the dependent variables. Both tests proved reliable, with total sprint time being the most reliable method of assessing performance. This study demonstrates that the addition of tackling significantly increases the physiological response to repeated-sprint exercise and reduces repeated-sprint performance in rugby league players. Furthermore, RSA and REA appear to be 2 distinct qualities that can be reliably assessed with total time being the most reliable measure of performance.

  3. Multineuronal Spike Sequences Repeat with Millisecond Precision

    Directory of Open Access Journals (Sweden)

    Koki eMatsumoto

    2013-06-01

    Full Text Available Cortical microcircuits are nonrandomly wired by neurons. As a natural consequence, spikes emitted by microcircuits are also nonrandomly patterned in time and space. One of the prominent spike organizations is a repetition of fixed patterns of spike series across multiple neurons. However, several questions remain unsolved, including how precisely spike sequences repeat, how the sequences are spatially organized, how many neurons participate in sequences, and how different sequences are functionally linked. To address these questions, we monitored spontaneous spikes of hippocampal CA3 neurons ex vivo using a high-speed functional multineuron calcium imaging technique that allowed us to monitor spikes with millisecond resolution and to record the location of spiking and nonspiking neurons. Multineuronal spike sequences were overrepresented in spontaneous activity compared to the statistical chance level. Approximately 75% of neurons participated in at least one sequence during our observation period. The participants were sparsely dispersed and did not show specific spatial organization. The number of sequences relative to the chance level decreased when larger time frames were used to detect sequences. Thus, sequences were precise at the millisecond level. Sequences often shared common spikes with other sequences; parts of sequences were subsequently relayed by following sequences, generating complex chains of multiple sequences.

  4. Modelling repeatedly flaring delta-sunspots

    CERN Document Server

    Chatterjee, Piyali; Carlsson, Mats

    2016-01-01

    Active regions (AR) appearing on the surface of the Sun are classified into $\\alpha$, $\\beta$, $\\gamma$, and $\\delta$ by the rules of the Mount Wilson Observatory, California on the basis of their topological complexity. Amongst these, the $\\delta$-sunspots are known to be super-active and produce the most X-ray flares. Here, we present results from a simulation of the Sun by mimicking the upper layers and the corona, but starting at a more primitive stage than any earlier treatment. We find that this initial state consisting of only a thin sub-photospheric magnetic sheet breaks into multiple flux-tubes which evolve into a colliding-merging system of spots of opposite polarity upon surface emergence, similar to those often seen on the Sun. The simulation goes on to produce many exotic $\\delta$-sunspot associated phenomena: repeated flaring in the range of typical solar flare energy release and ejective helical flux ropes with embedded cool-dense plasma filaments resembling solar coronal mass ejections.

  5. A Repeated Signal Difference for Recognising Patterns

    Directory of Open Access Journals (Sweden)

    Kieran Greer

    2016-08-01

    Full Text Available This paper describes a new mechanism that might help with defining pattern sequences, by the fact that it can produce an upper bound on the ensemble value that can persistently oscillate with the actual values produced from each pattern. With every firing event, a node also receives an on/off feedback switch. If the node fires then it sends a feedback result depending on the input signal strength. If the input signal is positive or larger, it can store an ‘on’ switch feedback for the next iteration. If the signal is negative or smaller it can store an ‘off’ switch feedback for the next iteration. If the node does not fire, then it does not affect the current feedback situation and receives the switch command produced by the last active pattern event for the same neuron. The upper bound therefore also represents the largest or most enclosing pattern set and the lower value is for the actual set of firing patterns. If the pattern sequence repeats, it will oscillate between the two values, allowing them to be recognised and measured more easily, over time. Tests show that changing the sequence ordering produces different value sets, which can also be measured.

  6. Hypoxic Repeat Sprint Training Improves Rugby Player's Repeated Sprint but Not Endurance Performance.

    Science.gov (United States)

    Hamlin, Michael J; Olsen, Peter D; Marshall, Helen C; Lizamore, Catherine A; Elliot, Catherine A

    2017-01-01

    This study aims to investigate the performance changes in 19 well-trained male rugby players after repeat-sprint training (six sessions of four sets of 5 × 5 s sprints with 25 s and 5 min of active recovery between reps and sets, respectively) in either normobaric hypoxia (HYP; n = 9; FIO2 = 14.5%) or normobaric normoxia (NORM; n = 10; FIO2 = 20.9%). Three weeks after the intervention, 2 additional repeat-sprint training sessions in hypoxia (FIO2 = 14.5%) was investigated in both groups to gauge the efficacy of using "top-up" sessions for previously hypoxic-trained subjects and whether a small hypoxic dose would be beneficial for the previously normoxic-trained group. Repeated sprint (8 × 20 m) and Yo-Yo Intermittent Recovery Level 1 (YYIR1) performances were tested twice at baseline (Pre 1 and Pre 2) and weekly after (Post 1-3) the initial intervention (intervention 1) and again weekly after the second "top-up" intervention (Post 4-5). After each training set, heart rate, oxygen saturation, and rate of perceived exertion were recorded. Compared to baseline (mean of Pre 1 and Pre 2), both the hypoxic and normoxic groups similarly lowered fatigue over the 8 sprints 1 week after the intervention (Post 1: -1.8 ± 1.6%, -1.5 ± 1.4%, mean change ± 90% CI in HYP and NORM groups, respectively). However, from Post 2 onwards, only the hypoxic group maintained the performance improvement compared to baseline (Post 2: -2.1 ± 1.8%, Post 3: -2.3 ± 1.7%, Post 4: -1.9 ± 1.8%, and Post 5: -1.2 ± 1.7%). Compared to the normoxic group, the hypoxic group was likely to have substantially less fatigue at Post 3-5 (-2.0 ± 2.4%, -2.2 ± 2.4%, -1.6 ± 2.4% Post 3, Post 4, Post 5, respectively). YYIR1 performances improved throughout the recovery period in both groups (13-37% compared to baseline) with unclear differences found between groups. The addition of two sessions of "top-up" training after intervention 1, had little effect on either group. Repeat-sprint training in

  7. Hypoxic Repeat Sprint Training Improves Rugby Player's Repeated Sprint but Not Endurance Performance

    Science.gov (United States)

    Hamlin, Michael J.; Olsen, Peter D.; Marshall, Helen C.; Lizamore, Catherine A.; Elliot, Catherine A.

    2017-01-01

    This study aims to investigate the performance changes in 19 well-trained male rugby players after repeat-sprint training (six sessions of four sets of 5 × 5 s sprints with 25 s and 5 min of active recovery between reps and sets, respectively) in either normobaric hypoxia (HYP; n = 9; FIO2 = 14.5%) or normobaric normoxia (NORM; n = 10; FIO2 = 20.9%). Three weeks after the intervention, 2 additional repeat-sprint training sessions in hypoxia (FIO2 = 14.5%) was investigated in both groups to gauge the efficacy of using “top-up” sessions for previously hypoxic-trained subjects and whether a small hypoxic dose would be beneficial for the previously normoxic-trained group. Repeated sprint (8 × 20 m) and Yo-Yo Intermittent Recovery Level 1 (YYIR1) performances were tested twice at baseline (Pre 1 and Pre 2) and weekly after (Post 1–3) the initial intervention (intervention 1) and again weekly after the second “top-up” intervention (Post 4–5). After each training set, heart rate, oxygen saturation, and rate of perceived exertion were recorded. Compared to baseline (mean of Pre 1 and Pre 2), both the hypoxic and normoxic groups similarly lowered fatigue over the 8 sprints 1 week after the intervention (Post 1: −1.8 ± 1.6%, −1.5 ± 1.4%, mean change ± 90% CI in HYP and NORM groups, respectively). However, from Post 2 onwards, only the hypoxic group maintained the performance improvement compared to baseline (Post 2: −2.1 ± 1.8%, Post 3: −2.3 ± 1.7%, Post 4: −1.9 ± 1.8%, and Post 5: −1.2 ± 1.7%). Compared to the normoxic group, the hypoxic group was likely to have substantially less fatigue at Post 3–5 (−2.0 ± 2.4%, −2.2 ± 2.4%, −1.6 ± 2.4% Post 3, Post 4, Post 5, respectively). YYIR1 performances improved throughout the recovery period in both groups (13–37% compared to baseline) with unclear differences found between groups. The addition of two sessions of “top-up” training after intervention 1, had little effect on either

  8. An Expanded CAG Repeat in Huntingtin Causes +1 Frameshifting.

    Science.gov (United States)

    Saffert, Paul; Adamla, Frauke; Schieweck, Rico; Atkins, John F; Ignatova, Zoya

    2016-08-26

    Maintenance of triplet decoding is crucial for the expression of functional protein because deviations either into the -1 or +1 reading frames are often non-functional. We report here that expression of huntingtin (Htt) exon 1 with expanded CAG repeats, implicated in Huntington pathology, undergoes a sporadic +1 frameshift to generate from the CAG repeat a trans-frame AGC repeat-encoded product. This +1 recoding is exclusively detected in pathological Htt variants, i.e. those with expanded repeats with more than 35 consecutive CAG codons. An atypical +1 shift site, UUC C at the 5' end of CAG repeats, which has some resemblance to the influenza A virus shift site, triggers the +1 frameshifting and is enhanced by the increased propensity of the expanded CAG repeats to form a stem-loop structure. The +1 trans-frame-encoded product can directly influence the aggregation of the parental Htt exon 1.

  9. Repeats in transforming acidic coiled-coil (TACC) genes.

    Science.gov (United States)

    Trivedi, Seema

    2013-06-01

    Transforming acidic coiled-coil proteins (TACC1, 2, and 3) are essential proteins associated with the assembly of spindle microtubules and maintenance of bipolarity. Dysregulation of TACCs is associated with tumorigenesis, but studies of microsatellite instability in TACC genes have not been extensive. Microsatellite or simple sequence repeat instability is known to cause many types of cancer. The present in silico analysis of SSRs in human TACC gene sequences shows the presence of mono- to hexa-nucleotide repeats, with the highest densities found for mono- and di-nucleotide repeats. Density of repeats is higher in introns than in exons. Some of the repeats are present in regulatory regions and retained introns. Human TACC genes show conservation of many repeat classes. Microsatellites in TACC genes could be valuable markers for monitoring numerical chromosomal aberrations and or cancer.

  10. Survey of simple sequence repeats in woodland strawberry (Fragaria vesca).

    Science.gov (United States)

    Guan, L; Huang, J F; Feng, G Q; Wang, X W; Wang, Y; Chen, B Y; Qiao, Y S

    2013-07-30

    The use of simple sequence repeats (SSRs), or microsatellites, as genetic markers has become popular due to their abundance and variation in length among individuals. In this study, we investigated linkage groups (LGs) in the woodland strawberry (Fragaria vesca) and demonstrated variation in the abundances, densities, and relative densities of mononucleotide, dinucleotide, and trinucleotide repeats. Mononucleotide, dinucleotide, and trinucleotide repeats were more common than longer repeats in all LGs examined. Perfect SSRs were the predominant SSR type found and their abundance was extremely stable among LGs and chloroplasts. Abundances of mononucleotide, dinucleotide, and trinucleotide repeats were positively correlated with LG size, whereas those of tetranucleotide and hexanucleotide SSRs were not. Generally, in each LG, the abundance, relative abundance, relative density, and the proportion of each unique SSR all declined rapidly as the repeated unit increased. Furthermore, the lengths and frequencies of SSRs varied among different LGs.

  11. Quasimonomorphic Mononucleotide Repeats for High-Level Microsatellite Instability Analysis

    Directory of Open Access Journals (Sweden)

    Olivier Buhard

    2004-01-01

    Full Text Available Microsatellite instability (MSI analysis is becoming more and more important to detect sporadic primary tumors of the MSI phenotype as well as in helping to determine Hereditary Non-Polyposis Colorectal Cancer (HNPCC cases. After some years of conflicting data due to the absence of consensus markers for the MSI phenotype, a meeting held in Bethesda to clarify the situation proposed a set of 5 microsatellites (2 mononucleotide repeats and 3 dinucleotide repeats to determine MSI tumors. A second Bethesda consensus meeting was held at the end of 2002. It was discussed here that the 1998 microsatellite panel could underestimate high-level MSI tumors and overestimate low-level MSI tumors. Amongst the suggested changes was the exclusive use of mononucleotide repeats in place of dinucleotide repeats. We have already proposed a pentaplex MSI screening test comprising 5 quasimonomorphic mononucleotide repeats. This article compares the advantages of mono or dinucleotide repeats in determining microsatellite instability.

  12. Zinc-finger directed double-strand breaks within CAG repeat tracts promote repeat instability in human cells.

    Science.gov (United States)

    Mittelman, David; Moye, Christopher; Morton, Jason; Sykoudis, Kristen; Lin, Yunfu; Carroll, Dana; Wilson, John H

    2009-06-16

    Expanded triplet repeats have been identified as the genetic basis for a growing number of neurological and skeletal disorders. To examine the contribution of double-strand break repair to CAG x CTG repeat instability in mammalian systems, we developed zinc finger nucleases (ZFNs) that recognize and cleave CAG repeat sequences. Engineered ZFNs use a tandem array of zinc fingers, fused to the FokI DNA cleavage domain, to direct double-strand breaks (DSBs) in a site-specific manner. We first determined that the ZFNs cleave CAG repeats in vitro. Then, using our previously described tissue culture assay for identifying modifiers of CAG repeat instability, we found that transfection of ZFN-expression vectors induced up to a 15-fold increase in changes to the CAG repeat in human and rodent cell lines, and that longer repeats were much more sensitive to cleavage than shorter ones. Analysis of individual colonies arising after treatment revealed a spectrum of events consistent with ZFN-induced DSBs and dominated by repeat contractions. We also found that expressing a dominant-negative form of RAD51 in combination with a ZFN, dramatically reduced the effect of the nuclease, suggesting that DSB-induced repeat instability is mediated, in part, through homology directed repair. These studies identify a ZFN as a useful reagent for characterizing the effects of DSBs on CAG repeats in cells.

  13. Assembly of Repeat Content Using Next Generation Sequencing Data

    Energy Technology Data Exchange (ETDEWEB)

    labutti, Kurt; Kuo, Alan; Grigoriev, Igor; Copeland, Alex

    2014-03-17

    Repetitive organisms pose a challenge for short read assembly, and typically only unique regions and repeat regions shorter than the read length, can be accurately assembled. Recently, we have been investigating the use of Pacific Biosciences reads for de novo fungal assembly. We will present an assessment of the quality and degree of repeat reconstruction possible in a fungal genome using long read technology. We will also compare differences in assembly of repeat content using short read and long read technology.

  14. Neuropathological diagnosis and CAG repeat expansion in Huntington's disease.

    OpenAIRE

    Xuereb, J H; MacMillan, J C; Snell, R; Davies, P.; Harper, P S

    1996-01-01

    OBJECTIVE--To correlate the degree of CAG repeat expansion with neuropathological findings in Huntington's disease. METHODS--The CAG repeat polymorphism was analysed in a large series of brain samples from 268 patients with a clinical diagnosis of Huntington's disease in which full neuropathological data was available. RESULTS--Analysis by polymerase chain reaction was successful in 63% of samples (169 of 268). Repeat expansions were detected in 152 of 153 (99%) samples with a neuropathologic...

  15. The evolution of filamin – A protein domain repeat perspective

    OpenAIRE

    Light, Sara; Sagit, Rauan; Ithychanda, Sujay S.; Qin, Jun; Elofsson, Arne

    2012-01-01

    Particularly in higher eukaryotes, some protein domains are found in tandem repeats, performing broad functions often related to cellular organization. For instance, the eukaryotic protein filamin interacts with many proteins and is crucial for the cytoskeleton. The functional properties of long repeat domains are governed by the specific properties of each individual domain as well as by the repeat copy number. To provide better understanding of the evolutionary and functional history of rep...

  16. Repeated fecal microbiota transplantation in a child with ulcerative colitis.

    Science.gov (United States)

    Shimizu, Hirotaka; Arai, Katsuhiro; Abe, Jun; Nakabayashi, Kazuhiko; Yoshioka, Takako; Hosoi, Kenji; Kuroda, Makoto

    2016-08-01

    We report the case of an 11-year-old girl with ulcerative colitis refractory to conventional therapy, who was subsequently treated successfully with repeated fecal microbiota transplantation (FMT). The patient was steroid dependent despite several infliximab treatments, and colectomy was proposed to improve quality of life. After repeated FMT, she was able to maintain remission with on minimal dose of steroid. Although her fecal microbiota was dysbiotic before FMT, it was restored to a similar pattern as the donor after repeated FMT.

  17. Artificial leucine rich repeats as new scaffolds for protein design.

    Science.gov (United States)

    Baabur-Cohen, Hemda; Dayalan, Subashini; Shumacher, Inbal; Cohen-Luria, Rivka; Ashkenasy, Gonen

    2011-04-15

    The leucine rich repeat (LRR) motif that participates in many biomolecular recognition events in cells was suggested as a general scaffold for producing artificial receptors. We describe here the design and first total chemical synthesis of small LRR proteins, and their structural analysis. When evaluating the tertiary structure as a function of different number of repeating units (1-3), we were able to find that the 3-repeats sequence, containing 90 amino acids, folds into the expected structure.

  18. Coexistence of 3G repeaters with LTE base stations.

    Science.gov (United States)

    Yeo, Woon-Young; Lee, Sang-Min; Hwang, Gyung-Ho; Kim, Jae-Hoon

    2013-01-01

    Repeaters have been an attractive solution for mobile operators to upgrade their wireless networks at low cost and to extend network coverage effectively. Since the first LTE commercial deployment in 2009, many mobile operators have launched LTE networks by upgrading their 3G and legacy networks. Because all 3G frequency bands are shared with the frequency bands for LTE deployment and 3G mobile operators have an enormous number of repeaters, reusing 3G repeaters in LTE networks is definitely a practical and cost-efficient solution. However, 3G repeaters usually do not support spatial multiplexing with multiple antennas, and thus it is difficult to reuse them directly in LTE networks. In order to support spatial multiplexing of LTE, the role of 3G repeaters should be replaced with small LTE base stations or MIMO-capable repeaters. In this paper, a repeater network is proposed to reuse 3G repeaters in LTE deployment while still supporting multilayer transmission of LTE. Interestingly, the proposed network has a higher cluster throughput than an LTE network with MIMO-capable repeaters.

  19. Mononucleotide repeats are asymmetrically distributed in fungal genes

    Directory of Open Access Journals (Sweden)

    de Graaff Leo H

    2008-12-01

    Full Text Available Abstract Background Systematic analyses of sequence features have resulted in a better characterisation of the organisation of the genome. A previous study in prokaryotes on the distribution of sequence repeats, which are notoriously variable and can disrupt the reading frame in genes, showed that these motifs are skewed towards gene termini, specifically the 5' end of genes. For eukaryotes no such intragenic analysis has been performed, though this could indicate the pervasiveness of this distribution bias, thereby helping to expose the selective pressures causing it. Results In fungal gene repertoires we find a similar 5' bias of intragenic mononucleotide repeats, most notably for Candida spp., whereas e.g. Coccidioides spp. display no such bias. With increasing repeat length, ever larger discrepancies are observed in genome repertoire fractions containing such repeats, with up to an 80-fold difference in gene fractions at repeat lengths of 10 bp and longer. This species-specific difference in gene fractions containing large repeats could be attributed to variations in intragenic repeat tolerance. Furthermore, long transcripts experience an even more prominent bias towards the gene termini, with possibly a more adaptive role for repeat-containing short transcripts. Conclusion Mononucleotide repeats are intragenically biased in numerous fungal genomes, similar to earlier studies on prokaryotes, indicative of a similar selective pressure in gene organization.

  20. Huntington's disease as caused by 34 CAG repeats.

    Science.gov (United States)

    Andrich, Jürgen; Arning, Larissa; Wieczorek, Stefan; Kraus, Peter H; Gold, Ralf; Saft, Carsten

    2008-04-30

    Huntington's disease (HD) is an autosomal dominantly inherited neurodegenerative disorder caused by an abnormal expansion of a polymorphic stretch of CAG repeats in the coding 5' part of the HD gene on chromosome 4p. Expansions of CAG blocks beyond 35 repeats are associated with the clinical presentation of HD. There is an intermediate range of rare alleles between 27 and 35 CAG repeats with a higher risk for further expansion in subsequent generations. Here, we report a 75-year-old male with clinical features of HD and 34 CAG repeat units.

  1. Intragenic tandem repeat variation between Legionella pneumophila strains

    Directory of Open Access Journals (Sweden)

    Jarraud Sophie

    2008-12-01

    Full Text Available Abstract Background Bacterial genomes harbour a large number of tandem repeats, yet the possible phenotypic effects of those found within the coding region of genes are only beginning to be examined. Evidence exists from other organisms that these repeats can be involved in the evolution of new genes, gene regulation, adaptation, resistance to environmental stresses, and avoidance of the immune system. Results In this study, we have investigated the presence and variability in copy number of intragenic tandemly repeated sequences in the genome of Legionella pneumophila, the etiological agent of a severe pneumonia known as Legionnaires' disease. Within the genome of the Philadelphia strain, we have identified 26 intragenic tandem repeat sequences using conservative selection criteria. Of these, seven were "polymorphic" in terms of repeat copy number between a large number of L. pneumophila serogroup 1 strains. These strains were collected from a wide variety of environments and patients in several geographical regions. Within this panel of strains, all but one of these seven genes exhibited statistically different patterns in repeat copy number between samples from different origins (environmental, clinical, and hot springs. Conclusion These results support the hypothesis that intragenic tandem repeats could play a role in virulence and adaptation to different environments. While tandem repeats are an increasingly popular focus of molecular typing studies in prokaryotes, including in L. pneumophila, this study is the first examining the difference in tandem repeat distribution as a function of clinical or environmental origin.

  2. Genus-specific protein binding to the large clusters of DNA repeats (short regularly spaced repeats) present in Sulfolobus genomes

    DEFF Research Database (Denmark)

    Peng, Xu; Brügger, Kim; Shen, Biao

    2003-01-01

    Short regularly spaced repeats (SRSRs) occur in multiple large clusters in archaeal chromosomes and as smaller clusters in some archaeal conjugative plasmids and bacterial chromosomes. The sequence, size, and spacing of the repeats are generally constant within a cluster but vary between clusters...... that are identical in sequence to one of the repeat variants in the S. solfataricus chromosome. Repeats from the pNOB8 cluster were amplified and tested for protein binding with cell extracts from S. solfataricus. A 17.5-kDa SRSR-binding protein was purified from the cell extracts and sequenced. The protein is N...... terminally modified and corresponds to SSO454, an open reading frame of previously unassigned function. It binds specifically to DNA fragments carrying double and single repeat sequences, binding on one side of the repeat structure, and producing an opening of the opposite side of the DNA structure. It also...

  3. Extracellular-signal regulated kinase (Erk1/2), mitogen-activated protein kinase-activated protein kinase 2 (MK2) and tristetraprolin (TTP) comprehensively regulate injury-induced immediate early gene (IEG) response in in vitro liver organ culture.

    Science.gov (United States)

    Tran, Doan Duy Hai; Koch, Alexandra; Saran, Shashank; Armbrecht, Marcel; Ewald, Florian; Koch, Martina; Wahlicht, Tom; Wirth, Dagmar; Braun, Armin; Nashan, Björn; Gaestel, Matthias; Tamura, Teruko

    2016-05-01

    Differentiated hepatocytes are long-lived and normally do not undergo cell division, however they have the unique capacity to autonomously decide their replication fate after liver injury. In this context, the key players of liver regeneration immediately after injury have not been adequately studied. Using an in vitro liver culture system, we show that after liver injury, p38 mitogen-activated protein kinase (p38MAPK), mitogen-activated protein kinase-activated protein kinase 2 (MK2) and extracellular-signal regulated kinase (Erk)1/2 were activated within 15 min and continued to be phosphorylated for more than 2h. Both p38MAPK and Erk1/2 were activated at the edge of the cut as well as on the liver surface where the mesothelial cell sheet expresses several cytokines. Notably, in human liver Erk1/2 was also activated under the mesothelial cell sheet shortly after liver resections. Furthermore, in in vitro liver slice culture immediate early genes (IEGs) were upregulated within 1-2 h and the S phase marker proliferation-cell-nuclear-antigen (PCNA) appeared 24 h after injury. Although Erk1/2 was activated after injury, in MK2 depleted liver a set of IEGs, such as Dusp1, Cox2, or c-Myc and proliferation marker gene Ki67 were not induced. In addition, in immortalized hepatocyte cells, THLE-2, the same subset of genes was upregulated upon stimulation with lipopolysaccharide (LPS), but not in the presence of MK2 inhibitor. The protein level of tristetraprolin (TTP), a substrate for MK2 that plays a role in mRNA degradation, was increased in the presence of MK2 inhibitor. In this context, the depletion of TTP gene rescued Dusp1, Cox2, or c-Myc upregulation in the presence of MK2 inhibitor. These data imply that MK2 pathway is positively involved in Erk1/2 induced IEG response after liver injury. These data also suggest that in vitro liver culture may be a useful tool for measuring the proliferation potential of hepatocytes in individual liver.

  4. Cardiorespiratory Coordination in Repeated Maximal Exercise

    Directory of Open Access Journals (Sweden)

    Sergi Garcia-Retortillo

    2017-06-01

    Full Text Available Increases in cardiorespiratory coordination (CRC after training with no differences in performance and physiological variables have recently been reported using a principal component analysis approach. However, no research has yet evaluated the short-term effects of exercise on CRC. The aim of this study was to delineate the behavior of CRC under different physiological initial conditions produced by repeated maximal exercises. Fifteen participants performed 2 consecutive graded and maximal cycling tests. Test 1 was performed without any previous exercise, and Test 2 6 min after Test 1. Both tests started at 0 W and the workload was increased by 25 W/min in males and 20 W/min in females, until they were not able to maintain the prescribed cycling frequency of 70 rpm for more than 5 consecutive seconds. A principal component (PC analysis of selected cardiovascular and cardiorespiratory variables (expired fraction of O2, expired fraction of CO2, ventilation, systolic blood pressure, diastolic blood pressure, and heart rate was performed to evaluate the CRC defined by the number of PCs in both tests. In order to quantify the degree of coordination, the information entropy was calculated and the eigenvalues of the first PC (PC1 were compared between tests. Although no significant differences were found between the tests with respect to the performed maximal workload (Wmax, maximal oxygen consumption (VO2 max, or ventilatory threshold (VT, an increase in the number of PCs and/or a decrease of eigenvalues of PC1 (t = 2.95; p = 0.01; d = 1.08 was found in Test 2 compared to Test 1. Moreover, entropy was significantly higher (Z = 2.33; p = 0.02; d = 1.43 in the last test. In conclusion, despite the fact that no significant differences were observed in the conventionally explored maximal performance and physiological variables (Wmax, VO2 max, and VT between tests, a reduction of CRC was observed in Test 2. These results emphasize the interest of CRC

  5. Cardiorespiratory Coordination in Repeated Maximal Exercise.

    Science.gov (United States)

    Garcia-Retortillo, Sergi; Javierre, Casimiro; Hristovski, Robert; Ventura, Josep L; Balagué, Natàlia

    2017-01-01

    Increases in cardiorespiratory coordination (CRC) after training with no differences in performance and physiological variables have recently been reported using a principal component analysis approach. However, no research has yet evaluated the short-term effects of exercise on CRC. The aim of this study was to delineate the behavior of CRC under different physiological initial conditions produced by repeated maximal exercises. Fifteen participants performed 2 consecutive graded and maximal cycling tests. Test 1 was performed without any previous exercise, and Test 2 6 min after Test 1. Both tests started at 0 W and the workload was increased by 25 W/min in males and 20 W/min in females, until they were not able to maintain the prescribed cycling frequency of 70 rpm for more than 5 consecutive seconds. A principal component (PC) analysis of selected cardiovascular and cardiorespiratory variables (expired fraction of O2, expired fraction of CO2, ventilation, systolic blood pressure, diastolic blood pressure, and heart rate) was performed to evaluate the CRC defined by the number of PCs in both tests. In order to quantify the degree of coordination, the information entropy was calculated and the eigenvalues of the first PC (PC1) were compared between tests. Although no significant differences were found between the tests with respect to the performed maximal workload (Wmax), maximal oxygen consumption (VO2 max), or ventilatory threshold (VT), an increase in the number of PCs and/or a decrease of eigenvalues of PC1 (t = 2.95; p = 0.01; d = 1.08) was found in Test 2 compared to Test 1. Moreover, entropy was significantly higher (Z = 2.33; p = 0.02; d = 1.43) in the last test. In conclusion, despite the fact that no significant differences were observed in the conventionally explored maximal performance and physiological variables (Wmax, VO2 max, and VT) between tests, a reduction of CRC was observed in Test 2. These results emphasize the interest of CRC evaluation in

  6. Turkish population data on the short tandem repeat locus TPOX

    DEFF Research Database (Denmark)

    Vural, B; Poda, M; Atlioglu, E;

    1998-01-01

    Allele and genotype frequencies were determined for the STR (short tandem repeat) locus TPOX in a random Turkish population sample of 200 individuals.......Allele and genotype frequencies were determined for the STR (short tandem repeat) locus TPOX in a random Turkish population sample of 200 individuals....

  7. PILER-CR: Fast and accurate identification of CRISPR repeats

    Directory of Open Access Journals (Sweden)

    Edgar Robert C

    2007-01-01

    Full Text Available Abstract Background Sequencing of prokaryotic genomes has recently revealed the presence of CRISPR elements: short, highly conserved repeats separated by unique sequences of similar length. The distinctive sequence signature of CRISPR repeats can be found using general-purpose repeat- or pattern-finding software tools. However, the output of such tools is not always ideal for studying these repeats, and significant effort is sometimes needed to build additional tools and perform manual analysis of the output. Results We present PILER-CR, a program specifically designed for the identification and analysis of CRISPR repeats. The program executes rapidly, completing a 5 Mb genome in around 5 seconds on a current desktop computer. We validate the algorithm by manual curation and by comparison with published surveys of these repeats, finding that PILER-CR has both high sensitivity and high specificity. We also present a catalogue of putative CRISPR repeats identified in a comprehensive analysis of 346 prokaryotic genomes. Conclusion PILER-CR is a useful tool for rapid identification and classification of CRISPR repeats. The software is donated to the public domain. Source code and a Linux binary are freely available at http://www.drive5.com/pilercr.

  8. Repeatable mechanochemical activation of dynamic covalent bonds in thermoplastic elastomers.

    Science.gov (United States)

    Imato, Keiichi; Kanehara, Takeshi; Nojima, Shiki; Ohishi, Tomoyuki; Higaki, Yuji; Takahara, Atsushi; Otsuka, Hideyuki

    2016-08-18

    Repeated mechanical scission and recombination of dynamic covalent bonds incorporated in segmented polyurethane elastomers are demonstrated by utilizing a diarylbibenzofuranone-based mechanophore and by the design of the segmented polymer structures. The repeated mechanochemical reactions can accompany clear colouration and simultaneous fading.

  9. PCR-free digital minisatellite tandem repeat genotyping.

    Science.gov (United States)

    Chen, Yuchao; Seo, Tae Seok

    2011-06-01

    We demonstrated a proof-of-concept for novel minisatellite tandem repeat typing, called PCR-free digital VNTR (variable number tandem repeat) typing, which is composed of three steps: a ligation reaction instead of PCR thermal cycling, magnetic bead-based solid-phase capture for purification, and an elongated sample stacking microcapillary electrophoresis (μCE) for sensitive digital coding of repeat number. We designed a 16-bp fluorescently labeled ligation probe which is complementary to a repeat unit of a biotinylated synthetic template mimicking the human D1S80 VNTR locus and is randomly hybridized with the minisatellite tandem repeats. A quick isothermal ligation reaction was followed to link the adjacent ligation probes on the DNA templates, and then the ligated products were purified by streptavidin-coated magnetic beads. After a denaturing step, a large amount of ligated products whose size difference was equivalent to the repeat unit were released and recovered. Through the elongated sample stacking μCE separation on a microdevice, the fluorescence signal of the ligated products was generated in the electropherogram and the peak number was directly counted which was exactly matched with the repeat number of VNTR locus. We could successfully identify the minisatellite tandem repeat number with only 5 fmol of DNA template in 30 min.

  10. Development of Repeated Sprint Ability in Talented Youth Basketball Players

    NARCIS (Netherlands)

    te Wierike, Sanne C. M.; de Jong, Mark C.; Tromp, Eveline J. Y.; Vuijk, Pieter J.; Lemmink, Koen A. P. M.; Malina, Robert M.; Elferink-Gemser, Marije T.; Visscher, Chris

    te Wierike, SCM, de Jong, MC, Tromp, EJY, Vuijk, PJ, Lemmink, KAPM, Malina, RM, Elferink-Gemser, MT, and Visscher, C. Development of repeated sprint ability in talented youth basketball players. J Strength Cond Res 28(4): 928-934, 2014-Factors affecting repeated sprint ability (RSA) were evaluated

  11. Vocabulary Learning through Assisted and Unassisted Repeated Reading

    Science.gov (United States)

    Webb, Stuart; Chang, Anna C-S.

    2012-01-01

    Previous research investigating the effects of unassisted and assisted repeated reading has primarily focused on how each approach may contribute to improvement in reading comprehension and fluency. Incidental learning of the form and meaning of unknown or partially known words encountered through assisted and unassisted repeated reading has yet…

  12. Impact of Inclusion or Exclusion of Repeaters on Test Equating

    Science.gov (United States)

    Puhan, Gautam

    2011-01-01

    This study examined the effect of including or excluding repeaters on the equating process and results. New forms of two tests were equated to their respective old forms using either all examinees or only the first timer examinees in the new form sample. Results showed that for both tests used in this study, including or excluding repeaters in the…

  13. Effect of Repeated Simulations by Standardized Patients on Intercase Reliability.

    Science.gov (United States)

    Colliver, Jerry A.; And Others

    1991-01-01

    A study using five Southern Illinois University senior medical school classes (n=350 students) investigated whether having a standardized patient simulate a case repeatedly in postclerkship medical student evaluation affects the measure's reliability. Results suggest that repeated simulation had little or no effect on intercase reliability of…

  14. Analysis of CR1 Repeats in the Zebra Finch Genome

    Directory of Open Access Journals (Sweden)

    George E. Liu

    2013-06-01

    Full Text Available Most bird species have smaller genomes and fewer repeats than mammals. Chicken Repeat 1 (CR1 repeat is one of the most abundant families of repeats, ranging from ~133,000 to ~187,000 copies accounting for ~50 to ~80% of the interspersed repeats in the zebra finch and chicken genomes, respectively. CR1 repeats are believed to have arisen from the retrotransposition of a small number of master elements, which gave rise to multiple CR1 subfamilies in the chicken. In this study, we performed a global assessment of the divergence distributions, phylogenies, and consensus sequences of CR1 repeats in the zebra finch genome. We identified and validated 34 CR1 subfamilies and further analyzed the correlation between these subfamilies. We also discovered 4 novel lineage-specific CR1 subfamilies in the zebra finch when compared to the chicken genome. We built various evolutionary trees of these subfamilies and concluded that CR1 repeats may play an important role in reshaping the structure of bird genomes.

  15. Repeated Witnessing of Conspecifics in Pain : Effects on Emotional Contagion

    NARCIS (Netherlands)

    Carrillo, Maria; Migliorati, Filippo; Bruls, Rune; Han, Yingying; Heinemans, Mirjam; Pruis, Ilanah; Gazzola, V.; Keysers, C.

    2015-01-01

    Witnessing of conspecifics in pain has been shown to elicit socially triggered freezing in rodents. It is unknown how robust this response is to repeated exposure to a cage-mate experiencing painful stimulation. To address this question, shock-experienced Observer rats repeatedly witnessed familiar

  16. Secret key rates for an encoded quantum repeater

    Science.gov (United States)

    Bratzik, Sylvia; Kampermann, Hermann; Bruß, Dagmar

    2014-03-01

    We investigate secret key rates for the quantum repeater using encoding [L. Jiang et al., Phys. Rev. A 79, 032325 (2009), 10.1103/PhysRevA.79.032325] and compare them to the standard repeater scheme by Briegel, Dür, Cirac, and Zoller. The former scheme has the advantage of a minimal consumption of classical communication. We analyze the trade-off in the secret key rate between the communication time and the required resources. For this purpose we introduce an error model for the repeater using encoding which allows for input Bell states with a fidelity smaller than one, in contrast to the model given by L. Jiang et al. [Phys. Rev. A 79, 032325 (2009), 10.1103/PhysRevA.79.032325]. We show that one can correct additional errors in the encoded connection procedure of this repeater and develop a suitable decoding algorithm. Furthermore, we derive the rate of producing entangled pairs for the quantum repeater using encoding and give the minimal parameter values (gate quality and initial fidelity) for establishing a nonzero secret key. We find that the generic quantum repeater is optimal regarding the secret key rate per memory per second and show that the encoded quantum repeater using the simple three-qubit repetition code can even have an advantage with respect to the resources compared to other recent quantum repeater schemes with encoding.

  17. CTG trinucleotide repeat "big jumps": large expansions, small mice.

    Directory of Open Access Journals (Sweden)

    Mário Gomes-Pereira

    2007-04-01

    Full Text Available Trinucleotide repeat expansions are the genetic cause of numerous human diseases, including fragile X mental retardation, Huntington disease, and myotonic dystrophy type 1. Disease severity and age of onset are critically linked to expansion size. Previous mouse models of repeat instability have not recreated large intergenerational expansions ("big jumps", observed when the repeat is transmitted from one generation to the next, and have never attained the very large tract lengths possible in humans. Here, we describe dramatic intergenerational CTG*CAG repeat expansions of several hundred repeats in a transgenic mouse model of myotonic dystrophy type 1, resulting in increasingly severe phenotypic and molecular abnormalities. Homozygous mice carrying over 700 trinucleotide repeats on both alleles display severely reduced body size and splicing abnormalities, notably in the central nervous system. Our findings demonstrate that large intergenerational trinucleotide repeat expansions can be recreated in mice, and endorse the use of transgenic mouse models to refine our understanding of triplet repeat expansion and the resulting pathogenesis.

  18. Development of Repeated Sprint Ability in Talented Youth Basketball Players

    NARCIS (Netherlands)

    te Wierike, Sanne C. M.; de Jong, Mark C.; Tromp, Eveline J. Y.; Vuijk, Pieter J.; Lemmink, Koen A. P. M.; Malina, Robert M.; Elferink-Gemser, Marije T.; Visscher, Chris

    2014-01-01

    te Wierike, SCM, de Jong, MC, Tromp, EJY, Vuijk, PJ, Lemmink, KAPM, Malina, RM, Elferink-Gemser, MT, and Visscher, C. Development of repeated sprint ability in talented youth basketball players. J Strength Cond Res 28(4): 928-934, 2014-Factors affecting repeated sprint ability (RSA) were evaluated i

  19. Monotone missing data and repeated controls of fallible authors

    NARCIS (Netherlands)

    Raats, V.M.

    2004-01-01

    Chapters 2 and 3 focus on repeated audit controls with categorical variables. Chapter 4 and 5 introduce and analyse a very general multivariate regression model for (monotone) missing data. In the final Chapter 6 the previous chapters are combined into a more realistic model for repeated audit contr

  20. Development of Repeated Sprint Ability in Talented Youth Basketball Players

    NARCIS (Netherlands)

    te Wierike, Sanne C. M.; de Jong, Mark C.; Tromp, Eveline J. Y.; Vuijk, Pieter J.; Lemmink, Koen A. P. M.; Malina, Robert M.; Elferink-Gemser, Marije T.; Visscher, Chris

    2014-01-01

    te Wierike, SCM, de Jong, MC, Tromp, EJY, Vuijk, PJ, Lemmink, KAPM, Malina, RM, Elferink-Gemser, MT, and Visscher, C. Development of repeated sprint ability in talented youth basketball players. J Strength Cond Res 28(4): 928-934, 2014-Factors affecting repeated sprint ability (RSA) were evaluated i

  1. Contraceptive Use among Women Seeking Repeat Abortion in ...

    African Journals Online (AJOL)

    AJRH Managing Editor

    Compared with women seeking their first abortion, significantly more repeat abortion clients had ever used ... social sigma24, repeat abortion may be as well, perhaps even .... 0.1198. aIncludes hostess, cleaner, waitress, housemaid, commercial sex worker, and cook ..... be made to support the process by strengthening.

  2. Witness recall across repeated interviews in a case of repeated abuse.

    Science.gov (United States)

    Brubacher, Sonja P; La Rooy, David

    2014-02-01

    In this illustrative case study we examine the three forensic interviews of a girl who experienced repeated sexual abuse from ages 7 to 11. She disclosed the abuse after watching a serialized television show that contained a storyline similar to her own experience. This triggered an investigation that ended in successful prosecution of the offender. Because this case involved abuse that was repeated on a weekly basis for 4 years we thus investigated the degree to which the child's narrative reflected specific episodes or generic accounts, and both the interviewer's and child's attempts to elicit and provide, respectively, specific details across the 3 interviews collected in a 1 month period. Across the 3 interviews, the child's account was largely generic, yet on a number of occasions she provided details specific to individual incidents (episodic leads) that could have been probed further. As predicted: earlier interviews were characterized more by episodic than generic prompts and the reverse was true for the third interview; the child often responded using the same style of language (episodic or generic) as the interviewer; and open questions yielded narrative information. We discuss the importance of adopting children's words to specify occurrences, and the potential benefits of permitting generic recall in investigative interviews on children's ability to provide episodic leads. Despite the fact that the testimony was characterized by generic information about what usually happened, rather than specific episodic details about individual occurrences, this case resulted in successful prosecution.

  3. Effects of 3-repeat tau on taxol mobility through microtubules

    Science.gov (United States)

    Park, Hyunjoo; Fygenson, Deborah; Kim, Mahn Won

    2005-03-01

    Both the anti-cancer drug taxol and the microtubule-associated protein tau suppress dynamics of microtubules (MT). We have observed taxol mobility with full-length 3-repeat tau, one of six tau isoforms, using fluorescence recovery after photobleaching (FRAP) on MTs and compare with earlier results on recombinant full-length adult 4-repeat tau. Taxol mobility becomes highly sensitive to taxol concentration in the presence of 3-repeat tau (up to 1:1 molar ratio) as it does in the presence of 4-repeat tau, but is 2 to 3 times faster at low taxol concentrations. Fitting to a mean-field binding reaction model [J.L. Ross et.al, PNAS 101:12910-5 (2004)] suggests that the presence of 3-repeat tau enhances taxol movement through pores in the MT walls.

  4. Consistency of Repeated Naming in Aphasia

    Directory of Open Access Journals (Sweden)

    Elizabeth E. Galletta

    2015-09-01

    Full Text Available Background People with mild aphasia and healthy elderly often exhibit similar impairments on language tests of word retrieval. However, variable practice effects in object naming by three individuals with aphasia compared to young and elderly adults have been reported (Wingfield et al. 2006. Wingfield et al. (2006 found that naming of the same pictures of objects over five trials demonstrated decreasing response latencies over repeated trials for both older and younger adults, but not for individuals with aphasia. In fact, among their three participants with aphasia, response latencies in the consecutive trials differed considerably. The authors suggested that different underlying processes may be involved in word retrieval for people with aphasia compared to adults without brain injuries. In our study we aimed to further consider the effect of practice on both object and action naming in individuals with mild aphasia. Method One woman with anomic aphasia (age 38 years; WAB Aphasia Quotient = 88 and one healthy woman (age 25 years participated. Both were native English speakers and reported 18 years of formal education. Participants were tested individually, with a set of 27 object pictures and a set of 27 action pictures presented one at a time on a computer screen. The participants were instructed to name each picture as quickly as possible as soon as each picture appeared on the screen. There were 10 trials of each set of pictures, with different random orders for each trial. The order of presentation of the object and action picture sets alternated across participants. Naming responses were recorded to computer sound files for later measurements of response latencies. A brief tone was presented simultaneous with the picture onset, allowing later measurement of response latencies from the onset of picture presentation to the onset of the participant’s correct response. Results Our findings resembled those reported in Wingfield et al. (2006

  5. CAG trinucleotide RNA repeats interact with RNA-binding proteins

    Energy Technology Data Exchange (ETDEWEB)

    McLaughlin, B.A.; Eberwine, J.; Spencer, C. [Univ. of Pennsylvania, Philadelphia, PA (United States)

    1996-09-01

    Genes associated with several neurological diseases are characterized by the presence of an abnormally long trinucleotide repeat sequence. By way of example, Huntington`s disease (HD), is characterized by selective neuronal degeneration associated with the expansion of a polyglutamine-encoding CAG tract. Normally, this CAG tract is comprised of 11-34 repeats, but in HD it is expanded to >37 repeats in affected individuals. The mechanism by which CAG repeats cause neuronal degeneration is unknown, but it has been speculated that the expansion primarily causes abnormal protein functioning, which in turn causes HD pathology. Other mechanisms, however, have not been ruled out. Interactions between RNA and RNA-binding proteins have previously been shown to play a role in the expression of several eukaryotic genes. Herein, we report the association of cytoplasmic proteins with normal length and extended CAG repeats, using gel shift and LJV crosslinking assays. Cytoplasmic protein extracts from several rat brain regions, including the striatum and cortex, sites of neuronal degeneration in HD, contain a 63-kD RNA-binding protein that specifically interacts with these CAG-repeat sequences. These protein-RNA interactions are dependent on the length of the CAG repeat, with longer repeats binding substantially more protein. Two CAG repeat-binding proteins are present in human cortex and striatum; one comigrates with the rat protein at 63 kD, while the other migrates at 49 kD. These data suggest mechanisms by which RNA-binding proteins may be involved in the pathological course of trinucleotide repeat-associated neurological diseases. 47 refs., 5 figs.

  6. Repeatability Evaluation of Finger Tapping Device with Magnetic Sensors

    Science.gov (United States)

    Sano, Yuko; Kandori, Akihiko; Shima, Keisuke; Tamura, Yasuhiro; Takagi, Hiroshi; Tsuji, Toshio; Noda, Masafumi; Higashikawa, Fumiko; Yokoe, Masaru; Sakoda, Saburo

    We tested the repeatability of a finger tapping device with magnetic sensors to determine its reliability. This device, which was developed to assist in the diagnosis of movement disorders such as Parkinson's disease (PD) and strokes, measures the distance between the first and index fingers during finger tapping movements (opening and closing the fingers repeatedly). We evaluated three types of repeatability based on ICC (interclass correlation coefficient) and Welch's test (test for equal means in a oneway layout): repeatability when measured at different times, when using different devices, and when using different measurers. We calculated these three types for three finger tapping tasks on both hands for 21 characteristics calculated from finger tapping waveforms. Results demonstrated that the repeatability when using different devices is high regardless of the task or hand. The repeatability when measuring at different times and when using different measurers is high at some tasks, but not all. One of the finger tapping tasks (finger tapping movement with the largest amplitude and highest velocity), which is used in a conventional PD diagnosis method (UPDRS), does not have enough repeatability, while other tasks show high repeatability. Results also showed that five characteristics have the highest repeatability (ICC ≥ 0.5 or significance probability of Welch's test ≥ 5% in all tasks): “total moving distance,” “average of local minimum acceleration in opening motion,” “average of local minimum acceleration in closing motion,” “average of local maximum distance” and “average of local minimum velocity”. These results clearly demonstrate the strong repeatability of this device and lead to more precise diagnosis of movement disorders.

  7. Strategy When Faced with Failure: Persistence and Degree Attainment of Course Repeaters versus Non-Repeaters. AIR 2002 Forum Paper.

    Science.gov (United States)

    Fenton, Kathleen S.

    Graduation and persistence rates were compared for 184 students, 92 of whom had repeated multiple courses or at least 1 course 3 times. A control group of 92 nonrepeating students was drawn from the remaining 303 students of the entire 1996 cohort. There was no difference between the graduation rate of repeaters and nonrepeaters. The persistence…

  8. Peptide substrates for Rho-associated kinase 2 (Rho-kinase 2/ROCK2.

    Directory of Open Access Journals (Sweden)

    Jeong-Hun Kang

    Full Text Available Peptide substrates sensitive for a certain protein kinase could be important for new-drug development and to understand the mechanism of diseases. Rho-associated kinase (Rho-kinase/ROCK is a serine/threonine kinase, and plays an important part in cardiovascular disease, migration and invasion of tumor cells, and in neurological disorders. The purpose of this study was to find substrates with high affinity and sensitivity for ROCK2. We synthesized 136 peptide substrates from protein substrates for ROCK2 with different lengths and charged peptides. Incorporation of (32P [counts per minute (CPM] for each peptide substrate was determined by the radiolabel assay using [γ-(32P]ATP. When the top five peptide substrates showing high CPMs (R4, R22, R133, R134, and R135 were phosphorylated by other enzymes (PKA, PKCα, and ERK1, R22, R133, and R135 displayed the highest CPM level for ROCK2 compared with other enzymes, whereas R4 and R134 showed similar CPM levels for ROCK2 and PKCα. We hypothesize that R22, R133, and R135 can be useful peptide substrates for ROCK2.

  9. Peptide substrates for Rho-associated kinase 2 (Rho-kinase 2/ROCK2).

    Science.gov (United States)

    Kang, Jeong-Hun; Asai, Daisuke; Tsuchiya, Akira; Mori, Takeshi; Niidome, Takuro; Katayama, Yoshiki

    2011-01-01

    Peptide substrates sensitive for a certain protein kinase could be important for new-drug development and to understand the mechanism of diseases. Rho-associated kinase (Rho-kinase/ROCK) is a serine/threonine kinase, and plays an important part in cardiovascular disease, migration and invasion of tumor cells, and in neurological disorders. The purpose of this study was to find substrates with high affinity and sensitivity for ROCK2. We synthesized 136 peptide substrates from protein substrates for ROCK2 with different lengths and charged peptides. Incorporation of (32)P [counts per minute (CPM)] for each peptide substrate was determined by the radiolabel assay using [γ-(32)P]ATP. When the top five peptide substrates showing high CPMs (R4, R22, R133, R134, and R135) were phosphorylated by other enzymes (PKA, PKCα, and ERK1), R22, R133, and R135 displayed the highest CPM level for ROCK2 compared with other enzymes, whereas R4 and R134 showed similar CPM levels for ROCK2 and PKCα. We hypothesize that R22, R133, and R135 can be useful peptide substrates for ROCK2.

  10. The effect of ataxia-telangiectasia mutated kinase-dependent hyperphosphorylation of checkpoint kinase-2 on oligodeoxynucleotide 7909 containing CpG motifs-enhanced sensitivity to X-rays in human lung adenocarcinoma A549 cells

    Directory of Open Access Journals (Sweden)

    Liu XQ

    2015-06-01

    Full Text Available Xiaoqun Liu,1,* Xiangdong Liu,2,* Tiankui Qiao,1 Wei Chen,1 Sujuan Yuan1 1Department of Oncology, 2Department of Ophthalmology, Affiliated Jinshan Hospital, Fudan University, Shanghai, People’s Republic of China *These authors contributed equally to this work Objective: The aim of the study reported here was to further investigate the potential effect of ataxia-telangiectasia mutated (ATM kinase-dependent hyperphosphorylation of checkpoint kinase-2 (Chk2 on radiosensitivity enhanced by oligodeoxynucleotide 7909 containing CpG motifs (CpG ODN7909 in human lung adenocarcinoma A549 cells. Methods: In vitro A549 cells were randomly separated into control, CpG, X-ray, CpG+X-ray, ATM kinase-small interfering RNA (siRNA+CpG+X-ray (ATM-siRNA, and Chk2-siRNA+CpG+X-ray (Chk2-siRNA groups. siRNAs were adopted to silence the ATM and Chk2 genes. Expression and phosphorylation of ATM kinase and Chk2 were detected by Western blot assay. Cell colonies were observed under inverted phase-contrast microscopy. Cellular survival curves were fitted using a multi-target single-hitting model. Cell cycle and apoptosis were analyzed by flow cytometry. Results: Expression of ATM kinase and Chk2 was similar among the control, CpG, X-ray, and CpG+X-ray groups. Phosphorylated ATM kinase and Chk2 were significantly increased in the CpG+X-ray group compared with in the X-ray group (t=6.00, P<0.01 and t=3.13, P<0.05, respectively, though these were hardly detected in the control and CpG groups. However, expression of ATM kinase and Chk2 was clearly downregulated in the ATM-siRNA and Chk2-siRNA groups, respectively. Similarly, their phosphorylation levels were also significantly decreased in the ATM-siRNA group (t=14.35, P<0.01 and t=8.46, P<0.01, respectively and a significant decrease in phosphorylated Chk2 was observed in the Chk2-siRNA group (t=7.28, P<0.01 when compared with the CpG+X-ray group. Further, the number of A549 cells at Gap 2/mitotic phase and the apoptosis

  11. Repeating earthquakes recorded by Liaoning Regional Seismograph Network

    Institute of Scientific and Technical Information of China (English)

    LI Yu-tong; WU Zhong-liang; JIANG Chang-sheng; LI Guang-ping

    2008-01-01

    In the list of 'repeating pairs' or 'doublets' of earthquakes in China identified by Schaff and Richards using tele-seismic waveform cross-correlation, there were 23 repeating pairs located in Liaoning Province. In this study the waveforms of these events were cross-correlated using records from Liaoning Regional Seismograph Network (LRSN), and the 'repeating events' in the sense of regional waveform cross-correlation were obtained. The result was compared with that of Schaff and Richards and was used for the assessment of the seismic phase picking and event location practice of LRSN. The result shows that 'repeating events' in the sense of teleseismic waveform cross-correlation and those in the sense of regional waveform cross-correlation have significant difference, al-though with some overlap. However, the overall assessment of the location accuracy and the phase pick errors of LRSN by using these two sets of 'repeating events', respectively, provides similar results, while 'repeating events' in the sense of regional waveform cross-correlation seem to be better performing in such an assessment. With the assumption that the separation between the 'repeaters' be less than 1 km, the uncertainty in routine earthquake location of LRSN is estimated to be below 5 km, with the average of 2 km. In the observational bulletins of LRSN the time error in phase picking is estimated to be within±Is for 94% Pg readings and for 88% Sg readings.

  12. Repeat breeding: Incidence, risk factors and diagnosis in buffaloes

    Directory of Open Access Journals (Sweden)

    Chandra Shekher Saraswat

    2016-04-01

    Full Text Available Repeat breeding in buffaloes was evaluated in terms of incidence, risk factors and diagnosis. The incidence of repeat breeding is low in buffaloes however in different studies the incidence varied from 0.70% to 30%. Because of seasonal suppression of fertility repeat breeding in buffaloes should be limited to the breeding season. Spring and winter calving, first parity, peri-parturient disease and lactation are significant risk factors for repeat breeding in buffaloes. The etiologies of repeat breeding in buffaloes can be failure of fertilization and early embryonic deaths. Only a few of causes of failure of fertilization have been identified in buffaloes. Ovulatory disturbances and ovarian cysts are uncommon in buffaloes and cysts have poor clinical manifestation. Endometritis is the common female cause of fertilization failures in buffaloes whereas poor semen quality and improper insemination are the bull side factors for fertilization failures. Early embryonic deaths are common in buffaloes mated/inseminated during the end of the breeding season due to a low luteal progesterone however embryonic deaths occur late (<25 days in buffaloes. Diagnostic approaches for repeat breeding include vaginoscopic and transrectal examination and uterine cytology for genital health. More precise evaluations of the ovarian and uterine function can be obtained by ultrasonographic and hysteroscopic examinations performed sequentially however, precise diagnosis of the cause of repeat breeding seems difficult.

  13. Exploring the repeat protein universe through computational protein design.

    Science.gov (United States)

    Brunette, T J; Parmeggiani, Fabio; Huang, Po-Ssu; Bhabha, Gira; Ekiert, Damian C; Tsutakawa, Susan E; Hura, Greg L; Tainer, John A; Baker, David

    2015-12-24

    A central question in protein evolution is the extent to which naturally occurring proteins sample the space of folded structures accessible to the polypeptide chain. Repeat proteins composed of multiple tandem copies of a modular structure unit are widespread in nature and have critical roles in molecular recognition, signalling, and other essential biological processes. Naturally occurring repeat proteins have been re-engineered for molecular recognition and modular scaffolding applications. Here we use computational protein design to investigate the space of folded structures that can be generated by tandem repeating a simple helix-loop-helix-loop structural motif. Eighty-three designs with sequences unrelated to known repeat proteins were experimentally characterized. Of these, 53 are monomeric and stable at 95 °C, and 43 have solution X-ray scattering spectra consistent with the design models. Crystal structures of 15 designs spanning a broad range of curvatures are in close agreement with the design models with root mean square deviations ranging from 0.7 to 2.5 Å. Our results show that existing repeat proteins occupy only a small fraction of the possible repeat protein sequence and structure space and that it is possible to design novel repeat proteins with precisely specified geometries, opening up a wide array of new possibilities for biomolecular engineering.

  14. ACCA phosphopeptide recognition by the BRCT repeats of BRCA1.

    Science.gov (United States)

    Ray, Hind; Moreau, Karen; Dizin, Eva; Callebaut, Isabelle; Venezia, Nicole Dalla

    2006-06-16

    The tumour suppressor gene BRCA1 encodes a 220 kDa protein that participates in multiple cellular processes. The BRCA1 protein contains a tandem of two BRCT repeats at its carboxy-terminal region. The majority of disease-associated BRCA1 mutations affect this region and provide to the BRCT repeats a central role in the BRCA1 tumour suppressor function. The BRCT repeats have been shown to mediate phospho-dependant protein-protein interactions. They recognize phosphorylated peptides using a recognition groove that spans both BRCT repeats. We previously identified an interaction between the tandem of BRCA1 BRCT repeats and ACCA, which was disrupted by germ line BRCA1 mutations that affect the BRCT repeats. We recently showed that BRCA1 modulates ACCA activity through its phospho-dependent binding to ACCA. To delineate the region of ACCA that is crucial for the regulation of its activity by BRCA1, we searched for potential phosphorylation sites in the ACCA sequence that might be recognized by the BRCA1 BRCT repeats. Using sequence analysis and structure modelling, we proposed the Ser1263 residue as the most favourable candidate among six residues, for recognition by the BRCA1 BRCT repeats. Using experimental approaches, such as GST pull-down assay with Bosc cells, we clearly showed that phosphorylation of only Ser1263 was essential for the interaction of ACCA with the BRCT repeats. We finally demonstrated by immunoprecipitation of ACCA in cells, that the whole BRCA1 protein interacts with ACCA when phosphorylated on Ser1263.

  15. Secure quantum network coding for controlled repeater networks

    Science.gov (United States)

    Shang, Tao; Li, Jiao; Liu, Jian-wei

    2016-07-01

    To realize efficient quantum communication based on quantum repeater, we propose a secure quantum network coding scheme for controlled repeater networks, which adds a controller as a trusted party and is able to control the process of EPR-pair distribution. As the key operations of quantum repeater, local operations and quantum communication are designed to adopt quantum one-time pad to enhance the function of identity authentication instead of local operations and classical communication. Scheme analysis shows that the proposed scheme can defend against active attacks for quantum communication and realize long-distance quantum communication with minimal resource consumption.

  16. Instability of trinucleotidic repeats during chromatin remodeling in spermatids.

    Science.gov (United States)

    Simard, Olivier; Grégoire, Marie-Chantal; Arguin, Mélina; Brazeau, Marc-André; Leduc, Frédéric; Marois, Isabelle; Richter, Martin V; Boissonneault, Guylain

    2014-11-01

    Transient DNA breaks and evidence of DNA damage response have recently been reported during the chromatin remodeling process in haploid spermatids, creating a potential window of enhanced genetic instability. We used flow cytometry to achieve separation of differentiating spermatids into four highly purified populations using transgenic mice harboring 160 CAG repeats within exon 1 of the human Huntington disease gene (HTT). Trinucleotic repeat expansion was found to occur immediately following the chromatin remodeling steps, confirming the genetic instability of the process and pointing to the origin of paternal anticipation observed in some trinucleotidic repeats diseases.

  17. Analysis of repeated outcome measures from longitudinal studies

    Institute of Scientific and Technical Information of China (English)

    Yuanjia WANG; Naihua DUAN

    2011-01-01

    @@ In many clinical studies repeated measurements of an outcome are collected over time.For example,in an 8-week study of treatment for obsessive compulsive disorder,the severity of the disorder may be measured weekly using the Yale-Brown-Obsessive-Compulsive-Disorder-Scale (YBOCS).For each study participant who completes the study,there will be nine repeated measures of YBOCS (a baseline assessment plus eight assessments during the course of treatment).Such a study in which participants are followed and measured repeatedly over time is called a longitudinal study and the resulting data are called longitudinal data.

  18. Frequency Bandwidth of Half-Wave Impedance Repeater

    Directory of Open Access Journals (Sweden)

    Marek Dvorsky

    2012-01-01

    Full Text Available This article brings in the second part general information about half-wave impedance repeater. The third part describes the basic functional principles of the half-wave impedance repeater using Smith chart. The main attention is focused in part four on the derivation of repeater frequency bandwidth depending on characteristics and load impedance of unknown feeder line. Derived dependences are based on the elementary features of the feeder lines with specific length. The described functionality is proved in part 4.3 by measurement of transformed impedance using vector several unbalanced feeder lines and network analyzer VNWA3+.

  19. Repeated morphine treatment influences operant and spatial learning differentially

    Institute of Scientific and Technical Information of China (English)

    Mei-Na WANG; Zhi-Fang DONG; Jun CAO; Lin XU

    2006-01-01

    Objective To investigate whether repeated morphine exposure or prolonged withdrawal could influence operant and spatial learning differentially. Methods Animals were chronically treated with morphine or subjected to morphine withdrawal. Then, they were subjected to two kinds of learning: operant conditioning and spatial learning.Results The acquisition of both simple appetitive and cued operant learning was impaired after repeated morphine treatment. Withdrawal for 5 weeks alleviated the impairments. Single morphine exposure disrupted the retrieval of operant memory but had no effect on rats after 5-week withdrawal. Contrarily, neither chronic morphine exposure nor 5-week withdrawal influenced spatial learning task of the Morris water maze. Nevertheless, the retrieval of spatial memory was impaired by repeated morphine exposure but not by 5-week withdrawal. Conclusion These observations suggest that repeated morphine exposure can influence different types of learning at different aspects, implicating that the formation of opiate addiction may usurp memory mechanisms differentially.

  20. Highly Informative Simple Sequence Repeat (SSR) Markers for Fingerprinting Hazelnut

    Science.gov (United States)

    Simple sequence repeat (SSR) or microsatellite markers have many applications in breeding and genetic studies of plants, including fingerprinting of cultivars and investigations of genetic diversity, and therefore provide information for better management of germplasm collections. They are repeatab...

  1. On the role of memory errors in quantum repeaters

    CERN Document Server

    Hartmann, L; Dür, W; Kraus, B

    2006-01-01

    We investigate the influence of memory errors in the quantum repeater scheme for long-range quantum communication. We show that the communication distance is limited in standard operation mode due to memory errors resulting from unavoidable waiting times for classical signals. We show how to overcome these limitations by (i) improving local memory, and (ii) introducing two new operational modes of the quantum repeater. In both operational modes, the repeater is run blindly, i.e. without waiting for classical signals to arrive. In the first scheme, entanglement purification protocols based on one-way classical communication are used allowing to communicate over arbitrary distances. However, the error thresholds for noise in local control operations are very stringent. The second scheme makes use of entanglement purification protocols with two-way classical communication and inherits the favorable error thresholds of the repeater run in standard mode. One can increase the possible communication distance by an o...

  2. Analysis of Simple Sequence Repeats in Genomes of Rhizobia

    Institute of Scientific and Technical Information of China (English)

    GAO Ya-mei; HAN Yi-qiang; TANG Hui; SUN Dong-mei; WANG Yan-jie; WANG Wei-dong

    2008-01-01

    Simple sequence repeats (SSRs) or microsatellites, as genetic markers, are ubiquitous in genomes of various organisms. The analysis of SSR in rhizobia genome provides useful information for a variety of applications in population genetics of rhizobia. We analyzed the occurrences, relative abundance, and relative density of SSRs, the most common in Bradyrhizobium japonicum, Mesorhizobium loti, and Sinorhizobium meliloti genomes se-quenced in the microorganisms tandem repeats database, and SSRs in the three species genomes were compared with each other. The result showed that there were 1 410, 859, and 638 SSRs in B. japonicum, M. loti, and 5. meliloti genomes, respectively. In the genomes of B. japonicum, M. loti, and 5. meliloti, tetranucleotide, pentanucleotide, and hexanucleotide repeats were more abundant and indicated higher mutation rates in these species. The least abundance was mononucleotide repeat. The SSRs type and distribution were similar among these species.

  3. simple sequence repeat (SSR) markers in genetic analysis of

    African Journals Online (AJOL)

    Yomi

    2012-08-28

    Aug 28, 2012 ... In the present study, 78 mapped simple sequence repeat (SSR) markers representing 11 ... mean (UPGMA) with each cluster representing a particular Vigna species. ..... were reported to be more frequent than the compound.

  4. Study of simple sequence repeat (SSR) polymorphism for biotic ...

    African Journals Online (AJOL)

    home

    2013-10-02

    Oct 2, 2013 ... back cross breeding; SSRs, simple sequence repeats; PIC, polymorphism ..... PIC values were reported in barley wheat and rice (Gu et ... doubled-haploid rice population. Theor. ... Grover A, Aishwarya V, Sharma PC (2007).

  5. Markerless modification of trinucleotide repeat loci in BACs.

    Science.gov (United States)

    Benzow, Kellie A; Koob, Michael D

    2013-01-01

    Transcription and splicing of human genes are regulated by nucleotide sequences encoded across large segments of our genome, and trinucleotide repeat expansion mutations can have both profound and subtle effects on these processes. In the course of our work to understand the impact of the Spinocerebellar Ataxia type 8 (SCA8) CTG repeat expansion on the transcription and splicing of the RNAs encoded near the SCA8 locus, we have developed a set of reagents and protocols for modifying large genomic BAC clones of this region. We describe the two-step procedure that allows us to precisely replace unexpanded trinucleotide repeats with expanded variants of these repeat sequences without leaving any exogenous sequences in the final constructs, and we discuss how this approach can be adapted to make other desired sequence changes to these genomic clones.

  6. Discriminant analysis for repeated measures data: a review

    Directory of Open Access Journals (Sweden)

    Lisa Lix

    2010-09-01

    Full Text Available Discriminant analysis (DA encompasses procedures for classifying observations into groups (i.e., predictive discriminative analysis and describing the relative importance of variables for distinguishing amongst groups (i.e., descriptive discriminative analysis. In recent years, a number of developments have occurred in DA procedures for the analysis of data from repeated measures designs. Specifically, DA procedures have been developed for repeated measures data characterized by missing observations and/or unbalanced measurement occasions, as well as high-dimensional data in which measurements are collected repeatedly on two or more variables. This paper reviews the literature on DA procedures for univariate and multivariate repeated measures data, focusing on covariance pattern and linear mixed-effects models. A numeric example illustrates their implementation using SAS software.

  7. Bayesian model selection of informative hypotheses for repeated measurements

    NARCIS (Netherlands)

    Mulder, Joris; Klugkist, I.G.; Schoot, Rens van de; Meeus, W.H.J.; Selfhout, Maarten; Hoijtink, Herbert

    2010-01-01

    When analyzing repeated measurements data, researchers often have expectations about the relations between the measurement means. The expectations can often be formalized using equality and inequality constraints between (i) the measurement means over time, (ii) the measurement means between

  8. Bayesian model selection of informative hypotheses for repeated measurements

    NARCIS (Netherlands)

    Mulder, J.|info:eu-repo/dai/nl/304823031; Klugkist, I.G.|info:eu-repo/dai/nl/27330089X; Van de Schoot, R.|info:eu-repo/dai/nl/304833207; Meeus, W.H.J.|info:eu-repo/dai/nl/070442215; van Zalk, M.H.W.|info:eu-repo/dai/nl/304836214; Hoijtink, H.J.A.|info:eu-repo/dai/nl/075184427

    2009-01-01

    When analyzing repeated measurements data, researchers often have expectations about the relations between the measurement means. The expectations can often be formalized using equality and inequality constraints between (i) the measurement means over time, (ii) the measurement means between groups,

  9. Correct use of repeated measures analysis of variance.

    Science.gov (United States)

    Park, Eunsik; Cho, Meehye; Ki, Chang-Seok

    2009-02-01

    In biomedical research, researchers frequently use statistical procedures such as the t-test, standard analysis of variance (ANOVA), or the repeated measures ANOVA to compare means between the groups of interest. There are frequently some misuses in applying these procedures since the conditions of the experiments or statistical assumptions necessary to apply these procedures are not fully taken into consideration. In this paper, we demonstrate the correct use of repeated measures ANOVA to prevent or minimize ethical or scientific problems due to its misuse. We also describe the appropriate use of multiple comparison tests for follow-up analysis in repeated measures ANOVA. Finally, we demonstrate the use of repeated measures ANOVA by using real data and the statistical software package SPSS (SPSS Inc., USA).

  10. The Pathogenic Role of Low Range Repeats in SCA17.

    Directory of Open Access Journals (Sweden)

    Jung Hwan Shin

    Full Text Available SCA17 is an autosomal dominant cerebellar ataxia with expansion of the CAG/CAA trinucleotide repeats in the TATA-binding protein (TBP gene. SCA17 can have various clinical presentations including parkinsonism, ataxia, chorea and dystonia. SCA17 is diagnosed by detecting the expanded CAG repeats in the TBP gene; however, in the literature, pathologic repeat numbers as low as 41 overlap with normal repeat numbers.The subjects in this study included patients with involuntary movement disorders such as cerebellar ataxia, parkinsonism, chorea and dystonia who visited Seoul National University Hospital between Jan. 2006 and Apr. 2014 and were screened for SCA17. Those who were diagnosed with other genetic diseases or nondegenerative diseases were excluded. DNA from healthy subjects who did not have a family history of parkinsonism, ataxia, psychiatric symptoms, chorea or dystonia served as the control. In total, 5242 chromosomes from 2099 patients and 522 normal controls were analyzed.The total number of patients included in the analysis was 2099 (parkinsonism, 1706; ataxia, 345; chorea, 37; and dystonia, 11. In the normal control, up to 44 repeats were found. In the 44 repeat group, there were 7 (0.3% patients and 1 (0.2% normal control. In 43 repeat group, there were 8 (0.4% patients and 2 (0.4% normal controls. In the 42 repeat group, there were 16 (0.8% patients and 3 (0.6% normal controls. In 41 repeat group, there were 48 (2.3% patients and 8 (1.5% normal controls. Considering the overlaps and non-significant differences in allelic frequencies between the patients and the normal controls with low-expansions, we could not determine a definitive cutoff value for the pathologic CAG repeat number of SCA17.Because the statistical analysis between the normal controls and patients with low range expansions failed to show any differences so far, we must consider that clinical cases with low range expansions could be idiopathic movement disorders showing

  11. Evaluation of Mammalian Interspersed Repeats to investigate the goat genome

    Directory of Open Access Journals (Sweden)

    P. Mariani

    2010-01-01

    Full Text Available Among the repeated sequences present in most eukaryotic genomes, SINEs (Short Interspersed Nuclear Elements are widely used to investigate evolution in the mammalian order (Buchanan et al., 1999. One family of these repetitive sequences, the MIR (Mammalian Interspersed Repeats; Jurka et al., 1995, is ubiquitous in all mammals.MIR elements are tRNA-derived SINEs and are identifiable by a conserved core region of about 70 nucleotides.

  12. The evolution of filamin – A protein domain repeat perspective

    Science.gov (United States)

    Light, Sara; Sagit, Rauan; Ithychanda, Sujay S.; Qin, Jun; Elofsson, Arne

    2013-01-01

    Particularly in higher eukaryotes, some protein domains are found in tandem repeats, performing broad functions often related to cellular organization. For instance, the eukaryotic protein filamin interacts with many proteins and is crucial for the cytoskeleton. The functional properties of long repeat domains are governed by the specific properties of each individual domain as well as by the repeat copy number. To provide better understanding of the evolutionary and functional history of repeating domains, we investigated the mode of evolution of the filamin domain in some detail. Among the domains that are common in long repeat proteins, sushi and spectrin domains evolve primarily through cassette tandem duplications while scavenger and immunoglobulin repeats appear to evolve through clustered tandem duplications. Additionally, immunoglobulin and filamin repeats exhibit a unique pattern where every other domain shows high sequence similarity. This pattern may be the result of tandem duplications, serve to avert aggregation between adjacent domains or it is the result of functional constraints. In filamin, our studies confirm the presence of interspersed integrin binding domains in vertebrates, while invertebrates exhibit more varied patterns, including more clustered integrin binding domains. The most notable case is leech filamin, which contains a 20 repeat expansion and exhibits unique dimerization topology. Clearly, invertebrate filamins are varied and contain examples of similar adjacent integrin-binding domains. Given that invertebrate integrin shows more similarity to the weaker filamin binder, integrin β3, it is possible that the distance between integrin-binding domains is not as crucial for invertebrate filamins as for vertebrates. PMID:22414427

  13. The evolution of filamin-a protein domain repeat perspective.

    Science.gov (United States)

    Light, Sara; Sagit, Rauan; Ithychanda, Sujay S; Qin, Jun; Elofsson, Arne

    2012-09-01

    Particularly in higher eukaryotes, some protein domains are found in tandem repeats, performing broad functions often related to cellular organization. For instance, the eukaryotic protein filamin interacts with many proteins and is crucial for the cytoskeleton. The functional properties of long repeat domains are governed by the specific properties of each individual domain as well as by the repeat copy number. To provide better understanding of the evolutionary and functional history of repeating domains, we investigated the mode of evolution of the filamin domain in some detail. Among the domains that are common in long repeat proteins, sushi and spectrin domains evolve primarily through cassette tandem duplications while scavenger and immunoglobulin repeats appear to evolve through clustered tandem duplications. Additionally, immunoglobulin and filamin repeats exhibit a unique pattern where every other domain shows high sequence similarity. This pattern may be the result of tandem duplications, serve to avert aggregation between adjacent domains or it is the result of functional constraints. In filamin, our studies confirm the presence of interspersed integrin binding domains in vertebrates, while invertebrates exhibit more varied patterns, including more clustered integrin binding domains. The most notable case is leech filamin, which contains a 20 repeat expansion and exhibits unique dimerization topology. Clearly, invertebrate filamins are varied and contain examples of similar adjacent integrin-binding domains. Given that invertebrate integrin shows more similarity to the weaker filamin binder, integrin β3, it is possible that the distance between integrin-binding domains is not as crucial for invertebrate filamins as for vertebrates. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. DSR-Based Selective Repeat ARQ Protocol in MANET

    Institute of Scientific and Technical Information of China (English)

    张全新; 宋瀚涛

    2003-01-01

    The efficient route algorithms involved in mobile ad hoc network(MANET) are studied. An arrangement of a combination of the traditional dynamic source routing(DSR) protocol is put forward and the selective repeat ARQ protocol is put forward by analyzing and studying them in detail and providing the scheme. In networks, especially in wireless networks, the nodes are capable to process data much faster than transmission, the DSR-based selective repeat ARQ protocol has real meanings in MANET.

  15. Are major repeater patients addicted to suicidal behavior?

    Science.gov (United States)

    Blasco-Fontecilla, Hilario; Artieda-Urrutia, Paula; Berenguer-Elias, Nuria; Garcia-Vega, Juan Manuel; Fernandez-Rodriguez, Monica; Rodriguez-Lomas, Cesar; Gonzalez-Villalobos, Isabel; Iruela-Cuadrado, Luis; de Leon, José

    2014-01-01

    The literature provides support for the hypothesis that some major repeaters (individuals with >=5 lifetime suicide attempts) are addicted to suicidal behavior (SB). This study explores whether major repeaters are addicted to SB or not using 7 criteria: tolerance (Criterion 1), withdrawal (Criterion 2), loss of control (Criterion 3), problems in quitting/cutting down (Criterion 4), much time spent using (Criterion 5), substantial reduction in activities (Criterion 6), and adverse physiological/physical consequences (Criterion 7). Total dependence on SB was indicated by the presence of 3 or more of the 7 criteria in the last 12 months. This cross-sectional study at Puerta de Hierro University Hospital (Madrid, Spain) recruited 118 suicide attempters including 8 major repeaters (7%, 8/118), who were all females. The association between each SB addiction criterion, physiological dependence and total dependence with major repeater status was tested for significance and for effect size with odds ratios (ORs) and their 95% confidence intervals. As hypothesized, major repeaters met significantly higher frequency of criteria for total dependence on SB, OR=62.9 (6.4-615). A backward stepwise logistic regression model was used to provide an OR between major repeater status and total dependence status corrected by confounding variables. Age, panic disorder without agoraphobia, borderline personality disorder, history of psychiatric inpatient admission, and total dependence on SB were introduced as independent variables with major repeater status as the dependent variable. The model selected total dependence and age as the remaining significant variables in the last step. Accordingly, major repeaters appear to be addicted to SB.

  16. A note on renegotiation in repeated Bertrand duopolies

    DEFF Research Database (Denmark)

    Andersson, Ola; Wengström, Erik Roland

    2007-01-01

    Weak Renegotiation-Proofness (WRP) singles out marginal cost pricing as a unique pure-strategy equilibrium of the infinitely repeated Bertrand duopoly. We show that, with a discrete strategy space, WRP does not eliminate any relevant subgame perfect equilibrium outcome......Weak Renegotiation-Proofness (WRP) singles out marginal cost pricing as a unique pure-strategy equilibrium of the infinitely repeated Bertrand duopoly. We show that, with a discrete strategy space, WRP does not eliminate any relevant subgame perfect equilibrium outcome...

  17. Repeated nondiagnostic result of thyroid fine-needle aspiration biopsy.

    Science.gov (United States)

    Ziemiańska, Klaudia; Kopczyński, Janusz; Kowalska, Aldona

    2016-01-01

    Fine-needle aspiration biopsy (FNAB) is the most accurate and cost-effective method to evaluate the risk of malignancy of thyroid nodules, but approximately 1-24% of FNABs generate a nondiagnostic result (ND-FNAB). The aim of this study was to determine the predictive factors of a repeated nondiagnostic result of FNAB. A total of 4018 FNABs performed in a territorial referral centre were analysed, of which 288 (7.17%) were nondiagnostic. Medical records were available for 245 biopsies performed in 228 patients. The retrospective analysis of factors that may influence a repeat ND-FNAB, including demographic, clinical and ultrasound characteristics, was performed. A repeat FNAB was performed in 159 nodules giving a diagnostic result in 79.2% of cases. The time between the biopsies ranged from 1 to 611 days (mean 154.4, median 119). The timing of a repeat FNAB did not significantly alter the diagnostic output (p = 0.29). In the univariate analysis, significant predictors of a repeat ND-FNAB were older patient age (p = 0.02), L-thyroxine supplementation (p = 0.05), and a history of (131)I therapy (p < 0.0001). In the multivariate analysis, only a history of (131)I therapy was a statistically significant risk factor for a repeat ND-FNAB (p = 0.002). Patients with a history of (131)I therapy and ND-FNAB should undergo periodic ultrasonographic assessment rather than a repeat biopsy. The interval between repeated FNABs recommended by guidelines does not affect the diagnostic output.

  18. Linking SNPs to CAG repeat length in Huntington's disease patients.

    Science.gov (United States)

    Liu, Wanzhao; Kennington, Lori A; Rosas, H Diana; Hersch, Steven; Cha, Jang-Ho; Zamore, Phillip D; Aronin, Neil

    2008-11-01

    Allele-specific silencing using small interfering RNAs targeting heterozygous single-nucleotide polymorphisms (SNPs) is a promising therapy for human trinucleotide repeat diseases such as Huntington's disease. Linking SNP identities to the two HTT alleles, normal and disease-causing, is a prerequisite for allele-specific RNA interference. Here we describe a method, SNP linkage by circularization (SLiC), to identify linkage between CAG repeat length and nucleotide identity of heterozygous SNPs using Huntington's disease patient peripheral blood samples.

  19. Failure Characteristic of Laser Cladding Samples on Repeated Impact

    Institute of Scientific and Technical Information of China (English)

    SHI Shi-hong; ZHENG Qi-guang; FU Ge-yan; ZHANG Jin-ping

    2004-01-01

    Using self-made impact fatigue test instruments and related analytic devices,the mechanical components with laser cladding layer have been attempted.It is found that,on repeated impact force,several failure modes of the components include the surface cracks,surface plastic deformation,corrosive pitting and coat collapse,etc.The paper reported the test method and initial analysis conclusions about the unique failure characteristics of the mechanical components on repeated impact load.

  20. Memory-based quantum repeater in quantum information communication

    Institute of Scientific and Technical Information of China (English)

    Wu Xiang-Sheng

    2004-01-01

    This paper studies the quantum repeater in quantum information communication. We propose to introduce the photon buffer mechanism for storing photons, which uses fibre delay loops as photon memories and a programmable 1 × N switcher for distributing photon delay time. Meanwhile, we also consider entanglement purification and entanglement swapping restoration at an entanglement purification or entanglement swapping failure and introduce a protection link mechanism that allows the photonic quantum repeater of a broken connection to initiate a connection restoration process.

  1. Quantum repeater based on cavity QED evolutions and coherent light

    Science.gov (United States)

    Gonţa, Denis; van Loock, Peter

    2016-05-01

    In the framework of cavity QED, we propose a quantum repeater scheme that uses coherent light and chains of atoms coupled to optical cavities. In contrast to conventional repeater schemes, in our scheme there is no need for an explicit use of two-qubit quantum logical gates by exploiting solely the cavity QED evolution. In our previous work (Gonta and van Loock in Phys Rev A 88:052308, 2013), we already proposed a quantum repeater in which the entanglement between two neighboring repeater nodes was distributed using controlled displacements of input coherent light, while the produced low-fidelity entangled pairs were purified using ancillary (four-partite) entangled states. In the present work, the entanglement distribution is realized using a sequence of controlled phase shifts and displacements of input coherent light. Compared to previous coherent-state-based distribution schemes for two-qubit entanglement, our scheme here relies only upon a simple discrimination of two coherent states with opposite signs, which can be performed in a quantum mechanically optimal fashion via a beam splitter and two on-off detectors. For the entanglement purification, we employ a method that avoids the use of extra entangled ancilla states. Our repeater scheme exhibits reasonable fidelities and repeater rates providing an attractive platform for long-distance quantum communication.

  2. Considerations on repeated repairing of weldments in Inconel 718 alloy

    Science.gov (United States)

    Bayless, E. O.; Lovoy, C. V.; Mcilwain, M. C.; Munafo, P.

    1981-01-01

    The effects of repeated weld repairs on the metallurgical characteristics, high cycle fatigue (HCF), and tensile properties of Inconel 718 butt weld joints were determined. A 1/4 in thick plate and a 1/2 in thick plate were used as well as tungsten inert gas welding, and Inconel 718 filler wire. Weld panels were subjected to 2, 6, and 12 repeated repairs and were made in a highly restrained condition. Post weld heat treatments were also conducted with the welded panel in the highly restrained condition. Results indicate that no significant metallurgical anomaly is evident as a result of up to twelve repeated weld repairs. No degradation in fatigue life is noted for up to twelve repeated repairs. Tensile results from specimens which contained up to twelve repeated weld repairs revealed no significant degradation in UTS and YS. However, a significant decrease in elongation is evident with specimens (solution treated and age hardened after welding) which contained twelve repeated repairs. The elongation loss is attributed to the presence of a severe notch on each side (fusion line) of the repair weld bead reinforcement.

  3. Evolutionary dynamics of satellite DNA repeats from Phaseolus beans.

    Science.gov (United States)

    Ribeiro, Tiago; Dos Santos, Karla G B; Richard, Manon M S; Sévignac, Mireille; Thareau, Vincent; Geffroy, Valérie; Pedrosa-Harand, Andrea

    2017-03-01

    Common bean (Phaseolus vulgaris) subtelomeres are highly enriched for khipu, the main satellite DNA identified so far in this genome. Here, we comparatively investigate khipu genomic organization in Phaseolus species from different clades. Additionally, we identified and characterized another satellite repeat, named jumper, associated to khipu. A mixture of P. vulgaris khipu clones hybridized in situ confirmed the presence of khipu-like sequences on subterminal chromosome regions in all Phaseolus species, with differences in the number and intensity of signals between species and when species-specific clones were used. Khipu is present as multimers of ∼500 bp and sequence analyses of cloned fragments revealed close relationship among khipu repeats. The new repeat, named jumper, is a 170-bp satellite sequence present in all Phaseolus species and inserted into the nontranscribed spacer (NTS) of the 5S rDNA in the P. vulgaris genome. Nevertheless, jumper was found as a high-copy repeat at subtelomeres and/or pericentromeres in the Phaseolus microcarpus lineage only. Our data argue for khipu as an important subtelomeric satellite DNA in the genus and for a complex satellite repeat composition of P. microcarpus subtelomeres, which also contain jumper. Furthermore, the differential amplification of these repeats in subtelomeres or pericentromeres reinforces the presence of a dynamic satellite DNA library in Phaseolus.

  4. Quantum key distribution with two-segment quantum repeaters

    Energy Technology Data Exchange (ETDEWEB)

    Kampermann, Hermann; Abruzzo, Silvestre; Bruss, Dagmar [Theoretische Physik III, Heinrich-Heine-Universitaet Duesseldorf (Germany)

    2014-07-01

    Quantum repeaters represent one possible way to achieve long-distance quantum key distribution. One way of improving the repeater rate and decreasing the memory coherence time is the usage of multiplexing. Motivated by the experimental fact that long-range connections are practically demanding, we extend the analysis of the quantum repeater multiplexing protocol to the case of short-range connections. We derive formulas for the repeater rate and we show that short-range connections lead to most of the benefits of a full-range multiplexing protocol. A less demanding QKD-protocol without quantum memories was recently introduced by Lo et al. We generalize this measurement-device-independent quantum key Distribution protocol to the scenario where the repeater Station contains also heralded quantum memories. We assume either single-photon sources or weak coherent pulse sources plus decay states. We show that it is possible to significantly outperform the original proposal, even in presence of decoherence of the quantum memory. We give formulas in terms of device imperfections i.e., the quantum bit error rate and the repeater rate.

  5. Ising Model Reprogramming of a Repeat Protein's Equilibrium Unfolding Pathway.

    Science.gov (United States)

    Millership, C; Phillips, J J; Main, E R G

    2016-05-08

    Repeat proteins are formed from units of 20-40 aa that stack together into quasi one-dimensional non-globular structures. This modular repetitive construction means that, unlike globular proteins, a repeat protein's equilibrium folding and thus thermodynamic stability can be analysed using linear Ising models. Typically, homozipper Ising models have been used. These treat the repeat protein as a series of identical interacting subunits (the repeated motifs) that couple together to form the folded protein. However, they cannot describe subunits of differing stabilities. Here we show that a more sophisticated heteropolymer Ising model can be constructed and fitted to two new helix deletion series of consensus tetratricopeptide repeat proteins (CTPRs). This analysis, showing an asymmetric spread of stability between helices within CTPR ensembles, coupled with the Ising model's predictive qualities was then used to guide reprogramming of the unfolding pathway of a variant CTPR protein. The designed behaviour was engineered by introducing destabilising mutations that increased the thermodynamic asymmetry within a CTPR ensemble. The asymmetry caused the terminal α-helix to thermodynamically uncouple from the rest of the protein and preferentially unfold. This produced a specific, highly populated stable intermediate with a putative dimerisation interface. As such it is the first step in designing repeat proteins with function regulated by a conformational switch. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  6. Repeated swim stress alters brain benzodiazepine receptors measured in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Weizman, R.; Weizman, A.; Kook, K.A.; Vocci, F.; Deutsch, S.I.; Paul, S.M.

    1989-06-01

    The effects of repeated swim stress on brain benzodiazepine receptors were examined in the mouse using both an in vivo and in vitro binding method. Specific in vivo binding of (/sup 3/H)Ro15-1788 to benzodiazepine receptors was decreased in the hippocampus, cerebral cortex, hypothalamus, midbrain and striatum after repeated swim stress (7 consecutive days of daily swim stress) when compared to nonstressed mice. In vivo benzodiazepine receptor binding was unaltered after repeated swim stress in the cerebellum and pons medulla. The stress-induced reduction in in vivo benzodiazepine receptor binding did not appear to be due to altered cerebral blood flow or to an alteration in benzodiazepine metabolism or biodistribution because there was no difference in (14C)iodoantipyrine distribution or whole brain concentrations of clonazepam after repeated swim stress. Saturation binding experiments revealed a change in both apparent maximal binding capacity and affinity after repeated swim stress. Moreover, a reduction in clonazepam's anticonvulsant potency was also observed after repeated swim stress (an increase in the ED50 dose for protection against pentylenetetrazol-induced seizures), although there was no difference in pentylenetetrazol-induced seizure threshold between the two groups. In contrast to the results obtained in vivo, no change in benzodiazepine receptor binding kinetics was observed using the in vitro binding method. These data suggest that environmental stress can alter the binding parameters of the benzodiazepine receptor and that the in vivo and in vitro binding methods can yield substantially different results.

  7. Repeated measurement sampling in genetic association analysis with genotyping errors.

    Science.gov (United States)

    Lai, Renzhen; Zhang, Hong; Yang, Yaning

    2007-02-01

    Genotype misclassification occurs frequently in human genetic association studies. When cases and controls are subject to the same misclassification model, Pearson's chi-square test has the correct type I error but may lose power. Most current methods adjusting for genotyping errors assume that the misclassification model is known a priori or can be assessed by a gold standard instrument. But in practical applications, the misclassification probabilities may not be completely known or the gold standard method can be too costly to be available. The repeated measurement design provides an alternative approach for identifying misclassification probabilities. With this design, a proportion of the subjects are measured repeatedly (five or more repeats) for the genotypes when the error model is completely unknown. We investigate the applications of the repeated measurement method in genetic association analysis. Cost-effectiveness study shows that if the phenotyping-to-genotyping cost ratio or the misclassification rates are relatively large, the repeat sampling can gain power over the regular case-control design. We also show that the power gain is not sensitive to the genetic model, genetic relative risk and the population high-risk allele frequency, all of which are typically important ingredients in association studies. An important implication of this result is that whatever the genetic factors are, the repeated measurement method can be applied if the genotyping errors must be accounted for or the phenotyping cost is high.

  8. DNA methylation and triplet repeat stability: New proposals addressing actual questions on the CGG repeat of fragile X syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Woehrle, D.; Schwemmle, S.; Steinbach, P. [Univ. of Ulm (Germany)

    1996-08-09

    Methylation of expanded CGG repeats in the FMR1 gene may well have different consequences. One is that methylation, extending into upstream regulatory elements, could lead to gene inactivation. Another effect of methylation, which we have obtained evidence for, could be stabilization of the repeat sequence and even prevention of premutations from expansion to full mutation. The full mutation of the fragile X syndrome probably occurs in an early transitional stage of embryonic development. The substrate is a maternally inherited premutation. The product usually is a mosaic pattern of full mutations detectable in early fetal life. These full mutation patterns are mitotically stable as, for instance, different somatic tissues of full mutation fetuses show identical mutation patterns. This raised the following questions: What triggers repeat expansion in that particular stage of development and what causes subsequent mitotic stability of expanded repeats? 21 refs., 1 fig.

  9. Filamin repeat segments required for photosensory signalling in Dictyostelium discoideum

    Directory of Open Access Journals (Sweden)

    Ahmed Afsar U

    2007-11-01

    Full Text Available Abstract Background Filamin is an actin binding protein which is ubiquitous in eukaryotes and its basic structure is well conserved – an N-terminal actin binding domain followed by a series of repeated segments which vary in number in different organisms. D. discoideum is a well established model organism for the study of signalling pathways and the actin cytoskeleton and as such makes an excellent organism in which to study filamin. Ddfilamin plays a putative role as a scaffolding protein in a photosensory signalling pathway and this role is thought to be mediated by the unusual repeat segments in the rod domain. Results To study the role of filamin in phototaxis, a filamin null mutant, HG1264, was transformed with constructs each of which expressed wild type filamin or a mutant filamin with a deletion of one of the repeat segments. Transformants expressing the full length filamin to wild type levels completely rescued the phototaxis defect in HG1264, however if filamin was expressed at lower than wild type levels the phototaxis defect was not restored. The transformants lacking any one of the repeat segments 2–6 retained defective phototaxis and thermotaxis phenotypes, whereas transformants expressing filaminΔ1 exhibited a range of partial complementation of the phototaxis phenotype which was related to expression levels. Immunofluorescence microscopy showed that filamin lacking any of the repeat segments still localised to the same actin rich areas as wild type filamin. Ddfilamin interacts with RasD and IP experiments demonstrated that this interaction did not rely upon any single repeat segment or the actin binding domain. Conclusion This paper demonstrates that wild type levels of filamin expression are essential for the formation of functional photosensory signalling complexes and that each of the repeat segments 2–6 are essential for filamins role in phototaxis. By contrast, repeat segment 1 is not essential provided the mutated

  10. REPEATED RHYME AND REPEATED REDIF IN GAZELS / GAZELDE İKİLEME REDİF VE İKİLEME KAFİYE

    Directory of Open Access Journals (Sweden)

    Assoc. Prof. Dr. Yaşar AYDEMİR

    2009-04-01

    Full Text Available Meter and rhyme are indispensable elements forClassical Turkish poem. Usually rhyme together withredif (repeated voice/ word after the rhyme is used inClassical Turkish poem. One of the way of using rhymeand redif is "repeated rhyme and repeated redif" in poem.In this paper, "repeated rhyme and repeatedredif" was studied.

  11. Who Repeats Algebra I, and How Does Initial Performance Relate to Improvement When the Course Is Repeated? REL 2015-059

    Science.gov (United States)

    Fong, Anthony B.; Jaquet, Karina; Finkelstein, Neal

    2014-01-01

    This REL West study explores the prevalence of students repeating Algebra I, who is most likely to repeat the course, and the level of improvement for students who repeat. Using six years of data from a cohort of 3,400 first-time seventh grade students in a California school district, authors found that 44 percent of students repeated algebra I.…

  12. Germ-line CAG repeat instability causes extreme CAG repeat expansion with infantile-onset spinocerebellar ataxia type 2

    DEFF Research Database (Denmark)

    Vinther-Jensen, Tua; Ek, Jakob; Duno, Morten

    2013-01-01

    The spinocerebellar ataxias (SCA) are a genetically and clinically heterogeneous group of diseases, characterized by dominant inheritance, progressive cerebellar ataxia and diverse extracerebellar symptoms. A subgroup of the ataxias is caused by unstable CAG-repeat expansions in their respective ...... of paternal germ-line repeat sequence instability of the expanded SCA2 locus.European Journal of Human Genetics advance online publication, 10 October 2012; doi:10.1038/ejhg.2012.231....

  13. Repeated high-intensity exercise in professional rugby union.

    Science.gov (United States)

    Austin, Damien; Gabbett, Tim; Jenkins, David

    2011-07-01

    The aim of the present study was to describe the frequency, duration, and nature of repeated high-intensity exercise in Super 14 rugby union. Time-motion analysis was used during seven competition matches over the 2008 and 2009 Super 14 seasons; five players from each of four positional groups (front row forwards, back row forwards, inside backs, and outside backs) were assessed (20 players in total). A repeated high-intensity exercise bout was considered to involve three or more sprints, and/or tackles and/or scrum/ruck/maul activities within 21 s during the same passage of play. The range of repeated high-intensity exercise bouts for each group in a match was as follows: 11-18 for front row forwards, 11-21 for back row forwards, 13-18 for inside backs, and 2-11 for outside backs. The durations of the most intense repeated high-intensity exercise bouts for each position ranged from 53 s to 165 s and the minimum recovery periods between repeated high-intensity exercise bouts ranged from 25 s for the back row forwards to 64 s for the front row forwards. The present results show that repeated high-intensity exercise bouts vary in duration and activities relative to position but all players in a game will average at least 10 changes in activity in the most demanding bouts and complete at least one tackle and two sprints. The most intense periods of activity are likely to last as long as 120 s and as little as 25 s recovery may separate consecutive repeated high-intensity exercise bouts. The present findings can be used by coaches to prepare their players for the most demanding passages of play likely to be experienced in elite rugby union.

  14. Automated Detection of Trinucleotide Repeats in Fragile X Syndrome.

    Science.gov (United States)

    Hamdan; Tynan; Fenwick; Leon

    1997-12-01

    Background: The conventional method for diagnosis of fragile X syndrome has been amplification of the trinucleotide repeat region of the FMR-1 gene by polymerase chain reaction (PCR) and Southern blot analysis to detect full expansion and hypermethylation. "Stuttering" resulting from incomplete amplification is still observed in the PCR products despite the use of reagents that reduce the secondary structure of the GC-rich template. In addition, PCR products can be detected by autoradiography only after 1 to 2 days of exposure. By combination of a recently reported amplification protocol with fluorescence detection of PCR products in an automated DNA sequencer, the PCR protocol for amplification of trinucleotide repeats was simplified. This modified protocol is highly reproducible, more accurate, and less costly than the conventional protocol because of the elimination of radioisotopes from the PCR. Methods and Results: PCRs were conducted with betaine and Pfu DNA polymerase. This improved PCR protocol allowed immediate detection of PCR products in agarose gels containing ethidium bromide. Stuttering was completely eliminated and fragments of up to 1kb ( approximately 250 repeats) were visible in agarose gels. PCR products were automatically detected by laser fluorescence in an automated DNA sequencer by inclusion of a fluorescently-labeled primer in the PCR reaction. A short electrophoresis run of 100 minutes in denaturing acrylamide gels was sufficient to give high resolution of fragments with higher accuracy and sensitivity than conventional detection by autoradiography. Conclusions: A simple, nonradioactive protocol that is more rapid and less expensive than the conventional PCR protocol for the detection of trinucleotide repeats has been developed. By use of this detection protocol, fragment sizes containing up to 100 repeats could be detected, alleles differing by one trinucleotide repeat were clearly resolved, and heterogeneous repeat patterns such as those

  15. Intra-genomic variation in the ribosomal repeats of nematodes.

    Directory of Open Access Journals (Sweden)

    Holly M Bik

    Full Text Available Ribosomal loci represent a major tool for investigating environmental diversity and community structure via high-throughput marker gene studies of eukaryotes (e.g. 18S rRNA. Since the estimation of species' abundance is a major goal of environmental studies (by counting numbers of sequences, understanding the patterns of rRNA copy number across species will be critical for informing such high-throughput approaches. Such knowledge is critical, given that ribosomal RNA genes exist within multi-copy repeated arrays in a genome. Here we measured the repeat copy number for six nematode species by mapping the sequences from whole genome shotgun libraries against reference sequences for their rRNA repeat. This revealed a 6-fold variation in repeat copy number amongst taxa investigated, with levels of intragenomic variation ranging from 56 to 323 copies of the rRNA array. By applying the same approach to four C. elegans mutation accumulation lines propagated by repeated bottlenecking for an average of ~400 generations, we find on average a 2-fold increase in repeat copy number (rate of increase in rRNA estimated at 0.0285-0.3414 copies per generation, suggesting that rRNA repeat copy number is subject to selection. Within each Caenorhabditis species, the majority of intragenomic variation found across the rRNA repeat was observed within gene regions (18S, 28S, 5.8S, suggesting that such intragenomic variation is not a product of selection for rRNA coding function. We find that the dramatic variation in repeat copy number among these six nematode genomes would limit the use of rRNA in estimates of organismal abundance. In addition, the unique pattern of variation within a single genome was uncorrelated with patterns of divergence between species, reflecting a strong signature of natural selection for rRNA function. A better understanding of the factors that control or affect copy number in these arrays, as well as their rates and patterns of evolution

  16. Diagnosis of repeated/intermittent failures in discrete event systems.

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, H. E.; Jiang, S.; Kumar, R.

    2003-04-01

    We introduce the notion of repeated failure diagnosability for diagnosing the occurrence of a repeated number of failures in discrete event systems. This generalizes the earlier notion of diagnosability that was used to diagnose the occurrence of a failure, but from which the information regarding the multiplicity of the occurrence of the failure could not be obtained. It is possible that in some systems the same type of failure repeats a multiple number of times. It is desirable to have a diagnoser which not only diagnoses that such a failure has occurred but also determines the number of times the failure has occurred. To aide such analysis we introduce the notions of K-diagnosability (K failures diagnosability), [1,K]-diagnosability (1 through K failures diagnosability), and [1,1]-diagnosability (1 through 1 failures diagnosability). Here the rst (resp., last) notion is the weakest (resp., strongest) of all three, and the earlier notion of diagnosability is the same as that of K-diagnosability or that of [1,K]- diagnosability with K = 1. We give polynomial algorithms for checking these various notions of repeated failure diagnosability, and also present a procedure of polynomial complexity for the on-line diagnosis of repeated failures.

  17. Value of repeat biopsy in lupus nephritis flares

    Science.gov (United States)

    Greloni, G; Scolnik, M; Marin, J; Lancioni, E; Quiroz, C; Zacariaz, J; De la Iglesia Niveyro, P; Christiansen, S; Pierangelo, M A; Varela, C F; Rosa-Diez, G J; Catoggio, L J; Soriano, E R

    2014-01-01

    Objectives Renal flares are common in lupus nephritis (LN), and class switch is thought to be characteristic. There is no agreement on indications for performing a repeat renal biopsy. Our objective was to retrospectively review patients who had more than one renal biopsy performed on clinical indications, and analyse clinical, pathological and treatment changes after successive biopsies. Methods Forty-five patients with LN and one or more repeat renal biopsies were included, with a total of 116 biopsies. Results Of the 71 repeat biopsies, pathological transition occurred in 39 (54.9%). When having a previous biopsy with a proliferative lesion, class switch occurred in 55.6%, with 24.4% evolving into non-proliferative classes. When previous biopsy was class V, transition to other classes occurred in 58.3% and changes were all into proliferative classes. Conversion from one pure proliferative form to another (class III to class IV or vice versa) happened in 11.3% of the rebiopsies, with 62 rebiopsies (87.3%) leading to a change in the treatment regimen. Conclusions Histological transformations were common, and they occurred when the previous biopsy had non-proliferative lesions as well as when lesions were proliferative. Treatments were modified after repeat renal biopsy in the majority of patients. In this experience, kidney repeat biopsies were useful in guiding treatment of LN flares. PMID:25396056

  18. A COMPARISON OF PAIRS FIGURE SKATERS IN REPEATED JUMPS

    Directory of Open Access Journals (Sweden)

    William A. Sands

    2012-03-01

    Full Text Available Trends in pairs figure skating have shown that increasingly difficult jumps have become an essential aspect of high-level performance, especially in the latter part of a competitive program. We compared a repeated jump power index in a 60 s repeated jump test to determine the relationship of repeated jump test to competitive rank and to measure 2D hip, knee, and ankle angles and angular velocities at 0, 20, 40, and 60 s. Eighteen National Team Pairs Figure Skaters performed a 60 s repeated jump test on a large switch-mat with timing of flight and ground durations and digital video recording. Each 60-s period was divided into 6, 10-s intervals, with power indexes (W/kg calculated for each 10-s interval. Power index by 10-s interval repeated measures ANOVAs (RMANOVA showed that males exceeded females at all intervals, and the highest power index interval was during 10 to 20 s for both sexes. RMANOVAs of angles and angular velocities showed main effects for time only. Power index and jumping techniques among figure skaters showed rapid and steady declines over the test duration. Power index can predict approximately 50% of competitive rank variance, and sex differences in jumping technique were rare

  19. Discrepancy variation of dinucleotide microsatellite repeats in eukaryotic genomes.

    Science.gov (United States)

    Gao, Huan; Cai, Shengli; Yan, Binlun; Chen, Baiyao; Yu, Fei

    2009-01-01

    To address whether there are differences of variation among repeat motif types and among taxonomic groups, we present here an analysis of variation and correlation of dinucleotide microsatellite repeats in eukaryotic genomes. Ten taxonomic groups were compared, those being primates, mammalia (excluding primates and rodentia), rodentia, birds, fish, amphibians and reptiles, insects, molluscs, plants and fungi, respectively. The data used in the analysis is from the literature published in the Journal of Molecular Ecology Notes. Analysis of variation reveals that there are no significant differences between AC and AG repeat motif types. Moreover, the number of alleles correlates positively with the copy number in both AG and AC repeats. Similar conclusions can be obtained from each taxonomic group. These results strongly suggest that the increase of SSR variation is almost linear with the increase of the copy number of each repeat motif. As well, the results suggest that the variability of SSR in the genomes of low-ranking species seem to be more than that of high-ranking species, excluding primates and fungi.

  20. Physiological consequences of repeated exposures to conditioned fear.

    Science.gov (United States)

    Thompson, Robert S; Strong, Paul V; Fleshner, Monika

    2012-06-01

    Activation of the stress response evokes a cascade of physiological reactions that may be detrimental when repeated or chronic, and when triggered after exposure to psychological/emotional stressors. Investigation of the physiological mechanisms responsible for the health damaging effects requires animal paradigms that repeatedly evoke a response to psychological/emotional stressors. To this end, adult male Sprague Dawley rats were repeatedly exposed (2X per day for 20 days) to a context that they were conditioned to fear (conditioned fear test, CFT). Repeated exposure to CFT produced body weight loss, adrenal hypertrophy, thymic involution, and basal corticosterone elevation. In vivo biotelemetry measures revealed that CFT evokes sympathetic nervous system driven increases in heart rate (HR), mean arterial pressure (MAP), and core body temperature. Extinction of behavioral (freezing) and physiological responses to CFT was prevented using minimal reinstatement footshock. MAP responses to the CFT did not diminish across 20 days of exposure. In contrast, HR and cardiac contractility responses declined by day 15, suggesting a shift toward vascular-dominated MAP (a pre-clinical marker of CV dysfunction). Flattened diurnal rhythms, common to stress-related mood/anxiety disorders, were found for most physiological measures. Thus, repeated CFT produces adaptations indicative of the health damaging effects of psychological/emotional stress.

  1. Physiological Consequences of Repeated Exposures to Conditioned Fear

    Directory of Open Access Journals (Sweden)

    Robert S. Thompson

    2012-05-01

    Full Text Available Activation of the stress response evokes a cascade of physiological reactions that may be detrimental when repeated or chronic, and when triggered after exposure to psychological/emotional stressors. Investigation of the physiological mechanisms responsible for the health damaging effects requires animal paradigms that repeatedly evoke a response to psychological/emotional stressors. To this end, adult male Sprague Dawley rats were repeatedly exposed (2X per day for 20 days to a context that they were conditioned to fear (conditioned fear test, CFT. Repeated exposure to CFT produced body weight loss, adrenal hypertrophy, thymic involution, and basal corticosterone elevation. In vivo biotelemetry measures revealed that CFT evokes sympathetic nervous system driven increases in heart rate (HR, mean arterial pressure (MAP, and core body temperature. Extinction of behavioral (freezing and physiological responses to CFT was prevented using minimal reinstatement footshock. MAP responses to the CFT did not diminish across 20 days of exposure. In contrast, HR and cardiac contractility responses declined by day 15, suggesting a shift toward vascular-dominated MAP (a pre-clinical marker of CV dysfunction. Flattened diurnal rhythms, common to stress-related mood/anxiety disorders, were found for most physiological measures. Thus, repeated CFT produces adaptations indicative of the health damaging effects of psychological/emotional stress.

  2. Implementation of bipartite or remote unitary gates with repeater nodes

    Science.gov (United States)

    Yu, Li; Nemoto, Kae

    2016-08-01

    We propose some protocols to implement various classes of bipartite unitary operations on two remote parties with the help of repeater nodes in-between. We also present a protocol to implement a single-qubit unitary with parameters determined by a remote party with the help of up to three repeater nodes. It is assumed that the neighboring nodes are connected by noisy photonic channels, and the local gates can be performed quite accurately, while the decoherence of memories is significant. A unitary is often a part of a larger computation or communication task in a quantum network, and to reduce the amount of decoherence in other systems of the network, we focus on the goal of saving the total time for implementing a unitary including the time for entanglement preparation. We review some previously studied protocols that implement bipartite unitaries using local operations and classical communication and prior shared entanglement, and apply them to the situation with repeater nodes without prior entanglement. We find that the protocols using piecewise entanglement between neighboring nodes often require less total time compared to preparing entanglement between the two end nodes first and then performing the previously known protocols. For a generic bipartite unitary, as the number of repeater nodes increases, the total time could approach the time cost for direct signal transfer from one end node to the other. We also prove some lower bounds of the total time when there are a small number of repeater nodes. The application to position-based cryptography is discussed.

  3. Age, CAG repeat length, and clinical progression in Huntington's disease.

    Science.gov (United States)

    Rosenblatt, Adam; Kumar, Brahma V; Mo, Alisa; Welsh, Claire S; Margolis, Russell L; Ross, Christopher A

    2012-02-01

    The objective of this study was to further explore the effect of CAG repeat length on the rate of clinical progression in patients with Huntington's disease. The dataset included records for 569 subjects followed prospectively at the Baltimore Huntington's Disease Center. Participants were seen for a mean of 7.1 visits, with a mean follow-up of 8.2 years. Subjects were evaluated using the Quantified Neurologic Examination and its Motor Impairment subscale, the Mini-Mental State Examination, and the Huntington's disease Activities of Daily Living Scale. By itself, CAG repeat length showed a statistically significant but small effect on the progression of all clinical measures. Contrary to our previous expectations, controlling for age of onset increased the correlation between CAG repeat length and progression of all variables by 69% to 159%. Graphical models further supported the idea that individuals with smaller triplet expansions experience a more gradual decline. CAG repeat length becomes an important determinant of clinical prognosis when accounting for age of onset. This suggests that the aging process itself influences clinical outcomes in Huntington's disease. Inconsistent results in prior studies examining CAG repeat length and progression may indeed reflect a lack of age adjustment.

  4. Repeat Sequences and Base Correlations in Human Y Chromosome Palindromes

    Institute of Scientific and Technical Information of China (English)

    Neng-zhi Jin; Zi-xian Liu; Yan-jiao Qi; Wen-yuan Qiu

    2009-01-01

    On the basis of information theory and statistical methods, we use mutual information, n-tuple entropy and conditional entropy, combined with biological characteristics, to analyze the long range correlation and short range correlation in human Y chromosome palindromes. The magnitude distribution of the long range correlation which can be reflected by the mutual information is P5>P5a>P5b (P5a and P5b are the sequences that replace solely Alu repeats and all interspersed repeats with random uncorrelated sequences in human Y chromosome palindrome 5, respectively); and the magnitude distribution of the short range correlation which can be reflected by the n-tuple entropy and the conditional entropy is P5>P5a>P5b>random uncorrelated sequence. In other words, when the Alu repeats and all interspersed repeats replace with random uncorrelated sequence, the long range and short range correlation decrease gradually. However, the random uncorrelated sequence has no correlation. This research indicates that more repeat sequences result in stronger correlation between bases in human Y chromosome. The analyses may be helpful to understand the special structures of human Y chromosome palindromes profoundly.

  5. Tracking a closing volcanic system using repeating earthquakes

    Science.gov (United States)

    Buurman, H.; West, M. E.; Grapenthin, R.

    2011-12-01

    Repeating, volcano-tectonic (VT) earthquakes were recorded at the end of the explosive phase of the 2009 eruption of Redoubt Volcano, Alaska. The events cluster into several families which exhibit cross-correlation values greater than 0.8 and are distributed between 0-10 km below the edifice. The earthquake magnitudes decline gradually with time, and the events also appear to shallow as the sequence progresses. This activity continued for over 2 months and accompanied steady dome growth, which halted around the same time that the last of the repeating VTs were recorded. The repetitive nature of these earthquakes, their relatively deep locations and their occurrence following 3 weeks of major explosive eruptions suggest that they are related to changes around the conduit system and/or the magma storage area as the last of the magma was removed from the mid-crustal storage area. Geodetic data indicate that the deflation of the edifice, which had been continuous throughout the explosive activity, ceased coincident with the onset of the repeating VT earthquakes. We use evidence from earthquake relocations and earthquake focal mechanisms to investigate the source for the repeating VT earthquakes. We propose a model in which the repeating earthquakes are closely related to the adjustment of the conduit system and mid crustal storage area in response to the last of the ascending magma.

  6. Design and analysis of communication protocols for quantum repeater networks

    Science.gov (United States)

    Jones, Cody; Kim, Danny; Rakher, Matthew T.; Kwiat, Paul G.; Ladd, Thaddeus D.

    2016-08-01

    We analyze how the performance of a quantum-repeater network depends on the protocol employed to distribute entanglement, and we find that the choice of repeater-to-repeater link protocol has a profound impact on entanglement-distribution rate as a function of hardware parameters. We develop numerical simulations of quantum networks using different protocols, where the repeater hardware is modeled in terms of key performance parameters, such as photon generation rate and collection efficiency. These parameters are motivated by recent experimental demonstrations in quantum dots, trapped ions, and nitrogen-vacancy centers in diamond. We find that a quantum-dot repeater with the newest protocol (‘MidpointSource’) delivers the highest entanglement-distribution rate for typical cases where there is low probability of establishing entanglement per transmission, and in some cases the rate is orders of magnitude higher than other schemes. Our simulation tools can be used to evaluate communication protocols as part of designing a large-scale quantum network.

  7. Positional Repeatability Measurements Of Stepper Motors At Cryogenic Temperatures

    Science.gov (United States)

    Pompea, Stephen M.; Hall, Michael S.; Bartko, Frank; Houck, James R.

    1983-08-01

    Stepper motors operating at liquid helium temperature have multiple applications in cryogenically-cooled telescopes such as the Shuttle Infrared Telescope Facility (SIRTF). These SIRTF applications include driving cryogen flow valves, operating the Multiple Instrument Chamber (MIC) beam splitter mechanism, and operating filters and grating wheel mechanisms in the scientific instruments. The positional repeatability of the beam splitter drive mechanism is especially critical since it feeds the optical beam to the scien-tific instruments. Despite these important applications, no significant data on the positional repeatability of stepper motors at cryogenic temperatures has been available. Therefore, we conducted a series of measurements to determine the positional repeatability of a modified, off-the-shelf Berger/Lahr stepper motor (model RDM 253/25, step angle 3.6°) which had demonstrated excellent performance in previous endurance testing at LHe temperature. These test results indicated that the positional repeatability of the motor was excellent at all temperatures, with somewhat better performance at cryogenic temperatures. Another important result was that the motor could be repeatedly turned off and on while still accurately retaining its rotor position.

  8. The diversity and evolution of Wolbachia ankyrin repeat domain genes.

    Directory of Open Access Journals (Sweden)

    Stefanos Siozios

    Full Text Available Ankyrin repeat domain-encoding genes are common in the eukaryotic and viral domains of life, but they are rare in bacteria, the exception being a few obligate or facultative intracellular Proteobacteria species. Despite having a reduced genome, the arthropod strains of the alphaproteobacterium Wolbachia contain an unusually high number of ankyrin repeat domain-encoding genes ranging from 23 in wMel to 60 in wPip strain. This group of genes has attracted considerable attention for their astonishing large number as well as for the fact that ankyrin proteins are known to participate in protein-protein interactions, suggesting that they play a critical role in the molecular mechanism that determines host-Wolbachia symbiotic interactions. We present a comparative evolutionary analysis of the wMel-related ankyrin repeat domain-encoding genes present in different Drosophila-Wolbachia associations. Our results show that the ankyrin repeat domain-encoding genes change in size by expansion and contraction mediated by short directly repeated sequences. We provide examples of intra-genic recombination events and show that these genes are likely to be horizontally transferred between strains with the aid of bacteriophages. These results confirm previous findings that the Wolbachia genomes are evolutionary mosaics and illustrate the potential that these bacteria have to generate diversity in proteins potentially involved in the symbiotic interactions.

  9. Follistatin: A Potential Anabolic Treatment for Re-Innervated Muscle

    Science.gov (United States)

    2016-09-01

    produce AAV in sufficient quantities, perceived easier (and more economical) production of AV, and a history of successful use of AV for protein ...rodent gastrocnemius muscle. The efficacy of Adenoassociated virus delivery of FS-288 DNA or direct delivery of recombinant FS-288 protein is...Special Reporting Requirements…………………………………… 9 9. Appendices…………………………………………………………… 9 1 1. Introduction: Functional recovery following major peripheral

  10. DNA profiling of extended tracts of primitive DNA repeats: Direct identification of unstable simple repeat loci in complex genome

    Energy Technology Data Exchange (ETDEWEB)

    Rogaeva, E.A.; Korovaitseva, G.; St. George-Hyslop, P. [Univ. of Toronto (Canada)] [and others

    1994-09-01

    The most simple DNA repetitive elements, with repetitive monomer units of only 1-10 bp in tandem tracts, are an abundant component of the human genome. The expansion of at least one type of these repeats ((CCG)n and (CTG)n) have been detected for a several neurological diseases with anticipation in successive generations. We propose here a simple method for the identification of particularly expanded repeats and for the recovery of flanking sequences. We generated DNA probes using PCR to create long concatamers (n>100) by amplification of the di-, tri-, tetra-, penta- and hexa-nucleotide repeat oligonucleotide primer pairs. To reduce the complexity of the background band pattern, the genomic DNA was restricted with a mixture of at least five different endonucleases, thereby reducing the size of restriction fragments containing short simple repeat arrays while leaving intact the large fragments containing the longer simple repeats arrays. Direct blot hybridization has shown different {open_quotes}DNA fingerprint{close_quotes} patterns with all arbitrary selected di-hexa nucleotide repeat probes. Direct hybridization of the (CTG)n and (CCG)n probes revealed simple or multiple band patterns depending upon stringency conditions. We were able to detect the presence of expanded unstable tri-nucleotide alleles by (CCG)n probe for some FRAXA subjects and by (CTG)n probe for some myotonic dystrophy subjects which were not present in the parental DNA patterns. The cloning of the unstable alleles for simple repeats can be performed by direct recover from agarose gels of the aberrant unstable bands detected above. The recovered flanking regions can be cloned, sequenced and used for PCR detection of expanded alleles or can be used to screen cDNA. This method may be used for testing of small families with diseases thought to display clinical evidence of anticipation.

  11. Integrated expression analysis of muscle hypertrophy identifies Asb2 as a negative regulator of muscle mass

    Science.gov (United States)

    Davey, Jonathan R.; Watt, Kevin I.; Parker, Benjamin L.; Chaudhuri, Rima; Ryall, James G.; Cunningham, Louise; Qian, Hongwei; Sartorelli, Vittorio; Chamberlain, Jeffrey; James, David E.

    2016-01-01

    The transforming growth factor-β (TGF-β) signaling network is a critical regulator of skeletal muscle mass and function and, thus, is an attractive therapeutic target for combating muscle disease, but the underlying mechanisms of action remain undetermined. We report that follistatin-based interventions (which modulate TGF-β network activity) can promote muscle hypertrophy that ameliorates aging-associated muscle wasting. However, the muscles of old sarcopenic mice demonstrate reduced response to follistatin compared with healthy young-adult musculature. Quantitative proteomic and transcriptomic analyses of young-adult muscles identified a transcription/translation signature elicited by follistatin exposure, which included repression of ankyrin repeat and SOCS box protein 2 (Asb2). Increasing expression of ASB2 reduced muscle mass, thereby demonstrating that Asb2 is a TGF-β network–responsive negative regulator of muscle mass. In contrast to young-adult muscles, sarcopenic muscles do not exhibit reduced ASB2 abundance with follistatin exposure. Moreover, preventing repression of ASB2 in young-adult muscles diminished follistatin-induced muscle hypertrophy. These findings provide insight into the program of transcription and translation events governing follistatin-mediated adaptation of skeletal muscle attributes and identify Asb2 as a regulator of muscle mass implicated in the potential mechanistic dysfunction between follistatin-mediated muscle growth in young and old muscles. PMID:27182554

  12. Evaluating post-Katrina recovery in Mississippi using repeat photography.

    Science.gov (United States)

    Burton, Christopher; Mitchell, Jerry T; Cutter, Susan L

    2011-07-01

    Hurricane Katrina of August 2005 had extensive consequences for the state of Mississippi in the United States. Widespread infrastructure and property damage, massive social dislocation, and ecological loss remain among the many challenges faced by communities as they work towards 'normalcy'. This study employs repeat photography to understand differential recovery from Hurricane Katrina in Mississippi. Revealing change with conventional landscape photography, a process known as repeat photography, is common in the natural sciences. Simply stated, repeat photography is the practice of re-photographing the same scene as it appears in an earlier photograph. Photographs were taken at 131 sites every six months over a three-year period. Each photograph was assigned a recovery score and a spatially interpolated recovery surface was generated for each time period. The mapped and graphed results show disparities in the progression of recovery: some communities quickly entered the rebuilding process whereas others have lagged far behind.

  13. Chloride permeability of concrete under static and repeated compressive loading

    Energy Technology Data Exchange (ETDEWEB)

    Saito, Mitsuru; Ishimori, Hiroshi [Kanazawa Inst. of Technology, Ishikawa (Japan)

    1995-05-01

    The chloride permeability of normal weight concrete subjected to static and repeated compressive loading was evaluated by using the AASHTO T277 test method. The results of concrete under static loading showed that the application of loads up to 90% of the ultimate strength had little effect on the chloride permeability. It was found from the results of concrete under repeated loading that load repetitions at the maximum stress levels of 60% or more caused the chloride permeability to increase significantly. The test results also indicated that the chloride permeability of concrete subjected to static and repeated loading increased at an increasing rate with its residual strain. The relation between the chloride permeability obtained and the cracking behavior of concrete previously reported was discussed.

  14. Coevolution between simple sequence repeats (SSRs and virus genome size

    Directory of Open Access Journals (Sweden)

    Zhao Xiangyan

    2012-08-01

    Full Text Available Abstract Background Relationship between the level of repetitiveness in genomic sequence and genome size has been investigated by making use of complete prokaryotic and eukaryotic genomes, but relevant studies have been rarely made in virus genomes. Results In this study, a total of 257 viruses were examined, which cover 90% of genera. The results showed that simple sequence repeats (SSRs is strongly, positively and significantly correlated with genome size. Certain repeat class is distributed in a certain range of genome sequence length. Mono-, di- and tri- repeats are widely distributed in all virus genomes, tetra- SSRs as a common component consist in genomes which more than 100 kb in size; in the range of genome  Conclusions We conducted this research standing on the height of the whole virus. We concluded that genome size is an important factor in affecting the occurrence of SSRs; hosts are also responsible for the variances of SSRs content to a certain degree.

  15. Assessing agreement with repeated measures for random observers.

    Science.gov (United States)

    Chen, Chia-Cheng; Barnhart, Huiman X

    2011-12-30

    Agreement studies are often concerned with assessing whether different observers for measuring responses on the same subject or sample can produce similar results. The concordance correlation coefficient (CCC) is a popular index for assessing the closeness among observers for quantitative measurements. Usually, the CCC is used for data without and with replications based on subject and observer effects only. However, we cannot use this methodology if repeated measurements rather than replications are collected. Although there exist some CCC-type indices for assessing agreement with repeated measurements, there is no CCC for random observers and random time points. In this paper, we propose a new CCC for repeated measures where both observers and time points are treated as random effects. A simulation study demonstrates our proposed methodology, and we use vertebral body data and image data for illustrations.

  16. A Novel Algorithm for Finding Interspersed Repeat Regions

    Institute of Scientific and Technical Information of China (English)

    Dongdong Li; Zhengzhi Wang; Qingshan Ni

    2004-01-01

    The analysis of repeats in the DNA sequences is an important subject in bioinformatics. In this paper, we propose a novel projection-assemble algorithm to find unknown interspersed repeats in DNA sequences. The algorithm employs random projection algorithm to obtain a candidate fragment set, and exhaustive search algorithm to search each pair of fragments from the candidate fragment set to find potential linkage, and then assemble them together. The complexity of our projection-assemble algorithm is nearly linear to the length of the genome sequence, and its memory usage is limited by the hardware. We tested our algorithm with both simulated data and real biology data, and the results show that our projection-assemble algorithm is efficient. By means of this algorithm, we found an un-labeled repeat region that occurs five times in Escherichia coli genome, with its length more than 5,000 bp, and a mismatch probability less than 4%.

  17. A PLL Synthesizer with Learning Repeatable Fluctuation of Input Signal

    Science.gov (United States)

    Ono, Hiroyuki

    This paper describes a high frequency PLL (Phase Locked Loop) synthesizer with a function of learning then eliminating repeatable fluctuation of timing intervals on series input pulses. Typical spindle encoder generates digital pulses according to the revolution speed. The intervals of each pulse have repeatable fluctuation every revolution by eccentricity or warpage of the encoder scale disk. This method provides a programmable counter for the loop counter of PLL circuit and an interval counter with memory in order to learn the repeatable fluctuation. After the learning process, the PLL generates very pure tone clock signal based on the real flutter components of the spindle revolution speed without influenced by encoder errors. This method has been applied to a hard disk test system in order to generate 3GHz read/write clock.

  18. The effects of repeated idea elaboration on unconscious plagiarism.

    Science.gov (United States)

    Stark, Louisa-Jayne; Perfect, Timothy J

    2008-01-01

    Unconscious plagiarism occurs in a recall task when someone presents someone else's idea as his or her own. Recent research has shown that the likelihood of such an error is inflated if the idea is improved during the retention interval, but not if it is imagined. Here, we explore the effects of repeating the elaboration phase during the retention interval. Participants in a group first generated alternate uses to common objects before elaborating the ideas either by imagining them or by improving them. This elaboration phase occurred once, twice, or not at all. Later, they attempted to recall their original ideas and generate new ideas. Repeated imagery did not inflate unconscious plagiarism on either task. In contrast, repeating the improvement phase increased plagiarism to dramatically high levels in the recall task. The latter effect might be particularly pertinent to real-world cases of plagiarism in which the ideas under dispute have been the subject of creative development over many occasions.

  19. Repeated Games With Intervention: Theory and Applications in Communications

    CERN Document Server

    Xiao, Yuanzhang; van der Schaar, Mihaela

    2011-01-01

    In communication systems where users share common resources, users' selfish behavior usually results in suboptimal resource utilization. There have been extensive works that model communication systems with selfish users as one-shot games and propose incentive schemes to achieve Pareto optimal action profiles as non-cooperative equilibria. However, in many communication systems, due to strong negative externalities among users, the sets of feasible payoffs in one-shot games are nonconvex. Thus, it is possible to expand the set of feasible payoffs by having users choose convex combinations of different payoffs. In this paper, we propose a repeated game model generalized by intervention. First, we use repeated games to convexify the set of feasible payoffs in one-shot games. Second, we combine conventional repeated games with intervention, originally proposed for one-shot games, to achieve a larger set of equilibrium payoffs and loosen requirements for users' patience to achieve it. We study the problem of maxi...

  20. Archery performance level and repeatability of event-related EMG.

    Science.gov (United States)

    Soylu, A R; Ertan, H; Korkusuz, F

    2006-12-01

    The purpose of the current study was to compare the repeatability of electromyographic linear envelopes (LE) of archery groups. Surface electromyography (EMG) signals of musculus flexor digitorum superficialis (MFDS) and extensor digitorum (MED) of 23 participants (seven skilled, six beginner archers and ten non-archers) were recorded during archery shooting. Two-second periods (clicker falls at first second) of 12 shots' EMG data were recorded, full-wave rectified and filtered (60 ms moving-average filter) for each participant's drawing arm. Repeatability was investigated by using a statistical criterion, variance ratio (VR). Archers' performances were evaluated in terms of FITA scores. The results showed that FITA scores were significantly correlated to the VRs of MFDS and MED. EMG LEs were more repeatable among archers than non-archers. Therefore, we inferred that VRs of MFDS and MED might be important variables for (a) assessing shooting techniques, (b) evaluation of archers' progress, and (c) selection of talented archers.