WorldWideScience

Sample records for repeat breeding syndrome

  1. Repeat breeding: Incidence, risk factors and diagnosis in buffaloes

    Directory of Open Access Journals (Sweden)

    Chandra Shekher Saraswat

    2016-04-01

    Full Text Available Repeat breeding in buffaloes was evaluated in terms of incidence, risk factors and diagnosis. The incidence of repeat breeding is low in buffaloes however in different studies the incidence varied from 0.70% to 30%. Because of seasonal suppression of fertility repeat breeding in buffaloes should be limited to the breeding season. Spring and winter calving, first parity, peri-parturient disease and lactation are significant risk factors for repeat breeding in buffaloes. The etiologies of repeat breeding in buffaloes can be failure of fertilization and early embryonic deaths. Only a few of causes of failure of fertilization have been identified in buffaloes. Ovulatory disturbances and ovarian cysts are uncommon in buffaloes and cysts have poor clinical manifestation. Endometritis is the common female cause of fertilization failures in buffaloes whereas poor semen quality and improper insemination are the bull side factors for fertilization failures. Early embryonic deaths are common in buffaloes mated/inseminated during the end of the breeding season due to a low luteal progesterone however embryonic deaths occur late (<25 days in buffaloes. Diagnostic approaches for repeat breeding include vaginoscopic and transrectal examination and uterine cytology for genital health. More precise evaluations of the ovarian and uterine function can be obtained by ultrasonographic and hysteroscopic examinations performed sequentially however, precise diagnosis of the cause of repeat breeding seems difficult.

  2. Repeatable timing of northward departure, arrival and breeding in Black-tailed Godwits

    NARCIS (Netherlands)

    Lourenço, P.M.; Kentie, R.; Schroeder, J.; Groen, N.M.; Hooijmeijer, J.C.E.W.; Piersma, T.

    2011-01-01

    When early breeding is advantageous, migrants underway to the breeding areas may be time stressed. The timing of sequential events such as migration and breeding is expected to be correlated because of a "domino effect", and would be of particular biological importance if timings are repeatable with

  3. Repeatable timing of northward departure, arrival and breeding in Black-tailed Godwits

    NARCIS (Netherlands)

    Lourenço, P.M.; Kentie, R.; Schroeder, J.; Groen, N.M.; Hooijmeijer, J.C.E.W.; Piersma, T.

    2011-01-01

    When early breeding is advantageous, migrants underway to the breeding areas may be time stressed. The timing of sequential events such as migration and breeding is expected to be correlated because of a "domino effect", and would be of particular biological importance if timings are repeatable

  4. Repeatable timing of northward departure, arrival and breeding in Black-tailed Godwits Limosa l. limosa, but no domino effects

    NARCIS (Netherlands)

    Lourenco, Pedro M.; Kentie, Rosemarie; Schroeder, Julia; Groen, Niko M.; Piersma, Theunis; Bairlein, F.; Hooijmeijer, Jos C.E.W.

    2011-01-01

    When early breeding is advantageous, migrants underway to the breeding areas may be time stressed. The timing of sequential events such as migration and breeding is expected to be correlated because of a "domino effect", and would be of particular biological importance if timings are repeatable

  5. Automated Detection of Trinucleotide Repeats in Fragile X Syndrome.

    Science.gov (United States)

    Hamdan; Tynan; Fenwick; Leon

    1997-12-01

    Background: The conventional method for diagnosis of fragile X syndrome has been amplification of the trinucleotide repeat region of the FMR-1 gene by polymerase chain reaction (PCR) and Southern blot analysis to detect full expansion and hypermethylation. "Stuttering" resulting from incomplete amplification is still observed in the PCR products despite the use of reagents that reduce the secondary structure of the GC-rich template. In addition, PCR products can be detected by autoradiography only after 1 to 2 days of exposure. By combination of a recently reported amplification protocol with fluorescence detection of PCR products in an automated DNA sequencer, the PCR protocol for amplification of trinucleotide repeats was simplified. This modified protocol is highly reproducible, more accurate, and less costly than the conventional protocol because of the elimination of radioisotopes from the PCR. Methods and Results: PCRs were conducted with betaine and Pfu DNA polymerase. This improved PCR protocol allowed immediate detection of PCR products in agarose gels containing ethidium bromide. Stuttering was completely eliminated and fragments of up to 1kb ( approximately 250 repeats) were visible in agarose gels. PCR products were automatically detected by laser fluorescence in an automated DNA sequencer by inclusion of a fluorescently-labeled primer in the PCR reaction. A short electrophoresis run of 100 minutes in denaturing acrylamide gels was sufficient to give high resolution of fragments with higher accuracy and sensitivity than conventional detection by autoradiography. Conclusions: A simple, nonradioactive protocol that is more rapid and less expensive than the conventional PCR protocol for the detection of trinucleotide repeats has been developed. By use of this detection protocol, fragment sizes containing up to 100 repeats could be detected, alleles differing by one trinucleotide repeat were clearly resolved, and heterogeneous repeat patterns such as those

  6. Blood haematological and biochemical parameters in normal cycling, pregnant and repeat breeding buffaloes (Bubalus bubalis) maintained in isothermic and isonutritional conditions

    Institute of Scientific and Technical Information of China (English)

    Anthony Sabasthin; Venkataswamy Girish Kumar; Sumanta Nandi

    2012-01-01

    Objective:The present study was envisaged to examine the hematological and biochemical, parameters in three different groups of buffaloes (regularly cycling, pregnant and repeat breeding) maintained in isothermic and isonutritional conditions to establish the variations in blood and/or serum components in these groups.Methods:Blood samples were analyzed for hemoglobin, PCV, TLC, neutophil, lymphocyte, eosinophil, and monocyte count, glucose, total protein, albumin, globulin, urea and cholesterol.Results:The results revealed significantly lower haemoglobin and packed cell volume value in repeat breeding when compared to pregnant and regularly cycling animals. The WBC value significantly higher in repeat breeding when compared to regularly cycling animals. The average mean values of neutrophils, lymphocyte and eosinophils revealed a no significant difference in the neutrophils, lymphocyte and eosinophils in between the group. The mean values of monocytes revealed a significantly higher value in repeat breeding animals when compared to pregnant animals. The serum glucose, total protein, cholesterol and urea levels were significantly lower in repeat breeding compared to pregnant and regularly cycling animals. The levels of albumin and globulin revealed non-significant difference among the groups.Conclusions: A significant decrease in the hemoglobin, PCV, glucose, total protein, cholesterol and urea was observed in the repeat breeding animals when compared to pregnant and regularly cycling animals.

  7. Reticulate phylogeny of gastropod-shell-breeding cichlids from Lake Tanganyika – the result of repeated introgressive hybridization

    Directory of Open Access Journals (Sweden)

    Blanc Michel

    2007-01-01

    Full Text Available Abstract Background The tribe Lamprologini is the major substrate breeding lineage of Lake Tanganyika's cichlid species flock. Among several different life history strategies found in lamprologines, the adaptation to live and breed in empty gastropod shells is probably the most peculiar. Although shell-breeding arose several times in the evolutionary history of the lamprologines, all obligatory and most facultative shell-breeders belong to the so called "ossified group", a monophyletic lineage within the lamprologine cichlids. Since their distinctive life style enables these species to live and breed in closest vicinity, we hypothesized that these cichlids might be particularly prone to accidental hybridization, and that introgression might have affected the evolutionary history of this cichlid lineage. Results Our analyses revealed discrepancies between phylogenetic hypotheses based on mitochondrial and nuclear (AFLP data. While the nuclear phylogeny was congruent with morphological, behavioral and ecological characteristics, several species – usually highly specialized shell-breeders – were placed at contradicting positions in the mitochondrial phylogeny. The discordant phylogenies strongly suggest repeated incidents of introgressive hybridization between several distantly related shell-breeding species, which reticulated the phylogeny of this group of cichlids. Long interior branches and high bootstrap support for many interior nodes in the mitochondrial phylogeny argue against a major effect of ancient incomplete lineage sorting on the phylogenetic reconstruction. Moreover, we provide morphological and genetic (mtDNA and microsatellites evidence for ongoing hybridization among distantly related shell-breeders. In these cases, the territorial males of the inferred paternal species are too large to enter the shells of their mate, such that they have to release their sperm over the entrance of the shell to fertilize the eggs. With sperm

  8. Repeated embryo collection and interspecies transfer in alpacas and llamas during non-breeding season

    Directory of Open Access Journals (Sweden)

    Pacheco J

    2015-08-01

    Full Text Available Sexual behavior evaluation was evaluated, collecting and interspecies embryo transfer inter species in llamas and alpacas during non-breeding season, 10 and 10 donor alpacas llamas, alpacas and 20 receiving 20 llamas, 5 alpacas and 5 llamas males were used. Sexual behavior by libido in males and acceptance of female to male in the presence of a dominant follicle was evaluated, the collection of embryos simple ovulation by non-surgical technique was performed and the fresh embryos are transferred directly into the horn left. It was observed that only 40% of alpaca accept the male and female in all cases had to use two males for mating, but all llama males mounted on the first attempt and accepted all females breeding. Embryos were collected at 25 and 60% of alpacas and llamas washes respectively, all were grade 1 embryos transferable; the embryo transfer fertility evaluated by ultrasound at 25 days was 100 and 41.6% respectively for donor alpaca and llama, however ultrasound evaluation at 60 days fertility was 50 and 25% respectively for donor alpaca and llama. We conclude that there is greater reproductive seasonality in alpaca regard to llamas, all were grade 1 embryos collected, fertility evaluated by ultrasound 25 days down to 60 days, demonstrating embryonic mortality, possibly due to the non-breeding season of both species.

  9. Comparison of random regression and repeatability models to predict breeding values from test-day records of Norwegian goats.

    Science.gov (United States)

    Andonov, S; Ødegård, J; Svendsen, M; Ådnøy, T; Vegara, M; Klemetsdal, G

    2013-03-01

    One aim of the research was to challenge a previously selected repeatability model with 2 other repeatability models. The main aim, however, was to evaluate random regression models based on the repeatability model with lowest mean-squared error of prediction, using Legendre polynomials up to third order for both animal additive genetic and permanent environmental effects. The random regression and repeatability models were compared for model fit (using likelihood-ratio testing, Akaike information criterion, and the Bayesian information criterion) and the models' mean-squared errors of prediction, and by cross-validation. Cross-validation was carried out by correlating excluded observations in one data set with the animals' breeding values as predicted from the pedigree only in the remaining data, and vice versa (splitting proportion: 0.492). The data was from primiparous goats in 2 closely tied buck circles (17 flocks) in Norway, with 11,438 records for daily milk yield and 5,686 to 5,896 records for content traits (fat, protein, and lactose percentages). A simple pattern was revealed; for daily milk yield with about 5 records per animal in first lactation, a second-order random regression model should be chosen, whereas for content traits that had only about 3 observations per goat, a first-order polynomial was preferred. The likelihood-ratio test, Akaike information criterion, and mean-squared error of prediction favored more complex models, although the results from the latter and the Bayesian information criterion were in the direction of those obtained with cross-validation. As the correlation from cross-validation was largest with random regression, genetic merit was predicted more accurate with random regression models than with the repeatability model.

  10. DNA methylation and triplet repeat stability: New proposals addressing actual questions on the CGG repeat of fragile X syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Woehrle, D.; Schwemmle, S.; Steinbach, P. [Univ. of Ulm (Germany)

    1996-08-09

    Methylation of expanded CGG repeats in the FMR1 gene may well have different consequences. One is that methylation, extending into upstream regulatory elements, could lead to gene inactivation. Another effect of methylation, which we have obtained evidence for, could be stabilization of the repeat sequence and even prevention of premutations from expansion to full mutation. The full mutation of the fragile X syndrome probably occurs in an early transitional stage of embryonic development. The substrate is a maternally inherited premutation. The product usually is a mosaic pattern of full mutations detectable in early fetal life. These full mutation patterns are mitotically stable as, for instance, different somatic tissues of full mutation fetuses show identical mutation patterns. This raised the following questions: What triggers repeat expansion in that particular stage of development and what causes subsequent mitotic stability of expanded repeats? 21 refs., 1 fig.

  11. Diversity and genetic stability in banana genotypes in a breeding program using inter simple sequence repeats (ISSR) markers.

    Science.gov (United States)

    Silva, A V C; Nascimento, A L S; Vitória, M F; Rabbani, A R C; Soares, A N R; Lédo, A S

    2017-02-23

    Banana (Musa spp) is a fruit species frequently cultivated and consumed worldwide. Molecular markers are important for estimating genetic diversity in germplasm and between genotypes in breeding programs. The objective of this study was to analyze the genetic diversity of 21 banana genotypes (FHIA 23, PA42-44, Maçã, Pacovan Ken, Bucaneiro, YB42-47, Grand Naine, Tropical, FHIA 18, PA94-01, YB42-17, Enxerto, Japira, Pacovã, Prata-Anã, Maravilha, PV79-34, Caipira, Princesa, Garantida, and Thap Maeo), by using inter-simple sequence repeat (ISSR) markers. Material was generated from the banana breeding program of Embrapa Cassava & Fruits and evaluated at Embrapa Coastal Tablelands. The 12 primers used in this study generated 97.5% polymorphism. Four clusters were identified among the different genotypes studied, and the sum of the first two principal components was 48.91%. From the Unweighted Pair Group Method using Arithmetic averages (UPGMA) dendrogram, it was possible to identify two main clusters and subclusters. Two genotypes (Garantida and Thap Maeo) remained isolated from the others, both in the UPGMA clustering and in the principal cordinate analysis (PCoA). Using ISSR markers, we could analyze the genetic diversity of the studied material and state that these markers were efficient at detecting sufficient polymorphism to estimate the genetic variability in banana genotypes.

  12. Clinical and Breed Characteristics of Idiopathic Head Tremor Syndrome in 291 Dogs: A Retrospective Study

    Directory of Open Access Journals (Sweden)

    Linda G. Shell

    2015-01-01

    Full Text Available Objective. To establish signalment and phenomenology of canine idiopathic head tremor syndrome (IHTS, an episodic head movement disorder of undetermined pathogenesis. Design. Retrospective case series. Animals. 291 dogs with IHTS diagnosed between 1999 and 2013. Procedures. Clinical information was obtained from an online community of veterinary information aggregation and exchange (Veterinary Information Network, 777 W Covell Boulevard, Davis, CA 95616 and conducted with their approval. Information on breed, sex, age of onset, tremor description, mentation during the event, effect of distractions and drugs, diagnostics, presence of other problems, and outcome was analyzed. Results. IHTS was found in 24 pure breeds. Bulldogs, Labrador Retrievers, Boxers, and Doberman Pinschers comprised 69%; mixed breeds comprised 17%. Average onset age was 29 months (range: 3 months to 12 years. First episode occurred before 48 months of age in 88%. Vertical (35%, horizontal (50%, and rotational (15% movements were documented. Possible trigger events were found in 21%. Mentation was normal in 93%. Distractions abated the tremor in 87%. Most dogs did not respond to antiepileptic drugs. Conclusions and Clinical Relevance. This retrospective study documents IHTS in many breeds including Labrador Retrievers, Boxers, and mixed breeds.

  13. A case presentation of spider lamb syndrome in a Kermanian breed lamb

    Science.gov (United States)

    Nazem, Mohammad Naser; Shojaei, Bahador; Asadi, Akbar; Hasanzadeh, Mohammad

    2015-01-01

    Skeletal abnormalities are most often used to describe defects in the arms or legs that are associated with genes or chromosomes, or that occur due to an event that happens during pregnancy. Spider lamb syndrome (SLS) is a congenital disorder in sheep breeding that is recognized by some deformities in skeletal system especially in the limbs. A dead day-old cross-breed white lamb with deformed limbs was referred to the anatomy hall of the Veterinary Faculty of Shahid Bahonar University of Kerman. In the external examination, the lamb was very skinny and in the facial region, superior brachygnathia with a slight Roman nose were observed. Metacarpal and metatarsal regions were more elongated than that expected. Also Metacarpal and metatarsal bones were as long as the antebrachial and crural regions, respectively. This paper, the first report of this syndrome in Iran, described the anatomic and radiographic features of the skeletal deformities in a day-old dead Kermanian breed lamb. PMID:26973772

  14. Effect of sera of normal cycling, pregnant and repeat breeding buffaloes (Bubalus bubalis) on in vitro maturation of buffalo, sheep and goat oocytes

    Institute of Scientific and Technical Information of China (English)

    Anthony Sabasthin; Sumanta Nandi; Venkataswamy Girish Kumar

    2013-01-01

    Objective: To examine the oocytes maturation capacity of buffalo, sheep and goat using media containing sera of three different groups of buffaloes (regularly cycling, pregnant and repeat breeding). Methods: The buffalo, sheep and goat oocytes were matured under suitable conditions in medium containing sera of regularly cycling, pregnant and repeat breeding buffaloes. Results:The oocytes maturation rate containing buffalo oocytes cultured in media containing sera of the control group and regularly cycling group were not significantly different. However when oocytes cultured in the media containing sera of pregnant buffaloes the maturation rate were significantly declined. Further significant declined in maturation rate were observed when oocytes cultured in media containing sera of repeat breeding buffaloes. When sheep and goat oocytes cultured in the media containing control, pregnant and regularly cycling animals sera the oocytes maturation rate were not significantly different. A significant decline in maturation rate of sheep and goat oocytes were observed, when oocytes cultured in media containing sera of repeat breeding buffaloes. Conclusion: We may conclude that serum collected from normal cycling buffaloes can be used for oocytes maturation in both homogeneous and heterogeneous species.

  15. Promoter-bound trinucleotide repeat mRNA drives epigenetic silencing in fragile X syndrome.

    Science.gov (United States)

    Colak, Dilek; Zaninovic, Nikica; Cohen, Michael S; Rosenwaks, Zev; Yang, Wang-Yong; Gerhardt, Jeannine; Disney, Matthew D; Jaffrey, Samie R

    2014-02-28

    Epigenetic gene silencing is seen in several repeat-expansion diseases. In fragile X syndrome, the most common genetic form of mental retardation, a CGG trinucleotide-repeat expansion adjacent to the fragile X mental retardation 1 (FMR1) gene promoter results in its epigenetic silencing. Here, we show that FMR1 silencing is mediated by the FMR1 mRNA. The FMR1 mRNA contains the transcribed CGG-repeat tract as part of the 5' untranslated region, which hybridizes to the complementary CGG-repeat portion of the FMR1 gene to form an RNA·DNA duplex. Disrupting the interaction of the mRNA with the CGG-repeat portion of the FMR1 gene prevents promoter silencing. Thus, our data link trinucleotide-repeat expansion to a form of RNA-directed gene silencing mediated by direct interactions of the trinucleotide-repeat RNA and DNA.

  16. Promoter-Bound Trinucleotide Repeat mRNA Drives Epigenetic Silencing in Fragile X Syndrome

    OpenAIRE

    Colak, Dilek; Zaninovic, Nikica; Cohen, Michael S.; Rosenwaks, Zev; Yang, Wang-Yong; Gerhardt, Jeannine; Disney, Matthew D.; Jaffrey, Samie R.

    2014-01-01

    Epigenetic gene silencing is seen in several repeat-expansion diseases. In fragile X syndrome, the most common genetic form of mental retardation, a CGG trinucleotide–repeat expansion adjacent to the fragile X mental retardation 1 (FMR1) gene promoter results in its epigenetic silencing. Here, we show that FMR1 silencing is mediated by the FMR1 mRNA. The FMR1 mRNA contains the transcribed CGG-repeat tract as part of the 5′ untranslated region, which hybridizes to the complementary CGG-repeat ...

  17. Development of Highly Informative Genome-Wide Single Sequence Repeat Markers for Breeding Applications in Sesame and Construction of a Web Resource: SisatBase

    Science.gov (United States)

    Dossa, Komivi; Yu, Jingyin; Liao, Boshou; Cisse, Ndiaga; Zhang, Xiurong

    2017-01-01

    The sequencing of the full nuclear genome of sesame (Sesamum indicum L.) provides the platform for functional analyses of genome components and their application in breeding programs. Although the importance of microsatellites markers or simple sequence repeats (SSR) in crop genotyping, genetics, and breeding applications is well established, only a little information exist concerning SSRs at the whole genome level in sesame. In addition, SSRs represent a suitable marker type for sesame molecular breeding in developing countries where it is mainly grown. In this study, we identified 138,194 genome-wide SSRs of which 76.5% were physically mapped onto the 13 pseudo-chromosomes. Among these SSRs, up to three primers pairs were supplied for 101,930 SSRs and used to in silico amplify the reference genome together with two newly sequenced sesame accessions. A total of 79,957 SSRs (78%) were polymorphic between the three genomes thereby suggesting their promising use in different genomics-assisted breeding applications. From these polymorphic SSRs, 23 were selected and validated to have high polymorphic potential in 48 sesame accessions from different growing areas of Africa. Furthermore, we have developed an online user-friendly database, SisatBase (http://www.sesame-bioinfo.org/SisatBase/), which provides free access to SSRs data as well as an integrated platform for functional analyses. Altogether, the reference SSR and SisatBase would serve as useful resources for genetic assessment, genomic studies, and breeding advancement in sesame, especially in developing countries. PMID:28878802

  18. Development of Highly Informative Genome-Wide Single Sequence Repeat Markers for Breeding Applications in Sesame and Construction of a Web Resource: SisatBase

    Directory of Open Access Journals (Sweden)

    Komivi Dossa

    2017-08-01

    Full Text Available The sequencing of the full nuclear genome of sesame (Sesamum indicum L. provides the platform for functional analyses of genome components and their application in breeding programs. Although the importance of microsatellites markers or simple sequence repeats (SSR in crop genotyping, genetics, and breeding applications is well established, only a little information exist concerning SSRs at the whole genome level in sesame. In addition, SSRs represent a suitable marker type for sesame molecular breeding in developing countries where it is mainly grown. In this study, we identified 138,194 genome-wide SSRs of which 76.5% were physically mapped onto the 13 pseudo-chromosomes. Among these SSRs, up to three primers pairs were supplied for 101,930 SSRs and used to in silico amplify the reference genome together with two newly sequenced sesame accessions. A total of 79,957 SSRs (78% were polymorphic between the three genomes thereby suggesting their promising use in different genomics-assisted breeding applications. From these polymorphic SSRs, 23 were selected and validated to have high polymorphic potential in 48 sesame accessions from different growing areas of Africa. Furthermore, we have developed an online user-friendly database, SisatBase (http://www.sesame-bioinfo.org/SisatBase/, which provides free access to SSRs data as well as an integrated platform for functional analyses. Altogether, the reference SSR and SisatBase would serve as useful resources for genetic assessment, genomic studies, and breeding advancement in sesame, especially in developing countries.

  19. Cross-trimester repeated measures testing for Down's syndrome screening: an assessment.

    LENUS (Irish Health Repository)

    Wright, D

    2010-07-01

    To provide estimates and confidence intervals for the performance (detection and false-positive rates) of screening for Down\\'s syndrome using repeated measures of biochemical markers from first and second trimester maternal serum samples taken from the same woman.

  20. Analysis of genetic diversity and population structure of peanut cultivars and breeding lines from China, India and the US using simple sequence repeat markers.

    Science.gov (United States)

    Wang, Hui; Khera, Pawan; Huang, Bingyan; Yuan, Mei; Katam, Ramesh; Zhuang, Weijian; Harris-Shultz, Karen; Moore, Kim M; Culbreath, Albert K; Zhang, Xinyou; Varshney, Rajeev K; Xie, Lianhui; Guo, Baozhu

    2016-05-01

    Cultivated peanut is grown worldwide as rich-source of oil and protein. A broad genetic base is needed for cultivar improvement. The objectives of this study were to develop highly informative simple sequence repeat (SSR) markers and to assess the genetic diversity and population structure of peanut cultivars and breeding lines from different breeding programs in China, India and the US. A total of 111 SSR markers were selected for this study, resulting in a total of 472 alleles. The mean values of gene diversity and polymorphic information content (PIC) were 0.480 and 0.429, respectively. Country-wise analysis revealed that alleles per locus in three countries were similar. The mean gene diversity in the US, China and India was 0.363, 0.489 and 0.47 with an average PIC of 0.323, 0.43 and 0.412, respectively. Genetic analysis using the STRUCTURE divided these peanut lines into two populations (P1, P2), which was consistent with the dendrogram based on genetic distance (G1, G2) and the clustering of principal component analysis. The groupings were related to peanut market types and the geographic origin with a few admixtures. The results could be used by breeding programs to assess the genetic diversity of breeding materials to broaden the genetic base and for molecular genetics studies.

  1. Analysis of genetic diversity and population structure of peanut cultivars and breeding lines from China, India and the US using simple sequence repeat markers

    Institute of Scientific and Technical Information of China (English)

    Hui Wang; Xinyou Zhang; Rajeev K. Varshney; Lianhui Xie; Baozhu Guo; Pawan Khera; Bingyan Huang; Mei Yuan; Ramesh Katam; Weijian Zhuang; Karen Harris-Shultz; Kim M. Moore; Albert K. Culbreath

    2016-01-01

    Cultivated peanut is grown worldwide as rich-source of oil and protein. A broad genetic base is needed for cultivar improvement. The objectives of this study were to develop highly informative simple sequence repeat (SSR) markers and to assess the genetic diversity and population structure of peanut cultivars and breeding lines from different breeding programs in China, India and the US. A total of 111 SSR markers were selected for this study, resulting in a total of 472 alleles. The mean values of gene diversity and polymorphic information content (PIC) were 0.480 and 0.429, respectively. Country-wise analysis revealed that alleles per locus in three countries were similar. The mean gene diversity in the US, China and India was 0.363, 0.489 and 0.47 with an average PIC of 0.323, 0.43 and 0.412, respectively. Genetic analysis using the STRUCTURE divided these peanut lines into two populations (P1, P2), which was consistent with the dendro-gram based on genetic distance (G1, G2) and the clustering of principal component analysis. The groupings were related to peanut market types and the geographic origin with a few admixtures. The results could be used by breeding programs to assess the genetic diversity of breeding materials to broaden the genetic base and for molecular genetics studies.

  2. Repeatability of baseline corticosterone and short-term corticosterone stress responses, and their correlation with testosterone and body condition in a terrestrial breeding anuran (Platymantis vitiana).

    Science.gov (United States)

    Narayan, Edward J; Cockrem, John F; Hero, Jean-Marc

    2013-06-01

    Repeatability of physiological response variables, such as the stress hormone corticosterone, across numerous sampling occasions is an important assumption for their use as predictors of behaviour, reproduction and fitness in animals. Very few studies have actually tested this assumption in free-living animals under uncontrolled natural conditions. Non-invasive urine sampling and standard capture handling protocol have enabled the rapid quantification of baseline corticosterone and short-term corticosterone stress responses in anuran amphibians. In this study, established non-invasive methods were used to monitor physiological stress and urinary testosterone levels in male individuals of the terrestrial breeding Fijian ground frog (Platymantis vitiana). Adult male frogs (n = 20) were sampled at nighttime on three repeated occasions at intervals of 14 days during their annual breeding season on Viwa Island, Fiji. All frogs expressed urinary corticosterone metabolite responses to the capture and handling stressor, with some frogs showing consistently higher urinary corticosterone responses than others. Ranks of corticosterone values at 0, 4 and 8 h, and the corrected rank were highly significant (r = 0.75-0.99) between the three repeated sampling occasions. Statistical repeatabilities were high for baseline corticosterone (r = 0.973) and for corticosterone values at 2 h (r = 0.862), 4 h (r = 0.861), 6 h (r = 0.820) and 8 h (r = 0.926), and also for the total (inclusive of baseline corticosterone values) and the corrected integrated responses (index of the acute response) [r = 0.867 and r = 0.870]. Urinary testosterone levels also showed high statistical repeatability (r = 0.78). Furthermore, variation in baseline and short-term corticosterone stress responses was greater between individuals than within individuals. Baseline urinary corticosterone was significantly negatively correlated with the corrected integrated corticosterone response (r = -0.3, p breeding period

  3. Neuropharmacological lesion localization in idiopathic Horner's syndrome in Golden Retrievers and dogs of other breeds.

    Science.gov (United States)

    Simpson, Katherine M; Williams, David L; Cherubini, Giunio B

    2015-01-01

    To investigate whether idiopathic Horner's syndrome (HS) in Golden Retrievers is an exclusively preganglionic disorder based on denervation hypersensitivity pharmacological testing with phenylephrine. Medical records of dogs presented with HS between 2000 and 2012. Dogs presented with additional ocular or systemic signs were excluded. Clinical data examined included age, sex, duration of clinical signs, ancillary diagnostic test results, and time to mydriasis on topical ocular application of 1% phenylephrine. Lesions were diagnosed as postganglionic (mydriasis within 20 min) or preganglionic (mydriasis between 20 and 45 min). Medical records of 21 dogs of nine different breeds were included. An etiopathogenesis for Horner's syndrome was determined in five dogs, none of which were Golden Retrievers. All diagnoses correlated with pharmacological lesion localization. Ten Golden Retrievers were included (eight male and two female) with a mean age of 8.5 years (range: 4-13). Lesion localization was diagnosed as postganglionic in eight (mean: 10 min [range: 6-18]) and preganglionic in two Golden Retrievers (20 and 24 min). All cases were unilateral and had completely resolved within 15 weeks (range: 11-20). Recurrence was not reported in any of the patients. Idiopathic postganglionic HS was diagnosed in eight of 10 Golden Retrievers contradicting previous reports of a purely preganglionic localization. Etiopathogenesis of canine idiopathic HS remains to be determined; nevertheless, a vascular etiology cannot be excluded. Future studies using magnetic resonance angiography may aid in clarifying the pathogenesis. © 2013 American College of Veterinary Ophthalmologists.

  4. Telomere and ribosomal DNA repeats are chromosomal targets of the bloom syndrome DNA helicase

    Directory of Open Access Journals (Sweden)

    Paric Enesa

    2003-10-01

    Full Text Available Abstract Background Bloom syndrome is one of the most cancer-predisposing disorders and is characterized by genomic instability and a high frequency of sister chromatid exchange. The disorder is caused by loss of function of a 3' to 5' RecQ DNA helicase, BLM. The exact role of BLM in maintaining genomic integrity is not known but the helicase has been found to associate with several DNA repair complexes and some DNA replication foci. Results Chromatin immunoprecipitation of BLM complexes recovered telomere and ribosomal DNA repeats. The N-terminus of BLM, required for NB localization, is the same as the telomere association domain of BLM. The C-terminus is required for ribosomal DNA localization. BLM localizes primarily to the non-transcribed spacer region of the ribosomal DNA repeat where replication forks initiate. Bloom syndrome cells expressing the deletion alleles lacking the ribosomal DNA and telomere association domains have altered cell cycle populations with increased S or G2/M cells relative to normal. Conclusion These results identify telomere and ribosomal DNA repeated sequence elements as chromosomal targets for the BLM DNA helicase during the S/G2 phase of the cell cycle. BLM is localized in nuclear bodies when it associates with telomeric repeats in both telomerase positive and negative cells. The BLM DNA helicase participates in genomic stability at ribosomal DNA repeats and telomeres.

  5. Telomere and ribosomal DNA repeats are chromosomal targets of the bloom syndrome DNA helicase.

    Science.gov (United States)

    Schawalder, James; Paric, Enesa; Neff, Norma F

    2003-10-27

    Bloom syndrome is one of the most cancer-predisposing disorders and is characterized by genomic instability and a high frequency of sister chromatid exchange. The disorder is caused by loss of function of a 3' to 5' RecQ DNA helicase, BLM. The exact role of BLM in maintaining genomic integrity is not known but the helicase has been found to associate with several DNA repair complexes and some DNA replication foci. Chromatin immunoprecipitation of BLM complexes recovered telomere and ribosomal DNA repeats. The N-terminus of BLM, required for NB localization, is the same as the telomere association domain of BLM. The C-terminus is required for ribosomal DNA localization. BLM localizes primarily to the non-transcribed spacer region of the ribosomal DNA repeat where replication forks initiate. Bloom syndrome cells expressing the deletion alleles lacking the ribosomal DNA and telomere association domains have altered cell cycle populations with increased S or G2/M cells relative to normal. These results identify telomere and ribosomal DNA repeated sequence elements as chromosomal targets for the BLM DNA helicase during the S/G2 phase of the cell cycle. BLM is localized in nuclear bodies when it associates with telomeric repeats in both telomerase positive and negative cells. The BLM DNA helicase participates in genomic stability at ribosomal DNA repeats and telomeres.

  6. A Case with Repeated Recurrent Acute Coronary Syndrome due to Pseudoephedrine Use: Kounis Syndrome

    Directory of Open Access Journals (Sweden)

    Metin Çeliker

    2014-01-01

    Full Text Available Allergic reaction-associated acute coronary syndrome picture is defined as Kounis syndrome. Although drug use is the most common cause of allergic reaction, foods and environmental factors may also play a role in the etiology. Herein, a case with acute coronary syndrome that developed two times at 8-month interval due to pseudoephedrine use for upper respiratory tract infection is presented.

  7. Mechanism of Repeat-Associated MicroRNAs in Fragile X Syndrome

    Directory of Open Access Journals (Sweden)

    Karen Kelley

    2012-01-01

    Full Text Available The majority of the human genome is comprised of non-coding DNA, which frequently contains redundant microsatellite-like trinucleotide repeats. Many of these trinucleotide repeats are involved in triplet repeat expansion diseases (TREDs such as fragile X syndrome (FXS. After transcription, the trinucleotide repeats can fold into RNA hairpins and are further processed by Dicer endoribonuclases to form microRNA (miRNA-like molecules that are capable of triggering targeted gene-silencing effects in the TREDs. However, the function of these repeat-associated miRNAs (ramRNAs is unclear. To solve this question, we identified the first native ramRNA in FXS and successfully developed a transgenic zebrafish model for studying its function. Our studies showed that ramRNA-induced DNA methylation of the FMR1 5′-UTR CGG trinucleotide repeat expansion is responsible for both pathological and neurocognitive characteristics linked to the transcriptional FMR1 gene inactivation and the deficiency of its protein product FMRP. FMRP deficiency often causes synapse deformity in the neurons essential for cognition and memory activities, while FMR1 inactivation augments metabotropic glutamate receptor (mGluR-activated long-term depression (LTD, leading to abnormal neuronal responses in FXS. Using this novel animal model, we may further dissect the etiological mechanisms of TREDs, with the hope of providing insights into new means for therapeutic intervention.

  8. [A case of postcardiac injury syndrome with repeated pleuritis after blunt chest trauma].

    Science.gov (United States)

    Namba, Ryoichi; Yamamoto, Yusuke; Nawa, Takeshi; Endo, Katuyuki

    2009-12-01

    A 59-year-old man suffered blunt injury to the left chest during a fall in August 2004. He had 5 repeated episodes of back and left chest pain in three years since August 2005. Since these symptoms were accompanied by left pleural effusion and serum inflammatory reaction, the tentative diagnosis was pleuritis. Although examinations of pleural effusion showed exudation with marked augmentation of inflammatory cells, there were no findings that suggested the cause of repetitive pleuritis. All symptoms were relieved within one or two weeks following administration of non-steroid anti-inflammatory drugs. Surgical thoracoscopy was carried out to investigate the cause of repeated pleuritis, and an acquired deficit of the left pericardium was noted. We considered this case to be postcardiac injury syndrome causing repeated pleuritis following blunt chest injury.

  9. Presence of repeater F-waves in the early stage of Guillain-Barré syndrome.

    Science.gov (United States)

    Geijo-Barrientos, Emilio; González, Ofelia; Pastore-Olmedo, Carlos

    2012-03-01

    The absence or a prolonged latency of late responses, like F-waves, is a common neurophysiological finding with diagnostic utility in the early Guillain-Barré syndrome. However, the presence and the number of repeater F-waves have not been studied in this disease. In four patients, we report the transient presence of repeater F-waves in nerves of the lower limbs shortly after the onset of the disease. In each patient, the initial (diagnostic) nerve conduction study showed a high incidence of repeater F-waves in the tibial or in the peroneal nerves of one side, with normal distal motor latencies; in the other nerves explored the F-waves were fully abolished and the motor potentials were abnormal. In a second study, done 2-6 weeks later, we observed the abolition of the F-waves or a significant increase of its minimal latency in those nerves in which we had detected the repeaters. The presence of a high number of repeater F-waves with normal latencies in some nerves may be a transient and initial electrophysiological sign useful in the early diagnosis of this disease.

  10. RAN translation at CGG repeats induces ubiquitin proteasome system impairment in models of fragile X-associated tremor ataxia syndrome

    OpenAIRE

    Oh, Seok Yoon; He, Fang; Krans, Amy; Frazer, Michelle; Taylor, J. Paul; Paulson, Henry L.; Todd, Peter K

    2015-01-01

    Fragile X-associated tremor ataxia syndrome (FXTAS) is a neurodegenerative disorder caused by a CGG trinucleotide repeat expansion in the 5′ UTR of the Fragile X gene, FMR1. FXTAS is thought to arise primarily from an RNA gain-of-function toxicity mechanism. However, recent studies demonstrate that the repeat also elicits production of a toxic polyglycine protein, FMRpolyG, via repeat-associated non-AUG (RAN)-initiated translation. Pathologically, FXTAS is characterized by ubiquitin-positive ...

  11. Role of syndrome information on a one-way quantum repeater using teleportation-based error correction

    Science.gov (United States)

    Namiki, Ryo; Jiang, Liang; Kim, Jungsang; Lütkenhaus, Norbert

    2016-11-01

    We investigate a quantum repeater scheme for quantum key distribution based on the work by S. Muralidharan et al. [Phys. Rev. Lett. 112, 250501 (2014)], 10.1103/PhysRevLett.112.250501. Our scheme extends that work by making use of error syndrome measurement outcomes available at the repeater stations. We show how to calculate the secret key rates for the case of optimizing the syndrome information, while the known key rate is based on a scenario of coarse graining the syndrome information. We show that these key rates can surpass the Pirandola-Laurenza-Ottaviani-Banchi bound on secret key rates of direct transmission over lossy bosonic channels.

  12. A unified rapid PCR method for detection of normal and expanded trinucleotide alleles of CAG repeats in huntington chorea and CGG repeats in fragile X syndrome.

    Science.gov (United States)

    Todorov, Tihomir; Todorova, Albena; Georgieva, Bilyana; Mitev, Vanyo

    2010-06-01

    We report on a unified rapid betaine-based-PCR protocol for amplification of the (CAG)n region in Huntington disease (HD) and the (CGG)n region in Fragile X syndrome (FXS), followed by an electrophoretic separation on automated sequencer for precise determination of the triplet numbers. The high betaine concentration (2.5 M betaine) permits precise amplification of the CAG and CGG repeats. Ten HD affected patients and 10 healthy individuals from HD families were re-evaluated. For FXS the CGG region in normal individuals and premutations of about 100 repeats were precisely amplified by this protocol. Ten unrelated FXS premutation carriers and 24 mentally retarded non-FXS affected boys were re-examined by this method. The results totally coincided with the previous ones. This protocol is a good choice as a fast screening test. Within 24 h we can have preliminary information on the patient's genetic status. Normal individuals, CGG premutation carriers up to 100 repeats, as well as HD patients carrying an expansion up to 50 CAG repeats can be easily clarified. This accounts for a relatively large proportion (about 90%) of the suspected HD and FXS patients, referred to our laboratory for genetic analysis. The calculation of the repeat's number is more accurate for the correct interpretation of the results, screening tests and genetic counselling.

  13. Heterozygosities and genetic relationship of tea cultivars revealed by simple sequence repeat markers and implications for breeding and genetic mapping programs.

    Science.gov (United States)

    Tan, L Q; Zhang, C C; Qi, G N; Wang, L Y; Wei, K; Chen, S X; Zou, Y; Wu, L Y; Cheng, H

    2015-03-06

    Genetic maps are essential tools for quantitative trait locus analysis and marker-assisted selection breeding. In order to select parents that are highly heterozygous for genetic mapping, the heterozygosity (HS) of 24 tea cultivars (Camellia sinensis) was analyzed with 72 simple sequence repeat markers. In total, 359 alleles were obtained with an average of 4.99 per marker. The HS varied greatly from 37.5 to 71.0% with an average of 51.3%. On average, tea cultivars from Fujian Province showed a higher level of heterozygosity (59.8%) than those from Zhejiang (48.5%) and Yunnan (44.5%), and the 12 national tea cultivars were generally more heterozygous than the 12 provincial cultivars. Unweighted pair-group analysis using the arithmetic average grouping divided the 24 cultivars into 2 groups that are consistent with the morphological classification. All dual combinations of the 24 cultivars were studied to calculate the percentage of mappable markers when using pseudo-testcross mapping strategy, and results showed that this value also varied greatly from 51.4 to 90.3%. The genetic relationships and HS differences among different cultivars were discussed, and tea cultivars with high HS were recommended as cross parents for genetic mapping programs.

  14. Androgen receptor CAG repeats length polymorphism and the risk of polycystic ovarian syndrome (PCOS.

    Directory of Open Access Journals (Sweden)

    Singh Rajender

    Full Text Available OBJECTIVE: Polycystic ovarian syndrome (PCOS refers to an inheritable androgen excess disorder characterized by multiple small follicles located at the ovarian periphery. Hyperandrogenism in PCOS, and inverse correlation between androgen receptor (AR CAG numbers and AR function, led us to hypothesize that CAG length variations may affect PCOS risk. METHODS: CAG repeat region of 169 patients recruited following strictly defined Rotterdam (2003 inclusion criteria and that of 175 ethnically similar control samples, were analyzed. We also conducted a meta-analysis on the data taken from published studies, to generate a pooled estimate on 2194 cases and 2242 controls. RESULTS: CAG bi-allelic mean length was between 8.5 and 24.5 (mean = 17.43, SD = 2.43 repeats in the controls and between 11 and 24 (mean = 17.39, SD = 2.29 repeats in the cases, without any significant difference between the two groups. Further, comparison of bi-allelic mean and its frequency distribution in three categories (short, moderate and long alleles did not show any significant difference between controls and various case subgroups. Frequency distribution of bi-allelic mean in two categories (extreme and moderate alleles showed over-representation of extreme sized alleles in the cases with marginally significant value (50.3% vs. 61.5%, χ(2 = 4.41; P = 0.036, which turned insignificant upon applying Bonferroni correction for multiple comparisons. X-chromosome inactivation analysis showed no significant difference in the inactivation pattern of CAG alleles or in the comparison of weighed bi-allelic mean between cases and controls. Meta-analysis also showed no significant correlation between CAG length and PCOS risk, except a minor over-representation of short CAG alleles in the cases. CONCLUSION: CAG bi-allelic mean length did not differ between controls and cases/case sub-groups nor did the allele distribution. Over-representation of short

  15. Androgen insensitivity syndrome: do trinucleotide repeats in androgen receptor gene have any role?

    Institute of Scientific and Technical Information of China (English)

    Singh Rajender; Nalini J. Gupta; Baidyanath Chakravarty; Lalji Singh; Kumarasamy Thangaraj

    2008-01-01

    Aim: To investigate the role of CAG and GGN repeats as genetic background affecting androgen insensitivity syn- drome (AIS) phenotype. Methods: We analyzed lengths of androgen receptor (AR)-CAG and GGN repeats in 69 AIS cases, along with 136 unrelated normal male individuals. The lengths of repeats were analyzed using polymerase chain reaction (PCR) amplification followed by allelic genotyping to determine allele length. Results: Our study revealed significantly shorter mean lengths of CAG repeats in patients (mean 18.25 repeats, range 14-26 repeats) in comparison to the controls (mean 22.57 repeats, range 12-39 repeats) (two-tailed P < 0.0001). GGN repeats, however, did not differ significantly between patients (mean 21.48 repeats) and controls (mean 21.21 repeats) (two- tailed P = 0.474). Among patients' groups, the mean number of CAG repeats in partial androgen insensitivity cases (mean 15.83 repeats) was significantly less than in complete androgen insensitivity cases (mean 19.46 repeats) (two- tailed P < 0.0001). Conclusion: The findings suggest that shorter lengths of repeats in the AR gene might act as low penetrance genetic background in varying manifestation of androgen insensitivity. (Asian J Androl 2008 Jul; 10: 616-624)

  16. Role of Repeat Muscle Compartment Pressure Measurements in Chronic Exertional Compartment Syndrome of the Lower Leg

    Science.gov (United States)

    van Zantvoort, Aniek P. M.; de Bruijn, Johan A.; Winkes, Michiel B.; Hoogeveen, Adwin R.; Teijink, Joep A. W.; Scheltinga, Marc R.

    2017-01-01

    Background: The diagnostic gold standard for diagnosing chronic exertional compartment syndrome (CECS) is a dynamic intracompartmental pressure (ICP) measurement of the muscle. The potential role of a repeat ICP (re-ICP) measurement in patients with persistent lower leg symptoms after surgical decompression or with ongoing symptoms after an earlier normal ICP is unknown. Purpose: To study whether re-ICP measurements in patients with persistent CECS-like symptoms of the lower leg may contribute to the diagnosis of CECS after both surgical decompression and a previously normal ICP measurement. Study Design: Case series; Level of evidence, 4. Methods: Charts of patients who underwent re-ICP measurement of lower leg compartments (anterior [ant], deep posterior [dp], and/or lateral [lat] compartments) between 2001 and 2013 were retrospectively studied. CECS was diagnosed on the basis of generally accepted cutoff pressures for newly onset CECS (Pedowitz criteria: ICP at rest ≥15 mmHg, ≥30 mmHg after 1 minute, or ≥20 mmHg 5 minutes after a provocative test). Factors predicting recurrent CECS after surgery or after a previously normal ICP measurement were analyzed. Results: A total of 1714 ICP measurements were taken in 1513 patients with suspected CECS over a 13-year observation period. In all, 201 (12%) tests were re-ICP measurements for persistent lower leg symptoms. Based on the proposed ICP cutoff values, CECS recurrence was diagnosed in 16 of 62 previously operated compartments (recurrence rate, 26%; 53 patients [64% female]; median age, 24 years; age range, 15-78 years). Recurrence rates were not different among the 3 lower leg CECS compartments (ant-CECS, 17%; dp-CECS, 33%; lat-CECS, 30%; χ2 = 1.928, P = .381). Sex (χ2 = 0.058, P = .810), age (U = 378, z = 1.840, P = .066), bilaterality (χ2 = 0.019, P = .889), and prefasciotomy ICP did not predict recurrence. Re-ICP measurements evaluating 20 compartments with previously normal ICP measurements (15

  17. Role of Repeat Muscle Compartment Pressure Measurements in Chronic Exertional Compartment Syndrome of the Lower Leg.

    Science.gov (United States)

    van Zantvoort, Aniek P M; de Bruijn, Johan A; Winkes, Michiel B; Hoogeveen, Adwin R; Teijink, Joep A W; Scheltinga, Marc R

    2017-06-01

    The diagnostic gold standard for diagnosing chronic exertional compartment syndrome (CECS) is a dynamic intracompartmental pressure (ICP) measurement of the muscle. The potential role of a repeat ICP (re-ICP) measurement in patients with persistent lower leg symptoms after surgical decompression or with ongoing symptoms after an earlier normal ICP is unknown. To study whether re-ICP measurements in patients with persistent CECS-like symptoms of the lower leg may contribute to the diagnosis of CECS after both surgical decompression and a previously normal ICP measurement. Case series; Level of evidence, 4. Charts of patients who underwent re-ICP measurement of lower leg compartments (anterior [ant], deep posterior [dp], and/or lateral [lat] compartments) between 2001 and 2013 were retrospectively studied. CECS was diagnosed on the basis of generally accepted cutoff pressures for newly onset CECS (Pedowitz criteria: ICP at rest ≥15 mmHg, ≥30 mmHg after 1 minute, or ≥20 mmHg 5 minutes after a provocative test). Factors predicting recurrent CECS after surgery or after a previously normal ICP measurement were analyzed. A total of 1714 ICP measurements were taken in 1513 patients with suspected CECS over a 13-year observation period. In all, 201 (12%) tests were re-ICP measurements for persistent lower leg symptoms. Based on the proposed ICP cutoff values, CECS recurrence was diagnosed in 16 of 62 previously operated compartments (recurrence rate, 26%; 53 patients [64% female]; median age, 24 years; age range, 15-78 years). Recurrence rates were not different among the 3 lower leg CECS compartments (ant-CECS, 17%; dp-CECS, 33%; lat-CECS, 30%; χ(2) = 1.928, P = .381). Sex (χ(2) = 0.058, P = .810), age (U = 378, z = 1.840, P = .066), bilaterality (χ(2) = 0.019, P = .889), and prefasciotomy ICP did not predict recurrence. Re-ICP measurements evaluating 20 compartments with previously normal ICP measurements (15 patients [53% female]; mean age, 31 ± 10 years

  18. Repeated sense of hunger leads to the development of visceral obesity and metabolic syndrome in a mouse model.

    Science.gov (United States)

    Han, Jong-Min; Kim, Hyeong-Geug; Lee, Jin-Seok; Choi, Min-Kyung; Kim, Young-Ae; Son, Chang-Gue

    2014-01-01

    Obesity-related disorders, especially metabolic syndrome, contribute to 2.8 million deaths each year worldwide, with significantly increasing morbidity. Eating at regular times and proper food quantity are crucial for maintaining a healthy status. However, many people in developed countries do not follow a regular eating schedule due to a busy lifestyle. Herein, we show that a repeated sense of hunger leads to a high risk of developing visceral obesity and metabolic syndrome in a mouse model (both 3-week and 6-week-old age, 10 mice in each group). The ad libitum (AL) group (normal eating pattern) and the food restriction (FR) group (alternate-day partially food restriction by given only 1/3 of average amount) were compared after 8-week experimental period. The total food consumption in the FR group was lower than in the AL group, however, the FR group showed a metabolic syndrome-like condition with significant fat accumulation in adipose tissues. Consequently, the repeated sense of hunger induced the typical characteristics of metabolic syndrome in an animal model; a distinct visceral obesity, hyperlipidemia, hyperglycemia and hepatic steatosis. Furthermore, we found that specifically leptin, a major metabolic hormone, played a major role in the development of these pathological disorders. Our study indicated the importance of regular eating habits besides controlling calorie intake.

  19. Repeated sense of hunger leads to the development of visceral obesity and metabolic syndrome in a mouse model.

    Directory of Open Access Journals (Sweden)

    Jong-Min Han

    Full Text Available Obesity-related disorders, especially metabolic syndrome, contribute to 2.8 million deaths each year worldwide, with significantly increasing morbidity. Eating at regular times and proper food quantity are crucial for maintaining a healthy status. However, many people in developed countries do not follow a regular eating schedule due to a busy lifestyle. Herein, we show that a repeated sense of hunger leads to a high risk of developing visceral obesity and metabolic syndrome in a mouse model (both 3-week and 6-week-old age, 10 mice in each group. The ad libitum (AL group (normal eating pattern and the food restriction (FR group (alternate-day partially food restriction by given only 1/3 of average amount were compared after 8-week experimental period. The total food consumption in the FR group was lower than in the AL group, however, the FR group showed a metabolic syndrome-like condition with significant fat accumulation in adipose tissues. Consequently, the repeated sense of hunger induced the typical characteristics of metabolic syndrome in an animal model; a distinct visceral obesity, hyperlipidemia, hyperglycemia and hepatic steatosis. Furthermore, we found that specifically leptin, a major metabolic hormone, played a major role in the development of these pathological disorders. Our study indicated the importance of regular eating habits besides controlling calorie intake.

  20. Treatment of neuroblastoma in congenital central hypoventilation syndrome with a PHOX2B polyalanine repeat expansion mutation: New twist on a neurocristopathy syndrome.

    Science.gov (United States)

    Armstrong, Amy E; Weese-Mayer, Debra E; Mian, Amir; Maris, John M; Batra, Vandana; Gosiengfiao, Yasmin; Reichek, Jennifer; Madonna, Mary Beth; Bush, Jonathan W; Shore, Richard M; Walterhouse, David O

    2015-11-01

    Neuroblastoma in patients with congenital central hypoventilation syndrome (CCHS) as part of a neurocristopathy syndrome is a rare finding and has only been associated with paired-like homeobox 2b (PHOX2B) non-polyalanine-repeat-expansion mutations. To the best of our knowledge, we report the first case of a child with CCHS and Hirschsprung disease who had a PHOX2B polyalanine-repeat-expansion mutation (PARM) (genotype 20/33) and developed high-risk neuroblastoma. We further describe his treatment including chemotherapy and therapeutic I(131) -metaiodobenzylguanidine. This case highlights the need to consider neuroblastoma in patients with CCHS and the longest PHOX2B PARMs and to individualize treatment based on co-morbidities.

  1. Histone deacetylases suppress CGG repeat-induced neurodegeneration via transcriptional silencing in models of fragile X tremor ataxia syndrome.

    Directory of Open Access Journals (Sweden)

    Peter K Todd

    Full Text Available Fragile X Tremor Ataxia Syndrome (FXTAS is a common inherited neurodegenerative disorder caused by expansion of a CGG trinucleotide repeat in the 5'UTR of the fragile X syndrome (FXS gene, FMR1. The expanded CGG repeat is thought to induce toxicity as RNA, and in FXTAS patients mRNA levels for FMR1 are markedly increased. Despite the critical role of FMR1 mRNA in disease pathogenesis, the basis for the increase in FMR1 mRNA expression is unknown. Here we show that overexpressing any of three histone deacetylases (HDACs 3, 6, or 11 suppresses CGG repeat-induced neurodegeneration in a Drosophila model of FXTAS. This suppression results from selective transcriptional repression of the CGG repeat-containing transgene. These findings led us to evaluate the acetylation state of histones at the human FMR1 locus. In patient-derived lymphoblasts and fibroblasts, we determined by chromatin immunoprecipitation that there is increased acetylation of histones at the FMR1 locus in pre-mutation carriers compared to control or FXS derived cell lines. These epigenetic changes correlate with elevated FMR1 mRNA expression in pre-mutation cell lines. Consistent with this finding, histone acetyltransferase (HAT inhibitors repress FMR1 mRNA expression to control levels in pre-mutation carrier cell lines and extend lifespan in CGG repeat-expressing Drosophila. These findings support a disease model whereby the CGG repeat expansion in FXTAS promotes chromatin remodeling in cis, which in turn increases expression of the toxic FMR1 mRNA. Moreover, these results provide proof of principle that HAT inhibitors or HDAC activators might be used to selectively repress transcription at the FMR1 locus.

  2. RISK OF REPEATED THROMBOTIC EVENTS IN PATIENTS SURVIVED ACUTE CORONARY SYNDROME AND HAVING LABORATORY PROVEN RESISTANCE TO ACETYLSALICYLIC ACID

    Directory of Open Access Journals (Sweden)

    N. F. Puchinyan

    2009-01-01

    Full Text Available Aim. To evaluate risk of repeated atherothrombotic events in patients survived acute coronary syndrome (ACS and having poorly reduced platelet aggregation (proven by optical aggregometry in response to acetylsalicylic acid (ASA therapy.Material and methods. 200 patients with ACS (aged 56,6±9,2 y.o. were included in the study. Platelet functional activity during ASA therapy was evaluated with laser aggregometer. ASA resistance was defined if the summarizing index of platelet aggregation (induced with ADP, 5 mμml/l was 50% or higher during ASA therapy. Observation period was 18±6 months. Atherothrombotic events (unstable angina, myocardial infarction, stroke, cardiovascular death were considered.Results. Lack ASA response rate was about 12%. Totally 22 repeated atherothrombotic events were registered: 5,6% among ASA sensitive patients and 50% - among ASA resistant patients. Repeated atherothrombotic events were registered in ASA resistance patients during first 14 days. ASA sensitive patients showed repeated atherothrombotic events in some months after ACS. The relative risk of cardiovascular event in ASA resistance patients was 8,92 (CI 95% 4,39; 17,84 р=0,05.Conclusion. The high level of the induced platelet aggregation (proven by laser aggregometry points to high risk of repeated atherothrombotic events in patients with ACS.

  3. RAI1 point mutations, CAG repeat variation, and SNP analysis in non-deletion Smith-Magenis syndrome.

    Science.gov (United States)

    Bi, Weimin; Saifi, G Mustafa; Girirajan, Santhosh; Shi, Xin; Szomju, Barbara; Firth, Helen; Magenis, R Ellen; Potocki, Lorraine; Elsea, Sarah H; Lupski, James R

    2006-11-15

    Smith-Magenis syndrome (SMS) is a multiple congenital anomalies/mental retardation disorder characterized by distinct craniofacial features and neurobehavioral abnormalities usually associated with an interstitial deletion in 17p11.2. Heterozygous point mutations in the retinoic acid induced 1 gene (RAI1) have been reported in nine SMS patients without a deletion detectable by fluorescent in situ hybridization (FISH), implicating RAI1 haploinsufficiency as the cause of the major clinical features in SMS. All of the reported point mutations are unique and de novo. RAI1 contains a polymorphic CAG repeat and encodes a plant homeo domain (PHD) zinc finger-containing transcriptional regulator. We report a novel RAI1 frameshift mutation, c.3103delC, in a non-deletion patient with many SMS features. The deletion of a single cytosine occurs in a heptameric C-tract (CCCCCCC), the longest mononucleotide repeat in the RAI1 coding region. Interestingly, we had previously reported a frameshift mutation, c.3103insC, in the same mononucleotide repeat. Furthermore, all five single base frameshift mutations preferentially occurred in polyC but not polyG tracts. We also investigated the distribution of the polymorphic CAG repeats in both the normal population and the SMS patients as one potential molecular mechanism for variability of clinical expression. In this limited data set, there was no significant association between the length of CAG repeats and the SMS phenotype. However, we identified a 5-year-old girl with an apparent SMS phenotype who was a compound heterozygote for an RAI1 missense mutation inherited from her father and a polyglutamine repeat of 18 copies, representing the largest known CAG repeat in this gene, inherited from her mother.

  4. A novel unstable duplication upstream of HAS2 predisposes to a breed-defining skin phenotype and a periodic fever syndrome in Chinese Shar-Pei dogs.

    Directory of Open Access Journals (Sweden)

    Mia Olsson

    2011-03-01

    Full Text Available Hereditary periodic fever syndromes are characterized by recurrent episodes of fever and inflammation with no known pathogenic or autoimmune cause. In humans, several genes have been implicated in this group of diseases, but the majority of cases remain unexplained. A similar periodic fever syndrome is relatively frequent in the Chinese Shar-Pei breed of dogs. In the western world, Shar-Pei have been strongly selected for a distinctive thick and heavily folded skin. In this study, a mutation affecting both these traits was identified. Using genome-wide SNP analysis of Shar-Pei and other breeds, the strongest signal of a breed-specific selective sweep was located on chromosome 13. The same region also harbored the strongest genome-wide association (GWA signal for susceptibility to the periodic fever syndrome (p(raw = 2.3 × 10⁻⁶, p(genome = 0.01. Dense targeted resequencing revealed two partially overlapping duplications, 14.3 Kb and 16.1 Kb in size, unique to Shar-Pei and upstream of the Hyaluronic Acid Synthase 2 (HAS2 gene. HAS2 encodes the rate-limiting enzyme synthesizing hyaluronan (HA, a major component of the skin. HA is up-regulated and accumulates in the thickened skin of Shar-Pei. A high copy number of the 16.1 Kb duplication was associated with an increased expression of HAS2 as well as the periodic fever syndrome (p < 0.0001. When fragmented, HA can act as a trigger of the innate immune system and stimulate sterile fever and inflammation. The strong selection for the skin phenotype therefore appears to enrich for a pleiotropic mutation predisposing these dogs to a periodic fever syndrome. The identification of HA as a major risk factor for this canine disease raises the potential of this glycosaminoglycan as a risk factor for human periodic fevers and as an important driver of chronic inflammation.

  5. CAG repeat polymorphism in androgen receptor gene is not directly associated with polycystic ovary syndrome but influences serum testosterone levels.

    Science.gov (United States)

    Skrgatic, L; Baldani, D Pavicic; Cerne, J Z; Ferk, P; Gersak, K

    2012-02-01

    Hyperandrogenemia has been the most consistent feature of polycystic ovary syndrome (PCOS). Androgens exert their effects through androgen receptors (ARs). The expansion of the codon CAG trinucleotide repeat polymorphism in exon 1 of the AR gene represents a type of genetic alteration associated with changes in the AR gene function. The purpose of this study was to establish a possible association of the AR gene CAG repeat length polymorphism with PCOS, and its influence on clinical and biochemical androgen traits. Two hundred and fourteen Croatian women with PCOS and 209 healthy control women of reproductive age were enrolled. Phenotypic hyperandrogenism, BMI and waist to hip ratio were recorded. Hormonal profiles, fasting insulin and glucose levels were measured on cycle days 3-5. Genotyping of the CAG repeat polymorphism in the AR gene was performed. We found no significant difference in the mean CAG repeat number between the PCOS patients and controls (22.1±3.4 vs. 21.9±3.2, P=0.286). There was a positive correlation between the CAG repeat length and total testosterone (TT) in the PCOS group (R=0.225, P=0.015). A multiple linear regression model using mean CAG repeat length, BMI, age and HOMA-IR as predictors explained 8.5% (adjusted R²) of the variability in serum TT levels. In this model the CAG repeat polymorphism was found to be a significant predictor of serum TT levels in PCOS patients (P=0.015). The logistic regression analysis revealed that the CAG repeat length is not a significant predictor of hirsutism and acne status (P=0.921 and P=0.437, respectively). The model was adjusted for serum TT, free testosterone, androstendione and DHEAS levels as independent variables, which were also not found to be significant predictors of hirsutism (P=0.687, P=0.194, P=0.675 and P=0.938, respectively) or acne status (P=0.594, P=0.095, P=0.290 and P=0.151, respectively). In conclusion, the AR CAG repeat polymorphism is not a major determinant of PCOS in the

  6. Johann Friedrich Horner and the Repeated Discovery of Oculosympathoparesis: Whose Syndrome Is It?

    Science.gov (United States)

    Abbas, Ahmed; Manjila, Sunil; Singh, Mantinderpreet; Belle, Vaijayantee; Chandar, Krishan; Miller, Jonathan P

    2015-09-01

    Disruption of cranial sympathetic tone leads to the symptom complex of miosis, ptosis, and hemifacial anhidrosis. It is widely believed that this phenomenon was discovered in 1869 by the Swiss ophthalmologist Johann Friedrich Horner, and as a result, the term Horner syndrome has become synonymous with the clinical presentation. However, the syndrome that would become Horner syndrome had actually been described several times before his report. François Pourfour du Petit documented the ocular effects of sympathetic trunk lesions in animal studies in 1727. Claude Bernard identified the full clinical triad in animal studies in 1852, and as a result, the condition is sometimes called Bernard syndrome. There were also 2 previous reports of ptosis and miosis resulting from sympathetic nerve damage in humans: 1 by Edward Selleck Hare in 1838 associated with brachial plexus tumor, and the other by Silas Weir Mitchell in 1864 associated with a gunshot wound to the neck. Although Horner was the first to objectively characterize the co-occurrence of vasomotor and ocular changes in a human patient, he did not identify the etiology of the condition, discuss its relationship to the sympathetic nervous system, or reference any of the previous studies in animals or humans. It is possible that a lack of familiarity with previous investigations delayed the full appreciation of the mechanism underlying this disorder.

  7. Repeated evolution of vertebrate pollination syndromes in a recently diverged Andean plant clade.

    Science.gov (United States)

    Lagomarsino, Laura P; Forrestel, Elisabeth J; Muchhala, Nathan; Davis, Charles C

    2017-08-01

    Although specialized interactions, including those involving plants and their pollinators, are often invoked to explain high species diversity, they are rarely explored at macroevolutionary scales. We investigate the dynamic evolution of hummingbird and bat pollination syndromes in the centropogonid clade (Lobelioideae: Campanulaceae), an Andean-centered group of ∼550 angiosperm species. We demonstrate that flowers hypothesized to be adapted to different pollinators based on flower color fall into distinct regions of morphospace, and this is validated by morphology of species with known pollinators. This supports the existence of pollination syndromes in the centropogonids, an idea corroborated by ecological studies. We further demonstrate that hummingbird pollination is ancestral, and that bat pollination has evolved ∼13 times independently, with ∼11 reversals. This convergence is associated with correlated evolution of floral traits within selective regimes corresponding to pollination syndrome. Collectively, our results suggest that floral morphological diversity is extremely labile, likely resulting from selection imposed by pollinators. Finally, even though this clade's rapid diversification is partially attributed to their association with vertebrate pollinators, we detect no difference in diversification rates between hummingbird- and bat-pollinated lineages. Our study demonstrates the utility of pollination syndromes as a proxy for ecological relationships in macroevolutionary studies of certain species-rich clades. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.

  8. Negative association between androgen receptor gene CAG repeat polymorphism and polycystic ovary syndrome? A systematic review and meta-analysis.

    Science.gov (United States)

    Wang, Rui; Goodarzi, Mark O; Xiong, Ting; Wang, Di; Azziz, Ricardo; Zhang, Hanwang

    2012-10-01

    A number of studies focusing on the association between the exon 1 CAG repeat polymorphism of the androgen receptor (AR) gene and polycystic ovary syndrome (PCOS) have revealed conflicting results. The current systematic review and meta-analysis was conducted to quantify the strength of the association and to explore potential sources of heterogeneity that may have influenced the results. Studies matched to search terms from PubMed, EMBASE and HuGE Navigator published through to 31 January 2012 were retrieved. Data extraction from the included studies was carried out by two authors independently. Weighted mean differences (WMDs) of biallelic mean and odds ratios (ORs) of alleles and genotypes were pooled for meta-analysis. Sixteen articles reporting on 17 studies were included. In continuous data analysis, the summary WMD was -0.06 (95% confidence interval -0.29 to 0.16). In dichotomous data analysis, we divided the alleles into short and long alleles and calculated the summary ORs. No statistically significant results were identified by different comparison models or different cut-off point definitions. No publication bias was observed in continuous and dichotomous data analysis. In summary, the current systematic review and meta-analysis found that the AR CAG microsatellite repeat polymorphism is unlikely to be a major determining factor in the development of PCOS.

  9. Pitfalls in Suspected Acute Aortic Syndrome: Impact of Appropriate and If Required Repeated Imaging

    Directory of Open Access Journals (Sweden)

    C. Meier

    2015-01-01

    Full Text Available The incidence of acute aortic syndrome is low, but the spontaneous course is often life-threatening. Adequate ECG-gated imaging is fundamental within the diagnostic workup. We here report a case of a 53-year-old man presenting with atypical chest pain, slight increase of D dimers at admission, and extended diameter of the ascending aorta accompanied by mild aortic regurgitation. Interpretation of an initial contrast-enhanced computed tomography was false negative due to inadequate gating and motion artifacts, thereby judging a tiny contrast signal in the left anterior quadrant of the ascending aorta as a pseudointimal flap. By hazard, cardiac magnetic resonance imaging demonstrated an ulcer-like lesion superior to the aortic root, leading to aortic surgery at the last moment. As sensitivity of imaging is not 100%, this example underlines that second imaging studies might be necessary if the first imaging is negative, but the clinical suspicion still remains high.

  10. Comparison of Multilocus Variable-Number Tandem-Repeat Analysis and Multilocus Sequence Typing for Differentiation of Hemolytic-Uremic Syndrome-Associated Escherichia coli (HUSEC) Collection Strains▿

    OpenAIRE

    2011-01-01

    Multilocus variable-number tandem-repeat analysis (MLVA) was compared to multilocus sequence typing (MLST) to differentiate hemolytic uremic syndrome-associated enterohemorrhagic Escherichia coli strains. Although MLVA—like MLST—was highly discriminatory (index of diversity, 0.988 versus 0.984), a low level of concordance demonstrated the limited ability of MLVA to reflect long-term evolutionary events.

  11. Budd-Chiari syndrome and heparin-induced thrombocytopenia in polycythemia vera: Successful treatment with repeated TIPS and interferon alpha

    Directory of Open Access Journals (Sweden)

    Akoum Riad

    2009-01-01

    Full Text Available Polycythemia vera (PV is a common cause of Budd-Chiari syndrome (BCS and portal vein thrombosis (PVT. The postpartum period is a precipitating cofactor. An additional heparin-induced thrombocytopenia/thrombosis (HIT/T leads to a life-threatening condition in which transjugular intrahepatic portosystemic shunting (TIPS seems to be the only life-saving procedure. We describe the case of a subacute BCS and PVT in the late postpartum period. The diagnosis was established using CT scan, MRI, and Doppler ultrasonography of abdominal vessels and the laboratory findings were compatible with PV. After a successful creation of TIPS, a HIT/T worsened the hemorrhagic and thrombotic picture. TIPS procedure was successfully repeated and heparin was replaced with Fondaparinux and then vitamin K antagonist. The treatment with interferon alpha-2A, started after the normalization of liver functions, resulted in a complete remission within 6 months. The JAK2 V617F mutation clone remained undetectable after 2 years′ follow-up.

  12. Decrease in the CGG{sub n} trinucleotide repeat mutation of the fragile X syndrome to normal size range during paternal transmission

    Energy Technology Data Exchange (ETDEWEB)

    Vaeisaenen, M.L.; Haataja, R.; Leisti, J. [Oulu Univ. Hospital (Finland)

    1996-09-01

    The fragile X syndrome, the most common inherited form of mental retardation, is caused by the expansion of a CGG{sub n} trinucleotide repeat in the FMR-1 gene. Although the repeat number usually increases during transmission, few cases with reduction of an expanded CGG{sub n} repeat back to the normal size range have been reported. We describe for the first time a family in which such reduction has occurred in the paternal transmission. The paternal premutation ({Delta} = 300 hp) was not detected in one of the five daughters or in the son of this daughter, although he had the grandpaternal RFLP haplotype. Instead, fragments indicating the normal CGG{sub n} repeat size were seen on a Southern blot probed with StB12.3. PCR analysis of the CGG{sub n} repeat confirmed this; in addition to a maternal allele of 30 repeats, an allele of 34 repeats was detected in the daughter and, further, in her son. Sequencing of this new allele revealed a pure CGG{sub n} repeat configuration without AGG interruptions. No evidence for a somatic mosaicism of a premutation allele in the daughter or a normal allele in her father was detected when investigating DNA derived from blood lymphocytes and skin fibroblasts. Another unusual finding in this family was lack of the PCR product of the microsatellite marker RS46 (DXS548) in one of the grandmaternal X chromosomes, detected as incompatible inheritance of RS46 alleles. The results suggest an intergenerational reduction in the CGG{sub n} repeat from premutation size to the normal size range and stable transmission of the contracted repeat to the next generation. However, paternal germ-line mosaicism could not be excluded as an alternative explanation for the reverse mutation. 37 refs., 4 figs.

  13. Repeated Insulin-like Growth Factor 1 (IGF1 treatment in a patient with Rett Syndrome: a single case study

    Directory of Open Access Journals (Sweden)

    Giorgio ePini

    2014-06-01

    Full Text Available Rett syndrome (RTT is a devastating neurodevelopmental disorder that has no cure. Patients show regression of acquired skills, motor and speech impairment, cardio-respiratory distress, microcephaly and stereotyped hand movements. The majority of RTT patients display mutations in the gene that codes for the Methyl-CpG binding protein 2 (MeCP2, which is involved in the development of the central nervous system, especially synaptic and circuit maturation. Thus, agents that promote brain development and synaptic function are good candidates for ameliorating the symptoms of RTT. In particular, Insulin-like growth Factor 1 (IGF1 and its active peptide (1-3IGF1 cross the Blood Brain Barrier, and therefore are ideal treatments for RTT Indeed, both (1-3IGF1 and IGF1 treatment significantly ameliorates RTT symptoms in a mouse model of the disease In a previous study we established that IGF1 is safe and well tolerated on Rett patients. In this open label clinical case study, we assess the safety and tolerability of IGF1 administration in two cycles of the treatment. Before and after each cycle we monitored the clinical and blood parameters, autonomic function and social and cognitive abilities, and we found that IGF1 was well tolerated each time and did not induce any side effect, nor it interfered with the other treatments that the patient was undergoing. We noticed a moderate improvement in the cognitive, social and autonomic abilities of the patient after each cycle but the benefits were not retained between the two cycles, consistent with the preclinical observation that treatments for RTT should be administered through life. We find that repeated IGF1 treatment is safe and well tolerated in Rett patients but observed effects are not retained between cycles. These results have applications to other pathologies considering that IGF1 has been shown to be effective in other disorders of the autism spectrum.

  14. Repeated insulin-like growth factor 1 treatment in a patient with rett syndrome: a single case study.

    Science.gov (United States)

    Pini, Giorgio; Scusa, M Flora; Benincasa, Alberto; Bottiglioni, Ilaria; Congiu, Laura; Vadhatpour, Cyrus; Romanelli, Anna Maria; Gemo, Ilaria; Puccetti, Chetti; McNamara, Rachel; O'Leary, Seán; Corvin, Aiden; Gill, Michael; Tropea, Daniela

    2014-01-01

    Rett syndrome (RTT) is a devastating neurodevelopmental disorder that has no cure. Patients show regression of acquired skills, motor, and speech impairment, cardio-respiratory distress, microcephaly, and stereotyped hand movements. The majority of RTT patients display mutations in the gene that codes for the Methyl-CpG binding protein 2 (MeCP2), which is involved in the development of the central nervous system, especially synaptic and circuit maturation. Thus, agents that promote brain development and synaptic function are good candidates for ameliorating the symptoms of RTT. In particular, insulin-like growth factor 1 (IGF1) and its active peptide (1-3) IGF1 cross the Blood Brain Barrier, and therefore are ideal treatments for RTT Indeed, both (1-3) IGF1 and IGF1 treatment significantly ameliorates RTT symptoms in a mouse model of the disease In a previous study, we established that IGF1 is safe and well tolerated on Rett patients. In this open label clinical case study, we assess the safety and tolerability of IGF1 administration in two cycles of the treatment. Before and after each cycle, we monitored the clinical and blood parameters, autonomic function, and social and cognitive abilities, and we found that IGF1 was well tolerated each time and did not induce any side effect, nor it interfered with the other treatments that the patient was undergoing. We noticed a moderate improvement in the cognitive, social, and autonomic abilities of the patient after each cycle but the benefits were not retained between the two cycles, consistent with the pre-clinical observation that treatments for RTT should be administered through life. We find that repeated IGF1 treatment is safe and well tolerated in Rett patients but observed effects are not retained between cycles. These results have applications to other pathologies considering that IGF1 has been shown to be effective in other disorders of the autism spectrum.

  15. Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

    Science.gov (United States)

    Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

    2012-01-01

    Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr.

  16. A single nucleotide variant in the FMR1 CGG repeat results in a "Pseudodeletion" and is not associated with the fragile X syndrome phenotype.

    Science.gov (United States)

    Cecconi, Massimiliano; Forzano, Francesca; Rinaldi, Rosanna; Cappellacci, Sandra; Grammatico, Paola; Faravelli, Francesca; Dagna Bricarelli, Franca; Di Maria, Emilio; Grasso, Marina

    2008-05-01

    The molecular diagnosis of fragile X syndrome relies on the detection of the pathogenic CGG repeat expansion in the FMR1 gene. Deletions and point mutations have occasionally been reported. Rare polymorphisms might mimic a deletion by Southern blot analysis, leading to false-positive results. We describe a novel rare nucleotide substitution within the CGG repeat. The proband was a woman with a positive family history of mental retardation. Southern blot analysis showed an additional band consistent with a deletion in the region detected by the StB12.3 probe. Sequencing of this region revealed a G>C transversion that interrupts the CGG repeat and introduces an EagI site. The same variant was observed in both the healthy son and father of the proband, supporting the hypothesis that the nucleotide substitution is a silent polymorphism, the frequency of which we estimated to be less than 1% in the general population. These findings argue for a pathogenic role of nucleotide variants within the CGG repeat and suggest possible consequences of unexpected findings in the molecular diagnostics of fragile X syndrome. Thus, although the sequence context of a single nucleotide substitution may not predict possible effects on mRNA or protein function, a specific change in the higher order structures of DNA or mRNA may be functionally relevant in the pathological phenotype.

  17. A Single Nucleotide Variant in the FMR1 CGG Repeat Results in a “Pseudodeletion” and Is Not Associated with the Fragile X Syndrome Phenotype

    Science.gov (United States)

    Cecconi, Massimiliano; Forzano, Francesca; Rinaldi, Rosanna; Cappellacci, Sandra; Grammatico, Paola; Faravelli, Francesca; Dagna Bricarelli, Franca; Di Maria, Emilio; Grasso, Marina

    2008-01-01

    The molecular diagnosis of fragile X syndrome relies on the detection of the pathogenic CGG repeat expansion in the FMR1 gene. Deletions and point mutations have occasionally been reported. Rare polymorphisms might mimic a deletion by Southern blot analysis, leading to false-positive results. We describe a novel rare nucleotide substitution within the CGG repeat. The proband was a woman with a positive family history of mental retardation. Southern blot analysis showed an additional band consistent with a deletion in the region detected by the StB12.3 probe. Sequencing of this region revealed a G>C transversion that interrupts the CGG repeat and introduces an EagI site. The same variant was observed in both the healthy son and father of the proband, supporting the hypothesis that the nucleotide substitution is a silent polymorphism, the frequency of which we estimated to be less than 1% in the general population. These findings argue for a pathogenic role of nucleotide variants within the CGG repeat and suggest possible consequences of unexpected findings in the molecular diagnostics of fragile X syndrome. Thus, although the sequence context of a single nucleotide substitution may not predict possible effects on mRNA or protein function, a specific change in the higher order structures of DNA or mRNA may be functionally relevant in the pathological phenotype. PMID:18403614

  18. Kearns-Sayre syndrome case presenting a mitochondrial DNA deletion with unusual direct repeats and a rudimentary RNAse mitochondria ribonucleotide processing target sequence

    Energy Technology Data Exchange (ETDEWEB)

    Remes, A.M.; Hassinen, I.E. (Univ. of Oulu (Finland)); Peuhkurinen, K.J.; Herva, R.; Majamaa, K. (Oulu Univ. Central Hospital (Finland))

    1993-04-01

    A mitochondrial DNA deletion in a case of Kearns-Sayre syndrome is described. The deletion is bracketed by direct repeats that were unusual in that one of them was located 11--13 nucleotides from the deletion seam and both were conserved, which should not occur in slip replication or illegitimate elongation. The deleted region was demarcated on the deletion side by sequences that could be predicted to form hairpin structures. The 5[prime]-side of the deletion was flanked by a sequence homologous to a 9-nucleotide piece of the conserved sequence block II of the D-loop. This arrangement around the deletion in Kearns-Sayre syndrome bears some resemblance to the arrangement in the Pearson marrow- pancreas syndrome described by A. Rotig et al. (1991, Genomics 10: 502--504). 10 refs., 1 fig.

  19. Sequestration of DROSHA and DGCR8 by Expanded CGG RNA Repeats Alters MicroRNA Processing in Fragile X-Associated Tremor/Ataxia Syndrome

    Directory of Open Access Journals (Sweden)

    Chantal Sellier

    2013-03-01

    Full Text Available Fragile X-associated tremor/ataxia syndrome (FXTAS is an inherited neurodegenerative disorder caused by the expansion of 55–200 CGG repeats in the 5′ UTR of FMR1. These expanded CGG repeats are transcribed and accumulate in nuclear RNA aggregates that sequester one or more RNA-binding proteins, thus impairing their functions. Here, we have identified that the double-stranded RNA-binding protein DGCR8 binds to expanded CGG repeats, resulting in the partial sequestration of DGCR8 and its partner, DROSHA, within CGG RNA aggregates. Consequently, the processing of microRNAs (miRNAs is reduced, resulting in decreased levels of mature miRNAs in neuronal cells expressing expanded CGG repeats and in brain tissue from patients with FXTAS. Finally, overexpression of DGCR8 rescues the neuronal cell death induced by expression of expanded CGG repeats. These results support a model in which a human neurodegenerative disease originates from the alteration, in trans, of the miRNA-processing machinery.

  20. Sequestration of DROSHA and DGCR8 by expanded CGG RNA repeats alters microRNA processing in fragile X-associated tremor/ataxia syndrome.

    Science.gov (United States)

    Sellier, Chantal; Freyermuth, Fernande; Tabet, Ricardos; Tran, Tuan; He, Fang; Ruffenach, Frank; Alunni, Violaine; Moine, Herve; Thibault, Christelle; Page, Adeline; Tassone, Flora; Willemsen, Rob; Disney, Matthew D; Hagerman, Paul J; Todd, Peter K; Charlet-Berguerand, Nicolas

    2013-03-28

    Fragile X-associated tremor/ataxia syndrome (FXTAS) is an inherited neurodegenerative disorder caused by the expansion of 55-200 CGG repeats in the 5' UTR of FMR1. These expanded CGG repeats are transcribed and accumulate in nuclear RNA aggregates that sequester one or more RNA-binding proteins, thus impairing their functions. Here, we have identified that the double-stranded RNA-binding protein DGCR8 binds to expanded CGG repeats, resulting in the partial sequestration of DGCR8 and its partner, DROSHA, within CGG RNA aggregates. Consequently, the processing of microRNAs (miRNAs) is reduced, resulting in decreased levels of mature miRNAs in neuronal cells expressing expanded CGG repeats and in brain tissue from patients with FXTAS. Finally, overexpression of DGCR8 rescues the neuronal cell death induced by expression of expanded CGG repeats. These results support a model in which a human neurodegenerative disease originates from the alteration, in trans, of the miRNA-processing machinery.

  1. Large C9orf72 Hexanucleotide Repeat Expansions Are Seen in Multiple Neurodegenerative Syndromes and Are More Frequent Than Expected in the UK Population

    Science.gov (United States)

    Beck, Jon; Poulter, Mark; Hensman, Davina; Rohrer, Jonathan D.; Mahoney, Colin J.; Adamson, Gary; Campbell, Tracy; Uphill, James; Borg, Aaron; Fratta, Pietro; Orrell, Richard W.; Malaspina, Andrea; Rowe, James; Brown, Jeremy; Hodges, John; Sidle, Katie; Polke, James M.; Houlden, Henry; Schott, Jonathan M.; Fox, Nick C.; Rossor, Martin N.; Tabrizi, Sarah J.; Isaacs, Adrian M.; Hardy, John; Warren, Jason D.; Collinge, John; Mead, Simon

    2013-01-01

    Hexanucleotide repeat expansions in C9orf72 are a major cause of frontotemporal lobar degeneration (FTLD) and amyotrophic lateral sclerosis (ALS). Understanding the disease mechanisms and a method for clinical diagnostic genotyping have been hindered because of the difficulty in estimating the expansion size. We found 96 repeat-primed PCR expansions: 85/2,974 in six neurodegenerative diseases cohorts (FTLD, ALS, Alzheimer disease, sporadic Creutzfeldt-Jakob disease, Huntington disease-like syndrome, and other nonspecific neurodegenerative disease syndromes) and 11/7,579 (0.15%) in UK 1958 birth cohort (58BC) controls. With the use of a modified Southern blot method, the estimated expansion range (smear maxima) in cases was 800–4,400. Similarly, large expansions were detected in the population controls. Differences in expansion size and morphology were detected between DNA samples from tissue and cell lines. Of those in whom repeat-primed PCR detected expansions, 68/69 were confirmed by blotting, which was specific for greater than 275 repeats. We found that morphology in the expansion smear varied among different individuals and among different brain regions in the same individual. Expansion size correlated with age at clinical onset but did not differ between diagnostic groups. Evidence of instability of repeat size in control families, as well as neighboring SNP and microsatellite analyses, support multiple expansion events on the same haplotype background. Our method of estimating the size of large expansions has potential clinical utility. C9orf72-related disease might mimic several neurodegenerative disorders and, with potentially 90,000 carriers in the United Kingdom, is more common than previously realized. PMID:23434116

  2. A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene.

    Science.gov (United States)

    Leonova, J; Hanson, C

    1999-01-01

    This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.

  3. Short QTc Interval in Males with Klinefelter Syndrome-Influence of CAG Repeat Length, Body Composition, and Testosterone Replacement Therapy

    DEFF Research Database (Denmark)

    Jørgensen, Inger Norlyk; Skakkebaek, Anne; Andersen, Niels Holmark

    2015-01-01

    BackgroundKlinefelter syndrome (KS) is a sex chromosomal aneuploidy (47,XXY) affecting 1/660 males. Based on findings in Turner syndrome, we hypothesized that electrocardiogram (ECG) abnormalities would be present in males with KS. ObjectiveTo investigate ECGs in males with KS and compare with co...

  4. Molecular diagnosis of Prader-Willi syndrome: Parent-of-origin dependent methylation sites and non-isotopic detection of (CA){sub n} dinucleotide repeat polymorphisms

    Energy Technology Data Exchange (ETDEWEB)

    Lerer, I.; Meiner, V.; Pashut-Lavon, I.; Abeliovich, D.

    1994-08-01

    We describe our experience in the molecular diagnosis of 22 patients suspected of Prader-Willi syndrome (PWS) using a DNA probe PW71 (D15S63) which detects a parent-of-origin specific methylated site in the PWS critical region. The cause of the syndrome was determined as deletion or uniparental disomy according to the segregation of (CA){sub n} dinucleotide repeat polymorphisms of the PWS/AS region and more distal markers of chromosome 15. In 10 patients the clinical diagnosis was confirmed by the segregation of (CA){sub n}, probably due to paternal microdeletion in the PWs critical region which did not include the loci D15S97, D15S113, GABRB3, and GABRA5. This case demonstrates the advantage of the DNA probe PW71 in the diagnosis of PWS. 31 refs., 2 figs., 3 tabs.

  5. Beverage Intake Assessment Questionnaire: Relative Validity and Repeatability in a Spanish Population with Metabolic Syndrome from the PREDIMED-PLUS Study

    Science.gov (United States)

    Ferreira-Pêgo, Cíntia; Nissensohn, Mariela; Kavouras, Stavros A.; Babio, Nancy; Serra-Majem, Lluís; Martín Águila, Adys; Mauromoustakos, Andy; Álvarez Pérez, Jacqueline; Salas-Salvadó, Jordi

    2016-01-01

    We assess the repeatability and relative validity of a Spanish beverage intake questionnaire for assessing water intake from beverages. The present analysis was performed within the framework of the PREDIMED-PLUS trial. The study participants were adults (aged 55–75) with a BMI ≥27 and <40 kg/m2, and at least three components of Metabolic Syndrome (MetS). A trained dietitian completed the questionnaire. Participants provided 24-h urine samples, and the volume and urine osmolality were recorded. The repeatability of the baseline measurement at 6 and 1 year was examined by paired Student’s t-test comparisons. A total of 160 participants were included in the analysis. The Bland–Altman analysis showed relatively good agreement between total daily fluid intake assessed using the fluid-specific questionnaire, and urine osmolality and 24-h volume with parameter estimates of −0.65 and 0.22, respectively (R2 = 0.20; p < 0.001). In the repeatability test, no significant differences were found between neither type of beverage nor total daily fluid intake at 6 months and 1-year assessment, compared to baseline. The proposed fluid-specific assessment questionnaire designed to assess the consumption of water and other beverages in Spanish adult individuals was found to be relatively valid with good repeatability. PMID:27483318

  6. Prevalence of Asherman's syndrome after secondary removal of placental remnants or a repeat curettage for incomplete abortion

    NARCIS (Netherlands)

    I.C.D. Westendorp (Iris); W.M. Ankum (Willem); B.W.J. Mol (Ben); J. Vonk (Jan)

    1998-01-01

    textabstractThis prospective study assesses the prevalence of intrauterine adhesions among women undergoing secondary removal of placental remnants after delivery, or a repeat curettage for incomplete abortions, and evaluates risk factors associated with the presence of

  7. Normal number of CGG repeats in the FMR-1 gene and abnormal incorporation of fibrillin into the extracellular matrix in Lujan Syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Greenhaw, G.A.; Stone, C.; Milewicz, D. [Univ. of Texas Health Science Center, Houston, TX (United States)

    1994-09-01

    Lujan syndrome is an X-linked condition that includes mild-to-moderate mental retardation, poor social integration, normal secondary sexual development with normal testicular size, generalized hypotonia, hypernasal voice and dolichostenomelia. Major cardiac complications and lens dislocation have not been reported although severe myopia may occur. All reported cases have had negative cytogenetic screening for fra(X) syndrome but establishing this constellation of findings as a distinctive entity has been difficult. We report 4 males in two sibships with clinical findings consistent with Lujan syndrome, normal karyotypes, negative cytogenetic screening for fra(X) syndrome and a normal number of CGG repeats in the FMR-1 gene. Dermal fibroblasts explanted from one of the affected males were used to study fibrillin synthesis secretion and extracellular matrix incorporation into microfibrils. Cells from the affected individual showed normal synthesis and secretion of fibrillin when compared to control cells, but the fibrillin was not incorporated into the extracellular matrix. These results suggest the presence of a gene on the X chromosome which may play a role in microfibril assembly and when deficient may disrupt the incorporation of fibrillin into microfibrils. This may be important not only in normal body morphogenesis but also in the development/function of the brain. More affected individuals are needed to investigate these findings further.

  8. Patterns of molecular genetic variation among cat breeds.

    Science.gov (United States)

    Menotti-Raymond, Marilyn; David, Victor A; Pflueger, Solveig M; Lindblad-Toh, Kerstin; Wade, Claire M; O'Brien, Stephen J; Johnson, Warren E

    2008-01-01

    Genetic variation in cat breeds was assessed utilizing a panel of short tandem repeat (STR) loci genotyped in 38 cat breeds and 284 single-nucleotide polymorphisms (SNPs) genotyped in 24 breeds. Population structure in cat breeds generally reflects their recent ancestry and absence of strong breed barriers between some breeds. There is a wide range in the robustness of population definition, from breeds demonstrating high definition to breeds with as little as a third of their genetic variation partitioning into a single population. Utilizing the STRUCTURE algorithm, there was no clear demarcation of the number of population subdivisions; 16 breeds could not be resolved into independent populations, the consequence of outcrossing in established breeds to recently developed breeds with common ancestry. These 16 breeds were divided into 6 populations. Ninety-six percent of cats in a sample set of 1040 were correctly assigned to their classified breed or breed group/population. Average breed STR heterozygosities ranged from moderate (0.53; Havana, Korat) to high (0.85; Norwegian Forest Cat, Manx). Most of the variation in cat breeds was observed within a breed population (83.7%), versus 16.3% of the variation observed between populations. The hierarchical relationships of cat breeds is poorly defined as demonstrated by phylogenetic trees generated from both STR and SNP data, though phylogeographic grouping of breeds derived completely or in part from Southeast Asian ancestors was apparent.

  9. Floral Syndrome and Breeding System of Iris tectorum%鸢尾的花部结构及繁育系统特征

    Institute of Scientific and Technical Information of China (English)

    刘宗才; 焦铸锦; 董旭升; 代金星

    2011-01-01

    对鸢尾(Iris tectorum)居群的花部特征、授粉特性、繁育系统及访花昆虫行为等进行了研究。在自然条件下,鸢尾4—6月开花,群体花期约60 d,群体盛花期约30 d,集中在4月20日—5月20日,单株花期10~30 d,单花花期2 d。雄蕊短于花柱,花药紧贴花柱外侧,花药与柱头相差约3 mm,在花朵开放的整个过程中雌、雄蕊的相对位置不变。杂交指数OCI为4,P/O(花粉/胚珠比)为234.4,结合坐果率判断其繁育系统属于异交,部分自交亲和,需要传粉者。鸢尾高度特化的花部特征与黄胸木蜂(Xylocop%Field investigation was performed on the floral syndrome,pollination characteristics,pollinator behaviors and breeding system of Iris tectorum by continuous observations and analyzing data of out-crossing index,pollen-ovule ratio,fruit-set ratio and seed-set ratio.The results were as follows: Under natural conditions,the flowering stage of populations is about 60 days from April to June,and the majority of plants kept blooming in 20th April to 20th May.The flowering stage for individual plant was 10–30 days.The life span of a single flower was about 2 days.The stamen was closed to the lateral side of the petaloid style.The stamen was about 3 mm shorter than the style.The relative position between the stamen and style was always unchanged during the whole flowering stage.It showed that the breeding system was out-crossing,part self-compatibility,insect pollinator-dependent when comparing the results of pollination experiments with the results of out-crossing index and pollen-ovule ratio.The specialized floral structure was suitable for the behavior of the pollinator,Xylocopa appendiculata and Xylocopa tranquebarorum.Hand pollinations improved reproductive success,suggesting that sexual reproduction may be influenced by pollen limitation and less pollinators in nature.

  10. A genome-wide association study to detect genetic variation for postpartum dysgalactia syndrome in five commercial pig breeding lines.

    Science.gov (United States)

    Preissler, Regine; Tetens, Jens; Reiners, Kerstin; Looft, Holger; Kemper, Nicole

    2013-08-01

    Postpartum dysgalactia syndrome (PDS) in sows is an important disease after parturition with a relevant economic impact, affecting the health and welfare of both sows and piglets. The genetic background of this disease has been discussed and its heritability estimated, but further genetic analyses are lacking in detail. The aim of the current study was to detect loci affecting the susceptibility to PDS through a genome-wide association approach. The study was designed as a family-based association study with matched sampling of affected sows and healthy half- or full-sib control sows on six farms. For the study, 597 sows (322 affected vs. 275 healthy control sows) were genotyped on 62 163 single nucleotide polymorphisms (SNPs) using the Illumina PorcineSNP60 BeadChip. After quality control, 585 sows (314 affected vs. 271 healthy control sows) and 49 740 SNPs remained for further analysis. Statistics were performed mainly with the r package genabel and included a principal component analysis. A statistically significant genome-wide associated SNP was identified on porcine chromosome (SSC) 17. Further promising results with moderate significance were detected on SSC 13 and on an unplaced scaffold with an older annotation on SSC 15. The PRICKLE2 and NRP2 genes were identified as candidate genes near associated SNPs. Several quantitative trait loci (QTL) have been previously described in these genomic regions, including QTL for mammary gland condition, as teat number and non-functional nipples QTL, as well as QTL for body temperature and gestation length.

  11. Floral syndrome and breeding system of Corydalis edulis%紫堇的花部综合特征与繁育系统的研究

    Institute of Scientific and Technical Information of China (English)

    夏青; 周守标; 张栋; 晁天彩

    2012-01-01

    A field investigation was conducted on the floral syndrome and breeding system of Corydalis edulis located in natural populations in campus of Anhui Normal University by out-crossing index, pollen-ovule ratio, artificial pollination and bagging experiment. Hie results showed that the plant was in bloom from March to May and flowering span among populations was 72 days. The flowering span for a raceme was 14-24 days. The life span of one single flower was approximately 5-10 days. Spatial positioning of stigma and anthers were spatially desperation on the day of anthesis. The filaments were shorter than the styles through pollen vitality and stigma receptivity experiments. A self-pollination breeding system was reflected by OCI 3, pollinators were required sometimes; A complex cross bred was indicated by P/O =857.14, combined with the results of the bagging and artificial pollination experiment, the breeding system of C. edulis was mixed with self-pollination and outcrossing. The special floral structure and pests destroying may have a certain impact on seed-set rate.%目的:通过研究紫堇的花部综合特征和繁育系统,来了解其生物学特性,为其人工培育提供理论基础.方法:通过野外观察,运用杂交指数、花粉-胚珠比、花粉活力和柱头可授性、人工授粉和套袋实验等研究方法,对安徽师范大学赭山校区荷园内紫堇自然种群的开花动态及繁育系统进行了研究.结果:紫堇在3-5月份开花,群体花期72 d,一个总状花序花期14 ~24 d,单花花期5~10d.开花过程中柱头与花药无明显空间隔离现象,由花粉活力检测和柱头可授性观察,可知雌蕊先于雄蕊成熟.杂交指数(OCI)为3,繁育系统为自交亲和,有时需要传粉者;花粉-胚珠比(P/O) 857.14,为兼性异交;人工套袋和授粉实验证明其繁育类型倾向于自交.结论:紫堇的花部自身结构和传粉昆虫单一可能对结实率有一定的影响.

  12. PHOX2B polyalanine repeat length is associated with sudden infant death syndrome and unclassified sudden infant death in the Dutch population.

    Science.gov (United States)

    Liebrechts-Akkerman, Germaine; Liu, Fan; Lao, Oscar; Ooms, Ariadne H A G; van Duijn, Kate; Vermeulen, Mark; Jaddoe, Vincent W; Hofman, Albert; Engelberts, Adèle C; Kayser, Manfred

    2014-07-01

    Unclassified sudden infant death (USID) is the sudden and unexpected death of an infant that remains unexplained after thorough case investigation including performance of a complete autopsy and review of the circumstances of death and the clinical history. When the infant is below 1 year of age and with onset of the fatal episode apparently occurring during sleep, this is referred to as sudden infant death syndrome (SIDS). USID and SIDS remain poorly understood despite the identification of several environmental and some genetic risk factors. In this study, we investigated genetic risk factors involved in the autonomous nervous system in 195 Dutch USID/SIDS cases and 846 Dutch, age-matched healthy controls. Twenty-five DNA variants from 11 genes previously implicated in the serotonin household or in the congenital central hypoventilation syndrome, of which some have been associated with SIDS before, were tested. Of all DNA variants considered, only the length variation of the polyalanine repeat in exon 3 of the PHOX2B gene was found to be statistically significantly associated with USID/SIDS in the Dutch population after multiple test correction. Interestingly, our data suggest that contraction of the PHOX2B exon 3 polyalanine repeat that we found in six of 160 SIDS and USID cases and in six of 814 controls serves as a probable genetic risk factor for USID/SIDS at least in the Dutch population. Future studies are needed to confirm this finding and to understand the functional effect of the polyalanine repeat length variation, in particular contraction, in exon 3 of the PHOX2B gene.

  13. Introduction, persistence and fade-out of porcine reproductive and respiratory syndrome virus in a Dutch breeding herd : a mathematical analysis

    NARCIS (Netherlands)

    Nodelijk, G.; Jong, de M.C.M.; Nes, van A.; Vernooij, J.C.M.; Leengoed, L.A.M.G.; Pol, J.M.A.; Verheijden, J.H.M.

    2000-01-01

    The objective of this study was to investigate the dynamics of PRRSV infection and to quantify transmission within a breeding herd, and its impact on herd performance. For this purpose a longitudinal study was performed in a closed breeding herd of 115 sows. Statistical methods and Monte Carlo simul

  14. Repeated renal infarction in native and transplanted kidneys due to left ventricular thrombus formation caused by antiphospholipid antibody syndrome.

    Science.gov (United States)

    Scully, Paul; Leckstroem, Daniel C; McGrath, Andrew; Chambers, John; Goldsmith, David J

    2013-01-01

    Antiphospholipid syndrome can be a feature of several underlying conditions, such as lupus, but it can also occur idiopathically. Diagnosis usually comes after investigation of recurrent venous or arterial thromboses, emboli, or hypertension/proteinuria where the kidney is involved and is usually confirmed by laboratory testing. We describe a case of a man with a myocardial infarction who developed mural thrombus in an akinetic left ventricular segment but then who recurrently embolized first to one of his native kidneys and then later to a transplanted kidney. Although the clinical behavior was typical of antiphospholipid syndrome, it took numerous laboratory assays over many years until finally the problem was confirmed and life-long warfarin therapy instituted.

  15. Repeater F waves: a comparison of sensitivity with sensory antidromic wrist-to-palm latency and distal motor latency in the diagnosis of carpal tunnel syndrome.

    Science.gov (United States)

    Macleod, W N

    1987-05-01

    Thirty-five thousand six hundred supramaximal shocks were applied to 209 healthy and 147 entrapped median nerves (carpal tunnel syndrome--CTS) to characterize the backfiring behavior of the alpha motor neuron pool of abductor pollicis brevis in health and the modifying effect of a compressive neuropathy. A contraction of the normal subpopulation of active F-wave generators was found in CTS, while active neurons backfired at higher than normal frequencies (p less than 0.001). These modifications in spinal behavior are reflected in the % Repeater F-wave value, whose sensitivity in the detection of CTS approaches that of sensory wrist-to-palm latency estimation. This technique offers an alternative to latency measurement in the diagnosis of CTS. An economical strategy for the electrodiagnosis of CTS is proposed.

  16. Hormonal secretion and quality of life in Nelson syndrome and Cushing disease after long acting repeatable octreotide: a short series and update.

    Science.gov (United States)

    Arregger, Alejandro L; Cardoso, Estela M L; Sandoval, Olga B; Monardes Tumilasci, Elida G; Sanchez, Rocío; Contreras, Liliana N

    2014-01-01

    Clinical management of persistent adrenocorticotropin hormone (ACTH) excess in Nelson syndrome (NS) and Cushing disease (CD) remains a challenge. Somatostatin and its analogs as octreotide decrease ACTH secretion through somatostatin receptors of pituitary cells. To our knowledge, there are no reports on the effect of long-acting repeatable octreotide (oct-lar) on hormonal secretion and quality of life in patients with NS and CD who failed conventional therapy. Herein, we describe the effects of treatment with oct-lar (20 mg/month intramurally) in 1 woman with NS and 2 women with persistent CD. Oct-lar therapy reduced ACTH secretion and improved the quality of life in NS patient. By contrast, in CD patients, it failed to control ACTH and cortisol secretion, and the quality of life remained unchanged.

  17. Genome-wide gene expression profiles in lung tissues of pig breeds differing in resistance to porcine reproductive and respiratory syndrome virus.

    Directory of Open Access Journals (Sweden)

    Jinyi Xing

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS caused by PRRS virus (PRRSV is an infectious disease characterized by severe reproductive deficiency in pregnant sows, typical respiratory symptoms in piglets, and high mortality rate of piglets. In this study, we employed an Affymetrix microarray chip to compare the gene expression profiles of lung tissue samples from Dapulian (DPL pigs (a Chinese indigenous pig breed and Duroc×Landrace×Yorkshire (DLY pigs after infection with PRRSV. During infection with PRRSV, the DLY pigs exhibited a range of clinical features that typify the disease, whereas the DPL pigs showed only mild signs of the disease. Overall, the DPL group had a lower percentage of CD4(+ cells and lower CD4(+/CD8(+ratios than the DLY group (p<0.05. For both IL-10 and TNF-α, the DLY pigs had significantly higher levels than the DPL pigs (p<0.01. The DLY pigs have lower serum IFN-γ levels than the DPL pigs (p<0.01. The serum IgG levels increased slightly from 0 dpi to 7 dpi, and peaked at 14 dpi (p<0.0001. Microarray data analysis revealed 16 differentially expressed (DE genes in the lung tissue samples from the DLY and DPL pigs (q≤5%, of which LOC100516029 and LOC100523005 were up-regulated in the PRRSV-infected DPL pigs, while the other 14 genes were down-regulated in the PRRSV-infected DPL pigs compared with the PRRSV-infected DLY pigs. The mRNA expression levels of 10 out of the 16 DE genes were validated by real-time quantitative RT-PCR and their fold change was consistent with the result of microarray data analysis. We further analyzed the mRNA expression level of 8 differentially expressed genes between the DPL and DLY pigs for both uninfected and infected groups, and found that TF and USP18 genes were important in underlying porcine resistance or susceptibility to PRRSV.

  18. Repeated renal infarction in native and transplanted kidneys due to left ventricular thrombus formation caused by antiphospholipid antibody syndrome

    Directory of Open Access Journals (Sweden)

    Scully P

    2013-01-01

    Full Text Available Paul Scully,1 Daniel C Leckstroem,1 Andrew McGrath,2 John Chambers,3 David J Goldsmith11Nephrology Department, 2Radiology Department, 3Cardiology Department, King's Health Partners, Academic Health Sciences Centre, London, United KingdomAbstract: Antiphospholipid syndrome can be a feature of several underlying conditions, such as lupus, but it can also occur idiopathically. Diagnosis usually comes after investigation of recurrent venous or arterial thromboses, emboli, or hypertension/proteinuria where the kidney is involved and is usually confirmed by laboratory testing. We describe a case of a man with a myocardial infarction who developed mural thrombus in an akinetic left ventricular segment but then who recurrently embolized first to one of his native kidneys and then later to a transplanted kidney. Although the clinical behavior was typical of antiphospholipid syndrome, it took numerous laboratory assays over many years until finally the problem was confirmed and life-long warfarin therapy instituted.Keywords: antiphospholipid therapy, emboli, infarction, kidney, kidney transplant

  19. Chromosome breakage in Prader-Willi and Angelman syndrome deletions may involve recombination between a repeat at the proximal and distal breakpoints

    Energy Technology Data Exchange (ETDEWEB)

    Amos-Landgraf J.; Nicholls, R.D. [Case Western Reserve Univ., Cleveland, OH (United States); Gottlieb, W. [Univ. of Florida, Gainesville, FL (United States)] [and others

    1994-09-01

    Prader-Willi (PWS) and Angelman (AS) syndromes most commonly arise from large deletions of 15q11-q13. Deletions in PWS are paternal in origin, while those in AS are maternal in origin, clearly demonstrating genomic imprinting in these clinically distinct neurobehavioural disorders. In at least 90% of PWS and AS deletion patients, the same 4 Mb region within 15q11-q13 is deleted with breakpoints clustering in single YAC clones at the proximal and distal ends. To study the mechanism of chromosome breakage in PWS and AS, we have previously isolated 25 independent clones from these three YACs using Alu-vector PCR. Four clones were selected that appear to detect a low copy repeat that is located in the proximal and distal breakpoint regions of chromosome 15q11-q13. Three clones detect the same 4 HindIII bands in genomic DNA, all from 15q11-q13, with differing intensities for the probes located at the proximal or distal breakpoints region, respectively. This suggests that these probes detect related members of a low-copy repeat at either location. Moreover, the 254RL2 probe detects a novel HindIII band in two unrelated PWS deletion patients, suggesting that this may represent a breakpoint fragment, with recombination occurring within a similar interval in both patients. A fourth clone, 318RL3 detects 5 bands in HindIII-digested genomic DNA, all from 15q11-q13. This YAC endclone itself is not deleted in PWS and AS deletion patients, as seen by an invariant strong band. Two other strong bands are variably intact or deleted in different PWS or AS deletion patients, suggesting a relationship of this sequence to the breakpoints. Moreover, PCR using 318RL3 primers from the distal 93C9 YAC led to the isolation of a related clone with 96% identity, demonstrating the existence of a low-copy repeat with members close to the proximal and distal breakpoints. Taken together, our data suggest a complex, low-copy repeat with members at both the proximal and distal boundaries.

  20. 白及的花部特征与繁育系统%Floral Syndrome and Breeding System of Bletilla striata

    Institute of Scientific and Technical Information of China (English)

    王彩霞; 田敏; 李全健; 刘芬

    2012-01-01

    通过野外观察、授粉特性分析、杂交指数估算及人工控制授粉试验等方法对白及野生居群的花部特征和繁育系统进行了研究。结果表明:在自然条件下,白及4-5月开花,群体花期约44d,群体盛花期约12d,集中在4月29日-5月10日,单株花期11-27d,单花花期6-8d。总状花序上具两性花3-11朵。在花朵开放的整个过程中,花药始终高于柱头且两者之间存在隔性物质聚结成团,无法散落至柱头。开花后3d内花粉活力和柱头可授性均较高。白及交指娄为4,拿论去雄与否,套袋后的花均不结实,说明其不能进行自然的白花授粉和无融合生殖。同株异花授粉和异株授粉的结实率分别为93.33%、90.00%和93.33%,自然条件下的结实率为5.26%。花粉成熟时由粘性物质聚结成团和缺乏有效的传粉媒介可能是白及自然条件下结实率低的主要原因。%Field investigation, out-crossing index estimation, pollination characteristics analysis and artificial pollination experiments were conducted on the floral syndrome and breeding system of Bletilla striata. The main results were as follows: Under natural conditions, the flowering stage of populations was approximately 44 days from April to May, and the majority of plants kept blooming in 29th April to 10th May. The flowering stage for individual plant was approximately 11 - 27 days and the life span of a single flower was about 6 - 8 days. The flowers of B. striata were bisexual, with 3 to 11 in a raceme. The anther always exceeded stigma during the whole flowering process. Mature pollen grains were grouped by viscous substances and couldn't disseminate to the stigma. The pollen viability and the stigma receptivity were both high within 3 days after blossoming. The out-crossing index was 4. Bagged flowers had no fruit setting regardless of emasculation or not, which indicated that there were no spontaneous

  1. The Metabolic Syndrome, Inflammation, and Colorectal Cancer Risk: An Evaluation of Large Panels of Plasma Protein Markers Using Repeated, Prediagnostic Samples

    Directory of Open Access Journals (Sweden)

    Sophia Harlid

    2017-01-01

    Full Text Available Metabolic syndrome (MetS, a set of metabolic risk factors including obesity, dysglycemia, and dyslipidemia, is associated with increased colorectal cancer (CRC risk. A putative biological mechanism is chronic, low-grade inflammation, both a feature of MetS and a CRC risk factor. However, excess body fat also induces a proinflammatory state and increases CRC risk. In order to explore the relationship between MetS, body size, inflammation, and CRC, we studied large panels of inflammatory and cancer biomarkers. We included 138 participants from the Västerbotten Intervention Programme with repeated sampling occasions, 10 years apart. Plasma samples were analyzed for 178 protein markers by proximity extension assay. To identify associations between plasma protein levels and MetS components, linear mixed models were fitted for each protein. Twelve proteins were associated with at least one MetS component, six of which were associated with MetS score. MetS alone was not related to any protein. Instead, BMI displayed by far the strongest associations with the biomarkers. One of the 12 MetS score-related proteins (FGF-21, also associated with BMI, was associated with an increased CRC risk (OR 1.71, 95% CI 1.19–2.47. We conclude that overweight and obesity, acting through both inflammation and other mechanisms, likely explain the MetS-CRC connection.

  2. Monitoring of hematopoietic chimerism after transplantation for pediatric myelodysplastic syndrome: real-time or conventional short tandem repeat PCR in peripheral blood or bone marrow?

    Science.gov (United States)

    Willasch, Andre M; Kreyenberg, Hermann; Shayegi, Nona; Rettinger, Eva; Meyer, Vida; Zabel, Marion; Lang, Peter; Kremens, Bernhard; Meisel, Roland; Strahm, Brigitte; Rossig, Claudia; Gruhn, Bernd; Klingebiel, Thomas; Niemeyer, Charlotte M; Bader, Peter

    2014-12-01

    Quantitative real-time PCR (qPCR) has been proposed as a highly sensitive method for monitoring hematopoietic chimerism and may serve as a surrogate marker for the detection of minimal residual disease minimal residual disease in myelodysplastic syndrome (MDS), until specific methods of detection become available. Because a systematic comparison of the clinical utility of qPCR with the gold standard short tandem repeat (STR)-PCR has not been reported, we retrospectively measured chimerism by qPCR in 54 children transplanted for MDS in a previous study. Results obtained by STR-PCR in the initial study served as comparison. Because the detection limit of qPCR was sufficiently low to detect an autologous background, we defined the sample as mixed chimera if the proportion of recipient-derived cells exceeded .5%. The true positive rates were 100% versus 80% (qPCR versus STR-PCR, not significant), and mixed chimerism in most cases was detected earlier by qPCR than by STR-PCR (median, 31 days) when chimerism was quantified concurrently in peripheral blood and bone marrow. Both methods revealed a substantial rate of false positives (22.7% versus 13.6%, not significant), indicating the importance of serial testing of chimerism to monitor its progression. Finally, we propose criteria for monitoring chimerism in pediatric MDS with regard to the subtypes, specimens, PCR method, and timing of sampling.

  3. Expression of estrus before fixed-time AI affects conception rates and factors that impact expression of estrus and the repeatability of expression of estrus in sequential breeding seasons.

    Science.gov (United States)

    Richardson, Brittany N; Hill, Scott L; Stevenson, Jeffery S; Djira, Gemechis D; Perry, George A

    2016-03-01

    Expression of estrus after PG and before fixed-time AI has been reported to change the uterine environment, increase accessory sperm numbers, fertilization rates, and overall embryo survival. Thus, expression of estrus can strongly impact overall pregnancy success. Because of variation in percentage of beef females detected in estrus and number of animals per study, it can be difficult to detect a significant effect of estrus on pregnancy success. Thus, a meta-analysis was conducted using data from 10,116 beef females in 22 studies that utilized variations of the 5 most common fixed-time AI protocols (CO-Synch, 7-day CO-Synch+CIDR, 5-day CIDR, PG 6-day CIDR, and the 14-day CIDR protocols) to examine the effect of detection in standing estrus on subsequent fixed-time AI pregnancy success. A random-effects model was used to combine the studies/herds. The overall model indicated a positive effect of estrus on conception rates with cows detected in estrus before fixed-time AI having a 27% greater (Prate compared with those not detected in estrus. Next we determined factors that influenced expression of estrus. Data were available on 547 cows synchronized with a CIDR based fixed-time AI protocols and observed for estrus before AI during 2-4 breeding seasons. Analysis of these cows indicated that days postpartum (P=0.22) did not impact estrous expression. In contrast, BCS influenced estrous expression (P=0.04) with cows in a BCS of ≤4 (51±5%) having decreased expression of estrus compared to cows with a BCS>4 (≥70±4%). Initiation of estrous cycles before the breeding season also influenced estrous expression (P=0.03), with anestrous cows having greater expression of estrus compared with estrus-cycling cows (78±5% vs. 70±5%, respectively). In conclusion, among all currently recommended fixed-time AI protocols, cows detected in estrus before fixed-time AI had improved conception rates, with BCS and estrus-cycling status having the greatest influence on expression

  4. Chemotherapy refractory testicular germ cell tumor is associated with a variant in Armadillo Repeat gene deleted in Velco-Cardio-Facial syndrome (ARVCF

    Directory of Open Access Journals (Sweden)

    Chunkit eFung

    2012-12-01

    Full Text Available Introduction: There is evidence that inherited genetic variation affects both testicular germ cell tumor (TGCT treatment outcome and risks of late-complications arising from cisplatin-based chemotherapy. Using a candidate gene approach, we examined associations of three genes involved in the cisplatin metabolism pathway, GSTP1, COMT, and TPMT, with TGCT outcome and cisplatin-induced neurotoxicity. Material and Methods: Our study population includes a subset of patients (n=137 from a genome-wide association study at the University of Pennsylvania that evaluates inherited genetic susceptibility to TGCT. All patients in our study had at least one course of cisplatin-based chemotherapy with at least one year of follow up. A total of 90 markers in GSTP1, COMT and TPMT and their adjacent genomic regions (± 20 kb were analyzed for associations with refractory TGCT after first course of chemotherapy, progression-free survival (PFS, overall survival (OS, peripheral neuropathy, and ototoxicity. Results: After adjustment for multiple comparisons, one SNP, rs2073743, in the flanking region (± 20 kb of COMT was associated with refractory TGCT after initial chemotherapy. This SNP lies within the intron region of the Armadillo Repeat gene deleted in Velco-Cardio-Facial syndrome (ARVCF. The G allele of rs2073743 predisposed patients to refractory disease with a relative risk of 2.6 (95% CI 1.1, 6.3; P=0.03. Assuming recessive inheritance, patients with the GG genotype had 22.7 times higher risk (95% CI 3.3, 155.8; P=0.04 of developing refractory disease when compared to those with the GC or CC genotypes. We found no association of our candidate genes with peripheral neuropathy, ototoxicity, PFS and OS. Discussion: This is the first study to suggest that germline genetic variants of ARVCF may affect TGCT outcome. The result of this study is hypothesis generating and should be validated in future studies.

  5. Patients with chronic fatigue syndrome performed worse than controls in a controlled repeated exercise study despite a normal oxidative phosphorylation capacity

    Directory of Open Access Journals (Sweden)

    Sluiter Wim

    2010-10-01

    Full Text Available Abstract Background The aim of this study was to investigate the possibility that a decreased mitochondrial ATP synthesis causes muscular and mental fatigue and plays a role in the pathophysiology of the chronic fatigue syndrome (CFS/ME. Methods Female patients (n = 15 and controls (n = 15 performed a cardiopulmonary exercise test (CPET by cycling at a continuously increased work rate till maximal exertion. The CPET was repeated 24 h later. Before the tests, blood was taken for the isolation of peripheral blood mononuclear cells (PBMC, which were processed in a special way to preserve their oxidative phosphorylation, which was tested later in the presence of ADP and phosphate in permeabilized cells with glutamate, malate and malonate plus or minus the complex I inhibitor rotenone, and succinate with rotenone plus or minus the complex II inhibitor malonate in order to measure the ATP production via Complex I and II, respectively. Plasma CK was determined as a surrogate measure of a decreased oxidative phosphorylation in muscle, since the previous finding that in a group of patients with external ophthalmoplegia the oxygen consumption by isolated muscle mitochondria correlated negatively with plasma creatine kinase, 24 h after exercise. Results At both exercise tests the patients reached the anaerobic threshold and the maximal exercise at a much lower oxygen consumption than the controls and this worsened in the second test. This implies an increase of lactate, the product of anaerobic glycolysis, and a decrease of the mitochondrial ATP production in the patients. In the past this was also found in patients with defects in the mitochondrial oxidative phosphorylation. However the oxidative phosphorylation in PBMC was similar in CFS/ME patients and controls. The plasma creatine kinase levels before and 24 h after exercise were low in patients and controls, suggesting normality of the muscular mitochondrial oxidative phosphorylation. Conclusion The

  6. Indigenous knowledge of animal breeding and breeds

    OpenAIRE

    I. Kohler-Rollefson

    2004-01-01

    Indigenous knowledge of animal breeding (IK-AB) includes concepts and practices used to influence the genetic composition of herds. Indigenous selection is often based on preferences based on physical characteristics, vigor, social and economic insurance. This issue paper summarizes the value of indigenous knowledge and local breeds to achieve agricultural sustainability. Links to IK-AB information are also provided. Available in SANREM office, ES

  7. Deployment Repeatability

    Science.gov (United States)

    2016-04-01

    controlled to great precision, but in a Cubesat , there may be no attitude determination at all. Such a Cubesat might treat sun angle and tumbling rates as...could be sensitive to small differences in motor controller timing. In these cases, the analyst might choose to model the entire deployment path, with...knowledge of the material damage model or motor controller timing precision. On the other hand, if many repeated and environmentally representative

  8. Genomic dairy cattle breeding

    DEFF Research Database (Denmark)

    Mark, Thomas; Sandøe, Peter

    2010-01-01

    The aim of this paper is to discuss the potential consequences of modern dairy cattle breeding for the welfare of dairy cows. The paper focuses on so-called genomic selection, which deploys thousands of genetic markers to estimate breeding values. The discussion should help to structure...... the thoughts of breeders and other stakeholders on how to best make use of genomic breeding in the future. Intensive breeding has played a major role in securing dramatic increases in milk yield since the Second World War. Until recently, the main focus in dairy cattle breeding was on production traits......, unfavourable genetic trends for metabolic, reproductive, claw and leg diseases indicate that these attempts have been insufficient. Today, novel genome-wide sequencing techniques are revolutionising dairy cattle breeding; these enable genetic changes to occur at least twice as rapidly as previously. While...

  9. Genomic dairy cattle breeding

    DEFF Research Database (Denmark)

    Mark, Thomas; Sandøe, Peter

    2010-01-01

    The aim of this paper is to discuss the potential consequences of modern dairy cattle breeding for the welfare of dairy cows. The paper focuses on so-called genomic selection, which deploys thousands of genetic markers to estimate breeding values. The discussion should help to structure...... the thoughts of breeders and other stakeholders on how to best make use of genomic breeding in the future. Intensive breeding has played a major role in securing dramatic increases in milk yield since the Second World War. Until recently, the main focus in dairy cattle breeding was on production traits......, unfavourable genetic trends for metabolic, reproductive, claw and leg diseases indicate that these attempts have been insufficient. Today, novel genome-wide sequencing techniques are revolutionising dairy cattle breeding; these enable genetic changes to occur at least twice as rapidly as previously. While...

  10. Highly Informative Simple Sequence Repeat (SSR) Markers for Fingerprinting Hazelnut

    Science.gov (United States)

    Simple sequence repeat (SSR) or microsatellite markers have many applications in breeding and genetic studies of plants, including fingerprinting of cultivars and investigations of genetic diversity, and therefore provide information for better management of germplasm collections. They are repeatab...

  11. Study of simple sequence repeat (SSR) polymorphism for biotic ...

    African Journals Online (AJOL)

    home

    2013-10-02

    Oct 2, 2013 ... back cross breeding; SSRs, simple sequence repeats; PIC, polymorphism ..... PIC values were reported in barley wheat and rice (Gu et ... doubled-haploid rice population. Theor. ... Grover A, Aishwarya V, Sharma PC (2007).

  12. Large C9orf72 Hexanucleotide Repeat Expansions Are Seen in Multiple Neurodegenerative Syndromes and Are More Frequent Than Expected in the UK Population

    OpenAIRE

    Beck, Jon; Poulter, Mark; Hensman, Davina; Rohrer, Jonathan D.; Mahoney, Colin J; Adamson, Gary; Campbell, Tracy; Uphill, James; Borg, Aaron; Fratta, Pietro; Orrell, Richard W.; Malaspina, Andrea; Rowe, James; Brown, Jeremy; Hodges, John

    2013-01-01

    Hexanucleotide repeat expansions in C9orf72 are a major cause of frontotemporal lobar degeneration (FTLD) and amyotrophic lateral sclerosis (ALS). Understanding the disease mechanisms and a method for clinical diagnostic genotyping have been hindered because of the difficulty in estimating the expansion size. We found 96 repeat-primed PCR expansions: 85/2,974 in six neurodegenerative diseases cohorts (FTLD, ALS, Alzheimer disease, sporadic Creutzfeldt-Jakob disease, Huntington disease-like sy...

  13. Floral syndrome and breeding characters of Iris speculatrix%小花鸢尾的花部结构与繁育特性研究

    Institute of Scientific and Technical Information of China (English)

    王冠群; 李丹青; 张佳平; 夏宜平

    2014-01-01

    通过对小花鸢尾( Iris speculatrix)的田间观测,运用杂交指数、花粉活力及柱头可授性、花粉/胚珠比、人工控制授粉试验等方法,对其花部结构、开花动态及繁育系统进行研究。结果表明:在杭州地区自然气候条件下,小花鸢尾通常于5月初至6月初开花,群体花期约35 d;盛花期约12 d,集中在5月8日至5月20日;单株花期3~6 d,单花期3 d。花两性,雌雄蕊同熟。花药紧贴花柱外侧,低于柱头约3 mm。杂交指数(OCI)为4,花粉胚珠比(P/O)为552,结合去雄、人工套袋和自然授粉坐果率判断,小花鸢尾繁育系统为兼性异交。试验证实小花鸢尾的人工授粉坐果率高于自然传粉,其自然授粉有性繁殖系统受到花器官结构和环境因子的影响。%Through the specific field observation of Iris speculatrix, its outcrossing index , pollen vitality and stigma receptivity , the ratio of pollen and ovule , artificial pollination and bagging were investigated to understand the flower feature , blossom dynamic and breeding system .Results showed that under the natural climate of Hangzhou , the flow-ering stage of populations was about 35 d from May to June, and the majority of plants kept blooming in 8th May to 20th May.The flowering stage for individual plant was 3-6 days.The life span of a single flower was about 3 d. The flowers, setting on the same inflorescence , were monoecism.Male and female flowers mature at the same time , and the distance between anther and stigma was about 3 mm.The out cross index(OCI)was 4, and pollen-ovule ratio ( P/O) was 552 .Taking the results of the emasculated , bagged and artificial pollination experiment together , it indi-cated that Iris speculatrix flower is a mixed-crossing system with out-crossing affinity as the main breeding form and concomitance out-crossing.Artificial pollination on fruit set rate was higher than the natural pollination .It was con

  14. 风箱果的花部综合特征及繁育系统研究%Floral syndrome and breeding system of Physocarpus amurensis

    Institute of Scientific and Technical Information of China (English)

    殷东生; 魏晓慧; 沈海龙

    2016-01-01

    风箱果属濒危灌木且分布范围狭窄,自然条件下有性更新能力差,局部种群有消失的趋势.通过野外观察和人工授粉试验对风箱果的传粉生物学特征和繁育系统进行研究.结果表明:单花花期(5.1 ± 0.23) d,花序花期(8.4 ± 0.98)d.单花花期依其形态和散粉时间可以分为5个时期,即初花期、散粉前期、散粉初期、散粉盛期、散粉末期.通过花粉/胚珠测定,结合人工授粉和套袋试验可以确定风箱果的繁育系统属于专性异交、自交不亲和、传粉过程需要传粉者.自然状态下风箱果的结实率(23.02 ± 6.08)%和结籽率(9.86 ± 2.86)%均较低,这与当前片断化生境中传粉昆虫种类和数量少、效率低下等有关,说明生境片断化影响风箱果植株的早期生殖成功.异株异花授粉可显著提高结实率及结籽率,分别可达(60.17 ± 4.67)% 和(49.61 ± 4.04)%.%Physocarpus amurensis is an endangered shrub with an extremely narrow distribution in fragmented habitats.Its sexual reproductive capacity is low,and local population may be disappeared gradually.We studied the characteristics of pollination biology and breeding system of P.amurensis in the fragmented habitats through field observation and artificial pollination.Results showed that the life spans of single flowers and inflorescences were (5.1 ± 0.23) d and (8.4 ± 0.98) d,respectively.The flowering phase of a single flower can be divided into five periods in terms of flower morphology and dehiscence:"flower bud","pre-dehiscence","initial dehiscence","full dehiscence",and "end-dehiscence".Based on the results of pollen/ovule ratio,emasculation,bagging and artificial pollination studies,we found that the breeding system of P.amurensis is outcrossed and self-incompatible,and demands for pollinators.The fruit-setting ratio and seed-bearing ratio under natural conditions were low,(23.02 ± 6.08)% and (9.86 ± 2.86)%,respectively.The main reason might be that

  15. Implementation in breeding programmes

    NARCIS (Netherlands)

    Coffey, M.P.; McParland, S.; Bastin, C.; Wall, E.; Berry, D.P.; Veerkamp, R.F.

    2013-01-01

    Genetic improvement is easy when selecting for one heritable and well-recorded trait at a time. Many industrialised national dairy herds have overall breeding indices that incorporate a range of traits balanced by their known or estimated economic value. Future breeding goals will contain more non-p

  16. Implementation in breeding programmes

    NARCIS (Netherlands)

    Coffey, M.P.; McParland, S.; Bastin, C.; Wall, E.; Berry, D.P.; Veerkamp, R.F.

    2013-01-01

    Genetic improvement is easy when selecting for one heritable and well-recorded trait at a time. Many industrialised national dairy herds have overall breeding indices that incorporate a range of traits balanced by their known or estimated economic value. Future breeding goals will contain more non-p

  17. PRINCIPLES OF ANIMAL BREEDING

    Directory of Open Access Journals (Sweden)

    Sonja Jovanovac

    2014-06-01

    Full Text Available University textbook Principles of Animal Breeding is intended for students of agriculture and veterinary medicine. The material is the adapted curricula of undergraduate and graduate level studies in the framework of which the modules Principles of animal breeding as well as Basics of genetics and selection of animals attended are listened. The textbook contains 14 chapters and a glossary of terms. Its concept enables combining fundamental and modern knowledge in the breeding and selection of animals based on balanced and quality manner. The textbook material can be divided into several thematic sections. The first one relates to the classical notions of domestic animals breeding such as the history of breeding, domestication, breed, hereditary and non-hereditary variability and description of general and production traits. The second section focuses on the basic concepts in population and quantitative genetics, as well as biometrics. The third unit is dedicated to the principles of selection and domestic animals improving. The fourth unit relates to the current concepts and objectives of the molecular markers use in domestic animals selection and breeding. The above material has been submitted to the Croatian universities, but so far it has not been published as a textbook. The Ministry of Science, Education and Sports of Republic of Croatia approved financial support for the textbook publication.

  18. Most frequent calf diseases in industrial breeding

    Directory of Open Access Journals (Sweden)

    Lazić Sava

    2004-01-01

    Full Text Available It is possible to conduct an analysis of the incidence of viral diseases in calves if these diseases are divided into two basic groups. One group comprises diseases of respiratory organs which are manifested by symptoms of a respiratory syndrome, and the second group comprises diseases of digestive tract organs in the form of a gastrointestinal syndrome. It is considered that viruses have the dominant role in the complex etiology of the respiratory syndrome, primarily the IBR virus or the Bovine Herpes Virus-1 (BHV-1, followed by the parainfluenza 3 virus (RSV, the Bovine Viral Diahrrea Virus (BVDV, the bovine Respiratory Syncytial Virus (RSV, but also other viruses, such as adenoviruses, rhinoviruses, coronaviruses, can also influence the appearance of the respiratory syndrome. The respiratory syndrome is rarely caused by a single viral agent, but most frequently by mixed viruses, but also by bacterial infections. Mixed viral infections often have a lethal outcome. Investigations of the etiology of the gastrointestinal syndrome so far indicate that, in addition to bacteria, viruses can also be a significant etiological factor. Rotaviruses, coronaviruses, adenoviruses parvoviruses, herpesviruses (the IBR virus, pestiviruses (BVDV, can be the causes of a gastrointestinal syndrome. It is believed that viruses can be the cause in about 10% cases in the ethiopathogenesis of this syndrome. The paper describes the etiopathogenesis of calf diseases of viral etiology which are most often found in the local conditions of industrial breeding of calves.

  19. Food-induced contact urticaria syndrome (CUS) in atopic dermatitis: Reproducibility of repeated and duplicate testing with a skin provocation test,the skin application food test (SAFT)

    NARCIS (Netherlands)

    A.P. Oranje (Arnold); D. van Gysel (Dirk); P.G.H. Mulder (Paul); P.H. Dieges

    1994-01-01

    textabstractIgE-mediated contact urticaria syndrome (CUS) is one of the manifestations of allergy in childhood atopic dermatitis (AD). Allergens such as foods and animal products penetrate the skin easily. They can then cause urticarial reactions in sensitized individuals. A provocation test system

  20. Birds - Breeding [ds60

    Data.gov (United States)

    California Department of Resources — This data set provides access to information gathered on annual breeding bird surveys in California using a map layer developed by the Department. This data layer...

  1. Waterfowl breeding population survey

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Waterfowl breeding population surveys have been completed annually on the Arctic Coastal Plain of Alaska since 1986. Methods for the 2011 Arctic Coastal Plain...

  2. Waterfowl breeding population survey

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Waterfowl breeding population surveys have been completed annually on the Arctic Coastal Plain of Alaska since 1986. Methods for the 2010 Arctic Coastal Plain...

  3. Garlic breeding system innovations

    NARCIS (Netherlands)

    Zheng, S.J.; Kamenetsky, R.; Féréol, L.; Barandiaran, X.; Rabinowitch, H.D.; Chovelon, V.; Kik, C.

    2007-01-01

    This review outlines innovative methods for garlic breeding improvement and discusses the techniques used to increase variation like mutagenesis and in vitro techniques, as well as the current developments in florogenesis, sexual hybridization, genetic transformation and mass propagation. Sexual ste

  4. PRINCIPLES OF ANIMAL BREEDING

    OpenAIRE

    2014-01-01

    University textbook Principles of Animal Breeding is intended for students of agriculture and veterinary medicine. The material is the adapted curricula of undergraduate and graduate level studies in the framework of which the modules Principles of animal breeding as well as Basics of genetics and selection of animals attended are listened. The textbook contains 14 chapters and a glossary of terms. Its concept enables combining fundamental and modern knowledge in the ...

  5. A case of congenital central hypoventilation syndrome in a three-generation family with non-polyalanine repeat PHOX2B mutation.

    Science.gov (United States)

    Low, K J; Turnbull, A R; Smith, K R; Hilliard, T N; Hole, L J; Meecham Jones, D J; Williams, M M; Donaldson, A

    2014-10-01

    We describe a three generation family in whom multiple individuals are variably affected due to a PHOX2B non-polyalanine repeat mutation. This family demonstrates extreme phenotypic variability and autosomal dominant transmission over three generations not previously reported in the wider literature. Novel findings also inclue a history of recurrent second trimester miscarriage. Pediatr Pulmonol. 2014; 49:E140-E143. © 2014 Wiley Periodicals, Inc.

  6. [Gene pool differentiation between Altaic and trotting horse breeds inferred from ISSR-PCR marker data].

    Science.gov (United States)

    Feofilov, A V; Bardukov, N V; Glazko, V I

    2011-09-01

    Using ISSR-PCR marker data, comparative analysis of the gene pools of Altaic and trotting horse breeds was carried out. Horse groups of different origin demonstrated differences in amplification spectra of DNA fragments flanked by inverted repeats of four microsatellites. Combinations of certain DNA fragments present in these profiles reproducibly distinguished genomes of the Altaic breed from the trotting breeds. Genetic differentiation between some trotting breeds, based on Nei genetic distance values, was found to be comparable to that between the groups of horses of Altaic breed from two different farms.

  7. Broiler breeding : breeding goals, selection schemes and the usefulness of local breeds for China

    NARCIS (Netherlands)

    Jiang, X.

    1999-01-01

    This dissertation considers three aspects of broiler breeding: definition of breeding goals, selection schemes for specialized lines, and the usefulness of local breeds for China. Economic values in broiler breeding were derived based on a deterministic model. A systematic design for the application

  8. Breeding-assisted genomics.

    Science.gov (United States)

    Poland, Jesse

    2015-04-01

    The revolution of inexpensive sequencing has ushered in an unprecedented age of genomics. The promise of using this technology to accelerate plant breeding is being realized with a vision of genomics-assisted breeding that will lead to rapid genetic gain for expensive and difficult traits. The reality is now that robust phenotypic data is an increasing limiting resource to complement the current wealth of genomic information. While genomics has been hailed as the discipline to fundamentally change the scope of plant breeding, a more symbiotic relationship is likely to emerge. In the context of developing and evaluating large populations needed for functional genomics, none excel in this area more than plant breeders. While genetic studies have long relied on dedicated, well-structured populations, the resources dedicated to these populations in the context of readily available, inexpensive genotyping is making this philosophy less tractable relative to directly focusing functional genomics on material in breeding programs. Through shifting effort for basic genomic studies from dedicated structured populations, to capturing the entire scope of genetic determinants in breeding lines, we can move towards not only furthering our understanding of functional genomics in plants, but also rapidly improving crops for increased food security, availability and nutrition.

  9. Breed differences in behavioural development in kittens.

    Science.gov (United States)

    Marchei, P; Diverio, S; Falocci, N; Fatjó, J; Ruiz-de-la-Torre, J L; Manteca, X

    2009-03-23

    Differences in behaviour of pure breed cats have been suggested but not wholly investigated. Oriental/Siamese/Abyssinian (OSA) kittens (n=43) were weekly compared with Norwegian Forest (NFO) kittens (n=39) from the 4th to the 10th week of age in a repeated Open Field Test (OFT) paradigm. Heart rate (HR) and rectal temperature (RT) before and after the test, and behavioural responses during the OFT were recorded. Behaviours registered were analysed by focal animal sampling. Significant breed differences were found; cats of the northern zones (NFO) seem to develop earlier thermoregulatory abilities. Precocious opening of eyes, higher locomotion scores and longer time spent standing, observed in OSA kittens may indicate an earlier neurological development. Inter breed differences recorded for exploration and locomotion seem to indicate coping style divergences: in the OFT challenging situation OSA kittens presented higher emotional tachycardia and performed more passively, with a faster decline in exploration and locomotion scores. NFO kittens exerted a more active behaviour as they spent more time exploring the arena and in escape attempts. Notwithstanding OSA and NFO cat selection was mainly aimed to improve divergent morphological traits, some different behavioural and physiological traits seem to have been maintained or co-selected within each breed.

  10. Welfare in horse breeding

    DEFF Research Database (Denmark)

    Campbell, M.L.H.; Sandøe, Peter

    2015-01-01

    Welfare problems related to the way horses are bred, whether by coitus or by the application of artificial reproduction techniques (ARTs), have been given no discrete consideration within the academic literature. This paper reviews the existing knowledge base about welfare issues in horse breeding...... and identifies areas in which data is lacking. We suggest that all methods of horse breeding are associated with potential welfare problems, but also that the judicious use of ARTs can sometimes help to address those problems. We discuss how negative welfare effects could be identified and limited and how...

  11. Welfare in horse breeding

    DEFF Research Database (Denmark)

    Campbell, M.L.H.; Sandøe, Peter

    2015-01-01

    Welfare problems related to the way horses are bred, whether by coitus or by the application of artificial reproduction techniques (ARTs), have been given no discrete consideration within the academic literature. This paper reviews the existing knowledge base about welfare issues in horse breeding...... and identifies areas in which data is lacking. We suggest that all methods of horse breeding are associated with potential welfare problems, but also that the judicious use of ARTs can sometimes help to address those problems. We discuss how negative welfare effects could be identified and limited and how...

  12. Dexmedetomidine for an awake fiber-optic intubation of a parturient with Klippel-Feil syndrome, Type I Arnold Chiari malformation and status post released tethered spinal cord presenting for repeat cesarean section

    Directory of Open Access Journals (Sweden)

    Tanmay H. Shah

    2011-08-01

    Full Text Available Patients with Klippel-Feil Syndrome (KFS have congenital fusion of their cervical vertebrae due to a failure in the normal segmentation of the cervical vertebrae during the early weeks of gestation and also have myriad of other associated anomalies. Because of limited neck mobility, airway management in these patients can be a challenge for the anesthesiologist. We describe a unique case in which a dexmedetomidine infusion was used as sedation for an awake fiber-optic intubation in a parturient with Klippel-Feil Syndrome, who presented for elective cesarean delivery. A 36-yearold female, G2P1A0 with KFS (fusion of cervical vertebrae who had prior cesarean section for breech presentation with difficult airway management was scheduled for repeat cesarean delivery. After obtaining an informed consent, patient was taken in the operating room and non-invasive monitors were applied. Dexmedetomidine infusion was started and after adequate sedation, an awake fiberoptic intubation was performed. General anesthetic was administered after intubation and dexmedetomidine infusion was continued on maintenance dose until extubation. Klippel-Feil Syndrome (KFS is a rare congenital disorder for which the true incidence is unknown, which makes it even rare to see a parturient with this disease. Patients with KFS usually have other congenital abnormalities as well, sometimes including the whole thoraco-lumbar spine (Type III precluding the use of neuraxial anesthesia for these patients. Obstetric patients with KFS can present unique challenges in administering anesthesia and analgesia, primarily as it relates to the airway and dexmedetomidine infusion has shown promising result to manage the airway through awake fiberoptic intubation without any adverse effects on mother and fetus.

  13. Syndrome of arachnomelia in Simmental cattle

    Directory of Open Access Journals (Sweden)

    Weppert Myriam

    2008-10-01

    Full Text Available Abstract Background The syndrome of arachnomelia is an inherited malformation mainly of limbs, back and head in cattle. At present the arachnomelia syndrome has been well known mainly in Brown Swiss cattle. Nevertheless, the arachnomelia syndrome had been observed in the Hessian Simmental population during the decade 1964–1974. Recently, stillborn Simmental calves were observed having a morphology similar to the arachnomelia syndrome. The goal of this work was the characterization of the morphology and genealogy of the syndrome in Simmental to establish the basis for an effective management of the disease. Results The first pathologically confirmed arachnomelia syndrome-cases in the current Simmental population appeared in the year 2005. By 2007, an additional 140 calves with the arachnomelia syndrome were identified. The major pathological findings were malformed bones affecting the head, long bones of the legs and the vertebral column. It could be shown that, with the exception of two cases that were considered as phenocopies, all of the paternal and about two-third of the maternal pedigrees of the affected calves could be traced back to one common founder. Together with the data from experimental matings, the pedigree data support an autosomal recessive mutation being the etiology of the arachnomelia syndrome. The frequency of the mutation in the current population was estimated to be 3.32%. Conclusion We describe the repeated occurrence of the arachnomelia syndrome in Simmental calves. It resembles completely the same defect occurring in the Brown Swiss breed. The mutation became relatively widespread amongst the current population. Therefore, a control system has to be established and it is highly desirable to map the disease and develop a genetic test system.

  14. Hominoid lineage specific amplification of low-copy repeats on 22q11.2 (LCR22s) associated with velo-cardio-facial/digeorge syndrome.

    Science.gov (United States)

    Babcock, Melanie; Yatsenko, Svetlana; Hopkins, Janet; Brenton, Matthew; Cao, Qing; de Jong, Pieter; Stankiewicz, Pawel; Lupski, James R; Sikela, James M; Morrow, Bernice E

    2007-11-01

    Segmental duplications or low-copy repeats (LCRs) constitute approximately 5% of the sequenced portion of the human genome and are associated with many human congenital anomaly disorders. The low-copy repeats on chromosome 22q11.2 (LCR22s) mediate chromosomal rearrangements resulting in deletions, duplications and translocations. The evolutionary mechanisms leading to LCR22 formation is unknown. Four genes, USP18, BCR, GGTLA and GGT, map adjacent to the LCR22s and pseudogene copies are located within them. It has been hypothesized that gene duplication occurred during primate evolution, followed by recombination events, forming pseudogene copies. We investigated whether gene duplication could be detected in non-human hominoid species. FISH mapping was performed using probes to the four functional gene loci. There was evidence for a single copy in humans but additional copies in hominoid species. We then compared LCR22 copy number using LCR22 FISH probes. Lineage specific LCR22 variation was detected in the hominoid species supporting the hypothesis. To independently validate initial findings, real time PCR, and screening of gorilla BAC library filters were performed. This was compared to array comparative genome hybridization data available. The most striking finding was a dramatic amplification of LCR22s in the gorilla. The LCR22s localized to the telomeric or subtelomeric bands of gorilla chromosomes. The most parsimonious explanation is that the LCR22s became amplified by inter-chromosomal recombination between telomeric bands. In summary, our results are consistent with a lineage specific coupling between gene and LCR22 duplication events. The LCR22s thus serve as an important model for evolution of genome variation.

  15. Thoracic meningocele in lumbo-costo-vertebral syndrome in a child: possible enlargement with repeated motion by anchoring to the diaphragm.

    Science.gov (United States)

    Wataya, Takafumi; Horikawa, Kyohei; Kitagawa, Masashi; Tashiro, Yuzuru

    2016-08-01

    Lumbo-costo-vertebral syndrome (LCVS) is a rare disorder in children that is characterized by hemivertebrae, congenital absence of ribs, meningocele, and hypoplasia of the truncal and abdominal wall presenting as a congenital lumbar hernia. An otherwise healthy 12-month-old girl was referred to the authors' hospital with soft swelling on her left middle back; scoliosis had been present since birth. Imaging revealed a thoracic meningocele, ectopia of the spleen suggesting lumbar hernia, multiple anomalies of the thoracic vertebral columns, and defects of the ribs; thus, LCVS was diagnosed. Surgical observation revealed that the meningocele was firmly anchored to part of the diaphragm, which created stretching tension in the meningocele continuously with exhalation. Once detached, the meningocele shrank spontaneously and never developed again after cauterization. In this case, continuous or pulsatile pressure in the presence of a vertebral defect was thus considered to be an important factor for formation of the thoracic meningocele.

  16. [Intravenous Sedation and Repeated "the Same Day General Anesthesia" for a School-age Boy with Dandy-Walker Syndrome and Dentinogenesis].

    Science.gov (United States)

    Hitosugi, Takashi; Tsukamoto, Masanori; Fujiwara, Shigeki; Yokoyama, Takeshi

    2016-03-01

    Dandy-Walker syndrome (DWS) is characterized by perfect or partial defect of the cerebellum vermis and cystic dilatation of the posterior fossa communicating with the fourth ventricle. Common clinical signs are mental retardation, cerebellar ataxia, and those of increased intracranial pressure (ICP). Associated congenital anomalies are craniofacial, cardiac, renal, and skeletal abnormalities. We experienced a case of intravenous sedation and six times of "the same day" general anesthesia for a school-aged boy (10-13 years old) with DWS and hypodentinogenesis. The patient underwent an examination and dental treatments. We had to pay attention to airway management tracheal tube selection and control of ICP. In addition, we should prevent tooth injuries through mishaps during tracheal intubations, since all-tooth-hypoplasia with fragile dental crowns was strongly suggested in this case. Detailed postoperative care is also required for general anesthesia afflicted with DWS.

  17. Breeding kennel management.

    Science.gov (United States)

    Mullen, S

    1992-09-01

    Veterinarians and dog breeders should work together to establish protocols for health care and breeding management that are based on sound scientific principles as well as practical systems. These protocols should involve bitches, stud dogs, and puppies. Tantamount importance must be placed on record keeping so that problems may be identified and solved before they are irreversible.

  18. Plant breeding and genetics

    Science.gov (United States)

    The ultimate goal of plant breeding is to develop improved crops. Improvements can be made in crop productivity, crop processing and marketing, and/or consumer quality. The process of developing an improved cultivar begins with intercrossing lines with high performance for the traits of interest, th...

  19. Travelling to breed

    NARCIS (Netherlands)

    Drent, RJ; Fox, AD; Stahl, J

    2006-01-01

    Traditionally, investigation of the dynamics of avian migration has been heavily biased towards the autumn return trip to the wintering quarters. Since the migratory prelude to breeding has direct fitness consequences, the European Science Foundation recently redressed the balance and sponsored a wo

  20. Penguin breeding in Edinburgh

    NARCIS (Netherlands)

    Gillespie, T.H.; F.R.S.E.,; F.Z.S.,

    1939-01-01

    The Scottish National Zoological Park at Edinburgh has been notably successful in keeping and breeding penguins. It is happy in possessing as a friend and benefactor, Mr Theodore E. Salvesen, head of the firm of Christian Salvesen & Co., Leith, to whose interest and generosity it owes the great numb

  1. Reverse breeding: a novel breeding approach based on engineered meiosis

    NARCIS (Netherlands)

    Dirks, R.; Dun, van K.P.M.; Snoo, de B.; Berg, van den M.; Lelivelt, C.L.C.; Voermans, W.; Woudenberg, L.; Wit, de J.P.C.; Reinink, K.; Schut, J.W.; Jong, de J.H.S.G.M.; Wijnker, T.G.

    2009-01-01

    Reverse breeding (RB) is a novel plant breeding technique designed to directly produce parental lines for any heterozygous plant, one of the most sought after goals in plant breeding. RB generates perfectly complementing homozygous parental lines through engineered meiosis. The method is based on re

  2. Prevalence of myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS in three regions of England: a repeated cross-sectional study in primary care

    Directory of Open Access Journals (Sweden)

    Fayyaz Shagufta

    2011-07-01

    Full Text Available Abstract Background Myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS or chronic fatigue syndrome (CFS has been used to name a range of chronic conditions characterized by extreme fatigue and other disabling symptoms. Attempts to estimate the burden of disease have been limited by selection bias, and by lack of diagnostic biomarkers and of agreed reproducible case definitions. We estimated the prevalence and incidence of ME/CFS in three regions in England, and discussed the implications of frequency statistics and the use of different case definitions for health and social care planning and for research. Methods We compared the clinical presentation, prevalence and incidence of ME/CFS based on a sample of 143,000 individuals aged 18 to 64 years, covered by primary care services in three regions of England. Case ascertainment involved: 1 electronic search for chronic fatigue cases; 2 direct questioning of general practitioners (GPs on cases not previously identified by the search; and 3 clinical review of identified cases according to CDC-1994, Canadian and Epidemiological Case (ECD Definitions. This enabled the identification of cases with high validity. Results The estimated minimum prevalence rate of ME/CFS was 0.2% for cases meeting any of the study case definitions, 0.19% for the CDC-1994 definition, 0.11% for the Canadian definition and 0.03% for the ECD. The overall estimated minimal yearly incidence was 0.015%. The highest rates were found in London and the lowest in East Yorkshire. All but one of the cases conforming to the Canadian criteria also met the CDC-1994 criteria, however presented higher prevalence and severity of symptoms. Conclusions ME/CFS is not uncommon in England and represents a significant burden to patients and society. The number of people with chronic fatigue who do not meet specific criteria for ME/CFS is higher still. Both groups have high levels of need for service provision, including health and social

  3. CGG repeat in the FMR1 gene: Size matters

    NARCIS (Netherlands)

    R.A. Willemsen (Ralph); G.J. Levenga (Josien); B.A. Oostra (Ben)

    2011-01-01

    textabstractThe FMR1 gene contains a CGG repeat present in the 5'-untranslated region which can be unstable upon transmission to the next generation. The repeat is up to 55 CGGs long in the normal population. In patients with fragile X syndrome (FXS), a repeat length exceeding 200 CGGs (full

  4. Repeat-until-success quantum repeaters

    Science.gov (United States)

    Bruschi, David Edward; Barlow, Thomas M.; Razavi, Mohsen; Beige, Almut

    2014-09-01

    We propose a repeat-until-success protocol to improve the performance of probabilistic quantum repeaters. Conventionally, these rely on passive static linear-optics elements and photodetectors to perform Bell-state measurements (BSMs) with a maximum success rate of 50%. This is a strong impediment for entanglement swapping between distant quantum memories. Every time a BSM fails, entanglement needs to be redistributed between the corresponding memories in the repeater link. The key ingredients of our scheme are repeatable BSMs. Under ideal conditions, these turn probabilistic quantum repeaters into deterministic ones. Under realistic conditions, our protocol too might fail. However, using additional threshold detectors now allows us to improve the entanglement generation rate by almost orders of magnitude, at a nominal distance of 1000 km, compared to schemes that rely on conventional BSMs. This improvement is sufficient to make the performance of our scheme comparable to the expected performance of some deterministic quantum repeaters.

  5. 多次利培酮治疗致抗精神病药恶性综合征%Neuroleptic malignant syndrome after repeated treatment with risperidone

    Institute of Scientific and Technical Information of China (English)

    丁跃庆; 李华; 谢振强; 张伟娟; 代俊; 孔君; 吴洪军

    2012-01-01

    1例31岁女性患者因精神分裂症给予利培酮1 mg,2次/d口服,1周后剂量增至2 mg,2次/d.此前患者曾3次间断应用利培酮治疗.本次治疗规律服药49 d,患者精神症状缓解.第50~52天未遵医嘱规律服药.第54天患者出现大汗淋漓,体温达38.5 ℃.第55天出现意识障碍、心动过速、双上肢肌强直、肌张力增高.心电图示窦性心动过速.实验室检查示:白细胞计数12.3×109/L,胆碱酯酶 13 268 U /L,肌酸激酶 1447 U/L,利培酮血液浓度70.5 μg/L.诊断为抗精神病药恶性综合征(NMS).立即停用利培酮,进行物理降温、补液、抗心律失常、抗感染、纠正酸碱平衡、护肝等治疗.6 d后患者体温恢复正常,NMS症状消失.换用奥氮平治疗后,未再出现类似症状.%A 31-year-old woman with schizophrenia received risperidone 1 mg twice daily. One week later, the dose was increased to 2 mg twice daily. The patient had previously received risperidone intermittent treatment for three times. After a 49-day regular treatment, the psychiatric symptoms relieved. On days 50 to 52, she did not adhere to the instructions of the physician for regular use of the drug. On day 54, the patient experienced profuse sweating with a temperature of 38. 5 ℃. On day 55, she developed disturbance of consciousness, tachycardia, muscle rigidity of the upper limbs, and hypermyotonia. Her electrocardiograph showed sinus tachycardia. Laboratory tests showed the following findings: white blood cell count 12. 3 × 109/L, cholinesterase 13 268 U/L, creatine kinase 1447 U/L. The blood concentrations of risperidone was 70. 5 μg/L. Neuroleptic malignant syndrome ( NMS ) was diagnosed. The medication was stopped immediately. Physical methods for lowering body temperature, fluid supplement, antiarrhythmics, anti-infective therapy, correction of the acid-base imbalance, and liver-protective treatment were given. Six days later, the temperature returned to normal, the NMS symptoms

  6. Beyond breeding area management

    DEFF Research Database (Denmark)

    Pedersen, Lykke; Thorup, Kasper; Tøttrup, Anders P.

    Every year, billions of songbirds migrate thousands of kilometres between their European breeding grounds and African overwintering area. As migratory birds are dependent on resources at a number of sites varying in both space and time, they are likely to be more vulnerable to environmental change...... technological advances are currently enabling us to track yet smaller songbirds throughout their migration cycle providing valuable insight into the life cycle of individual birds. However, direct tracking of migratory birds has so far mainly been conducted on single populations and our understanding of entire...... and provide important information for conservation management of migratory birds....

  7. Breeding tropical forages

    Directory of Open Access Journals (Sweden)

    L Jank

    2011-01-01

    Full Text Available Brazil has the largest commercial beef cattle herd and is the main beef exporter in the world. Cultivated pastures arethe basis for the Brazilian beef production, and occupy an area of 101.4 million hectares. However, very few forage cultivars arecommercially available, and the majority of these are of apomictic reproduction, thus genetically homogeneous. Tropical foragebreeding is at its infancy, but much investment and efforts have been applied in the last three decades and some new cultivars havebeen released. In this paper, origin of different species, modes of reproduction, breeding programs and targets are discussed andthe resulting new cultivars released are presented.

  8. Radiation mutation breeding

    Energy Technology Data Exchange (ETDEWEB)

    Song, Hi Sup; Kim, Jae Sung; Kim, Jin Kyu; Shin, In Chul; Lim, Young Taek

    1998-04-01

    In order to develop an advanced technical knowledge for the selection of better mutants, some of the crops were irradiated and the mutation rate, the survival rate and the method for selction of a mutant were studied. Furthermore, this study aimed to obtain basic data applicable to the development of genetic resources by evaluation and analysis the specific character for selection of the superior mutant and its plant breeding. 1. selection of the mutant with a superior resistance against environment in the principal crops 1) New varieties of mutant rices such as Wonpyeongbyeo, Wongwangbyeo, Winmibyeo, and heogseon chalbeyeo (sticky forma) were registered in the national variety list and made an application to crop variety protection right. They are under review now. 2) We also keep on studying on the number of a grain of 8 lines of excellent mutant rice for the purpose of improvement of breeding . 3) We selected 3 lines which have a resistance to pod and stem blight in large soybean, 31 lines with small grain size and higher yield, 112 lines of soybean of cooking, 7 lines of low lipoxygenase content, and 12 lines with decreased phytic acid content by 20 % compared to the previous level. 2. Selection of advanced Mugunwha (Rose of Sharon) mutant 1) Bagseul, a new variety of mutant, was developed and 30 plantlets of it are being proliferated. 2) Fifty-three lines of a mutant having a various morphologies were selected.

  9. Next generation breeding.

    Science.gov (United States)

    Barabaschi, Delfina; Tondelli, Alessandro; Desiderio, Francesca; Volante, Andrea; Vaccino, Patrizia; Valè, Giampiero; Cattivelli, Luigi

    2016-01-01

    The genomic revolution of the past decade has greatly improved our understanding of the genetic make-up of living organisms. The sequencing of crop genomes has completely changed our vision and interpretation of genome organization and evolution. Re-sequencing allows the identification of an unlimited number of markers as well as the analysis of germplasm allelic diversity based on allele mining approaches. High throughput marker technologies coupled with advanced phenotyping platforms provide new opportunities for discovering marker-trait associations which can sustain genomic-assisted breeding. The availability of genome sequencing information is enabling genome editing (site-specific mutagenesis), to obtain gene sequences desired by breeders. This review illustrates how next generation sequencing-derived information can be used to tailor genomic tools for different breeders' needs to revolutionize crop improvement. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  10. Biotechnology in maize breeding

    Directory of Open Access Journals (Sweden)

    Mladenović-Drinić Snežana

    2004-01-01

    Full Text Available Maize is one of the most important economic crops and the best studied and most tractable genetic system among monocots. The development of biotechnology has led to a great increase in our knowledge of maize genetics and understanding of the structure and behaviour of maize genomes. Conventional breeding practices can now be complemented by a number of new and powerful techniques. Some of these often referred to as molecular methods, enable scientists to see the layout of the entire genome of any organism and to select plants with preferred characteristics by "reading" at the molecular level, saving precious time and resources. DNA markers have provided valuable tools in various analyses ranging from phylogenetic analysis to the positional cloning of genes. Application of molecular markers for genetic studies of maize include: assessment of genetic variability and characterization of germ plasm, identification and fingerprinting of genotypes, estimation of genetic distance, detection of monogamic and quantitative trait loci, marker assisted selection, identification of sequence of useful candidate genes, etc. The development of high-density molecular maps which has been facilitated by PCR-based markers, have made the mapping and tagging of almost any trait possible and serve as bases for marker assisted selection. Sequencing of maize genomes would help to elucidate gene function, gene regulation and their expression. Modern biotechnology also includes an array of tools for introducing or deieting a particular gene or genes to produce plants with novel traits. Development of informatics and biotechnology are resulted in bioinformatic as well as in expansion of microarrey technique. Modern biotechnologies could complement and improve the efficiency of traditional selection and breeding techniques to enhance agricultural productivity.

  11. Diversifying Selection Between Pure-Breed and Free-Breeding Dogs Inferred from Genome-Wide SNP Analysis

    Directory of Open Access Journals (Sweden)

    Małgorzata Pilot

    2016-08-01

    Full Text Available Domesticated species are often composed of distinct populations differing in the character and strength of artificial and natural selection pressures, providing a valuable model to study adaptation. In contrast to pure-breed dogs that constitute artificially maintained inbred lines, free-ranging dogs are typically free-breeding, i.e., unrestrained in mate choice. Many traits in free-breeding dogs (FBDs may be under similar natural and sexual selection conditions to wild canids, while relaxation of sexual selection is expected in pure-breed dogs. We used a Bayesian approach with strict false-positive control criteria to identify FST-outlier SNPs between FBDs and either European or East Asian breeds, based on 167,989 autosomal SNPs. By identifying outlier SNPs located within coding genes, we found four candidate genes under diversifying selection shared by these two comparisons. Three of them are associated with the Hedgehog (HH signaling pathway regulating vertebrate morphogenesis. A comparison between FBDs and East Asian breeds also revealed diversifying selection on the BBS6 gene, which was earlier shown to cause snout shortening and dental crowding via disrupted HH signaling. Our results suggest that relaxation of natural and sexual selection in pure-breed dogs as opposed to FBDs could have led to mild changes in regulation of the HH signaling pathway. HH inhibits adhesion and the migration of neural crest cells from the neural tube, and minor deficits of these cells during embryonic development have been proposed as the underlying cause of “domestication syndrome.” This suggests that the process of breed formation involved the same genetic and developmental pathways as the process of domestication.

  12. Potato breeding in the Netherlands

    NARCIS (Netherlands)

    Haan, de H.

    1953-01-01

    A remarkable feature of potato breeding in the Netherlands is the great number of private breeders who have concentrated their efforts on the improvement of the potato. The author calls attention to some circumstances and measures that have made potato breeding attractive in the Netherlands

  13. Microsatellite markers reveal low breeding system efficacy and pollen contamination can limit production of full-sib avocado progeny

    Science.gov (United States)

    Phytophthora cinnamomi causes a severe root rot in avocado, Persea americana. Breeding tolerant rootstocks is thought to be the most promising method for phytophthora root rot disease control but breeding avocado is challenging. The avocado flowering syndrome (synchronous protogynous dichogamy), com...

  14. RosBREED: Enabling Marker-Assisted Breeding in Rosaceae

    Science.gov (United States)

    Genomics research has not yet been translated into routine practical application in breeding Rosaceae fruit crops (peach, apple, strawberry, cherry, apricot, pear, raspberry, etc.). Through dedicated efforts of many researchers worldwide, a wealth of genomics resources has accumulated, including ES...

  15. RosBREED: Enabling marker-assisted breeding in Rosaceae

    NARCIS (Netherlands)

    Iezzoni, A.F.; Weebadde, C.; Luby, J.; Yue, C.; Weg, van de W.E.; Fazio, G.; Main, D.; Peace, C.P.; Bassil, N.V.; McFerson, J.

    2010-01-01

    Genomics research has not yet been translated into routine practical application in breeding Rosaceae fruit crops (peach, apple, strawberry, cherry, apricot, pear, raspberry, etc.). Through dedicated efforts of many researchers worldwide, a wealth of genomics resources has accumulated, including EST

  16. Quantum repeated games revisited

    CERN Document Server

    Frackiewicz, Piotr

    2011-01-01

    We present a scheme for playing quantum repeated 2x2 games based on the Marinatto and Weber's approach to quantum games. As a potential application, we study twice repeated Prisoner's Dilemma game. We show that results not available in classical game can be obtained when the game is played in the quantum way. Before we present our idea, we comment on the previous scheme of playing quantum repeated games.

  17. Illinois’ 2000 breeding season report

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes the 2000 breeding season for grassland birds in Illinois. The report begins by summarizing weather conditions throughout the season and...

  18. Atlantic Flyway Breeding Waterfowl Survey

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The Atlantic Flyway Technical Section initiated this breeding waterfowl survey in 11 northeast states ranging from New Hampshire to Virginia.

  19. Tricolored Blackbird - Breeding [ds20

    Data.gov (United States)

    California Department of Resources — These data come from observations of breeding tricolored blackbirds throughout their range in California. NAD27 coordinates are given in the data for each record....

  20. Bee Queen Breeding Methods - Review

    Directory of Open Access Journals (Sweden)

    Silvia Patruica

    2016-05-01

    Full Text Available The biological potential of a bee family is mainly generated by the biological value of the queen. Whether we grow queens widely or just for our own apiaries, we must consider the acquisition of high-quality biological material, and also the creation of optimal feeding and caring conditions, in order to obtain high genetic value queens. Queen breeding technology starts with the setting of hoeing families, nurse families, drone-breeding families – necessary for the pairing of young queens, and also of the families which will provide the bees used to populate the nuclei where the next queens will hatch. The complex of requirements for the breeding of good, high-production queens is sometimes hard to met, under the application of artificial methods. The selection of breeding method must rely on all these requirements and on the beekeeper’s level of training.

  1. Mutations induced in plant breeding

    Energy Technology Data Exchange (ETDEWEB)

    Barriga B, P. (Universidad Austral de Chile, Valdivia. Inst. de Produccion y Sanidad Vegetal)

    1984-10-01

    The most significant aspects of the use of ionizing radiations in plant breeding are reviewed. Aspects such as basic principles of mutation, expression and selection in obtention of mutants, methods for using induced mutations and sucess achieved with this methodology in plant breeding are reviewed. Results obtained in a program of induced mutation on wheat for high content of protein and lysine at the Universidad Austral de Chile are presented.

  2. The Power of CRISPR-Cas9-Induced Genome Editing to Speed Up Plant Breeding

    Directory of Open Access Journals (Sweden)

    Hieu X. Cao

    2016-01-01

    Full Text Available Genome editing with engineered nucleases enabling site-directed sequence modifications bears a great potential for advanced plant breeding and crop protection. Remarkably, the RNA-guided endonuclease technology (RGEN based on the clustered regularly interspaced short palindromic repeats (CRISPR and CRISPR-associated protein 9 (Cas9 is an extremely powerful and easy tool that revolutionizes both basic research and plant breeding. Here, we review the major technical advances and recent applications of the CRISPR-Cas9 system for manipulation of model and crop plant genomes. We also discuss the future prospects of this technology in molecular plant breeding.

  3. The Power of CRISPR-Cas9-Induced Genome Editing to Speed Up Plant Breeding

    Science.gov (United States)

    Wang, Wenqin; Le, Hien T. T.

    2016-01-01

    Genome editing with engineered nucleases enabling site-directed sequence modifications bears a great potential for advanced plant breeding and crop protection. Remarkably, the RNA-guided endonuclease technology (RGEN) based on the clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated protein 9 (Cas9) is an extremely powerful and easy tool that revolutionizes both basic research and plant breeding. Here, we review the major technical advances and recent applications of the CRISPR-Cas9 system for manipulation of model and crop plant genomes. We also discuss the future prospects of this technology in molecular plant breeding. PMID:28097123

  4. Reconfigurable multiport EPON repeater

    Science.gov (United States)

    Oishi, Masayuki; Inohara, Ryo; Agata, Akira; Horiuchi, Yukio

    2009-11-01

    An extended reach EPON repeater is one of the solutions to effectively expand FTTH service areas. In this paper, we propose a reconfigurable multi-port EPON repeater for effective accommodation of multiple ODNs with a single OLT line card. The proposed repeater, which has multi-ports in both OLT and ODN sides, consists of TRs, BTRs with the CDR function and a reconfigurable electrical matrix switch, can accommodate multiple ODNs to a single OLT line card by controlling the connection of the matrix switch. Although conventional EPON repeaters require full OLT line cards to accommodate subscribers from the initial installation stage, the proposed repeater can dramatically reduce the number of required line cards especially when the number of subscribers is less than a half of the maximum registerable users per OLT. Numerical calculation results show that the extended reach EPON system with the proposed EPON repeater can save 17.5% of the initial installation cost compared with a conventional repeater, and can be less expensive than conventional systems up to the maximum subscribers especially when the percentage of ODNs in lightly-populated areas is higher.

  5. Revisiting the TALE repeat.

    Science.gov (United States)

    Deng, Dong; Yan, Chuangye; Wu, Jianping; Pan, Xiaojing; Yan, Nieng

    2014-04-01

    Transcription activator-like (TAL) effectors specifically bind to double stranded (ds) DNA through a central domain of tandem repeats. Each TAL effector (TALE) repeat comprises 33-35 amino acids and recognizes one specific DNA base through a highly variable residue at a fixed position in the repeat. Structural studies have revealed the molecular basis of DNA recognition by TALE repeats. Examination of the overall structure reveals that the basic building block of TALE protein, namely a helical hairpin, is one-helix shifted from the previously defined TALE motif. Here we wish to suggest a structure-based re-demarcation of the TALE repeat which starts with the residues that bind to the DNA backbone phosphate and concludes with the base-recognition hyper-variable residue. This new numbering system is consistent with the α-solenoid superfamily to which TALE belongs, and reflects the structural integrity of TAL effectors. In addition, it confers integral number of TALE repeats that matches the number of bound DNA bases. We then present fifteen crystal structures of engineered dHax3 variants in complex with target DNA molecules, which elucidate the structural basis for the recognition of bases adenine (A) and guanine (G) by reported or uncharacterized TALE codes. Finally, we analyzed the sequence-structure correlation of the amino acid residues within a TALE repeat. The structural analyses reported here may advance the mechanistic understanding of TALE proteins and facilitate the design of TALEN with improved affinity and specificity.

  6. Breeding performance in the Italian chicken breed Mericanel della Brianza

    Directory of Open Access Journals (Sweden)

    Silvia Cerolini

    Full Text Available In Italy, 90 local avian breeds were described; the majority (61% were classified as extinct and only 8.9% as still widely spread. Therefore, efforts for conservation of Italian avian breeds are urgently required. The aim of this study was to record the breeding performance of the Italian breed Mericanel della Brianza to multiply a small population, in order to develop a conservation programme. Fourteen females and eight males were available at the beginning of the reproductive season in 2009 and organised into eight families (1 male/1-2 females kept in floor pens. Birds received a photoperiod of 14L:10D and were fed ad libitum. Breeding performance was recorded from March to June. Egg production and egg weight were recorded daily; eggs were set every two weeks and fertility, embryo mortality and hatchability were recorded. Mean egg production was 37% and mean egg weight was 34±3.49 g. High fertility values from 94% to 87% were recorded in the first three settings and the overall mean fertility value was 81.6%. Overall hatchability was only 49.6% owing to a high proportion of dead embryos. Embryo mortality occurred mainly between days 2 and 7 of incubation and during hatching. The highest hatchability values were recorded in settings 1 and 2, 69% and 60% respectively, and a large decrease was found in the subsequent settings. Marked variations in egg production, fertility, hatchability and embryo mortality were found among families. The present results represent the basic know ledge of reproductive parameters necessary to improve the reproductive efficiency of the breed within a conservation plan.

  7. Breeding performance in the Italian chicken breed Mericanel della Brianza

    Directory of Open Access Journals (Sweden)

    Stefano P. Marelli

    2010-11-01

    Full Text Available In Italy, 90 local avian breeds were described, the majority (61% were classified extinct and only 8.9 % still diffused. Therefore, efforts for conservation of Italian avian breeds are urgently required. The aim of this study was to record the breeding performance of the Italian breed Mericanel della Brianza and multiply a small population, in order to develop a conservation program. Fourteen females and 8 males were available at the beginning of the reproductive season in 2009 and organized in 8 families (1 male/1-2 females kept in floor pens. Birds received a photoperiod of 14L:10D and fed ad libitum. Breeding performance was recorded from March to June. Egg production and egg weight were recorded daily; eggs were set every 2 weeks and fertility, embryo mortality and hatchability were recorded. Mean egg production was 37% and mean egg weight was 34±3.49 g. High fertility values were recorded in the first three settings, from 94 to 87%, and the overall mean fertility value was 81.6%. Overall hatchability was only 49.6% due to a high proportion of dead embryos. Embryo mortality occurred mainly between day 2 and 7 of incubation and during hatch. Highest hatchability values were recorded in setting 1 and 2, 69 and 60% respectively, and a great decrease was found in the following settings. Great variations in egg production, fertility, hatchability and embryo mortality were found among families. The present results are the basic knowledge on reproductive parameters necessary to improve the reproductive efficiency of the breed within a conservation plan.

  8. Recursive quantum repeater networks

    CERN Document Server

    Van Meter, Rodney; Horsman, Clare

    2011-01-01

    Internet-scale quantum repeater networks will be heterogeneous in physical technology, repeater functionality, and management. The classical control necessary to use the network will therefore face similar issues as Internet data transmission. Many scalability and management problems that arose during the development of the Internet might have been solved in a more uniform fashion, improving flexibility and reducing redundant engineering effort. Quantum repeater network development is currently at the stage where we risk similar duplication when separate systems are combined. We propose a unifying framework that can be used with all existing repeater designs. We introduce the notion of a Quantum Recursive Network Architecture, developed from the emerging classical concept of 'recursive networks', extending recursive mechanisms from a focus on data forwarding to a more general distributed computing request framework. Recursion abstracts independent transit networks as single relay nodes, unifies software layer...

  9. Evolution, plant breeding and biodiversity

    Directory of Open Access Journals (Sweden)

    Salvatore Ceccarelli

    2011-11-01

    Full Text Available This paper deals with changes in biodiversity during the course of evolution, plant domestication and plant breeding. It shows than man has had a strong influence on the progressive decrease of biodiversity, unconscious at first and deliberate in modern times. The decrease in biodiversity in the agricultures of the North causes a severe threat to food security and is in contrasts with the conservation of biodiversity which is part of the culture of several populations in the South. The concluding section of the paper shows that man could have guided evolution in a different way and shows an example of participatory plant breeding, a type of breeding which is done in collaboration with farmers and is based on selection for specific adaptation. Even though participatory plant breeding has been practiced for only about 20 years and by relatively few groups, the effects on both biodiversity and crop production are impressive. Eventually the paper shows how participatory plant breeding can be developed into ‘evolutionary plant breeding’ to cope in a dynamic way with climate changes.

  10. CASSAVA BREEDING I: THE VALUE OF BREEDING VALUE

    Directory of Open Access Journals (Sweden)

    Hernán Ceballos

    2016-08-01

    Full Text Available Breeding cassava relies on several selection stages (single row trial-SRT; preliminary; advanced; and uniform yield trials - UYT. This study uses data from 14 years of evaluations. From more than 20,000 genotypes initially evaluated only 114 reached the last stage. The objective was to assess how the data at SRT could be used to predict the probabilities of genotypes reaching the UYT. Phenotypic data from each genotype at SRT was integrated into the selection index (SIN used by the cassava breeding program. Average SIN from all the progenies derived from each progenitor was then obtained. Average SIN is an approximation of the breeding value of each progenitor. Data clearly suggested that some genotypes were better progenitors than others (e.g. high number of their progenies reaching the UYT, suggesting important variation in breeding values of progenitors. However, regression of average SIN of each parental genotype on the number of their respective progenies reaching UYT resulted in a negligible coefficient of determination (r2 = 0.05. Breeding value (e.g. average SIN at SRT was not efficient predicting which genotypes were more likely to reach the UYT stage. Number of families and progenies derived from a given progenitor were more efficient predicting the probabilities of the progeny from a given parent reaching the UYT stage. Large within-family genetic variation tends to mask the true breeding value of each progenitor. The use of partially inbred progenitors (e.g. S1 or S2 genotypes would reduce the within-family genetic variation thus making the assessment of breeding value more accurate. Moreover, partial inbreeding of progenitors can improve the breeding value of the original (S0 parental material and sharply accelerate genetic gains. For instance, homozygous S1 genotypes for the dominant resistance to cassava mosaic disease could be generated and selected. All gametes from these selected S1 genotypes would carry the desirable allele

  11. Cassava Breeding I: The Value of Breeding Value

    Science.gov (United States)

    Ceballos, Hernán; Pérez, Juan C.; Joaqui Barandica, Orlando; Lenis, Jorge I.; Morante, Nelson; Calle, Fernando; Pino, Lizbeth; Hershey, Clair H.

    2016-01-01

    Breeding cassava relies on several selection stages (single row trial-SRT; preliminary; advanced; and uniform yield trials—UYT). This study uses data from 14 years of evaluations. From more than 20,000 genotypes initially evaluated only 114 reached the last stage. The objective was to assess how the data at SRT could be used to predict the probabilities of genotypes reaching the UYT. Phenotypic data from each genotype at SRT was integrated into the selection index (SIN) used by the cassava breeding program. Average SIN from all the progenies derived from each progenitor was then obtained. Average SIN is an approximation of the breeding value of each progenitor. Data clearly suggested that some genotypes were better progenitors than others (e.g., high number of their progenies reaching the UYT), suggesting important variation in breeding values of progenitors. However, regression of average SIN of each parental genotype on the number of their respective progenies reaching UYT resulted in a negligible coefficient of determination (r2 = 0.05). Breeding value (e.g., average SIN) at SRT was not efficient predicting which genotypes were more likely to reach the UYT stage. Number of families and progenies derived from a given progenitor were more efficient predicting the probabilities of the progeny from a given parent reaching the UYT stage. Large within-family genetic variation tends to mask the true breeding value of each progenitor. The use of partially inbred progenitors (e.g., S1 or S2 genotypes) would reduce the within-family genetic variation thus making the assessment of breeding value more accurate. Moreover, partial inbreeding of progenitors can improve the breeding value of the original (S0) parental material and sharply accelerate genetic gains. For instance, homozygous S1 genotypes for the dominant resistance to cassava mosaic disease (CMD) could be generated and selected. All gametes from these selected S1 genotypes would carry the desirable allele and

  12. What can be Learned from Silage Breeding Programs?

    Science.gov (United States)

    Lorenz, Aaron J.; Coors, James G.

    Improving the quality of cellulosic ethanol feedstocks through breeding and genetic manipulation could significantly impact the economics of this industry. Attaining this will require comprehensive and rapid characterization of large numbers of samples. There are many similarities between improving corn silage quality for dairy production and improving feedstock quality for cellulosic ethanol. It was our objective to provide insight into what is needed for genetic improvement of cellulosic feedstocks by reviewing the development and operation of a corn silage breeding program. We discuss the evolving definition of silage quality and relate what we have learned about silage quality to what is needed for measuring and improving feedstock quality. In addition, repeatability estimates of corn stover traits are reported for a set of hybrids. Repeatability of theoretical ethanol potential measured by near-infrared spectroscopy is high, suggesting that this trait may be easily improved through breeding. Just as cell wall digestibility has been factored into the latest measurements of silage quality, conversion efficiency should be standardized and included in indices of feedstock quality to maximize overall, economical energy availability.

  13. Biological mechanisms discriminating growth rate and adult body weight phenotypes in two Chinese indigenous chicken breeds.

    Science.gov (United States)

    Dou, Tengfei; Zhao, Sumei; Rong, Hua; Gu, Dahai; Li, Qihua; Huang, Ying; Xu, Zhiqiang; Chu, Xiaohui; Tao, Linli; Liu, Lixian; Ge, Changrong; Te Pas, Marinus F W; Jia, Junjing

    2017-06-20

    Intensive selection has resulted in increased growth rates and muscularity in broiler chickens, in addition to adverse effects, including delayed organ development, sudden death syndrome, and altered metabolic rates. The biological mechanisms underlying selection responses remain largely unknown. Non-artificially-selected indigenous Chinese chicken breeds display a wide variety of phenotypes, including differential growth rate, body weight, and muscularity. The Wuding chicken breed is a fast growing large chicken breed, and the Daweishan mini chicken breed is a slow growing small chicken breed. Together they form an ideal model system to study the biological mechanisms underlying broiler chicken selection responses in a natural system. The objective of this study was to study the biological mechanisms underlying differential phenotypes between the two breeds in muscle and liver tissues, and relate these to the growth rate and body development phenotypes of the two breeds. The muscle tissue in the Wuding breed showed higher expression of muscle development genes than muscle tissue in the Daweishan chicken breed. This expression was accompanied by higher expression of acute inflammatory response genes in Wuding chicken than in Daweishan chicken. The muscle tissue of the Daweishan mini chicken breed showed higher expression of genes involved in several metabolic mechanisms including endoplasmic reticulum, protein and lipid metabolism, energy metabolism, as well as specific immune traits than in the Wuding chicken. The liver tissue showed fewer differences between the two breeds. Genes displaying higher expression in the Wuding breed than in the Daweishan breed were not associated with a specific gene network or biological mechanism. Genes highly expressed in the Daweishan mini chicken breed compared to the Wuding breed were enriched for protein metabolism, ABC receptors, signal transduction, and IL6-related mechanisms. We conclude that faster growth rates and larger

  14. Diet of canvasbacks during breeding

    Science.gov (United States)

    Austin, J.E.; Serie, J.R.; Noyes, J.H.

    1990-01-01

    We examined diets of canvasbacks (Aythya valisineria) breeding in southwestern Manitoba during 1977-81. Percent volume of animal foods consumed did not differ between males and females nor among prenesting, rapid follicle growth, laying, incubation, and renesting periods in females (mean = 50.1%). Tubers and shoots of fennelleaf pondweed (Potamogeton pectinatus) and midge larvae (Chironomidae) were the predominant foods, comprising on average 45% and 23% of the diet volume, respectively. Continued importance of plant foods to canvasbacks throughout reproduction contrasts with the mostly invertebrate diets of other prairie-breeding ducks, and does not fit current theories of nutritional ecology of breeding anatids (i.e., females meet the protein requirements of reproduction by consuming a high proportion of animal foods).

  15. Emperor penguins breeding on iceshelves.

    Science.gov (United States)

    Fretwell, Peter T; Trathan, Phil N; Wienecke, Barbara; Kooyman, Gerald L

    2014-01-01

    We describe a new breeding behaviour discovered in emperor penguins; utilizing satellite and aerial-survey observations four emperor penguin breeding colonies have been recorded as existing on ice-shelves. Emperors have previously been considered as a sea-ice obligate species, with 44 of the 46 colonies located on sea-ice (the other two small colonies are on land). Of the colonies found on ice-shelves, two are newly discovered, and these have been recorded on shelves every season that they have been observed, the other two have been recorded both on ice-shelves and sea-ice in different breeding seasons. We conduct two analyses; the first using synthetic aperture radar data to assess why the largest of the four colonies, for which we have most data, locates sometimes on the shelf and sometimes on the sea-ice, and find that in years where the sea-ice forms late, the colony relocates onto the ice-shelf. The second analysis uses a number of environmental variables to test the habitat marginality of all emperor penguin breeding sites. We find that three of the four colonies reported in this study are in the most northerly, warmest conditions where sea-ice is often sub-optimal. The emperor penguin's reliance on sea-ice as a breeding platform coupled with recent concerns over changed sea-ice patterns consequent on regional warming, has led to their designation as "near threatened" in the IUCN red list. Current climate models predict that future loss of sea-ice around the Antarctic coastline will negatively impact emperor numbers; recent estimates suggest a halving of the population by 2052. The discovery of this new breeding behaviour at marginal sites could mitigate some of the consequences of sea-ice loss; potential benefits and whether these are permanent or temporary need to be considered and understood before further attempts are made to predict the population trajectory of this iconic species.

  16. Breeding monkeys for biomedical research

    Science.gov (United States)

    Bourne, G. H.; Golarzdebourne, M. N.; Keeling, M. E.

    1973-01-01

    Captive bred rhesus monkeys show much less pathology than wild born animals. The monkeys may be bred in cages or in an outdoor compound. Cage bred animals are not psychologically normal which makes then unsuited for some types of space related research. Compound breeding provides contact between mother and infant and an opportunity for the infants to play with their peers which are important requirements to help maintain their behavioral integrity. Offspring harvested after a year in the compound appear behaviorally normal and show little histopathology. Compound breeding is also an economical method for the rapid production of young animals. The colony can double its size about every two and a half years.

  17. Sport horses : breeding specialist from a single breeding programme?

    NARCIS (Netherlands)

    Rovere, G.A.

    2016-01-01

    Summary The general goal of this thesis was to provide information useful for the breeding programme of the Royal Dutch Warmblood Studbook (KWPN) in relation with the ongoing specialisation of the population. Data provided by KWPN consisted of records from studbook-first inspection,

  18. Development of breeding objectives for beef cattle breeding ...

    African Journals Online (AJOL)

    Mnr J F Kluyts

    The purpose of this article is to review the development of breeding objectives in beef cattle ... selection criteria, and estimation of phenotypic and genetic parameters. ... Unfortunately, the evolution from a performance .... The beef cattle industry has a history of chasing and promoting maximum values (e.g. maximum weight).

  19. Breed base representation in dairy animals of 5 breeds

    Science.gov (United States)

    Inheritance of DNA from different dairy breeds can be determined by genotyping, just as individual ancestors such as parents, grandparents, or even great grandparents can be identified correctly in a high percentage of the cases by genotyping even if not reported or reported incorrectly in pedigrees...

  20. Comparison of molecular breeding values based on within- and across-breed training in beef cattle.

    Science.gov (United States)

    Kachman, Stephen D; Spangler, Matthew L; Bennett, Gary L; Hanford, Kathryn J; Kuehn, Larry A; Snelling, Warren M; Thallman, R Mark; Saatchi, Mahdi; Garrick, Dorian J; Schnabel, Robert D; Taylor, Jeremy F; Pollak, E John

    2013-08-16

    Although the efficacy of genomic predictors based on within-breed training looks promising, it is necessary to develop and evaluate across-breed predictors for the technology to be fully applied in the beef industry. The efficacies of genomic predictors trained in one breed and utilized to predict genetic merit in differing breeds based on simulation studies have been reported, as have the efficacies of predictors trained using data from multiple breeds to predict the genetic merit of purebreds. However, comparable studies using beef cattle field data have not been reported. Molecular breeding values for weaning and yearling weight were derived and evaluated using a database containing BovineSNP50 genotypes for 7294 animals from 13 breeds in the training set and 2277 animals from seven breeds (Angus, Red Angus, Hereford, Charolais, Gelbvieh, Limousin, and Simmental) in the evaluation set. Six single-breed and four across-breed genomic predictors were trained using pooled data from purebred animals. Molecular breeding values were evaluated using field data, including genotypes for 2227 animals and phenotypic records of animals born in 2008 or later. Accuracies of molecular breeding values were estimated based on the genetic correlation between the molecular breeding value and trait phenotype. With one exception, the estimated genetic correlations of within-breed molecular breeding values with trait phenotype were greater than 0.28 when evaluated in the breed used for training. Most estimated genetic correlations for the across-breed trained molecular breeding values were moderate (> 0.30). When molecular breeding values were evaluated in breeds that were not in the training set, estimated genetic correlations clustered around zero. Even for closely related breeds, within- or across-breed trained molecular breeding values have limited prediction accuracy for breeds that were not in the training set. For breeds in the training set, across- and within-breed trained

  1. Breeding value estimation in the Hungarian Sport Horse population.

    Science.gov (United States)

    Posta, János; Komlósi, István; Mihók, Sándor

    2009-07-01

    The aims of this study were to estimate phenotypic and genetic parameters for a range of traits in Hungarian Sport Horses, and to compare several methods of estimating breeding value (BV) in this breed. The analyses were based on the Hungarian Sport Horse Studbook, results of self-performance tests (SPTs) and show-jumping competition results. An SPT comprises subjective judgement of conformation traits, movement analysis traits and free-jumping performance, assessed via ordinal scores. Genetic parameters of SPTs were estimated with an animal model. Different measurements of the competition performance were compared using the same repeatability model. Estimates of BV for sport were made with random regression models using a first-order Legendre polynomial. Heritability was found to increase and permanent environmental variance to decrease continuously with age. BVs can be estimated at different ages and from these a composite BV index can be computed. It is possible to weight BVs for the specific age of a horse.

  2. Variation of cats under domestication: genetic assignment of domestic cats to breeds and worldwide random-bred populations.

    Science.gov (United States)

    Kurushima, J D; Lipinski, M J; Gandolfi, B; Froenicke, L; Grahn, J C; Grahn, R A; Lyons, L A

    2013-06-01

    Both cat breeders and the lay public have interests in the origins of their pets, not only in the genetic identity of the purebred individuals, but also in the historical origins of common household cats. The cat fancy is a relatively new institution with over 85% of its 40-50 breeds arising only in the past 75 years, primarily through selection on single-gene aesthetic traits. The short, yet intense cat breed history poses a significant challenge to the development of a genetic marker-based breed identification strategy. Using different breed assignment strategies and methods, 477 cats representing 29 fancy breeds were analysed with 38 short tandem repeats, 148 intergenic and five phenotypic single nucleotide polymorphisms. Results suggest the frequentist method of Paetkau (single nucleotide polymorphisms = 0.78, short tandem repeats = 0.88) surpasses the Bayesian method of Rannala and Mountain (single nucleotide polymorphisms = 0.56, short tandem repeats = 0.83) for accurate assignment of individuals to the correct breed. Additionally, a post-assignment verification step with the five phenotypic single nucleotide polymorphisms accurately identified between 0.31 and 0.58 of the misassigned individuals raising the sensitivity of assignment with the frequentist method to 0.89 and 0.92 for single nucleotide polymorphisms and short tandem repeats respectively. This study provides a novel multistep assignment strategy and suggests that, despite their short breed history and breed family groupings, a majority of cats can be assigned to their proper breed or population of origin, that is, race.

  3. The Pentapeptide Repeat Proteins

    Energy Technology Data Exchange (ETDEWEB)

    Vetting,M.; Hegde, S.; Fajardo, J.; Fiser, A.; Roderick, S.; Takiff, H.; Blanchard, J.

    2006-01-01

    The Pentapeptide Repeat Protein (PRP) family has over 500 members in the prokaryotic and eukaryotic kingdoms. These proteins are composed of, or contain domains composed of, tandemly repeated amino acid sequences with a consensus sequence of [S, T,A, V][D, N][L, F]-[S, T,R][G]. The biochemical function of the vast majority of PRP family members is unknown. The three-dimensional structure of the first member of the PRP family was determined for the fluoroquinolone resistance protein (MfpA) from Mycobacterium tuberculosis. The structure revealed that the pentapeptide repeats encode the folding of a novel right-handed quadrilateral {beta}-helix. MfpA binds to DNA gyrase and inhibits its activity. The rod-shaped, dimeric protein exhibits remarkable size, shape and electrostatic similarity to DNA.

  4. The evolution of potato breeding

    Science.gov (United States)

    Potato cultivars in most regions of the world are tetraploid and clonally propagated. For over a century, the breeding strategy has been phenotypic recurrent selection. However, the polyploid nature of the crop prevents breeders from eliminating deleterious alleles and assembling positive alleles fo...

  5. Rose breeding: past, present, prospects

    NARCIS (Netherlands)

    Vries, de D.P.; Dubois, L.A.M.

    1996-01-01

    In this review the PAST, PRESENT and PROSPECT will be considered as three separate periods in the history of the breeding and development of rose cultivars. The recurring theme is the genetic variation. This theme was chosen because there is justified doubt as to sufficient genetic variation

  6. Rose breeding: past, present, prospects

    NARCIS (Netherlands)

    Vries, de D.P.; Dubois, L.A.M.

    1996-01-01

    In this review the PAST, PRESENT and PROSPECT will be considered as three separate periods in the history of the breeding and development of rose cultivars. The recurring theme is the genetic variation. This theme was chosen because there is justified doubt as to sufficient genetic variation availab

  7. Accuracies of genomically estimated breeding values from pure-breed and across-breed predictions in Australian beef cattle.

    Science.gov (United States)

    Boerner, Vinzent; Johnston, David J; Tier, Bruce

    2014-10-24

    The major obstacles for the implementation of genomic selection in Australian beef cattle are the variety of breeds and in general, small numbers of genotyped and phenotyped individuals per breed. The Australian Beef Cooperative Research Center (Beef CRC) investigated these issues by deriving genomic prediction equations (PE) from a training set of animals that covers a range of breeds and crosses including Angus, Murray Grey, Shorthorn, Hereford, Brahman, Belmont Red, Santa Gertrudis and Tropical Composite. This paper presents accuracies of genomically estimated breeding values (GEBV) that were calculated from these PE in the commercial pure-breed beef cattle seed stock sector. PE derived by the Beef CRC from multi-breed and pure-breed training populations were applied to genotyped Angus, Limousin and Brahman sires and young animals, but with no pure-breed Limousin in the training population. The accuracy of the resulting GEBV was assessed by their genetic correlation to their phenotypic target trait in a bi-variate REML approach that models GEBV as trait observations. Accuracies of most GEBV for Angus and Brahman were between 0.1 and 0.4, with accuracies for abattoir carcass traits generally greater than for live animal body composition traits and reproduction traits. Estimated accuracies greater than 0.5 were only observed for Brahman abattoir carcass traits and for Angus carcass rib fat. Averaged across traits within breeds, accuracies of GEBV were highest when PE from the pooled across-breed training population were used. However, for the Angus and Brahman breeds the difference in accuracy from using pure-breed PE was small. For the Limousin breed no reasonable results could be achieved for any trait. Although accuracies were generally low compared to published accuracies estimated within breeds, they are in line with those derived in other multi-breed populations. Thus PE developed by the Beef CRC can contribute to the implementation of genomic selection in

  8. Repeating the Past

    Science.gov (United States)

    Moore, John W.

    1998-05-01

    As part of the celebration of the Journal 's 75th year, we are scanning each Journal issue from 25, 50, and 74 years ago. Many of the ideas and practices described are so similar to present-day "innovations" that George Santayana's adage (1) "Those who cannot remember the past are condemned to repeat it" comes to mind. But perhaps "condemned" is too strong - sometimes it may be valuable to repeat something that was done long ago. One example comes from the earliest days of the Division of Chemical Education and of the Journal.

  9. Conservation priorities for Ethiopian sheep breeds combining threat status, breed merits and contributions to genetic diversity

    Directory of Open Access Journals (Sweden)

    Windig Jack J

    2008-07-01

    Full Text Available Abstract Prioritizing livestock breeds for conservation needs to incorporate both genetic and non-genetic aspects important for the survival of the breeds. Here, we apply a maximum-utility-strategy to prioritize 14 traditional Ethiopian sheep breeds based on their threat status, contributions to farmer livelihoods (current breed merits and contributions to genetic diversity. Contributions of the breeds to genetic diversity were quantified using Eding's marker-estimated kinship approaches. Non-genetic aspects included threats (e.g. low population size, low preferences by farmers and current merits (economic, ecological and cultural merits. Threat analysis identified eight of the 14 breeds as threatened. Analysis of current merits showed that sub-alpine and arid-lowland breeds contribute most to farmer livelihoods in comparison to other breeds. The highest contribution to the genetic diversity conserved was from the Simien breed. Simien showed high between-breed (low between-breed kinship = 0.04 as well as high within-breed diversity (low within-breed kinship = 0.09 and high HE = 0.73 and allelic richness = 6.83. We combined the results on threat status, current breed merits and contributions to genetic diversity to produce a ranking of the 14 breeds for conservation purposes. Our results balance the trade-offs between conserving breeds as insurance against future uncertainties and current sustainable utilization. The ranking of breeds provides a basis for conservation strategies for Ethiopian sheep and contributes to a regional or global conservation plan.

  10. Scheie syndrome

    Science.gov (United States)

    ... Hurler syndrome) MPS II (Hunter syndrome) MPS IV (Morquio syndrome) MPS III (Sanfilippo syndrome) Causes Scheie syndrome ... Autosomal recessive Cloudy cornea Hearing loss Hurler syndrome Morquio syndrome Review Date 4/20/2015 Updated by: ...

  11. Native Pig and Chicken Breed Database: NPCDB.

    Science.gov (United States)

    Jeong, Hyeon-Soo; Kim, Dae-Won; Chun, Se-Yoon; Sung, Samsun; Kim, Hyeon-Jeong; Cho, Seoae; Kim, Heebal; Oh, Sung-Jong

    2014-10-01

    Indigenous (native) breeds of livestock have higher disease resistance and adaptation to the environment due to high genetic diversity. Even though their extinction rate is accelerated due to the increase of commercial breeds, natural disaster, and civil war, there is a lack of well-established databases for the native breeds. Thus, we constructed the native pig and chicken breed database (NPCDB) which integrates available information on the breeds from around the world. It is a nonprofit public database aimed to provide information on the genetic resources of indigenous pig and chicken breeds for their conservation. The NPCDB (http://npcdb.snu.ac.kr/) provides the phenotypic information and population size of each breed as well as its specific habitat. In addition, it provides information on the distribution of genetic resources across the country. The database will contribute to understanding of the breed's characteristics such as disease resistance and adaptation to environmental changes as well as the conservation of indigenous genetic resources.

  12. All-optical repeater.

    Science.gov (United States)

    Silberberg, Y

    1986-06-01

    An all-optical device containing saturable gain, saturable loss, and unsaturable loss is shown to transform weak, distorted optical pulses into uniform standard-shape pulses. The proposed device performs thresholding, amplification, and pulse shaping as required from an optical repeater. It is shown that such a device could be realized by existing semiconductor technology.

  13. Bidirectional Manchester repeater

    Science.gov (United States)

    Ferguson, J.

    1980-01-01

    Bidirectional Manchester repeater is inserted at periodic intervals along single bidirectional twisted pair transmission line to detect, amplify, and transmit bidirectional Manchester 11 code signals. Requiring only 18 TTL 7400 series IC's, some line receivers and drivers, and handful of passive components, circuit is simple and relatively inexpensive to build.

  14. Floral syndrome and breeding system of endangered species Magnolia officinalis subsp biloba%濒危植物凹叶厚朴的花部综合特征和繁育系统

    Institute of Scientific and Technical Information of China (English)

    杨旭; 杨志玲; 王洁; 檀国印; 何正松

    2012-01-01

    Magnolia officinalis subsp. Biloba is an endangered species in China. To understand the reproductive biological causes of the endangering, a field observation was conducted to study the flowering biology and breeding system of three M. Officinalis subsp. Biloba populations in Zhejiang Province, with the focus on the outcrossing index, pollen-ovule ratio (P/O), pollen vitality, and stigma receptivity under natural condition and artificial pollination and bagging. Generally, the flowering of M. Officinalis subsp. Biloba lasted 4-5 days, and the flowering process for one flower could be divided into four periods based on the flower' s morphology and pollen dehiscence, I. E. , bud swelling, flower opening, full blooming, and flower withering. The population' s flowering started in April and ended in May, with the duration being about 30 days but differed at different sites and in different years. The populations had no flowering peak. The mean flower number per plant was 171.4-188. 8, and the mean flowering amplitude was 5-6 per plant per day. The outcrossing index was 4, and the pollen-ovule ratio (P/O) was 5726. 86. Under artificial pollination and bagging, the breeding system was of xenogamy, the pollen vitality was 94% and could be maintained for 6 days after pollen dehiscence, the stigma receptivity de-creased significantly after pollen dehiscence, and there was only a 5-6 hour overlap between high stigma receptivity and pollen dehiscence. Under natural condition, the fruit setting rate and the seed setting rate per fruit were low, but outcrossing increased the two rates by 14.25% and 43. 66% , respectively, as compared with the control. It was concluded that the low pollination efficiency, short duration of stigma' s optimal receptivity, and sterility induced by self-pollination were the main reproductive biological causes of the endangering of M. Officinalis subsp. Biloba.%为了解凹叶厚朴(Magnolia officinalis subsp,biloba)濒危的生殖生物学原因,

  15. Selective breeding in organic dairy production

    NARCIS (Netherlands)

    Nauta, W.J.

    2009-01-01

    Organic dairy farming started to take off in the early 1990s, when the European Union laid down organic standards for animal production. Until now, however, only incidental steps have been taken towards organic breeding and organic farmers mainly use breeding stock from conventional breeding program

  16. Vision of breeding for organic agriculture

    NARCIS (Netherlands)

    Nauta, W.J.; Groen, A.; Roep, D.; Veerkamp, R.F.; Baars, T.

    2003-01-01

    Taking the current breeding situation as the starting point, a number of scenarios are described for each animal sector which could gradually lead to a system of breeding which is more organic both in its aims and in the chain-based approach. The naturalness of the breeding techniques is an

  17. Selective breeding in organic dairy production

    NARCIS (Netherlands)

    Nauta, W.J.

    2009-01-01

    Organic dairy farming started to take off in the early 1990s, when the European Union laid down organic standards for animal production. Until now, however, only incidental steps have been taken towards organic breeding and organic farmers mainly use breeding stock from conventional breeding program

  18. Selective breeding in organic dairy production

    NARCIS (Netherlands)

    Nauta, W.J.

    2009-01-01

    Organic dairy farming started to take off in the early 1990s, when the European Union laid down organic standards for animal production. Until now, however, only incidental steps have been taken towards organic breeding and organic farmers mainly use breeding stock from conventional breeding

  19. Grooming relationships between breeding females and adult group members in cooperatively breeding moustached tamarins (Saguinus mystax).

    Science.gov (United States)

    Löttker, Petra; Huck, Maren; Zinner, Dietmar P; Heymann, Eckhard W

    2007-10-01

    Grooming is the most common form of affiliative behavior in primates that apart from hygienic and hedonistic benefits offers important social benefits for the performing individuals. This study examined grooming behavior in a cooperatively breeding primate species, characterized by single female breeding per group, polyandrous matings, dizygotic twinning, delayed offspring dispersal, and intensive helping behavior. In this system, breeding females profit from the presence of helpers but also helpers profit from staying in a group and assisting in infant care due to the accumulation of direct and indirect fitness benefits. We examined grooming relationships of breeding females with three classes of partners (breeding males, potentially breeding males, (sub)adult non-breeding offspring) during three reproductive phases (post-partum ovarian inactivity, ovarian activity, pregnancy) in two groups of wild moustached tamarins (Saguinus mystax). We investigated whether grooming can be used to regulate group size by either "pay-for-help" or "pay-to-stay" mechanisms. Grooming of breeding females with breeding males and non-breeding offspring was more intense and more balanced than with potentially breeding males, and most grooming occurred during the breeding females' pregnancies. Grooming was skewed toward more investment by the breeding females with breeding males during the phases of ovarian activity, and with potentially breeding males during pregnancies. Our results suggest that grooming might be a mechanism used by female moustached tamarins to induce mate association with the breeding male, and to induce certain individuals to stay in the group and help with infant care.

  20. A simple language to script and simulate breeding schemes: the breeding scheme language

    Science.gov (United States)

    It is difficult for plant breeders to determine an optimal breeding strategy given that the problem involves many factors, such as target trait genetic architecture and breeding resource availability. There are many possible breeding schemes for each breeding program. Although simulation study may b...

  1. Emperor penguins breeding on iceshelves.

    Directory of Open Access Journals (Sweden)

    Peter T Fretwell

    Full Text Available We describe a new breeding behaviour discovered in emperor penguins; utilizing satellite and aerial-survey observations four emperor penguin breeding colonies have been recorded as existing on ice-shelves. Emperors have previously been considered as a sea-ice obligate species, with 44 of the 46 colonies located on sea-ice (the other two small colonies are on land. Of the colonies found on ice-shelves, two are newly discovered, and these have been recorded on shelves every season that they have been observed, the other two have been recorded both on ice-shelves and sea-ice in different breeding seasons. We conduct two analyses; the first using synthetic aperture radar data to assess why the largest of the four colonies, for which we have most data, locates sometimes on the shelf and sometimes on the sea-ice, and find that in years where the sea-ice forms late, the colony relocates onto the ice-shelf. The second analysis uses a number of environmental variables to test the habitat marginality of all emperor penguin breeding sites. We find that three of the four colonies reported in this study are in the most northerly, warmest conditions where sea-ice is often sub-optimal. The emperor penguin's reliance on sea-ice as a breeding platform coupled with recent concerns over changed sea-ice patterns consequent on regional warming, has led to their designation as "near threatened" in the IUCN red list. Current climate models predict that future loss of sea-ice around the Antarctic coastline will negatively impact emperor numbers; recent estimates suggest a halving of the population by 2052. The discovery of this new breeding behaviour at marginal sites could mitigate some of the consequences of sea-ice loss; potential benefits and whether these are permanent or temporary need to be considered and understood before further attempts are made to predict the population trajectory of this iconic species.

  2. Comparative analysis of traditional and modern apricot breeding programs: A case of study with Spanish and Tunisian apricot breeding germplasm

    Energy Technology Data Exchange (ETDEWEB)

    Batnini, M.A.; Krichen, L.; Bourguiba, H.; Trifi-Farah, N.; Ruiz, D.; Martínez-Gómez, P.; Rubio, M.

    2016-11-01

    Traditional plant breeding is based on the observation of variation and the selection of the best phenotypes, whereas modern breeding is characterised by the use of controlled mating and the selection of descendants using molecular markers. In this work, a comparative analysis of genetic diversity in a traditional (Tunisian) and a modern (Spanish) apricot breeding programme was performed at the phenotypic and molecular level using simple sequence repeat (SSR) markers. Seven phenotypic traits were evaluated in 42 Tunisian apricot accessions and 30 genotypes from the Spanish apricot programme. In addition, 20 SSR markers previously described as linked to specific phenotypic traits were assayed. Results showed that modern breeding using controlled crosses increases the size of the fruit. The fruit weight average observed in the Tunisian cultivars was of 20.15 g. In the case of traditional Spanish cultivars the average weight was 47.12 g, whereas the average weight of the other progenitors from France, USA and South Africa was 72.85 g. Finally, in the new releases from the CEBAS-CSIC breeding programme, the average weight was 72.82 g. In addition, modern bred cultivars incorporate desirable traits such as self-compatibility and firmness. Cluster and structural analysis based on SSR data clearly differentiates the genotypes according to their geographic origin and pedigree. Finally, results showed an association between some alleles of PaCITA7 and UDP96003 SSR markers with apricot fruit weight, one allele of UDAp407 marker with fruit firmness and one allele of UDP98406 marker with fruit ripening. (Author)

  3. Assortative mating and fragmentation within dog breeds

    Directory of Open Access Journals (Sweden)

    Hailer Frank

    2008-01-01

    Full Text Available Abstract Background There are around 400 internationally recognized dog breeds in the world today, with a remarkable diversity in size, shape, color and behavior. Breeds are considered to be uniform groups with similar physical characteristics, shaped by selection rooted in human preferences. This has led to a large genetic difference between breeds and a large extent of linkage disequilibrium within breeds. These characteristics are important for association mapping of candidate genes for diseases and therefore make dogs ideal models for gene mapping of human disorders. However, genetic uniformity within breeds may not always be the case. We studied patterns of genetic diversity within 164 poodles and compared it to 133 dogs from eight other breeds. Results Our analyses revealed strong population structure within poodles, with differences among some poodle groups as pronounced as those among other well-recognized breeds. Pedigree analysis going three generations back in time confirmed that subgroups within poodles result from assortative mating imposed by breed standards as well as breeder preferences. Matings have not taken place at random or within traditionally identified size classes in poodles. Instead, a novel set of five poodle groups was identified, defined by combinations of size and color, which is not officially recognized by the kennel clubs. Patterns of genetic diversity in other breeds suggest that assortative mating leading to fragmentation may be a common feature within many dog breeds. Conclusion The genetic structure observed in poodles is the result of local mating patterns, implying that breed fragmentation may be different in different countries. Such pronounced structuring within dog breeds can increase the power of association mapping studies, but also represents a serious problem if ignored. In dog breeding, individuals are selected on the basis of morphology, behaviour, working or show purposes, as well as geographic

  4. Assortative mating and fragmentation within dog breeds.

    Science.gov (United States)

    Björnerfeldt, Susanne; Hailer, Frank; Nord, Maria; Vilà, Carles

    2008-01-28

    There are around 400 internationally recognized dog breeds in the world today, with a remarkable diversity in size, shape, color and behavior. Breeds are considered to be uniform groups with similar physical characteristics, shaped by selection rooted in human preferences. This has led to a large genetic difference between breeds and a large extent of linkage disequilibrium within breeds. These characteristics are important for association mapping of candidate genes for diseases and therefore make dogs ideal models for gene mapping of human disorders. However, genetic uniformity within breeds may not always be the case. We studied patterns of genetic diversity within 164 poodles and compared it to 133 dogs from eight other breeds. Our analyses revealed strong population structure within poodles, with differences among some poodle groups as pronounced as those among other well-recognized breeds. Pedigree analysis going three generations back in time confirmed that subgroups within poodles result from assortative mating imposed by breed standards as well as breeder preferences. Matings have not taken place at random or within traditionally identified size classes in poodles. Instead, a novel set of five poodle groups was identified, defined by combinations of size and color, which is not officially recognized by the kennel clubs. Patterns of genetic diversity in other breeds suggest that assortative mating leading to fragmentation may be a common feature within many dog breeds. The genetic structure observed in poodles is the result of local mating patterns, implying that breed fragmentation may be different in different countries. Such pronounced structuring within dog breeds can increase the power of association mapping studies, but also represents a serious problem if ignored. In dog breeding, individuals are selected on the basis of morphology, behaviour, working or show purposes, as well as geographic population structure. The same processes which have

  5. Breeding quinoa (Chenopodium quinoa Willd.)

    DEFF Research Database (Denmark)

    Zurita-Silva, Andrés; Fuentes, Francisco; Zamora, Pablo

    2014-01-01

    Quinoa (Chenopodium quinoa Willd.) originated in the Andean region of South America; this species is associated with exceptional grain nutritional quality and is highly valued for its ability to tolerate abiotic stresses. However, its introduction outside the Andes has yet to take off on a large...... scale. In the Andes, quinoa has until recently been marginally grown by small-scale Andean farmers, leading to minor interest in the crop from urban consumers and the industry. Quinoa breeding programs were not initiated until the 1960s in the Andes, and elsewhere from the 1970s onwards. New molecular...... tools available for the existing quinoa breeding programs, which are critically examined in this review, will enable us to tackle the limitations of allotetraploidy and genetic specificities. The recent progress, together with the declaration of "The International Year of the Quinoa" by the Food...

  6. SOYBEAN - MOLECULAR ASPECTS OF BREEDING

    Directory of Open Access Journals (Sweden)

    Aleksandra Sudarić

    2012-12-01

    Full Text Available The book Soybean: Molecular Aspects of Breeding focuses recent progress in our understanding of the genetics and molecular biology of soybean. This book is divided into four parts and contains 22 chapters. Part I, Molecular Biology and Biotechnology focuses advances in molecular biology and laboratory procedures that have been developed recently to manipulate DNA. Part II, Breeding for abiotic stress covers proteomics approaches form as a powerful tool for investigating the molecular mechanisms of the plant responses to various types of abiotic stresses. Part III, Breeding for biotic stress addresses issues related to application of molecular based strategies in order to increase soybean resistance to various biotic factors. Part IV, Recent Technology reviews recent technologies into the realm of soybean monitoring, processing and product use. While the information accumulated in this book is of primary interest for plant breeders, valuable insights are also offered to agronomists, molecular biologists, physiologists, plant pathologists, food scientists and students. The book is a result of efforts made by many experts from different countries (USA, Japan, Croatia, Serbia, China, Canada, Malawi, Iran, Hong Kong, Brasil, Mexico.

  7. Charge Breeding of Radioactive Ions

    CERN Document Server

    Wenander, F J C

    2013-01-01

    Charge breeding is a technique to increase the charge state of ions, in many cases radioactive ions. The singly charged radioactive ions, produced in an isotope separator on-line facility, and extracted with a low kinetic energy of some tens of keV, are injected into a charge breeder, where the charge state is increased to Q. The transformed ions are either directed towards a dedicated experiment requiring highly charged ions, or post-accelerated to higher beam energies. In this paper the physics processes involved in the production of highly charged ions will be introduced, and the injection and extraction beam parameters of the charge breeder defined. A description of the three main charge-breeding methods is given, namely: electron stripping in gas jet or foil; external ion injection into an electron-beam ion source/trap (EBIS/T); and external ion injection into an electron cyclotron resonance ion source (ECRIS). In addition, some preparatory devices for charge breeding and practical beam delivery aspects ...

  8. Duct Leakage Repeatability Testing

    Energy Technology Data Exchange (ETDEWEB)

    Walker, Iain [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Sherman, Max [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2014-01-01

    Duct leakage often needs to be measured to demonstrate compliance with requirements or to determine energy or Indoor Air Quality (IAQ) impacts. Testing is often done using standards such as ASTM E1554 (ASTM 2013) or California Title 24 (California Energy Commission 2013 & 2013b), but there are several choices of methods available within the accepted standards. Determining which method to use or not use requires an evaluation of those methods in the context of the particular needs. Three factors that are important considerations are the cost of the measurement, the accuracy of the measurement and the repeatability of the measurement. The purpose of this report is to evaluate the repeatability of the three most significant measurement techniques using data from the literature and recently obtained field data. We will also briefly discuss the first two factors. The main question to be answered by this study is to determine if differences in the repeatability of these tests methods is sufficient to indicate that any of these methods is so poor that it should be excluded from consideration as an allowed procedure in codes and standards.

  9. Circulating breeding and pre-breeding prolactin and LH are not associated with clutch size in the zebra finch (Taeniopygia guttata).

    Science.gov (United States)

    Ryan, Calen P; Dawson, Alistair; Sharp, Peter J; Meddle, Simone L; Williams, Tony D

    2014-06-01

    Clutch size is a fundamental predictor of avian fitness, widely-studied from evolutionary and ecological perspectives, but surprisingly little is known about the physiological mechanisms regulating clutch size variation. The only formal mechanistic hypothesis for avian clutch-size determination predicts an anti-gonadal effect of circulating prolactin (PRL) via the inhibition of luteinizing hormone (LH), and has become widely-accepted despite little experimental support. Here we investigated the relationship between pre-breeding and breeding plasma PRL and LH and clutch-size in captive-breeding female zebra finches (Taeniopygia guttata). Using a repeated-measures design, we followed individual females from pre-breeding, through multiple breeding attempts, and attempted to decrease PRL using the D2-receptor agonist, bromocriptine. Clutch size was independent of variation in pre-breeding PRL or LH, although pre-breeding LH was negatively correlated with the time between pairing and the onset of laying. Clutch size was independent of variation in plasma PRL on all days of egg-laying. Bromocriptine treatment had no effect on plasma PRL, but in this breeding attempt clutch size was also independent of plasma PRL. Finally, we found no evidence for an inverse relationship between plasma PRL and LH levels, as predicted if PRL had inhibitory effects via LH. Thus, our data fail to provide any support for the involvement of circulating PRL in clutch size determination. These findings suggest that alternative models for hormonal control of avian clutch size need to be considered, perhaps involving downstream regulation of plasma PRL at the level of the ovary, or other hormones that have not been considered to date.

  10. Epigenetics and triplet repeat neurological diseases

    Directory of Open Access Journals (Sweden)

    Sathiji eNageshwaran

    2015-12-01

    Full Text Available The term ‘junk DNA’ has been reconsidered following the delineation of the functional significance of repetitive DNA regions. Typically associated with centromeres and telomeres, DNA repeats are found in nearly all organisms throughout their genomes. Repetitive regions are frequently heterchromatinised resulting in silencing of intrinsic and nearby genes. However, this is not a uniform rule, with several genes known to require such an environment to permit transcription. Repetitive regions frequently exist as dinucleotide, trinucleotide and tetranucleotide repeats. The association between repetitive regions and disease was emphasised following the discovery of abnormal trinucleotide repeats underlying spinal and bulbar muscular atrophy (Kennedy’s disease and fragile X syndrome of mental retardation (FRAXA in 1991. In this review we provide a brief overview of epigenetic mechanisms and then focus on several diseases caused by DNA triplet-repeat expansions, which exhibit diverse epigenetic effects. It is clear that the emerging field of epigenetics is already generating novel potential therapeutic avenues for this group of largely incurable diseases.

  11. Genetic diversity of eleven European pig breeds

    Directory of Open Access Journals (Sweden)

    Foulley Jean-Louis

    2000-03-01

    Full Text Available Abstract A set of eleven pig breeds originating from six European countries, and including a small sample of wild pigs, was chosen for this study of genetic diversity. Diversity was evaluated on the basis of 18 microsatellite markers typed over a total of 483 DNA samples collected. Average breed heterozygosity varied from 0.35 to 0.60. Genotypic frequencies generally agreed with Hardy-Weinberg expectations, apart from the German Landrace and Schwäbisch-Hällisches breeds, which showed significantly reduced heterozygosity. Breed differentiation was significant as shown by the high among-breed fixation index (overall FST = 0.27, and confirmed by the clustering based on the genetic distances between individuals, which grouped essentially all individuals in 11 clusters corresponding to the 11 breeds. The genetic distances between breeds were first used to construct phylogenetic trees. The trees indicated that a genetic drift model might explain the divergence of the two German breeds, but no reliable phylogeny could be inferred among the remaining breeds. The same distances were also used to measure the global diversity of the set of breeds considered, and to evaluate the marginal loss of diversity attached to each breed. In that respect, the French Basque breed appeared to be the most "unique" in the set considered. This study, which remains to be extended to a larger set of European breeds, indicates that using genetic distances between breeds of farm animals in a classical taxonomic approach may not give clear resolution, but points to their usefulness in a prospective evaluation of diversity.

  12. Breeding without breeding: is a complete pedigree necessary for efficient breeding?

    Directory of Open Access Journals (Sweden)

    Yousry A El-Kassaby

    Full Text Available Complete pedigree information is a prerequisite for modern breeding and the ranking of parents and offspring for selection and deployment decisions. DNA fingerprinting and pedigree reconstruction can substitute for artificial matings, by allowing parentage delineation of naturally produced offspring. Here, we report on the efficacy of a breeding concept called "Breeding without Breeding" (BwB that circumvents artificial matings, focusing instead on a subset of randomly sampled, maternally known but paternally unknown offspring to delineate their paternal parentage. We then generate the information needed to rank those offspring and their paternal parents, using a combination of complete (full-sib: FS and incomplete (half-sib: HS analyses of the constructed pedigrees. Using a random sample of wind-pollinated offspring from 15 females (seed donors, growing in a 41-parent western larch population, BwB is evaluated and compared to two commonly used testing methods that rely on either incomplete (maternal half-sib, open-pollinated: OP or complete (FS pedigree designs. BwB produced results superior to those from the incomplete design and virtually identical to those from the complete pedigree methods. The combined use of complete and incomplete pedigree information permitted evaluating all parents, both maternal and paternal, as well as all offspring, a result that could not have been accomplished with either the OP or FS methods alone. We also discuss the optimum experimental setting, in terms of the proportion of fingerprinted offspring, the size of the assembled maternal and paternal half-sib families, the role of external gene flow, and selfing, as well as the number of parents that could be realistically tested with BwB.

  13. Repeatability of Cryogenic Multilayer Insulation

    Science.gov (United States)

    Johnson, W. L.; Vanderlaan, M.; Wood, J. J.; Rhys, N. O.; Guo, W.; Van Sciver, S.; Chato, D. J.

    2017-01-01

    Due to the variety of requirements across aerospace platforms, and one off projects, the repeatability of cryogenic multilayer insulation has never been fully established. The objective of this test program is to provide a more basic understanding of the thermal performance repeatability of MLI systems that are applicable to large scale tanks. There are several different types of repeatability that can be accounted for: these include repeatability between multiple identical blankets, repeatability of installation of the same blanket, and repeatability of a test apparatus. The focus of the work in this report is on the first two types of repeatability. Statistically, repeatability can mean many different things. In simplest form, it refers to the range of performance that a population exhibits and the average of the population. However, as more and more identical components are made (i.e. the population of concern grows), the simple range morphs into a standard deviation from an average performance. Initial repeatability testing on MLI blankets has been completed at Florida State University. Repeatability of five GRC provided coupons with 25 layers was shown to be +/- 8.4 whereas repeatability of repeatedly installing a single coupon was shown to be +/- 8.0. A second group of 10 coupons have been fabricated by Yetispace and tested by Florida State University, through the first 4 tests, the repeatability has been shown to be +/- 16. Based on detailed statistical analysis, the data has been shown to be statistically significant.

  14. Breeding schemes in reindeer husbandry

    Directory of Open Access Journals (Sweden)

    Lars Rönnegård

    2003-04-01

    Full Text Available The objective of the paper was to investigate annual genetic gain from selection (G, and the influence of selection on the inbreeding effective population size (Ne, for different possible breeding schemes within a reindeer herding district. The breeding schemes were analysed for different proportions of the population within a herding district included in the selection programme. Two different breeding schemes were analysed: an open nucleus scheme where males mix and mate between owner flocks, and a closed nucleus scheme where the males in non-selected owner flocks are culled to maximise G in the whole population. The theory of expected long-term genetic contributions was used and maternal effects were included in the analyses. Realistic parameter values were used for the population, modelled with 5000 reindeer in the population and a sex ratio of 14 adult females per male. The standard deviation of calf weights was 4.1 kg. Four different situations were explored and the results showed: 1. When the population was randomly culled, Ne equalled 2400. 2. When the whole population was selected on calf weights, Ne equalled 1700 and the total annual genetic gain (direct + maternal in calf weight was 0.42 kg. 3. For the open nucleus scheme, G increased monotonically from 0 to 0.42 kg as the proportion of the population included in the selection programme increased from 0 to 1.0, and Ne decreased correspondingly from 2400 to 1700. 4. In the closed nucleus scheme the lowest value of Ne was 1300. For a given proportion of the population included in the selection programme, the difference in G between a closed nucleus scheme and an open one was up to 0.13 kg. We conclude that for mass selection based on calf weights in herding districts with 2000 animals or more, there are no risks of inbreeding effects caused by selection.

  15. Genetic characterization of Egyptian and Italian sheep breeds using mitochondrial DNA

    OpenAIRE

    Othman E. Othman; Lorraine Pariset; Esraa A. Balabel; Marco Marioti

    2015-01-01

    A 721-bp fragment from 15,541 to 16,261 bp (NC_001941.1) of the mtDNA control region from different Egyptian and Italian sheep breeds was amplified. The PCR products were purified and sequenced. From the amplified fragment of 721-bp, a region of 423 bp after excluding a central region rich in tandem repeats was analyzed. Within all tested breeds, the haplotype diversity and average number of pairwise differences were 0.97571 and 7.01484, respectively. The genetic distances (D) and the aver...

  16. Hypokalemia syndrome in cattle.

    Science.gov (United States)

    Sattler, Nicolas; Fecteau, Gilles

    2014-07-01

    This article describes hypokalemia syndrome. Lactating dairy cows seem to be at the highest risk, but younger animals may also develop the disease. At present, except for animals treated with repeated isoflupredone acetate administration, the exact determinants causing hypokalemia syndrome remain uncertain. Affected animals are anorexic, weak to recumbent, and most often show signs of gastrointestinal stasis. Treatment is directed toward supportive care and oral potassium supplementation.

  17. Breeding for behavioural change in farm animails

    DEFF Research Database (Denmark)

    Sandøe, Peter; D'eath, RB; Lawrence, AB

    2009-01-01

    examples, such as breeding for good maternal behaviour, could enhance welfare, production and naturalness, although dilemmas emerge where improved welfare could result from breeding away from natural behaviour. Selection against certain behaviours may carry a risk of creating animals which are generally......In farm animal breeding, behavioural traits are rarely included in selection programmes despite their potential to improve animal production and welfare. Breeding goals have been broadened beyond production traits in most farm animal species to include health and functional traits......, and opportunities exist to increase the inclusion of behaviour in breeding indices. On a technical level, breeding for behaviour presents a number of particular challenges compared to physical traits. It is much more difficult and time-consuming to directly measure behaviour in a consistent and reliable manner...

  18. Selkirk Rex: morphological and genetic characterization of a new cat breed.

    Science.gov (United States)

    Filler, Serina; Alhaddad, Hasan; Gandolfi, Barbara; Kurushima, Jennifer D; Cortes, Alejandro; Veit, Christine; Lyons, Leslie A; Brem, Gottfried

    2012-01-01

    Rexoid, curly hair mutations have been selected to develop new domestic cat breeds. The Selkirk Rex is the most recently established curly-coated cat breed originating from a spontaneous mutation that was discovered in the United States in 1987. Unlike the earlier and well-established Cornish and Devon Rex breeds with curly-coat mutations, the Selkirk Rex mutation is suggested as autosomal dominant and has a different curl phenotype. This study provides a genetic analysis of the Selkirk Rex breed. An informal segregation analysis of genetically proven matings supported an autosomal, incomplete dominant expression of the curly trait in the Selkirk Rex. Homozygous curl cats can be distinguished from heterozygous cats by head and body type, as well as the presentation of the hair curl. Bayesian clustering of short tandem repeat (STR) genotypes from 31 cats that represent the future breeding stock supported the close relationship of the Selkirk Rex to the British Shorthair, Scottish Fold, Persian, and Exotic Shorthair, suggesting the Selkirk as part of the Persian breed family. The high heterozygosity of 0.630 and the low mean inbreeding coefficient of 0.057 suggest that Selkirk Rex has a diverse genetic foundation. A new locus for Selkirk autosomal dominant Rex, SADRE, is suggested for the curly trait.

  19. Breeding of speciality maize for industrial purposes

    OpenAIRE

    2010-01-01

    The breeding programme on speciality maize with specific traits was established at the Maize Research Institute, Zemun Polje, several decades ago. The initial material was collected, new methods applying to breeding of speciality maize, i.e. popping maize, sweet maize and white-seeded maize, were introduced. The aim was to enhance and improve variability of the initial material for breeding these three types of maize. Then, inbred lines of good combining abilities were developed and used as c...

  20. Development Of Space Breeding In China

    Institute of Scientific and Technical Information of China (English)

    Liu Luxiang

    2009-01-01

    @@ Space breeding provides a new technical platform for Chinese agricaltural scientists to explore the mechanism of crop mutation induced during spaceflight and breeds new varieties of crops. It is important for China to develop the space breeding industry,maintain China's lead position in this field,serve agricultural production better,promote China's sustainable and healthy agricultural development,and ensure national food safety.

  1. The Breeding Bird Survey, 1966

    Science.gov (United States)

    Robbins, C.S.; Van Velzen, W.T.

    1967-01-01

    A Breeding Bird Survey of a large section on North America was conducted during June 1966. Cooperators ran a total of 585 Survey routes in 26 eastern States and 4 Canadian Provinces. Future coverage of established routes will enable changes in the abundance of North American breeding birds to be measured. Routes are selected at random on the basis of one-degree blocks of latitude and longitude. Each 241/2-mile route, with 3-minute stops spaced one-half mile apart, is driven by automobile. All birds heard or seen at the stops are recorded on special forms and the data are then transferred to machine punch cards. The average number of birds per route is tabulated by State, along with the total number of each species and the percent of routes and stops upon which they were recorded. Maps are presented showing the range and abundance of selected species. Also, a year-to-year comparison is made of populations of selected species on Maryland routes in 1965 and 1966.

  2. Molecular tools for breeding basidiomycetes.

    Science.gov (United States)

    Ramírez, L; Larraya, L M; Pisabarro, A G

    2000-09-01

    The industrial production of edible basidiomycetes is increasing every year as a response to the increasing public demand of them because of their nutritional properties. About a dozen of fungal species can be currently produced for food with sound industrial and economic bases. Notwithstanding, this production is threatened by biotic and abiotic factors that make it necessary to improve the fungal strains currently used in industry. Breeding of edible basidiomycetes, however, has been mainly empirical and slow since the genetic tools useful in the selection of the new genetic material to be introduced in the commercial strains have not been developed for these fungi as it was for other organisms. In this review we will discuss the main genetic factors that should be considered to develop breeding approaches and tools for higher basidiomycetes. These factors are (i) the genetic system controlling fungal mating; (ii) the genomic structure and organisation of these fungi; and (iii) the identification of genes involved in the control of quantitative traits. We will discuss the weight of these factors using the oyster mushroom Pleurotus ostreatus as a model organism for most of the edible fungi cultivated industrially.

  3. Breeding without Breeding: Is a Complete Pedigree Necessary for Efficient Breeding?

    Science.gov (United States)

    El-Kassaby, Yousry A.; Cappa, Eduardo P.; Liewlaksaneeyanawin, Cherdsak; Klápště, Jaroslav; Lstibůrek, Milan

    2011-01-01

    Complete pedigree information is a prerequisite for modern breeding and the ranking of parents and offspring for selection and deployment decisions. DNA fingerprinting and pedigree reconstruction can substitute for artificial matings, by allowing parentage delineation of naturally produced offspring. Here, we report on the efficacy of a breeding concept called “Breeding without Breeding” (BwB) that circumvents artificial matings, focusing instead on a subset of randomly sampled, maternally known but paternally unknown offspring to delineate their paternal parentage. We then generate the information needed to rank those offspring and their paternal parents, using a combination of complete (full-sib: FS) and incomplete (half-sib: HS) analyses of the constructed pedigrees. Using a random sample of wind-pollinated offspring from 15 females (seed donors), growing in a 41-parent western larch population, BwB is evaluated and compared to two commonly used testing methods that rely on either incomplete (maternal half-sib, open-pollinated: OP) or complete (FS) pedigree designs. BwB produced results superior to those from the incomplete design and virtually identical to those from the complete pedigree methods. The combined use of complete and incomplete pedigree information permitted evaluating all parents, both maternal and paternal, as well as all offspring, a result that could not have been accomplished with either the OP or FS methods alone. We also discuss the optimum experimental setting, in terms of the proportion of fingerprinted offspring, the size of the assembled maternal and paternal half-sib families, the role of external gene flow, and selfing, as well as the number of parents that could be realistically tested with BwB. PMID:21991342

  4. Chemical classification of cattle. 1. Breed groups.

    Science.gov (United States)

    Baker, C M; Manwell, C

    1980-01-01

    From approximately 1000 papers with data on protein polymorphism in some 216 breeds of cattle, 10 polymorphic proteins were compared in means and variances of gene frequencies (arcsin p 1/2) for ten well-recognized breed groups for 196 of the breeds. The polymorphic proteins were alpha-lactalbumin, beta-lactoglobulin, caseins (alpha s1, beta and chi), serum albumin, transferrin, haemoglobin, amylase I and carbonic anhydrase II. The breed groups were North European, Pied Lowland, European Red brachyceros, Channel Island brachyceros, Upland brachyceros, primigenius-brachyceros mixed, primigenius, Indian Zebu, African Humped (with Zebu admixture), and African Humped (Sanga). The coherence within groups and the differences between groups are often impressive. Only carbonic anhydrase II fails to differentiate at least some of the major breed groups. In some cases paradoxical distributions of rare genetic variants can be explained by a more detailed inspection of breed history. The chemical data support the morphological and geographical divisions of cattle into major breed groups. There are three distinct but related brachyceros groups; for some polymorphisms the two Channel Island breeds, the Jersey and the Guernsey, are quite divergent. Although some authorities have considered the Pied Lowland as primigenius, it is a very distinct breed group.

  5. Genomics-assisted breeding in fruit trees.

    Science.gov (United States)

    Iwata, Hiroyoshi; Minamikawa, Mai F; Kajiya-Kanegae, Hiromi; Ishimori, Motoyuki; Hayashi, Takeshi

    2016-01-01

    Recent advancements in genomic analysis technologies have opened up new avenues to promote the efficiency of plant breeding. Novel genomics-based approaches for plant breeding and genetics research, such as genome-wide association studies (GWAS) and genomic selection (GS), are useful, especially in fruit tree breeding. The breeding of fruit trees is hindered by their long generation time, large plant size, long juvenile phase, and the necessity to wait for the physiological maturity of the plant to assess the marketable product (fruit). In this article, we describe the potential of genomics-assisted breeding, which uses these novel genomics-based approaches, to break through these barriers in conventional fruit tree breeding. We first introduce the molecular marker systems and whole-genome sequence data that are available for fruit tree breeding. Next we introduce the statistical methods for biparental linkage and quantitative trait locus (QTL) mapping as well as GWAS and GS. We then review QTL mapping, GWAS, and GS studies conducted on fruit trees. We also review novel technologies for rapid generation advancement. Finally, we note the future prospects of genomics-assisted fruit tree breeding and problems that need to be overcome in the breeding.

  6. The productivity of various pure breed and cross breed of imported pigs during lactation period

    Directory of Open Access Journals (Sweden)

    Djamuara Aritonang

    2001-03-01

    Full Text Available A study has been conducted to evaluate the productivity of pure breeds and cross breeds of imported pigs. Sixteen strains of pigs with five best sows were selected based on litter size and birth weight on the second parity. The results of the study showed that the pure breed performance was better than the cross breeds, as shown by the litter size, birth and weaned weight, less mortality, better mothering ability and better feed efficiency. Between pure breed, the Landrace and Yorkshire were better than other sows and between the cross breed, the LH and YL performed better than other crossbreeds. It is recommended that the pure breed especially Landrace and Yorkshire and LH and YL of cross breed are better than others

  7. Evolution of antiphospholipid antibody syndrome.

    Science.gov (United States)

    Baviskar, Rutuja R; Amonkar, Gayathri P; Chaudhary, Vinod A; Balasubramanian, Meenakshi; Mohite, Shailesh C; Puranik, Gururaj V

    2012-12-01

    Antiphospholipid antibody syndrome is a very important cause of cerebral infarction, myocardial infarction, and repeated pregnancy losses in women. We present an extremely rare case of a 44-year-old man with antiphospholipid syndrome who collapsed and died suddenly. At autopsy, he was found to have both cerebral and myocardial infarction. In all young patients with cerebral infarction, myocardial infarction, pulmonary embolism, recurrent miscarriages, and unexplained low platelet count, one must consider the strong possibility of antiphospholipid antibody syndrome.

  8. Across Breed QTL Detection and Genomic Prediction in French and Danish Dairy Cattle Breeds

    DEFF Research Database (Denmark)

    van den Berg, Irene; Guldbrandtsen, Bernt; Hozé, C

    Our objective was to investigate the potential benefits of using sequence data to improve across breed genomic prediction, using data from five French and Danish dairy cattle breeds. First, QTL for protein yield were detected using high density genotypes. Part of the QTL detected within breed was...

  9. Conservation priorities for Ethiopian sheep breeds combining threat status, breed merits and contributions to genetic diversity

    NARCIS (Netherlands)

    Gizaw, S.; Komen, J.; Windig, J.J.; Hanotte, O.; Arendonk, van J.A.M.

    2008-01-01

    Prioritizing livestock breeds for conservation needs to incorporate both genetic and non-genetic aspects important for the survival of the breeds. Here, we apply a maximum-utility-strategy to prioritize 14 traditional Ethiopian sheep breeds based on their threat status, contributions to farmer livel

  10. Across Breed QTL Detection and Genomic Prediction in French and Danish Dairy Cattle Breeds

    DEFF Research Database (Denmark)

    van den Berg, Irene; Guldbrandtsen, Bernt; Hozé, C

    Our objective was to investigate the potential benefits of using sequence data to improve across breed genomic prediction, using data from five French and Danish dairy cattle breeds. First, QTL for protein yield were detected using high density genotypes. Part of the QTL detected within breed was...

  11. Artificiat insemination vercus natural breeding in a multi.breed beef ...

    African Journals Online (AJOL)

    calving-to-breeding period the following breeding season and a reduced ..... the first four weeks of the calving season, while only 49 9o of the calves born as a result ... breeding season rather than leaving the job to the bulls later in the season.

  12. Breeding programmes for smallholder sheep farming systems: II. Optimization of cooperative village breeding schemes

    NARCIS (Netherlands)

    Gizaw, S.; Arendonk, van J.A.M.; Valle-Zarate, A.; Haile, A.; Rischkowsky, B.; Dessie, T.; Mwai, A.O.

    2014-01-01

    A simulation study was conducted to optimize a cooperative village-based sheep breeding scheme for Menz sheep of Ethiopia. Genetic gains and profits were estimated under nine levels of farmers' participation and three scenarios of controlled breeding achieved in the breeding programme, as well as un

  13. Dumping Syndrome

    Science.gov (United States)

    ... System & How it Works Digestive Diseases A-Z Dumping Syndrome What is dumping syndrome? Dumping syndrome occurs when food, especially sugar, ... the colon and rectum—and anus. What causes dumping syndrome? Dumping syndrome is caused by problems with ...

  14. Breeding for Grass Seed Yield

    DEFF Research Database (Denmark)

    Boelt, Birte; Studer, Bruno

    2010-01-01

    Seed yield is a trait of major interest for many fodder and amenity grass species and has received increasing attention since seed multiplication is economically relevant for novel grass cultivars to compete in the commercial market. Although seed yield is a complex trait and affected...... by agricultural practices as well as environmental factors, traits related to seed production reveal considerable genetic variation, prerequisite for improvement by direct or indirect selection. This chapter first reports on the biological and physiological basics of the grass reproduction system, then highlights...... important aspects and components affecting the seed yield potential and the agronomic and environmental aspects affecting the utilization and realization of the seed yield potential. Finally, it discusses the potential of plant breeding to sustainably improve total seed yield in fodder and amenity grasses....

  15. Cattle breeding goals and production circumstances

    NARCIS (Netherlands)

    Groen, A.F.

    1989-01-01

    This thesis gives the results of a study on the relationship between cattle breeding goals and production circumstances. The relationship between breeding goals and production circumstances mostly arises from the influences of production circumstances on the economic values of genetic

  16. Breed predisposition to canine gastric carcinoma

    DEFF Research Database (Denmark)

    Seim-Wikse, Tonje; Jörundsson, Einar; Nødtvedt, Ane

    2013-01-01

    Previous research has indicated a breed predisposition to gastric carcinoma in dogs. However, results to date are inconsistent since several studies have failed to prove such a predisposition. Better knowledge of breeds at risk could facilitate early detection of gastric carcinoma in dogs. The ai...

  17. Breed predisposition to canine gastric carcinoma

    DEFF Research Database (Denmark)

    Seim-Wikse, Tonje; Jörundsson, Einar; Nødtvedt, Ane;

    2013-01-01

    Previous research has indicated a breed predisposition to gastric carcinoma in dogs. However, results to date are inconsistent since several studies have failed to prove such a predisposition. Better knowledge of breeds at risk could facilitate early detection of gastric carcinoma in dogs. The ai...

  18. Genetic diversity of 11 European pig breeds

    NARCIS (Netherlands)

    Lavall, G.; Iannuccelli, N.; Legault, C.; Milan, D.; Groenen, M.A.M.; Andersson, L.; Fredholm, M.; Geldermann, H.; Foulley, J.L.; Chevalet, C.; Ollivier, L.

    2000-01-01

    A set of eleven pig breeds originating from six European countries, and including a small sample of wild pigs, was chosen for this study of genetic diversity. Diversity was evaluated on the basis of 18 microsatellite markers typed over a total of 483 DNA samples collected. Average breed heterozygosi

  19. Cattle breeding goals and production circumstances.

    NARCIS (Netherlands)

    Groen, A.F.

    1989-01-01

    This thesis gives the results of a study on the relationship between cattle breeding goals and production circumstances. The relationship between breeding goals and production circumstances mostly arises from the influences of production circumstances on the economic values of geneticim

  20. Lily breeding research in the Netherlands

    NARCIS (Netherlands)

    Tuyl, van J.M.; Holsteijn, van H.M.C.

    1996-01-01

    At the Centre for Plant Breeding and Reproduction Research (CPRO-DLO) in Wageningen lily breeding research in the Netherlands is concentrated. To this end sources of germplasm (genetic material) are maintained in a lily species and cultivar collection. Research is done on long term storage of this c

  1. Plant Breeding: Surprisingly, Less Sex Is Better.

    Science.gov (United States)

    van Dijk, Peter J; Rigola, Diana; Schauer, Stephen E

    2016-02-01

    Introduction of apomixis, asexual reproduction through seeds, into crop species has the potential to dramatically transform plant breeding. A new study demonstrates that traits can be stably transferred between generations in newly produced apomictic lines, and heralds a breeding revolution needed to increase food production for the growing planet.

  2. Breeding for behavioural change in farm animals

    DEFF Research Database (Denmark)

    D'Eath, R.B.; Conington, J.; Lawrence, A.B.

    2010-01-01

    In farm animal breeding, behavioural traits are rarely included in selection programmes despite their potential to improve animal production and welfare. Breeding goals have been broadened beyond production traits in most farm animal species to include health and functional traits, and opportunit...

  3. Breeding for behavioural change in farm animails

    DEFF Research Database (Denmark)

    Sandøe, Peter; D'eath, RB; Lawrence, AB

    2009-01-01

    examples, such as breeding for good maternal behaviour, could enhance welfare, production and naturalness, although dilemmas emerge where improved welfare could result from breeding away from natural behaviour. Selection against certain behaviours may carry a risk of creating animals which are generally...

  4. Impact of selective breeding on European aquaculture

    NARCIS (Netherlands)

    Janssen, K.; Chavanne, H.; Berentsen, P.; Komen, H.

    2016-01-01

    Objectives of this study were to determine the combined market share of breeding companies in aquaculture production in Europe, to describe the main characteristics of breeding companies and their programs, and to provide per species estimates on cumulative genetic gain in growth performance. Sur

  5. Non-canonical RAN Translation of CGG Repeats Has Canonical Requirements.

    Science.gov (United States)

    Cox, Diana C; Cooper, Thomas A

    2016-04-21

    Repeat expansions cause dominantly inherited neurological disorders. In this issue of Molecular Cell, Kearse et al. (2016) examine the requirements for RAN translation of the CGG repeats that cause fragile X-associated tremor/ataxia syndrome, revealing similarities and differences with canonical translation.

  6. Improved molecular diagnosis of unparental disomy 15 in Prader-Willi and Angelman syndromes utilizing new short tandem repeats (STRs) mapped to chromosome 15q11.2-q12

    Energy Technology Data Exchange (ETDEWEB)

    Christian, S.L.; Kubota, T.; Ledbetter, D.H. [National Institutes of Health, Bethesda, MD (United States)] [and others

    1994-09-01

    Prader-Willi syndrome (PWS) and Angelman syndrome (AS) are distinct mental retardation disorders caused by paternal (PWS) or maternal (AS) deficiencies of chromosome 15q11.2-q12. Three STRs (D15S11, GABRB3, and D15S113) were previously developed utilizing YACs from this region as a molecular diagnostic test for PWS/AS. Since then twenty-three new STRs have been developed by several groups which map to 15q11.2-q12. Fine mapping of some of these markers was accomplished utilizing a 3.5 Mb YAC contig of this region. Three new CEPH-Genethon markers, D15S122, D15S128, and D15S210 were mapped within the smallest PWS/AS critical regions. D15S122 mapped to YACs 230H12 and 132D4, D15S128 mapped to YACs 457B4, 11H11, and B58C7, and D15S210 mapped to 132D4 and B230E3. To improve molecular diagnosis of uniparental disomy in PWS/AS, D15S122 and D15S128 with >70% hetrozygosities were placed in a new multiplex PCR reaction with D15S11. Additionally, three CEPH-Genethon markers with high heterozygosities from distal 15q, D15S123, D15S125, and D15S131, were used establish a second multiplex to increase the total number of markers analyzed to six. Twenty-three patients with uniparental disomy 15 were compared using the original multiplex and the two new multiplexes. The results indicated that 16/23 had at least one fully informative marker with the original multiplex and 23/23 using the two new multiplexes. Using a more rigorous diagnostic criterion of two fully informative markers, only 8/23 were informative with the original multiplex and 21/23 with the two new multiplexes. These results demonstrate that these two new multiplexes composed of a total of six polymorphic STRs provide an improved diagnostic test for uniparental disomy 15.

  7. Breeding for behavioural change in farm animals

    DEFF Research Database (Denmark)

    D'Eath, R.B.; Conington, J.; Lawrence, A.B.

    2010-01-01

    In farm animal breeding, behavioural traits are rarely included in selection programmes despite their potential to improve animal production and welfare. Breeding goals have been broadened beyond production traits in most farm animal species to include health and functional traits...... in order to evaluate the large numbers of animals necessary for a breeding programme. For this reason, the development and validation of proxy measures of key behavioural traits is often required. Despite these difficulties, behavioural traits have been introduced by certain breeders. For example, ease...... of handling is now included in some beef cattle breeding programmes. While breeding for behaviour is potentially beneficial, ethical concerns have been raised. Since animals are adapted to the environment rather than the other way around, there may be a loss of 'naturalness' and/or animal integrity. Some...

  8. Selection criteria in organic cattle breeding

    Directory of Open Access Journals (Sweden)

    Savić Mila

    2014-01-01

    Full Text Available The central issue in process of organizing organic cattle breeding is the knowledge about specificities of this kind of production, good knowledge of breed characteristics (body composition, immune tolerance, expressed predisposition towards some diseases, production properties. Research centres, in collaboration with producers, have defined the essential features on which the selection programmes in organic cattle breeding are based on. Of the greatest importance for veterinary service is the fact that selection programmes in organic cattle breeding are in the first place based on giving priority to healthy animals, with strong immune system, good reproductive characteristics, which can be in production system for a long period. Additional important selective criteria is specific body resistance and adaptability of autochtonous breeds to environmental conditions. [Projekat Ministarstva nauke Republike Srbije, br. TP 31085

  9. Genetic diversity in Tunisian horse breeds

    Directory of Open Access Journals (Sweden)

    B. Jemmali

    2017-06-01

    Full Text Available This study aimed at screening genetic diversity and differentiation in four horse breeds raised in Tunisia, the Barb, Arab-Barb, Arabian, and English Thoroughbred breeds. A total of 200 blood samples (50 for each breed were collected from the jugular veins of animals, and genomic DNA was extracted. The analysis of the genetic structure was carried out using a panel of 16 microsatellite loci. Results showed that all studied microsatellite markers were highly polymorphic in all breeds. Overall, a total of 147 alleles were detected using the 16 microsatellite loci. The average number of alleles per locus was 7.52 (0.49, 7.35 (0.54, 6.3 (0.44, and 6 (0.38 for the Arab-Barb, Barb, Arabian, and English Thoroughbred breeds, respectively. The observed heterozygosities ranged from 0.63 (0.03 in the English Thoroughbred to 0.72 in the Arab-Barb breeds, whereas the expected heterozygosities were between 0.68 (0.02 in the English Thoroughbred and 0.73 in the Barb breeds. All FST values calculated by pairwise breed combinations were significantly different from zero (p  <  0.05 and an important genetic differentiation among breeds was revealed. Genetic distances, the factorial correspondence, and principal coordinate analyses showed that the important amount of genetic variation was within population. These results may facilitate conservation programs for the studied breeds and enhance preserve their genetic diversity.

  10. Effect of repeated morphine withdrawal on spatial learning, memory and serum cortisol level in mice

    OpenAIRE

    Mahdieh Matinfar; Mahsa Masjedi Esfahani; Neda Aslany; Seyyed Hamid Reza Davoodi; Pouya Parsaei; Ghasem Zarei; Parham Reisi

    2013-01-01

    Background: One of the serious problems that opioid addicted people are facing is repeated withdrawal syndrome that is accompanying with a significant stress load for addicts. Therefore, the aim of this study was to evaluate the effects of repeated withdrawal on spatial learning, memory and serum cortisol levels in morphine-dependent mice. Materials and Methods: Male NMRI mice received morphine as daily increasing doses for 3 days. After that, the mice underwent one time or repeated spont...

  11. Expansion of protein domain repeats.

    Directory of Open Access Journals (Sweden)

    Asa K Björklund

    2006-08-01

    Full Text Available Many proteins, especially in eukaryotes, contain tandem repeats of several domains from the same family. These repeats have a variety of binding properties and are involved in protein-protein interactions as well as binding to other ligands such as DNA and RNA. The rapid expansion of protein domain repeats is assumed to have evolved through internal tandem duplications. However, the exact mechanisms behind these tandem duplications are not well-understood. Here, we have studied the evolution, function, protein structure, gene structure, and phylogenetic distribution of domain repeats. For this purpose we have assigned Pfam-A domain families to 24 proteomes with more sensitive domain assignments in the repeat regions. These assignments confirmed previous findings that eukaryotes, and in particular vertebrates, contain a much higher fraction of proteins with repeats compared with prokaryotes. The internal sequence similarity in each protein revealed that the domain repeats are often expanded through duplications of several domains at a time, while the duplication of one domain is less common. Many of the repeats appear to have been duplicated in the middle of the repeat region. This is in strong contrast to the evolution of other proteins that mainly works through additions of single domains at either terminus. Further, we found that some domain families show distinct duplication patterns, e.g., nebulin domains have mainly been expanded with a unit of seven domains at a time, while duplications of other domain families involve varying numbers of domains. Finally, no common mechanism for the expansion of all repeats could be detected. We found that the duplication patterns show no dependence on the size of the domains. Further, repeat expansion in some families can possibly be explained by shuffling of exons. However, exon shuffling could not have created all repeats.

  12. CROSSING OF HOLSTEIN HORSE BREED WITH SOME OTHER BREEDS

    Directory of Open Access Journals (Sweden)

    Josip Ljubešić

    2000-06-01

    Full Text Available An experiment of crossing a heavier-weight semi-breed horse (Holstein with mares of Croatian Posavian type draft horse resulted in possibility of such further crossing. Attained product meets today’s market requirements: firstly as an export-meat category that meets Italian market requirements, since other markets are not well known, secondly, it can be used as a sport-tourist-recreation horse. It must be pointed out that all produced hybrids did not meet the needs of these two basic criteria. In spite of being potential slaughtery head with good utilization, each produced head can be, according to its exterial properties, used as a sporttourist animal that showed certain usable values and results proven by the experiment. The hybrids showed some hereditory draft horse properties shown on enclosed photos. In addition, exterier measures show that former knowledge on hybrids can respond the question of a horse raising on non-utilized pastures which they got used to very well. Thus these horses are able to be estimated by their body development just as our native draft Posavian type horse including possibility of using them as a sport-tourist-recreation horse.

  13. Livestock breeding for sustainability to mitigate global warming, with ...

    African Journals Online (AJOL)

    Livestock breeding for sustainability to mitigate global warming, with the emphasis ... is essential in implementing efficient breeding systems to cope with climate change. Sophisticated statistical models continue to support animal breeding and ...

  14. DWI Repeaters and Non-Repeaters: A Comparison.

    Science.gov (United States)

    Weeber, Stan

    1981-01-01

    Discussed how driving-while-intoxicated (DWI) repeaters differed signigicantly from nonrepeaters on 4 of 23 variables tested. Repeaters were more likely to have zero or two dependent children, attend church frequently, drink occasionally and have one or more arrests for public intoxication. (Author)

  15. To Repeat or Not to Repeat a Course

    Science.gov (United States)

    Armstrong, Michael J.; Biktimirov, Ernest N.

    2013-01-01

    The difficult transition from high school to university means that many students need to repeat (retake) 1 or more of their university courses. The authors examine the performance of students repeating first-year core courses in an undergraduate business program. They used data from university records for 116 students who took a total of 232…

  16. Breeding objectives for Targhee sheep.

    Science.gov (United States)

    Borg, R C; Notter, D R; Kuehn, L A; Kott, R W

    2007-11-01

    Breeding objectives were developed for Targhee sheep under rangeland production conditions. Traits considered were those for which EPD were available from the US National Sheep Improvement Program and included direct and maternal effects on 120-d weaning weight (WW and MM, respectively); yearling weight (YW); yearling fleece weight, fiber diameter, and staple length; and percent lamb crop (PLC), measured as the number of lambs born per 100 ewes lambing. A bioeconomic model was used to predict the effects of a change of 1 additive SD in EPD for each trait, holding all other traits constant at their mean, on animal performance, feed requirements, feed costs, and economic returns. Resulting economic weightings were then used to derive selection indexes. Indexes were derived separately for 3 prolificacy levels (1.41, 1.55, and 1.70 lambs/ewe lambing), 2 triplet survival levels (50 and 67%), 2 lamb pricing policies (with or without discounting of prices for heavy feeder lambs), and 3 forage cost scenarios (renting pasture, purchasing hay, or reducing flock size to accommodate increased nutrient requirements for production). Increasing PLC generally had the largest impact on profitability, although an increase in WW was equally important, with low feed costs and no discounting of prices for heavy feeder lambs. Increases in PLC were recommended at all 3 prolificacy levels, but with low triplet survival the value of increasing PLC eventually declined as the mean litter size increased to approximately 2.15 lambs/ewe lambing and above. Increasing YW (independent of WW) increased ewe maintenance costs and reduced profitability. Predicted changes in breeding values for WW and YW under index selection varied with lamb pricing policy and feed costs. With low feed costs or no discounts for heavy lambs, YW increased at a modest rate in association with increasing WW, but with high feed costs or discounting of heavy lambs, genetic trends in WW were reduced by approximately 50% to

  17. Native Pig and Chicken Breed Database: NPCDB

    Directory of Open Access Journals (Sweden)

    Hyeon-Soo Jeong

    2014-10-01

    Full Text Available Indigenous (native breeds of livestock have higher disease resistance and adaptation to the environment due to high genetic diversity. Even though their extinction rate is accelerated due to the increase of commercial breeds, natural disaster, and civil war, there is a lack of well-established databases for the native breeds. Thus, we constructed the native pig and chicken breed database (NPCDB which integrates available information on the breeds from around the world. It is a nonprofit public database aimed to provide information on the genetic resources of indigenous pig and chicken breeds for their conservation. The NPCDB (http://npcdb.snu.ac.kr/ provides the phenotypic information and population size of each breed as well as its specific habitat. In addition, it provides information on the distribution of genetic resources across the country. The database will contribute to understanding of the breed’s characteristics such as disease resistance and adaptation to environmental changes as well as the conservation of indigenous genetic resources.

  18. LINE CONSTRUCTION OF NONIUS BREED IN SLOVAKIA

    Directory of Open Access Journals (Sweden)

    Eva Mlyneková

    2013-12-01

    Full Text Available Nowadays breeding has become the problem often solved in European states and it has been paid much attention by breeding organizations. In terms of hippology as well as some urgent requirements from the side of nonius breeders we have focussed on this particular breed especially from the reason of its further survival and development in Slovakia. The aim of this paper was to evaluate the growth indicators as well as the achievement level of the stallions since 1927 to the present. Based on our research of the nonius body lines we can state that at present there are 3 stallions that are followers of the N VIII horse line founder. In general, there are 12 stallions that are active within this breed in Slovakia. It was statistically confirmed that this particular breed grew much stronger through the goal-directed breeding work, improved nutrition as well as the immediate breeding site. It was quite complicated to evaluate the performance tests because the individual indicators were significantly influenced by the subjective views of the commitee members performing the evaluation. The next factor which prevents the objective evaluation is the fact that in the period up to 1979, the performance tests were valued by the 100 point system and from the year 1980 by the 10 point system. That is why we take the performance test results into account only as supplemental ones, which can provide a kind of amendment to the observed biological parameters.

  19. Advances in Japanese pear breeding in Japan.

    Science.gov (United States)

    Saito, Toshihiro

    2016-01-01

    The Japanese pear (Pyrus pyrifolia Nakai) is one of the most widely grown fruit trees in Japan, and it has been used throughout Japan's history. The commercial production of pears increased rapidly with the successive discoveries of the chance seedling cultivars 'Chojuro' and 'Nijisseiki' around 1890, and the development of new cultivars has continued since 1915. The late-maturing, leading cultivars 'Niitaka' and 'Shinko' were released during the initial breeding stage. Furthermore, systematic breeding by the Horticultural Research Station (currently, NARO Institute of Fruit Tree Science, National Agriculture and Food Research Organization (NIFTS)) began in 1935, which mainly aimed to improve fruit quality by focusing on flesh texture and black spot disease resistance. To date, 22 cultivars have been released, including 'Kosui', 'Hosui', and 'Akizuki', which are current leading cultivars from the breeding program. Four induced mutant cultivars induced by gamma irradiation, which exhibit some resistance to black spot disease, were released from the Institute of Radiation Breeding. Among these cultivars, 'Gold Nijisseiki' has become a leading cultivar. Moreover, 'Nansui' from the Nagano prefectural institute breeding program was released, and it has also become a leading cultivar. Current breeding objectives at NIFTS mainly combine superior fruit quality with traits related to labor and cost reduction, multiple disease resistance, or self-compatibility. Regarding future breeding, marker-assisted selection for each trait, QTL analyses, genome-wide association studies, and genomic selection analyses are currently in progress.

  20. A population genetic database of cat breeds developed in coordination with a domestic cat STR multiplex.

    Science.gov (United States)

    Menotti-Raymond, Marilyn; David, Victor A; Weir, Bruce S; O'Brien, Stephen J

    2012-05-01

    A simple tandem repeat (STR) PCR-based typing system developed for the genetic individualization of domestic cat samples has been used to generate a population genetic database of domestic cat breeds. A panel of 10 tetranucleotide STR loci and a gender-identifying sequence tagged site (STS) were co-amplified in genomic DNA of 1043 individuals representing 38 cat breeds. The STR panel exhibits relatively high heterozygosity in cat breeds, with an average 10-locus heterozygosity of 0.71, which represents an average of 38 breed-specific heterozygosities for the 10-member panel. When the entire set of breed individuals was analyzed as a single population, a heterozygosity of 0.87 was observed. Heterozygosities obtained for the 10 loci range from 0.72 to 0.96. The power for genetic individualization of domestic cat samples of the multiplex is high, with a probability of match (p(m)) of 6.2E-14, using a conservative θ = 0.05.

  1. Genetic variability of Appaloosa horses: a study of a closed breeding population from Argentina

    Directory of Open Access Journals (Sweden)

    Claudia Malena CORBI-BOTTO,Sebastian Andres SADABA,Elina Ines FRANCISCO,Paula Belen KALEMKERIAN,Juan Pedro LIRON,Egle Etel VILLEGAS-CASTAGNASSO,Guillermo GIOVAMBATTISTA,Pilar PERAL-GARCIA,Silvina DIAZ

    2014-09-01

    Full Text Available The genetic diversity and structure of 72 Appaloosa horses belonging to a closed breeding population from an ecological reserve in Buenos Aires, Argentina, was investigated using eight microsatellite markers from the International Society for Animal Genetics panel. Our data showed that this Appaloosa horse population had an elevated degree of genetic diversity (He= 0.746 and did not present a significant increase of homozygous individuals (FIS~0. However, the short tandem repeats, AHT5, ASB2, HTG10 and VHL20, were not in Hardy–Weinberg equilibrium (P-value<0.05. Genetic relationships between this population and other well known horse breeds showed that Appaloosa horses from Argentina could have had their origin in the horses of the Nez Perce's people in Idaho while other Appaloosa horses may have had influences from Andalusian and Lusitano breeds. This closed breeding population conserves an important degree of Appaloosa genetic diversity and notwithstanding its particular breeding characteristics, represents a valuable genetic resource for conservation.

  2. The past, present and future of breeding rust resistant wheat

    Directory of Open Access Journals (Sweden)

    Jeffrey G Ellis

    2014-11-01

    Full Text Available Two classes of genes are used for breeding rust resistant wheat. The first class, called R (for resistance genes, are pathogen race-specific in their action, effective at all plant growth stages and probably mostly encode immune receptors of the nucleotide binding leucine rich repeat (NB-LRR class. The second class called Adult Plant Resistance genes (APR because resistance is usually functional only in adult plants, and, in contrast to most R genes, the levels of resistance conferred by single APR genes are only partial and allow considerable disease development. Some but not all APR genes provide resistance to all isolates of a rust pathogen species and a subclass of these provides resistance to several fungal pathogen species. Initial indications are that APR genes encode a more heterogeneous range of proteins than R proteins. Two APR genes, Lr34 and Yr36, have been cloned from wheat and their products are an ABC transporter and a protein kinase, respectively. Lr34 and Sr2 have provided long lasting and widely used (durable partial resistance and are mainly used in conjunction with other R and APR genes to obtain adequate rust resistance. We caution that some APR genes indeed include race-specific, weak R genes which may be of the NB-LRR class. A research priority to better inform rust resistance breeding is to characterize further APR genes in wheat and to understand how they function and how they interact when multiple APR and R genes are stacked in a single genotype by conventional and GM breeding. An important message is do not be complacent about the general durability of all APR genes.

  3. Breeding Practices in Sheep Farming

    Directory of Open Access Journals (Sweden)

    M.A. Shejal

    2009-02-01

    Full Text Available The sheep is an important economic livestock species, contributing greatly to the Indian economy, especially in arid, semi arid and mountain areas. The current population in world is 1110.78 millions, around 44.85 millions (1987 sheeps in India (ICAR., 2002. Sheeps are mostly reared for meat and wool. The average annual wool production per sheep is between 3.5 to 5.5 kg of fine quality wool in Australia, New Zealand and U.S.S.R., where as in India except Magra sheep which annually yield more than 2 kg wool having staple length 5.8 cm, the average of rest of the wool produced is less than 1.0 kg per sheep of inferior quality (Banerjee G.C., 1998. Therefore many farmers in southern India adapted sheep rearing for meat production than for wool production. For yielding more production from sheep farming one should have sound knowledge of general information related to the reproduction and different breeding practices. [Vet. World 2009; 2(1.000: 43-44

  4. Nifty Nines and Repeating Decimals

    Science.gov (United States)

    Brown, Scott A.

    2016-01-01

    The traditional technique for converting repeating decimals to common fractions can be found in nearly every algebra textbook that has been published, as well as in many precalculus texts. However, students generally encounter repeating decimal numerals earlier than high school when they study rational numbers in prealgebra classes. Therefore, how…

  5. Nifty Nines and Repeating Decimals

    Science.gov (United States)

    Brown, Scott A.

    2016-01-01

    The traditional technique for converting repeating decimals to common fractions can be found in nearly every algebra textbook that has been published, as well as in many precalculus texts. However, students generally encounter repeating decimal numerals earlier than high school when they study rational numbers in prealgebra classes. Therefore, how…

  6. Management and Breeding Soundness of Mature Bulls.

    Science.gov (United States)

    Palmer, Colin W

    2016-07-01

    Mature bulls must be fed a balanced ration, vaccinated appropriately, and undergo a breeding soundness evaluation to ensure they meet what is required of a short, but intense breeding season. To be classified as a satisfactory potential breeder, minimum standards for physical soundness, scrotal circumference, sperm motility, and sperm morphology must be achieved using an accepted bull-breeding soundness evaluation format. Sperm production requires approximately 70 days. Heat and stress are the most common insults to spermatogenesis, causing an increase in morphologic abnormalities with obesity-associated scrotal fat accumulation being the most frequent cause of elevated testicular temperature in mature bulls.

  7. Cushing syndrome

    Science.gov (United States)

    Hypercortisolism; Cortisol excess; Glucocorticoid excess - Cushing syndrome ... The most common cause of Cushing syndrome is taking too much ... exogenous Cushing syndrome . Prednisone, dexamethasone, and ...

  8. Serotonin syndrome

    Science.gov (United States)

    Hyperserotonemia; Serotonergic syndrome; Serotonin toxicity; SSRI - serotonin syndrome; MAO - serotonin syndrome ... two medicines that affect the body's level of serotonin are taken together at the same time. The ...

  9. Necrotizing meningoencephalitis in a large mixed-breed dog.

    Science.gov (United States)

    Estey, Chelsie M; Scott, Steven J; Cerda-Gonzalez, Sofia

    2014-12-01

    A 4-year-old 26-kg (57.2-lb) spayed female Staffordshire Bull Terrier mix was evaluated because of a 24-hour history of cluster seizures. Neurologic examination revealed altered mentation and multifocal intracranial signs; MRI was performed. The MRI findings included multifocal, asymmetric forebrain lesions affecting both the gray and white matter, an area suggestive of focal necrosis, and loss of corticomedullary distinction. A midline shift and caudal transtentorial herniation were noted, suggestive of greater than normal intracranial pressure. Because the dog's clinical signs worsened despite medical treatment and additional evidence of increased intracranial pressure, bilateral craniectomy and durectomy were performed. Histologic evaluation of a brain biopsy specimen revealed bilateral and asymmetric areas of necrosis in the subcortical white matter and adjacent gray matter. At the periphery of the necrotic areas, there was increased expression of glial fibrillary acidic protein and Virchow-Robin spaces were expanded by CD3+ lymphocytes. Results of immunohistochemical analysis of brain tissue were negative for canine distemper virus, Neospora canis, and Toxoplasma gondii. These clinical, imaging, and histopathologic findings were compatible with necrotizing meningoencephalitis. The dog's neurologic status continued to worsen following surgery. Repeated MRI revealed ongoing signs of increased intracranial pressure, despite the bilateral craniectomy. The owners elected euthanasia. To the author's knowledge, this is the first report of necrotizing meningoencephalitis in a large mixed-breed dog. Necrotizing meningoencephalitis should be considered as a differential diagnosis in dogs other than small or toy breeds that have signs suggestive of inflammatory disease.

  10. All-photonic quantum repeaters

    Science.gov (United States)

    Azuma, Koji; Tamaki, Kiyoshi; Lo, Hoi-Kwong

    2015-01-01

    Quantum communication holds promise for unconditionally secure transmission of secret messages and faithful transfer of unknown quantum states. Photons appear to be the medium of choice for quantum communication. Owing to photon losses, robust quantum communication over long lossy channels requires quantum repeaters. It is widely believed that a necessary and highly demanding requirement for quantum repeaters is the existence of matter quantum memories. Here we show that such a requirement is, in fact, unnecessary by introducing the concept of all-photonic quantum repeaters based on flying qubits. In particular, we present a protocol based on photonic cluster-state machine guns and a loss-tolerant measurement equipped with local high-speed active feedforwards. We show that, with such all-photonic quantum repeaters, the communication efficiency scales polynomially with the channel distance. Our result paves a new route towards quantum repeaters with efficient single-photon sources rather than matter quantum memories. PMID:25873153

  11. Transcatheter treatment of Lutembacher syndrome

    Institute of Scientific and Technical Information of China (English)

    SHEN Xiang-qian; ZHOU Sheng-hua; ZHOU Tao; QI Shu-shan; FANG Zhen-fei; LV Xiao-ling

    2005-01-01

    @@ Lutembacher syndrome, a combination of congenital atrial septal defect (ASD) complicated by acquired mitral stenosis,1 has been traditionally treated by open-heart surgery.2 With the introduction of transcatheter closure of ASD3 and percutaneous balloon mitral valvuloplasty,4 then Lutembacher syndrome can be treated percutaneously. Percutaneous management of Lutembacher syndrome can obviate the morbidity and mortality associated with cardiac surgery, the psychological trauma of a thoracotomy scar and the possibility of repeat thoracotomy for mitral restenosis. So the technique may be ideal for treatment of Lutembacher syndrome.

  12. The ascent of cat breeds: genetic evaluations of breeds and worldwide random-bred populations.

    Science.gov (United States)

    Lipinski, Monika J; Froenicke, Lutz; Baysac, Kathleen C; Billings, Nicholas C; Leutenegger, Christian M; Levy, Alon M; Longeri, Maria; Niini, Tirri; Ozpinar, Haydar; Slater, Margaret R; Pedersen, Niels C; Lyons, Leslie A

    2008-01-01

    The diaspora of the modern cat was traced with microsatellite markers from the presumed site of domestication to distant regions of the world. Genetic data were derived from over 1100 individuals, representing 17 random-bred populations from five continents and 22 breeds. The Mediterranean was reconfirmed to be the probable site of domestication. Genetic diversity has remained broad throughout the world, with distinct genetic clustering in the Mediterranean basin, Europe/America, Asia and Africa. However, Asian cats appeared to have separated early and expanded in relative isolation. Most breeds were derived from indigenous cats of their purported regions of origin. However, the Persian and Japanese bobtail were more aligned with European/American than with Mediterranean basin or Asian clusters. Three recently derived breeds were not distinct from their parental breeds of origin. Pure breeding was associated with a loss of genetic diversity; however, this loss did not correlate with breed popularity or age.

  13. Waterfowl Breeding Population and Habitat Survey

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The Waterfowl Breeding Population and Habitat Survey was initiated experimentally in 1947 and became operational in 1955. It is conducted cooperatively by the U.S....

  14. Western Ontario: Waterfowl breeding population survey: 1986

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes the Waterfowl Breeding Population and Habitat Survey for western Ontario during 1986. The primary purpose of the survey is to provide...

  15. California Least Tern Breeding Survey 1995 Season

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Sterna antillarum browni) nested at 37 sites along the coast of California. This 7% decrease in breeding population size from 1994 brings to an end the trend since...

  16. Final Performance Report : Snowy Plover Breeding Distribution

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Surveys of breeding populations and nesting habitat of the snowy plover were conducted from January to August, 1989 along the Gulf Coast of Florida and Alabama....

  17. Waterfowl breeding population survey: Southern Saskatchewan: 2000

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes the Waterfowl Breeding Population and Habitat Survey for southern Saskatchewan during 2000. The primary purpose of the survey is to provide...

  18. Waterfowl breeding pair survey: Southern Alberta: 1981

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes the Waterfowl Breeding Population and Habitat Survey for southern Alberta during 1981. The primary purpose of the survey is to provide...

  19. Waterfowl breeding population survey: Southern Manitoba: 1983

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes the Waterfowl Breeding Population and Habitat Survey for southern Manitoba during 1983. The primary purpose of the survey is to provide...

  20. Waterfowl breeding population survey for Montana: 1993

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes the Waterfowl Breeding Population and Habitat Survey for Montana during 1993. The primary purpose of the survey is to provide information on...

  1. Waterfowl breeding population survey for Montana: 1998

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes the Waterfowl Breeding Population and Habitat Survey for Montana during 1998. The primary purpose of the survey is to provide information on...

  2. Waterfowl breeding population survey: Southern Saskatchewan: 1983

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes the Waterfowl Breeding Population and Habitat Survey for southern Saskatchewan during 1983. The primary purpose of the survey is to provide...

  3. Central Quebec: Waterfowl breeding population survey: 2000

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes the Waterfowl Breeding Population and Habitat Survey for Central Quebec during 2000. The primary purpose of the survey is to provide...

  4. Western Ontario: Waterfowl breeding population survey: 1989

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes the Waterfowl Breeding Population and Habitat Survey for western Ontario during 1989. The primary purpose of the survey is to provide...

  5. Western Ontario: Waterfowl breeding population survey: 1995

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes the Waterfowl Breeding Population and Habitat Survey for western Ontario during 1995. The primary purpose of the survey is to provide...

  6. Western Ontario: Waterfowl breeding population survey: 1993

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes the Waterfowl Breeding Population and Habitat Survey for western Ontario during 1993. The primary purpose of the survey is to provide...

  7. Western Ontario: Waterfowl breeding population survey: 1994

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes the Waterfowl Breeding Population and Habitat Survey for western Ontario during 1994. The primary purpose of the survey is to provide...

  8. Western Ontario: Waterfowl breeding population survey: 1996

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes the Waterfowl Breeding Population and Habitat Survey for western Ontario during 1996. The primary purpose of the survey is to provide...

  9. Western Ontario: Waterfowl breeding population survey: 1987

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes the Waterfowl Breeding Population and Habitat Survey for western Ontario during 1987. The primary purpose of the survey is to provide...

  10. Western Ontario: Waterfowl breeding population survey: 1992

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes the Waterfowl Breeding Population and Habitat Survey for western Ontario during 1992. The primary purpose of the survey is to provide...

  11. Western Ontario: Waterfowl breeding population survey: 1990

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes the Waterfowl Breeding Population and Habitat Survey for western Ontario during 1990. The primary purpose of the survey is to provide...

  12. Western Ontario: Waterfowl breeding population survey: 1997

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes the Waterfowl Breeding Population and Habitat Survey for western Ontario during 1997. The primary purpose of the survey is to provide...

  13. Western Ontario: Waterfowl breeding population survey: 1988

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes the Waterfowl Breeding Population and Habitat Survey for western Ontario during 1988. The primary purpose of the survey is to provide...

  14. Prospects for Hybrid Breeding in Bioenergy Grasses

    DEFF Research Database (Denmark)

    Aguirre, Andrea Arias; Studer, Bruno; Frei, Ursula

    2012-01-01

    of different hybrid breeding schemes to optimally exploit heterosis for biomass yield in perennial ryegrass (Lolium perenne L.) and switchgrass (Panicum virgatum), two perennial model grass species for bioenergy production. Starting with a careful evaluation of current population and synthetic breeding methods......, we address crucial topics to implement hybrid breeding, such as the availability and development of heterotic groups, as well as biological mechanisms for hybridization control such as self-incompatibility (SI) and male sterility (MS). Finally, we present potential hybrid breeding schemes based on SI...... and MS for the two bioenergy grass species, and discuss how molecular tools and synteny can be used to transfer relevant information for genes controlling these biological mechanisms across grass species...

  15. Prunus transcription factors: Breeding perspectives

    Directory of Open Access Journals (Sweden)

    Valmor João Bianchi

    2015-06-01

    Full Text Available Many plant processes depend on differential gene expression, which is generally controlled by complex proteins called transcription factors (TFs. In peach, 1,533 TFs have been identified, accounting for about 5.5% of the 27,852 protein-coding genes. These TFs are the reference for the rest of the Prunus species. TF studies in Prunus have been performed on the gene expression analysis of different agronomic traits, including control of the flowering process, fruit quality, and biotic and abiotic stress resistance. These studies, using quantitative RT-PCR, have mainly been performed in peach, and to a lesser extent in other species, including almond, apricot, black cherry, Fuji cherry, Japanese apricot, plum, and sour and sweet cherry. Other tools have also been used in TF studies, including cDNA-AFLP, LC-ESI-MS, RNA and DNA blotting or mapping. More recently, new tools assayed include microarray and high-throughput DNA sequencing (DNA-Seq and RNA sequencing (RNA-Seq. New functional genomics opportunities include genome resequencing and the well-known synteny among Prunus genomes and transcriptomes. These new functional studies should be applied in breeding programs in the development of molecular markers. With the genome sequences available, some strategies that have been used in model systems (such as SNP genotyping assays and genotyping-by-sequencing may be applicable in the functional analysis of Prunus TFs as well. In addition, the knowledge of the gene functions and position in the peach reference genome of the TFs represents an additional advantage. These facts could greatly facilitate the isolation of genes via QTL (quantitative trait loci map-based cloning in the different Prunus species, following the association of these TFs with the identified QTLs using the peach reference genome.

  16. [Pain caused by breeding: definition, judgment, pathogenesis].

    Science.gov (United States)

    Herzog, A

    1997-02-01

    Special terms of the "German Animal Protection Law (section 11b)"and the "European Agreement for Protection of Domestic Animals" particularly "torture-breeding, genetic characteristics, well-being, soundness, pains, injuries and specific use" are commented. Examples of torture-breedings are discussed: Dog (Merle-faktor, brachycephalie, atrichosis), cat (Mans-factor, W-gene, folded-ears), birds (tuffs, ear-drops, tailesness, hypertrophy of bill-warts, abnormal position of tarsal-joints, hypertrophy of imposing behavior).

  17. Gardner Syndrome

    Science.gov (United States)

    ... Home > Types of Cancer > Gardner Syndrome Request Permissions Gardner Syndrome Approved by the Cancer.Net Editorial Board , 06/2014 What is Gardner syndrome? Gardner syndrome is a subtype of familial ...

  18. Repeatability of feather mite prevalence and intensity in passerine birds.

    Directory of Open Access Journals (Sweden)

    Javier Diaz-Real

    Full Text Available Understanding why host species differ so much in symbiont loads and how this depends on ecological host and symbiont traits is a major issue in the ecology of symbiosis. A first step in this inquiry is to know whether observed differences among host species are species-specific traits or more related with host-symbiont environmental conditions. Here we analysed the repeatability (R of the intensity and the prevalence of feather mites to partition within- and among-host species variance components. We compiled the largest dataset so far available: 119 Paleartic passerine bird species, 75,944 individual birds, ca. 1.8 million mites, seven countries, 23 study years. Several analyses and approaches were made to estimate R and adjusted repeatability (R(adj after controlling for potential confounding factors (breeding period, weather, habitat, spatial autocorrelation and researcher identity. The prevalence of feather mites was moderately repeatable (R = 0.26-0.53; R(adj = 0.32-0.57; smaller values were found for intensity (R = 0.19-0.30; R(adj = 0.18-0.30. These moderate repeatabilities show that prevalence and intensity of feather mites differ among species, but also that the high variation within species leads to considerable overlap among bird species. Differences in the prevalence and intensity of feather mites within bird species were small among habitats, suggesting that local factors are playing a secondary role. However, effects of local climatic conditions were partially observed for intensity.

  19. Testicular Histomorphometric Evaluation of Zebu Bull Breeds

    Directory of Open Access Journals (Sweden)

    Paulo Antônio Terrabuio Andreussi

    2014-12-01

    Full Text Available The objective of this study was to evaluate the quantitative histology and testicular biometrics in zebu bulls of different breeds. Testicular fragments of Nelore (n=10, Polled Nelore (n=6, Gir (n=5, Guzerat (n=5 and Tabapuã bulls (n=5 were used. The fragments were perfusion-fixed in Karnovsky solution, embedded in glycol methacrylate and stained with toluidine blue-1% sodium borate. The Nelore animals had a higher tubular volumetric proportion (85.2% and greater height of the seminiferous epithelium (73.2 µm than the Gir, Guzerat and Tabapuã breeds. The Nelore animals also had a higher volumetric proportion of Leydig cells (5.2% than the Guzerat and Tabapuã breeds. There was no significant difference for any of these parameters between the Nelore and Polled Nelore breeds. The gonadosomatic index, seminiferous tubule diameter, cross-sectional area of the seminiferous tubule and tubule length (total length and length per gram of testicular parenchyma did not vary among the breeds studied. The morphometric parameters evaluated suggested that the genetic selection applied to the Nelore and Polled Nelore breeds improved the efficiency of spermatogenesis in these breeders.

  20. Citrus breeding, genetics and genomics in Japan

    Science.gov (United States)

    Omura, Mitsuo; Shimada, Takehiko

    2016-01-01

    Citrus is one of the most cultivated fruits in the world, and satsuma mandarin (Citrus unshiu Marc.) is a major cultivated citrus in Japan. Many excellent cultivars derived from satsuma mandarin have been released through the improvement of mandarins using a conventional breeding method. The citrus breeding program is a lengthy process owing to the long juvenility, and it is predicted that marker-assisted selection (MAS) will overcome the obstacle and improve the efficiency of conventional breeding methods. To promote citrus molecular breeding in Japan, a genetic mapping was initiated in 1987, and the experimental tools and resources necessary for citrus functional genomics have been developed in relation to the physiological analysis of satsuma mandarin. In this paper, we review the progress of citrus breeding and genome researches in Japan and report the studies on genetic mapping, expression sequence tag cataloguing, and molecular characterization of breeding characteristics, mainly in terms of the metabolism of bio-functional substances as well as factors relating to, for example, fruit quality, disease resistance, polyembryony, and flowering. PMID:27069387

  1. Citrus breeding, genetics and genomics in Japan.

    Science.gov (United States)

    Omura, Mitsuo; Shimada, Takehiko

    2016-01-01

    Citrus is one of the most cultivated fruits in the world, and satsuma mandarin (Citrus unshiu Marc.) is a major cultivated citrus in Japan. Many excellent cultivars derived from satsuma mandarin have been released through the improvement of mandarins using a conventional breeding method. The citrus breeding program is a lengthy process owing to the long juvenility, and it is predicted that marker-assisted selection (MAS) will overcome the obstacle and improve the efficiency of conventional breeding methods. To promote citrus molecular breeding in Japan, a genetic mapping was initiated in 1987, and the experimental tools and resources necessary for citrus functional genomics have been developed in relation to the physiological analysis of satsuma mandarin. In this paper, we review the progress of citrus breeding and genome researches in Japan and report the studies on genetic mapping, expression sequence tag cataloguing, and molecular characterization of breeding characteristics, mainly in terms of the metabolism of bio-functional substances as well as factors relating to, for example, fruit quality, disease resistance, polyembryony, and flowering.

  2. Neutronic Comparison of Tritium-Breeding Performance of Candidate Tritium-Breeding Materials

    Institute of Scientific and Technical Information of China (English)

    郑善良; 吴宜灿

    2003-01-01

    Tritium self-sustainment, which will meet the fuel requirement of fusion reactor, isone of the key issues of fusion power development. The tritium breeding performances of varioustritium-breeding materials are compared based on a series of neutronics calculations using three-dimensional Monte Carlo neutron-photon transport code MCNP/4C with the IAEA FENDL-2data library. The effects of the dimensions of the tritium-breeding zone and the enrichment of 6Lion Tritium Breeding Ratio (TBR) are analyzed. The effects of Be as a neutron multiplier on TBRare also calculated.

  3. Clock gene variation is associated with breeding phenology and maybe under directional selection in the migratory barn swallow.

    Directory of Open Access Journals (Sweden)

    Manuela Caprioli

    Full Text Available BACKGROUND: In diverse taxa, photoperiodic responses that cause seasonal physiological and behavioural shifts are controlled by genes, including the vertebrate Clock orthologues, that encode for circadian oscillator mechanisms. While the genetic network behind circadian rhythms is well described, relatively few reports exist of the phenological consequences of and selection on Clock genes in the wild. Here, we investigated variation in breeding phenology in relation to Clock genetic diversity in a long-distance migratory bird, the barn swallow (Hirundo rustica. METHODOLOGY/PRINCIPAL FINDINGS: In a sample of 922 adult barn swallows from a single population breeding in Italy we found one very common (Q(7 and three rare (Q(5, Q(6, Q(8 length variants of a functionally significant polyglutamine repeat. Rare (2.9% Q(7/Q(8 heterozygous females, but not males, bred significantly later than common (91.5% Q(7/Q(7 females, consistent with the expectation that 'long' alleles cause late breeding, as observed in a resident population of another bird species. Because breeding date depends on arrival date from migration, present results suggest that the association between breeding date and Clock might be mediated by migration phenology. In addition, fecundity selection appears to be operating against Q(7/Q(8 because late migrating/breeding swallows have fewer clutches per season, and late breeding has additional negative selection effects via reduced offspring longevity. Genotype frequencies varied marginally non-significantly with age, as Q(7/Q(8 frequency showed a 4-fold reduction in old individuals. This result suggests negative viability selection against Q(7/Q(8, possibly mediated by costs of late breeding. CONCLUSIONS/SIGNIFICANCE: This is the first study of migratory birds showing an association between breeding phenology and Clock genotype and suggesting that negative selection occurs on a phenologically deviant genotype. Low polymorphism at Clock may

  4. The fragile X syndrome.

    Science.gov (United States)

    de Vries, B B; Halley, D J; Oostra, B A; Niermeijer, M F

    1998-01-01

    The fragile X syndrome is characterised by mental retardation, behavioural features, and physical features, such as a long face with large protruding ears and macro-orchidism. In 1991, after identification of the fragile X mental retardation (FMR1) gene, the cytogenetic marker (a fragile site at Xq27.3) became replaced by molecular diagnosis. The fragile X syndrome was one of the first examples of a "novel" class of disorders caused by a trinucleotide repeat expansion. In the normal population, the CGG repeat varies from six to 54 units. Affected subjects have expanded CGG repeats (>200) in the first exon of the FMR1 gene (the full mutation). Phenotypically normal carriers of the fragile X syndrome have a repeat in the 43 to 200 range (the premutation). The cloning of the FMR1 gene led to the characterisation of its protein product FMRP, encouraged further clinical studies, and opened up the possibility of more accurate family studies and fragile X screening programmes. Images PMID:9678703

  5. Genetic parameters for ewe productivity traits in the Columbia, Suffolk and Targhee breeds.

    Science.gov (United States)

    Abdulkhaliq, A M; Harvey, W R; Parker, C F

    1989-12-01

    Estimates of repeatability and heritability were obtained for the following productivity traits of ewes: litter weight at birth (LWB) and weaning (LWW), litter size at birth (LSB), litter size alive at birth (NBA), litter size at weaning (LSW), neonatal survival rate (SRB) and preweaning survival rate (SRW). Phenotypic and genetic correlations were estimated for litter traits. The data set contained 6,394 ewe breeding records from three state stations over 10 yr on 1,731 ewes that were the progeny of 488 sires among three breeds (Columbia, Suffolk and Targhee). Pooled intra-station estimates of repeatability ranged from .11 to .22 for LWB and LWW among the three breeds. For litter size at birth, number born alive and litter size at weaning these estimates varied from .09 to .17 and for the survival traits (SRB and SRW) the variation was from .11 to .20. Intra-station estimates of heritability for the three breeds varied from .12 to .28 for LWB and LWW, and for LSB, NBA and LSW estimates varied from .05 to .35. Heritability estimates for survival traits (SRB and SRW) were low, ranging from .00 to .14. Phenotypic correlations among LWB, LWW, NBA and LSW ranged from .35 to .92 among the breed-station subclasses, with higher correlations occurring where a part-whole relationship existed. The study suggests that selection of ewes with high litter size at birth or at weaning and(or) litter weight at birth or at weaning will genetically improve total litter weight at weaning per ewe lambing.

  6. 50 CFR 15.24 - Permits for cooperative breeding.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false Permits for cooperative breeding. 15.24... PLANTS WILD BIRD CONSERVATION ACT Permits and Approval of Cooperative Breeding Programs § 15.24 Permits for cooperative breeding. (a) Application requirements for permits for cooperative breeding....

  7. Causes and consequences of repeatability, flexibility and individual fine-tuning of migratory timing in pike.

    Science.gov (United States)

    Tibblin, Petter; Forsman, Anders; Borger, Tobias; Larsson, Per

    2016-01-01

    Many organisms undertake migrations between foraging and breeding habitats and while it is assumed that reproductive timing affects fitness, little is known about the degree of individual consistency, and about the causes and consequences of individual variation in migratory timing in organisms other than birds. Here, we report on a 6-year mark-recapture study, including 2048 individuals, of breeding migration in anadromous pike (Esox lucius), an iteroparous top-predatory fish that displays homing behaviour. By repeated sampling across years at a breeding site, we first quantify individual variation both within and between breeding events and then investigate phenotypic correlates and fitness consequences of arrival timing to the breeding site. Our data demonstrate that males arrive before females, that large males arrive later than small males, that the timing of breeding migration varies among years and that individuals are consistent in their timing across years relative to other individuals in the population. Furthermore, data on return rates indicate that arrival time is under stabilizing viability selection, and that individuals who are more flexible in their timing of arrival during the first reproductive years survive longer compared with less flexible individuals. Finally, longitudinal data demonstrate that individuals consistently fine-tune their arrival timing across years, showing that the timing of arrival to breeding sites is influenced by experience. These findings represent rare evidence of how between- and within-individual variations in migratory timing across breeding events are correlated with phenotypic and fitness traits in an ecologically important keystone species. Our results emphasize the importance of considering variation in migratory timing both between and within individuals in studies investigating the fitness consequences of migratory behaviour and have implications for future management.

  8. Autism Spectrum Disorder and Fragile X Syndrome

    Science.gov (United States)

    ... Just Figuring Out CGG Repeats! Donate Print PDF Autism Spectrum Disorder and Fragile X Syndrome Fragile X ... known single gene cause of ASD What Is Autism Spectrum Disorder? Read my Story Autism spectrum disorder ( ...

  9. Analysis of repeated measures data

    CERN Document Server

    Islam, M Ataharul

    2017-01-01

    This book presents a broad range of statistical techniques to address emerging needs in the field of repeated measures. It also provides a comprehensive overview of extensions of generalized linear models for the bivariate exponential family of distributions, which represent a new development in analysing repeated measures data. The demand for statistical models for correlated outcomes has grown rapidly recently, mainly due to presence of two types of underlying associations: associations between outcomes, and associations between explanatory variables and outcomes. The book systematically addresses key problems arising in the modelling of repeated measures data, bearing in mind those factors that play a major role in estimating the underlying relationships between covariates and outcome variables for correlated outcome data. In addition, it presents new approaches to addressing current challenges in the field of repeated measures and models based on conditional and joint probabilities. Markov models of first...

  10. Strategy and Opportunity for The Development of Duck Breeding Farm

    Directory of Open Access Journals (Sweden)

    L Hardy Prasetyo

    2006-09-01

    Full Text Available The recent development of duck farming requires the availability of good quality breeding stocks commercially in order to improve productivity and efficiency . Presently, there is no commercial duck breeding farm which can produce good quality breeding stocks . This article presents information on alternatives in developing duck breeding farm, particularly for layer ducks . There are two alternative approaches in duck breeding farms : (1 Group breeding farm, which belongs to duck farmers' group, as part of a group production system, and (2 Commercial breeding farm, by an individual private company/Semi-Government Institution in a commercial scale and particularly for export market . A good breeding farm requires appropriate systems for selection and mating of the animals in order to guarantee the quality of the breeding stocks being produced . A breeding farm must be economically and technically feasible as an economic entity, so that economic analysis and marketing must be prepared seriously.

  11. Primary Antiphospholipid Antibody Syndrome: A Case Report.

    Science.gov (United States)

    Kadeli, Deepak K; Hanjagi, Siddaraya Y

    2015-10-01

    Primary Antiphospholipid antibody syndrome is a rare disease associated with thromboembolic events which may affect either the arterial or the venous vasculature. It presents with an increased risk of thrombosis in pregnant woman leading to repeated fetal losses. We present here a case of primary antiphospholipid antibody syndrome in young women who had previous event of gangrene of toes leading to their amputation and repeated fetal losses.

  12. Motives and values in farming local cattle breeds in Europe: a survey on 15 breeds

    NARCIS (Netherlands)

    Gandini, G.; Avon, L.; Bohte-Wilhelmus, D.I.; Bay, E.; Colinet, F.G.; Choroszy, Z.; Diaz, C.; Duclos, D.; Fernandez, J.; Gengler, N.; Hoving-Bolink, A.H.; Kearney, F.; Lilja, T.; Mäki-Tanila, A.; Martin-Collado, D.; Maurice - Van Eijndhoven, M.H.T.; Musella, M.; Pizzi, F.; Soini, K.; Toro, M.; Turri, F.; Viinalas, H.; Hiemstra, S.J.

    2010-01-01

    Within the EURECA project (Towards self-sustainable EUropean REgional CAttle breeds), we interviewed a total of 371 farmers of 15 local cattle breeds in eight European countries. Besides collecting data on farmers, land use, herd composition and economic role of cattle, we aimed at understanding far

  13. Breeding barnacle geese in Kolokolkova Bay, Russia : number of breeding pairs, reproductive success and morphology

    NARCIS (Netherlands)

    van der Jeugd, HP; Gurtovaya, E; Eichhorn, G; Litvin, KY; Mineev, OY; van Eerden, M

    2003-01-01

    We report the results of an expedition to a barnacle-goose (Branta leucopsis) breeding area in Kolokolkova Bay, west of the lower Pechora delta in northern Russia, undertaken in July 2002. In total, 6 breeding colonies were found within the study area, harbouring 1,324 nests. Mean clutch size was 2.

  14. Breeding programmes for smallholder sheep farming systems: II. Optimization of cooperative village breeding schemes.

    Science.gov (United States)

    Gizaw, S; van Arendonk, J A M; Valle-Zárate, A; Haile, A; Rischkowsky, B; Dessie, T; Mwai, A O

    2014-10-01

    A simulation study was conducted to optimize a cooperative village-based sheep breeding scheme for Menz sheep of Ethiopia. Genetic gains and profits were estimated under nine levels of farmers' participation and three scenarios of controlled breeding achieved in the breeding programme, as well as under three cooperative flock sizes, ewe to ram mating ratios and durations of ram use for breeding. Under fully controlled breeding, that is, when there is no gene flow between participating (P) and non-participating (NP) flocks, profits ranged from Birr 36.9 at 90% of participation to Birr 21.3 at 10% of participation. However, genetic progress was not affected adversely. When there was gene flow from the NP to P flocks, profits declined from Birr 28.6 to Birr -3.7 as participation declined from 90 to 10%. Under the two-way gene flow model (i.e. when P and NP flocks are herded mixed in communal grazing areas), NP flocks benefited from the genetic gain achieved in the P flocks, but the benefits declined sharply when participation declined beyond 60%. Our results indicate that a cooperative breeding group can be established with as low as 600 breeding ewes mated at a ratio of 45 ewes to one ram, and the rams being used for breeding for a period of two years. This study showed that farmer cooperation is crucial to effect genetic improvement under smallholder low-input sheep farming systems.

  15. Production system and participatory identification of breeding objective traits for indigenous goat breeds of Uganda

    NARCIS (Netherlands)

    Onzima, R.B.; Gizaw, S.; Kugonza, D.R.; Arendonk, van J.A.M.; Kanis, E.

    2017-01-01

    The success of breeding programs in improving indigenous livestock breeds in Uganda has hitherto been limited due to lack of involvement of the key stakeholders. Thus, participatory approaches are being promoted for designing community based improvement programs. The aim of this study was to

  16. Participatory definition of breeding objectives and selection indexes for sheep breeding in traditional systems

    NARCIS (Netherlands)

    Gizaw, S.; Lemma, S.; Komen, J.; Arendonk, van J.A.M.

    2010-01-01

    A farmer participatory approach was used to define breeding objectives and selection indexes for short-fat-tailed sheep in sheep–barley systems and Black Head Somali sheep in pastoral systems in Ethiopia. Breeding-objective traits were identified based on producers' preferences for traits collected

  17. The sub-annual breeding cycle of a tropical seabird.

    Science.gov (United States)

    Reynolds, S James; Martin, Graham R; Dawson, Alistair; Wearn, Colin P; Hughes, B John

    2014-01-01

    Breeding periodicity allows organisms to synchronise breeding attempts with the most favourable ecological conditions under which to raise offspring. For most animal species, ecological conditions vary seasonally and usually impose an annual breeding schedule on their populations; sub-annual breeding schedules will be rare. We use a 16-year dataset of breeding attempts by a tropical seabird, the sooty tern (Onychoprion fuscatus), on Ascension Island to provide new insights about this classical example of a population of sub-annually breeding birds that was first documented in studies 60 years previously on the same island. We confirm that the breeding interval of this population has remained consistently sub-annual. By ringing >17,000 birds and re-capturing a large sample of them at equivalent breeding stages in subsequent seasons, we reveal for the first time that many individual birds also consistently breed sub-annually (i.e. that sub-annual breeding is an individual as well as a population breeding strategy). Ascension Island sooty terns appear to reduce their courtship phase markedly compared with conspecifics breeding elsewhere. Our results provide rare insights into the ecological and physiological drivers of breeding periodicity, indicating that reduction of the annual cycle to just two life-history stages, breeding and moult, is a viable life-history strategy and that moult may determine the minimum time between breeding attempts.

  18. EFFECT OF BREED, SEX AND SOURCE WITHIN BREED ON THE HEAMATOGICAL PARAMETERS OF THE NIGERIAN GOATS

    Directory of Open Access Journals (Sweden)

    J.C. OKONKWO

    2011-01-01

    Full Text Available Effect of breed, sex and source within breed, together with their interactions on the haematological parameters of Nigerian goats were studied using 81 goats (comprising 9 males and 18 females per breed, objective being to characterize and outline the differences and similarities between the breeds in blood parameters. The goats were derived from different geo-ecological zones in the country based on the areas of preponderance of each breed. The breeds studied were: the Sahel goat (SG, Red Sokoto goat (RSG, and West African Dwarf goat (WADG and hematological values obtained per breed were: 22.52±1.48, 23.04±3.56, and 29.22±4.76 (%PCV; 7.52±0.50, 7.82±1.25 and 9.48±1.60 (g/dl Hb; 2.71±0.23, 3.09±0.64, and 4.10±0.42 (x1012/l RBC; 11.94±1.10, 11.32±2.03 and 9.23±0.63 (x109cells/l WBC, and 83.22±1.67, 76.72±2.30 and 73.34±3.40 (x106/mm3 MCV, respectively. Significant differences (P0.05 for all the breeds. The WADGs were superior to the RSGs and SGs in PCV, Hb, and RBC counts, but lower in WBC counts and MCV. The SGs were similar in most of the haematological profiles examined, irrespective of geo-ecological distance, indicating homogeneity of the breed. The sahelian goat breed also outscored other breeds in MCV, showing that the breed has greater propensity to transport oxygen and in situation occasioning oxygen starvation, the breed survives better. This explains the reason for the survival of the breed in arid and semi-arid zone. Gender has no effect on the MCV and the values of 83.22±1.67x106/mm3, 76.72±2.30x106/mm3 and 73.34±3.40x106/mm3 were observed for the SG, RSG, and WADG, respectively.

  19. Estimation of occupancy, breeding success, and predicted abundance of golden eagles (Aquila chrysaetos) in the Diablo Range, California, 2014

    Science.gov (United States)

    Wiens, J. David; Kolar, Patrick S.; Fuller, Mark R.; Hunt, W. Grainger; Hunt, Teresa

    2015-01-01

    We used a multistate occupancy sampling design to estimate occupancy, breeding success, and abundance of territorial pairs of golden eagles (Aquila chrysaetos) in the Diablo Range, California, in 2014. This method uses the spatial pattern of detections and non-detections over repeated visits to survey sites to estimate probabilities of occupancy and successful reproduction while accounting for imperfect detection of golden eagles and their young during surveys. The estimated probability of detecting territorial pairs of golden eagles and their young was less than 1 and varied with time of the breeding season, as did the probability of correctly classifying a pair’s breeding status. Imperfect detection and breeding classification led to a sizeable difference between the uncorrected, naïve estimate of the proportion of occupied sites where successful reproduction was observed (0.20) and the model-based estimate (0.30). The analysis further indicated a relatively high overall probability of landscape occupancy by pairs of golden eagles (0.67, standard error = 0.06), but that areas with the greatest occupancy and reproductive potential were patchily distributed. We documented a total of 138 territorial pairs of golden eagles during surveys completed in the 2014 breeding season, which represented about one-half of the 280 pairs we estimated to occur in the broader 5,169-square kilometer region sampled. The study results emphasize the importance of accounting for imperfect detection and spatial heterogeneity in studies of site occupancy, breeding success, and abundance of golden eagles.

  20. Corneal sensitivity in five horse breeds

    Directory of Open Access Journals (Sweden)

    Eunice Santos de Andrade

    Full Text Available ABSTRACT: This study aimed to determine and compare corneal sensitivity values in different regions of the cornea in five horse breeds. One hundred and forty five healthy horses, adults of both sexes, of the following breeds - Arabian horse (AH; n=20, Mangalarga Marchador (MM; n=50, Pure Blood Lusitano (PBL; n=35, Quarter Horse (QH; n=20, Brazilian Sport Horse (BSH; n=20-were investigated. Corneal touch threshold (CTT was measured with a Cochet-Bonnet esthesiometer in five different corneal regions. Measurements of the median central CTT were: 4.50±0.50cm (AH, 3.50±0.56cm (MM, 3.00±0.25cm (PBL, 2.50±0.44cm (QH and 2.50±0.00cm (BSH. The central region was the most sensitive and the dorsal region the least sensitive corneal region for all breeds. CTT values differed for corneal regions and horse breeds. The CTT values were different among the corneal regions and the horse breeds. Arabian horses presented higher sensitivity values being the most sensitive in all of the corneal regions.

  1. Resistance Genes in Global Crop Breeding Networks.

    Science.gov (United States)

    Garrett, K A; Andersen, K F; Asche, F; Bowden, R L; Forbes, G A; Kulakow, P A; Zhou, B

    2017-08-31

    Resistance genes are a major tool for managing crop diseases. The networks of crop breeders who exchange resistance genes and deploy them in varieties help to determine the global landscape of resistance and epidemics, an important system for maintaining food security. These networks function as a complex adaptive system, with associated strengths and vulnerabilities, and implications for policies to support resistance gene deployment strategies. Extensions of epidemic network analysis can be used to evaluate the multilayer agricultural networks that support and influence crop breeding networks. Here, we evaluate the general structure of crop breeding networks for cassava, potato, rice, and wheat. All four are clustered due to phytosanitary and intellectual property regulations, and linked through CGIAR hubs. Cassava networks primarily include public breeding groups, whereas others are more mixed. These systems must adapt to global change in climate and land use, the emergence of new diseases, and disruptive breeding technologies. Research priorities to support policy include how best to maintain both diversity and redundancy in the roles played by individual crop breeding groups (public versus private and global versus local), and how best to manage connectivity to optimize resistance gene deployment while avoiding risks to the useful life of resistance genes. [Formula: see text] Copyright © 2017 The Author(s). This is an open access article distributed under the CC BY 4.0 International license .

  2. [Historic treasures of Swiss horse breeding].

    Science.gov (United States)

    Meier, H

    2017-01-01

    Both a mandate of the Bernese Government (1705) and statements in the Georgica Helvetica of 1706 prove that Swiss horse breeding was lucrative and of good quality at that time. However, the political turmoil at the transition from the 18th to 19th century and excessive sales to France and Italy led to a severe drop in quantity as well in quality. The exhibition of horses in Aarau in 1865 showed a wretched state of the material. In the same year, Rudolf Zangger wrote a guide for the discussion of horse breeding in Switzerland. In the following year (1866), Johann Jakob Rychner published a report on horse breeding, and a further treatise on Swiss horse breeding by Johann Heinrich Hirzel followed in 1883. These publications created good and comprehensive fundamentals, which can still be considered valid. However history shows that the results and recommendations of these analyses barely led to improvements. Todays genomics with their possibilities open up a new era of animal breeding and raise bigger demands than ever.

  3. Growth curves for Laron syndrome.

    OpenAIRE

    Laron, Z; Lilos, P; Klinger, B.

    1993-01-01

    Growth curves for children with Laron syndrome were constructed on the basis of repeated measurements made throughout infancy, childhood, and puberty in 24 (10 boys, 14 girls) of the 41 patients with this syndrome investigated in our clinic. Growth retardation was already noted at birth, the birth length ranging from 42 to 46 cm in the 12/20 available measurements. The postnatal growth curves deviated sharply from the normal from infancy on. Both sexes showed no clear pubertal spurt. Girls co...

  4. A comparative study of clinical manifestations, haematological and serological responses after experimental infection with Anaplasma phagocytophilum in two Norwegian sheep breeds

    Directory of Open Access Journals (Sweden)

    Sandstedt Karin

    2011-02-01

    Full Text Available Abstract Background It has been questioned if the old native Norwegian sheep breed, Old Norse Sheep (also called Norwegian Feral Sheep, normally distributed on coastal areas where ticks are abundant, is more protected against tick-borne infections than other Norwegian breeds due to a continuously high selection pressure on pasture. The aim of the present study was to test this hypothesis in an experimental infection study. Methods Five-months-old lambs of two Norwegian sheep breeds, Norwegian White (NW sheep and Old Norse (ON sheep, were experimentally infected with a 16S rRNA genetic variant of Anaplasma phagocytophilum (similar to GenBank accession number M73220. The experiment was repeated for two subsequent years, 2008 and 2009, with the use of 16 lambs of each breed annually. Ten lambs of each breed were inoculated intravenously each year with 0.4 ml A. phagocytophilum-infected blood containing approximately 0.5 × 106 infected neutrophils/ml. Six lambs of each breed were used as uninfected controls. Half of the primary inoculated lambs in each breed were re-challenged with the same infectious dose at nine (2008 and twelve (2009 weeks after the first challenge. The clinical, haematological and serological responses to A. phagocytophilum infection were compared in the two sheep breeds. Results The present study indicates a difference in fever response and infection rate between breeds of Norwegian sheep after experimental infection with A. phagocytophilum. Conclusion Although clinical response seems to be less in ON-lambs compared to NW-lambs, further studies including more animals are needed to evaluate if the ON-breed is more protected against tick-borne infections than other Norwegian breeds.

  5. Developments in breeding cereals for organic agriculture

    DEFF Research Database (Denmark)

    Wolfe, M.S.; Baresel, J.P.; Desclaux, D.

    2008-01-01

    into the crop can be helped by diversification within the crop, allowing complementation and compensation among plants. Although the problems of breeding cereals for organic farming systems are large, there is encouraging progress. This lies in applications of ecology to organic crop production, innovations......The need for increased sustainability of performance in cereal varieties, particularly in organic agriculture (OA), is limited by the lack of varieties adapted to organic conditions. Here, the needs for breeding are reviewed in the context of three major marketing types, global, regional, local......, in European OA. Currently, the effort is determined, partly, by the outcomes from trials that compare varieties under OA and CA (conventional agriculture) conditions. The differences are sufficiently large and important to warrant an increase in appropriate breeding. The wide range of environments within OA...

  6. Selective breeding for scrapie resistance in sheep

    Directory of Open Access Journals (Sweden)

    Cristina Santos Sotomaior

    2012-11-01

    Full Text Available It is well known that the susceptibility of sheep to scrapie is determined by the host’s prion protein gene (PRNP. PRNP polymorphisms at codons 136 (alanine, A/valine, V, 154 (histidine, H/arginine, R and 171 (glutamine, Q/histidine, H/arginine, R are the main determinants of sheep susceptibility/resistance to classical scrapie. There are four major variants of the wild-type ARQ allele: VRQ, AHQ, ARH and ARR. Breeding programs have been developed in the European Union and the USA to increase the frequency of the resistant ARR allele while decreasing the frequency of the susceptible VRQ allele in sheep populations. In Brazil, little PRNP genotyping data are available for sheep, and thus far, no controlled breeding scheme for scrapie has been implemented. This review will focus on important epidemiological aspects of scrapie and the use of genetic resistance as a tool in breeding programs to control the disease.

  7. A role of the sires and dams in the hermaphrodite phenomenon linked with polled Damascus goat breed

    Directory of Open Access Journals (Sweden)

    M. Roukbi

    2013-12-01

    Full Text Available The selection for polled character as preferential in Damascus breed leads to spread homozygous individuals for the polled gene and polled intersexes and consequently further economic losses in this breed. It’s very important to study the genetic origin, the role of sirs and dams in the development of intersexuality linked with hornlessness, and evaluate some other effects in the excess of the intersexes in caprine herd. To perform this work data of 52 intersexes issues from mating 19 polled bucks with 12 horned and 37 polled goats in Humeimeh research station, belonging to General commission for agricultural scientific research, were collected and analyzed by mean of Chi-Square (SAS, 1998. The results showed the statistical effect of sires (P≤0.007 and the unstististical effect (P≥0.05 of dames on the development of polled intersexes in Damascus goat breed. The number of kids intersexes were repeated 10, 5, 4, 3, 2 and 1 for 1, 2, 2 and 1, five and eight sire number respectively. Whereas the number of kids intersexes were repeated only 2 and 1 for 3 and 46 goat number respectively. The sex of the kids, kidding type and horned goat character have all highly significant effect (P≤0.001 and this because intersex cases issues of single births and twin birth: twin to male, twin to female, and triple births: twin to male and female, and twin to tow males respectively were repeated 17, 18, 14, 2 and 1 respectively. Also, single births, twin births and triple births were repeated 17, 32 and 3 respectively. Cases of intersexuality issues from horned and polled goats were repeated 14 and 38 respectively. It was concluded the important role of hornlessness genetic and multiple births in the development of polled intersexes in Damascus goat breed.

  8. Genetic Diversity of European and Chinese Oilseed Brassica rapa Cultivars from Different Breeding Periods

    Institute of Scientific and Technical Information of China (English)

    ZHAO Yong-guo; Ofori Atta1; LU Chang-ming

    2009-01-01

    The Brassica oilseed crops went through two major breeding bottlenecks during the introgression of genes for zero erucic acid and low glucosinolate content, respectively, which may lead to reduced genetic biodiversity of the crop. This study investigates the impact of these bottlenecks on the genetic diversity within and across European and Chinese winter B. Rapa cultivars. We compared eight cultivars from Europe and China, representing three different seed qualities from three different breeding periods: (1) high erucic acid, high glucosinolates (++); (2) zero erucic acid, high glucosinolates (0+); (3) zero erueic acid, low glueosonolates (00, canola quality). Diversity was estimated on 32 plants per cultivar, with 16 simple sequence repeat (SSR) markers covering each of the B. Rapa linkage groups. The analysis of molecular variance (AMOVA) showed that genetic variations within cultivars, across cultivars and across regions (Europe and China) were significant, with about 60% of the total variation within cultivars. There was a slight, but non-significant loss in genetic diversity within cultivars when comparing the three breeding periods as indicated by effective number of alleles (2.39,2.23, and 1.99 for breeding periods 1, 2, and 3, respectively), Shannon information index (0.93, 0.90, 0.75), and expected heterozygosity (0.51, 0.49, 0.42). By cluster analysis (UPGMA dendrogram) and principal coordinate analysis, Chinese and European cultivars were clearly divided into two distinct groups. In conclusion, quality improvement did not significantly reduce the genetic diversity of European and Chinese B. Rapa cultivars.

  9. Situation and context impacts the expression of personality: the influence of breeding season and test context.

    Science.gov (United States)

    Haage, Marianne; Bergvall, Ulrika A; Maran, Tiit; Kiik, Kairi; Angerbjörn, Anders

    2013-11-01

    Non-human animal personality is defined as consistent behavioural differences across time and situations/contexts. Behaviours are, however, often plastic and to explain how plasticity and personality may coexist an adaptive framework has been developed. Still, there is little information on how personality is impacted by situations and contexts on an individual level. We investigated this in the European mink (Mustela lutreola) by performing a set of five experiments in two situations consisting of non-breeding and breeding season, and by using different test contexts. Three personality trait domains were identified; boldness, exploration and sociability. The levels of boldness and exploration changed between seasons but remained repeatable, which implies behavioural reaction norms and supports that the concept of personality remained applicable despite plasticity. Whilst males became bolder and more explorative in the breeding season females became shyer, which reflects European mink breeding behaviour. Furthermore, behaviours performed in mirror stimulus tests fell into different domains depending on whether, the test was conducted in the own territory or not, suggesting plasticity in the response towards conspecifics. To conclude, our results highlight the importance of situation and context for the expression of personality, and the significance of measuring multiple personality trait domains with several methods.

  10. Limitations on quantum key repeaters.

    Science.gov (United States)

    Bäuml, Stefan; Christandl, Matthias; Horodecki, Karol; Winter, Andreas

    2015-04-23

    A major application of quantum communication is the distribution of entangled particles for use in quantum key distribution. Owing to noise in the communication line, quantum key distribution is, in practice, limited to a distance of a few hundred kilometres, and can only be extended to longer distances by use of a quantum repeater, a device that performs entanglement distillation and quantum teleportation. The existence of noisy entangled states that are undistillable but nevertheless useful for quantum key distribution raises the question of the feasibility of a quantum key repeater, which would work beyond the limits of entanglement distillation, hence possibly tolerating higher noise levels than existing protocols. Here we exhibit fundamental limits on such a device in the form of bounds on the rate at which it may extract secure key. As a consequence, we give examples of states suitable for quantum key distribution but unsuitable for the most general quantum key repeater protocol.

  11. Role for Genetic Anticipation in Lynch Syndrome

    DEFF Research Database (Denmark)

    Nilbert, Mef; Timshel, Susanne; Bernstein, Inge

    2009-01-01

    PURPOSE: Anticipation (ie, an earlier age at onset in successive generations) is linked to repeat expansion in neurodegenerative syndromes, whereas its role in hereditary cancer is unclear. We assessed anticipation in Lynch syndrome (hereditary nonpolyposis colorectal cancer [HNPCC]), in which DN...

  12. MARKER ASSISTED SELECTION IN DISEASE RESISTANCE BREEDING

    Directory of Open Access Journals (Sweden)

    Narasimhulu Ragimekula

    2013-08-01

    Full Text Available Feeding ever-increasing population is the main challenge faced by the agricultural scientists and to meet this plant breeders have to put continuous efforts to develop new crop varieties on fast track basis. DNA based polymorphism, commonly known as DNA markers can be used for genetic improvement through selection for favourable traits such as disease resistance. Molecular markers are becoming an essential component in backcross breeding programs for tracking the resistance genes in gene pyramiding. Marker assisted selection (MAS, is expected to increase genetic response by affecting efficiency and accuracy of selection. Even though marker-assisted selection now plays a prominent role in the field of plant breeding, examples of successful, practical outcomes are rare. MAS, with few exceptions, has not yet delivered its expected benefits in commercial breeding. It is clear that DNA markers hold great promise, but realizing that promise remains elusive. The economic and biological constraints such as a low return of investment in small-grain cereal breeding, lack of diagnostic markers, and the prevalence of QTL-background effects hinder the broad implementation of MAS. Until complex traits can be fully dissected, the application of MAS will be limited to genes of moderate-to-large effect and to applications that do not endanger the response to conventional selection. Till then, observable phenotype will remain an important component of genetic improvement programmes, because it takes in to account the collective effect of all genes. In future, chip-based, high-throughput genotyping platforms and the introduction of genomic selection will reduce the current problems of integrating MAS in practical breeding programs and open new avenues for a molecular-based resistance breeding.

  13. Under-forest Breeding Pattern and the Practice Form

    Institute of Scientific and Technical Information of China (English)

    SHEN Zhong-ming

    2012-01-01

    Through the development in recent years, China’s under-forest breeding pattern can be divided into four kinds of practice form of under-forest breeding pattern (the pattern of breeding driven by leading enterprises; the pattern of breeding driven by intermediary economic organizations; the pattern of breeding driven by the professional wholesale market; the pattern of breeding driven by the modern animal husbandry demonstration areas), according to difference in the main body participating in signing the operation contract in breeding pattern. In the production practice of under-forest breeding pattern, the most widely used and successful pattern is the pattern of breeding driven by leading enterprises and its derivative forms.

  14. Hysteresis of magnetostructural transitions: Repeatable and non-repeatable processes

    Energy Technology Data Exchange (ETDEWEB)

    Provenzano, Virgil [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States); Della Torre, Edward; Bennett, Lawrence H. [Department of Electrical and Computer Engineering, The George Washington University, Washington, DC 20052 (United States); ElBidweihy, Hatem, E-mail: Hatem@gwmail.gwu.edu [Department of Electrical and Computer Engineering, The George Washington University, Washington, DC 20052 (United States)

    2014-02-15

    The Gd{sub 5}Ge{sub 2}Si{sub 2} alloy and the off-stoichiometric Ni{sub 50}Mn{sub 35}In{sub 15} Heusler alloy belong to a special class of metallic materials that exhibit first-order magnetostructural transitions near room temperature. The magnetic properties of this class of materials have been extensively studied due to their interesting magnetic behavior and their potential for a number of technological applications such as refrigerants for near-room-temperature magnetic refrigeration. The thermally driven first-order transitions in these materials can be field-induced in the reverse order by applying a strong enough field. The field-induced transitions are typically accompanied by the presence of large magnetic hysteresis, the characteristics of which are a complicated function of temperature, field, and magneto-thermal history. In this study we show that the virgin curve, the major loop, and sequentially measured MH loops are the results of both repeatable and non-repeatable processes, in which the starting magnetostructural state, prior to the cycling of field, plays a major role. Using the Gd{sub 5}Ge{sub 2}Si{sub 2} and Ni{sub 50}Mn{sub 35}In{sub 15} alloys, as model materials, we show that a starting single phase state results in fully repeatable processes and large magnetic hysteresis, whereas a mixed phase starting state results in non-repeatable processes and smaller hysteresis.

  15. Genetic Contributors to Intergenerational CAG Repeat Instability in Huntington’s Disease Knock-In Mice

    Science.gov (United States)

    Neto, João Luís; Lee, Jong-Min; Afridi, Ali; Gillis, Tammy; Guide, Jolene R.; Dempsey, Stephani; Lager, Brenda; Alonso, Isabel; Wheeler, Vanessa C.; Pinto, Ricardo Mouro

    2017-01-01

    Huntington’s disease (HD) is a neurodegenerative disorder caused by the expansion of a CAG trinucleotide repeat in exon 1 of the HTT gene. Longer repeat sizes are associated with increased disease penetrance and earlier ages of onset. Intergenerationally unstable transmissions are common in HD families, partly underlying the genetic anticipation seen in this disorder. HD CAG knock-in mouse models also exhibit a propensity for intergenerational repeat size changes. In this work, we examine intergenerational instability of the CAG repeat in over 20,000 transmissions in the largest HD knock-in mouse model breeding datasets reported to date. We confirmed previous observations that parental sex drives the relative ratio of expansions and contractions. The large datasets further allowed us to distinguish effects of paternal CAG repeat length on the magnitude and frequency of expansions and contractions, as well as the identification of large repeat size jumps in the knock-in models. Distinct degrees of intergenerational instability were observed between knock-in mice of six background strains, indicating the occurrence of trans-acting genetic modifiers. We also found that lines harboring a neomycin resistance cassette upstream of Htt showed reduced expansion frequency, indicative of a contributing role for sequences in cis, with the expanded repeat as modifiers of intergenerational instability. These results provide a basis for further understanding of the mechanisms underlying intergenerational repeat instability. PMID:27913616

  16. Fragile X Syndrome

    OpenAIRE

    Wilmar Saldarriaga; Flora Tassone; Laura Yuriko González-Teshima; Jose Vicente Forero-Forero; Sebastián Ayala-Zapata; Randi Hagerman

    2015-01-01

    Fragile X Syndrome (FXS) is a genetic disease due to a CGG trinucleotide expansion, named full mutation (greater than 200 CGG repeats), in the fragile X mental retardation 1 gene locus Xq27.3; which leads to an hypermethylated region in the gene promoter therefore silencing it and lowering the expression levels of the fragile X mental retardation 1, a protein involved in synaptic plasticity and maturation.  Individuals with FXS present with intellectual disability, autism, hyperactivity, long...

  17. Estimating superpopulation size and annual probability of breeding for pond-breeding salamanders

    Science.gov (United States)

    Kinkead, K.E.; Otis, D.L.

    2007-01-01

    It has long been accepted that amphibians can skip breeding in any given year, and environmental conditions act as a cue for breeding. In this paper, we quantify temporary emigration or nonbreeding probability for mole and spotted salamanders (Ambystoma talpoideum and A. maculatum). We estimated that 70% of mole salamanders may skip breeding during an average rainfall year and 90% may skip during a drought year. Spotted salamanders may be more likely to breed, with only 17% avoiding the breeding pond during an average rainfall year. We illustrate how superpopulations can be estimated using temporary emigration probability estimates. The superpopulation is the total number of salamanders associated with a given breeding pond. Although most salamanders stay within a certain distance of a breeding pond for the majority of their life spans, it is difficult to determine true overall population sizes for a given site if animals are only captured during a brief time frame each year with some animals unavailable for capture at any time during a given year. ?? 2007 by The Herpetologists' League, Inc.

  18. Costs Associated with Equine Breeding in Kentucky

    Science.gov (United States)

    Walker, Cassandra L.

    There were approximately 9 million horses in the United States having a 102 billion impact on the U.S. economy (AHC, 2005). Over 1 million of those horses were involved in the breeding sector. In Kentucky, nearly 18% of the horse population have been involved in breeding. Managing an equine enterprise can be difficult, particularly given that many who undertake such endeavors do not have a background or education in business management. Kentucky Cooperative Extension has produced interactive spreadsheets to help horse owners better understand the costs associated with owning horses or managing certain equine businesses, including boarding and training operations. However, there has been little support for breeders. Therefore, the objectives of this study were to provide owners with a list of services offered for breeding and the costs associated with those services. Survey questions were created from a list of topics pertinent to equine breeding and from that list of questions, an electronic survey was created. The survey was sent via Qualtrics Survey Software to collect information on stallion and mare management costs as well as expenses related to owning and breeding. Question topics included veterinary and housing costs, management and advertising expenses, and membership fees. A total of 78 farms were selected from the 2013 breeder's listings for the Kentucky Quarter Horse Association (n = 39) and the Kentucky Thoroughbred Farm Managers' Club (n = 26), and other breed association contacts (n = 13). These farms were selected from the lists by outside individuals who were not related to the project. Participants were asked to answer all questions relevant to the farm. After the initial survey distribution, follow-up e-mails and phone calls were conducted in order to answer any questions participants might have had about the survey. Survey response rate was 32.1% (25 of 78 surveys returned). Farms in Kentucky had an average of two farm-owned and two outside

  19. Analysis of Plant Breeding on Hadoop and Spark

    Directory of Open Access Journals (Sweden)

    Shuangxi Chen

    2016-01-01

    Full Text Available Analysis of crop breeding technology is one of the important means of computer-assisted breeding techniques which have huge data, high dimensions, and a lot of unstructured data. We propose a crop breeding data analysis platform on Spark. The platform consists of Hadoop distributed file system (HDFS and cluster based on memory iterative components. With this cluster, we achieve crop breeding large data analysis tasks in parallel through API provided by Spark. By experiments and tests of Indica and Japonica rice traits, plant breeding analysis platform can significantly improve the breeding of big data analysis speed, reducing the workload of concurrent programming.

  20. Breed differences in calving interval in the humid Mexican tropic.

    Science.gov (United States)

    Murillo Medina, Aída Lorena; Córdova-Izquierdo, Alejandro; Soriano Robles, Ramón; Mendoza Martínez, Germán David; Castillo-Juárez, Héctor

    2009-10-01

    The objective of this study was to evaluate the influence of breed, breed and sex of the calf, farm, calving number (CN), type of calving, and their interactions on CI using records from four different beef breeds performing in the humid tropical environment of Mexico. The influence of these factors on CN was also evaluated. CI and CN varied with farm, breed of the dam, and with breed of the dam by calf breed interaction (PAngus cows, although with an apparent unexpected negative impact on CN.

  1. Analysis of the performance test results of young pure breed boars from the Bydgoszcz breeding region in Poland

    Directory of Open Access Journals (Sweden)

    Grażyna MICHALSKA

    2016-02-01

    Full Text Available The aim of presented paper was analysis of the performance test results of young pure breed boars coming from The Bydgoszcz Breeding Region (located in Poland in Kujawy-Pomorze Province. The research covered the results concerning 4190 young boars of following breeds: Polish Large White, Polish Landrace, Hampshire, Duroc and Pietrain. Young pure breed boars were performance tested in 2009 and 2010 in The Bydgoszcz Breeding Region according to the actual methodology. Among young pure breed boars performance tested in The Bydgoszcz Breeding Region in tested years animals of Hampshire breed had the higher growth rate. The pigs of Pietrain breed had the highest meat content. Regarding to the most important parameter of performance test, i.e. selection index in analyzed years 2009 and 2010 the best results had young boars of Hampshire then Pietrain, Duroc, PLW and PL.

  2. Microbiological characterization of a newly established pig breed, Aachen Minipigs.

    Science.gov (United States)

    Plotzki, Elena; Heinrichs, Gerd; Kubícková, Barbara; Ulrich, Rainer G; Denner, Joachim

    2016-03-01

    To alleviate the shortage of human donor organs or tissues for the treatment of organ and tissue failure including diabetes, pigs are considered suitable donor animals. As organs from conventional pigs are usually too large, those from minipigs may be better suited. We recently characterized the Göttingen Minipigs, a breed well characterized concerning the presence of zoonotic microorganisms and found hepatitis E virus (HEV) and porcine cytomegalovirus (PCMV) in some animals. Here, we characterize another minipig, the Aachen Minipig (AaMP), a pig breed recently established close to the town Aachen in Germany. The animals were tested for the prevalence and expression of porcine endogenous retroviruses (PERVs) and the presence of some selected microorganisms, among them HEV, PCMV, and porcine lymphotropic herpesviruses (PLHVs) using highly sensitive and specific PCR and RT-PCR methods. In addition, we screened for antibodies against HEV and PLHV. PERV-A, PERV-B, and PERV-C sequences were found in the genome of all Aachen Minipigs. HEV RNA was found by real-time RT-PCR in most, and DNA of PCMV, PLHV-2, and PLHV-3 was found by PCR in some animals. The animals were free of eight other microorganisms tested, but some were seropositive for porcine circovirus 2 (PCV2), porcine reproductive and respiratory syndrome virus (PRRSV), and porcine epidemic diarrhea virus (PEDV). Based on medical examinations by veterinarians, the AaMP are in a good health status and seem to harbor only few microorganisms. To improve their status for use as donor pigs in xenotransplantation, the viruses detected might be eliminated by selection of negative animals, Cesarean section, and vaccination. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. EAMJ Dec. Repeatability.indd

    African Journals Online (AJOL)

    2008-12-12

    Dec 12, 2008 ... Results:Kappa values for four-week repeatability for the wheeze and asthma questions were 0.61 ... for logistic, cultural and ethical reasons, to use ... individual with baseline forced expiratory volume in .... period is likely to also include the effects of true ... data, the writing of the manuscript or the decision.

  4. Selective breeding of mice strains with different sensitivity to isoflurane

    Institute of Scientific and Technical Information of China (English)

    WANG Qian; ZHENG Yi; LU Jing; CHEN Lü; WANG Ju; ZHOU Jian-xin

    2010-01-01

    Background The mechanisms of action of volatile anesthetics are still unknown.Recently, the use of genetics as a means to investigate anesthetic action has increased in scale.However, only limited forward genetic approach studies were performed in mammals, especially with volatile anesthetics as the selection agent.In the present study, a selective breeding process was designed to produce strains of mice with different sensitivity to isoflurane.Methods One hundred and sixty male and female virgin outbred ICR/CD-1 mice at 65-70 days of age were selected as original generation, and the median effective dose (ED50) of inhaled isoflurane were measured by probit analysis with the loss of righting reflex as the endpoint of anesthesia.The most sensitive males and females were selected and mated one another randomly, as with the most resistant males and females.Thus two branches of mice (sensitive and resistant to isoflurane) were created and allowed to produce the next generation.At 65-70 days of age, screening experiment was performed in offspring, by selecting the most sensitive mice in sensitive branch and the most resistant mice in resistant branch.Selected males and females within each branch were mated one another randomly to produce the following generation.The same procedure was performed in the offspring.The process of screening and breeding was repeated for 8 generations, and then strains were conserved by mating the offspring one another randomly within each branch for 3 generations.Each pair of mice was allowed to produce the second litters as a backup, and isoflurane ED50 was measured in mice from the second litters.Results Isoflurane righting reflex ED50s (95% confidence limit (CL)) in original mice were 0.65% (0.58%-0.72%) in females and 0.63% (0.56%-0.69%) in males.After the 4th generation, isoflurane ED50s in resistant branch were significantly higher than those in sensitive branch (P <0.05), for both in females and males.In the 11th generation

  5. TDP-43 suppresses CGG repeat-induced neurotoxicity through interactions with HnRNP A2/B1

    OpenAIRE

    He, Fang; Krans, Amy; Freibaum, Brian D.; Taylor, J. Paul; Todd, Peter K

    2014-01-01

    Nucleotide repeat expansions can elicit neurodegeneration as RNA by sequestering specific RNA-binding proteins, preventing them from performing their normal functions. Conversely, mutations in RNA-binding proteins can trigger neurodegeneration at least partly by altering RNA metabolism. In Fragile X-associated tremor/ataxia syndrome (FXTAS), a CGG repeat expansion in the 5′UTR of the fragile X gene (FMR1) leads to progressive neurodegeneration in patients and CGG repeats in isolation elicit t...

  6. Metabolic Syndrome

    Science.gov (United States)

    ... hypertension, hypertriglyceridemia, insulin resistance syndrome, low HDL cholesterol, Metabolic Syndrome, overweight, syndrome x, type 2 diabetes Family Health, Kids and Teens, Men, Women January 2005 Copyright © American Academy of Family PhysiciansThis ...

  7. Marfan Syndrome

    Science.gov (United States)

    Marfan syndrome is a disorder that affects connective tissue. Connective tissues are proteins that support skin, bones, ... fibrillin. A problem with the fibrillin gene causes Marfan syndrome. Marfan syndrome can be mild to severe, ...

  8. Williams syndrome

    Science.gov (United States)

    Williams-Beuren syndrome ... Williams syndrome is caused by not having a copy of several genes. Parents may not have any family history of the condition. However, people with Williams syndrome have a 50% chance of passing the ...

  9. Fahr's Syndrome

    Science.gov (United States)

    ... Page You are here Home » Disorders » All Disorders Fahr's Syndrome Information Page Fahr's Syndrome Information Page What research is being done? ... and conducts research on neurogenetic disorders such as Fahr's Syndrome. The goals of this research are to ...

  10. Wheat breeding for quality: an historical review

    Science.gov (United States)

    Wheat (Triticum spp. L.) is a leading cereal contributing to the nourishment of humankind. Since its domestication ca. 12 000 years ago, humans have profoundly influenced its evolution. In the more recent past, breeding via cross-hybridization and the selection of progeny with superior end-use quali...

  11. MODELING REGIONAL SYSTEMS OF BREEDING PIGS

    Directory of Open Access Journals (Sweden)

    Svinarev I. Y.

    2015-12-01

    Full Text Available The article contains the experience of the development of the methodology and the computer program for calculation of regional and local systems of pigs hybridization at the example of the Rostov region (Russia. Crossing the GP lines for F1 should be organized in multiplier farm, which may be separate farms and to be part of large commercial farms. For the production of F1 in a multiplier farm, we must breed a purebred specialized paternal and a maternal line, selected on the effect of combining ability. For the successful functioning of the system of hybridization, it is necessary to build a genetic pyramid, including breeding and genetic centers (nucleus farm, multiplier farm, reproducing the baseline. The article gives a detailed calculation of sow population of levels of P, GP, GGP for maternal and paternal breeds of pigs. The program uses user-defined parameters of pigs productivity, of the simulated population, and the parameters characterizing the intensity of selection of young animals. To ensure annual production of 1,822 million pigs in the Rostov region it is necessary to provide the availability of brood stock in the amount of 89 thousand heads, 6 800 heads in the structure of grandparent flocks (GP, 730 heads in the structure of the Grand-Grand-parent stock (GGP, excluding sows second maternal and paternal breeds

  12. Seabird metapopulations: searching for alternative breeding habitats

    NARCIS (Netherlands)

    Schippers, P.; Snep, R.P.H.; Schotman, A.G.M.; Jochem, R.; Stienen, E.W.M.; Slim, P.A.

    2009-01-01

    Today, many seabird species nest in port areas, which are also necessary for human economic activity. In this paper, we evaluate, using a metapopulation model, the possibilities for creating alternative breeding sites for the Common Tern (Sterna hirundo) in the Rhine¿Meuse¿Scheldt estuary. We explor

  13. Plant Breeding by Using Radiation Mutation

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Si Yong; Kim, Dong Sub; Lee, Geung Joo (and others)

    2007-06-15

    A mutation breeding is to use physical or chemical mutagens to induce mutagenesis, followed by individual selections with favorable traits. The mutation breeding has many advantages over other breeding methods, which include the usefulness for improving one or two inferior characteristics, applications to broad species with different reproductive systems or to diverse plant materials, native or plant introduction with narrow genetic background, time and cost-effectiveness, and valuable mutant resources for genomic researches. Recent applications of the radiation breeding techniques to developments of flowering plants or food crops with improved functional constituents heightened the public's interests in agriculture and in our genetic resources and seed industries. The goals of this project, therefore, include achieving advances in domestic seed industries and agricultural productivities by developing and using new radiation mutants with favored traits, protecting an intellectual property right of domestic seeds or germplasm, and sharing the valuable mutants and mutated gene information for the genomic and biotech researches that eventually leads to economic benefits.

  14. Breeding for longevity in Italian Chianina cattle

    NARCIS (Netherlands)

    Forabosco, F.

    2005-01-01

    The objective of this thesis was to evaluate genetic aspects of longevity (LPL) in the Chianina beef cattle population in order to define how to include this trait in selection criteria. The Chianina breed has been raised for over twenty-two centuries inItaly

  15. Computerized management support for swine breeding farms.

    NARCIS (Netherlands)

    Huirne, R.B.M.

    1990-01-01

    1. INTRODUCTIONThe investigations described in this thesis have been directed towards computerized management support for swine breeding farms, focused on sow productivity and profitability. The study is composed of three basic parts: (1) basic description and definition of farm man

  16. Evaluation of charge breeding options for EURISOL

    CERN Document Server

    Delahaye, P; Lamy, T; Marie-Jeanne, M; Kester, O; Wenander, F

    2010-01-01

    A comprehensive study of charge breeding techniques for the most ambitious ISOL-facility project, EURISOL, is presented here. It is based on results obtained during the past years at CERN-ISOLDE and LPSC Grenoble with charge breeders of both ECR and EBIS types.

  17. Applied Genetics and Genomics in Alfalfa Breeding

    Directory of Open Access Journals (Sweden)

    E. Charles Brummer

    2012-03-01

    Full Text Available Alfalfa (Medicago sativa L., a perennial and outcrossing species, is a widely planted forage legume for hay, pasture and silage throughout the world. Currently, alfalfa breeding relies on recurrent phenotypic selection, but alternatives incorporating molecular marker assisted breeding could enhance genetic gain per unit time and per unit cost, and accelerate alfalfa improvement. Many major quantitative trait loci (QTL related to agronomic traits have been identified by family-based QTL mapping, but in relatively large genomic regions. Candidate genes elucidated from model species have helped to identify some potential causal loci in alfalfa mapping and breeding population for specific traits. Recently, high throughput sequencing technologies, coupled with advanced bioinformatics tools, have been used to identify large numbers of single nucleotide polymorphisms (SNP in alfalfa, which are being developed into markers. These markers will facilitate fine mapping of quantitative traits and genome wide association mapping of agronomic traits and further advanced breeding strategies for alfalfa, such as marker-assisted selection and genomic selection. Based on ideas from the literature, we suggest several ways to improve selection in alfalfa including (1 diversity selection and paternity testing, (2 introgression of QTL and (3 genomic selection.

  18. San Diego Zoo:Success in Breeding

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Giant pandas have become very popular in U.S.zoos. One in particular, the San Diego Zoo, has been extremely successful at making the pandas feel at home and getting them to breed. In 1999, it became home tothe first surviving panda cub born in the United States.

  19. Marketing potential of advanced breeding clones

    Science.gov (United States)

    The accumulation of reducing sugars during cold storage of potato tubers is a serious and costly problem for producers and processors. The degree to which cultivars accumulate reducing sugars during storage determines their processing and market potential. Cultivars or advanced breeding lines with...

  20. Breeding and Cytogenetics in the Genus Tulipa

    NARCIS (Netherlands)

    Marasek Ciolakowska, A.R.; Ramanna, M.S.; Arens, P.; Tuyl, van J.M.

    2012-01-01

    Tulip (Tulipa) is one of the most important ornamental bulbous plants, which has been cultivated for cut flower, potted plant, garden plant and for landscaping. Species from the different sections display complementary agronomic characteristics and breeding techniques are used to combine desired fea

  1. Rapid cyling plant breeding in citrus

    Science.gov (United States)

    Resistance or tolerance to huanglongbing (HLB) and other important traits have been identified in several citrus types and relatives and associated markers should be identified soon. What is urgently needed in addition is an accelerated strategy for citrus variety breeding. Identification and use of...

  2. Breeding for feed intake capacity in pigs

    NARCIS (Netherlands)

    Eissen, J.J.

    2000-01-01

    This thesis deals with feed intake capacity of pigs. By selection, breeding organizations try to achieve genetic improvement in production and reproduction efficiency. Future genetic improvement may become constrained by a limited feed intake capacity of growing pigs and lactating sows, respectively

  3. Relevance of test information in horse breeding

    NARCIS (Netherlands)

    Ducro, B.J.

    2011-01-01

      The aims of this study were 1) to determine the role of test results of young horses in selection for sport performance, 2) to assess the genetic diversity of a closed horse breed and 3) the consequences of inbreeding for male reproduction. The study was performed using existing databases

  4. Breeding for trypanotolerance in African cattle

    NARCIS (Netherlands)

    Waaij, van der E.H.

    2001-01-01

    Trypanosomosis, or sleeping sickness, is one of the most important livestock diseases in Africa. Some West African cattle breeds show a degree of resistance to a trypanosome infection: they are trypanotolerant. At the International Livestock Research Institute (ILRI) in Nairobi, Kenya, an F2 experim

  5. Pericardial effusion in a mixed breed dog.

    OpenAIRE

    2001-01-01

    A 7-year-old, spayed female mixed breed dog was evaluated for labored breathing, lethargy, and a distended abdomen. Pericardial effusion was diagnosed after radiographic and echocardiographic interpretation. Treatment consisted of thoracocentesis and a single pericardiocentesis. Follow-up examinations indicate that the dog's condition has remained stable.

  6. Computerized management support for swine breeding farms

    NARCIS (Netherlands)

    Huirne, R.B.M.

    1990-01-01

    1. INTRODUCTION

    The investigations described in this thesis have been directed towards computerized management support for swine breeding farms, focused on sow productivity and profitability. The study is composed of three basic parts: (1) basic description and

  7. Artificial Breeding Techniques of Whitmania pigra

    Institute of Scientific and Technical Information of China (English)

    Zhao; Nan; Xu; Ziliang

    2014-01-01

    The artificial breeding technology for juvenile of Whitmania pigra was introduced in the paper,including selection of sites and water quality,construction of spawning pool,hatching pool and escape proof facilities,key technology of leech selection,feeding,cocoon hatching,juvenile feeding and management.

  8. Relevance of test information in horse breeding

    NARCIS (Netherlands)

    Ducro, B.J.

    2011-01-01

      The aims of this study were 1) to determine the role of test results of young horses in selection for sport performance, 2) to assess the genetic diversity of a closed horse breed and 3) the consequences of inbreeding for male reproduction. The study was performed using existing databases

  9. Development and application of biological technologies in fish genetic breeding.

    Science.gov (United States)

    Xu, Kang; Duan, Wei; Xiao, Jun; Tao, Min; Zhang, Chun; Liu, Yun; Liu, ShaoJun

    2015-02-01

    Fish genetic breeding is a process that remolds heritable traits to obtain neotype and improved varieties. For the purpose of genetic improvement, researchers can select for desirable genetic traits, integrate a suite of traits from different donors, or alter the innate genetic traits of a species. These improved varieties have, in many cases, facilitated the development of the aquaculture industry by lowering costs and increasing both quality and yield. In this review, we present the pertinent literatures and summarize the biological bases and application of selection breeding technologies (containing traditional selective breeding, molecular marker-assisted breeding, genome-wide selective breeding and breeding by controlling single-sex groups), integration breeding technologies (containing cross breeding, nuclear transplantation, germline stem cells and germ cells transplantation, artificial gynogenesis, artificial androgenesis and polyploid breeding) and modification breeding technologies (represented by transgenic breeding) in fish genetic breeding. Additionally, we discuss the progress our laboratory has made in the field of chromosomal ploidy breeding of fish, including distant hybridization, gynogenesis, and androgenesis. Finally, we systematically summarize the research status and known problems associated with each technology.

  10. Breeding productivity of Smith Island black ducks

    Science.gov (United States)

    Haramis, G.M.; Jorde, D.G.; Olsen, G.H.; Stotts, D.B.; Harrison, M.K.; Perry, M.C.

    2002-01-01

    We investigated the breeding performance of American black ducks (Anas rubripes) on Smith Island, Chesapeake Bay, to improve our understanding of island black duck breeding ecology and to make management recommendations to enhance productivity. During 1995-96, we implanted 56 female black ducks with 20-g radio transmitters and tracked 35 of the individuals through the breeding season to locate nests, determine nest fate, and identify brood habitat. We also increased preseason banding efforts and compared capture characteristics over 12 years with those from the Deal Island Wildlife Management Area, a banding site on the mainland of Tangier Sound. A low rate of nesting (37%), lack of renesting, and poor hatching success (31%) indicated that island salt marsh habitats present a harsh environment for breeding black ducks. Black ducks located 11 of 13 nests (85%) in black needlerush (Juncus roemerianus) marsh where they were vulnerable to flooding from extreme tides and to egg predators. No nests were found on forested tree hammocks, a feature that distinguishes Smith Island from nearby South Marsh and Bloodsworth Islands. Nest predators included red foxes (Vulpes vulpes), herring gulls (Larus argentams), fish crows (Corvus ossifragus), and, potentially, Norway rats (Rattus norvegicus). Unlike mainland red foxes, foxes radio tracked on Smith Island were found to be capable swimmers and effective low marsh predators. We found shoreline meadows of widgeon grass (Ruppia maritima) to be important foraging sites for black ducks and suspected that the virtual absence of fresh water in this high salinity environment (1217+ ppt) to incur some cost in terms of growth and survival of ducklings. Preseason bandings revealed a high proportion of banded adults and a strong positive correlation in age ratios with the Deal Island banding site. This latter finding strongly suggests a negative universal effect of storm tides on nest success for Tangier Sound black ducks. Management to

  11. The role of water in animal breeding

    Directory of Open Access Journals (Sweden)

    Monica Serrantoni

    2006-07-01

    Full Text Available The role of water in animal breeding must be extended to a wider context than the animal production area, considering that 70% of the water used in the world is consumed by the whole production chain (agriculture and animal production. Therefore has a great importance the connection with other fields of the chain, as the fodder-growing and the cereal-growing, together with the evaluation and quantification of the environmental impacts. Water, that plays an essential role in the breeding, assumes different importance in relation to the animal class (birds, fish and mammals and to the animal species. Therefore are extremely different the water requirements and the water consumptions, that are moreover strongly influenced by many factors, such as the dry matter, the climatic breeding conditions, together with the individual animal features. All that represents the starting point to determine the strategies and the ways of the water giving in animal breeding, related to the technological, project and management aspects. Besides the quantitative aspects, water must be considered as food, because it is necessary to animal survival. The importance of the quality of water used in animal breeding and its nutritional role is closely related to the qualitative characteristics and to the presence of residual and polluting substances. The animal production chain, moreover, can produce environmental impacts on the aquatic ecosystems and therefore a particular attention goes to end uses of water as output of the whole animal production chain and to the quantification of the impacts, that is extremely complicate and difficult, depending on many variables. The considerations related to animal production chain assume a different value in the productive context of the management of the water resources in the third countries.

  12. The influence of cross-breeding Zlotnicka Spotted native breed sows ...

    African Journals Online (AJOL)

    Yomi

    2012-03-06

    Mar 6, 2012 ... Full Length Research Paper ... Large White (PLW) breeds on meat quality ... Duroc and Polish Large White boars on the quality of meat of crossbred fatteners. ... culinary and processing value, especially for ripening products.

  13. New trends in plant breeding - example of soybean

    Directory of Open Access Journals (Sweden)

    Miladinović Jegor

    2015-01-01

    Full Text Available Soybean breeding and selection is a continual process designed to increase yield levels and improve resistance to biotic and abiotic stresses. Soybean breeders have been successful in producing a large number of varieties using conventional breeding methods, the Single Seed Descent method in particular. In recent decades, with the increased use of genetic transformations, backcrossing is more frequent though the only trait that has been commercialized is glyphosate tolerance. Physiological breeding poses a particular challenge, as well as phenotyping and development of useful criteria and techniques suitable for plant breeding. Using modern remote sensing techniques provides great opportunity for collecting a large amount of physiological data in real environment, which is necessary for physiological breeding. Molecular based plant breeding methods and techniques are a conceptual part of any serious breeding program. Among those methods, the most extensively used is marker-assisted selection, as a supplement to conventional breeding methods. [Projekat Ministarstva nauke Republike Srbije, br. TR-31022

  14. Four Square Mile Survey breeding population report for 2001

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Production report of Four Square Mile Survey breeding population estimates for 13 species of ducks. Data includes summaries of breeding population estimates...

  15. Genetic variation of indigenous chicken breeds in China and a ...

    African Journals Online (AJOL)

    huis

    Keywords: Indigenous chicken breeds, AFLP markers, genetic variation, genetic relationships ... Some of these breeds have unique meat and/or egg qualities, a low susceptibility to stress and other ... early maturing and resistant to heat.

  16. BREED PREFERENCES AND EFFECTIVENESS OF BEEKEEPING IN THE SOUTH URAL

    Directory of Open Access Journals (Sweden)

    A. Mashenkov

    2012-12-01

    Full Text Available Efficiency of beekeeping is defined by breed of bees and melliferous herbs. In the conditions of sharply continental climate of South Ural, duration of success of beekeeping is provided with breed of bees.

  17. Organic plant breeding and propagation : concepts and strategies

    NARCIS (Netherlands)

    Lammerts van Bueren, E.T.

    2002-01-01

    Key-words : crop ideotype, genetic diversity, integrity of plants, intrinsic value, isophenic line mixture varieties, organic plant breeding, organic farming, organic propagation, participatory plant breeding, variety characteristics, seed-b

  18. RNA binding proteins hnRNP A2/B1 and CUGBP1 suppress Fragile X CGG premutation repeat-induced neurodegeneration in a Drosophila model of FXTAS

    OpenAIRE

    Sofola, Oyinkan A.; Jin, Peng; QIN, YUNLONG; Duan, Ranhui; LIU, Huijie; de Haro, Maria; Nelson,David L.; Botas, Juan

    2007-01-01

    Fragile X associated tremor ataxia syndrome (FXTAS) is a recently described neurodegenerative disorder of older adult carriers of premutation alleles (60-200 CGG repeats) in the fragile-X mental retardation gene (FMR1). It has been proposed that FXTAS is an RNA mediated neurodegenerative disease caused by the titration of RNA binding proteins by the CGG repeats. To test this hypothesis, we utilize a transgenic Drosophila model of FXTAS that expresses premutation length repeat (90 CGG repeats)...

  19. Directionality switchable gain stabilized linear repeater

    Science.gov (United States)

    Ota, Takayuki; Ohmachi, Tadashi; Aida, Kazuo

    2004-10-01

    We propose a new approach to realize a bidirectional linear repeater suitable for future optical internet networks and fault location in repeater chain with OTDR. The proposed approach is the linear repeater of simple configuration whose directionality is rearranged dynamically by electrical control signal. The repeater is composed of a magneto-optical switch, a circulator, a dynamically gain stabilized unidirectional EDFA, and control circuits. The repeater directionality is rearranged as fast as 0.1ms by an electrical control pulse. It is experimentally confirmed that OTDR with the directionality switchable repeater is feasible for repeater chain. The detailed design and performance of the repeater are also discussed, including the multi-pass interference (MPI) which may arise in the proposed repeater, the effect of the MPI on SNR degradation of the repeater chain and the feed-forward EDFA gain control circuit.

  20. Breeding objectives, selection criteria and breeding system of indigenous goat types in bale zone, oromia, Ethiopia

    Directory of Open Access Journals (Sweden)

    Belete Asefa

    2015-12-01

    Full Text Available The study was undertaken in bale zone to assess farmer’s selective breeding objectives, trait preferences, selection criteria and breeding system October 2012 to November 2013. A purposive and multistage sampling technique was applied for selection of 3 district and 9 kebeles. Then 360 households were selected by using simple random sampling techniques after the list of pastoralist having goats was identified. Statistical analysis system version 9.1 was used for analysis of data. Indices, effective population size and rate of inbreeding were calculated on average each respondent holds about 14 goats. Milk production is the main reason of goat keeping in the study area. Appearance is the first rank as selection criteria for male and female in all studies area. About 47.8% of the respondents have their own buck. The main use of breeding buck in the study area was for mating purpose (76.2%. Mean estimate of effective population size and mean rate of inbreeding was 2.43 and 0.21, respectively when a household flock is herded alone and under random mating. Therefore, any breed improvement strategies that are intended to be implemented in the study area and else- where should consider the traditional breeding practices and breeding objectives of the community.

  1. Breeding biology and nestling development of the Grasshopper Buzzard

    OpenAIRE

    Buij, R.; Kortekaas, K.; Folkertsma, I.; Van Der Velde, M.; Komdeur, J.; H. H. de Iongh; A. Monadjem

    2012-01-01

    Research into the effect of environmental variables on reproductive success of tropical raptors is often constrained by the lack of information on breeding biology. We provide the first detailed information of the breeding biology and nestling development of the Grasshopper Buzzard Butastur rufipennis, an Afrotropical migratory raptor threatened by extensive land transformation in its breeding range. Breeding coincided with the transition from the dry to the wet season. The mean incubation pe...

  2. Measurement-based quantum repeaters

    CERN Document Server

    Zwerger, M; Briegel, H J

    2012-01-01

    We introduce measurement-based quantum repeaters, where small-scale measurement-based quantum processors are used to perform entanglement purification and entanglement swapping in a long-range quantum communication protocol. In the scheme, pre-prepared entangled states stored at intermediate repeater stations are coupled with incoming photons by simple Bell-measurements, without the need of performing additional quantum gates or measurements. We show how to construct the required resource states, and how to minimize their size. We analyze the performance of the scheme under noise and imperfections, with focus on small-scale implementations involving entangled states of few qubits. We find measurement-based purification protocols with significantly improved noise thresholds. Furthermore we show that already resource states of small size suffice to significantly increase the maximal communication distance. We also discuss possible advantages of our scheme for different set-ups.

  3. A Repeating Fast Radio Burst

    CERN Document Server

    Spitler, L G; Hessels, J W T; Bogdanov, S; Brazier, A; Camilo, F; Chatterjee, S; Cordes, J M; Crawford, F; Deneva, J; Ferdman, R D; Freire, P C C; Kaspi, V M; Lazarus, P; Lynch, R; Madsen, E C; McLaughlin, M A; Patel, C; Ransom, S M; Seymour, A; Stairs, I H; Stappers, B W; van Leeuwen, J; Zhu, W W

    2016-01-01

    Fast Radio Bursts are millisecond-duration astronomical radio pulses of unknown physical origin that appear to come from extragalactic distances. Previous follow-up observations have failed to find additional bursts at the same dispersion measures (i.e. integrated column density of free electrons between source and telescope) and sky position as the original detections. The apparent non-repeating nature of the fast radio bursts has led several authors to hypothesise that they originate in cataclysmic astrophysical events. Here we report the detection of ten additional bursts from the direction of FRB121102, using the 305-m Arecibo telescope. These new bursts have dispersion measures and sky positions consistent with the original burst. This unambiguously identifies FRB121102 as repeating and demonstrates that its source survives the energetic events that cause the bursts. Additionally, the bursts from FRB121102 show a wide range of spectral shapes that appear to be predominantly intrinsic to the source and wh...

  4. DOWN SYNDROME WITH MOYAMOYA SYNDROME

    National Research Council Canada - National Science Library

    Mohan Makwana; R. K. Vishnoi; Jai Prakash Soni; Kapil Jetha; Suresh Kumar Verma; Pradeep Singh Rathore; Monika Choudhary

    2017-01-01

    ...,” in which the arterial changes are seen among patients with various syndromes or other disease processes- Down syndrome, sickle cell anaemia, neurofibromatosis type-1, congenital heart disease...

  5. Repeatability of Harris Corner Detector

    Institute of Scientific and Technical Information of China (English)

    HU Lili

    2003-01-01

    Interest point detectors are commonly employed to reduce the amount of data to be processed. The ideal interest point detector would robustly select those features which are most appropriate or salient for the application and data at hand. This paper shows that interest points are geometrically stable under different transformations.This property makes interest points very successful in the context of image matching. To measure this property quantatively, we introduce a evaluation criterion: repeatability rate.

  6. The use of clones in dairy cattle breeding.

    NARCIS (Netherlands)

    Boer, de I.J.M.

    1994-01-01

    The aim of this thesis was to determine a breeding scheme that optimally uses large scale production of genetically identical individuals (clones) in dairy cattle. Such a breeding scheme should optimize the continuous genetic improvement of the breeding population (genetic response), and the selecti

  7. 50 CFR 15.26 - Approval of cooperative breeding programs.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false Approval of cooperative breeding programs... WILDLIFE AND PLANTS WILD BIRD CONSERVATION ACT Permits and Approval of Cooperative Breeding Programs § 15.26 Approval of cooperative breeding programs. Upon receipt of a complete application, the...

  8. Genomic prediction across dairy cattle populations and breeds

    DEFF Research Database (Denmark)

    Zhou, Lei

    Genomic prediction is successful in single breed genetic evaluation. However, there is no achievement in acoress breed prediction until now. This thesis investigated genomic prediction across populations and breeds using Chinese Holsterin, Nordic Holstein, Norwgian Red, and Nordic Red. Nordic Red...

  9. The Evolution and Ecology of Cooperative Breeding in Vertebrates

    NARCIS (Netherlands)

    Komdeur, Jan; Eikenaar, Cas; Brouwer, Lyanne; Richardson, David S.

    2008-01-01

    Cooperative breeding – in which some adults forgo independent breeding and remain as subordinates within a group helping to raise the offspring of others – occurs in between 3% and 10% of vertebrates. The structure of such systems varies greatly, from pairs with helpers-at-the-nest to communal breed

  10. Population viability analysis on domestic horse breeds (Equus caballus)

    DEFF Research Database (Denmark)

    Thirstrup, Janne Pia; Bach, Lars; Loeschcke, Volker

    2009-01-01

    In this study, we performed a population viability analysis on 3 domestic horse breeds (Equus caballus) of Danish origin, namely, the Frederiksborg, the Knabstrupper, and the Jutland breeds. Because of their small population sizes, these breeds are considered endangered. The Vortex software...... available. The results of this analysis accord with other studies on the Prezwalski horse, indicating robustness in the parameter sensitivity for horses....

  11. The Pedigree Dog Breeding Debate in Ethics and Practice

    NARCIS (Netherlands)

    Bovenkerk, Bernice; Nijland, Hanneke J.

    2017-01-01

    Pedigree dog breeding has been the subject of public debate due to health problems caused by breeding for extreme looks and the narrow genepool of many breeds. Our research aims to provide insights in order to further the animal-ethical, political and society-wide discussion regarding the future of

  12. Breed differences in behavioural response to challenging situations in kittens.

    Science.gov (United States)

    Marchei, P; Diverio, S; Falocci, N; Fatjó, J; Ruiz-de-la-Torre, J L; Manteca, X

    2011-03-01

    In a previous experiment, the behaviour of Oriental/Siamese/Abyssinian (OSA) kittens was compared with that of Norwegian Forest kittens (NFO) in a repeated Open Field Test (OFT), and significant differences emerged. To further investigate such variations, we analyzed kittens' responses to a potentially threatening object (TO) during the OFT. It was a metal spring enveloped in a cotton case suddenly bouncing out of the cylinder after the first 6 min of OFT exposure, and the test lasted 6 more minutes. From the 4th to the 10th week of age, during each test, the response of 43 OSA kittens and 39 NFO kittens to the TO was analyzed. Heart rate (HR) before and after the test was recorded. Behaviours were recorded and analyzed by focal animal sampling. Behavioural modifications recorded after TO exposure confirmed our suggestions on slow limbic system development in NFO kittens, as previously suggested by poor habituation and poor memory retention of repeated OFT exposure. The evident avoiding response to the TO confirmed the adoption in NFO kittens of an active-coping strategy towards challenge, as indicated also by their high scores for exploration and escape attempts. Otherwise, poor TO influence on exploration observed in OSA kittens suggested the adoption of a passive coping strategy, as previously shown by low levels of exploration and intra-session reduction in the number of vocalizations. Nevertheless, some of the behaviours observed, and the evidence of emotional tachycardia in OSA kittens, suggested also that the low level of activity recorded could have been due to a low arousability predisposition in this breed. The perception of a poorly arousing potential in the experimental setting might have influenced the perception of danger and the behaviour adopted in OSA kittens.

  13. Achievements in NS rapeseed hybrids breeding

    Directory of Open Access Journals (Sweden)

    Marjanović-Jeromela Ana

    2016-01-01

    Full Text Available The increased production of oilseed rape (Brassica napus L. is evident on a global scale, but also in Serbia in the last decade. Rapeseed is used primarily for vegetable oil and processing industry, but also as a source of protein for animal feed and green manure. Following the cultivation of varieties, breeding and cultivation of hybrid rapeseed started in the 1990's, to take advantage of heterosis in F1 generation, while protecting the breeder's rights during seed commercialization. The breeding of hybrid oilseed rape requires high quality starting material (lines with good combining abilities for introduction of male sterility. Ogura sterility system is primarily used at the Institute of Field and Vegetable Crops, Novi Sad, Serbia. To use this system, separate lines are modified with genes for cytoplasmic male sterility (cms female line - mother line and restoration of fertility (Rf male lines - father line. In order to maintain the sterility of the mother line it is necessary to produce a maintainer line of cytoplasmic male sterility. Creation of these lines and hybrids at the Institute of Field and Vegetable Crops was successfully monitored with intense use of cytogenetic laboratory methods. The structure and vitality of pollen, including different phases during meiosis were checked so that cms stability was confirmed during the introduction of these genes into different lines. Rapeseed breeding program in Serbia resulted in numerous varieties through collaboration of researchers engaged in breeding and genetics of this plant species. So far, in addition to 12 varieties of winter rapeseed and two varieties of spring rapeseed, a new hybrid of winter rapeseed NS Ras was registered in Serbia. NS Ras is an early-maturing hybrid characterized by high seed yield and oil content. Average yield of NS Ras for two seasons and three sites was 4256 kg ha-1 of seed and 1704 kg ha-1 of oil. Three promising winter rapeseed hybrids are in the process of

  14. Genetics of canine diabetes mellitus: are the diabetes susceptibility genes identified in humans involved in breed susceptibility to diabetes mellitus in dogs?

    Science.gov (United States)

    Catchpole, Brian; Adams, Jamie P; Holder, Angela L; Short, Andrea D; Ollier, William E R; Kennedy, Lorna J

    2013-02-01

    Diabetes mellitus is a common endocrinopathy in companion animals, characterised by hyperglycaemia, glycosuria and weight loss, resulting from an absolute or relative deficiency in the pancreatic hormone insulin. There are breed differences in susceptibility to diabetes mellitus in dogs, with the Samoyed breed being overrepresented, while Boxers are relatively absent in the UK population of diabetic dogs, suggesting that genetic factors play an important role in determining susceptibility to the disease. A number of genes, linked with susceptibility to diabetes mellitus in humans, are associated with an increased risk of diabetes mellitus in dogs, some of which appear to be relatively breed-specific. Diabetes mellitus in dogs has been associated with major histocompatibility complex (MHC) class II genes (dog leucocyte antigen; DLA), with similar haplotypes and genotypes being identified in the most susceptible breeds. A region containing a variable number of tandem repeats (VNTR) and several polymorphisms have been identified in the canine insulin gene, with some alleles associated with susceptibility or resistance to diabetes mellitus in a breed-specific manner. Polymorphisms in the canine CTLA4 promoter and in other immune response genes are associated with susceptibility to diabetes mellitus in a number of pedigree breeds. Genome wide association studies are currently underway that should shed further light on the genetic factors responsible for the breed profile seen in the diabetic dog population.

  15. Low-Normal FMR1 CGG Repeat Length: Phenotypic Associations

    Directory of Open Access Journals (Sweden)

    Marsha eMailick

    2014-09-01

    Full Text Available This population-based study investigates genotype-phenotype correlations of low-normal CGG repeats in the fragile X mental retardation 1 (FMR1 gene. FMR1 plays an important role in brain development and function, and encodes FMRP (fragile X mental retardation protein, an RNA-binding protein that regulates protein synthesis impacting activity-dependent synaptic development and plasticity. Most past research has focused on CGG premutation expansions (41 to 200 CGG repeats and on fragile X syndrome (200+ CGG repeats, with considerably less attention on the other end of the spectrum of CGG repeats. Using existing data, older adults with 23 or fewer CGG repeats (2 SDs below the mean were compared with age-peers who have normal numbers of CGGs (24-40 with respect to cognition, mental health, cancer, and having children with disabilities. Men (n = 341 with an allele in the low-normal range and women (n = 46 with two low-normal alleles had significantly more difficulty with their memory and ability to solve day to day problems. Women with both FMR1 alleles in the low-normal category had significantly elevated odds of feeling that they need to drink more to get the same effect as in the past. These women also had two and one-half times the odds of having had breast cancer and four times the odds of uterine cancer. Men and women with low-normal CGGs had higher odds of having a child with a disability, either a developmental disability or a mental health condition. These findings are in line with the hypothesis that there is a need for tight neuronal homeostatic control mechanisms for optimal cognitive and behavioral functioning, and more generally that low numbers as well as high numbers of CGG repeats may be problematic for health.

  16. Abnormal Base Excision Repair at Trinucleotide Repeats Associated with Diseases: A Tissue-Selective Mechanism

    Directory of Open Access Journals (Sweden)

    Agathi-Vasiliki Goula

    2013-07-01

    Full Text Available More than fifteen genetic diseases, including Huntington’s disease, myotonic dystrophy 1, fragile X syndrome and Friedreich ataxia, are caused by the aberrant expansion of a trinucleotide repeat. The mutation is unstable and further expands in specific cells or tissues with time, which can accelerate disease progression. DNA damage and base excision repair (BER are involved in repeat instability and might contribute to the tissue selectivity of the process. In this review, we will discuss the mechanisms of trinucleotide repeat instability, focusing more specifically on the role of BER.

  17. Kindler syndrome

    Directory of Open Access Journals (Sweden)

    Kaviarasan P

    2005-01-01

    Full Text Available Kindler syndrome is a rare autosomal recessive disorder associated with skin fragility. It is characterized by blistering in infancy, photosensitivity and progressive poikiloderma. The syndrome involves the skin and mucous membrane with radiological changes. The genetic defect has been identified on the short arm of chromosome 20. This report describes an 18-year-old patient with classical features like blistering and photosensitivity in childhood and the subsequent development of poikiloderma. The differential diagnosis of Kindler syndrome includes diseases like Bloom syndrome, Cockayne syndrome, dyskeratosis congenita, epidermolysis bullosa, Rothmund-Thomson syndrome and xeroderma pigmentosum. Our patient had classical cutaneous features of Kindler syndrome with phimosis as a complication.

  18. Breeding Potential in Danish Apple Cultivar

    DEFF Research Database (Denmark)

    Larsen, Bjarne

    understanding of the link between phenotypes and the underlying gene-tic background which is crucial in plant breeding. We found a considerable genetic diversity in the collection and no genetic structure. We exposed a high number of accessions in admix and revealed several putative cultivar parentages, never......The diversity in plant genetic resources is a prerequisite for genetic improvement of cultivated crop species. Lack of in-depth characterization and evaluation of gene bank accessions is a major obstacle for their potential utilization. The Danish apple (Malus domestica L.) gene bank collection...... be used directly for marker-assisted selection. In addition, we suggest a number of candidate genes involved in the control of several important fruit quality traits. Future studies and breeding attempts can therefore benefit from the results, including genetic fingerprints and pedigree reconstruction...

  19. Genetics and breeding of brewers yeast

    Energy Technology Data Exchange (ETDEWEB)

    Nilsson-Tillgren, T.; Gjermansen, C.; Petersen, J.G.L.; Holmberg, S.; Kielland-Brandt, M.C.

    1984-01-01

    Yeasts, used for beer production, can be divided into two groups, top fermenters and bottom fermenters and Saccharomyces carlsbergensis has been chosen as the name for the bottom fermenting yeasts which are used in lager beer production. The key for the analysis of the chromosomes of Saccharomyces carlsbergensis was provided by the discovery that single chromosomes of meiotic segregants of these strains can be transferred to genetically marked Saccharomyces cerevisiae strains and subsequently analyzed by tetrad analysis and molecular hybridization. It is proposed that Saccharomyces carlsbergensis is composed of two rather divergent genotypes. Breeding can be accomplished by cross breeding and mutagenesis and possibly by introducing in vitro modified cloned genes into meiotic segregants of Saccharomyces carlsbergensis.

  20. Vertebral heart scores in eight dog breeds.

    Science.gov (United States)

    Jepsen-Grant, K; Pollard, R E; Johnson, L R

    2013-01-01

    The vertebral heart score (VHS) measurement is commonly used to provide a more objective measurement of cardiomegaly in canines. However, several studies have shown significant breed variations from the value previously established by Buchanan and Bücheler (9.7 ± 0.5). This study describes VHS measurements in Pug, Pomeranian, Yorkshire Terrier, Dachshund, Bulldog, Shih Tzu, Lhasa Apso, and Boston Terrier dog breeds. Dogs with two or three view thoracic radiographs, no subjective radiographic evidence of cardiomegaly, and no physical examination findings of heart murmurs or gallop rhythms were included in the study. The Pug, Pomeranian, Bulldog, and Boston Terrier groups were found to have a VHS significantly greater than 9.7 ± 0.5 (P Bulldog (P = 0.028) and Boston Terrier (P = 0.0004) groups. Thoracic depth to width ratio did not have a significant effect on VHS.

  1. Origin and fate of repeats in bacteria.

    Science.gov (United States)

    Achaz, G; Rocha, E P C; Netter, P; Coissac, E

    2002-07-01

    We investigated 53 complete bacterial chromosomes for intrachromosomal repeats. In previous studies on eukaryote chromosomes, we proposed a model for the dynamics of repeats based on the continuous genesis of tandem repeats, followed by an active process of high deletion rate, counteracted by rearrangement events that may prevent the repeats from being deleted. The present study of long repeats in the genomes of Bacteria and Archaea suggests that our model of interspersed repeats dynamics may apply to them. Thus the duplication process might be a consequence of very ancient mechanisms shared by all three domains. Moreover, we show that there is a strong negative correlation between nucleotide composition bias and the repeat density of genomes. We hypothesise that in highly biased genomes, non-duplicated small repeats arise more frequently by random effects and are used as primers for duplication mechanisms, leading to a higher density of large repeats.

  2. BreedVision — A Multi-Sensor Platform for Non-Destructive Field-Based Phenotyping in Plant Breeding

    Science.gov (United States)

    Busemeyer, Lucas; Mentrup, Daniel; Möller, Kim; Wunder, Erik; Alheit, Katharina; Hahn, Volker; Maurer, Hans Peter; Reif, Jochen C.; Würschum, Tobias; Müller, Joachim; Rahe, Florian; Ruckelshausen, Arno

    2013-01-01

    To achieve the food and energy security of an increasing World population likely to exceed nine billion by 2050 represents a major challenge for plant breeding. Our ability to measure traits under field conditions has improved little over the last decades and currently constitutes a major bottleneck in crop improvement. This work describes the development of a tractor-pulled multi-sensor phenotyping platform for small grain cereals with a focus on the technological development of the system. Various optical sensors like light curtain imaging, 3D Time-of-Flight cameras, laser distance sensors, hyperspectral imaging as well as color imaging are integrated into the system to collect spectral and morphological information of the plants. The study specifies: the mechanical design, the system architecture for data collection and data processing, the phenotyping procedure of the integrated system, results from field trials for data quality evaluation, as well as calibration results for plant height determination as a quantified example for a platform application. Repeated measurements were taken at three developmental stages of the plants in the years 2011 and 2012 employing triticale (×Triticosecale Wittmack L.) as a model species. The technical repeatability of measurement results was high for nearly all different types of sensors which confirmed the high suitability of the platform under field conditions. The developed platform constitutes a robust basis for the development and calibration of further sensor and multi-sensor fusion models to measure various agronomic traits like plant moisture content, lodging, tiller density or biomass yield, and thus, represents a major step towards widening the bottleneck of non-destructive phenotyping for crop improvement and plant genetic studies. PMID:23447014

  3. ITER breeding blanket module design and analysis

    Energy Technology Data Exchange (ETDEWEB)

    Kuroda, Toshimasa; Enoeda, Mikio; Kikuchi, Shigeto [Japan Atomic Energy Research Inst., Naka, Ibaraki (Japan). Naka Fusion Research Establishment] [and others

    1998-11-01

    The ITER breeding blanket employs a ceramic breeder and Be neutron multiplier both in small spherical pebble form. Radial-poloidal cooling panels are arranged in the blanket box to remove the nuclear heating in these materials and to reinforce the blanket structure. At the first wall, Be armor is bonded onto the stainless steel (SS) structure to provide a low Z plasma-compatible surface and to protect the first wall/blanket structure from the direct contact with the plasma during off-normal events. Thermo-mechanical analyses and investigation of fabrication procedure have been performed for this breeding blanket. To evaluate thermo-mechanical behavior of the pebble beds including the dependency of the effective thermal conductivity on stress, analysis methods have been preliminary established by the use of special calculation option of ABAQUS code, which are briefly summarized in this report. The structural response of the breeding blanket module under internal pressure of 4 MPa (in case of in-blanket LOCA) resulted in rather high stress in the blanket side (toroidal end) wall, thus addition of a stiffening rib or increase of the wall thickness will be needed. Two-dimensional elasto-plastic analyses have been performed for the Be/SS bonded interface at the first wall taking a fabrication process based on HIP bonding and thermal cycle due to pulsed plasma operation into account. The stress-strain hysteresis during these process and operation was clarified, and a procedure to assess and/or confirm the bonding integrity was also proposed. Fabrication sequence of the breeding blanket module was preliminarily developed based on the procedure to fabricate part by part and to assemble them one by one. (author)

  4. Meristem cultures in garlic (Allium sativum) breeding

    OpenAIRE

    ŠVEHLOVÁ, Eva

    2017-01-01

    The diploma thesis deals with the use of meristem cultures in garlic (Allium sativum) breeding. The source material was used variety Tantalum of garlic. The using material, before the isolation of meristem, was tested for the occurrence of viral diseases by immunological tests ELISA (Enzyme-Linked Immuno-Sorbent Assay), also known as EIA (Enzyme Immunoassay). The method used to detect antibodies and antigens. The material was tested for viruses onion yellow dwarf (OYDV - Onion Yellow Dwarf Vi...

  5. Colombian Creole horse breeds: Same origin but different diversity

    OpenAIRE

    Ligia Mercedes Jimenez; Susy Mendez; Susana Dunner; Javier Cañón; Óscar Cortés

    2012-01-01

    In order to understand the genetic ancestry and mitochondrial DNA (mtDNA) diversity of current Colombian horse breeds we sequenced a 364-bp fragment of the mitocondrial DNA D-loop in 116 animals belonging to five Spanish horse breeds and the Colombian Paso Fino and Colombian Creole cattle horse breeds. Among Colombian horse breeds, haplogroup D had the highest frequency (53%), followed by haplogroups A (19%), C (8%) and F (6%). The higher frequency of haplogroup D in Colombian horse breeds su...

  6. Repeat-mediated epigenetic dysregulation of the FMR1 gene in the Fragile X-related disorders

    Directory of Open Access Journals (Sweden)

    Karen eUsdin

    2015-06-01

    Full Text Available The Fragile X-related disorders are members of the Repeat Expansion Diseases, a group of genetic conditions resulting from an expansion in the size of a tandem repeat tract at a specific genetic locus. The repeat responsible for disease pathology in the Fragile X-related disorders is CGG/CCG and the repeat tract is located in the 5’ UTR of the FMR1 gene, whose protein product FMRP, is important for the proper translation of dendritic mRNAs in response to synaptic activation. There are two different pathological FMR1 allele classes that are distinguished only by the number of repeats. Premutation alleles have 55-200 repeats and confer risk of Fragile X-associated tremor/ataxia syndrome and Fragile X-associated primary ovarian insufficiency. Full mutation alleles on the other hand have >200 repeats and result in Fragile X syndrome, a disorder that affects learning and behavior. Different symptoms are seen in carriers of premutation and full mutation alleles because the repeat number has paradoxical effects on gene expression: Epigenetic changes increase transcription from premutation alleles and decrease transcription from full mutation alleles. This review will cover what is currently known about the mechanisms responsible for these changes in FMR1 expression and how they may relate to other Repeat Expansion Diseases that also show repeat-mediated changes in gene expression.

  7. The development of beef breeding bulls.

    Science.gov (United States)

    Engelken, T J

    2008-08-01

    Management of the bull battery will have a dramatic impact on profitability of the cow/calf enterprise. It is critical that young bulls be selected and developed to maximize longevity and productivity for the eventual buyer. Bulls must be structurally sound, healthy, and have adequate libido in order to service the required number of females. Once bulls complete their first breeding season, special care must be taken in order to ensure that they recover and regain needed body condition and pass a bull breeding soundness examination (BBSE). Mature bulls that have reached their genetic potential for growth require less intensive management, but the health program and annual BBSE cannot be overlooked. Mature bulls are also more likely to carry venereal disease and should be screened according to local disease incidence and state regulations. All bulls, regardless of age, should be observed early during the breeding season to ensure that they are physically capable of mounting and servicing females. The establishment of a complete management program, especially for young bulls, is essential to ensure that ranch resources are used efficiently, including maintenance of a high level of reproductive performance of the cow herd.

  8. Breeding ecology of the Puaiohi (Myadestes palmeri)

    Science.gov (United States)

    Snetsinger, T.J.; Herrmann, C.M.; Holmes, D.E.; Hayward, C.D.; Fancy, S.G.

    2005-01-01

    We studied the breeding ecology of the critically endangered Puaiohi (Myadestes palmeri), a poorly known Hawaiian thrush endemic to the island of Kauai. From 1996 through 1998, we monitored 96 active nests over the course of three breeding seasons. Mean clutch size was 2.0, and pairs produced an average of 1.5 fledglings/successful nest. Pairs renested after failure and some raised multiple broods. The mean annual reproductive effort was 2.1 nesting attempts/territory, and pairs produced a mean 1.1 fledglings/attempt. Large differences in nesting effort and productivity occurred among years, with mean number of fledglings/territory ranging from 0.4 to 4.9. Predation by owls (probably Short-eared Owls, Asia flammeus) and introduced rats (probably black rats, Rattus rattus) accounted for most nest failures. The presence of non-breeding floaters in the population and their largely unsuccessful attempts to gain territories in the study area suggest that the population is near carrying capacity. The high reproductive potential of the Puaiohi may help explain its persistence despite the species' historical rarity.

  9. Detection of Breeding Blankets Using Antineutrinos

    Science.gov (United States)

    Cogswell, Bernadette; Huber, Patrick

    2016-03-01

    The Plutonium Management and Disposition Agreement between the United States and Russia makes arrangements for the disposal of 34 metric tons of excess weapon-grade plutonium. Under this agreement Russia plans to dispose of its excess stocks by processing the plutonium into fuel for fast breeder reactors. To meet the disposition requirements this fuel would be burned while the fast reactors are run as burners, i.e., without a natural uranium blanket that can be used to breed plutonium surrounding the core. This talk discusses the potential application of antineutrino monitoring to the verification of the presence or absence of a breeding blanket. It is found that a 36 kg antineutrino detector, exploiting coherent elastic neutrino-nucleus scattering and made of silicon, could determine the presence of a breeding blanket at a liquid sodium cooled fast reactor at the 95% confidence level within 90 days. Such a detector would be a novel non-intrusive verification tool and could present a first application of coherent elastic neutrino-nucleus scattering to a real-world challenge.

  10. Cytogenetical characterization of bovine breeds Caracu, Junqueira, Pantaneiro and Patua

    Directory of Open Access Journals (Sweden)

    Rita Maria Ladeira Pires

    2014-10-01

    Full Text Available During the adaptive process to Brazilian conditions, the native cattle breeds acquired physiological and phenotypic characteristics wich differs them from European breeds, from which they derive. The objectives of present study were to compare the sex chromosomes morphologies between four Brazilian native cattle breeds as well as the incidence of chromosomal abnormalities. The karyotype of 332 animals from four breeds were analyzed: Caracu (115 females and 159 males, Junqueira (13 females and 3 males, Pantaneiro (8 males and Patua (21 females and 13 males. The Giemsa coloring were used to read the chromosome. All cattle breeds studied showed the normal chromosome (2n=60 consisting of 58 acrocentric autosomes and two submetacentric X chromosomes in females, and one X and one Y in males. In Caracu breed, selected for dairy or beef, it was developed by animals dimorphism carriers of Y chromosome (acrocentric and submetacentric, and the beef bloodlines showed higher percentage of acrocentric Y chromosome. There was 1% significant difference in Chi-Square test. In two females and two male born from twin birth of Caracu breed it was observed chemerism 60, XX/ 60, XY, and in other female from same breed it was observed 60, XX/ 61 XXY. For other three breeds, no chromosomal abnormality was observed. The Y chromosome morphology of the Pantaneiro and Patua breeds showed dimorphism of Y chromosome (submetacentric an acrocentric. In the Junqueira breed, only submetacentric morphology was observed.

  11. Genetic diversity in some local chicken breeds using microsatellite markers

    Directory of Open Access Journals (Sweden)

    M. Cassandro

    2010-04-01

    Full Text Available Genetic relationships among Veneto native breeds of chickens were studied on the basis of microsatellites polymorphisms. A total of 100 DNA samples from 2 local chicken breeds (45 Robusta Lionata and 43 Robusta Maculata and a commercial broiler line (12 Golden Comet were analyzed using 19 microsatellite markers. The average number of alleles per locus was 4.05 and the expected heterozigosity resulted lower for the local breeds than the broiler line. The Robusta Lionata breed and the broiler line showed a significant deficit and excess of heterozygotes, respectively, deviating from Hardy-Weinberg equilibrium. Nei’s standard genetic distances corrected for bias due to sampling of individuals (Da, based on allele frequencies, were calculated among breeds. The local breeds resulted very similar confirming the same genetic origin. The results suggested that microsatellite markers are a useful tool for studying the genetic diversity among local chicken breeds.

  12. Using 2-DE for the differentiation of local chicken breeds.

    Science.gov (United States)

    Zanetti, Enrico; Molette, Caroline; Chambon, Christophe; Pinguet, Jeremy; Rémignon, Hervé; Cassandro, Martino

    2011-07-01

    The aim of this study was to apply a proteomic approach for the characterisation of local chicken breeds. The experiment involved a total of 29 males of three local Italian chicken breeds: Pépoi, Padovana and Ermellinata di Rovigo. Sarcoplasmic protein fractions of breast muscle were analysed by 2-DE. Image analysis followed by statistical analysis enabled to differentiate groups of individuals based on the similarities of protein expression. Individuals were distinguished into clusters and groups, corresponding to the breed of origin. Distances among individuals, calculated using data on spot volumes, were used to draw a neighbour-joining tree, showing clear individual and breed grouping. The most relevant spots regarding breed differentiation were detected; 11 were identified by MS revealing preliminary evidences on the mechanisms of the breed differentiation process. The results evidenced the ability of proteomic analyses for the characterisation of chicken breeds. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Colombian Creole horse breeds: same origin but different diversity

    Directory of Open Access Journals (Sweden)

    Ligia Mercedes Jimenez

    2012-01-01

    Full Text Available In order to understand the genetic ancestry and mitochondrial DNA (mtDNA diversity of current Colombian horse breeds we sequenced a 364-bp fragment of the mitocondrial DNA D-loop in 116 animals belonging to five Spanish horse breeds and the Colombian Paso Fino and Colombian Creole cattle horse breeds. Among Colombian horse breeds, haplogroup D had the highest frequency (53%, followed by haplogroups A (19%, C (8% and F (6%. The higher frequency of haplogroup D in Colombian horse breeds supports the theory of an ancestral Iberian origin for these breeds. These results also indicate that different selective pressures among the Colombian breeds could explain the relatively higher genetic diversity found in the Colombian Creole cattle horse when compared with the Colombian Paso Fino.

  14. Colombian Creole horse breeds: Same origin but different diversity.

    Science.gov (United States)

    Jimenez, Ligia Mercedes; Mendez, Susy; Dunner, Susana; Cañón, Javier; Cortés, Oscar

    2012-12-01

    In order to understand the genetic ancestry and mitochondrial DNA (mtDNA) diversity of current Colombian horse breeds we sequenced a 364-bp fragment of the mitocondrial DNA D-loop in 116 animals belonging to five Spanish horse breeds and the Colombian Paso Fino and Colombian Creole cattle horse breeds. Among Colombian horse breeds, haplogroup D had the highest frequency (53%), followed by haplogroups A (19%), C (8%) and F (6%). The higher frequency of haplogroup D in Colombian horse breeds supports the theory of an ancestral Iberian origin for these breeds. These results also indicate that different selective pressures among the Colombian breeds could explain the relatively higher genetic diversity found in the Colombian Creole cattle horse when compared with the Colombian Paso Fino.

  15. Life histories and the evolution of cooperative breeding in mammals.

    Science.gov (United States)

    Lukas, Dieter; Clutton-Brock, Tim

    2012-10-07

    While the evolution of cooperative breeding systems (where non-breeding helpers participate in rearing young produced by dominant females) has been restricted to lineages with socially monogamous mating systems where coefficients of relatedness between group members are usually high, not all monogamous lineages have produced species with cooperative breeding systems, suggesting that other factors constrain the evolution of cooperative breeding. Previous studies have suggested that life-history parameters, including longevity, may constrain the evolution of cooperative breeding. Here, we show that transitions to cooperative breeding across the mammalian phylogeny have been restricted to lineages where females produce multiple offspring per birth. We find no support for effects of longevity or of other life-history parameters. We suggest that the evolution of cooperative breeding has been restricted to monogamous lineages where helpers have the potential to increase the reproductive output of breeders.

  16. Status and Prospects of Hybrid Rice Breeding in Jiangsu, China

    Institute of Scientific and Technical Information of China (English)

    WANG Cai-lin

    2005-01-01

    Research on hybrid rice in Jiangsu Province, China began in 1970. Great progress has been made since then, which can be divided into three stages according to the development of hybrid rice breeding and production in Jiangsu Province. The first stage was beginning stage from 1970 to 1980, when progress was mainly made in cytoplasmic male sterile line breeding. The second stage could be described as developing stage, from 1980 to 1995, when indica hybrid rice was rapidly popularized, and japonica hybrid rice became popular later. From 1996, hybrid rice breeding in Jiangsu Province entered the third stage, when both indica and japonica hybrid rice breeding in the three-line system or intersubspecific hybrid rice breeding in the two-line system made a great breakthrough with the successful breeding of the hybrids Teyou 559, 9 You 138 and Liangyoupeijiu. The developing trend of hybrid rice breeding in Jiangsu Province is also discussed.

  17. Improving repeatability by improving quality

    Energy Technology Data Exchange (ETDEWEB)

    Ronen, Shuki; Ackers, Mark; Schlumberger, Geco-Prakla; Brink, Mundy

    1998-12-31

    Time lapse (4-D) seismic is a promising tool for reservoir characterization and monitoring. The method is apparently simple: to acquire data repeatedly over the same reservoir, process and interpret the data sets, then changes between the data sets indicate changes in the reservoir. A problem with time lapse seismic data is that reservoirs are a relatively small part of the earth and important reservoir changes may cause very small differences to the time lapse data. The challenge is to acquire and process economical time lapse data such that reservoir changes can be detected above the noise of varying acquisition and environment. 7 refs., 9 figs.

  18. Coordinated hybrid automatic repeat request

    KAUST Repository

    Makki, Behrooz

    2014-11-01

    We develop a coordinated hybrid automatic repeat request (HARQ) approach. With the proposed scheme, if a user message is correctly decoded in the first HARQ rounds, its spectrum is allocated to other users, to improve the network outage probability and the users\\' fairness. The results, which are obtained for single- and multiple-antenna setups, demonstrate the efficiency of the proposed approach in different conditions. For instance, with a maximum of M retransmissions and single transmit/receive antennas, the diversity gain of a user increases from M to (J+1)(M-1)+1 where J is the number of users helping that user.

  19. Spatial scale of local breeding habitat quality and adjustment of breeding decisions.

    Science.gov (United States)

    Doligez, Blandine; Berthouly, Anne; Doligez, Damien; Tanner, Marion; Saladin, Verena; Bonfils, Danielle; Richner, Heinz

    2008-05-01

    Experimental studies provide evidence that, in spatially and temporally heterogeneous environments, individuals track variation in breeding habitat quality to adjust breeding decisions to local conditions. However, most experiments consider environmental variation at one spatial scale only, while the ability to detect the influence of a factor depends on the scale of analysis. We show that different breeding decisions by adults are based on information about habitat quality at different spatial scales. We manipulated (increased or decreased) local breeding habitat quality through food availability and parasite prevalence at a small (territory) and a large (patch) scale simultaneously in a wild population of Great Tits (Parus major). Females laid earlier in high-quality large-scale patches, but laying date did not depend on small-scale territory quality. Conversely, offspring sex ratio was higher (i.e., biased toward males) in high-quality, small-scale territories but did not depend on large-scale patch quality. Clutch size and territory occupancy probability did not depend on our experimental manipulation of habitat quality, but territories located at the edge of patches were more likely to be occupied than central territories. These results suggest that integrating different decisions taken by breeders according to environmental variation at different spatial scales is required to understand patterns of breeding strategy adjustment.

  20. Crowding by a repeating pattern.

    Science.gov (United States)

    Rosen, Sarah; Pelli, Denis G

    2015-01-01

    Theinability to recognize a peripheral target among flankers is called crowding. For a foveal target, crowding can be distinguished from overlap masking by its sparing of detection, linear scaling with eccentricity, and invariance with target size.Crowding depends on the proximity and similarity of the flankers to the target. Flankers that are far from or dissimilar to the target do not crowd it. On a gray page, text whose neighboring letters have different colors, alternately black and white, has enough dissimilarity that it might escape crowding. Since reading speed is normally limited by crowding, escape from crowding should allow faster reading. Yet reading speed is unchanged (Chung & Mansfield, 2009). Why? A recent vernier study found that using alternating-color flankers produces strong crowding (Manassi, Sayim, & Herzog, 2012). Might that effect occur with letters and reading? Critical spacing is the minimum center-to-center target-flanker spacing needed to correctly identify the target. We measure it for a target letter surrounded by several equidistant flanker letters of the same polarity, opposite polarity, or mixed polarity: alternately white and black. We find strong crowding in the alternating condition, even though each flanker letter is beyond its own critical spacing (as measured in a separate condition). Thus a periodic repeating pattern can produce crowding even when the individual elements do not. Further, in all conditions we find that, once a periodic pattern repeats (two cycles), further repetition does not affect critical spacing of the innermost flanker.

  1. Introduction of quinolone resistant Escherichia coli to Swedish broiler population by imported breeding animals.

    Science.gov (United States)

    Börjesson, Stefan; Guillard, Thomas; Landén, Annica; Bengtsson, Björn; Nilsson, Oskar

    2016-10-15

    During recent years a rapid increase of quinolone resistant Escherichia coli have been noted in the Swedish broiler population, despite the lack of a known selective pressure. The current study wanted to investigate if imported breeding birds could be a source for the quinolone resistant E. coli. The occurrence of quinolone resistant E. coli was investigated, using selective cultivation with nalidixic acid, in grand-parent birds on arrival to Sweden and their progeny. In addition, sampling in hatcheries and empty cleaned poultry houses was performed. Clonality of isolates was investigated using a 10-loci multiple-locus variable number tandem repeat analysis (MLVA). To identify the genetic basis for the resistance isolates were also analysed for occurrence of plasmid-mediated quinolone resistance (PMQR) determinants and characterization of chromosomal mutations. E. coli resistant to nalidixic acid occurred in grandparent birds imported to Sweden for breeding purposes. Four predominant MLVA types were identified in isolates from grandparent birds, parent birds and broilers. However, resistant E. coli with identical MLVA patterns were also present in hatcheries and poultry houses suggesting that the environment plays a role in the occurrence. Nalidixic acid resistance was due to a mutation in the gyrA gene and no PMQR could be identified. The occurrence of identical clones in all levels of the production pyramid points to that quinolone resistant E. coli can be introduced through imported breeding birds and spread by vertical transmission to all levels of the broiler production pyramid.

  2. Negative inbreeding effects in tree fruit breeding: self-compatibility transmission in almond.

    Science.gov (United States)

    Alonso Segura, J M; Socias I Company, R

    2007-07-01

    Inbreeding depression has been observed in most fruit trees, negatively affecting the offspring of related parents. This problem is steadily increasing due to the repeated utilization of parents in breeding programmes. In almond, self-compatibility transmission from 'Tuono' to its offspring remains partially unexplained due to deviations from the expected genotype ratios. In order to test if these deviations could be due to inbreeding, the S-genotypes of the seedlings of four almond families, 'Tuono' (S(1)S(f )) x 'Ferragnès' (S(1)S(3)), 'Tuono' (S(1)S(f)) x 'Ferralise' (S(1)S(3)) and reciprocal crosses were studied. The S-genotype determination of each seedling by separation of stylar S-RNases and by S-allele-specific PCR amplification gave identical results. The ratio of S-genotypes of the family 'Tuono' x 'Ferralise' was the one least adjusted to the expected 1:1 ratio, because the number of self-compatible seedlings (S(f)S(3)) was less than a half the number of self-incompatible ones (S(1)S(3)). A mechanism acting against inbreeding would favour cross-breeding in the following generation to increase heterozygosity. This fact stresses the need to avoid crosses between related parents in fruit breeding programmes.

  3. Automatization and familiarity in repeated checking

    NARCIS (Netherlands)

    Dek, Eliane C P; van den Hout, Marcel A.; Giele, Catharina L.; Engelhard, Iris M.

    2014-01-01

    Repeated checking paradoxically increases memory uncertainty. This study investigated the underlying mechanism of this effect. We hypothesized that as a result of repeated checking, familiarity with stimuli increases, and automatization of the checking procedure occurs, which should result in decrea

  4. CDC Vital Signs: Preventing Repeat Teen Births

    Science.gov (United States)

    ... file Error processing SSI file Preventing Repeat Teen Births Recommend on Facebook Tweet Share Compartir On this ... Too many teens, ages 15–19, have repeat births. Nearly 1 in 5 births to teens, ages ...

  5. The prevalence of subclinical endometritis and intrauterine infections in repeat breeder cows.

    Science.gov (United States)

    Pothmann, H; Prunner, I; Wagener, K; Jaureguiberry, M; de la Sota, R L; Erber, R; Aurich, C; Ehling-Schulz, M; Drillich, M

    2015-05-01

    The objectives of this study were to assess the prevalence of subclinical endometritis and the presence of common uterine pathogens in repeat breeder cows. A total of 121 cows with three or more consecutive artificial inseminations without conception and no clinical signs of disease were defined as repeat breeder cows and were enrolled in this trial. Intrauterine samples were collected with the cytobrush technique to determine the prevalence of subclinical endometritis and bacteriologic infections. Blood samples were analyzed for concentrations of progesterone and estradiol in plasma to assess ovarian activity. Furthermore, breed, parity, history of calving and postpartum uterine infection, clinical findings of transrectal palpation, and backfat thickness were analyzed as potential factors for the prevalence of subclinical endometritis in repeat breeder cows. The prevalence of subclinical endometritis in repeat breeder cows was 12.7%; but common uterine pathogens, Escherichia coli and Trueperella pyogenes, were found in only one and three cows, respectively. Ovarian activity was determined in 95.0% of all cows. Recorded variables had no effect on the prevalence of subclinical endometritis in repeat breeder cows. In conclusion, subclinical endometritis and uterine infections linked to common pathogens were playing a minor role as a cause for repeat breeder cows in this study. Alternative reasons for failure to conceive in these cows are discussed.

  6. Floral biology, breeding system and pollination ecology of an endangered tree Tetracentron sinense Oliv. (Trochodendraceae).

    Science.gov (United States)

    Gan, Xiaohong; Cao, Lingling; Zhang, Xia; Li, Huaichun

    2013-12-01

    Tetracentron sinense Oliv. is an endangered tree mainly distributed in south-central China. The breeding system and pollination ecology of T. sinense are unclear. With a conservation perspective, the floral biology, breeding system and pollination ecology of Tetracentron sinense Oliv. were investigated, in order to discuss the endangered factors related to pollination, and to provide important information for its conservation. Our results revealed four important aspects of the reproductive biology of T. sinense. 1) T. sinense usually flowers by the beginning of June, and the flowering period of the population is about two months, and the florescence of florets lasted for 15 to 24 days with delicate fragrance. 2) The pollen/ovule ratio is 720 ± 28, and the outcrossing index is three. Artificial pollination experiments showed that T. sinense is self-compatible, with facultative xenogamy and no indication of agamospermy. 3) The pollination syndrome is ambophily, and self-pollination plays an important role in fruit production if wind and insect pollination is unavailable. 4) Insect pollinators were predominantly represented by Coleoptera, Diptera and Hymenoptera. Syrphid fly and bees were the main effective pollinators. The results suggested that T. sinense exhibits a mixed-mating system, and autogamy in its breeding system may provide reproductive assurance for the population maintenance. During flowering and pollination in natural population, the decrease of population density and harsh environmental condition might be one of crucial reasons resulting in endanger for this species.

  7. Biological parameters used in setting captive-breeding quotas for Indonesia's breeding facilities.

    Science.gov (United States)

    Janssen, Jordi; Chng, Serene C L

    2017-07-03

    The commercial captive breeding of wildlife is often seen as a potential conservation tool to relieve pressure on wild populations, but laundering of wild-sourced specimens as captive bred can seriously undermine conservation efforts and provide a false sense of sustainability. Indonesia is at the center of such controversy; therefore, we examined Indonesia's captive-breeding production plan (CBPP) for 2016. We compared the biological parameters used in the CBPP with parameters in the literature and with parameters suggested by experts on each species and identified shortcomings of the CBPP. Production quotas for 99 out of 129 species were based on inaccurate or unrealistic biological parameters and production quotas deviated more than 10% from what parameters in the literature allow for. For 38 species, the quota exceeded the number of animals that can be bred based on the biological parameters (range 100-540%) calculated with equations in the CBPP. We calculated a lower reproductive output for 88 species based on published biological parameters compared with the parameters used in the CBPP. The equations used in the production plan did not appear to account for other factors (e.g., different survival rate for juveniles compared to adult animals) involved in breeding the proposed large numbers of specimens. We recommend the CBPP be adjusted so that realistic published biological parameters are applied and captive-breeding quotas are not allocated to species if their captive breeding is unlikely to be successful or no breeding stock is available. The shortcomings in the current CBPP create loopholes that mean mammals, reptiles, and amphibians from Indonesia declared captive bred may have been sourced from the wild. © 2017 Society for Conservation Biology.

  8. Expanded complexity of unstable repeat diseases

    OpenAIRE

    Polak, Urszula; McIvor, Elizabeth; Dent, Sharon Y.R.; Wells, Robert D.; Napierala, Marek.

    2012-01-01

    Unstable Repeat Diseases (URDs) share a common mutational phenomenon of changes in the copy number of short, tandemly repeated DNA sequences. More than 20 human neurological diseases are caused by instability, predominantly expansion, of microsatellite sequences. Changes in the repeat size initiate a cascade of pathological processes, frequently characteristic of a unique disease or a small subgroup of the URDs. Understanding of both the mechanism of repeat instability and molecular consequen...

  9. Effects on milk production in F1 crossbred of Alpine goat breed (♂ and Albanian goat breed (♀

    Directory of Open Access Journals (Sweden)

    Luan Hajno

    2012-07-01

    Full Text Available About 950,000 goats, farmed mostly in hilly and mountainous areas of Albania, contribute about 8% of the country’s total milk production. In order to increase milk production, farmers are currently using crosses of the local goat breed with exotic breeds, mainly the Alpine breed from France. This study examines milk production data of first lactation from 45 goats of the local breed, 82 goats of the Alpine breed and 58 F1 crosses (♂Alpine breed x ♀local breed. The goats were kept on small-scale farms according to the traditional Albanian system. Milking was carried out in the morning and evening. Kids were weaned at 65 days of age after which milking started. Milk yield was recorded twice with a 15-day interval between the two readings. Total milk yield was calculated using the Fleischmann method. The F1 goats produced 37.8 kg more milk than local breed goats although the lactation length (P<0.05 of F1 goats was six days shorter compared to that of local breed goats (P<0.05. Analysis of variance showed a highly significant effect (P<0.01 of the genotype factor on milk production. The average Cappio-Borlino curves of three genotypes indicated that the lactation curves of local breed and F1 crosses were similar. Although the F1 cross goats had 50% of their genomes from a genetically improved breed they were still able to deal with the difficult conditions that characterize the traditional extensive farming systems in Albania. Breeding pure Alpine breed or its crosses with the local goat breed improved milk production in an extensive traditional system.

  10. Breeding blanket design for ITER and prototype (DEMO) fusion reactors and breeding materials issues

    Energy Technology Data Exchange (ETDEWEB)

    Takatsu, H.; Enoeda, M. [Japan Atomic Energy Research Inst., Naka, Ibaraki (Japan). Naka Fusion Research Establishment

    1998-03-01

    Current status of the designs of the ITER breeding blanket and DEMO blankets is introduced placing emphasis on the breeding materials selection and related issues. The former design is based on the up-to-date design activities, as of October 1997, being performed jointly by Joint Central Team (JCT) and Home Teams (HT`s), while the latter is based on the DEMO blanket test module designs being proposed by each Party at the TBWG (Test Blanket Working Group) meetings. (J.P.N.)

  11. 47 CFR 97.205 - Repeater station.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Repeater station. 97.205 Section 97.205... SERVICE Special Operations § 97.205 Repeater station. (a) Any amateur station licensed to a holder of a Technician, General, Advanced or Amateur Extra Class operator license may be a repeater. A holder of...

  12. 47 CFR 22.1015 - Repeater operation.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false Repeater operation. 22.1015 Section 22.1015... Offshore Radiotelephone Service § 22.1015 Repeater operation. Offshore central stations may be used as repeater stations provided that the licensee is able to maintain control of the station, and in...

  13. Trace minerals profile of blood serum and estrual mucus in repeat breeder Kankrej cows

    Directory of Open Access Journals (Sweden)

    N F Chaudhari

    2013-06-01

    Full Text Available Aim: The study was carried out with an idea to ascertain involvement of trace minerals in failure of conception in Knakrej cow. Materials and Methods: The animals under study were comprised of 10 normal (Group-I and 20 repeat breeder (Group-II Kankrej cows. Blood samples of each repeat breeding and normally cycling cows was collected before Artificial insemination. The mucus samples were collected aseptically before breeding. The cervical mucus was diluted with triple glass distilled water at the rate of 1: 3 using vertex machine. The diluted mucus and serum was used for the trace minerals estimation. Results: The values observed for copper, iron, zinc and manganese in blood serum of normal and repeat breeding animals was 2.27 ± 0.05 vs 0.87 ± 0.02, 1.41 ± 0.02 vs 0.65 ± 0.01, 1.94 ± 0.01 vs 1.78 ± 0.02 and 0.43 ± 0.02 vs 0.18 ± 0.01 ppm, respectively and in estrual mucus it was 1.37 ± 0.10 vs 0.44 ± 0.06, 0.74 ± 0.07 vs 0.33 ± 0.05, 1.47 ± 0.10 vs 0.82 ± 0.06 and 0.29 ± 0.04 vs 0.23 ± 0.03 ppm, respectively. All the values in blood serum and estrual mucus were significantly (p<0.01 higher in normal than repeat breeder cows except manganese in estrual mucus, which was non significantly higher in normal as compared to repeat breeder Kankrej cows. Conclusion: All trace minerals was higher in blood serum of normal animals as compared to repeat breeder. In estrual mucus except manganese, all trace minerals was higher in normal cows than repeat breeder. [Vet World 2013; 6(3.000: 143-146

  14. ProtRepeatsDB: a database of amino acid repeats in genomes

    Directory of Open Access Journals (Sweden)

    Chauhan Virander S

    2006-07-01

    Full Text Available Abstract Background Genome wide and cross species comparisons of amino acid repeats is an intriguing problem in biology mainly due to the highly polymorphic nature and diverse functions of amino acid repeats. Innate protein repeats constitute vital functional and structural regions in proteins. Repeats are of great consequence in evolution of proteins, as evident from analysis of repeats in different organisms. In the post genomic era, availability of protein sequences encoded in different genomes provides a unique opportunity to perform large scale comparative studies of amino acid repeats. ProtRepeatsDB http://bioinfo.icgeb.res.in/repeats/ is a relational database of perfect and mismatch repeats, access to which is designed as a resource and collection of tools for detection and cross species comparisons of different types of amino acid repeats. Description ProtRepeatsDB (v1.2 consists of perfect as well as mismatch amino acid repeats in the protein sequences of 141 organisms, the genomes of which are now available. The web interface of ProtRepeatsDB consists of different tools to perform repeat s; based on protein IDs, organism name, repeat sequences, and keywords as in FASTA headers, size, frequency, gene ontology (GO annotation IDs and regular expressions (REGEXP describing repeats. These tools also allow formulation of a variety of simple, complex and logical queries to facilitate mining and large-scale cross-species comparisons of amino acid repeats. In addition to this, the database also contains sequence analysis tools to determine repeats in user input sequences. Conclusion ProtRepeatsDB is a multi-organism database of different types of amino acid repeats present in proteins. It integrates useful tools to perform genome wide queries for rapid screening and identification of amino acid repeats and facilitates comparative and evolutionary studies of the repeats. The database is useful for identification of species or organism specific

  15. Fitness consequences of timing of migration and breeding in cormorants.

    Directory of Open Access Journals (Sweden)

    Phillip Gienapp

    Full Text Available In most bird species timing of breeding affects reproductive success whereby early breeding is favoured. In migratory species migration time, especially arrival at the breeding grounds, and breeding time are expected to be correlated. Consequently, migration time should also have fitness consequences. However, in contrast to breeding time, evidence for fitness consequences of migration time is much more limited. Climate change has been shown to negatively affect the synchrony between trophic levels thereby leading to directional selection on timing but again direct evidence in avian migration time is scarce. We here analysed fitness consequences of migration and breeding time in great cormorants and tested whether climate change has led to increased selection on timing using a long-term data set from a breeding colony on the island of Vorsø (Denmark. Reproductive success, measured as number of fledglings, correlated with breeding time and arrival time at the colony and declined during the season. This seasonal decline became steeper during the study period for both migration and breeding time and was positively correlated to winter/spring climate, i.e. selection was stronger after warmer winters/springs. However, the increasing selection pressure on timing seems to be unrelated to climate change as the climatic variables that were related to selection strength did not increase during the study period. There is indirect evidence that phenology or abundances of preferred prey species have changed which could have altered selection on timing of migration and breeding.

  16. Simulation Modeling in Plant Breeding: Principles and Applications

    Institute of Scientific and Technical Information of China (English)

    WANG Jian-kang; Wolfgang H Pfeiffer

    2007-01-01

    Conventional plant breeding largely depends on phenotypic selection and breeder's experience, therefore the breeding efficiency is low and the predictions are inaccurate. Along with the fast development in molecular biology and biotechnology, a large amount of biological data is available for genetic studies of important breeding traits in plants,which in turn allows the conduction of genotypic selection in the breeding process. However, gene information has not been effectively used in crop improvement because of the lack of appropriate tools. The simulation approach can utilize the vast and diverse genetic information, predict the cross performance, and compare different selection methods. Thus,the best performing crosses and effective breeding strategies can be identified. QuLine is a computer tool capable of defining a range, from simple to complex genetic models, and simulating breeding processes for developing final advanced lines. On the basis of the results from simulation experiments, breeders can optimize their breeding methodology and greatly improve the breeding efficiency. In this article, the underlying principles of simulation modeling in crop enhancement is initially introduced, following which several applications of QuLine are summarized, by comparing the different selection strategies, the precision parental selection, using known gene information, and the design approach in breeding. Breeding simulation allows the definition of complicated genetic models consisting of multiple alleles, pleiotropy, epistasis, and genes, by environment interaction, and provides a useful tool for breeders, to efficiently use the wide spectrum of genetic data and information available.

  17. Breeding implications resulting from classification of patellae luxation in dogs.

    Science.gov (United States)

    van Grevenhof, E M; Hazewinkel, H A W; Heuven, H C M

    2016-08-01

    Patellar luxation (PL) is one of the major hereditary orthopaedic abnormalities observed in a variety of dog breeds. When the patellae move sideways out of the trochlear groove, this is called PL. The PL score varies between dogs from normal to very severe. Reducing the prevalence of PL by breeding could prevent surgery, thereby improve welfare. Orthopaedic specialists differentiate between normal and loose patellae, where the patellae can be moved to the edge of the trochlear groove, considering scoring loose patellae as normal in the future. Loose patellae are considered acceptable for breeding so far by the breeding organization. The aim of this study was to analyse the genetic background of PL to decide on the importance of loose patellae when breeding for healthy dogs. Data are available from two dog breeds, that is Flat-coated Retrievers (n = 3808) and Kooiker dogs (n = 794), with a total of 4602 dogs. Results show that loose patellae indicate that dogs are genetically more susceptible to develop PL because family members of the dogs with loose patellae showed more severe PL. In addition, the estimated breeding values for dogs with loose patellae indicate that breeding values of dogs with loose patellae were worse than breeding values obtained for dogs with a normal score. Given these results, it is advised to orthopaedic specialists to continue to score loose patellae as a separate class and to dog breeders to minimize the use of dogs in breeding with a genetically higher susceptibility for PL.

  18. Tourette Syndrome

    Science.gov (United States)

    ... vocal tics including coprolalia (uttering swear words) or echolalia (repeating the words or phrases of others). Many ... vocal tics including coprolalia (uttering swear words) or echolalia (repeating the words or phrases of others). Many ...

  19. Breed of cow and herd productivity affect milk composition and modeling of coagulation, curd firming, and syneresis.

    Science.gov (United States)

    Stocco, G; Cipolat-Gotet, C; Bobbo, T; Cecchinato, A; Bittante, G

    2017-01-01

    Milk coagulation properties (MCP) have been widely investigated in the past using milk collected from different cattle breeds and herds. However, to our knowledge, no previous studies have assessed MCP in individual milk samples from several multi-breed herds characterized by either high or low milk productivity, thereby allowing the effects of herd and cow breed to be evaluated independently. Multi-breed herds (n=41) were classified into 2 categories based on milk productivity (high vs. low), defined according to the average milk net energy yielded daily by lactating cows. Milk samples were taken from 1,508 cows of 6 different breeds: 3 specialized dairy (Holstein-Friesian, Brown Swiss, Jersey) and 3 dual-purpose (Simmental, Rendena, Alpine Grey) breeds, and analyzed in duplicate (3,016 tests) using 2 lactodynamographs to obtain 240 curd firming (CF) measurements over 60min (1 every 15 s) for each duplicate. The 5 traditional single-point MCP (RCT, k20, a30, a45, and a60) were yielded directly by the instrument from the available CF measures. All 240 CF measures of each replicate were also used to estimate 4 individual equation parameters: RCT estimated according to curd firm change over time modeling (RCTeq), asymptotic potential curd firmness (CFP), curd firming instant rate constant (kCF), and syneresis instant rate constant (kSR) and 2 derived traits: maximum curd firmness achieved within 45min (CFmax) and time at achievement of CFmax (tmax) by curvilinear regression using a nonlinear procedure. Results showed that the effect of herd-date on traditional and modeled MCP was modest, ranging from 6.1% of total variance for k20 to 10.7% for RCT, whereas individual animal variance was the highest, ranging from 32.0% for tmax to 82.5% for RCTeq. The repeatability of MCP was high (>80%) for all traits except those associated with the last part of the lactodynamographic curve (i.e., a60, kSR, kCF, and tmax: 57 to 71%). Reproducibility, taking into account the effect

  20. Pentatricopeptide repeat proteins in plants.

    Science.gov (United States)

    Barkan, Alice; Small, Ian

    2014-01-01

    Pentatricopeptide repeat (PPR) proteins constitute one of the largest protein families in land plants, with more than 400 members in most species. Over the past decade, much has been learned about the molecular functions of these proteins, where they act in the cell, and what physiological roles they play during plant growth and development. A typical PPR protein is targeted to mitochondria or chloroplasts, binds one or several organellar transcripts, and influences their expression by altering RNA sequence, turnover, processing, or translation. Their combined action has profound effects on organelle biogenesis and function and, consequently, on photosynthesis, respiration, plant development, and environmental responses. Recent breakthroughs in understanding how PPR proteins recognize RNA sequences through modular base-specific contacts will help match proteins to potential binding sites and provide a pathway toward designing synthetic RNA-binding proteins aimed at desired targets.

  1. Two-dimensional quantum repeaters

    Science.gov (United States)

    Wallnöfer, J.; Zwerger, M.; Muschik, C.; Sangouard, N.; Dür, W.

    2016-11-01

    The endeavor to develop quantum networks gave rise to a rapidly developing field with far-reaching applications such as secure communication and the realization of distributed computing tasks. This ultimately calls for the creation of flexible multiuser structures that allow for quantum communication between arbitrary pairs of parties in the network and facilitate also multiuser applications. To address this challenge, we propose a two-dimensional quantum repeater architecture to establish long-distance entanglement shared between multiple communication partners in the presence of channel noise and imperfect local control operations. The scheme is based on the creation of self-similar multiqubit entanglement structures at growing scale, where variants of entanglement swapping and multiparty entanglement purification are combined to create high-fidelity entangled states. We show how such networks can be implemented using trapped ions in cavities.

  2. General benchmarks for quantum repeaters

    CERN Document Server

    Pirandola, Stefano

    2015-01-01

    Using a technique based on quantum teleportation, we simplify the most general adaptive protocols for key distribution, entanglement distillation and quantum communication over a wide class of quantum channels in arbitrary dimension. Thanks to this method, we bound the ultimate rates for secret key generation and quantum communication through single-mode Gaussian channels and several discrete-variable channels. In particular, we derive exact formulas for the two-way assisted capacities of the bosonic quantum-limited amplifier and the dephasing channel in arbitrary dimension, as well as the secret key capacity of the qubit erasure channel. Our results establish the limits of quantum communication with arbitrary systems and set the most general and precise benchmarks for testing quantum repeaters in both discrete- and continuous-variable settings.

  3. Hungarian repeat station survey, 2010

    Directory of Open Access Journals (Sweden)

    Péter Kovács

    2013-03-01

    Full Text Available The last Hungarian repeat station survey was completed between October 2010 and February 2011. Declination, inclination and the total field were observed using one-axial DMI fluxgate magnetometer mounted on Zeiss20A theodolite and GSM 19 Overhauser magnetometer. The magnetic elements of the sites were reduced to the epoch of 2010.5 on the basis of the continuous recordings of Tihany Geophysical Observatory. In stations located far from the reference observatory, the observations were carried out in the morning and afternoon in order to decrease the effect of the distant temporal correction. To further increase the accuracy, on-site dIdD variometer has also been installed near the Aggtelek station, in the Baradla cave, during the survey of the easternmost sites. The paper presents the technical details and the results of our last campaign. The improvement of the accuracy of the temporal reduction by the use of the local variometer is also reported.

  4. Quality control during repeated fryings

    Directory of Open Access Journals (Sweden)

    Cuesta, C.

    1998-08-01

    Full Text Available Most of the debate ¡s about how the slow or frequent turnover of fresh fat affects the deterioration, of fat used in frying. Then, the modification of different oils used in repeated fryings of potatoes without or with turnover of fresh oil, under similar frying conditions, was evaluated by two criteria: by measuring the total polar component isolated by column chromatography and by the evaluation of the specific compounds related to thermoxidative and hydrolytic alteration by High Performance Size Exclusion Chromatography (HPSEC. The results indicate that with frequent turnover of fresh oil, the critical level of 25% of polar material is rarely reached, and there are fewer problems with fat deterioration because the frying tended to increase the level of polar material and thermoxidative compounds (polymers and dimers of triglycerides and oxidized triglycerides in the fryer oil during the first fryings, followed by minor changes and a tendency to reach a near-steady state in successive fryings. However, in repeated frying of potatoes using a null turnover the alteration rate was higher being linear the relationship found between polar material or the different thermoxidative compounds and the number of fryings. On the other hand chemical reactions produced during deep-fat frying can be minimized by using proper oils. In addition the increased level of consumers awareness toward fat composition and its impact on human health could had an impact on the selection of fats for snacks and for industry. In this way monoenic fats are the most adequate from a nutritional point of view and for its oxidative stability during frying.

  5. Effect of repeated morphine withdrawal on spatial learning, memory and serum cortisol level in mice

    Directory of Open Access Journals (Sweden)

    Mahdieh Matinfar

    2013-01-01

    Full Text Available Background: One of the serious problems that opioid addicted people are facing is repeated withdrawal syndrome that is accompanying with a significant stress load for addicts. Therefore, the aim of this study was to evaluate the effects of repeated withdrawal on spatial learning, memory and serum cortisol levels in morphine-dependent mice. Materials and Methods: Male NMRI mice received morphine as daily increasing doses for 3 days. After that, the mice underwent one time or repeated spontaneous or pharmacologic (naloxone-precipitated withdrawal. Then spatial learning and memory were investigated by morris water maze test, and at the end trunk blood samples were collected for measurement of serum cortisol levels. Results: The results showed that only repeated spontaneous withdrawal significantly increases escape latency ( P < 0.05, and in other models of withdrawal, spatial learning and memory were intact. The results of probe trial were intact in all groups. Radioimmunoassay showed that serum cortisol levels were increased significantly in all models of withdrawal ( P < 0.05 and P < 0.01 except the repeated spontaneous withdrawal. Conclusion: The results showed that short periods of withdrawal syndrome can increase serum cortisol levels; however they do not affect spatial learning and memory. Nevertheless, repeated spontaneous withdrawal can make learning slow.

  6. Milk yield of some Croatian sheep breeds

    OpenAIRE

    Kristijan Pandek; Boro Mioč; Zdravko Barać; Vesna Pavić; Neven Antunac; Zvonimir Prpić

    2005-01-01

    Among the most important breeds of sheep, used for the milk production in Croatia, are the sheep from Pag, Brač, Cres, Istrian and Travnik΄s sheep, different crossbreeds and, recently, East Friesian sheep. The aim of the research was to determine the genotype effect on lactation period, milk yield and protein and fat content, which are important in cheese making. The longest lactation period (213 days) had East Friesian sheep, while the highest total milk production (294 kg) and the highest p...

  7. Strategy for larch breeding in Iceland

    Energy Technology Data Exchange (ETDEWEB)

    Eysteinsson, T. [Iceland Forest Service, Egilsstadir (Iceland)

    1995-12-31

    An accelerated breeding program for Siberian larch was initiated in Iceland in 1992. Siberian larch is an important exotic species, but not fully adapted to Icelandic conditions. Selections are made based on adaptive traits such as growth rhythm and resistance to damage as well as form and growth rate. Seed will be produced in containerised, greenhouse orchards, necessitating selection for fecundity to best use expensive greenhouse space. Research will concentrate on developing flower induction treatments for Siberian larch and ways to maximize seed production and viability. 19 refs

  8. Studies on mutation breeding of hibiscus syriacuse

    Energy Technology Data Exchange (ETDEWEB)

    Song, Hee Sub; Kim, Jin Kyu; Lee, Ki Un; Lim, Yong Taek [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

    1995-12-01

    Hibiscus has been known as a national flower of Korea. Hibiscus has ahch a characteristic of self-incompatibility that all the plants exist as natural hybrids and have heterogeneous genes. Thirth two domestic varieties were propagated. Radiosensitivity of H. syriacus irradiated with gamma ray was investigated in plant cuttings. The plant height was reduced by 45 percent in 5 kR irradiated group compared to control group. The radiation dose of 5 kR could be rrecommended for mutation breeding of Hibiscus cuttings. Promising mutant lines were selected form the varieties of Hwarang Wolsan 176, I1pyondansim and Emille. 6 tabs., 2 figs., 13 refs., 4 ills. (Author).

  9. Advances in Japanese pear breeding in Japan

    OpenAIRE

    Saito, Toshihiro

    2016-01-01

    The Japanese pear (Pyrus pyrifolia Nakai) is one of the most widely grown fruit trees in Japan, and it has been used throughout Japan’s history. The commercial production of pears increased rapidly with the successive discoveries of the chance seedling cultivars ‘Chojuro’ and ‘Nijisseiki’ around 1890, and the development of new cultivars has continued since 1915. The late-maturing, leading cultivars ‘Niitaka’ and ‘Shinko’ were released during the initial breeding stage. Furthermore, systemati...

  10. Breeding Potential in Danish Apple Cultivar

    DEFF Research Database (Denmark)

    Larsen, Bjarne

    , including several rare alleles. Using historical gene bank records, including aroma volatile analysis, sugar and acid data and other fruit- and tree character records, we established genotype-phenotype relationships, performing a genome-wide association study. A number of SNP markers are presented that can...... be used directly for marker-assisted selection. In addition, we suggest a number of candidate genes involved in the control of several important fruit quality traits. Future studies and breeding attempts can therefore benefit from the results, including genetic fingerprints and pedigree reconstruction...

  11. Veal fatty acid composition of different breeds

    Directory of Open Access Journals (Sweden)

    Ivica Kos

    2010-01-01

    Full Text Available Veal fatty acid composition in M. Longissimus thoracis was investigated in different calf breeds (Simmental, Holstein, Simmental x Holstein. Calves were reared on the same farm under identical feeding and handling conditions. Simmental calves had higher polyunsaturated fatty acid (PUFA but lower saturated fatty acid (SFA and monounsaturated fatty acid (MUFA values than Holstein and crossbreed calves (P<0,05. The PUFA/SFA ratio was the highest in Simmental calves and the lowest in Holstein calves. Simmental calves also had the highest n-6/n-3 ratio while the crossbreed calves had the lowest n-6/n-3 ratio.

  12. Review: Towards the agroecological management of ruminants, pigs and poultry through the development of sustainable breeding programmes. II. Breeding strategies.

    Science.gov (United States)

    Phocas, F; Belloc, C; Bidanel, J; Delaby, L; Dourmad, J Y; Dumont, B; Ezanno, P; Fortun-Lamothe, L; Foucras, G; Frappat, B; González-García, E; Hazard, D; Larzul, C; Lubac, S; Mignon-Grasteau, S; Moreno, C R; Tixier-Boichard, M; Brochard, M

    2016-11-01

    Agroecology uses ecological processes and local resources rather than chemical inputs to develop productive and resilient livestock and crop production systems. In this context, breeding innovations are necessary to obtain animals that are both productive and adapted to a broad range of local contexts and diversity of systems. Breeding strategies to promote agroecological systems are similar for different animal species. However, current practices differ regarding the breeding of ruminants, pigs and poultry. Ruminant breeding is still an open system where farmers continue to choose their own breeds and strategies. Conversely, pig and poultry breeding is more or less the exclusive domain of international breeding companies which supply farmers with hybrid animals. Innovations in breeding strategies must therefore be adapted to the different species. In developed countries, reorienting current breeding programmes seems to be more effective than developing programmes dedicated to agroecological systems that will struggle to be really effective because of the small size of the populations currently concerned by such systems. Particular attention needs to be paid to determining the respective usefulness of cross-breeding v. straight breeding strategies of well-adapted local breeds. While cross-breeding may offer some immediate benefits in terms of improving certain traits that enable the animals to adapt well to local environmental conditions, it may be difficult to sustain these benefits in the longer term and could also induce an important loss of genetic diversity if the initial pure-bred populations are no longer produced. As well as supporting the value of within-breed diversity, we must preserve between-breed diversity in order to maintain numerous options for adaptation to a variety of production environments and contexts. This may involve specific public policies to maintain and characterize local breeds (in terms of both phenotypes and genotypes), which could

  13. Integrated control of gastrointestinal nematodes in lambs using a bioactive feed × breed approach.

    Science.gov (United States)

    Werne, S; Isensee, A; Maurer, V; Perler, E; Drewek, A; Heckendorn, F

    2013-12-06

    Forages rich in condensed tannins have repeatedly shown potential to reduce gastrointestinal nematode infection in sheep. Similarly, several breeds of sheep have shown a relative resistance to gastrointestinal nematodes (GIN). We hypothesised that additive or even synergic effects may arise from the combination of a relatively resistant breed and a diet rich in condensed tannins. In study I, 160 lambs of the native Red Engadine Sheep (RES) and 113 lambs of the Swiss White Alpine sheep (SWA) were artificially infected with GIN and subsequently grazed for 52 days. The lambs were then distributed to 2 groups for a 14-day experimental feeding period. One group received a diet with a proportion of 55% sainfoin and was compared to a control group on the basis of faecal egg counts (FEC). In study II, 25 RES and 27 SWA lambs grazed infectious pastures for 37 days and were subsequently fed for 13 consecutive days with approximately 100% sainfoin or control forage. In addition to the FEC determination at the start and the end of the experimental feeding, the 52 lambs in study II were slaughtered and necropsied to determine their worm burden. FEC at the end of the feeding period were significantly lower in sainfoin fed lambs compared to controls in study I (pnematode genera found in the sacrificed lambs of study II were Haemonchus spp., Teladorsagia spp., Nematodirus spp. and Trichostrongylus spp. Overall, RES had a significantly lower Haemonchus spp. (p=0.035) and Trichostrongylus spp. (p=0.003) worm burden compared to SWA. Regardless of breed, sainfoin feeding significantly reduced Teladorsagia spp. (p=0.049) and Nematodirus spp. (p<0.001) worm burden. Although, we could not demonstrate additive or synergic effects when using an integrated breed × sainfoin approach, the finding that a proportion of only 55% sainfoin in the diet led to a lower FEC compared to controls is important with respect to the implementation on producing farms.

  14. Toward Genomics-Based Breeding in C3 Cool-Season Perennial Grasses.

    Science.gov (United States)

    Talukder, Shyamal K; Saha, Malay C

    2017-01-01

    Most important food and feed crops in the world belong to the C3 grass family. The future of food security is highly reliant on achieving genetic gains of those grasses. Conventional breeding methods have already reached a plateau for improving major crops. Genomics tools and resources have opened an avenue to explore genome-wide variability and make use of the variation for enhancing genetic gains in breeding programs. Major C3 annual cereal breeding programs are well equipped with genomic tools; however, genomic research of C3 cool-season perennial grasses is lagging behind. In this review, we discuss the currently available genomics tools and approaches useful for C3 cool-season perennial grass breeding. Along with a general review, we emphasize the discussion focusing on forage grasses that were considered orphan and have little or no genetic information available. Transcriptome sequencing and genotype-by-sequencing technology for genome-wide marker detection using next-generation sequencing (NGS) are very promising as genomics tools. Most C3 cool-season perennial grass members have no prior genetic information; thus NGS technology will enhance collinear study with other C3 model grasses like Brachypodium and rice. Transcriptomics data can be used for identification of functional genes and molecular markers, i.e., polymorphism markers and simple sequence repeats (SSRs). Genome-wide association study with NGS-based markers will facilitate marker identification for marker-assisted selection. With limited genetic information, genomic selection holds great promise to breeders for attaining maximum genetic gain of the cool-season C3 perennial grasses. Application of all these tools can ensure better genetic gains, reduce length of selection cycles, and facilitate cultivar development to meet the future demand for food and fodder.

  15. Toward Genomics-Based Breeding in C3 Cool-Season Perennial Grasses

    Directory of Open Access Journals (Sweden)

    Shyamal K. Talukder

    2017-07-01

    Full Text Available Most important food and feed crops in the world belong to the C3 grass family. The future of food security is highly reliant on achieving genetic gains of those grasses. Conventional breeding methods have already reached a plateau for improving major crops. Genomics tools and resources have opened an avenue to explore genome-wide variability and make use of the variation for enhancing genetic gains in breeding programs. Major C3 annual cereal breeding programs are well equipped with genomic tools; however, genomic research of C3 cool-season perennial grasses is lagging behind. In this review, we discuss the currently available genomics tools and approaches useful for C3 cool-season perennial grass breeding. Along with a general review, we emphasize the discussion focusing on forage grasses that were considered orphan and have little or no genetic information available. Transcriptome sequencing and genotype-by-sequencing technology for genome-wide marker detection using next-generation sequencing (NGS are very promising as genomics tools. Most C3 cool-season perennial grass members have no prior genetic information; thus NGS technology will enhance collinear study with other C3 model grasses like Brachypodium and rice. Transcriptomics data can be used for identification of functional genes and molecular markers, i.e., polymorphism markers and simple sequence repeats (SSRs. Genome-wide association study with NGS-based markers will facilitate marker identification for marker-assisted selection. With limited genetic information, genomic selection holds great promise to breeders for attaining maximum genetic gain of the cool-season C3 perennial grasses. Application of all these tools can ensure better genetic gains, reduce length of selection cycles, and facilitate cultivar development to meet the future demand for food and fodder.

  16. Syndromic autism: II. Genetic syndromes associated with autism

    National Research Council Canada - National Science Library

    Artigas-Pallarés, J; Gabau-Vila, E; Guitart-Feliubadaló, M

    2005-01-01

    ..., tuberous sclerosis, Duchenne's disease, Timothy syndrome, 10p terminal deletion, Cowden syndrome, 45,X/46,XY mosaicism, Myhre syndrome, Sotos syndrome, Cohen syndrome, Goldenhar syndrome, Joubert...

  17. Edwards' syndrome.

    Science.gov (United States)

    Crawford, Doreen; Dearmun, Annette

    2016-12-08

    Edwards' syndrome is a serious genetic condition that affects fetal cellular functions, tissue development and organogenesis. Most infants with the syndrome are female, but there is no race predominance.

  18. Dravet Syndrome

    Science.gov (United States)

    ... Craniosynostosis Information Page Creutzfeldt-Jakob Disease Information Page Cushing's Syndrome Information Page Dandy-Walker Syndrome Information Page Deep Brain Stimulation for Parkinson's Disease Information Page Dementia Information ...

  19. Paraneoplastic Syndromes

    Science.gov (United States)

    ... dementia, seizures, sensory loss in the limbs, and vertigo or dizziness. Paraneoplastic syndromes include Lambert-Eaton myasthenic ... dementia, seizures, sensory loss in the limbs, and vertigo or dizziness. Paraneoplastic syndromes include Lambert-Eaton myasthenic ...

  20. Turner Syndrome

    Science.gov (United States)

    Turner syndrome is a genetic disorder that affects a girl's development. The cause is a missing or incomplete ... t work properly. Other physical features typical of Turner syndrome are Short, "webbed" neck with folds of skin ...

  1. Cushing's Syndrome

    Science.gov (United States)

    Cushing's syndrome is a hormonal disorder. The cause is long-term exposure to too much cortisol, a hormone ... cause your body to make too much cortisol. Cushing's syndrome is rare. Some symptoms are Upper body obesity ...

  2. Lynch Syndrome

    Science.gov (United States)

    ... colon cancer may include surgery, chemotherapy and radiation therapy. Cancer screening for people with Lynch syndrome If you ... et al. Milestones of Lynch syndrome: 1895-2015. Nature Reviews Cancer. http://www.nature.com/nrc/journal/vaop/ncurrent/ ...

  3. Metabolic Syndrome

    Science.gov (United States)

    Metabolic syndrome is a group of conditions that put you at risk for heart disease and diabetes. These ... doctors agree on the definition or cause of metabolic syndrome. The cause might be insulin resistance. Insulin is ...

  4. Meckel syndrome

    National Research Council Canada - National Science Library

    Salonen, R; Paavola, P

    1998-01-01

    Meckel syndrome (MKS) is a lethal syndrome with a central nervous system malformation, usually occipital meningoencephalocele, bilaterally large multicystic kidneys with fibrotic changes of the liver, and polydactyly in most cases...

  5. Angelman Syndrome

    Science.gov (United States)

    ... this syndrome often display hyperactivity, small head size, sleep disorders, and movement and balance disorders that can cause ... this syndrome often display hyperactivity, small head size, sleep disorders, and movement and balance disorders that can cause ...

  6. Apert Syndrome.

    Science.gov (United States)

    Datta, Saikat; Saha, Sandip; Kar, Arnab; Mondal, Souvonik; Basu, Syamantak

    2014-09-01

    Apert syndrome is one of the craniosynostosis syndromes which, due to its association with other skeletal anomalies, is also known as acrocephalosyndactyly. It is a rare congenital anomaly which stands out from other craniosynostosis due to its characteristic skeletal presentations.

  7. Learning about Down Syndrome

    Science.gov (United States)

    ... genetic terms used on this page Learning About Down Syndrome What is Down syndrome? What are the symptoms ... syndrome Additional Resources for Down Syndrome What is Down syndrome? Down syndrome is a chromosomal condition related to ...

  8. Assessing the Genetic Diversity and Genealogical Reconstruction of Cypress (Cupressus funebris Endl. Breeding Parents Using SSR Markers

    Directory of Open Access Journals (Sweden)

    Hanbo Yang

    2016-07-01

    Full Text Available To identify genetic diversity, genetic structure and the relationship among accessions, and further establish a core collection for the long-term breeding of cypress (Cupressus funebris Endl., the genealogy of breeding parents was reconstructed using simple sequence repeat (SSR molecular markers. Seventeen SSR markers were used to detect molecular polymorphisms among 290 cypress accessions from five provinces and 53 accessions with unknown origin in China. A total of 92 alleles (Na were detected with 5.412 alleles per locus and an average polymorphism information content (PIC of 0.593. The haplotype diversity (H ranged from 0.021 to 0.832, with an average of 0.406. The number of alleles (Na and the effective number of alleles (Ne ranged from 4.294 to 5.176 and from 2.488 to 2.817 among five populations, respectively. The pairwise population matrix of Nei’s genetic distance ranged from 0.008 to 0.023. Based on the results of unweighted pair group method average (UPGMA cluster and population structure analyses, 343 breeding parents were divided into two major groups. Lower genetic differentiation coefficients and closer genetic relationships were observed among cypress breeding parents, suggesting that the genetic basis was narrow, and the genetic relationship was confused by frequent introduction and wide cultivation. Moreover, we reconstructed the genealogy between breeding parents and 30 accessions of breeding parents from an identified core collection. According to the present study, not only geographic origin but also the relationship of the individuals should be considered in future crossbreeding work.

  9. Studies of the CAG repeat in the Machado-Joseph disease gene in Taiwan.

    Science.gov (United States)

    Hsieh, M; Tsai, H F; Lu, T M; Yang, C Y; Wu, H M; Li, S Y

    1997-08-01

    Machado-Joseph disease (MJD) is an autosomal dominant spinocerebellar degeneration characterized by cerebellar ataxia and pyramidal signs associated in varying degrees with a dystonic-rigid extrapyramidal syndrome or peripheral amyotrophy. Unstable CAG trinucleotide repeat expansion in the MJD gene on the long arm of chromosome 14 has been identified as the pathological mutation for MJD. While investigating the distribution of CAG repeat lengths of the MJD gene in Taiwan's population, we have identified 18 MJD-affected patients and 12 at-risk individuals in seven families. In addition, we have analyzed the range of CAG repeat lengths in 96 control individuals. The CAG repeat number ranged from 13 to 44 in the controls and 72-85 in the affected and at-risk individuals. Our results indicated that the CAG repeat number was inversely correlated with the age of onset. The differences in CAG repeat length between parent and child and between siblings are greater with paternal transmission than maternal transmission. Our data show a tendency towards the phenomenon of anticipation in the MJD families but do not support unidirectional expansion of CAG repeats during transmission. We also demonstrated that PCR amplification of the CAG repeats in the MJD gene from villous DNA was possible and might prove useful as a diagnostic tool for affected families in the future.

  10. Genome-wide genetic changes during modern breeding of maize.

    Science.gov (United States)

    Jiao, Yinping; Zhao, Hainan; Ren, Longhui; Song, Weibin; Zeng, Biao; Guo, Jinjie; Wang, Baobao; Liu, Zhipeng; Chen, Jing; Li, Wei; Zhang, Mei; Xie, Shaojun; Lai, Jinsheng

    2012-06-03

    The success of modern maize breeding has been demonstrated by remarkable increases in productivity over the last four decades. However, the underlying genetic changes correlated with these gains remain largely unknown. We report here the sequencing of 278 temperate maize inbred lines from different stages of breeding history, including deep resequencing of 4 lines with known pedigree information. The results show that modern breeding has introduced highly dynamic genetic changes into the maize genome. Artificial selection has affected thousands of targets, including genes and non-genic regions, leading to a reduction in nucleotide diversity and an increase in the proportion of rare alleles. Genetic changes during breeding happen rapidly, with extensive variation (SNPs, indels and copy-number variants (CNVs)) occurring, even within identity-by-descent regions. Our genome-wide assessment of genetic changes during modern maize breeding provides new strategies as well as practical targets for future crop breeding and biotechnology.

  11. Phenotypic Diagnosis of Lineage and Differentiation During Sake Yeast Breeding.

    Science.gov (United States)

    Ohnuki, Shinsuke; Okada, Hiroki; Friedrich, Anne; Kanno, Yoichiro; Goshima, Tetsuya; Hasuda, Hirokazu; Inahashi, Masaaki; Okazaki, Naoto; Tamura, Hiroyasu; Nakamura, Ryo; Hirata, Dai; Fukuda, Hisashi; Shimoi, Hitoshi; Kitamoto, Katsuhiko; Watanabe, Daisuke; Schacherer, Joseph; Akao, Takeshi; Ohya, Yoshikazu

    2017-08-07

    Sake yeast was developed exclusively in Japan. Its diversification during breeding remains largely uncharacterized. To evaluate the breeding processes of the sake lineage, we thoroughly investigated the phenotypes and differentiation of 27 sake yeast strains using high-dimensional, single-cell, morphological phenotyping. Although the genetic diversity of the sake yeast lineage is relatively low, its morphological diversity has expanded substantially compared to that of the Saccharomycescerevisiae species as a whole. Evaluation of the different types of breeding processes showed that the generation of hybrids (crossbreeding) has more profound effects on cell morphology than the isolation of mutants (mutation breeding). Analysis of phenotypic robustness revealed that some sake yeast strains are more morphologically heterogeneous, possibly due to impairment of cellular network hubs. This study provides a new perspective for studying yeast breeding genetics and micro-organism breeding strategies. Copyright © 2017 Ohnuki et al.

  12. Characterization of the genetic profile of five Danish dog breeds

    DEFF Research Database (Denmark)

    Pertoldi, Cino; Kristensen, Torsten Nygaard; Loeschcke, Volker

    2013-01-01

    was determined by means of principal component analysis (PCA) and through a Bayesian clustering method. Both the PCA and the Bayesian clustering method revealed a clear genetic separation of the 5 breeds. The level of genetic variation within the breeds varied. The expected heterozygosity (H) as well......This investigation presents results from a genetic characterization of 5 Danish dog breeds genotyped on the CanineHD BeadChip microarray with 170,000 SNP. The breeds investigated were 1) Danish Spitz (DS; n = 8), 2) Danish-Swedish Farm Dog (DSF; n = 18), 3) Broholmer (BR; n = 22), 4) Old Danish...... Pointing Dog (ODP; n = 24), and 5) Greenland Dog (GD; n = 23). The aims of the investigation were to characterize the genetic profile of the abovementioned dog breeds by quantifying the genetic differentiation among them and the degree of genetic homogeneity within breeds. The genetic profile...

  13. Combining Breeding Bird Survey and distance sampling to estimate density of migrant and breeding birds

    Science.gov (United States)

    Somershoe, S.G.; Twedt, D.J.; Reid, B.

    2006-01-01

    We combined Breeding Bird Survey point count protocol and distance sampling to survey spring migrant and breeding birds in Vicksburg National Military Park on 33 days between March and June of 2003 and 2004. For 26 of 106 detected species, we used program DISTANCE to estimate detection probabilities and densities from 660 3-min point counts in which detections were recorded within four distance annuli. For most species, estimates of detection probability, and thereby density estimates, were improved through incorporation of the proportion of forest cover at point count locations as a covariate. Our results suggest Breeding Bird Surveys would benefit from the use of distance sampling and a quantitative characterization of habitat at point count locations. During spring migration, we estimated that the most common migrant species accounted for a population of 5000-9000 birds in Vicksburg National Military Park (636 ha). Species with average populations of 300 individuals during migration were: Blue-gray Gnatcatcher (Polioptila caerulea), Cedar Waxwing (Bombycilla cedrorum), White-eyed Vireo (Vireo griseus), Indigo Bunting (Passerina cyanea), and Ruby-crowned Kinglet (Regulus calendula). Of 56 species that bred in Vicksburg National Military Park, we estimated that the most common 18 species accounted for 8150 individuals. The six most abundant breeding species, Blue-gray Gnatcatcher, White-eyed Vireo, Summer Tanager (Piranga rubra), Northern Cardinal (Cardinalis cardinalis), Carolina Wren (Thryothorus ludovicianus), and Brown-headed Cowbird (Molothrus ater), accounted for 5800 individuals.

  14. Influence of cross-breeding of native breed sows of Zlotnicka ...

    African Journals Online (AJOL)

    ZUZA

    2011-11-16

    Nov 16, 2011 ... African Journal of Biotechnology Vol. 10(72), pp ... 1The Poznan University of Life Sciences, Department of Pig Breeding and Production, ul. Wolynska ... 2Institute of Agricultural and Food Biotechnology, Department of Meat and Fat Technology, ... them unsuitable for traditional culinary processes and aims.

  15. Elephant reproduction: improvement of breeding efficiency and development of a breeding strategy

    NARCIS (Netherlands)

    Thitaram, C.|info:eu-repo/dai/nl/304838608

    2009-01-01

    The efficiency of reproduction of the Asian elephant (Elephas maximus) has become of major concern. Captive breeding programs worldwide have met with limited success and few ex situ elephant populations are self-sustaining. The low birth rate and high mortality cause the captive population to

  16. Genetic Diversity of Some Tomato Cultivars and Breeding Lines Commonly Used in Pakistani Breeding Program

    Directory of Open Access Journals (Sweden)

    Muhammad Azhar Shah

    2014-10-01

    Full Text Available Genetic diversity present in gene pool is an important determination for breeding programs, and characterization is useful of building crop plant collections primarily based on the knowledge of the presence of valuable genes and traits. Developing successful varieties for increasing the future yield and quality of tomato depend mainly on the genetic diversity of parents used in the breeding program. Molecular characterization of 21 tomato genotypes used in in Pakistani breeding program was studied using random amplified polymorphic DNA (RAPD markers. Total 102 bands were amplified among 21 genotypes using 20 RAPD primers. Overall 73.5% polymorphism was shown as 75 out of 102 loci were polymorphic. High degree of divergence between varieties was indicated by low level of monomorphic bands. The number of PCR products per primer varied from 2-8 with an average of 5.1 bands per primer. Primer GL J-20 and GL C-09 produced maximum number of bands whereas the primers GL A-09 produced the lowest. The polymorphism per RAPD primer ranged from 50% to 100% with an average of 73.5%. The accumulative analysis of amplified products generated by RAPD’s was enough to assess the genetic diversity among the genotypes. The information would be helpful for formulating future breeding and genome mapping programs. This study will also work as an indicator for tomato breeders to evolve varieties with genetic diverse back ground to achieve sustainability in tomato production in the country.

  17. Elephant reproduction: improvement of breeding efficiency and development of a breeding strategy

    NARCIS (Netherlands)

    Thitaram, C.

    2009-01-01

    The efficiency of reproduction of the Asian elephant (Elephas maximus) has become of major concern. Captive breeding programs worldwide have met with limited success and few ex situ elephant populations are self-sustaining. The low birth rate and high mortality cause the captive population to declin

  18. Concepts and strategies of organic plant breeding in light of novel breeding techniques

    NARCIS (Netherlands)

    Nuijten, Edwin; Messmer, Monika M.; Lammerts van Bueren, Edith

    2017-01-01

    In this paper, we describe the development of a set of guiding principles for the evaluation of breeding techniques by the organic sector over time. The worldwide standards of organic agriculture (OA) do not allow genetic engineering (GE) or any products derived from genetic engineering. The

  19. Extent of linkage disequilibrium in large breed dogs: chromosomal and breed variation

    Science.gov (United States)

    Purpose: Understanding extent of linkage disequilibrium (LD) is a crucial component for successful utilization of genome-wide association studies (GWAS). The extent of LD in the dog has been described based upon small marker sets in multiple breeds and studies. Understanding variation in LD on a per...

  20. Pseudo-differentiation syndrome

    Directory of Open Access Journals (Sweden)

    Dina Khalaf

    2011-12-01

    Full Text Available A patient with relapsed acute myeloid leukemia (AML (M2 FAB classification developed a differentiating syndrome upon receiving Decitabine therapy given with palliative intent. The patient presented with high grade fever, constitutional symptoms and severe chest symptoms with no underlying lung condition. Chest x-ray (CXR showed diffuse pulmonary infiltrates. Septic work up followed by intravenous broad spectrum antimicrobials did not improve his condition. Pan cultures’ results were repeatedly negative. Treatment with high dose Dexamethasone (DXM resulted in marked clinical and radiological improvement. Our patient initially presented with relapsed AML (M2 Fab classification with t (8; 21; negative FMS-like tyrosine kinase -internal tandem duplication (FLT3-ITD which are all good prognostic factors, yet the patient had an atypical clinical course with early frequent relapses, differentiation syndrome associated with Decitabine therapy and late in his disease, he developed a granulocytic sarcoma.

  1. BREEDING AND GENETICS SYMPOSIUM: Climate change and selective breeding in aquaculture.

    Science.gov (United States)

    Sae-Lim, P; Kause, A; Mulder, H A; Olesen, I

    2017-04-01

    Aquaculture is the fastest growing food production sector and it contributes significantly to global food security. Based on Food and Agriculture Organization (FAO) of the United Nations, aquaculture production must increase significantly to meet the future global demand for aquatic foods in 2050. According to Intergovernmental Panel on Climate Change (IPCC) and FAO, climate change may result in global warming, sea level rise, changes of ocean productivity, freshwater shortage, and more frequent extreme climate events. Consequently, climate change may affect aquaculture to various extents depending on climatic zones, geographical areas, rearing systems, and species farmed. There are 2 major challenges for aquaculture caused by climate change. First, the current fish, adapted to the prevailing environmental conditions, may be suboptimal under future conditions. Fish species are often poikilothermic and, therefore, may be particularly vulnerable to temperature changes. This will make low sensitivity to temperature more important for fish than for livestock and other terrestrial species. Second, climate change may facilitate outbreaks of existing and new pathogens or parasites. To cope with the challenges above, 3 major adaptive strategies are identified. First, general 'robustness' will become a key trait in aquaculture, whereby fish will be less vulnerable to current and new diseases while at the same time thriving in a wider range of temperatures. Second, aquaculture activities, such as input power, transport, and feed production contribute to greenhouse gas emissions. Selection for feed efficiency as well as defining a breeding goal that minimizes greenhouse gas emissions will reduce impacts of aquaculture on climate change. Finally, the limited adoption of breeding programs in aquaculture is a major concern. This implies inefficient use of resources for feed, water, and land. Consequently, the carbon footprint per kg fish produced is greater than when fish from

  2. Velocardiofacial Syndrome

    Science.gov (United States)

    Gothelf, Doron; Frisch, Amos; Michaelovsky, Elena; Weizman, Abraham; Shprintzen, Robert J.

    2009-01-01

    Velocardiofacial syndrome (VCFS), also known as DiGeorge, conotruncal anomaly face, and Cayler syndromes, is caused by a microdeletion in the long arm of Chromosome 22. We review the history of the syndrome from the first clinical reports almost half a century ago to the current intriguing molecular findings associating genes from the…

  3. Fraser syndrome

    Directory of Open Access Journals (Sweden)

    Kalpana Kumari M

    2008-04-01

    Full Text Available Fraser syndrome or cryptophthalmos is a rare autosomal recessive disorder characterized by major features such as cryptophthalmos, syndactyly and abnormal genitalia. The diagnosis of this syndrome can be made on clinical examination and perinatal autopsy. We present the autopsy findings of a rare case of Fraser syndrome in a male infant.

  4. Rowell syndrome

    Directory of Open Access Journals (Sweden)

    Ramesh Y Bhat

    2014-01-01

    Full Text Available Rowell syndrome is a rare disease consisting of erythema multiforme-like lesions associated with lupus erythematosus. The syndrome occurs mostly in middle-aged women. The authors describe the syndrome in a 15-year-old boy who responded well to systemic steroids and hydroxychloroquine.

  5. Wallenberg's Syndrome

    Science.gov (United States)

    ... Information Page You are here Home » Disorders » All Disorders Wallenberg's Syndrome Information Page Wallenberg's Syndrome Information Page What ... better ways to prevent, treat, and ultimately cure disorders such as Wallenberg’s syndrome. Information from the National Library of Medicine’s ...

  6. Maternal genealogical patterns of chicken breeds sampled in Europe.

    Science.gov (United States)

    Lyimo, C M; Weigend, A; Msoffe, P L; Hocking, P M; Simianer, H; Weigend, S

    2015-08-01

    The aim of this study was to investigate the maternal genealogical pattern of chicken breeds sampled in Europe. Sequence polymorphisms of 1256 chickens of the hypervariable region (D-loop) of mitochondrial DNA (mtDNA) were used. Median-joining networks were constructed to establish evolutionary relationships among mtDNA haplotypes of chickens, which included a wide range of breeds with different origin and history. Chicken breeds which have had their roots in Europe for more than 3000 years were categorized by their founding regions, encompassing Mediterranean type, East European type and Northwest European type. Breeds which were introduced to Europe from Asia since the mid-19th century were classified as Asian type, and breeds based on crossbreeding between Asian breeds and European breeds were classified as Intermediate type. The last group, Game birds, included fighting birds from Asia. The classification of mtDNA haplotypes was based on Liu et al.'s (2006) nomenclature. Haplogroup E was the predominant clade among the European chicken breeds. The results showed, on average, the highest number of haplotypes, highest haplotype diversity, and highest nucleotide diversity for Asian type breeds, followed by Intermediate type chickens. East European and Northwest European breeds had lower haplotype and nucleotide diversity compared to Mediterranean, Intermediate, Game and Asian type breeds. Results of our study support earlier findings that chicken breeds sampled in Europe have their roots in the Indian subcontinent and East Asia. This is consistent with historical and archaeological evidence of chicken migration routes to Europe. © 2015 Stichting International Foundation for Animal Genetics.

  7. Characterization of the genetic profile of five Danish dog breeds

    DEFF Research Database (Denmark)

    Pertoldi, Cino; Kristensen, T. N.; Loeschcke, Volker;

    2013-01-01

    This investigation presents results from a genetic characterization of 5 Danish dog breeds genotyped on the CanineHD BeadChip microarray with 170,000 SNP. The breeds investigated were 1) Danish Spitz (DS; n = 8), 2) Danish-Swedish Farm Dog (DSF; n = 18), 3) Broholmer (BR; n = 22), 4) Old Danish P...... strategies for the preservation of the genetic pool of these dog breeds. © 2013 American Society of Animal Science. All rights reserved....

  8. Binucleation to breed new plant species adaptable to their environments

    OpenAIRE

    Moustafa, Khaled

    2015-01-01

    Classical plant breeding approaches may fall short to breed new plant species of high environmental and ecological interests. Biotechnological and genetic manipulations, on the other hand, may hold more effective capabilities to circumvent the limitations of sexual incompatibility and conventional breeding programs. Given that plant cells encompass multiple copies of organellar genomes (mitochondrial and plastidial genomes), an important question could be raised about whether an artificial at...

  9. Evaluation of the conformation of stallions of selected horse breeds

    OpenAIRE

    Tereza Petlachová; Eva Sobotková; Iva Jiskrová; Markéta Píšová; Iveta Bihuncová; Hana Černohorská; Martina Kosťuková

    2012-01-01

    The aim of this study was to evaluate the conformation of stallions of the breeds American Quarter Horse (AQH), American Paint Horse (APH), Appaloosa (Appa), the Lipizzaner horse (LH) and the Old Kladruby horse (OKH). Representatives of these breeds are characterized as the descendants of horses on the base of the Arab-Berber blood. Western breeds (AQH, APH, Appa) due to different environmental conditions, nutrition and the other structure under the influence of a different type of use, type ...

  10. Study of wool characteristics in the aranese ovine breed

    OpenAIRE

    Parés Casanova, Pere-Miquel; Jordana i Vidal, Jordi; Perezgrovas Garza, Raúl

    2011-01-01

    To date, no ethnological study on the wool characteristics of the Spanish Aranese ovine breed has been published.Fifty three animals belonging to this breed are tested as fleece samples. Each sample is analyzed for fleece type and length, yield by isoalcohol scouring, fiber length for each kind of fiber, variation in fiber diameter, and proportions of non-medullated and medullated or kemp fibers. Fiber length appears shorter than that previously reported for the breed by other authors. Fleece...

  11. The Breeding Bird Survey, 1967 and 1968

    Science.gov (United States)

    Robbins, C.S.; Van Velzen, W.T.

    1969-01-01

    In the Breeding Bird Survey of North America, cooperators ran 982 survey routes in 1967 and 1,174 in 1968. All States except Hawaii and all Canadian Provinces except Newfoundland were included. Roadside routes are selected at random within 1-degree blocks of latitude and longitude. Each 24 1/2-mile route, with 3-minute stops spaced half a mile apart, is driven by automobile. All birds heard or seen at the stops are recorded on special forms, and the data are transferred to magnetic tape for analysis. The average number of birds of each species per route is tabulated by State and Province, presenting for the first time a record of the comparative abundance of each species across the continent. The sample size is given for each species recorded. A sophisticated analysis program, here employed for the first time, is used to compute weighted mean values of the survey results for selected species at the State, stratum, regional, and continental level. The statistical significance of year-to-year changes at the 80, 90, 95, and 99 percent levels of probability are part of the computer output. An index for comparing populations of each species from year to year is established, with 1968 as the base year. Maps show the breeding range and comparative abundance of selected species.

  12. Breeding habitats of mosquitoes in Goa.

    Science.gov (United States)

    Kulkarni, S M; Naik, P S

    1989-03-01

    Studies carried out in Goa from 1986 to 1987 revealed immature stages of 43 species of mosquitoes. Breeding habitats were divided into three categories, viz., (i) Ground water habitats consisting of ground pools and tanks, rocky pools, paddy fields and stream beds, yielding 30 species; (ii) Plant habitats consisting of tree holes and fallen coconut shells and leaf sheaths yielding 20 species; and (iii) Domestic/peridomestic habitats consisting of cement tanks, glass, earthen, metallic containers and tyres yielding 11 species. Five species viz., Anopheles subpictus, Aedes albopictus, Armigeres subalbatus, Culex quinquefasciatus and Cx. pallidothorax were found in all three types of habitats. Cx. tritaeniorhynchus preferred to breed in ground pools and paddy fields but was found in domestic cement tanks and ground tanks in adverse season. Majority of the anophelines and culicines were found in ground water habitats. Five out of 11 species of Aedes were found in tree holes. Aedes aegypti and Toxorhynchites splendens were found only in discarded tyres. Three species of the genus Uranotaenia, viz., U. bicolor, U. stricklandi and U. campestris were recorded from stream beds and plant containers.

  13. Nutrient reserve dynamics of breeding canvasbacks

    Science.gov (United States)

    Barzen, J.A.; Serie, J.R.

    1990-01-01

    We compared nutrients in reproductive and nonreproductive tissues of breeding Canvasbacks (Aythya valisineria) to assess the relative importance of endogenous reserves and exogenous foods. Fat reserves of females increased during rapid follicle growth and varied more widely in size during the early phase of this period. Females began laying with ca. 205 g of fat in reserve and lost 1.8 g of carcass fat for every 1 g of fat contained in their ovary and eggs. Females lost body mass (primarily fat) at a declining rate as incubation advanced. Protein reserves increased directly with dry oviduct mass during rapid follicle growth. This direct relationship was highly dependent upon data from 2 birds and likely biased by structural size. During laying, protein reserves did not vary with the combined mass of dry oviduct and dry egg protein. Between laying and incubation, mean protein reserves decreased by an amount equal to the protein found in 2.1 Canvasback eggs. Calcium reserves did not vary with the cumulative total of calcium deposited in eggs. Mean calcium reserve declined by the equivalent content of 1.2 eggs between laying and incubation. We believe that protein and calcium were stored in small amounts during laying, and that they were supplemented continually by exogenous sources. In contrast, fat was stored in large amounts and contributed significantly to egg production and body maintenance. Male Canvasbacks lost fat steadily--but not protein or calcium--as the breeding season progressed.

  14. Hybrid reactors: Nuclear breeding or energy production?

    Energy Technology Data Exchange (ETDEWEB)

    Piera, Mireia [UNED, ETSII-Dp Ingenieria Energetica, c/Juan del Rosal 12, 28040 Madrid (Spain); Lafuente, Antonio; Abanades, Alberto; Martinez-Val, J.M. [ETSII-UPM, c/Jose Gutierrez Abascal 2, 28006 Madrid (Spain)

    2010-09-15

    After reviewing the long-standing tradition on hybrid research, an assessment model is presented in order to characterize the hybrid performance under different objectives. In hybrids, neutron multiplication in the subcritical blanket plays a major role, not only for energy production and nuclear breeding, but also for tritium breeding, which is fundamental requirement in fusion-fission hybrids. All three objectives are better achieved with high values of the neutron multiplication factor (k-eff) with the obvious and fundamental limitation that it cannot reach criticality under any event, particularly, in the case of a loss of coolant accident. This limitation will be very important in the selection of the coolant. Some general considerations will be proposed, as guidelines for assessing the hybrid potential in a given scenario. Those guidelines point out that hybrids can be of great interest for the future of nuclear energy in a framework of Sustainable Development, because they can contribute to the efficient exploitation of nuclear fuels, with very high safety features. Additionally, a proposal is presented on a blanket specially suited for fusion-fission hybrids, although this reactor concept is still under review, and new work is needed for identifying the most suitable blanket composition, which can vary depending on the main objective of the hybrid. (author)

  15. Tornadic storm avoidance behavior in breeding songbirds.

    Science.gov (United States)

    Streby, Henry M; Kramer, Gunnar R; Peterson, Sean M; Lehman, Justin A; Buehler, David A; Andersen, David E

    2015-01-05

    Migration is a common behavior used by animals of many taxa to occupy different habitats during different periods. Migrant birds are categorized as either facultative (i.e., those that are forced to migrate by some proximal cue, often weather) or obligate (i.e., those that migrate on a regular cycle). During migration, obligate migrants can curtail or delay flights in response to inclement weather or until favorable winds prevail, and they can temporarily reorient or reverse direction when ecological or meteorological obstacles are encountered. However, it is not known whether obligate migrants undertake facultative migrations and make large-scale movements in response to proximal cues outside of their regular migration periods. Here, we present the first documentation of obligate long-distance migrant birds undertaking a facultative migration, wherein breeding golden-winged warblers (Vermivora chrysoptera) carrying light-level geolocators performed a >1,500 km 5-day circumvention of a severe tornadic storm. The birds evacuated their breeding territories >24 hr before the arrival of the storm and atmospheric variation associated with it. The probable cue, radiating >1,000 km from tornadic storms, perceived by birds and influencing bird behavior and movements, is infrasound (i.e., sound below the range of human hearing). With the predicted increase in severity and frequency of similar storms as anthropogenic climate change progresses, understanding large-scale behavioral responses of animals to such events will be an important objective of future research.

  16. Hyperventilation and exhaustion syndrome.

    Science.gov (United States)

    Ristiniemi, Heli; Perski, Aleksander; Lyskov, Eugene; Emtner, Margareta

    2014-12-01

    Chronic stress is among the most common diagnoses in Sweden, most commonly in the form of exhaustion syndrome (ICD-10 classification - F43.8). The majority of patients with this syndrome also have disturbed breathing (hyperventilation). The aim of this study was to investigate the association between hyperventilation and exhaustion syndrome. Thirty patients with exhaustion syndrome and 14 healthy subjects were evaluated with the Nijmegen Symptom Questionnaire (NQ). The participants completed questionnaires about exhaustion, mental state, sleep disturbance, pain and quality of life. The evaluation was repeated 4 weeks later, after half of the patients and healthy subjects had engaged in a therapy method called 'Grounding', a physical exercise inspired by African dance. The patients reported significantly higher levels of hyperventilation as compared to the healthy subjects. All patients' average score on NQ was 26.57 ± 10.98, while that of the healthy subjects was 15.14 ± 7.89 (t = -3.48, df = 42, p therapy such as Grounding.

  17. Breeding programs for smallholder sheep farming systems: I. Evaluation of alternative designs of breeding schemes.

    Science.gov (United States)

    Gizaw, S; Rischkowsky, B; Valle-Zárate, A; Haile, A; van Arendonk, J A M; Mwai, A O; Dessie, T

    2014-10-01

    Village- and central nucleus-based schemes were simulated and evaluated for their relative bio-economic efficiencies, using Ethiopia's Menz sheep as example. The schemes were: village-based 2-tier (Scheme-1) and 1-tier (Scheme-2) cooperative village breeding schemes, dispersed village-based nuclei scheme (Scheme-3), conventional 2-tier central nucleus-based scheme (Scheme-4), and schemes linking a central nucleus and village multiplier nuclei with selection in central nucleus (Scheme-5) or in both central and village nuclei (Scheme-6). Among village-based schemes, Scheme-1 gave the highest genetic progress, while Scheme-2 was economically the most efficient with genetic gain in the breeding objective of Birr 5.6 and a profit of Birr 37.2/ewe/year. The central nucleus schemes were more efficient than the village schemes. Scheme-4 was the most efficient with genetic gain in the breeding objective of Birr 13.5 and a profit of Birr 71.2, but is operationally more difficult as it requires a very large central nucleus. The choice between village and central nucleus-based schemes would depend on local conditions (availability of infrastructure, logistics and technical knowhow and support). Linking central nucleus with village-based nuclei (Scheme-6) would be a feasible option to overcome the operational difficulties of the conventional central nucleus scheme. If a village-based breeding program is envisaged as should be the 1st step in most low-input systems, then Scheme-2 is the most efficient. To scale out to an entire Menz breed level, Scheme-3 would be recommended.

  18. Isolation and characterization of human brain genes with (CCA){sub n} trinucleotide repeats

    Energy Technology Data Exchange (ETDEWEB)

    Longshore, J.W.; Finley, W.H.; Descartes, M. [Univ. of Alabama, Birmingham, AL (United States)] [and others

    1994-09-01

    Expansion of trinucleotide repeats has been described as a new form of mutation. To date, only the expansion of (CGG){sub n} and (CAG){sub n} repeats have been associated with disease. Expansion of (CAG){sub n} repeats has been found to cause Huntington`s disease, Kennedy`s disease, myotonic dystrophy, spinocerebellar ataxia type 1, and dentatorubral pallidoluysian atrophy. (CGG){sub n} repeat expansion has been implicated in the fragile X syndrome and FRAXE mental retardation. In an effort to identify other potential repeats as candidates for expansion, a DNA linguistics approach was used to study 10 Mb of human DNA sequences in GenBank. Our study found the (CCA){sub n} repeat and the disease-associated (CGG){sub n} and (CAG){sub n} repeats to be over-represented in the human genome. The (CCA){sub n} repeat also shares other characteristics with (CGG){sub n} and (CAG){sub n}, making it a good candidate for expansion. Trinucleotide repeat numbers in disease-associated genes are normally polymorphic in a population. Therefore, by studying genes for polymorphisms, candidate genes may be identified. Twelve sequences previously deposited in GenBank with at least five tandem copies of (CCA) were studied and no polymorphisms were found. To identify other candidate genes, a human hippocampus cDNA library was screened with a (CCA){sub 8} probe. This approach identified 19 novel expressed sequences having long tandem (CCA){sub n} repeats which are currently under investigation for polymorphisms. Genes with polymorphic repeats may serve as markers for linkage studies or as candidate genes for genetic diseases showing anticipation.

  19. Characterization of conservative somatic instability of the CAG repeat region in Huntington`s disease

    Energy Technology Data Exchange (ETDEWEB)

    Schaefer, F.V.; Calikoglu, A.S.; Whetsell, L.H. [H.A. Chapman Research Institute of Medical Genetics, Tulsa, OK (United States)

    1994-09-01

    Instability and enlargement of a CAG repeat region at the beginning of the huntingtin gene (IT-15) has been linked with Huntington`s disease. The CAG repeat size shows a highly significant correlation with age-of-onset of clinicial features in individuals with 40 or more repeats who have Huntington disease. The clinical status of nonsymptomatic individuals with 30 to 39 CAG repeats is considered ambiguous. In order to define more carefully the nature of the HD expansion instability, we examined patients in our HD population using a discriminating fluorescence-based PCR approach. The degree of somatic mutation increases with both earlier age of onset and the size of the inherited allele. A single prominent band one repeat larger than the index peak was typical in individuals with 40-41 CAG repeats. Three to four larger bands are typically discerned in individuals with 50 or more repeats. In an extreme example, an individual with approximately 95 repeats had at least 8 prominent bands. Plotting the degree of somatic mutation relative to the size of the HD allele shows somatic mutation activity increases with size. By this approach 40-60% of the alleles in a 40-41 CAG repeat HD loci is represented in the primary allele. In contrast, the primary allele represents a relatively minor proportion of the total alleles for expansions greater than 50 CAG repeats (10-20%). The limited range of somatic mutation suggest that the instability is restricted to very early stages of embryogenesis before tissue development diverges or that persistent somatic instability occurs at a slow rate. Therefore, the properties of somatic instability in Huntington`s disease have aspects that are both in common but also different from that found in other trinucleotide repeat expanding diseases such as myotonic muscular dystrophy and fragile X syndrome.

  20. D-loop haplotype diversity in Brazilian horse breeds.

    Science.gov (United States)

    Ianella, Patrícia; Albuquerque, Maria do Socorro Maués; Paiva, Samuel Rezende; Egito, Andréa Alves do; Almeida, Leonardo Daniel; Sereno, Fabiana T P S; Carvalho, Luiz Felipe Ramos; Mariante, Arthur da Silva; McManus, Concepta Margaret

    2017-08-31

    The first horses were brought to Brazil by the colonizers after 1534. Over the centuries, these animals evolved and adapted to local environmental conditions usually unsuitable for exotic breeds, thereby originating locally adapted Brazilian breeds. The present work represents the first description of maternal genetic diversity in these horse breeds based on D-loop sequences. A D-Loop HSV-I fragment of 252 bp, from 141 horses belonging to ten Brazilian breeds / genetic groups (locally adapted and specialized breeds) were analysed. Thirty-five different haplotypes belonging to 18 haplogroups were identified with 33 polymorphic sites. Haplotype diversity (varying from 0.20 to 0.96) and nucleotide diversity (varying from 0.0039 to 0.0239) was lower for locally adapted than for specialized breeds, with the same pattern observed for FST values. Haplogroups identified in Brazilian breeds are in agreement with previous findings in South American samples. The low variability observed mainly in locally adapted breeds, indicates that, to ensure conservation of these breeds, careful reproductive management is needed. Additional genetic characterization studies are required to support accurate decision-making.

  1. Development of Circular Economy of Characteristic Breeding Industry in Guangxi

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    In order to achieve characteristic,high-quality,high-efficiency,low-consumption,healthy and intensive breeding,we use the ecology method to analyze the status quo of development of characteristic breeding industry in Guangxi,from advantages in resources,industrial development,characteristic breeding,and standardized construction.There are some problems existing in the development of characteristic breeding industry in Guangxi:prominent contradiction among human,land and grain;outdated breeding mode;low comprehensive utilization rate of resources;increasingly deteriorating ecological environment.We put forth the following recommendations:based on the ecological and economic principles,introducing"reduce,reuse,recycle"idea of circular economy;striving to choose the development pattern of circular economy adapting to local resource characteristics,planting and breeding habits;in terms of realization path,paying close attention to construction of standardized breeding farm,cultivation of organic fertilizer industry,infrastructure construction,environmental law enforcement,and other parts;reinforcing the policy guidance,adjusting and optimizing industrial structure,strengthening scientific and technological innovation,and advancing industrialization management,to promote steady development of circular economy of characteristic breeding industry in Guangxi,and accelerate the process of rejuvenating province by breeding industry,enriching the people and building up Guangxi.

  2. Owner perceived differences between mixed-breed and purebred dogs

    Science.gov (United States)

    Turcsán, Borbála; Miklósi, Ádám; Kubinyi, Enikő

    2017-01-01

    Studies about the behaviours of mixed-breed dogs are rare, although mixed-breeds represent the majority of the world’s dog population. We have conducted two surveys to investigate the behavioural, demographic, and dog keeping differences between purebred and mixed-breed companion dogs. Questionnaire data were collected on a large sample of dogs living in Germany (N = 7,700 purebred dogs representing more than 200 breeds, and N = 7,691 mixed-breeds). We found that according to their owners, mixed-breeds were (1) less calm, (2) less sociable toward other dogs, and (3) showed more problematic behaviour than purebreds (p 10%) differences: neutering was more frequent among mixed-breeds, and they were acquired at older ages than purebreds (p < 0.001 for both), which could result in the observed behaviour differences. After controlling for the distribution of the demographic and dog keeping factors, we found that mixed-breeds were (1) more trainable than purebreds, (2) less calm, and (3) showed more problematic behaviour than purebreds (p < 0.001 for all). We discuss that these differences at least partly might be due to selective forces. Our results suggest that instead of being the “average” dogs, mixed-breeds represent a special group with characteristic behavioural traits. PMID:28222103

  3. Neuroleptic malignant syndrome and serotonin syndrome in a female patient: a clinicopathologic case.

    Science.gov (United States)

    Gómez-Esteban, Juan Carlos; Barcena, Joseba; Forcadas, Maribel; Somme, Johanne; Agundez, Marta; Tijero, Beatriz; Zarranz, Juan J

    2009-01-01

    We report the case of a 24-year-old female patient who initially developed a neuroleptic malignant syndrome after haloperidol exposure and experienced 6 years later a serotonin syndrome after repeated fluoxetine exposure. The patient did not respond to symptomatic treatment and died in this latter episode. At necropsy, no gross or microscopic changes were seen with conventional histological stains, and immunohistochemical stains were negative. This is the first clinicopathologic case of a patient who experienced both neuroleptic malignant and serotonin syndromes. We speculate that this case argue in favor that both syndromes share some fundamental pathogenetic mechanisms.

  4. Refeeding syndrome.

    Science.gov (United States)

    Fernández López, M T; López Otero, M J; Alvarez Vázquez, P; Arias Delgado, J; Varela Correa, J J

    2009-01-01

    Refeeding syndrome is a complex syndrome that occurs as a result of reintroducing nutrition (oral, enteral or parenteral) to patients who are starved or malnourished. Patients can develop fluid-balance abnormalities, electrolyte disorders (hypophosphataemia, hypokalaemia and hypomagnesaemia), abnormal glucose metabolism and certain vitamin deficiencies. Refeeding syndrome encompasses abnormalities affecting multiple organ systems, including neurological, pulmonary, cardiac, neuromuscular and haematological functions. Pathogenic mechanisms involved in the refeeding syndrome and clinical manifestations have been reviewed. We provide suggestions for the prevention and treatment of refeeding syndrome. The most important steps are to identify patients at risk, reintroduce nutrition cautiously and correct electrolyte and vitamin deficiencies properly.

  5. [Metabolic syndrome].

    Science.gov (United States)

    Mitsuishi, Masanori; Miyashita, Kazutoshi; Itoh, Hiroshi

    2009-02-01

    Metabolic syndrome, which is consisted of hypertension, dyslipidemia and impaired glucose tolerance, is one of the most significant lifestyle-related disorders that lead to cardiovascular diseases. Among many upstream factors that are related to metabolic syndrome, obesity, especially visceral obesity, plays an essential role in its pathogenesis. In recent studies, possible mechanisms which connect obesity to metabolic syndrome have been elucidated, such as inflammation, abnormal secretion of adipokines and mitochondrial dysfunction. In this review, we focus on the relationship between obesity and metabolic syndrome; and illustrate how visceral obesity contributes to, and how the treatments for obesity act on metabolic syndrome.

  6. Evaluation of breeding objectives for purebred and crossbred selection schemes for adoption in indigenous chicken breeding programmes.

    Science.gov (United States)

    Okeno, T O; Kahi, A K; Peters, K J

    2013-01-01

    1. The aim of the study was to evaluate the genetic and economic breeding objectives for an indigenous chicken (IC) breeding programme in Kenya. 2. A closed three-tier nucleus breeding programme with three breeding objectives and two selection schemes was simulated. The breeding objectives included IC dual-purpose (ICD) for both eggs and meat, IC layer (ICL) for eggs and IC broiler (ICB) for meat production. 3. Pure line selection scheme (PLS) for development of IC pure breeds and crossbreeding scheme (CBS) for the production of hybrids were considered. Two-and three-way crossbreeding strategies were evaluated under CBS and the impact of nucleus size on genetic gains and profitability of the breeding programme were investigated. 4. Males were the main contributors to genetic gains. The highest genetic gains for egg number (2·71 eggs) and growth traits (1·74 g average daily gain and 57·96 g live weight at 16 weeks) were realised under PLS in ICL and ICB, respectively. 5. The genetic response for age at first egg was desirable in all the breeding objectives, while that for fertility and hatchability were only favourable under ICL and PLS in ICD. Faecal egg count and immune antibody response had low, but positive gains except under PLS where the later was unfavourable. ICB was the most profitable breeding objective, followed by ICD and ICL under all the selection schemes. 6. Although PLS was superior in genetic gains and profitability and recommended in breeding programmes targeting ICL and ICB, a three line CBS should be considered in development of a dual-purpose breed. 7. Increasing the nucleus size beyond 5% of the IC population was not attractive as it resulted in declining profitability of the breeding programme.

  7. [Autoinflammatory syndrome].

    Science.gov (United States)

    Ida, Hiroaki; Eguchi, Katsumi

    2009-03-01

    The autoinflammatory syndromes include a group of inherited diseases that are characterized by 1) seemingly unprovoked episodes of systemic inflammations, 2) absence of high titer of autoantibody or auto-reactive T cell, and 3) inborn error of innate immunity. In this article, we will focus on the clinical features, the pathogenesis related the genetic defects, and the therapeutic strategies in the representative disorders including familial Mediterranean fever (FMF), TNF receptor associated periodic syndrome (TRAPS), cryopyrin-associated periodic syndrome (CAPS), hyper-IgD with periodic fever syndrome (HIDS), syndrome of pyogenic arthritis with pyoderma gangrenosum and acne (PAPA), and Blau syndrome. Recent advances in genetics and molecular biology have proceeded our understanding of the pathogenesis of autoinflammatory syndromes.

  8. Mitochondrial DNA of seven Italian sheep breeds shows faint signatures of domestication and suggests recent breed formation.

    Science.gov (United States)

    Mariotti, Marco; Valentini, Alessio; Marsan, Paolo Ajmone; Pariset, Lorraine

    2013-10-01

    Italy represented a crucial zone for migration and formation of sheep breeds. However, few data on Italian breeds have been published so far. We analysed seven Italian sheep breeds using mitochondrial DNA (mtDNA) sequencing to gain information on their genetic diversity and history. A 721 bp mtDNA control region fragment was amplified and sequenced in a total of 138 samples belonging to seven breeds and to Italian mohuflon (Ovis orientalis musimon) to investigate genetic diversity and phylogenetic evolution. We retrieved 68 variable sites and 79 haplotypes. The sheep breeds in our study are quite diverse, and phylogenetic analyses resulted in 3.6% of the samples belonging to A, 2.2% to D and 94.2% to B mtDNA haplogroups. Principal Component Analysis (PCA) showed a separation of breeds on both dimensions. The results of this study provide data on Italian breeds, presently scarcely investigated, and contribute to the knowledge of Italian sheep breeds and will be useful to the understanding of population genetics and breed evolution.

  9. Cholistan and Cholistani Breed of Cattle

    Directory of Open Access Journals (Sweden)

    U. Farooq, H. A. Samad*, F. Sher1, M. Asim1 and M. Arif Khan2

    2010-04-01

    Full Text Available Cholistan, once a green and prosperous land with the source of water being the ancient Hakra River, was also the cradle of great Hakra Valley Civilization. It is sprawled at an area of 26,000 Km2, located between the latitudes 27º42´and 29º45´North and longitudes 69º52´and 75º24´East. The bioclimatic system of Cholistan falls under the category of “tropical desert” with very scanty rainfall. Geomorphologically, the soils of Cholistan are a complex blend of river alluvium and Aeolin sands. Based on topography, type of soil and vegetation, this desert is divided into two geomorphic regions: the Lesser Cholistan (the Northern 7,770 Km² region and the Greater Cholistan (the Southern 18,130 Km² region. The primary source of water is rainfall which is utilized through natural depressions or man-made ponds called “Tobas” and “Dahars.” The secondary source is underground water which is brackish and salty and not fit for human/animal consumption. Two livestock production systems prevail under pastoralism in Cholistan viz. transhumanie and nomadic. Despite an uncertain, unpredictable rainfall, low humidity and extremes in temperatures, Cholistan has long been famous for raising different breeds of livestock, contributing a significant share to national milk, meat and wool output. The total livestock population estimated during 2006 was 12,09528, out of which 47% were cattle. Cholistani cattle are considered to be ancestor of the Sahiwal and are a thermo-tolerant, tick-resistant breed. Preliminary data on some productive and reproductive traits of Cholistani cows maintained at Govt. Livestock Station, Jugait Peer, Bahawalpur during the period 2005 to 2009 revealed the avergae values for the productive traits i.e. lactation length, lactation yield, dry period, service period and fat percentage in milk as 165 days, 1235 liters, 155 days, 121 days and 4.8%, respectively. Similarly, the average values for reproductive traits i.e. age at

  10. Optimizing breeding decisions for Finnish dairy herds.

    Science.gov (United States)

    Rajala-Schultz, P J; Gröhn, Y T; Allore, H G

    2000-01-01

    The purpose of this study was to determine the effect of reproductive performance on profitability and optimal breeding decisions for Finnish dairy herds. We used a dynamic programming model to optimize dairy cow insemination and replacement decisions. This optimization model maximizes the expected net revenues from a given cow and her replacements over a decision horizon. Input values and prices reflecting the situation in 1998 in Finland were used in the study. Reproductive performance was reflected in the model by overall pregnancy rate, which was a function of heat detection and conception rate. Seasonality was included in conception rate. The base run had a pregnancy rate of 0.49 (both heat detection and conception rate of 0.7). Different scenarios were modeled by changing levels of conception rate, heat detection, and seasonality in fertility. Reproductive performance had a considerable impact on profitability of a herd; good heat detection and conception rates provided an opportunity for management control. When heat detection rate decreased from 0.7 to 0.5, and everything else was held constant, net revenues decreased approximately 2.6%. If the conception rate also decreased to 0.5 (resulting in a pregnancy rate of 0.25), net revenues were approximately 5% lower than with a pregnancy rate of 0.49. With lower fertility, replacement percentage was higher and the financial losses were mainly from higher replacement costs. Under Finnish conditions, it is not optimal to start breeding cows calving in spring and early summer immediately after the voluntary waiting period. Instead, it is preferable to allow the calving interval to lengthen for these cows so that their next calving is in the fall. However, cows calving in the fall should be bred immediately after the voluntary waiting period. Across all scenarios, optimal solutions predicted most calvings should occur in fall and the most profitable time to bring a replacement heifer into a herd was in the fall. It

  11. Human Short Tandem Repeat (STR Markers for Paternity Testing in Pig-Tailed Macaques

    Directory of Open Access Journals (Sweden)

    DYAH PERWITASARI-FARAJALLAH

    2007-06-01

    Full Text Available This study investigated the use of human short tandem repeat (STR or microsatellite loci markers for assessing paternity and genetic structure of pig-tailed macaques (Macaca nemestrina breeding colony. Four human microsatellite primer pairs located at human map position D1S548, D3S1768, D5S820, and D2S1777, were amplified by polymerase chain reaction (PCR for pig-tailed macaques. Four loci were found to be clearly and reliably amplified, and three loci exhibited high levels of genetic heterogeneity. These loci were sufficiently informative to differentiate discretely between related and unrelated pairs.

  12. CAGE BREEDING OF WARM WATER FRESHWATER FISH SPECIES

    Directory of Open Access Journals (Sweden)

    Roman Safner

    2008-10-01

    Full Text Available In the 1970s, Croatia became actively involved in the contemporary trend of breeding fish in floating cages. In addition to various species of marine fishes, breeding was attempted with trout, carp, catfish, cisco and salmon. Of the above freshwater fish species, specific standards were established only for the cage breeding of rainbow trout. Cage breeding of the remaining species remained at the level of occasional attempts, with more of an experimental than a commercial character. The regular attempts to master this technique for cage breeding of warm water freshwater fish species were aimed at achieving the known benefits of such breeding, such as simplicity of implementing technological measures, easier establishment of the breeding system, simpler manipulation, the possibility of denser colonies per unit volume with a high level of production, easier adaptations to market conditions and fewer initial structural investments. Despite the many advantages, the main reasons for the lack of greater implementation of the cage breeding technology for warm water species of freshwater fish include problems in obtaining the appropriate category and quantity of healthy fry, the specificity and applicability of physical and chemical properties of the recipients and human error. In evaluating the advantages and disadvantages, the final decision on the justification of cage breeding for individual warm water freshwater species must be based on both biological and economic factors. Based on the knowledge of cage breeding acquired to date, the rule for virtually all intensive breeding systems is that it is only recommended for those species with high market demand and a high market price. The technology that demands nutrition with highly concentrated feed and other production expenditures is costly, and is therefore not profitable with less expensive fish species. Furthermore, production must be market oriented, i.e. the appropriate market research measures

  13. Is income breeding an appropriate construct for waterfowl?

    Science.gov (United States)

    Janke, Adam K.; Anteau, Michael J.; Markl, Nicholas; Stafford, Joshua D.

    2015-01-01

    Breeding birds use a range of nutrient accumulation and allocation strategies to meet the nutritional demands of clutch formation and incubation. On one end of the spectrum, capital breeders use stored nutrients acquired prior to clutch formation and incubation to sustain metabolism during reproduction, while on the opposite end, income breeders derive nutrients solely from exogenous sources on the breeding grounds. Blue-winged Teal (Anas discors) are an ideal candidate to test for adoption of an income strategy among migratory waterfowl because of their small body size, temperate breeding range, and timing of reproduction relative to pulses in nutrient availability within breeding habitats. We collected migrating and pre-breeding Blue-winged Teal (n = 110) during the warmest spring in over a century in the southern edge of the species’ breeding range, which produced ideal conditions to test for adoption of an income breeding strategy among migratory waterfowl. Regression analyses revealed that females accumulated protein and fat reserves early in follicle development and appeared to mobilize at least some reserves coincident with the onset of clutch formation. Accumulation and subsequent mobilization of nutrient reserves was inconsistent with adherence to an income breeding strategy and suggested breeding Blue-winged Teal used capital (albeit locally acquired) for reproduction. Our results add to existing knowledge on the ubiquity of endogenous nutrient reserve accumulation prior to and during reproduction by waterfowl, perhaps suggesting endogenous nutrient reserves are universally used for clutch formation or incubation to some degree. If indeed Blue-winged Teal and other waterfowl universally use capital for breeding, research and conservation efforts should shift from evaluating whether an income breeding strategy is used and focus on when and where necessary capital is acquired prior to clutch formation.

  14. Strengthening concept learning by repeated testing.

    Science.gov (United States)

    Wiklund-Hörnqvist, Carola; Jonsson, Bert; Nyberg, Lars

    2014-02-01

    The aim of this study was to examine whether repeated testing with feedback benefits learning compared to rereading of introductory psychology key-concepts in an educational context. The testing effect was examined immediately after practice, after 18 days, and at a five-week delay in a sample of undergraduate students (n = 83). The results revealed that repeated testing with feedback significantly enhanced learning compared to rereading at all delays, demonstrating that repeated retrieval enhances retention compared to repeated encoding in the short- and the long-term. In addition, the effect of repeated testing was beneficial for students irrespectively of working memory capacity. It is argued that teaching methods involving repeated retrieval are important to consider by the educational system.

  15. Repeat concussions in the national football league.

    Science.gov (United States)

    Casson, Ira R; Viano, David C; Powell, John W; Pellman, Elliot J

    2011-01-01

    Repeat concussion is an important issue in the National Football League (NFL). An initial description of repeat injuries was published for 6 years (1996-2001). The characteristics and frequency of repeat concussion in the NFL have not changed in the subsequent 6 years (2002-2007). Case control. From 1996 to 2007, concussions were reported using a standardized form documenting signs and symptoms, loss of consciousness and medical action taken. Data on repeat concussions were analyzed for the 12 years and compared between the 2 periods. In 2002-2007, 152 players had repeat concussions (vs 160 in 1996-2001); 44 had 3+ head injuries (vs 52). The positions most often associated with repeat concussion in 2002-2007 were the defensive secondary, kick unit, running back, and linebacker. The odds for repeat concussion were elevated for wide receivers, tight ends, and linebackers but lower than in the earlier period. During 2002-2007, over half of players with repeat concussion were removed from play, and fewer immediately returned (vs 1996-2001). The average duration between concussions was 1.25 years for 2002-2007 and 1.65 years for the 12-year period. Over 12 years, 7.6% of all repeat concussions occurred within 2 weeks of the prior concussion. The defensive secondary, kick unit, running back, and linebacker have the highest incidence of repeat concussion. During 2002-2007, more than half of players with repeat concussion were removed from play, and only a fraction immediately returned. Although concussion was managed more conservatively by team physicians in the recent 6 years, repeat concussions occurred at similar rates during both periods.

  16. Automated quality checks on repeat prescribing.

    OpenAIRE

    Rogers, Jeremy E; Wroe, Christopher J; Roberts, Angus; Swallow, Angela; Stables, David; Cantrill, Judith A; Rector, Alan L.

    2003-01-01

    BACKGROUND: Good clinical practice in primary care includes periodic review of repeat prescriptions. Markers of prescriptions that may need review have been described, but manually checking all repeat prescriptions against the markers would be impractical. AIM: To investigate the feasibility of computerising the application of repeat prescribing quality checks to electronic patient records in United Kingdom (UK) primary care. DESIGN OF STUDY: Software performance test against benchmark manual...

  17. Short Tandem Repeat DNA Internet Database

    Science.gov (United States)

    SRD 130 Short Tandem Repeat DNA Internet Database (Web, free access)   Short Tandem Repeat DNA Internet Database is intended to benefit research and application of short tandem repeat DNA markers for human identity testing. Facts and sequence information on each STR system, population data, commonly used multiplex STR systems, PCR primers and conditions, and a review of various technologies for analysis of STR alleles have been included.

  18. Issues and perspectives in dairy sheep breeding

    Directory of Open Access Journals (Sweden)

    Pierlorenzo Secchiari

    2010-01-01

    Full Text Available The present review consists of two parts. In the first part, the authors briefly describe the state of the art of breedingprogrammes for Italian dairy sheep; then they report new models for genetic evaluation and consider the problem ofgenotype x environment interaction and the impact of farming systems on the genetic merit of animals. In the secondpart new breeding goals regarding the evolution of milk quality concept and the increasing importance of functional traitsare reported. Regarding milk quality, the authors especially focus on the traits related to cheese-making ability and onthe nutraceutical aspects of milk. Among functional traits, resistance to diseases (mastitis and Scrapie has been highlightedfor its great importance in livestock species. Finally, the perspectives of marker-assisted selection have also beenreported.

  19. Radiation-induced mutations and plant breeding

    Energy Technology Data Exchange (ETDEWEB)

    Naqvi, S.H.M.

    1985-01-01

    Ionizing radiation could cause genetic changes in an organism and could modify gene linkages. The induction of mutation through radiation is random and the probability of getting the desired genetic change is low but can be increased by manipulating different parameters such as dose rate, physical conditions under which the material has been irradiated, etc. Induced mutations have been used as a supplement to conventional plant breeding, particularly for creating genetic variability for specific characters such as improved plant structure, pest and disease resistance, and desired changes in maturity period; more than 200 varieties of crop plants have been developed by this technique. The Pakistan Atomic Energy Commission has used this technique fruitfully to evolve better germplasm in cotton, rice, chickpea, wheat and mungbean; some of the mutants have become popular commercial varieties. This paper describes some uses of radiation induced mutations and the results achieved in Pakistan so far.

  20. Studies on mutation breeding of hibiscus Syriacus

    Energy Technology Data Exchange (ETDEWEB)

    Song, Heui Sub; Lee, Ki Woon; Im, Yong Taek [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

    1994-12-01

    Hibiscus(Hibiscus syracuse L.) has been know as a national flower of Korea science old times. Although there are some ancient records that the Hibiscus had been planted in large quantities in Korea, Japanese had dug out all the good plants of Hibiscus in this country during their colonial period. But Hibiscus has such a characteristics of self-incompatibility that all the plants exist as a hybrid naturally and have heterogeneous genes. Therefore many good characters can be taken out from the surviving plants. Many domestic 78 varieties of Hibiscus syracuse were collected and propagated 26 varieties cuttings. Radiosensitivity of gamma-ray irradiated Hibiscus syracuse were investigated the germination rate, survival rate, plant height was with the increase of 4 kR better than control. The radiation doses of 10-12 kR are recommended for mutation breeding of Hibiscus. 6 figs, 11 tabs, 41 refs. (Author).