WorldWideScience

Sample records for renewable protein binders

  1. Studies on the Renewability of Polymeric Binders for Foundry

    Directory of Open Access Journals (Sweden)

    B. Grabowska

    2012-09-01

    Full Text Available In this paper the results of studies of polymeric binders on the example of the new BioCo2 binder, including the problem of itsrenewability, are presented. The results of structural studies (FT-IR for the BioCo2 binder before and after crosslinking, and bendingstrength tests Rg u fresh and renewed cured molding sands with BioCo2 binder are discussed. The cross-linking binder and curring ofmoulding sand was carried out by physical agents (microwave radiation, temperature. On the basis of obtained results was shown that it is possible to restore the initial properties of the adhesive of BioCo2 binder. The initial properties of moulding sand can be achieved, after the cross-linking binders and after curing in the moulding sands with bioCo2 binder , by supplementing the moulding sand composition by the appropriate amount of water.

  2. RELATIVE DOSING OF PHOSPHATE BINDERS FOR EFFECTIVE MANAGEMENT OF PHOSPHATE AND PROTEIN INTAKE IN CHRONIC KIDNEY DISEASE

    Directory of Open Access Journals (Sweden)

    J Brian Copley

    2012-06-01

    The availability of binding capacity data for P binders, presents physicians with the possibility of tailoring doses of binder to a patient’s diet, facilitating sufficient intake of dietary protein while maintaining a neutral P balance. Use of high-capacity binders, such as lanthanum carbonate, would minimize the tablet burden faced by patients and this may also encourage adherence.

  3. Development of a green binder system for paper products.

    Science.gov (United States)

    Flory, Ashley R; Vicuna Requesens, Deborah; Devaiah, Shivakumar P; Teoh, Keat Thomas; Mansfield, Shawn D; Hood, Elizabeth E

    2013-03-26

    It is important for industries to find green chemistries for manufacturing their products that have utility, are cost-effective and that protect the environment. The paper industry is no exception. Renewable resources derived from plant components could be an excellent substitute for the chemicals that are currently used as paper binders. Air laid pressed paper products that are typically used in wet wipes must be bound together so they can resist mechanical tearing during storage and use. The binders must be strong but cost-effective. Although chemical binders are approved by the Environmental Protection Agency, the public is demanding products with lower carbon footprints and that are derived from renewable sources. In this project, carbohydrates, proteins and phenolic compounds were applied to air laid, pressed paper products in order to identify potential renewable green binders that are as strong as the current commercial binders, while being organic and renewable. Each potential green binder was applied to several filter paper strips and tested for strength in the direction perpendicular to the cellulose fibril orientation. Out of the twenty binders surveyed, soy protein, gelatin, zein protein, pectin and Salix lignin provided comparable strength results to a currently employed chemical binder. These organic and renewable binders can be purchased in large quantities at low cost, require minimal reaction time and do not form viscous solutions that would clog sprayers, characteristics that make them attractive to the non-woven paper industry. As with any new process, a large-scale trial must be conducted along with an economic analysis of the procedure. However, because multiple examples of "green" binders were found that showed strong cross-linking activity, a candidate for commercial application will likely be found.

  4. Development of a green binder system for paper products

    Science.gov (United States)

    2013-01-01

    Background It is important for industries to find green chemistries for manufacturing their products that have utility, are cost-effective and that protect the environment. The paper industry is no exception. Renewable resources derived from plant components could be an excellent substitute for the chemicals that are currently used as paper binders. Air laid pressed paper products that are typically used in wet wipes must be bound together so they can resist mechanical tearing during storage and use. The binders must be strong but cost-effective. Although chemical binders are approved by the Environmental Protection Agency, the public is demanding products with lower carbon footprints and that are derived from renewable sources. Results In this project, carbohydrates, proteins and phenolic compounds were applied to air laid, pressed paper products in order to identify potential renewable green binders that are as strong as the current commercial binders, while being organic and renewable. Each potential green binder was applied to several filter paper strips and tested for strength in the direction perpendicular to the cellulose fibril orientation. Out of the twenty binders surveyed, soy protein, gelatin, zein protein, pectin and Salix lignin provided comparable strength results to a currently employed chemical binder. Conclusions These organic and renewable binders can be purchased in large quantities at low cost, require minimal reaction time and do not form viscous solutions that would clog sprayers, characteristics that make them attractive to the non-woven paper industry. As with any new process, a large-scale trial must be conducted along with an economic analysis of the procedure. However, because multiple examples of “green” binders were found that showed strong cross-linking activity, a candidate for commercial application will likely be found. PMID:23531016

  5. Biopitch produced from eucalyptus wood pyrolysis liquids as a renewable binder for carbon electrode manufacture

    Directory of Open Access Journals (Sweden)

    Rocha J.D.

    2002-01-01

    Full Text Available Interest in biomass as a clean source of fuel, chemicals and materials is growing fast. What is attractive about biomass is its renewability and that it is CO2 balanced and sulfur-free. Biomass pyrolysis produces charcoal, bio-oil and gases in different proportions, depending on the technology and raw material used. In this study biopitch, a substitute for fossil pitches in electrodes, was produced from bio-oil distillation in bench-scale equipment. Biopitch and charcoal were mixed and thermically modified to give prebaked electrodes. The physico-chemical and mechanical properties of the biopitch and final electrodes were measured and compared with those of coal tar and petroleum materials. Despite their similar application, biomaterials are structurally and chemically different from minerals. The oxygen content in biopitch is ca 20 wt% and in mineral pitches it is no more than 2 wt%. Characterization experiments for electrode samples measured electrical resistivity, Young's modulus, rupture strength, density, porosity and proximate analysis.

  6. In vitro affinity screening of protein and peptide binders by megavalent bead surface display.

    Science.gov (United States)

    Diamante, Letizia; Gatti-Lafranconi, Pietro; Schaerli, Yolanda; Hollfelder, Florian

    2013-10-01

    The advent of protein display systems has provided access to tailor-made protein binders by directed evolution. We introduce a new in vitro display system, bead surface display (BeSD), in which a gene is mounted on a bead via strong non-covalent (streptavidin/biotin) interactions and the corresponding protein is displayed via a covalent thioether bond on the DNA. In contrast to previous monovalent or low-copy bead display systems, multiple copies of the DNA and the protein or peptide of interest are displayed in defined quantities (up to 10(6) of each), so that flow cytometry can be used to obtain a measure of binding affinity. The utility of the BeSD in directed evolution is validated by library selections of randomized peptide sequences for binding to the anti-hemagglutinin (HA) antibody that proceed with enrichments in excess of 10(3) and lead to the isolation of high-affinity HA-tags within one round of flow cytometric screening. On-bead K(d) measurements suggest that the selected tags have affinities in the low nanomolar range. In contrast to other display systems (such as ribosome, mRNA and phage display) that are limited to affinity panning selections, BeSD possesses the ability to screen and rank binders by their affinity in vitro, a feature that hitherto has been exclusive to in vivo multivalent cell display systems (such as yeast display).

  7. Designed protein binders in combination with nanocrystalline diamond for use in high-sensitivity biosensors.

    Science.gov (United States)

    Fromell, Karin; Forsberg, Pontus; Karlsson, Mikael; Larsson, Karin; Nikolajeff, Fredrik; Baltzer, Lars

    2012-10-01

    A platform for diagnostic applications showing signal-to-noise ratios that by far surpass those of traditional bioanalytical test formats has been developed. It combines the properties of modified nanocrystalline diamond (NCD) surfaces and those of polyethylene oxide and polypropylene oxide based block copolymers for surface passivation and binder conjugation with a new class of synthetic binders for proteins. The NCD surfaces were fluorine-, hydrogen-, or oxygen-terminated prior to further biofunctionalization and the surface composition was characterized by X-ray photoelectron spectroscopy. In a proof of principle demonstration targeting the C-reactive protein, an ELISA carried out using an F-terminated diamond surface showed a signal-to-noise ratio of 3,900 which compares well to the signal-to-noise of 89 obtained in an antibody-based ELISA on a polystyrene microtiter plate, a standard test format used in most life science laboratories today. The increase in signal-to-noise ratio is to a large extent the result of extremely efficient passivation of the diamond surface. The results suggest that significant improvements can be obtained in standardized test formats using new materials in combination with new types of chemical coatings and receptor molecules.

  8. SiteBinder: an improved approach for comparing multiple protein structural motifs.

    Science.gov (United States)

    Sehnal, David; Vařeková, Radka Svobodová; Huber, Heinrich J; Geidl, Stanislav; Ionescu, Crina-Maria; Wimmerová, Michaela; Koča, Jaroslav

    2012-02-27

    There is a paramount need to develop new techniques and tools that will extract as much information as possible from the ever growing repository of protein 3D structures. We report here on the development of a software tool for the multiple superimposition of large sets of protein structural motifs. Our superimposition methodology performs a systematic search for the atom pairing that provides the best fit. During this search, the RMSD values for all chemically relevant pairings are calculated by quaternion algebra. The number of evaluated pairings is markedly decreased by using PDB annotations for atoms. This approach guarantees that the best fit will be found and can be applied even when sequence similarity is low or does not exist at all. We have implemented this methodology in the Web application SiteBinder, which is able to process up to thousands of protein structural motifs in a very short time, and which provides an intuitive and user-friendly interface. Our benchmarking analysis has shown the robustness, efficiency, and versatility of our methodology and its implementation by the successful superimposition of 1000 experimentally determined structures for each of 32 eukaryotic linear motifs. We also demonstrate the applicability of SiteBinder using three case studies. We first compared the structures of 61 PA-IIL sugar binding sites containing nine different sugars, and we found that the sugar binding sites of PA-IIL and its mutants have a conserved structure despite their binding different sugars. We then superimposed over 300 zinc finger central motifs and revealed that the molecular structure in the vicinity of the Zn atom is highly conserved. Finally, we superimposed 12 BH3 domains from pro-apoptotic proteins. Our findings come to support the hypothesis that there is a structural basis for the functional segregation of BH3-only proteins into activators and enablers.

  9. Design of phage-displayed cystine-stabilized mini-protein libraries for proteinaceous binder engineering.

    Science.gov (United States)

    Chang, Hung-Ju; Yang, An-Suei

    2014-01-01

    Cystine-stabilized mini-proteins are important scaffolds in the combinatorial search of binders for molecular recognition. The structural determinants of a cystine-stabilized scaffold are the critical residues determining the formation of the native disulfide-bonding configuration, and thus should remain unchanged in the combinatorial libraries so as to allow a large portion of the library sequences to be compatible with the scaffold structure. A high-throughput molecular evolution procedure has been developed to select and screen for the polypeptide sequences folding into a specific cystine-stabilized structure. Patterns of sequence preference that emerge from the resultant sequence profiles provide structural determinant information, which facilitates the designs of combinatorial libraries for combinatorial approaches as in phage display. This methodology enables artificial cystine-stabilized proteins to be engineered with enhanced folding and binding properties.

  10. GEL CASTING OF ALUMINA CERAMICS USING AN EGG WHITE PROTEIN BINDER SYSTEM

    Directory of Open Access Journals (Sweden)

    XING HE

    2011-02-01

    Full Text Available Egg white protein (EW is a food ingredient commonly used for its gelling properties and has been applied in ceramic fabrication. In this work, EW was used as an environmentally-friendly binder for gelcasting alumina ceramics at elevated temperature (80°C. The gelling behavior was compared with the ambient temperature drying-induced gelation processing. The processing conditions and mechanical properties of the ceramics processed from two different processing variants were compared. The results indicate that the ceramics from heat-induced gelation showed improved mechanical properties and more uniform microstructure after sintering in comparison to the drying-induced ones. Dense and complex-shaped ceramic parts via computer numerical controlled (CNC green machining have been produced from the EW gelcast ceramics.

  11. New Insights into the Phylogeny and Gene Context Analysis of Binder of Sperm Proteins (BSPs.

    Directory of Open Access Journals (Sweden)

    Edith Serrano

    Full Text Available Seminal plasma (SP proteins support the survival of spermatozoa acting not only at the plasma membrane but also by inhibition of capacitation, resulting in higher fertilizing ability. Among SP proteins, BSP (binder of sperm proteins are the most studied, since they may be useful for the improvement of semen diluents, storage and subsequent fertilization results. However, an updated and detailed phylogenetic analysis of the BSP protein superfamily has not been carried out with all the sequences described in the main databases. The update view shows for the first time an equally distributed number of sequences between the three families: BSP, and their homologs 1 (BSPH1 and 2 (BSPH2. The BSP family is divided in four subfamilies, BSP1 subfamily being the predominant, followed by subfamilies BSP3, BSP5 and BSP2. BSPH proteins were found among placental mammals (Eutheria belonging to the orders Proboscidea, Primates, Lagomorpha, Rodentia, Chiroptera, Perissodactyla and Cetartiodactyla. However, BSPH2 proteins were also found in the Scandentia order and Metatheria clade. This phylogenetic analysis, when combined with a gene context analysis, showed a completely new evolutionary scenario for the BSP superfamily of proteins with three defined different gene patterns, one for BSPs, one for BSPH1/BSPH2/ELSPBP1 and another one for BSPH1/BSPH2 without ELSPBP1. In addition, the study has permitted to define concise conserved blocks for each family (BSP, BSPH1 and BSPH2, which could be used for a more reliable assignment for the incoming sequences, for data curation of current databases, and for cloning new BSPs, as the one described in this paper, ram seminal vesicle 20 kDa protein (RSVP20, Ovis aries BSP5b.

  12. New Insights into the Phylogeny and Gene Context Analysis of Binder of Sperm Proteins (BSPs)

    Science.gov (United States)

    Arruga, Diana; Pérez-Pé, Rosaura; Sánchez-Ferrer, Álvaro; Muiño-Blanco, Teresa; Cebrián-Pérez, José A.

    2015-01-01

    Seminal plasma (SP) proteins support the survival of spermatozoa acting not only at the plasma membrane but also by inhibition of capacitation, resulting in higher fertilizing ability. Among SP proteins, BSP (binder of sperm) proteins are the most studied, since they may be useful for the improvement of semen diluents, storage and subsequent fertilization results. However, an updated and detailed phylogenetic analysis of the BSP protein superfamily has not been carried out with all the sequences described in the main databases. The update view shows for the first time an equally distributed number of sequences between the three families: BSP, and their homologs 1 (BSPH1) and 2 (BSPH2). The BSP family is divided in four subfamilies, BSP1 subfamily being the predominant, followed by subfamilies BSP3, BSP5 and BSP2. BSPH proteins were found among placental mammals (Eutheria) belonging to the orders Proboscidea, Primates, Lagomorpha, Rodentia, Chiroptera, Perissodactyla and Cetartiodactyla. However, BSPH2 proteins were also found in the Scandentia order and Metatheria clade. This phylogenetic analysis, when combined with a gene context analysis, showed a completely new evolutionary scenario for the BSP superfamily of proteins with three defined different gene patterns, one for BSPs, one for BSPH1/BSPH2/ELSPBP1 and another one for BSPH1/BSPH2 without ELSPBP1. In addition, the study has permitted to define concise conserved blocks for each family (BSP, BSPH1 and BSPH2), which could be used for a more reliable assignment for the incoming sequences, for data curation of current databases, and for cloning new BSPs, as the one described in this paper, ram seminal vesicle 20 kDa protein (RSVP20, Ovis aries BSP5b). PMID:26333091

  13. Inactive enzymatic mutant proteins (phosphoglycerate mutase and enolase as sugar binders for ribulose-1,5-bisphosphate regeneration reactors

    Directory of Open Access Journals (Sweden)

    Giri Ashok

    2005-02-01

    Full Text Available Abstract Background Carbon dioxide fixation bioprocess in reactors necessitates recycling of D-ribulose1,5-bisphosphate (RuBP for continuous operation. A radically new close loop of RuBP regenerating reactor design has been proposed that will harbor enzyme-complexes instead of purified enzymes. These reactors will need binders enabling selective capture and release of sugar and intermediate metabolites enabling specific conversions during regeneration. In the current manuscript we describe properties of proteins that will act as potential binders in RuBP regeneration reactors. Results We demonstrate specific binding of 3-phosphoglycerate (3PGA and 3-phosphoglyceraldehyde (3PGAL from sugar mixtures by inactive mutant of yeast enzymes phosphoglycerate mutase and enolase. The reversibility in binding with respect to pH and EDTA has also been shown. No chemical conversion of incubated sugars or sugar intermediate metabolites were found by the inactive enzymatic proteins. The dissociation constants for sugar metabolites are in the micromolar range, both proteins showed lower dissociation constant (Kd for 3-phosphoglycerate (655–796 μM compared to 3-phosphoglyceraldehyde (822–966 μM indicating higher affinity for 3PGA. The proteins did not show binding to glucose, sucrose or fructose within the sensitivity limits of detection. Phosphoglycerate mutase showed slightly lower stability on repeated use than enolase mutants. Conclusions The sugar and their intermediate metabolite binders may have a useful role in RuBP regeneration reactors. The reversibility of binding with respect to changes in physicochemical factors and stability when subjected to repeated changes in these conditions are expected to make the mutant proteins candidates for in-situ removal of sugar intermediate metabolites for forward driving of specific reactions in enzyme-complex reactors.

  14. Particle-based N-linked glycan analysis of selected proteins from biological samples using nonglycosylated binders.

    Science.gov (United States)

    Sroka-Bartnicka, Anna; Karlsson, Isabella; Ndreu, Lorena; Quaranta, Alessandro; Pijnappel, Matthijs; Thorsén, Gunnar

    2017-01-05

    Glycosylation is one of the most common and important post-translational modifications, influencing both the chemical and the biological properties of proteins. Studying the glycosylation of the entire protein population of a sample can be challenging because variations in the concentrations of certain proteins can enhance or obscure changes in glycosylation. Furthermore, alterations in the glycosylation pattern of individual proteins, exhibiting larger variability in disease states, have been suggested as biomarkers for different types of cancer, as well as inflammatory and neurodegenerative diseases. In this paper, we present a rapid and efficient method for glycosylation analysis of individual proteins focusing on changes in the degree of fucosylation or other alterations to the core structure of the glycans, such as the presence of bisecting N-acetylglucosamines and a modified degree of branching. Streptavidin-coated magnetic beads are used in combination with genetically engineered immunoaffinity binders, called VHH antibody fragments. A major advantage of the VHHs is that they are nonglycosylated; thus, enzymatic release of glycans from the targeted protein can be performed directly on the beads. After deglycosylation, the glycans are analyzed by MALDI-TOF-MS. The developed method was evaluated concerning its specificity, and thereafter implemented for studying the glycosylation pattern of two different proteins, alpha-1-antitrypsin and transferrin, in human serum and cerebrospinal fluid. To our knowledge, this is the first example of a protein array-type experiment that employs bead-based immunoaffinity purification in combination with mass spectrometry analysis for fast and efficient glycan analysis of individual proteins in biological fluid. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  15. A single rainbow trout cobalamin-binding protein stands in for three human binders

    DEFF Research Database (Denmark)

    Greibe, Eva; Fedosov, Sergey; Sorensen, Boe S

    2012-01-01

    -binding proteins of the rainbow trout (Oncorhynchus mykiss) and to compare their properties with those of the three human cobalamin-binding proteins. High cobalamin-binding capacity was found in trout stomach (210 pmol/g), roe (400 pmol/g), roe fluid (390 nmol/liter), and plasma (2500 nmol/liter). In all cases...

  16. Rheological characteristics of synthetic road binders

    Energy Technology Data Exchange (ETDEWEB)

    Gordon D. Airey; Musarrat H. Mohammed; Caroline Fichter [University of Nottingham, Nottingham (United Kingdom)

    2008-08-15

    This paper deals with the synthesis of polymer binders from monomers that could in future be derived from renewable resources. These binders consist of polyethyl acrylate (PEA) of different molecular weight, polymethyl acrylate (PMA) and polybutyl acrylate (PBA), which were synthesised from ethyl acrylate, methyl acrylate and butyl acrylate, respectively, by atom transfer radical polymerization (ATRP). The fundamental rheological properties of these binders were determined by means of a dynamic shear rheometer (DSR) using a combination of temperature and frequency sweeps. The results indicate that PEA has rheological properties similar to that of 100/150 penetration grade bitumen, PMA similar rheological properties to that of 10/20 penetration grade bitumen, while PBA, due to its highly viscous nature and low complex modulus, cannot be used on its own as an asphalt binder. The synthetic binders were also combined with conventional penetration grade bitumen to produce a range of bitumen-synthetic polymer binder blends. These blends were batched by mass in the ratio of 1:1 or 3:1 and subjected to the same DSR rheological testing as the synthetic binders. The blends consisting of a softer bitumen (70/100 pen or 100/150 pen) with a hard synthetic binder (PMA) tended to be more compatible and therefore stable and produced rheological properties that combined the properties of the two components. The synthetic binders and particularly the extended bitumen samples (blends) produced rheological properties that showed similar characteristics to elastomeric SBS PMBs. 30 refs., 12 figs., 2 tabs.

  17. Development of an innovative bio-binder using Asphalt-rubber technology

    OpenAIRE

    2013-01-01

    This research work evaluates several parameters that can affect Asphalt Rubber (AR) binder performance and applies the AR technology to the development of an innovative renewable bio-binder that can fully and cost-effectively replace asphaltic bitumen derived from petroleum in flexible pavement construction. The “Binder Accelerated Separator” method was used to divide the constituents of the Asphalt Rubber and bio-binder (residual binder and swelled rubber). The physical and chemi...

  18. Metal-phosphate binders

    Science.gov (United States)

    Howe, Beth Ann [Lewistown, IL; Chaps-Cabrera, Jesus Guadalupe [Coahuila, MX

    2009-05-12

    A metal-phosphate binder is provided. The binder may include an aqueous phosphoric acid solution, a metal-cation donor including a metal other than aluminum, an aluminum-cation donor, and a non-carbohydrate electron donor.

  19. Anionic surface binders

    Directory of Open Access Journals (Sweden)

    Aljaž-Rožič Mateja

    2004-01-01

    Full Text Available The MELAMIN Chemical Factory in Kočevje manufactures synthetic resins and binders for the paper industry. Binders based on AKD (alkyl ketene dimer are produced which are used for binding paper and cardboard in the range of neutral and partially basic pH. Cationic and, lately, anionic binders are mostly used for the bulk binding of paper and board. The possibility of using AKD binders on paper or board surfaces is presented. In this case partially cationic AKD binders may be applied. When optical whiteners are used, the application of AKD binders is recommended. In the case of paper it is possible to substitute acrylate binders by AKD binders. The best results are obtained when the paper is first partly treated in bulk and subsequently surface treated.

  20. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry as a tool for fast identification of protein binders in color layers of paintings.

    Science.gov (United States)

    Hynek, Radovan; Kuckova, Stepanka; Hradilova, Janka; Kodicek, Milan

    2004-01-01

    Identification of materials in color layers of paintings is necessary for correct decisions concerning restoration procedures as well as proving the authenticity of the painting. The proteins are usually important components of the painting layers. In this paper it has been demonstrated that matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOFMS) can be used for fast and reliable identification of proteins in color layers even in old, highly aged matrices. The digestion can be easily performed directly on silica wafers which are routinely used for infrared analysis. The amount of material necessary for such an analysis is extremely small. Peptide mass mapping using digestion with trypsin followed by MALDI-TOFMS and identification of the protein was successfully used for determination of the binder from a painting of the 19th century.

  1. HMX/TATB/binder development

    Energy Technology Data Exchange (ETDEWEB)

    Stallings, T.L.; Osborn, A.G.; Schaffer, C.L.; Crutchmer, J.A.

    1981-05-01

    The processing and sensitivity characteristics of three HMX/TATB/Binder formulations were investigated. Viton A, Kraton G 1650, and Estane 5702-F1 binders were studied. The thermal stabilities of these compositions are near those of HMX/binder formulations, whereas impact, skid and friction sensitivity levels are less than HMX compositions, but greater than those of TATB/binder systems.

  2. Heterochromatin protein 1 promotes self-renewal and triggers regenerative proliferation in adult stem cells.

    Science.gov (United States)

    Zeng, An; Li, Yong-Qin; Wang, Chen; Han, Xiao-Shuai; Li, Ge; Wang, Jian-Yong; Li, Dang-Sheng; Qin, Yong-Wen; Shi, Yufang; Brewer, Gary; Jing, Qing

    2013-04-29

    Adult stem cells (ASCs) capable of self-renewal and differentiation confer the potential of tissues to regenerate damaged parts. Epigenetic regulation is essential for driving cell fate decisions by rapidly and reversibly modulating gene expression programs. However, it remains unclear how epigenetic factors elicit ASC-driven regeneration. In this paper, we report that an RNA interference screen against 205 chromatin regulators identified 12 proteins essential for ASC function and regeneration in planarians. Surprisingly, the HP1-like protein SMED-HP1-1 (HP1-1) specifically marked self-renewing, pluripotent ASCs, and HP1-1 depletion abrogated self-renewal and promoted differentiation. Upon injury, HP1-1 expression increased and elicited increased ASC expression of Mcm5 through functional association with the FACT (facilitates chromatin transcription) complex, which consequently triggered proliferation of ASCs and initiated blastema formation. Our observations uncover an epigenetic network underlying ASC regulation in planarians and reveal that an HP1 protein is a key chromatin factor controlling stem cell function. These results provide important insights into how epigenetic mechanisms orchestrate stem cell responses during tissue regeneration.

  3. New BioCo binders containing biopolymers for foundry industry

    Directory of Open Access Journals (Sweden)

    B. Grabowska

    2013-01-01

    Full Text Available Possibilities of cross-linking of new polymer binders from the BioCo group, their hardening in moulding sands at the application of cross-linking agents both physical and chemical are presented. Their thermal stability was determined. It was proved, that moulding sands bound by the BioCo binders are characterised by the compression strength (Ruc of an order of 2 MPa, and the bending strength (Rug of 1 MPa, after 1 hour of a sample curing. The worked out BioCo binders are biodegradable and renewable in the part which was not completely burned. The investigated moulding sands with the BioCo binders are easily knocked out and have a good susceptibility for mechanical reclamation processes.

  4. Breakpoint or Binder

    NARCIS (Netherlands)

    dr. Gürkan Çelik

    2013-01-01

    Civil society as a social sphere is constantly subjected to change. Using the Dutch context, this article addresses the question whether religiously inspired engagement is a binder or a breakpoint in modern societies. The author examines how religiously inspired people in the Netherlands involve the

  5. Targeting proapoptotic protein BAD inhibits survival and self-renewal of cancer stem cells.

    Science.gov (United States)

    Sastry, K S R; Al-Muftah, M A; Li, Pu; Al-Kowari, M K; Wang, E; Ismail Chouchane, A; Kizhakayil, D; Kulik, G; Marincola, F M; Haoudi, A; Chouchane, L

    2014-12-01

    Emerging evidence suggests that the resistance of cancer stem cells (CSC) to many conventional therapies is one of the major limiting factors of cancer therapy efficacy. Identification of mechanisms responsible for survival and self-renewal of CSC will help design new therapeutic strategies that target and eliminate both differentiated cancer cells and CSC. Here we demonstrated the potential role of proapoptotic protein BAD in the biology of CSC in melanoma, prostate and breast cancers. We enriched CD44(+)/CD24(-) cells (CSC) by tumorosphere formation and purified this population by FACS. Both spheres and CSC exhibited increased potential for proliferation, migration, invasion, sphere formation, anchorage-independent growth, as well as upregulation of several stem cell-associated markers. We showed that the phosphorylation of BAD is essential for the survival of CSC. Conversely, ectopic expression of a phosphorylation-deficient mutant BAD induced apoptosis in CSC. This effect was enhanced by treatment with a BH3-mimetic, ABT-737. Both pharmacological agents that inhibit survival kinases and growth factors that are involved in drug resistance delivered their respective cytotoxic and protective effects by modulating the BAD phosphorylation in CSC. Furthermore, the frequency and self-renewal capacity of CSC was significantly reduced by knocking down the BAD expression. Consistent with our in vitro results, significant phosphorylation of BAD was found in CD44(+) CSC of 83% breast tumor specimens. In addition, we also identified a positive correlation between BAD expression and disease stage in prostate cancer, suggesting a role of BAD in tumor advancement. Our studies unveil the role of BAD in the survival and self-renewal of CSC and propose BAD not only as an attractive target for cancer therapy but also as a marker of tumor progression.

  6. Biobased adhesives, gums, emulsions and binders: current trends and future prospects

    Science.gov (United States)

    Biopolymers derived from renewable resources are an emerging class of advanced materials that offer many useful properties for a wide range of food and non-food applications. Current state of the art in research and development of renewable polymers as adhesives, gums, binders and emulsions will be ...

  7. Interaction nonlinearity in asphalt binders

    Science.gov (United States)

    Motamed, Arash; Bhasin, Amit; Liechti, Kenneth M.

    2012-05-01

    Asphalt mixtures are complex composites that comprise aggregate, asphalt binder, and air. Several research studies have shown that the mechanical behavior of the asphalt mixture is strongly influenced by the matrix, i.e. the asphalt binder. Characterization and a thorough understanding of the binder behavior is the first and crucial step towards developing an accurate constitutive model for the composite. Accurate constitutive models for the constituent materials are critical to ensure accurate performance predictions at a material and structural level using micromechanics. This paper presents the findings from a systematic investigation into the nature of the linear and nonlinear response of asphalt binders subjected to different types of loading using the Dynamic Shear Rheometer (DSR). Laboratory test data show that a compressive normal force is generated in an axially constrained specimen subjected to torsional shear. This paper investigates the source of this normal force and demonstrates that the asphalt binder can dilate when subjected to shear loads. This paper also presents the findings from a study conducted to investigate the source of the nonlinearity in the asphalt binder. Test results demonstrate that the application of cyclic shear loads results in the development of a normal force and a concomitant reduction in the dynamic shear modulus. This form of nonlinear response is referred to as an "interaction nonlinearity". A combination of experimental and analytical tools is used to demonstrate and verify the presence of this interaction nonlinearity in asphalt binders. The findings from this study highlight the importance of modeling the mechanical behavior of asphalt binders based on the overall stress state of the material.

  8. A novel screening system for claudin binder using baculoviral display.

    Directory of Open Access Journals (Sweden)

    Hideki Kakutani

    Full Text Available Recent progress in cell biology has provided new insight into the claudin (CL family of integral membrane proteins, which contains more than 20 members, as a target for pharmaceutical therapy. Few ligands for CL have been identified because it is difficult to prepare CL in an intact form. In the present study, we developed a method to screen for CL binders by using the budded baculovirus (BV display system. CL4-displaying BV interacted with a CL4 binder, the C-terminal fragment of Clostridium perfringens enterotoxin (C-CPE, but it did not interact with C-CPE that was mutated in its CL4-binding region. C-CPE did not interact with BV and CL1-displaying BV. We used CL4-displaying BV to select CL4-binding phage in a mixture of a scFv-phage and C-CPE-phage. The percentage of C-CPE-phage in the phage mixture increased from 16.7% before selection to 92% after selection, indicating that CL-displaying BV may be useful for the selection of CL binders. We prepared a C-CPE phage library by mutating the functional amino acids. We screened the library for CL4 binders by affinity to CL4-displaying BV, and we found that the novel CL4 binders modulated the tight-junction barrier. These findings indicate that the CL-displaying BV system may be a promising method to produce a novel CL binder and modulator.

  9. Increase in composite binder activity

    Science.gov (United States)

    Fediuk, R.; Smoliakov, A.; Stoyushko, N.

    2016-11-01

    The binder of portland cement (51-59 wt.%), fly ash of thermal power stations (3644 wt.%), limestone crushing waste (4-9 wt.%) and dry hyper plasticizer (0.2 wt.%) has been created. It can be used in the building materials industry for production of high-strength concrete. The composite binder is obtained by co-milling of the components in vario-planetary mill to a specific surface area of 550-600 m2/kg. The technical result is the possibility of obtaining a composite binder with significant replacement of cement with industrial waste, cost-effective and superior to portland cement for construction and technical properties, increased activity. This allows producing concrete for walling with a compressive strength of 100 MPa, while using more than 50% of industrial waste.

  10. Electrochemical components employing polysiloxane-derived binders

    Science.gov (United States)

    Delnick, Frank M.

    2013-06-11

    A processed polysiloxane resin binder for use in electrochemical components and the method for fabricating components with the binder. The binder comprises processed polysiloxane resin that is partially oxidized and retains some of its methyl groups following partial oxidation. The binder is suitable for use in electrodes of various types, separators in electrochemical devices, primary lithium batteries, electrolytic capacitors, electrochemical capacitors, fuel cells and sensors.

  11. Heat-resistant inorganic binders.

    Directory of Open Access Journals (Sweden)

    KUDRYAVTSEV Pavel Gennadievich,

    2017-04-01

    Full Text Available The authors consider some aspects of production of inorganic heat-resistant composite materials in which new classes of inorganic binders - the basic salts of various metals – are applied. The possibility to use hydroxochlorides and hydroxonitrates of aluminum, zirconium, chromium and a number of other metals as the binder has been shown. The main products of the thermal decomposition of all types of binders discussed in this paper are nano-dispersed highly refractory oxides. Increased pressure in the manufacture of these materials shifts the position of the minimum of the dependence «production strength – production temperature» in the direction of low temperatures. This effect is caused by decreased film thickness of the binder located between filler particles and hence by increased rate of transfer of the matter to the interface and by facilitated sintering process. Materials based on the systems containing chromium and some other elements in transitional oxidation states are colour. For this reason, they have the worst thermal conductivity under the same heat resistance compared to colorless materials.

  12. The Influence of Wall Binders

    DEFF Research Database (Denmark)

    Rose, Jørgen

    1997-01-01

    This report is an analysis of the thermal bridge effects that occur in wall binders in masonry buildings. The effects are analyzed using a numerical calculation programme.The results are compared to the values given in the danish standard, DS418....

  13. In silico design of smart binders to anthrax PA

    Science.gov (United States)

    Sellers, Michael; Hurley, Margaret M.

    2012-06-01

    The development of smart peptide binders requires an understanding of the fundamental mechanisms of recognition which has remained an elusive grail of the research community for decades. Recent advances in automated discovery and synthetic library science provide a wealth of information to probe fundamental details of binding and facilitate the development of improved models for a priori prediction of affinity and specificity. Here we present the modeling portion of an iterative experimental/computational study to produce high affinity peptide binders to the Protective Antigen (PA) of Bacillus anthracis. The result is a general usage, HPC-oriented, python-based toolkit based upon powerful third-party freeware, which is designed to provide a better understanding of peptide-protein interactions and ultimately predict and measure new smart peptide binder candidates. We present an improved simulation protocol with flexible peptide docking to the Anthrax Protective Antigen, reported within the context of experimental data presented in a companion work.

  14. Development of a rubber-modified fractionated bio-oil for use as noncrude petroleum binder in flexible pavements

    OpenAIRE

    2012-01-01

    The increasing demand for petroleum-derived products coupled with decreasing world crude reserves has led to substantial increases in asphalt pricing. Society’s additional interest in energy independence and use of renewable sources of energy is also a motivation for developing and using more sustainable materials such as binders derived from noncrude petroleum sources for use in highway applications. Iowa State University has been developing noncrude petroleum binders derived from the produc...

  15. miR-200c and GATA binding protein 4 regulate human embryonic stem cell renewal and differentiation

    Directory of Open Access Journals (Sweden)

    Hsiao-Ning Huang

    2014-03-01

    Full Text Available Human embryonic stem cells (hESCs are functionally unique for their self-renewal ability and pluripotency, but the molecular mechanisms giving rise to these properties are not fully understood. hESCs can differentiate into embryoid bodies (EBs containing ectoderm, mesoderm, and endoderm. In the miR-200 family, miR-200c was especially enriched in undifferentiated hESCs and significantly downregulated in EBs. The knockdown of the miR-200c in hESCs downregulated Nanog expression, upregulated GATA binding protein 4 (GATA4 expression, and induced hESC apoptosis. The knockdown of GATA4 rescued hESC apoptosis induced by downregulation of miR-200c. miR-200c directly targeted the 3′-untranslated region of GATA4. Interestingly, the downregulation of GATA4 significantly inhibited EB formation in hESCs. Overexpression of miR-200c inhibited EB formation and repressed the expression of ectoderm, endoderm, and mesoderm markers, which could partially be rescued by ectopic expression of GATA4. Fibroblast growth factor (FGF and activin A/nodal can sustain hESC renewal in the absence of feeder layer. Inhibition of transforming growth factor-β (TGF-β/activin A/nodal signaling by SB431542 treatment downregulated the expression of miR-200c. Overexpression of miR-200c partially rescued the expression of Nanog/phospho-Smad2 that was downregulated by SB431542 treatment. Our observations have uncovered novel functions of miR-200c and GATA4 in regulating hESC renewal and differentiation.

  16. Prion protein is expressed on long-term repopulating hematopoietic stem cells and is important for their self-renewal.

    Science.gov (United States)

    Zhang, Cheng Cheng; Steele, Andrew D; Lindquist, Susan; Lodish, Harvey F

    2006-02-14

    Although the wild-type prion protein (PrP) is abundant and widely expressed in various types of tissues and cells, its physiological function(s) remain unknown, and PrP knockout mice do not exhibit overt and undisputed phenotypes. Here we showed that PrP is expressed on the surface of several bone marrow cell populations successively enriched in long-term (LT) hematopoietic stem cells (HSCs) using flow cytometry analysis. Affinity purification of the PrP-positive and -negative fractions from these populations, followed by competitive bone marrow reconstitution assays, shows that all LT HSCs express PrP. HSCs from PrP-null bone marrow exhibited impaired self-renewal in serial transplantation of lethally irradiated mouse recipients both in the presence and absence of competitors. When treated with a cell cycle-specific myelotoxic agent, the animals reconstituted with PrP-null HSCs exhibit increased sensitivity to hematopoietic cell depletion. Ectopic expression of PrP in PrP-null bone marrow cells by retroviral infection rescued the defective hematopoietic engraftment during serial transplantation. Therefore, PrP is a marker for HSCs and supports their self-renewal.

  17. Observation of asphalt binder microstructure with ESEM.

    Science.gov (United States)

    Mikhailenko, P; Kadhim, H; Baaj, H; Tighe, S

    2017-09-01

    The observation of asphalt binder with the environmental scanning electron microscope (ESEM) has shown the potential to observe asphalt binder microstructure and its evolution with binder aging. A procedure for the induction and identification of the microstructure in asphalt binder was established in this study and included sample preparation and observation parameters. A suitable heat-sampling asphalt binder sample preparation method was determined for the test and several stainless steel and Teflon sample moulds developed, finding that stainless steel was the preferable material. The magnification and ESEM settings conducive to observing the 3D microstructure were determined through a number of observations to be 1000×, although other magnifications could be considered. Both straight run binder (PG 58-28) and an air blown oxidised binder were analysed; their structures being compared for their relative size, abundance and other characteristics, showing a clear evolution in the fibril microstructure. The microstructure took longer to appear for the oxidised binder. It was confirmed that the fibril microstructure corresponded to actual characteristics in the asphalt binder. Additionally, a 'bee' micelle structure was found as a transitional structure in ESEM observation. The test methods in this study will be used for more comprehensive analysis of asphalt binder microstructure. © 2017 The Authors Journal of Microscopy © 2017 Royal Microscopical Society.

  18. Twin screw wet granulation: Binder delivery.

    Science.gov (United States)

    Saleh, Mohammed F; Dhenge, Ranjit M; Cartwright, James J; Hounslow, Michael J; Salman, Agba D

    2015-06-20

    The effects of three ways of binder delivery into the twin screw granulator (TSG) on the residence time, torque, properties of granules (size, shape, strength) and binder distribution were studied. The binder distribution was visualised through the transparent barrel using high speed imaging as well as quantified using offline technique. Furthermore, the effect of binder delivery and the change of screw configuration (conveying elements only and conveying elements with kneading elements) on the surface velocity of granules across the screw channel were investigated using particle image velocimetry (PIV). The binder was delivered in three ways; all solid binder incorporated with powder mixture, 50% of solid binder mixed with powder mixture and 50% mixed with water, all the solid binder dissolved in water. Incorporation of all solid binder with powder mixture resulted in the relatively longer residence time and higher torque, narrower granule size distribution, more spherical granules, weaker big-sized granules, stronger small-sized granules and better binder distribution compared to that in other two ways. The surface velocity of granules showed variation from one screw to another as a result of uneven liquid distribution as well as shown a reduction while introducing the kneading elements into the screw configuration.

  19. The Extracellular Heme-binding Protein HbpS from the Soil Bacterium Streptomyces reticuli Is an Aquo-cobalamin Binder*

    Science.gov (United States)

    Ortiz de Orué Lucana, Darío; Fedosov, Sergey N.; Wedderhoff, Ina; Che, Edith N.; Torda, Andrew E.

    2014-01-01

    The extracellular protein HbpS from Streptomyces reticuli interacts with iron ions and heme. It also acts in concert with the two-component sensing system SenS-SenR in response to oxidative stress. Sequence comparisons suggested that the protein may bind a cobalamin. UV-visible spectroscopy confirmed binding (Kd = 34 μm) to aquo-cobalamin (H2OCbl+) but not to other cobalamins. Competition experiments with the H2OCbl+-coordinating ligand CN− and comparison of mutants identified a histidine residue (His-156) that coordinates the cobalt ion of H2OCbl+ and substitutes for water. HbpS·Cobalamin lacks the Asp-X-His-X-X-Gly motif seen in some cobalamin binding enzymes. Preliminary tests showed that a related HbpS protein from a different species also binds H2OCbl+. Furthermore, analyses of HbpS-heme binding kinetics are consistent with the role of HbpS as a heme-sensor and suggested a role in heme transport. Given the high occurrence of HbpS-like sequences among Gram-positive and Gram-negative bacteria, our findings suggest a great functional versatility among these proteins. PMID:25342754

  20. Quantification of the main digestive processes in ruminants: the equations involved in the renewed energy and protein feed evaluation systems.

    Science.gov (United States)

    Sauvant, D; Nozière, P

    2016-05-01

    The evolution of feeding systems for ruminants towards evaluation of diets in terms of multiple responses requires the updating of the calculation of nutrient supply to the animals to make it more accurate on aggregated units (feed unit, or UF, for energy and protein digestible in the intestine, or PDI, for metabolizable protein) and to allow prediction of absorbed nutrients. The present update of the French system is based on the building and interpretation through meta-analysis of large databases on digestion and nutrition of ruminants. Equations involved in the calculation of UF and PDI have been updated, allowing: (1) prediction of the out flow rate of particles and liquid depending on the level of intake and the proportion of concentrate, and the use of this in the calculation of ruminal digestion of protein and starch from in situ data; (2) the system to take into account the effects of the main factors of digestive interactions (level of intake, proportion of concentrate, rumen protein balance) on organic matter digestibility, energy losses in methane and in urine; (3) more accurate calculation of the energy available in the rumen and the efficiency of its use for the microbial protein synthesis. In this renewed model UF and PDI values of feedstuffs vary depending on diet composition, and intake level. Consequently, standard feed table values can be considered as being only indicative. It is thus possible to predict the nutrient supply on a wider range of diets more accurately and in particular to better integrate energy×protein interactions occurring in the gut.

  1. Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study.

    Science.gov (United States)

    Kittler, L; Baguley, B C; Löber, G; Waring, M J

    1999-01-01

    A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

  2. Time dependent viscoelastic rheological response of pure, modified and synthetic bituminous binders

    Science.gov (United States)

    Airey, G. D.; Grenfell, J. R. A.; Apeagyei, A.; Subhy, A.; Lo Presti, D.

    2016-08-01

    Bitumen is a viscoelastic material that exhibits both elastic and viscous components of response and displays both a temperature and time dependent relationship between applied stresses and resultant strains. In addition, as bitumen is responsible for the viscoelastic behaviour of all bituminous materials, it plays a dominant role in defining many of the aspects of asphalt road performance, such as strength and stiffness, permanent deformation and cracking. Although conventional bituminous materials perform satisfactorily in most highway pavement applications, there are situations that require the modification of the binder to enhance the properties of existing asphalt material. The best known form of modification is by means of polymer modification, traditionally used to improve the temperature and time susceptibility of bitumen. Tyre rubber modification is another form using recycled crumb tyre rubber to alter the properties of conventional bitumen. In addition, alternative binders (synthetic polymeric binders as well as renewable, environmental-friendly bio-binders) have entered the bitumen market over the last few years due to concerns over the continued availability of bitumen from current crudes and refinery processes. This paper provides a detailed rheological assessment, under both temperature and time regimes, of a range of conventional, modified and alternative binders in terms of the materials dynamic (oscillatory) viscoelastic response. The rheological results show the improved viscoelastic properties of polymer- and rubber-modified binders in terms of increased complex shear modulus and elastic response, particularly at high temperatures and low frequencies. The synthetic binders were found to demonstrate complex rheological behaviour relative to that seen for conventional bituminous binders.

  3. Renewal processes

    CERN Document Server

    Mitov, Kosto V

    2014-01-01

    This monograph serves as an introductory text to classical renewal theory and some of its applications for graduate students and researchers in mathematics and probability theory. Renewal processes play an important part in modeling many phenomena in insurance, finance, queuing systems, inventory control and other areas. In this book, an overview of univariate renewal theory is given and renewal processes in the non-lattice and lattice case are discussed. A pre-requisite is a basic knowledge of probability theory.

  4. Water-resistant gypsum binder

    Directory of Open Access Journals (Sweden)

    Panchenko Alexander I.

    2016-01-01

    Full Text Available The authors developed a multi-component gypsum binder (MGB with an improved (by 1.8 to 2.2 times water resistance value in comparison with the initial gypsum and a softening factor value within the range of 0.85 to 0.91 through the introduction of a complex additive containing carbide mud and bio-silica. The use of a complex additive provides for the formation of a denser structure due to the formation of low-base calcium hydrated silicates at early stages of the hardening process under wet or dry air conditions. The developed binding agent has a lower (by 2.5 to 3 times open porosity, a greater compressive strength (by 1.4 to 1.6 times for a dry state and by 2.6 times in a water-saturated state and does not require any special curing conditions in contrast to the other multi-component gypsum binders. The authors show the influence of mud-and-silica additive on the properties of hardened MGB and suggest a method of computation of the optimum MGB composition for given components.

  5. The estimation of ability to reclame of moduling sands with biopolymer binders

    Directory of Open Access Journals (Sweden)

    J. Jakubski

    2011-04-01

    Full Text Available Applied up till now organic binding materials, on the basis of synthetic resins are characterised by good technological properties, but cause high emission of harmful substances. That’s why contemporary scientific researches are leading to progressive replacing the binders obtained from petrochemical materials with polymer biocomposites coming from renewable resources. Increasing concern of aliphatic polyesters such as polylactide, polycaprolactone, poly(hydroxyalkanoates and aliphatic-aromatic polyesters is caused by the possibility of using them for producing many biodegradable products. In that context it is important to expand the researches connected to using biopolymers as moulding sands binders. Contemporary authors’ papers were focused on technological properties and harmfulness for the environment of this ecological moulding sands. TThis article takes into consideration the ability to reclamation of moulding sands with biopolymer binders.

  6. On the microstructure of bituminous binders

    NARCIS (Netherlands)

    Fischer, H.R.; Dillingh, E.C.; Hermse, C.G.M.

    2014-01-01

    The objective of this work is to study the common features and the evolution of microstructures of bituminous binders regardless of their grade (PEN 10/20 to 160/220) and source/origin using the atomic force microscope operated in phase contrast mode. All bituminous binders show the same microstruct

  7. Rheological characteristics of aged asphalt binder

    Institute of Scientific and Technical Information of China (English)

    刘聪慧; 吴少鹏; 刘全涛; 朱国军

    2008-01-01

    Different aging levels(RTFOT,PAV-10h,PAV-20h and PAV-30 h) of asphalt binders with various mass ratios of mineral powder to asphalt(0,0.4,0.8,1.2,1.6,2.0) were used to investigate the rheological properties of aged asphalt binders with respect to their short and long terms aging characteristics.Viscosity test,dynamic shear test and creep test were conducted.The test results indicate that the viscosity of aged asphalt binder increases sharply with the extension of aging period.Complex shear modulus of aged asphalt increases,which indicates that the stiffness of asphalt binders can increase.The phase angle for aged asphalt binders reduces,which indicates that the elastic portion for viscoelastic property of asphalt binders increases.|G*|·sin δ increases after aging procedure which means that the fatigue resistance becomes poor.The creep test results show that creep strain curves varies remarkably for virgin and aged asphalt binders.The total strain during loading period and the permanent strain decreases significantly for aged asphalt binders,which implies that the elastic portion increases and the viscous portion decreases.

  8. Optimization of Binder Jetting Using Taguchi Method

    Science.gov (United States)

    Shrestha, Sanjay; Manogharan, Guha

    2017-03-01

    Among several additive manufacturing (AM) methods, binder-jetting has undergone a recent advancement in its ability to process metal powders through selective deposition of binders on a powder bed followed by curing, sintering, and infiltration. This study analyzes the impact of various process parameters in binder jetting on mechanical properties of sintered AM metal parts. The Taguchi optimization method has been employed to determine the optimum AM parameters to improve transverse rupture strength (TRS), specifically: binder saturation, layer thickness, roll speed, and feed-to-powder ratio. The effects of the selected process parameters on the TRS performance of sintered SS 316L samples are studied with the American Society of Testing Materials (ASTM) standard test method. It was found that binder saturation and feed-to-powder ratio were the most critical parameters, which reflects the strong influence of binder powder interaction and density of powder bed on resulting mechanical properties. This article serves as an aid in understanding the optimum process parameters for binder jetting of SS 316L.

  9. Optimization of Binder Jetting Using Taguchi Method

    Science.gov (United States)

    Shrestha, Sanjay; Manogharan, Guha

    2017-01-01

    Among several additive manufacturing (AM) methods, binder-jetting has undergone a recent advancement in its ability to process metal powders through selective deposition of binders on a powder bed followed by curing, sintering, and infiltration. This study analyzes the impact of various process parameters in binder jetting on mechanical properties of sintered AM metal parts. The Taguchi optimization method has been employed to determine the optimum AM parameters to improve transverse rupture strength (TRS), specifically: binder saturation, layer thickness, roll speed, and feed-to-powder ratio. The effects of the selected process parameters on the TRS performance of sintered SS 316L samples are studied with the American Society of Testing Materials (ASTM) standard test method. It was found that binder saturation and feed-to-powder ratio were the most critical parameters, which reflects the strong influence of binder powder interaction and density of powder bed on resulting mechanical properties. This article serves as an aid in understanding the optimum process parameters for binder jetting of SS 316L.

  10. Center for BioBased Binders and Pollution Reduction Technology

    Energy Technology Data Exchange (ETDEWEB)

    Thiel, Jerry [Univ. of Northern Iowa, Cedar Falls, IA (United States)

    2013-07-01

    Funding will support the continuation of the Center for Advanced Bio-based Binders and Pollution Reduction Technology Center (CABB) in the development of bio-based polymers and emission reduction technologies for the metal casting industry. Since the formation of the center several new polymers based on agricultural materials have been developed. These new materials have show decreases in hazardous air pollutants, phenol and formaldehyde as much as 50 to 80% respectively. The polymers termed bio-polymers show a great potential to utilize current renewable agricultural resources to replace petroleum based products and reduce our dependence on importing of foreign oil. The agricultural technology has shown drastic reductions in the emission of hazardous air pollutants and volatile organic compounds and requires further development to maintain competitive costs and productivity. The project will also research new and improved inorganic binders that promise to eliminate hazardous emissions from foundry casting operations and allow for the beneficial reuse of the materials and avoiding the burdening of overcrowded landfills.

  11. Renewable Energy

    DEFF Research Database (Denmark)

    Sørensen, Bent Erik

    Bent Sorensen’s Renewable Energy: Physics, Engineering, Environmental Impacts, Economics and Planning, Fifth Edition, continues the tradition by providing a thorough and current overview of the entire renewable energy sphere. Since its first edition, this standard reference source helped put...... renewable energy on the map of scientific agendas. Several renewable energy solutions no longer form just a marginal addition to energy supply, but have become major players, with the promise to become the backbone of an energy system suitable for life in the sustainability lane. This volume is a problem...... structured around three parts in order to assist readers in focusing on the issues that impact them the most for a given project or question. PART I covers the basic scientific principles behind all major renewable energy resources, such as solar, wind, and biomass. PART II provides in-depth information...

  12. Renewable energy.

    Science.gov (United States)

    Destouni, Georgia; Frank, Harry

    2010-01-01

    The Energy Committee of the Royal Swedish Academy of Sciences has in a series of projects gathered information and knowledge on renewable energy from various sources, both within and outside the academic world. In this article, we synthesize and summarize some of the main points on renewable energy from the various Energy Committee projects and the Committee's Energy 2050 symposium, regarding energy from water and wind, bioenergy, and solar energy. We further summarize the Energy Committee's scenario estimates of future renewable energy contributions to the global energy system, and other presentations given at the Energy 2050 symposium. In general, international coordination and investment in energy research and development is crucial to enable future reliance on renewable energy sources with minimal fossil fuel use.

  13. How to assess the efficacy of phosphate binders.

    Science.gov (United States)

    Caravaca, Francisco; Caravaca-Fontán, Fernando; Azevedo, Lilia; Luna, Enrique

    The efficacy of phosphate binders is difficult to be estimated clinically. This study analyzes the changes in serum phosphate and urinary phosphate excretion after the prescription of phosphate binders (PB) in patients with chronic kidney disease stage 4-5 pre-dialysis, and the usefulness of the ratio between total urinary phosphate and protein catabolic rate (Pu/PCR) for estimating the efficacy of PB. This retrospective observational cohort study included adult chronic kidney disease patients. Biochemical parameters were determined baseline and after 45-60 days on a low phosphate diet plus PB ("binder" subgroup=260 patients) or only with dietary advice ("control" subgroup=79 patients). Phosphate load (total urinary excretion) per unit of renal function (Pu/GFR) was the best parameter correlated with serum phosphate levels (R(2)=0.61). Mean±SD level of Pu/PCR was 8.2±2.3mg of urinary phosphate per each g of estimated protein intake. After treatment with PB, serum phosphate levels decreased by 11%, urinary phosphate 22%, protein catabolic rate 7%, and Pu/PCR 15%. In the control subgroup, Pu/PCR increased by 20%. Urinary phosphate and urea nitrogen excretion correlated strongly, both baseline and after PB or dietary advice. The proposed parameter Pu/PCR may reflect the rate of intestinal phosphate absorption, and therefore, its variations after PB prescription may be a useful tool for estimating the pharmacological efficacy of these drugs. Copyright © 2016 Sociedad Española de Nefrología. Published by Elsevier España, S.L.U. All rights reserved.

  14. Effects of binders combined with glucono-δ-lactone on the quality characteristics of pressure-induced cold-set restructured pork.

    Science.gov (United States)

    Chun, Ji-Yeon; Choi, Mi-Jung; Min, Sang-Gi; Hong, Geun-Pyo

    2014-10-01

    This study investigated the effects of binders and glucono-δ-lactone (GdL) on characteristics of pressure-induced (450MPA for 3min) cold-set restructured pork. Isolated soy protein (SP), wheat flour (WF), and κ-carrageenan (CG) were adopted as binders. The addition of binders improved water-binding properties of restructured pork, and the binders diminished the decrease in water binding properties caused by GdL-induced acidification. Pressure-induced restructured pork prepared with binders showed less harder and more cohesive texture than those of the thermal-treated control (TC). The results indicate that pressure-induced cold-set meat restructuring could be achieved when binders and GdL were used in the formulation. Copyright © 2014. Published by Elsevier Ltd.

  15. Biodegradable materials as foundry moulding sands binders

    Directory of Open Access Journals (Sweden)

    K. Major - Gabryś

    2015-07-01

    Full Text Available The aim of this article is to show the possibility of using biodegradable materials as part of the composition of foundry moulding and core sand binders. Research shows that moulding sands with biodegradable materials selected as binders are not only less toxic but are also better suited to mechanical reclamation than moulding sands with phenol-furfuryl resin. The use of biodegradable materials as additives to typical synthetic resins can result in their decreased toxicity and improved ability to reclamation as well as in accelerated biodegradation of binding material leftovers of mechanical reclamation.

  16. THE STUDY ON MECHANISM OF BINDER MIGRATION DURING COATING PROCESS

    Institute of Scientific and Technical Information of China (English)

    YunLiang; KefuChen

    2004-01-01

    Binder migration during coating process and themechanism of binder migration were studied in thispaper. After the latex was tagged by osmium, thedegree of binder migration was measured byenergy-dispersive X-ray spectrometer. For the wetsample just after coating application, the realinformation of binder distribution was kept byquenching the sample in liquid nitrogen followed byfreeze-drying. The results showed: under thecondition of this research, binder migration occurredboth in the process of coating application and drying.But the amount of binder migration occurred duringcoating application was much little than that occurredduring drying. The mechanism of binder migrationduring the process of coating application was studiedby force analyses. And one viewpoint was proposedthat was binder migration was caused by Magnusforce and Saffman force.

  17. THE STUDY ON MECHANISM OF BINDER MIGRATION DURING COATING PROCESS

    Institute of Scientific and Technical Information of China (English)

    Yun Liang; Kefu Chen

    2004-01-01

    Binder migration during coating process and the mechanism of binder migration were studied in this paper. After the latex was tagged by osmium, the degree of binder migration was measured by energy-dispersive X-ray spectrometer. For the wet sample just after coating application, the real information of binder distribution was kept by quenching the sample in liquid nitrogen followed by freeze-drying. The results showed: under the condition of this research, binder migration occurred both in the process of coating application and drying.But the amount of binder migration occurred during coating application was much little than that occurred during drying. The mechanism of binder migration during the process of coating application was studied by force analyses. And one viewpoint was proposed that was binder migration was caused by Magnus force and Saffman force.

  18. Modification Bituminous Binders Petroleum Resin (Based on C9 Fraction

    Directory of Open Access Journals (Sweden)

    Elena A. Chigorina

    2015-12-01

    Full Text Available The goal of the present study is to measure the basic parameters of a bituminous binder obtained by modification of the BND 60/90 binder with petroleum resin, for both dynamic and static modification modes.

  19. Renewable Energy

    Science.gov (United States)

    Boyle, Godfrey

    2004-05-01

    Stimulated by recent technological developments and increasing concern over the sustainability and environmental impact of conventional fuel usage, the prospect of producing clean, sustainable power in substantial quantities from renewable energy sources arouses interest around the world. This book provides a comprehensive overview of the principal types of renewable energy--including solar, thermal, photovoltaics, bioenergy, hydro, tidal, wind, wave, and geothermal. In addition, it explains the underlying physical and technological principles of renewable energy and examines the environmental impact and prospects of different energy sources. With more than 350 detailed illustrations, more than 50 tables of data, and a wide range of case studies, Renewable Energy, 2/e is an ideal choice for undergraduate courses in energy, sustainable development, and environmental science. New to the Second Edition ·Full-color design ·Updated to reflect developments in technology, policy, attitides ·Complemented by Energy Systems and Sustainability edited by Godfrey Boyle, Bob Everett and Janet Ramage, all of the Open University, U.K.

  20. Glyoxalated polyacrylamide as a covalently attachable and rapidly cross-linkable binder for Si electrode in lithium ion batteries

    Science.gov (United States)

    Yoo, Jung-Keun; Jeon, Jaebeom; Kang, Kisuk; Jung, Yeon Sik

    2017-01-01

    Recently, investigation of Si-based anode materials for rechargeable battery applications garnered much interest due to its exceptionally high capacity. High-capacity Si anode ( 4,200 mAhg-1) is highly desirable for the replacement of conventional graphite anode (storage applications such as in electric vehicles (EVs) and energy storage systems (ESSs) for renewable energy sources. However, Si-based anodes suffer from poor cycling stability due to their large volumetric changes during repeated Li insertion. Therefore, development of highly efficient binder materials that can suppress the volume change of Si is one of the most essential parts of improving the performance of batteries. We herein demonstrate highly cross-linked polymeric binder (glyoxalated polyacrylamide) with an enhanced mechanical property by applying wet-strengthening chemistry used in paper industry. We found that the degree of cross-linking can be systematically adjusted by controlling the acidity of the slurry and has a profound effect on the cell performance using Si anode. The enhanced cycle performance of Si nanoparticles obtained by treating the binder at pH 4 can be explained by its strong interaction between the binder and Si surface and current collector, and also rigidity of binder by cross-linking. [Figure not available: see fulltext.

  1. BINDER DRAINAGE TEST FOR POROUS MIXTURES MADE BY VARYING THE MAXIMUM AGGREGATE SIZES

    Directory of Open Access Journals (Sweden)

    Hardiman Hardiman

    2004-01-01

    Full Text Available Binder drainage occurs with mixes of small aggregate surface area particularly porous asphalt. The binder drainage test, developed by the Transport Research Laboratory, UK, is commonly used to set an upper limit on the acceptable binder content for a porous mix. This paper presents the results of a laboratory investigation to determine the effects of different binder types on the binder drainage characteristics of porous mix made of various maximum aggregate sizes 20, 14 and 10 mm. Two types of binder were used, conventional 60/70 pen bitumen, and styrene butadiene styrene (SBS modified bitumen. The amount of binder lost through drainage after three hours at the maximum mixing temperature were measured in duplicate for mixes of different maximum sizes and binder contents. The maximum mixing temperature adopted depends on the types of binder used. The retained binder is plotted against the initial mixed binder content, together with the line of equality where the retained binder equals the mixed binder content. The results indicate the significant contribution of using SBS modified bitumen to increase the target bitumen binder content. Their significance is discussed in terms of target binder content, the critical binder content, the maximum mixed binder content and the maximum retained binder content values obtained from the binder drainage test. It was concluded that increasing maximum aggregate sizes decrease the maximum retained binder content, critical binder content, target binder content, maximum mixed binder content, and mixed content for both binders, but however for all mixtures, SBS is the highest.

  2. Influência de diferentes aglutinantes na digestibilidade aparente da matéria seca e da proteína, no pacu (Piaractus mesopotamicus arraçoado com rações elaboradas com ou sem vapor Influence of different binders in the apparent digestibility of dry matter and protein in pacu (Piaractus mesopotamicus fed with ration processed with or without steam

    Directory of Open Access Journals (Sweden)

    Maria Angélica Rosa Ribeiro

    1999-07-01

    Full Text Available O trabalho foi realizado no Centro Nacional de Pesquisa de Peixes Tropicais - Cepta, com o objetivo de determinar a influência de vários aglutinantes: carboximetilcelulose, polimetilcarbamida, amido de mandioca, alginato de sódio, polivinilpirrolidona e goma guar, bem como a técnica de processamento, com ou sem vapor, na digestibilidade aparente das frações matéria seca e proteína bruta. Os resultados obtidos demonstraram que a técnica de processamento a que se submete a mistura, durante a confecção de ração para peixes, influencia o coeficiente de digestibilidade aparente das frações matéria seca e proteína bruta, em pacus. Quando da confecção de rações para peixes, houver a necessidade de utilizar-se de aglutinantes, a fim de obter pelletes mais estáveis, recomenda-se, para os equipamentos dotados de câmara de acondicionamento com adição de vapor, a polivinilpirrolidona, e para os sem a adição de vapor, a goma guar.This work was carried out at National Research of Tropical Fishes - Cepta, with the objective to determine the influence of different dietary binders with their respective concentrations: sodium alginate, guar gum, polymethylolcarbamide, polyvinylpyrrolidone, carboxymethylcellulose, cassava starch, and the manufacturing process with or without steam, in the apparent digestibility of protein and dry matter. The results obtained showed that the manufacturing technique during the fish ration process, influences the apparent digestibility coefficient of dry matter and protein in pacu. When binders are required to obtain more stable diet pellets, polyvinylpyrrolidone for equipments with steam addition chambers and guar gum for equipment without steam are recommended.

  3. The effect of sodium hydroxide treatment on biomass binder preparation

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, X.; Xu, D.; Xu, Z.; Chen, Q. [China University of Mining and Technology, Beijing (China). Beijing Campus

    2001-02-01

    The possibility of rice straw which has been treated with sodium hydroxide for use as coal briquette binder was studied. The main factor which influenced the binder preparation was the concentration of sodium hydroxide. It was found that the binding ability of the solid component was higher than the liquid part. The prepared rice straw binder was mixed with inorganic material, bentonite, or high molecular synthetic organic materials to manufacture a compound coal briquette binder. This compound binder is waterproofing and can further enhance the strength of the briquette. 5 refs., 5 figs., 2 tabs.

  4. Phenomena during thermal removal of binders

    Science.gov (United States)

    Hrdina, Kenneth Edward

    The research presented herein has focused on debinding of an ethylene copolymer from a SiC based molded ceramic green body. Examination of the binder burnout process was carried out by breaking down the process into two distinct regions: those events which occur before any weight loss begins, and those events occurring during binder removal. Below the temperature of observed binder loss (175sp°C), both reversible and irreversible displacement was observed to occur. The displacement was accounted for by relaxation of molding stresses, thermal expansion of the system, and melting of the semicrystalline copolymer occurring during heating. Upon further heating the binder undergoes a two stage thermal degradation process. In the first stage, acetic acid is the only degradation product formed, as determined by GC/MS analysis. In this stage, component shrinkage persisted and it was found that one unit volume of shrinkage corresponded with one unit volume of binder removed, indicating that no porosity developed. The escaping acetic acid effluents must diffuse through liquid polymer filled porous regions to escape. The gas pressure of the acetic acid species produced in the first stage of the thermal degradation may exceed the ambient pressure promoting bubble formation. Controlling the heating rate of the specimen maintains the gas pressure below the bubbling threshold and minimizes the degradation time. Experiments have determined the kinetics of the reaction in the presence of the high surface area (10-15msp2/g) ceramic powder and then verified that acetic acid was diffusing through the polymer phase to the specimen surface where evaporation is taking place. The sorption method measured the diffusivity and activity of acetic acid within the filled ceramic system within a TGA. These data were incorporated into a Fickian type model which included the rate of generation of the diffusing species. The modeling process involved prediction of the bloating temperature as a

  5. Curing Reaction Model of Epoxy Asphalt Binder

    Institute of Scientific and Technical Information of China (English)

    QIAN Zhendong; CHEN Leilei; WANG Yaqi; SHEN Jialin

    2012-01-01

    In order to understand the strength developing law of the epoxy asphalt mixture,a curing reaction model of the epoxy asphalt binder was proposed based upon the thermokinetic analysis.Given some assumptions,the model was developed by applying the Kissinger law as well as Arrhenius equation,and the differential scanning calorimetry was performed for estimating the model parameters.To monitor the strength development of the epoxy asphalt mixture,a strength test program was employed and then results were compared to those produced from the proposed model.The comparative evaluation shows that a good consistency exists between the outputs from test program and the proposed model,indicating that the proposed model can be used effectively for simulating the curing reaction process for the epoxy asphalt binder and predicting the strength development for the epoxy asphalt mixture.

  6. Composite binders for concrete with reduced permeability

    Science.gov (United States)

    Fediuk, R.; Yushin, A.

    2016-02-01

    Composite binder consisting of cement (55%), acid fly ash (40%) and limestone (5%) has been designed. It is obtained by co-milling to a specific surface of 550 kg/m2, it has an activity of 77.3 MPa and can produce a more dense cement stone structure. Integrated study revealed that the concrete on the composite binder basis provides an effective diffusion coefficient D. So we can conclude that the concrete layer protects buildings from toxic effects of expanded polystyrene. Low water absorption of the material (2.5% by weight) is due to the structure of its cement stone pore space. Besides lime powder prevents the penetration of moisture, reduces water saturation of the coverage that has a positive effect on useful life period. It also explains rather low water vapor permeability of the material - 0.021 mg/(m- hour-Pa).

  7. Zirconium phosphate binder for periclase refractories

    Energy Technology Data Exchange (ETDEWEB)

    Volceanov, E. [ICEM S.A., Bucharest (Romania). Metallurgical Research Inst.; Georgescu, M.; Volceanov, A. [Universitatea Politehnica, Bucharest (Romania). Faculty of Industrial Chemistry; Mihalache, F. [REAL S.A., Ploiesti (Romania)

    2002-07-01

    Present paper brings information concerning the physical-mechanical properties of some high thermal resistant composites with phosphate bonding obtained from periclase clinker as solid component and various zirconium phosphates solutions as liquid component: ZI, ZII and ZIII. All these solutions were prepared from hydrous zirconia and orthophosphoric acid. The batches corresponding to a weight ratio solid / liquid = 3 / 1, have shown a good hardening behavior at normal temperature, especially for the ZII binder. Such compositions exhibit a very good thermal-mechanical behavior in the temperature range 1400 C - 1750 C. X-ray diffraction and electronomicroscopy (TEM) analysis provided information concerning the evolution of phase composition and microstructure during heating of the thermal resistant specimens chemically bound with a zirconium phosphate binder. (orig.)

  8. Viscoelastic models for explosive binder materials

    Energy Technology Data Exchange (ETDEWEB)

    Bardenhagen, S.G.; Harstad, E.N.; Maudlin, P.J.; Gray, G.T. [Los Alamos National Lab., NM (United States); Foster, J.C. Jr. [Wright Lab., Eglin AFB, FL (United States)

    1997-07-01

    An improved model of the mechanical properties of the explosive contained in conventional munitions is needed to accurately simulate performance and accident scenarios in weapons storage facilities. A specific class of explosives can he idealized as a mixture of two components: energetic crystals randomly suspended in a polymeric matrix (binder). Strength characteristics of each component material are important in the macroscopic behavior of the composite (explosive). Of interest here is the determination of an appropriate constitutive law for a polyurethane binder material. This paper is a continuation of previous work in modeling polyurethane at moderately high strain rates and for large deformations. Simulation of a large deformation (strains in excess of 100%) Taylor Anvil experiment revealed numerical difficulties which have been addressed. Additional experimental data have been obtained including improved resolution Taylor Anvil data, and stress relaxation data at various strain rates. A thorough evaluation of the candidate viscoelastic constitutive model is made and possible improvements discussed.

  9. Valorization of phosphogypsum as hydraulic binder.

    Science.gov (United States)

    Kuryatnyk, T; Angulski da Luz, C; Ambroise, J; Pera, J

    2008-12-30

    Phosphogypsum (calcium sulfate) is a naturally occurring part of the process of creating phosphoric acid (H(3)PO(4)), an essential component of many modern fertilizers. For every tonne of phosphoric acid made, from the reaction of phosphate rock with acid, commonly sulfuric acid, about 3t of phosphogypsum are created. There are three options for managing phosphogypsum: (i) disposal or dumping, (ii) stacking, (iii) use-in, for example, agriculture, construction, or landfill. This paper presents the valorization of two Tunisian phosphogypsums (referred as G and S) in calcium sulfoaluminate cement in the following proportions: 70% phosphogypsum-30% calcium sulfoaluminate clinker. The use of sample G leads to the production of a hydraulic binder which means that it is not destroyed when immersed in water. The binder including sample S performs very well when cured in air but is not resistant in water. Formation of massive ettringite in a rigid body leads to cracking and strength loss.

  10. Modular mobility investigation of polymer binder bitumen

    Science.gov (United States)

    Ayupov, D.; Makarov, D.; Murafa, A.; Khozin, V.; Khakimullin, Y.; Sundukov, V.; Khakimov, A.; Gizatullin, B.

    2015-01-01

    This paper is aimed to obtain polymer binder bitumen for the road applications with improved properties. Objectives included studying the degradation of crumb rubber during devulcanization in melted petroleum bitumen for its modification and resulted structural properties of bitumen. Using equilibrium swelling technique reduced density of the polymer chains was observed and analysis of sol-gel fractions showed a significant decrease in gel fraction. Under selected method of devulcanization 64% of the backbone rubber remained. With The H1 NMR relaxation method the reduction of bitumen molecular mobility was observed due to thickening of its light fractions. The effectiveness of devulcanization was optimized using a new agent in a powder form and vacuum application. The developed binder has an improved spectrum of physical and technical properties such as softening point temperature, hardness, elasticity, frost resistance, low temperature characteristics.

  11. High Performance Binder for EMCDB Propellants

    Directory of Open Access Journals (Sweden)

    V. K. Bhat

    1995-01-01

    Full Text Available A novel block polymer has been synthesised from caprolactone using hydroxy terminated polybutadiene as ring opening initiator. Usefulness of this polymer as propellant binder has been studied by generating data on physico-chemical properties of the polymer. The polymer exhibited high miscibility with nitrate ester and high solid loading capability. Preliminary data generated on typical propellant formulation indicated higher performance as compared to composite propellant.

  12. Identification of proteinaceous binders used in artworks by MALDI-TOF mass spectrometry.

    Science.gov (United States)

    Kuckova, Stepanka; Hynek, Radovan; Kodicek, Milan

    2007-05-01

    Proper identification of proteinaceous binders in artworks is essential for specification of the painting technique and thus also for selection of the restoration method; moreover, it might be helpful for the authentication of the artwork. This paper is concerned with the optimisation of analysis of the proteinaceous binders contained in the colour layers of artworks. Within this study, we worked out a method for the preparation and analysis of solid samples from artworks using tryptic cleavage and subsequent analysis of the acquired peptide mixture by matrix-assisted laser desorption/ionisation time of flight mass spectrometry. To make this approach rational and efficient, we created a database of commonly used binders (egg yolk, egg white, casein, milk, curd, whey, gelatine, and various types of animal glues); certain peaks in the mass spectra of these binders, formed by rich protein mixtures, were matched to amino acid sequences of the individual proteins that were found in the Internet database ExPASy; their cleavage was simulated by the program Mass-2.0-alpha4. The method developed was tested on model samples of ground layers prepared by an independent laboratory and then successfully applied to a real sample originating from a painting by Edvard Munch.

  13. CHIR99021 promotes self-renewal of mouse embryonic stem cells by modulation of protein-encoding gene and long intergenic non-coding RNA expression

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Yongyan [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Ai, Zhiying [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Yao, Kezhen [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Cao, Lixia; Du, Juan; Shi, Xiaoyan [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Guo, Zekun, E-mail: gzk@nwsuaf.edu.cn [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Zhang, Yong, E-mail: zhylab@hotmail.com [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China)

    2013-10-15

    Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR.

  14. Binder content influences on chloride ingress in concrete

    Energy Technology Data Exchange (ETDEWEB)

    Dhir, R.K.; Jones, M.R.; McCarthy, M.J. [Univ. of Dundee (United Kingdom)

    1996-12-01

    The reported study looked at the effect of reducing free water contents, and thereby binder contents, and thereby binder contents, on the ingress of chloride in concrete. Concretes with equal water/binder ratio (and design strength), but with water contents reduced by up to 30 liters/m{sup 3}, were tested for chloride diffusion (D) and penetration. The quality of the microstructure was inferred from initial surface absorption tests (ISAT). The results show no practical difference in chloride durability between the corresponding concretes, and that reducing the binder content, (providing that the water/binder ratio is maintained) is not likely to be detrimental. However, the results reported underline the importance of binder type, in this case PFA. Implications of the results are discussed and, in light of the findings, whether specifications which demand minimum cement contents are justified.

  15. Application of Microwaves for Binder Content Assessment in Moulding Sands

    Directory of Open Access Journals (Sweden)

    Nowak D.

    2012-09-01

    Full Text Available The paper presents results of preliminary examinations on possibility of determining binder content in traditional moulding sands with the microwave method. The presented measurements were carried-out using a special stand, the so-called slot line. Binder content in the sandmix was determined by measurements of absorption damping Ad and insertion losses IL of electromagnetic wave. One of main advantages of the suggested new method of binder content measurement is short measuring time.

  16. Effect of different binders on the physico-chemical, textural, histological, and sensory qualities of retort pouched buffalo meat nuggets.

    Science.gov (United States)

    Devadason, I Prince; Anjaneyulu, A S R; Babji, Y

    2010-01-01

    The functional properties of 4 binders, namely corn starch, wheat semolina, wheat flour, and tapioca starches, were evaluated to improve the quality of buffalo meat nuggets processed in retort pouches at F(0) 12.13. Incorporation of corn starch in buffalo meat nuggets produced more stable emulsion than other binders used. Product yield, drip loss, and pH did not vary significantly between the products with different binders. Shear force value was significantly higher for product with corn starch (0.42 +/- 0.0 Kg/cm(3)) followed by refined wheat flour (0.36 +/- 0.010 Kg/cm(3)), tapioca starch (0.32 +/- 0.010 Kg/cm(3)), and wheat semolina (0.32 +/- 0.010 Kg/cm(3)). Type of binder used had no significant effect on frying loss, moisture, and protein content of the product. However, fat content was higher in products with corn starch when compared to products with other binders. Texture profile indicated that products made with corn starch (22.17 +/- 2.55 N) and refined wheat flour (21.50 +/- 0.75 N) contributed firmer texture to the product. Corn starch contributed greater chewiness (83.8 +/- 12.51) to the products resulting in higher sensory scores for texture and overall acceptability. Products containing corn starch showed higher sensory scores for all attributes in comparison to products with other binders. Panelists preferred products containing different binders in the order of corn starch (7.23 +/- 0.09) > refined wheat flour (6.48 +/- 0.13) > tapioca starch (6.45 +/- 0.14) > wheat semolina (6.35 +/- 0.13) based on sensory scores. Histological studies indicated that products with corn starch showed dense protein matrix, uniform fat globules, and less number of vacuoles when compared to products made with other binders. The results indicated that corn flour is the better cereal binder for developing buffalo meat nuggets when compared to all other binders based on physico-chemical and sensory attributes.

  17. Thermal debinding dynamics of novel binder system

    Institute of Scientific and Technical Information of China (English)

    周继承; 黄伯云; 张传福; 刘业翔

    2001-01-01

    The thermal debinding dynamics of newly developed binders for cemented carbides extrusion molding was studied. It is shown that the thermal debinding processes can be divided into two stages: low temperature region, in which the low molecular mass components (LMMCs) are removed; and high temperature region, in which the polymer components are removed. The rate of thermal debinding is controlled by diffusion mechanism. The thermal debinding activation energies were solved out by differential method and integral method. The results show that the addition of other components acted as a catalyzer can effectively decrease the activation energy of thermal debinding processes.

  18. Sustainable binders for concrete: A structured approach from waste screening to binder composition development

    NARCIS (Netherlands)

    Vinai, R.; Panagiotopoulou, C.; Soutsos, M.; Taxiarchou, M.; Zervaki, M.; Valcke, S.L.A.; Ligero, V.C.; Couto, S.; Gupta, A.; Pipilikaki, P.; Alvarez, I.L.; Coelho, D.; Branquinho, J.

    2015-01-01

    Worldwide, the building sector requires the production of 4 billion tonnes of cement annually, consuming more than 40% of global energy. Alkali activated “cementless” binders have recently emerged as a novel eco-friendly construction material with a promising potential to replace ordinary Portland c

  19. RNA-binding proteins in human oogenesis: Balancing differentiation and self-renewal in the female fetal germline

    Directory of Open Access Journals (Sweden)

    Roseanne Rosario

    2017-05-01

    Full Text Available Primordial germ cells undergo three significant processes on their path to becoming primary oocytes: the initiation of meiosis, the formation and breakdown of germ cell nests, and the assembly of single oocytes into primordial follicles. However at the onset of meiosis, the germ cell becomes transcriptionally silenced. Consequently translational control of pre-stored mRNAs plays a central role in coordinating gene expression throughout the remainder of oogenesis; RNA binding proteins are key to this regulation. In this review we examine the role of exemplars of such proteins, namely LIN28, DAZL, BOLL and FMRP, and highlight how their roles during germ cell development are critical to oogenesis and the establishment of the primordial follicle pool.

  20. Glucose and glutamine fuel protein O-GlcNAcylation to control T cell self-renewal and malignancy

    OpenAIRE

    Swamy, Mahima; Pathak, Shalini; Grzes, Katarzyna M.; Damerow, Sebastian; Sinclair, Linda V.; van Aalten, Daan M.F.; Cantrell, Doreen A.

    2016-01-01

    Sustained glucose and glutamine transport are essential for activated T lymphocytes to support ATP and macromolecule biosynthesis. We now show that glutamine and glucose also fuel an indispensible dynamic regulation of intracellular protein O-GlcNAcylation at key stages of T cell development, transformation and differentiation. Glucose and glutamine are precursors of UDP-GlcNAc, a substrate for cellular glycosyltransferases. Immune activated T cells contained higher concentrations of UDP-GlcN...

  1. Evolution of geopolymer binders: a review

    Science.gov (United States)

    Nuruddin, M. F.; Malkawi, A. B.; Fauzi, A.; Mohammed, B. S.; Almattarneh, H. M.

    2016-06-01

    This study aimed to present the current state of research about the terminology, chemical reactions, mechanisms, and microstructure modelling of geopolymer binders. Modelling the structure of the geopolymerization products is essential for controlling the product properties. The currently available models have shown some limitations in determining the rate of geopolymerization and setting time of the gel. There is a need for deeper knowledge regarding the physicochemical analysis of geopolymer binders. Most of the available models have used pure material like metakaolin; however, the less pure materials are expected to have different mechanisms. The FTIR and MAS-NMR analysis are considered as effective tools in providing information on the molecular deviations during geopolymerization. However, XRD analysis is not effective because most of the changes take place in amorphous phases. Also, the role of the iron oxides and some of the other impurities still not clear where none of the previous method of investigation can be used to detect the molecular changes of the iron compounds. This issue is very relevant hence the iron oxides are existed in substantial amounts in most of the waste materials that are suitable to be used as geopolymer source materials.

  2. Mortar and concrete based on calcium sulphate binders

    NARCIS (Netherlands)

    Bakker, J.J.F.; Brouwers, H.J.H.

    2006-01-01

    In this study both hemi-hydrate and anhydrite are tested as calcium sulphate binders for structural mortar and concrete. The advantage of using calcium sulphates instead of cement as a binder is the fact that the production of calcium sulphate is more environmental friendly than that of cement. For

  3. 46 CFR 308.544 - Facultative binder, Form MA-315.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Facultative binder, Form MA-315. 308.544 Section 308.544 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION EMERGENCY OPERATIONS WAR RISK INSURANCE War Risk Cargo Insurance Iii-Facultative War Risk Cargo Insurance § 308.544 Facultative binder, Form...

  4. An Open Challenge Problem Repository for Systems Supporting Binders

    Directory of Open Access Journals (Sweden)

    Amy Felty

    2015-07-01

    Full Text Available A variety of logical frameworks support the use of higher-order abstract syntax in representing formal systems; however, each system has its own set of benchmarks. Even worse, general proof assistants that provide special libraries for dealing with binders offer a very limited evaluation of such libraries, and the examples given often do not exercise and stress-test key aspects that arise in the presence of binders. In this paper we design an open repository ORBI (Open challenge problem Repository for systems supporting reasoning with BInders. We believe the field of reasoning about languages with binders has matured, and a common set of benchmarks provides an important basis for evaluation and qualitative comparison of different systems and libraries that support binders, and it will help to advance the field.

  5. Viscoelastic Behaviour of Solid Propellants based on Various Polymeric Binders

    Directory of Open Access Journals (Sweden)

    N. Prabhakaran

    1995-01-01

    Full Text Available The dynamic mechanical properties of different binders and corresponding propellants are studied in terms of storage modulus and loss tangent. The binders investigated are HTPB, CTPB, PBAN, HEF-20 and ISRO polyol. The viscoelastic behaviour is investigated using Rheovibron viscoelastometer at 35 Hz covering a wide temperature range (-100 degree centigrade to 100 degree centigrade. The properties of the binder and corresponding propellant are compared in terms of parameters, tan delta/sub max/, T/sub g/ and the trend of their master relaxation modulus curves. It is found that polybutadiene binders exhibit lowest T/sub g/ (around -60 degree centigrade and ISRO polyol the highest (near -20 degree centigrade. The propellants have higher moduli than the binders at any temperature. The master relaxation modulus curve is influenced by the type of propellant.

  6. Environmentally Friendly Geopolymeric Binders Made with Perlite

    Science.gov (United States)

    Erdogan, S. T.

    2011-12-01

    Production of Portland cement (PC), the ubiquitous binding material for construction works, is responsible for 5-10 % of all anthropogenic CO2 emissions. Nearly half of these emissions arise from the decomposition of calcareous raw materials, and the other half from kiln fuel combustion and cement clinker grinding operations. As such, PC production contributes significantly to global warming and climate change. Lately, there have been efforts to develop alternative binders with lower associated green house gas emissions. An important class of such binders is geopolymers, formed by activating natural or waste materials with suitable alkaline or acidic solutions. These binders have very low CO2 emissions from grinding of the starting material, and some from the production of the activating chemical. The total CO2 emission from carefully formulated mixtures can be as low as 1/5th - 1/10th of those of Portland cement concrete mixtures with comparable properties. While use of industrial wastes is environmentally preferable, the variability of their chemical compositions over time makes their use difficult. Use of natural materials depletes resources but can have more consistent properties and can be more easily accepted. Perlite is a volcanic aluminosilicate glass abundant in Turkey, China, Japan, the US and several EU countries. It has been used in its expanded form, for horticulture, for insulation, and for producing lightweight concrete. Turkish perlites contain more than 70 % SiO2, and have a SiO2/Al2O3 ratio of ~5.5. This study shows that ground perlite can be mixed with alkaline activators like sodium hydroxide or sodium silicate to yield mortars with strengths comparable to those of portland cement mortars. Strength gain is slower than with PC mixtures at room temperature but adequate ultimate strength can be achieved with curing at slightly elevated temperatures in 24 h or less. Since perlite is natural, perlite geopolymers can have environmental, energetic, and

  7. Targeted Knockdown of RNA-Binding Protein TIAR for Promoting Self-Renewal and Attenuating Differentiation of Mouse Embryonic Stem Cells

    Directory of Open Access Journals (Sweden)

    Zhe Geng

    2015-01-01

    Full Text Available RNA-binding protein TIAR has been suggested to mediate the translational silencing of ARE-containing mRNAs. To analyze the functions of TIAR, we established RNAi and genetic rescue assays. We evaluated the expression of neuroectoderm markers Pax6 and nestin, mesoderm markers brachyury and Flk1, and hypoblast and definitive endoderm markers Sox17 and Gata6 during EB differentiation and found that knockdown TIAR expression restrained the differentiation of E14 cells. We assessed gene expression levels of Flk-1 and VE-cadherin and observed attenuated differentiation of E14 cells into endothelial cells upon downregulation of TIAR gene expression. As such, we hypothesized an essential role of TIAR related to EB differentiation. As TIAR inhibits the translation of c-myc, we proposed that downregulation of TIAR results in restrained differentiation of E14 cells, due in part to the function of c-myc. We found that TIAR inhibited c-myc expression at the translational level in E14 cells; accordingly, a reduction of TIAR expression promoted self-renewal of pluripotent cells and attenuated differentiation. Additionally, we established that TIAR inhibited TIA-1 expression at the translational level in E14 cells. Taken together, we have contributed to the understanding of the regulatory relationships between TIAR and both c-myc and TIA-1.

  8. Dilatometric examination of moulds with plaster binder

    Directory of Open Access Journals (Sweden)

    M. Nadolski

    2011-01-01

    Full Text Available Investigations concerning thermal expansion of moulding materials with plaster binder have been performed for two mixture compositionsof Authors’ own design, as well as for the material used in jewellery industry under the Prima-Cast trade name, and for ThermoMold 1200moulding material. The results of dilatometric examinations of these materials, carried out within the temperature range from about 20°Cto 650°C by means of the DA-3 automatic dilatometer, have been compared. An analysis of this comparison has revealed that it is thematrix composition which is decisive for the magnitude of dimensional changes of moulds, and that applying components which do notexhibit polymorphic transformations reduces dimensional changes of a mould during its thermal treatment.

  9. Utilisation of antibody microarrays for the selection of specific and informative antibodies from recombinant library binders of unknown quality

    DEFF Research Database (Denmark)

    Kibat, Janek; Schirrmann, Thomas; Knape, Matthias J

    2016-01-01

    Many diagnostic and therapeutic concepts require antibodies of high specificity. Recombinant binder libraries and related selection approaches allow the efficient isolation of antibodies against almost every target of interest. Nevertheless, it cannot be guaranteed that selected antibodies perform...... reducing the effort of antibody characterisation by concentrating on relevant molecules. In a pilot scheme, a library of 456 single-chain variable fragment (scFv) binders to 134 antigens was used. They were arranged in a microarray format and incubated with the protein content of clinical tissue samples...

  10. Carbon nanotube reinforced metal binder for diamond cutting tools

    DEFF Research Database (Denmark)

    Sidorenko, Daria; Mishnaevsky, Leon; Levashov, Evgeny

    2015-01-01

    of grain size of the structural constituents of the binder, what in turn leads to the improved simultaneously hardness, Young modulus, plastic extension, bending strength and performances of the metallic binders. Comparing service properties of diamond end-cutting drill bits with and without MWCNT one......The potential of carbon nanotube reinforcement of metallic binders for the improvement of quality and efficiency of diamond cutting wheels is studied. The effect of multi-walled carbon nanotube (MWCNT) reinforcement on the mechanical properties i.e. hardness, Young modulus, strength and deformation...

  11. Cationic fluorinated polymer binders for microbial fuel cell cathodes

    KAUST Repository

    Chen, Guang

    2012-01-01

    Fluorinated quaternary ammonium-containing polymers were used as catalyst binders in microbial fuel cell (MFC) cathodes. The performance of the cathodes was examined and compared to NAFION ® and other sulfonated aromatic cathode catalyst binders using linear sweep voltammetry (LSV), impedance spectroscopy, and performance tests in single chamber air-cathode MFCs. The cathodes with quaternary ammonium functionalized fluorinated poly(arylene ether) (Q-FPAE) binders showed similar current density and charge transfer resistance (R ct) to cathodes with NAFION ® binders. Cathodes containing either of these fluorinated binders exhibited better electrochemical responses than cathodes with sulfonated or quaternary ammonium-functionalized RADEL ® poly(sulfone) (S-Radel or Q-Radel) binders. After 19 cycles (19 d), the power densities of all the MFCs declined compared to the initial cycles due to biofouling at the cathode. MFC cathodes with fluorinated polymer binders (1445 mW m -2, Q-FPAE-1.4-H; 1397 mW m -2, Q-FPAE-1.4-Cl; 1277 mW m -2, NAFION ®; and 1256 mW m -2, Q-FPAE-1.0-Cl) had better performance than those with non-fluorinated polymer binders (880 mW m -2, S-Radel; 670 mW m -2, Q-Radel). There was a 15% increase in the power density using the Q-FPAE binder with a 40% higher ion exchange capacity (Q-FPAE-1.4-H compared to Q-FPAE-1.0-Cl) after 19 cycles of operation, but there was no effect on the power production due to counter ions in the binder (Cl -vs. HCO 3 -). The highest-performance cathodes (NAFION ® and Q-FPAE binders) had the lowest charge transfer resistances (R ct) in fresh and in fouled cathodes despite the presence of thick biofilms on the surface of the electrodes. These results show that fluorinated binders may decrease the penetration of the biofilm and associated biopolymers into the cathode structure, which helps to combat MFC performance loss over time. © 2012 The Royal Society of Chemistry.

  12. Strength properties of moulding sands with chosen biopolymer binders

    Directory of Open Access Journals (Sweden)

    St.M. Dobosz

    2010-07-01

    Full Text Available The article presents the results of primary researches of the IV generation moulding sands, in which as the binders are used differentbiodegradable materials. The bending and the tensile strength of the moulding sands with polylactide, poly(lactic-co-glycolic acid,polycaprolactone, polyhydroxybutyrate and cellulose acetate as binders were measured. The researches show that the best strengthproperties have the moulding sands with polylactide as binder. It was proved that the tested moulding sands’ strength properties are goodenough for foundry practice.

  13. Renewable energy annual 1996

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-03-01

    This report presents summary data on renewable energy consumption, the status of each of the primary renewable technologies, a profile of each of the associated industries, an analysis of topical issues related to renewable energy, and information on renewable energy projects worldwide. It is the second in a series of annual reports on renewable energy. The renewable energy resources included in the report are biomass (wood and ethanol); municipal solid waste, including waste-to-energy and landfill gas; geothermal; wind; and solar energy, including solar thermal and photovoltaic. The report also includes various appendices and a glossary.

  14. Sulindac sulfide reverses aberrant self-renewal of progenitor cells induced by the AML-associated fusion proteins PML/RARα and PLZF/RARα.

    Science.gov (United States)

    Steinert, Gunnar; Oancea, Claudia; Roos, Jessica; Hagemeyer, Heike; Maier, Thorsten; Ruthardt, Martin; Puccetti, Elena

    2011-01-01

    Chromosomal translocations can lead to the formation of chimeric genes encoding fusion proteins such as PML/RARα, PLZF/RARα, and AML-1/ETO, which are able to induce and maintain acute myeloid leukemia (AML). One key mechanism in leukemogenesis is increased self renewal of leukemic stem cells via aberrant activation of the Wnt signaling pathway. Either X-RAR, PML/RARα and PLZF/RARα or AML-1/ETO activate Wnt signaling by upregulating γ-catenin and β-catenin. In a prospective study, a lower risk of leukemia was observed with aspirin use, which is consistent with numerous studies reporting an inverse association of aspirin with other cancers. Furthermore, a reduction in leukemia risk was associated with use of non-steroidal anti-inflammatory drug (NSAID), where the effects on AML risk was FAB subtype-specific. To better investigate whether NSAID treatment is effective, we used Sulindac Sulfide in X-RARα-positive progenitor cell models. Sulindac Sulfide (SSi) is a derivative of Sulindac, a NSAID known to inactivate Wnt signaling. We found that SSi downregulated both β-catenin and γ-catenin in X-RARα-expressing cells and reversed the leukemic phenotype by reducing stem cell capacity and increasing differentiation potential in X-RARα-positive HSCs. The data presented herein show that SSi inhibits the leukemic cell growth as well as hematopoietic progenitors cells (HPCs) expressing PML/RARα, and it indicates that Sulindac is a valid molecular therapeutic approach that should be further validated using in vivo leukemia models and in clinical settings.

  15. Sulindac sulfide reverses aberrant self-renewal of progenitor cells induced by the AML-associated fusion proteins PML/RARα and PLZF/RARα.

    Directory of Open Access Journals (Sweden)

    Gunnar Steinert

    Full Text Available Chromosomal translocations can lead to the formation of chimeric genes encoding fusion proteins such as PML/RARα, PLZF/RARα, and AML-1/ETO, which are able to induce and maintain acute myeloid leukemia (AML. One key mechanism in leukemogenesis is increased self renewal of leukemic stem cells via aberrant activation of the Wnt signaling pathway. Either X-RAR, PML/RARα and PLZF/RARα or AML-1/ETO activate Wnt signaling by upregulating γ-catenin and β-catenin. In a prospective study, a lower risk of leukemia was observed with aspirin use, which is consistent with numerous studies reporting an inverse association of aspirin with other cancers. Furthermore, a reduction in leukemia risk was associated with use of non-steroidal anti-inflammatory drug (NSAID, where the effects on AML risk was FAB subtype-specific. To better investigate whether NSAID treatment is effective, we used Sulindac Sulfide in X-RARα-positive progenitor cell models. Sulindac Sulfide (SSi is a derivative of Sulindac, a NSAID known to inactivate Wnt signaling. We found that SSi downregulated both β-catenin and γ-catenin in X-RARα-expressing cells and reversed the leukemic phenotype by reducing stem cell capacity and increasing differentiation potential in X-RARα-positive HSCs. The data presented herein show that SSi inhibits the leukemic cell growth as well as hematopoietic progenitors cells (HPCs expressing PML/RARα, and it indicates that Sulindac is a valid molecular therapeutic approach that should be further validated using in vivo leukemia models and in clinical settings.

  16. Recombinant renewable polyclonal antibodies.

    Science.gov (United States)

    Ferrara, Fortunato; D'Angelo, Sara; Gaiotto, Tiziano; Naranjo, Leslie; Tian, Hongzhao; Gräslund, Susanne; Dobrovetsky, Elena; Hraber, Peter; Lund-Johansen, Fridtjof; Saragozza, Silvia; Sblattero, Daniele; Kiss, Csaba; Bradbury, Andrew R M

    2015-01-01

    Only a small fraction of the antibodies in a traditional polyclonal antibody mixture recognize the target of interest, frequently resulting in undesirable polyreactivity. Here, we show that high-quality recombinant polyclonals, in which hundreds of different antibodies are all directed toward a target of interest, can be easily generated in vitro by combining phage and yeast display. We show that, unlike traditional polyclonals, which are limited resources, recombinant polyclonal antibodies can be amplified over one hundred million-fold without losing representation or functionality. Our protocol was tested on 9 different targets to demonstrate how the strategy allows the selective amplification of antibodies directed toward desirable target specific epitopes, such as those found in one protein but not a closely related one, and the elimination of antibodies recognizing common epitopes, without significant loss of diversity. These recombinant renewable polyclonal antibodies are usable in different assays, and can be generated in high throughput. This approach could potentially be used to develop highly specific recombinant renewable antibodies against all human gene products.

  17. Effects of binder addition on the mechanical properties of bulk Y-Ba-Cu-O superconductors

    Science.gov (United States)

    Seki, H.; Wongsatanawarid, A.; Kobayashi, S.; Ikeda, Y.; Murakami, M.

    2010-11-01

    We studied the effects of binder addition on the mechanical properties of bulk Y-Ba-Cu-O superconductors. We prepared YBa2Cu3Oy, Y2BaCuO5 powders and polyvinyl alcohol mixed with water as a binder. These raw materials were mixed, and the binder-added powders were pressed into pellets. The hardness of the green compacts with binder is higher than that without the binder. However, the hardness of green compacts with 8% binder is the same as that with 4% binder. The maximum compression strength of the precursor with binder is higher than that without binder. Equally, the maximum strength of the green compacts with 8% binder is higher than that with 4% binder. The differential thermal analysis measurements showed that the exothermic reaction due to the decomposition of the organic binder started at 550 °C and gradually proceeded with further heating. After de-binder treatment, BaCO3 powders were produced on the green compacts. The green compacts were subjected to melt-processing. We also measured trapped magnetic fields of binder-added bulk Y-Ba-Cu-O superconductors with a Hall probe scanning device. Trapped magnetic field of the bulk added with 4% is higher than that of the binder-free bulk. Hence, Y-Ba-Cu-O bulk with suitable amount of binder shows good influence for mechanical strength and trapped magnetic field.

  18. Haemodynamic and respiratory effects of an abdominal compression binder

    DEFF Research Database (Denmark)

    Toft, M.H.; Bulow, J.; Simonsen, L.

    2008-01-01

    In order to elucidate the circulatory and respiratory effects of a newly developed abdominal compression binder 25 healthy, normal weight subjects were studied. In supine position the central haemodynamics were measured and estimated with a Finapress device. Lower extremity venous haemodynamics...... with or without the abdominal compression binder. The results show that the compression binder significantly increases the venous volume in the lower extremities as showed by a reduction in the venous capacitance in the lower extremities and a reduction in the stroke volume and cardiac output, while it does...... not influence the pulmonary volumes. It is concluded that the applied abdominal binder significantly affects peripheral and central haemodynamics. It should therefore be used with caution when in the supine position for longer periods, as the pooling of blood it induces in the lower extremities may have...

  19. Development of bio-sourced binder to metal injection moulding

    Science.gov (United States)

    Royer, Alexandre; Barrière, Thierry; Gelin, Jean-Claude

    2016-10-01

    In the MIM process the binder play the most important role. It provides fluidity of the feedstock mixture for injection molding and adhesion of the powder to keep the molded shape. The binder must provide strength and cohesion for the molded part, must be easy to be removed from the molded part, and must be the recyclable, environmentally friendly and economical ones. The goal of this study is to develop a binder environmentally friendly. For this, a study of formulation based on polyethylene glycol, because of is water debinding properties, was made. Polylactic acid and Polyhydroxyalkanoates were investigated as bio sourced polymers. The chemical, miscibility and rheological behavior of the binder formulation were investigated.

  20. Role of binder in the synthesis of titania membrane

    Indian Academy of Sciences (India)

    K S Seshadri; M Selvaraj; R Kesava Moorthy; K Varatharajan; M P Srinivasan; K B Lal

    2003-02-01

    The synthesis of titania membrane through sol–gel route involves hydrolysis of alkoxide, peptization of hydrous oxide of titanium to obtain a sol, adjustment of the sol viscosity by including a binder and filtration of the viscous sol through a microporous support, gelation and sintering to desired temperature. The binder plays an important role in that it not only helps in adjustment of sol viscosity but also helps in binding the sol particle with porous support. Here a comparative study on the role of different binders, viz. polyvinyl alcohol, polyethyleneimine, polyacrylamide, effect of their viscosity and surface tension effect on the morphology of the titania membrane is presented. The results show that among the three binders studied polyvinyl alcohol gave rise to membranes of desired characteristics when the sol viscosity was 0.08 pa.s.

  1. THE USE OF METAL PHOSPHATE BINDER AND SAND IN FOUNDRIES

    Directory of Open Access Journals (Sweden)

    I. E. Illarionov

    2013-01-01

    Full Text Available Some features of the use of mixtures of metal phosphate binder and management principles of their properties for production of castings of ferrous and non-ferrous metals and alloys were shown.

  2. Impact of Binder Composition on Inkjet Printing Paper

    Directory of Open Access Journals (Sweden)

    Yan Zhang

    2015-01-01

    Full Text Available This article is focused on the impact of different binder mixtures on the performances of paper surface and printability. The coating properties were studied with the chosen silica pigment, and the binder consisted of vinyl acetate copolymer and polyvinyl alcohol with different ratios, followed by the measurement of smoothness, whiteness, and surface strength. The inkjet image quality was assessed using water-based inks. The print density, dot gain, and line quality were analyzed. The results showed that the surface performance and printability were affected by the composition of the binder. With the decrease of vinyl acetate copolymer and the increase of polyvinyl alcohol, the surface smoothness and strength decreased, and the penetration and diffusion of the ink changed as well. When the binder mixture was used with proper ratio, a larger solid density, smaller dot gain, and higher definition can be achieved, which were better than using either one of them alone.

  3. Renewable Energy Certificates (RECs)

    Science.gov (United States)

    Renewable Energy Certificates (RECs), are tradable, non-tangible energy commodities in the United States that represent proof that 1 megawatt-hour (MWh) of electricity was generated from an eligible renewable energy resource.

  4. Development of composite solid propellent using dicyclopentadien binder

    Science.gov (United States)

    Bluestone, Stephen Ray

    Through the history of composite solid propellant binders new chemicals are introduced as binders to improve upon the previous generation. Sometimes this is done to improve upon the flaws or shortcomings of a previous binder. Other time it is to meet a new set of requirements desired by industry. Dicyclopentadiene (DCPD) is a hydrocarbon monomer being considered for its potential as a new binder in the composite propellant industry. The binder of a composite solid propellant is arguably the most important feature of the propellant. It is the binder that provides the majority of the structural characteristics of the propellant while also contributing itself as fuel to the combustion process. A binder in composite propellants must also be able to accept the introduction of a large quantity of solid filler; oxidizer, fuel, and other energetic and non-energetic particles. Many of the composite propellants used in industry today have over 80% of their weight composed of non-binder solid or liquid fillers. These requirements must be met by the binder in some form or fashion to produce a propellant able to compete with binders currently in use. When DCPD is polymerized it produces an extremely tough plastic with excellent tensile and impact strength. Experimentation has found that DCPD is able to support a large quantity of solid materials, over 80% weight of the mixture, while still retaining a great portion of its original strength. When compared to another similarly loaded binder currently used in industry, Hydroxyl-Terminated Polybutadiene (HTPB), it was found that DCPD composite propellant had nearly 1.5 times the stress capacity while still exhibiting over 75% of the strain capacity of HTPB based composite propellant. In addition it was also shown that DCPD composite propellant allows for tailoring of its mechanical properties with the addition of plasticizers. The DCPD based composite propellant also exhibits a burning rate nearly twice that HTPB. These factors

  5. Rheological Evaluation of Polymer Modiifed Asphalt Binders

    Institute of Scientific and Technical Information of China (English)

    WANG Lan; CHANG Chunqing

    2015-01-01

    The microstructure and dynamic rheological characteristics of asphalt containing different polymer modifiers (crumb rubber, styrene-butadiene-styrene and crumb rubber mix with styrene-butadiene-styrene) at mid and high service temperature levels were investigated by using scanning electron microscopy(SEM), dynamic shear rheometer(DSR) and repeat creep test. The main objective of the investigation was to rank the modifiers based on their effect on performance characteristics of asphalt under service conditions. To evaluate the effect of different modiifers on the viscoelastic response of asphalt, the temperature and frequency dependences of the dynamic viscoelastic properties were compared. The mid-temperature fatigue resistance and high-temperature rutting resistance of three polymer modiifed asphalts were evaluated to predict their ifeld performance in roads. Based on the current results, an improved rutting factor was proposed to determine the rutting resistance of asphalt pavements. In addition, the viscous stiffness (Gv), deifned as the reciprocal of viscous compliance, was used to evaluate the high-temperature deformation resistance of asphalt mixtures. The experimental results indicate that the asphalt containing crumb rubber only shows superior performance at mid and high service temperatures in all three modiifed asphalt binders due to the action of the crumb rubber.

  6. Realizing of Optimization of Binder Backfill Material Under Certain Strength with Fuzzy Sets

    Institute of Scientific and Technical Information of China (English)

    崔明义; 胡华

    2001-01-01

    The main factors deciding the compressive strength of binder backfill body are tailing density and binder dosage in binder backfill materials. Based on the antecedent of certain pulp density, the method of increasing the tailing density and reducing the binder dosage, or the manner of cutting down the tailing density and gaining the binder dosage are taken to guarantee the strength of backfill body. The problem that should be solved is how to determine the tailing density and the binder dosage rationally. This paper tries to realize the correct selection of the tailing density and the binder dosage in computer with the method of fuzzy mathematics.

  7. Novel Binders and Methods for Agglomeration of Ore

    Energy Technology Data Exchange (ETDEWEB)

    S. K. Kawatra; T. C. Eisele; K. A. Lewandowski; J. A. Gurtler

    2006-12-31

    Many metal extraction operations, such as leaching of copper, leaching of precious metals, and reduction of metal oxides to metal in high-temperature furnaces, require agglomeration of ore to ensure that reactive liquids or gases are evenly distributed throughout the ore being processed. Agglomeration of ore into coarse, porous masses achieves this even distribution of fluids by preventing fine particles from migrating and clogging the spaces and channels between the larger ore particles. Binders are critically necessary to produce agglomerates that will not break down during processing. However, for many important metal extraction processes there are no binders known that will work satisfactorily. Primary examples of this are copper heap leaching, where there are no binders that will work in the acidic environment encountered in this process, and advanced ironmaking processes, where binders must function satisfactorily over an extraordinarily large range of temperatures (from room temperature up to over 1200 C). As a result, operators of many facilities see a large loss of process efficiency due to their inability to take advantage of agglomeration. The large quantities of ore that must be handled in metal extraction processes also means that the binder must be inexpensive and useful at low dosages to be economical. The acid-resistant binders and agglomeration procedures developed in this project will also be adapted for use in improving the energy efficiency and performance of a broad range of mineral agglomeration applications, particularly heap leaching and advanced primary ironmaking. This project has identified several acid-resistant binders and agglomeration procedures that can be used for improving the energy efficiency of heap leaching, by preventing the ''ponding'' and ''channeling'' effects that currently cause reduced recovery and extended leaching cycle times. Methods have also been developed for iron ore

  8. Neutral hydrophilic cathode catalyst binders for microbial fuel cells

    KAUST Repository

    Saito, Tomonori

    2011-01-01

    Improving oxygen reduction in microbial fuel cell (MFC) cathodes requires a better understanding of the effects of the catalyst binder chemistry and properties on performance. A series of polystyrene-b-poly(ethylene oxide) (PS-b-PEO) polymers with systematically varying hydrophilicity were designed to determine the effect of the hydrophilic character of the binder on cathode performance. Increasing the hydrophilicity of the PS-b-PEO binders enhanced the electrochemical response of the cathode and MFC power density by ∼15%, compared to the hydrophobic PS-OH binder. Increased cathode performance was likely a result of greater water uptake by the hydrophilic binder, which would increase the accessible surface area for oxygen reduction. Based on these results and due to the high cost of PS-b-PEO, the performance of an inexpensive hydrophilic neutral polymer, poly(bisphenol A-co-epichlorohydrin) (BAEH), was examined in MFCs and compared to a hydrophilic sulfonated binder (Nafion). MFCs with BAEH-based cathodes with two different Pt loadings initially (after 2 cycles) had lower MFC performance (1360 and 630 mW m-2 for 0.5 and 0.05 mg Pt cm-2) than Nafion cathodes (1980 and 1080 mW m -2 for 0.5 and 0.05 mg Pt cm-2). However, after long-term operation (22 cycles, 40 days), power production of each cell was similar (∼1200 and 700-800 mW m-2 for 0.5 and 0.05 mg Pt cm-2) likely due to cathode biofouling that could not be completely reversed through physical cleaning. While binder chemistry could improve initial electrochemical cathode performance, binder materials had less impact on overall long-term MFC performance. This observation suggests that long-term operation of MFCs will require better methods to avoid cathode biofouling. © 2011 The Royal Society of Chemistry.

  9. Novel Binders and Methods for Agglomeration of Ore

    Energy Technology Data Exchange (ETDEWEB)

    S. K. Kawatra; T. C. Eisele; K. A. Lewandowski; J. A. Gurtler

    2006-12-31

    Many metal extraction operations, such as leaching of copper, leaching of precious metals, and reduction of metal oxides to metal in high-temperature furnaces, require agglomeration of ore to ensure that reactive liquids or gases are evenly distributed throughout the ore being processed. Agglomeration of ore into coarse, porous masses achieves this even distribution of fluids by preventing fine particles from migrating and clogging the spaces and channels between the larger ore particles. Binders are critically necessary to produce agglomerates that will not break down during processing. However, for many important metal extraction processes there are no binders known that will work satisfactorily. Primary examples of this are copper heap leaching, where there are no binders that will work in the acidic environment encountered in this process, and advanced ironmaking processes, where binders must function satisfactorily over an extraordinarily large range of temperatures (from room temperature up to over 1200 C). As a result, operators of many facilities see a large loss of process efficiency due to their inability to take advantage of agglomeration. The large quantities of ore that must be handled in metal extraction processes also means that the binder must be inexpensive and useful at low dosages to be economical. The acid-resistant binders and agglomeration procedures developed in this project will also be adapted for use in improving the energy efficiency and performance of a broad range of mineral agglomeration applications, particularly heap leaching and advanced primary ironmaking. This project has identified several acid-resistant binders and agglomeration procedures that can be used for improving the energy efficiency of heap leaching, by preventing the ''ponding'' and ''channeling'' effects that currently cause reduced recovery and extended leaching cycle times. Methods have also been developed for iron ore

  10. THE STUDY OF CORE SAND MIXTURES BASED ON POLYMERIC BINDERS

    Directory of Open Access Journals (Sweden)

    Ms. Natalia V. Zakharova

    2016-06-01

    Full Text Available The possibility of using foamed polystyrene waste as the binder in manufacturing core sand mixtures. The article provides experimental data obtained by studying the core sand mixtures properties depending on the methods of addition, foamed polystyrene solution amount, its viscosity and the method of drying. The author investigates the ways of using foamed polystyrene as the binder and as the polymeric additive.

  11. Quality of buffalo meat burger containing legume flours as binders.

    Science.gov (United States)

    Modi, V K; Mahendrakar, N S; Narasimha Rao, D; Sachindra, N M

    2004-01-01

    The effect of addition of different decorticated legume flours, viz., soya bean, bengal gram, green gram and black gram, on the quality of buffalo meat burger was studied. The burgers consisted of optimized quantities of roasted or unroasted legume flour, spices and common salt. Inclusion of roasted black gram flour registered the highest yield of 95.7%, lowest shrinkage of 5% and lowest fat absorption of 26.6% on frying. Protein content of 18-20% was highest in the soya flour formulation. Free fatty acid (FFA) values (as% oleic) increased from 14.3 to 17.3 in freshly prepared samples (before frying) to 16.0-19.4 in 4 m frozen (-16±2 °C) stored samples and fried samples had about 25% lower FFA values. Formulations with roasted flours registered lower thiobarbituric acid (TBA) values (mg malonaldehyde/kg sample) of 0.6-1.5 as against 0.6-2.1 for unroasted flours before frying. The burgers prepared with any of these binders were organoleptically acceptable even after storage at -16±2 °C for 4 months., However, the burger with black gram dhal (dehulled split legume) flour had better sensory quality attributes compared to other legumes.

  12. Aqueous Tape Casting Process with Styrene-acrylic Latex Binder

    Institute of Scientific and Technical Information of China (English)

    CUI Xue-min; OUYANG Shi-xi; HUANG Yong; YU Zhi-yong; ZHAO Shi-ke; WANG Chang-an

    2004-01-01

    A commercial styrene-acrylic latex binder has been investigated as a good binder for aqueous Al2O3 suspensions tape-casting process. This paper focuses on the forming film mechanism of latex binder, the rheological behaviors of the suspensions, physical properties of green tapes and drying process of aqueous slurries with latex binder system. The drying process of the alumina suspensions is shown to follow a two-stage mechanism (the first stage: evaporation controlled process; and the second stage: diffusion controlled process). During the drying stage of the suspensions, the compressive force presses the latex particles and makes them be distorted, which results in cross-linking structure in contacted latex particles of the solidified tapes.A smooth-surface and high-strength green tape was fabricated by aqueous tape casting with latex binder system. The results from the SEM images of the crossing section microstructure of green tapes show that the latex is a very suitable binder for aqueous tape casting.

  13. A Granule Model for Evaluating Adhesion of Pharmaceutical Binders

    Directory of Open Access Journals (Sweden)

    Hossein Orafai

    2003-10-01

    Full Text Available Granule capability is defined in terms of the strength of individual granule and friability of granulation batch to withstand breaking, abrasion and compactibility. Binder(s are added to perform the above properties .The common methods to asses their capability are to test crushing strength of the granules directly and to make statistical analysis and /or testing the friability of bulk granulation. In this work four substrate models including polymethylmetacrylate beads(PMMA,glass powder, acetaminophen, and para-aminobebzoic acid were chosen. The binder models were corn starch, gelatin, methylcellulose (MC and hydroxypropylmethylcellulose (HPMC. After massing the substrates with the binder solutions, discs were produced by the mean of the mold technique. The discs were dried and conditioned and then tested for tensile strength while the failed areas were scanned by SEM. Various granulations were made and the results of friability and crush strength were compared with the discs strength .The bond areas in the SEM showed the trend with the binder concentration .A comparison of the standard deviation shows that discs have much lower level of the strength than granules. The resulting discs showed a higher performance which is related to the stems for the discs shape .In conclusion, this method is a simple and is applicable to differentiate efficacy of binder under studies.

  14. PRELIMINARY TESTING OF NANOPARTICLE EFFECTIVENESS IN BINDER JETTING APPLICATIONS

    Energy Technology Data Exchange (ETDEWEB)

    Bailey, Alta C [ORNL; Elliott, Amy M [ORNL; Basti, Mufeed M [ORNL

    2016-01-01

    Binder jetting works by selectively depositing a binder with an inkjet print head into layers of powdered material. Compared with other metal Additive Manufacturing (AM) processes, binder jetting has significant potential for near-term adoption in manufacturing environments due to its reliability and throughput. The Achilles heel of binder jetting, however, is the inability to produce fully dense, single-alloy materials. The lack of density in printed binder jet parts is strictly dictated by the packing factor of the powder feedstock. Adding nanoparticles during printing will not only increase the part s packing factor but may also serve as a sintering aid. This study focuses on the effect of both the binder and nanoparticles on the final part density. As an unintended consequence of high nanoparticle loading, printed parts underwent a significant increase in porosity during the curing process. This unintended consequence is the apparent result of the nanoparticles blocking the exit of the solvent vapor during the curing step. Additionally, nanoparticle use for densification is validated with SEM imagery.

  15. NOVEL BINDERS AND METHODS FOR AGGLOMERATION OF ORE

    Energy Technology Data Exchange (ETDEWEB)

    S.K. Kawatra; T.C. Eisele; J.A. Gurtler; C.A. Hardison; K. Lewandowski

    2004-04-01

    Many metal extraction operations, such as leaching of copper, leaching of precious metals, and reduction of metal oxides to metal in high-temperature furnaces, require agglomeration of ore to ensure that reactive liquids or gases are evenly distributed throughout the ore being processed. Agglomeration of ore into coarse, porous masses achieves this even distribution of fluids by preventing fine particles from migrating and clogging the spaces and channels between the larger ore particles. Binders are critically necessary to produce agglomerates that will not break down during processing. However, for many important metal extraction processes there are no binders known that will work satisfactorily. Primary examples of this are copper heap leaching, where there are no binders that will work in the acidic environment encountered in this process, and advanced ironmaking processes, where binders must function satisfactorily over an extraordinarily large range of temperatures (from room temperature up to over 1200 C). As a result, operators of many facilities see a large loss of process efficiency due to their inability to take advantage of agglomeration. The large quantities of ore that must be handled in metal extraction processes also means that the binder must be inexpensive and useful at low dosages to be economical. The acid-resistant binders and agglomeration procedures developed in this project will also be adapted for use in improving the energy efficiency and performance of a broad range of mineral agglomeration applications, particularly heap leaching and advanced primary ironmaking.

  16. Binder/HMX interaction in PBX9501 at Elevated Temperatures

    Energy Technology Data Exchange (ETDEWEB)

    K., S C; M., T C

    2003-10-02

    Plastic bonded explosives (PBX) generally consist of 85 - 95 % by weight energetic material, such as HMX, and 5 - 15 % polymeric binder. Understanding of the structure and morphology at elevated temperatures and pressures is important for predicting of PBX behavior in accident scenarios. The crystallographic behavior of pure HMX has been measured as functions of temperature and grain size. The investigation is extended to the high temperature behavior of PBX 9501 (95% HMX, 2.5 % Estane, 2.5 % BDNPA/F). The results show that the HMX {beta}-phase to {delta}-phase transition in PBX 9501 is similar to that in neat HMX. However, in the presence of the PBX 9501 binder, {delta}-phase HMX readily converts back to {beta}-phase during cooling. Using the same temperature profile, the conversion rate decreases for each subsequent heating and cooling cycle. As observed in earlier experiments, no reverse conversion is observed without the polymer binder. It is proposed that the reversion of {delta}-phase to {beta}-phase is due to changes in the surface molecular potential caused by the influence of the polymer binder on the surface molecules of the {delta}-phase. Upon thermal cycling, the polymer binder segregates from the HMX particles and thus reduces the influence of the binder on the surface molecules. This segregation increases the resistance for the {delta}-phase to {beta}-phase transition, as demonstrated in an aged PBX 9501 material for which the reversion is not observed.

  17. Evaluation of wettability of binders used in moulding sands

    Directory of Open Access Journals (Sweden)

    Hutera B.

    2007-01-01

    Full Text Available Binders used in moulding sand have the differential properties. One of the main parameters influencing on moulding sand properties is wettability of the sand grain by binding material. In the article some problems concerned with wettability evaluation have been presented and the importance of this parameter for quantity description of process occurring in system: binder- sand grain has been mentioned. The procedure of wetting angle measurement and operation of prototype apparatus for wettability investigation of different binders used in moulding sand have been described, as well as the results of wetting angle measurement for different binders at different conditions. The addition of little amount of proper diluent to binder results in the state of equilibrium reached almost immediately. Such addition can also reduce the value of equilibrium contact angle. The uniform distribution of binder on the surface of the sand grains and reducing of the required mixing time can be obtained. It has also a positive effect on the moulding sand strength.

  18. Renewable energy annual 1995

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-12-01

    The Renewable Energy Annual 1995 is the first in an expected series of annual reports the Energy Information Administration (EIA) intends to publish to provide a comprehensive assessment of renewable energy. This report presents the following information on the history, status, and prospects of renewable energy data: estimates of renewable resources; characterizations of renewable energy technologies; descriptions of industry infrastructures for individual technologies; evaluations of current market status; and assessments of near-term prospects for market growth. An international section is included, as well as two feature articles that discuss issues of importance for renewable energy as a whole. The report also contains a number of technical appendices and a glossary. The renewable energy sources included are biomass (wood), municipal solid waste, biomass-derived liquid fuels, geothermal, wind, and solar and photovoltaic.

  19. VT Renewable Energy Sites - Renewable Energy Professionals

    Data.gov (United States)

    Vermont Center for Geographic Information — (Link to Metadata) The Renewable Energy Atlas of Vermont and this dataset were created to assist town energy committees, the Clean Energy Development Fund and other...

  20. Renewable Energy: Policy Considerations for Deploying Renewables

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2011-07-01

    This information paper accompanies the IEA publication Deploying Renewables 2011: Best and Future Policy Practice (IEA, 2011a). It provides more detailed data and analysis on policies for Deploying Renewables, and is intended to complement the main publication. It provides an account of the strategic drivers underpinning renewable energy (RE) technology deployment (energy security, economic development and environment protection) and assesses RE technologies with respect to these drivers, including an estimate of GHG emissions reductions due to RE technologies. The paper also explores the different barriers to deploying renewables at a given stage of market maturity and discusses what tools policy makers can avail of to succeed in removing deployment barriers. An additional topical highlight explores the challenges associated with accelerating the diffusion of RE technologies in developing countries.

  1. Inflammation-induced miRNA-155 inhibits self-renewal of neural stem cells via suppression of CCAAT/enhancer binding protein β (C/EBPβ) expression

    Science.gov (United States)

    Obora, Kayoko; Onodera, Yuta; Takehara, Toshiyuki; Frampton, John; Hasei, Joe; Ozaki, Toshifumi; Teramura, Takeshi; Fukuda, Kanji

    2017-01-01

    Intracerebral inflammation resulting from injury or disease is implicated in disruption of neural regeneration and may lead to irreversible neuronal dysfunction. Analysis of inflammation-related microRNA profiles in various tissues, including the brain, has identified miR-155 among the most prominent miRNAs linked to inflammation. Here, we hypothesize that miR-155 mediates inflammation-induced suppression of neural stem cell (NSC) self-renewal. Using primary mouse NSCs and human NSCs derived from induced pluripotent stem (iPS) cells, we demonstrate that three important genes involved in NSC self-renewal (Msi1, Hes1 and Bmi1) are suppressed by miR-155. We also demonstrate that suppression of self-renewal genes is mediated by the common transcription factor C/EBPβ, which is a direct target of miR-155. Our study describes an axis linking inflammation and miR-155 to expression of genes related to NSC self-renewal, suggesting that regulation of miR-155 may hold potential as a novel therapeutic strategy for treating neuroinflammatory diseases. PMID:28240738

  2. The addition effects of macro and nano clay on the performance of asphalt binder

    Directory of Open Access Journals (Sweden)

    M. El-Shafie

    2012-12-01

    Full Text Available The study was carried out to explore the addition effect of macro and organically modified nanoclay on the physical and mechanical properties of asphalt binders. Both macroclay and modified nanoclay were blended in an asphalt binder in various percentages (starting from 2% to 8%. The blended asphalt binders were characterized using kinematic viscosity (C.st, softening point (°C, and penetration and compared with anunmodified binder. The tensile strength of the asphalt binders was also tested as a function of clay types and content%. The results of the study indicated an increase in softening point; kinematics viscosity and decrease in binder penetration. The tensile strength of modified clay binders was enhanced at all percentages by a comparison with both macroclay and unmodified binders. The best improvements in the modified binders were obtained with 6% nanoclay.

  3. Interfacial reaction in squeeze cast SiCw/AZ91 composites with different binders

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The whisker/matrix interfaces in squeeze cast SiCw/AZ91 composites with different binders (silica binder, acid aluminum phosphate binder and without binder), were studied by transmission electron microscopy (TEM) and high resolution electron microscopy (HREM). The SiCw/AZ91 interface is very clean in the composites with no binders. For the composites with acid aluminum phosphate binders or silica binders, there exists fine discrete interfacial reaction products MgO at the interface, and a definite orientation relationship between MgO and SiCw. The interfacial reaction products MgO is unevenly distributed at different parts of the composite ingot with silica binder, and mainly distributed to the interface at the side part of the composite cylinder. While in the SiCw/AZ91 composite with acid aluminum phosphate binder, MgO particles are distributed evenly at the interface in almost all the parts of the composite ingot.

  4. RNA-binding protein L1TD1 interacts with LIN28 via RNA and is required for human embryonic stem cell self-renewal and cancer cell proliferation.

    Science.gov (United States)

    Närvä, Elisa; Rahkonen, Nelly; Emani, Maheswara Reddy; Lund, Riikka; Pursiheimo, Juha-Pekka; Nästi, Juuso; Autio, Reija; Rasool, Omid; Denessiouk, Konstantin; Lähdesmäki, Harri; Rao, Anjana; Lahesmaa, Riitta

    2012-03-01

    Human embryonic stem cells (hESC) have a unique capacity to self-renew and differentiate into all the cell types found in human body. Although the transcriptional regulators of pluripotency are well studied, the role of cytoplasmic regulators is still poorly characterized. Here, we report a new stem cell-specific RNA-binding protein L1TD1 (ECAT11, FLJ10884) required for hESC self-renewal and cancer cell proliferation. Depletion of L1TD1 results in immediate downregulation of OCT4 and NANOG. Furthermore, we demonstrate that OCT4, SOX2, and NANOG all bind to the promoter of L1TD1. Moreover, L1TD1 is highly expressed in seminomas, and depletion of L1TD1 in these cancer cells influences self-renewal and proliferation. We show that L1TD1 colocalizes and interacts with LIN28 via RNA and directly with RNA helicase A (RHA). LIN28 has been reported to regulate translation of OCT4 in complex with RHA. Thus, we hypothesize that L1TD1 is part of the L1TD1-RHA-LIN28 complex that could influence levels of OCT4. Our results strongly suggest that L1TD1 has an important role in the regulation of stemness.

  5. Performance analysis of flexible DSSC with binder addition

    Science.gov (United States)

    Muliani, Lia; Hidayat, Jojo; Anggraini, Putri Nur

    2016-04-01

    Flexible DSSC is one of modification of DSSC based on its substrate. Operating at low temperature, flexible DSSC requires a binder to improve particles interconnection. This research was done to compare the morphology and performance of flexible DSSC that was produced with binder-added and binder-free. TiO2 powder, butanol, and HCl were mixed for preparation of TiO2 paste. Small amount of titanium isopropoxide as binder was added into the mixture. TiO2 paste was deposited on ITO-PET plastic substrate with area of 1x1 cm2 by doctor blade method. Furthermore, SEM, XRD, and BET characterization were done to analyze morphology and surface area of the TiO2 photoelectrode microstructures. Dyed TiO2 photoelectrode and platinum counter electrode were assembled and injected by electrolyte. In the last process, flexible DSSCs were illuminated by sun simulator to do J-V measurement. As a result, flexible DSSC containing binder showed higher performance with photoconversion efficiency of 0.31%.

  6. Performance analysis of flexible DSSC with binder addition

    Energy Technology Data Exchange (ETDEWEB)

    Muliani, Lia; Hidayat, Jojo; Anggraini, Putri Nur, E-mail: putri.nur.anggraini@gmail.com [Research Center for Electronics and Telecommunications Indonesian Institute of Sciences (PPET-LIPI) Kampus LIPI, Jl. Sangkuriang, Bandung 40135 (Indonesia)

    2016-04-19

    Flexible DSSC is one of modification of DSSC based on its substrate. Operating at low temperature, flexible DSSC requires a binder to improve particles interconnection. This research was done to compare the morphology and performance of flexible DSSC that was produced with binder-added and binder-free. TiO{sub 2} powder, butanol, and HCl were mixed for preparation of TiO{sub 2} paste. Small amount of titanium isopropoxide as binder was added into the mixture. TiO{sub 2} paste was deposited on ITO-PET plastic substrate with area of 1x1 cm{sup 2} by doctor blade method. Furthermore, SEM, XRD, and BET characterization were done to analyze morphology and surface area of the TiO{sub 2} photoelectrode microstructures. Dyed TiO{sub 2} photoelectrode and platinum counter electrode were assembled and injected by electrolyte. In the last process, flexible DSSCs were illuminated by sun simulator to do J-V measurement. As a result, flexible DSSC containing binder showed higher performance with photoconversion efficiency of 0.31%.

  7. Renewable smart materials

    Science.gov (United States)

    Kim, Hyun Chan; Mun, Seongcheol; Ko, Hyun-U.; Zhai, Lindong; Kafy, Abdullahil; Kim, Jaehwan

    2016-07-01

    The use of renewable materials is essential in future technologies to harmonize with our living environment. Renewable materials can maintain our resources from the environment so as to overcome degradation of natural environmental services and diminished productivity. This paper reviews recent advancement of renewable materials for smart material applications, including wood, cellulose, chitin, lignin, and their sensors, actuators and energy storage applications. To further improve functionality of renewable materials, hybrid composites of inorganic functional materials are introduced by incorporating carbon nanotubes, titanium dioxide and tin oxide conducting polymers and ionic liquids. Since renewable materials have many advantages of biocompatible, sustainable, biodegradable, high mechanical strength and versatile modification behaviors, more research efforts need to be focused on the development of renewable smart materials.

  8. The renewable chemicals industry

    DEFF Research Database (Denmark)

    Christensen, Claus H.; Rass-Hansen, J.; Marsden, Charlotte Clare

    2008-01-01

    The possibilities for establishing a renewable chemicals industry featuring renewable resources as the dominant feedstock rather than fossil resources are discussed in this Concept. Such use of biomass can potentially be interesting from both an economical and ecological perspective. Simple...... per kilogram of desired product to illustrate in which processes the use of renewable resources lead to the most substantial reduction of CO2 emissions. The steps towards a renewable chemicals industry will most likely involve intimate integration of biocatalytic and conventional catalytic processes...... and educational tools are introduced to allow initial estimates of which chemical processes could be viable. Specifically, fossil and renewables value chains are used to indicate where renewable feedstocks can be optimally valorized. Additionally, C factors are introduced that specify the amount of CO2 produced...

  9. Policies for Renewable Heat

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-07-01

    This paper builds on IEA publications, Deploying Renewables, Principles for Effective Policies and Deploying Renewables, Best and Future Policy Practice, that discuss the 'integrated policy approach,' whereby renewable energy technologies require different support policies at different stages of their maturity pathways. The paper discusses how the integrated policy approach applies to renewable heat. It attempts to provide guidance for policy-makers on renewable heat throughout the different phases of the policy lifecycle, allowing for the specific challenges of renewable heat and needs of the many stakeholders involved. Stimulating a market for heat involves challenges that are different and, often, more difficult to overcome than in the electricity and transport sectors.

  10. Renewable energy resources

    CERN Document Server

    Twidell, John

    2015-01-01

    Renewable Energy Resources is a numerate and quantitative text covering the full range of renewable energy technologies and their implementation worldwide. Energy supplies from renewables (such as from biofuels, solar heat, photovoltaics, wind, hydro, wave, tidal, geothermal, and ocean-thermal) are essential components of every nation's energy strategy, not least because of concerns for the local and global environment, for energy security and for sustainability. Thus in the years between the first and this third edition, most renewable energy technologies have grown from fledgling impact to s

  11. Nanocrystalline WC with non-toxic Fe-Mn binder

    Energy Technology Data Exchange (ETDEWEB)

    Siemiaszko, Dariusz [Military University of Technology, Department of Advanced Technology and Chemistry, ul. Gen. S. Kaliskiego 2, 00-908 Warsaw (Poland); Rosinski, Marcin; Michalski, Andrzej [Warsaw University of Technology, Department of Materials Science and Engineering, Woloska 141, 02-507 Warsaw (Poland)

    2010-05-15

    Cemented carbides, based on the tungsten carbide (WC), are very popular and useful in an industry. The most important metal us as a binder in this kind of materials is cobalt. It has many advantages as a binder: very good wettability, favourable solubility with WC and thermal conductivity similar to WC. However, cost of cobalt is very high because of its low natural resources. Cobalt is not also neutral for health. It is known as an allergen and same research shown that it could cause a cancer. This paper presents results of sintering the tungsten carbides with Fe-Mn alloys as the binders. (copyright 2010 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  12. Permeability analysis for thermal binder removal from green ceramic bodies

    Science.gov (United States)

    Yun, Jeong Woo

    2007-12-01

    The permeability of unlaminated and laminated green tapes was determined as a function of binder content for binder removed by air oxidation. The tapes are comprised of barium titanate as the dielectric, and polyvinyl butyral and dioctyl phthalate as the main compoents of the binder mixture. The flow in porous media through the tapes was analyzed in terms of models for describing Knudsen, slip, and Poiseuille flow mechanisms. The characteristic pore size was determined to be 0.5-2 mum and thus Poiseuille flow was the dominant transport mechanism contributing to the flux. The permeability was then determined from Darcy's law for flow in porous media. The permeability was also determined from micro-structural attributes in terms of the specific surface, the pore fraction, and terms to account for tortuosity and constrictions. The permeability and adhesion strength of laminated green ceramic tapes were determined as a function of lamination conditions of time, temperature, and pressure.

  13. Modified polysaccharides as alternative binders for foundry industry

    Directory of Open Access Journals (Sweden)

    K. Kaczmarska

    2016-10-01

    Full Text Available Polysaccharides constitute a wide group of important polymers with many commercial applications, for example food packaging, fibres, coatings, adhesives etc. This review is devoted to the presentation of polysaccharide application in foundry industry. In this paper the selected properties of foundry moulding sand and core sand containing modified polysaccharides as binders are presented according to foreign literature data. Also, author’s own research about effect of using moulding sand binder consisting of modified polysaccharide (modified starch or its composition with non-toxic synthetic polymers are discussed. Based on technologies taken under consideration in this paper, it could be concluded that polysaccharides are suitable as an alternative for use as binder in foundry moulding applications.

  14. Enzyme-amplified protein micorarray and a fluidic renewable surface fluorescence immunoassay for botulinum neurotoxin detection using high-affinity recombinant antibodies

    Energy Technology Data Exchange (ETDEWEB)

    Varnum, Susan M.; Warner, Marvin G.; Dockendorff, Brian P.; Anheier, Norman C.; Lou, Jianlong; Marks, James D.; Smith, Leonard A.; Feldhaus, Michael J.; Grate, Jay W.; Bruckner-Lea, Cindy J.

    2006-06-16

    With the use of high-affinity recombinant monoclonal antibodies against the receptor binding domain of botulinum neurotoxin A (BoNT/A), two separate immunoassay platforms were developed for either the sensitive or the rapid detection of BoNT/A. An enzyme-linked immunosorbent assay (ELISA) microarray was developed for the specific and sensitive detection of BoNT in buffer and clinical fluids. This assay has the sensitivity to detect BoNT in diverse samples down to 14 fM (1.4 pg/mL). Using the recombinant monoclonal antibodies, a renewable surface microcolumn sensor was developed for the rapid detection of BoNT/A in an automated fluidic system. While the ELISA microarray assay, because of its sensitivity, offers an alternative to the mouse bioassay, the renewable surface assay has potential as a rapid screening assay for the analysis of complex environmental samples.

  15. Clinical pharmacokinetics of the phosphate binder lanthanum carbonate.

    Science.gov (United States)

    Damment, Stephen J P; Pennick, Michael

    2008-01-01

    Lanthanum carbonate is considered to be the most potent of a new generation of noncalcium phosphate binders used to treat hyperphosphataemia in chronic kidney disease (CKD), a condition associated with progressive bone and cardiovascular pathology and a markedly elevated risk of death. Its phosphate-binding action involves ionic binding and precipitation of insoluble complexes within the lumen of the intestine, thereby preventing absorption of dietary phosphate. While pharmacokinetics have little relevance to the efficacy of lanthanum carbonate, they are of fundamental importance when it comes to evaluating safety. When administered as lanthanum carbonate, the oral bioavailability of lanthanum is low (approximately 0.001%). The small absorbed fraction is excreted predominantly in bile, with less than 2% being eliminated by the kidneys. Predictably, therefore, plasma exposure and pharmacokinetics have been shown to be similar in healthy human volunteers and CKD stage 5 patients. With almost complete plasma protein binding, free lanthanum concentrations in patients at steady state are carbonate has a low propensity to cause systemic drug interactions due to its poor absorption. However, the higher concentrations present in the gastrointestinal tract can form chelates with some drugs, such as fluoroquinolones, and reduce their absorption. The improved understanding of the pharmacokinetics of lanthanum that has emerged in recent years has helped to explain why the myriad of calcium-like effects described in vitro for lanthanum have little if any relevance in vivo. The pharmacokinetic investigations of lanthanum carbonate formed an important part of the stringent premarketing safety assessment process and have been influential in reassuring both regulators and physicians that the agent can be used safely and effectively in this vulnerable dialysis population.

  16. Effect of DNA groove binder distamycin A upon chromatin structure.

    Directory of Open Access Journals (Sweden)

    Parijat Majumder

    Full Text Available BACKGROUND: Distamycin A is a prototype minor groove binder, which binds to B-form DNA, preferentially at A/T rich sites. Extensive work in the past few decades has characterized the binding at the level of double stranded DNA. However, effect of the same on physiological DNA, i.e. DNA complexed in chromatin, has not been well studied. Here we elucidate from a structural perspective, the interaction of distamycin with soluble chromatin, isolated from Sprague-Dawley rat. METHODOLOGY/PRINCIPAL FINDINGS: Chromatin is a hierarchical assemblage of DNA and protein. Therefore, in order to characterize the interaction of the same with distamycin, we have classified the system into various levels, according to the requirements of the method adopted, and the information to be obtained. Isothermal titration calorimetry has been employed to characterize the binding at the levels of chromatin, chromatosome and chromosomal DNA. Thermodynamic parameters obtained thereof, identify enthalpy as the driving force for the association, with comparable binding affinity and free energy for chromatin and chromosomal DNA. Reaction enthalpies at different temperatures were utilized to evaluate the change in specific heat capacity (ΔCp, which, in turn, indicated a possible binding associated structural change. Ligand induced structural alterations have been monitored by two complementary methods--dynamic light scattering, and transmission electron microscopy. They indicate compaction of chromatin. Using transmission electron microscopy, we have visualized the effect of distamycin upon chromatin architecture at di- and trinucleosome levels. Our results elucidate the simultaneous involvement of linker bending and internucleosomal angle contraction in compaction process induced by distamycin. CONCLUSIONS/SIGNIFICANCE: We summarize here, for the first time, the thermodynamic parameters for the interaction of distamycin with soluble chromatin, and elucidate its effect on

  17. Effect of crumb rubber on asphaltic binder chemistry and rheology

    Energy Technology Data Exchange (ETDEWEB)

    Lima, Cicero de S.; Tome, Luisa G.A.; Sant' ana, Hosiberto B.; Soares, Jorge B.; Soares, Sandra A. [University Federal of Ceara, Fortaleza, CE (Brazil)

    2008-07-01

    The use of the crumb rubber (CR) from scraps tires to modify asphalt binders (AB) at high temperature can improve significantly the performance grade, but the storage stability can be influenced after the mix of AB and CR or polymer. The major concern of asphalt binder with polymer and CR blends is their lack of stability during prolonged storage at high temperatures. The tendency to phase separation under quiescent conditions appears as an important limitation for the practical use of these blends. After the RTFOT and PAV process, the binder conventional and modified was analyzed in a Fourier Transform Infrared spectrometer (FTIR) for chemical characterization. After aging in RTFOT, the AB presented a larger degradation compared to the CR of RABC and RABC commercial. So, the crumb rubber contributed to the binder stability, acting as an antioxidant in the aging process. The dynamic mechanical properties of CR modify asphalts binder before and after graft has been characterized by use of dynamic shear rheometer (DSR) or advances rheology expanded system (ARES) of Rheometric Scientific. The difference in the viscoelastic parameters between the top and the bottom sections of the tube was measured. It has been found that the added content of CR has great effect on the rheological properties of the AB and its high temperature performance. It also has been confirmed that the RABC sample showed larger storage stability compared to the sample RABC commercial observed with viscoelastic parameters. As a consequence, the use CR and aromatic oil can be considered a suitable alternative for modification of binder in pavement. (author)

  18. Influence of conductive additive on temperature susceptibility of asphalt binders

    Institute of Scientific and Technical Information of China (English)

    吴少鹏; 李波; 陈筝; 黄旭

    2008-01-01

    The effects of graphite on temperature susceptibility of asphalt binders were investigated by penetration test,Ring & Ball softening point test and viscosity test.And penetration index(IP),viscosity-temperature susceptibility(SVT),and penetration-viscosity numbers(NPV) were introduced to evaluate the effects.The results show that the penetration,softening point and viscosity of asphalt binder increase with the increase of content of graphite.This means that the addition of graphite makes asphalts stiffer.The results from IP,NPV and SVT show that temperature susceptibility is reduced by the addition of graphite.

  19. Electronically conductive polymer binder for lithium-ion battery electrode

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Gao; Xun, Shidi; Battaglia, Vincent S.; Zheng, Honghe

    2017-05-16

    A family of carboxylic acid group containing fluorene/fluorenon copolymers is disclosed as binders of silicon particles in the fabrication of negative electrodes for use with lithium ion batteries. These binders enable the use of silicon as an electrode material as they significantly improve the cycle-ability of silicon by preventing electrode degradation over time. In particular, these polymers, which become conductive on first charge, bind to the silicon particles of the electrode, are flexible so as to better accommodate the expansion and contraction of the electrode during charge/discharge, and being conductive promote the flow battery current.

  20. Influencing of foundry bentonite mixtures by binder activation

    Directory of Open Access Journals (Sweden)

    J. Beňo

    2015-10-01

    Full Text Available Although new moulding processes for manufacture of high quality castings have been developed and introduced into foundry practice in recent years, the green-sand moulding in bentonite mixture still remains the most widely used technology. Higher utility properties of bentonite binders are achieved through their activation. This contribution is aimed at finding a suitable activating agent. A number of sodium salts and MgO based agents has been chosen. In the framework of the experiment the swelling volume of chosen agents was tested and technological parameters of a bentonite mixture with a binder activated with the studied agents were determined.

  1. Renewable Energy in Alaska

    Energy Technology Data Exchange (ETDEWEB)

    2013-03-01

    This report examines the opportunities, challenges, and costs associated with renewable energy implementation in Alaska and provides strategies that position Alaska's accumulating knowledge in renewable energy development for export to the rapidly growing energy/electric markets of the developing world.

  2. Marine Renewable Energies

    DEFF Research Database (Denmark)

    Azzellino, Arianna; Conley, Daniel; Vicinanza, Diego

    2013-01-01

    Countries with coastlines may have valuable renewable energy resources in the form of tides, currents, waves, and offshorewind.The potential to gather energy from the sea has recently gained interest in several nations, so Marine Renewable Energy Installations (hereinafter MREIs) will likely become...

  3. Region 9 Renewable Energy

    Science.gov (United States)

    Renewable energy production is expected to increase significantly in the next 25 years. The U.S. Environmental Protection Agency (EPA) Office of Solid Waste and Emergency Response (OSWER) Center for Program Analysis (OCPA) has initiated the RE-Powering America's Land Initiative to demonstrate the enormous potential that contaminated land and mining sites provide for developing renewable energy in the U.S.

  4. Renewable Energy Technology

    Science.gov (United States)

    Daugherty, Michael K.; Carter, Vinson R.

    2010-01-01

    In many ways the field of renewable energy technology is being introduced to a society that has little knowledge or background with anything beyond traditional exhaustible forms of energy and power. Dotson (2009) noted that the real challenge is to inform and educate the citizenry of the renewable energy potential through the development of…

  5. Renewable Energy Technology

    Science.gov (United States)

    Daugherty, Michael K.; Carter, Vinson R.

    2010-01-01

    In many ways the field of renewable energy technology is being introduced to a society that has little knowledge or background with anything beyond traditional exhaustible forms of energy and power. Dotson (2009) noted that the real challenge is to inform and educate the citizenry of the renewable energy potential through the development of…

  6. Effects of Fiber Finish on the Performance of Asphalt Binders and Mastics

    Directory of Open Access Journals (Sweden)

    Bradley J. Putman

    2011-01-01

    Full Text Available The objective of this study was to determine the effects of finishes applied to polyester fibers on the properties of asphalt binders and mastics. Asphalt binders were mixed with finishes that were extracted from the fibers, and mastics were also made with binder and fibers (with and without finish to isolate the effects of the finish. The results indicated that crude source plays a significant role in how the fiber finish affects the binders and mastics. Additionally different finishes had different effects on binder properties. The major finding of this study is that different polyester fibers, even from the same manufacturer, may not necessarily perform the same in an asphalt mixture. It is important to use fibers that are compatible with the particular asphalt binder that is being used because of the significance of the binder source on the interaction between the finish and the binder.

  7. Phosphate binders in chronic kidney disease: a systematic review of recent data.

    Science.gov (United States)

    Floege, Jürgen

    2016-06-01

    Hyperphosphatemia is common in chronic kidney disease (CKD) and is treated by dietary measures, dialysis techniques and/or phosphate binders. For the present review PubMed was searched for new publications on phosphate binders appearing between January 2010 and October 2015. This review summarizes the latest information on non-pharmacological measures and their problems in lowering phosphate in CKD patients, effects of phosphate binders on morbidity and mortality, adherence to phosphate binder therapy as well as new information on specific aspects of the various phosphate binders on the market: calcium acetate, calcium carbonate, magnesium-containing phosphate binders, polymeric phosphate binders (sevelamer, bixalomer, colestilan), lanthanum carbonate, ferric citrate, sucroferric oxyhydroxide, aluminum-containing phosphate binders, and new compounds in development. The review also briefly covers the emerging field of drugs targeting intestinal phosphate transporters.

  8. Comparison of efficacy of the phosphate binders nicotinic acid and sevelamer hydrochloride in hemodialysis patients

    National Research Council Canada - National Science Library

    Ahmadi, Farrokhlagha; Shamekhi, Fatemeh; Lessan-Pezeshki, Mahbob; Khatami, Mohammad Reza

    2012-01-01

    ...), and must be controlled with the use of phosphate binders. Studies comparing the effects of sevelamer and nicotinic acid, both similar non-calcium and non-aluminum phosphate binders, are not available...

  9. Renewable energy resources

    DEFF Research Database (Denmark)

    Ellabban, Omar S.; Abu-Rub, Haitham A.; Blaabjerg, Frede

    2014-01-01

    Electric energy security is essential, yet the high cost and limited sources of fossil fuels, in addition to the need to reduce greenhouse gasses emission, have made renewable resources attractive in world energy-based economies. The potential for renewable energy resources is enormous because...... they can, in principle, exponentially exceed the world's energy demand; therefore, these types of resources will have a significant share in the future global energy portfolio, much of which is now concentrating on advancing their pool of renewable energy resources. Accordingly, this paper presents how...... renewable energy resources are currently being used, scientific developments to improve their use, their future prospects, and their deployment. Additionally, the paper represents the impact of power electronics and smart grid technologies that can enable the proportionate share of renewable energy...

  10. Effects of binders on the performance of electric double-layer capacitors of carbon nanotube electrodes

    Institute of Scientific and Technical Information of China (English)

    LI Chensha; WANG Dazhi; ZHANG Baoyou; WANG Xiaofeng; CAO Maosheng; LIANG Ji

    2005-01-01

    Polarizable electrodes of electric double layer capacitor (EDLCs) were made from carhon nanotubes. Effects of different binders, which are phenolic resin (PF) and polytetrafluoroethylene (PTFE), on the properties of polarizable electrodes are studied. Results indicate that the microstructure, pore size distribution and specific capacitance of the electrodes with PTFE binder are superior to those electrodes with PF binder after carbonization. The suitable binder (PTFE) for carbon nanotubes electrodes is proposed.

  11. CHARMM-GUI Ligand Binder for absolute binding free energy calculations and its application.

    Science.gov (United States)

    Jo, Sunhwan; Jiang, Wei; Lee, Hui Sun; Roux, Benoît; Im, Wonpil

    2013-01-28

    Advanced free energy perturbation molecular dynamics (FEP/MD) simulation methods are available to accurately calculate absolute binding free energies of protein-ligand complexes. However, these methods rely on several sophisticated command scripts implementing various biasing energy restraints to enhance the convergence of the FEP/MD calculations, which must all be handled properly to yield correct results. Here, we present a user-friendly Web interface, CHARMM-GUI Ligand Binder ( http://www.charmm-gui.org/input/gbinding ), to provide standardized CHARMM input files for calculations of absolute binding free energies using the FEP/MD simulations. A number of features are implemented to conveniently set up the FEP/MD simulations in highly customizable manners, thereby permitting an accelerated throughput of this important class of computations while decreasing the possibility of human errors. The interface and a series of input files generated by the interface are tested with illustrative calculations of absolute binding free energies of three nonpolar aromatic ligands to the L99A mutant of T4 lysozyme and three FK506-related ligands to FKBP12. Statistical errors within individual calculations are found to be small (~1 kcal/mol), and the calculated binding free energies generally agree well with the experimental measurements and the previous computational studies (within ~2 kcal/mol). Therefore, CHARMM-GUI Ligand Binder provides a convenient and reliable way to set up the ligand binding free energy calculations and can be applicable to pharmaceutically important protein-ligand systems.

  12. Oil-acrylic hybrid latexes as binders for waterborne coatings

    NARCIS (Netherlands)

    Hamersveld, van E.M.S.; Es, van J.; German, A.L.; Cuperus, F.P.; Weissenborn, P.; Hellgren, A.C.

    1999-01-01

    The combination of the characteristics of oil, or alkyd, emulsions and acrylic latexes in a waterborne binder has been the object of various studies in the past. Strategies for combining the positive properties of alkyds, e.g. autoxidative curing, gloss and penetration in wood, with the fast drying

  13. Haemodynamic and respiratory effects of an abdominal compression binder

    DEFF Research Database (Denmark)

    Toft, Mette Helene; Bülow, Jens; Simonsen, Lene

    2008-01-01

    In order to elucidate the circulatory and respiratory effects of a newly developed abdominal compression binder 25 healthy, normal weight subjects were studied. In supine position the central haemodynamics were measured and estimated with a Finapress device. Lower extremity venous haemodynamics w...

  14. 46 CFR 308.103 - Insured amounts under interim binder.

    Science.gov (United States)

    2010-10-01

    ... INSURANCE War Risk Hull and Disbursements Insurance § 308.103 Insured amounts under interim binder. (a... chapter. (b) Insurance risks. Insurance risks covered by the terms of the standard form of war risk hull... insurance additional to the war risk hull insurance provided under this subpart, and payment of claim......

  15. Evaluation of Reclamability of Molding Sands with New Inorganic Binders

    Directory of Open Access Journals (Sweden)

    I. Izdebska-Szanda

    2012-04-01

    Full Text Available One of the purposes of the application of chemically modified inorganic binders is to improve knocking out properties and the related reclamability with previously used in foundry inorganic binder (water glass, which allowing the use of ecological binders for casting non- ferrous metals. Good knocking out properties of the sands is directly related to the waste sands reclamability, which is a necessary condition of effective waste management. Reclamation of moulding and core sands is a fundamental and effective way to manage waste on site at the foundry, in accordance with the Environmental Guidelines. Therefore, studies of reclamation of waste moulding and core sands with new types of inorganic binders (developed within the framework of the project were carried out. These studies allowed to determine the degree of recovery of useful, material, what the reclaimed sand is, and the degree of its use in the production process. The article presents these results of investigation. They are a part of broader research programme executed under the project POIG.01.01.02-00- 015/09 "Advanced materials and technologies".

  16. Multimodality and Immigrant Children (Response to Marni Binder)

    Science.gov (United States)

    Campano, Gerald; Low, David

    2011-01-01

    This response to Marni Binder reflects upon two examples of (im)migrant children's artwork and challenges the dominant notion that (im)migration experiences--and their subsequent portrayals--can be fit into neat slots. The authors position multimodal composing opportunities as affording children a vital instrument for deploying their full semiotic…

  17. 40 CFR 427.30 - Applicability; description of the asbestos paper (starch binder) subcategory.

    Science.gov (United States)

    2010-07-01

    ... asbestos paper (starch binder) subcategory. 427.30 Section 427.30 Protection of Environment ENVIRONMENTAL... Asbestos Paper (Starch Binder) Subcategory § 427.30 Applicability; description of the asbestos paper (starch binder) subcategory. The provisions of this subpart are applicable to discharges resulting...

  18. PHOSPHATE BINDER THERAPY AND SERUM PHOSPHATE CONTROL FOLLOWING INITIATION OF HAEMODIALYSIS

    Directory of Open Access Journals (Sweden)

    Kimberly Farrand

    2012-06-01

    Serum P can be difficult to control following initiation of HD. Patients with elevated serum P were younger, and most had higher P binder use than the reference group. Overall, binder use was lower than in other studies of HD patients. Dietary education and higher doses of the most effective P binders may be needed to improve P management.

  19. Novel Binders and Methods for Agglomeration of Ore

    Energy Technology Data Exchange (ETDEWEB)

    S. K. Kawatra; T. C. Eisele; K. A. Lewandowski; J. A. Gurtler

    2006-09-30

    Heap leaching is one of the methods being used to recover metal from low grade ore deposits. The main problem faced during heap leaching is the migration of fine grained particles through the heap, forming impermeable beds which result in poor solution flow. The poor solution flow leads to less contact between the leach solution and the ore, resulting in low recovery rates. Agglomeration of ore into coarse, porous masses prevents fine particles from migrating and clogging the spaces and channels between the larger ore particles. Currently, there is one facility in the United States which uses agglomeration. This operation agglomerates their ore using leach solution (raffinate), but is still experiencing undesirable metal recovery from the heaps due to agglomerate breakdown. The use of a binder, in addition to the leach solution, during agglomeration would help to produce stronger agglomerates that did not break down during processing. However, there are no known binders that will work satisfactorily in the acidic environment of a heap, at a reasonable cost. As a result, operators of many facilities see a large loss of process efficiency due to their inability to take advantage of agglomeration. Increasing copper recovery in heap leaching by the use of binders and agglomeration would result in a significant decrease in the amount of energy consumed. Assuming that 70% of all the leaching heaps would convert to using agglomeration technology, as much as 1.64*10{sup 12} BTU per year would be able to be saved if a 25% increase in copper recovery was experienced, which is equivalent to saving approximately 18% of the energy currently being used in leaching heaps. For every week a leach cycle was decreased, a savings of as much as 1.23*10{sup 11} BTU per week would result. This project has identified several acid-resistant binders and agglomeration procedures. These binders and experimental procedures will be able to be used for use in improving the energy efficiency of

  20. Investigation of the ageing effects on phenol-urea-formaldehyde binder and alkanol amine-acid anhydride binder coated mineral fibres

    DEFF Research Database (Denmark)

    Zafar, Ashar; Schjødt-Thomsen, Jan; Sodhi, R.;

    2013-01-01

    Phenol-Urea-Formaldehyde (PUF) binder coated mineral fibres' mechanical properties have been observed to degrade during ageing at elevated temperatures and humidity, while alkanol amine-acid anhydride binder based mineral fibres exhibited better ageing properties for same duration of ageing. X......-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) were employed to identify the chemical changes occurring in the PUF binder coated mineral fibres and alkanol amine-acid anhydride binder coated mineral fibres during that ageing. The samples were aged in a climate...... of amide, methylene ether and methylene linkages between urea groups present in the PUF binder. In the case of the alkanol amine-acid anhydride binder coated mineral fibres, both XPS and ToF-SIMS techniques consistently showed that the surface chemical composition of the organic components of the alkanol...

  1. Investigation of the ageing effects on phenol-urea-formaldehyde binder and alkanol amine-acid anhydride binder coated mineral fibres

    DEFF Research Database (Denmark)

    Zafar, Ashar; Schjødt-Thomsen, Jan; Sodhi, R.

    2013-01-01

    . Principal Component Analysis (PCA) was applied on the positive and negative ToF-SIMS spectra of the PUF binder coated mineral fibres, showing a decrease in the concentration of the nitrogen containing peaks during ageing. This decrease was attributed to the depolymerisation of the binder due to hydrolysis......Phenol-Urea-Formaldehyde (PUF) binder coated mineral fibres' mechanical properties have been observed to degrade during ageing at elevated temperatures and humidity, while alkanol amine-acid anhydride binder based mineral fibres exhibited better ageing properties for same duration of ageing. X......-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) were employed to identify the chemical changes occurring in the PUF binder coated mineral fibres and alkanol amine-acid anhydride binder coated mineral fibres during that ageing. The samples were aged in a climate...

  2. ALTERNATIVE BINDERS TO BENTONITE FOR IRON ORE PELLETIZING : PART II : EFFECTS ON METALLURGICAL AND CHEMICAL PROPERTIES

    Directory of Open Access Journals (Sweden)

    Osman Sivrikaya

    2014-07-01

    Full Text Available This study was started to find alternative binders to bentonite and to recover the low preheated and fired pellet mechanical strengths of organic binders-bonded pellets. Bentonite is considered as a chemical impurity for pellet chemistry due to acid constituents (SiO2 and Al2O3. Especially addition of silica-alumina bearing binders is detrimental for iron ore concentrate with high acidic content. Organic binders are the most studied binders since they are free in silica. Although they yield pellets with good wet strength; they have found limited application in industry since they fail to give sufficient physical and mechanical strength to preheated and fired pellets. It is investigated that how insufficient preheated and fired pellet strengths can be improved when organic binders are used as binder. The addition of a slag bonding/strength increasing constituent (free in acidic contents into pellet feed to provide pellet strength with the use of organic binders was proposed. Addition of boron compounds such as colemanite, tincal, borax pentahydrate, boric acid together with organic binders such as CMC, starch, dextrin and some organic based binders, into magnetite and hematite pellet mixture was tested. After determining the addition of boron compounds is beneficial to recover the low pellet physical and mechanical qualities in the first part of this study, in this second part, metallurgical and chemical properties (reducibility - swelling index – microstructure – mineralogy - chemical content of pellets produced with combined binders (an organic binder plus a boron compound were presented. The metallurgical and chemical tests results showed that good quality product pellets can be produced with combined binders when compared with the bentonite-bonded pellets. Hence, the suggested combined binders can be used as binder in place of bentonite in iron ore pelletizing without compromising the pellet chemistry.

  3. Biodegradable plastics from renewable sources.

    Science.gov (United States)

    Flieger, M; Kantorová, M; Prell, A; Rezanka, T; Votruba, J

    2003-01-01

    Plastic waste disposal is a huge ecotechnological problem and one of the approaches to solving this problem is the development of biodegradable plastics. This review summarizes data on their use, biodegradability, commercial reliability and production from renewable resources. Some commercially successful biodegradable plastics are based on chemical synthesis (i.e. polyglycolic acid, polylactic acid, polycaprolactone, and polyvinyl alcohol). Others are products of microbial fermentations (i.e. polyesters and neutral polysaccharides) or are prepared from chemically modified natural products (e.g., starch, cellulose, chitin or soy protein).

  4. Effects of Fibre Additive on the High Temperature Property of Asphalt Binder

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Polyester fibre and floc xylogen fibre were used to prepare fibre-asphalt binder.An SHRP's dynamic shear rheometer (DSR) was employed to investigate the rheology charac teristics of fibre-asphalt binder, andthe flow resistance of binder was revealed by combining the rutting parameter, G * / sinδ.The results indicate that both kinds of fibres remarkably improved the high temperature pe~orrnance of asphalt binder.At the same time, the reinforcement mechanism of the fibres in the asphalt binder was also analyzed.

  5. Alkali-activated binders/geopolymer and an application to environmental engineering

    Directory of Open Access Journals (Sweden)

    Nida Chaimoon

    2014-06-01

    Full Text Available For environmental reason, new binders that can be used as Portland cement replacement materials are being needed. Recently, alkali-activated binders (AAB and geopolymer have found increasing interest. As several research reports have showed that the two new binders are likely to have high potential to be developed and become an alternative to OPC. However, confusion in the classification of both binders is still there. This paper reviews knowledge about AAB and geopolymer including historical background, reaction mechanisms and reaction products. The similarities and differences of both binders are discussed. The application to environmental engineering on hazardous waste management using stabilization/solidification is also described.

  6. Renewable Substitutability Index: Maximizing Renewable Resource Use in Buildings

    Science.gov (United States)

    In order to achieve a material and energy balance in buildings that is sustainable in the long run, there is an urgent need to assess the renewable and non-renewable resources used in the manufacturing process and to progressively replace non-renewable resources with renewables. ...

  7. Renewable Substitutability Index: Maximizing Renewable Resource Use in Buildings

    Science.gov (United States)

    In order to achieve a material and energy balance in buildings that is sustainable in the long run, there is an urgent need to assess the renewable and non-renewable resources used in the manufacturing process and to progressively replace non-renewable resources with renewables. ...

  8. Region 9 Renewable Energy

    Data.gov (United States)

    U.S. Environmental Protection Agency — Renewable energy production is expected to increase significantly in the next 25 years. The U.S. Environmental Protection Agency (EPA) Office of Solid Waste and...

  9. INTEGRATED RENEWAL PROCESS

    Directory of Open Access Journals (Sweden)

    Suyono .

    2012-07-01

    Full Text Available The marginal distribution of integrated renewal process is derived in this paper. Our approach is based on the theory of point processes, especially Poisson point processes. The results are presented in the form of Laplace transforms.

  10. Renewable Energy Tracking Systems

    Science.gov (United States)

    Renewable energy generation ownership can be accounted through tracking systems. Tracking systems are highly automated, contain specific information about each MWh, and are accessible over the internet to market participants.

  11. Distinguishing binders from false positives by free energy calculations: fragment screening against the flap site of HIV protease.

    Science.gov (United States)

    Deng, Nanjie; Forli, Stefano; He, Peng; Perryman, Alex; Wickstrom, Lauren; Vijayan, R S K; Tiefenbrunn, Theresa; Stout, David; Gallicchio, Emilio; Olson, Arthur J; Levy, Ronald M

    2015-01-22

    Molecular docking is a powerful tool used in drug discovery and structural biology for predicting the structures of ligand-receptor complexes. However, the accuracy of docking calculations can be limited by factors such as the neglect of protein reorganization in the scoring function; as a result, ligand screening can produce a high rate of false positive hits. Although absolute binding free energy methods still have difficulty in accurately rank-ordering binders, we believe that they can be fruitfully employed to distinguish binders from nonbinders and reduce the false positive rate. Here we study a set of ligands that dock favorably to a newly discovered, potentially allosteric site on the flap of HIV-1 protease. Fragment binding to this site stabilizes a closed form of protease, which could be exploited for the design of allosteric inhibitors. Twenty-three top-ranked protein-ligand complexes from AutoDock were subject to the free energy screening using two methods, the recently developed binding energy analysis method (BEDAM) and the standard double decoupling method (DDM). Free energy calculations correctly identified most of the false positives (≥83%) and recovered all the confirmed binders. The results show a gap averaging ≥3.7 kcal/mol, separating the binders and the false positives. We present a formula that decomposes the binding free energy into contributions from the receptor conformational macrostates, which provides insights into the roles of different binding modes. Our binding free energy component analysis further suggests that improving the treatment for the desolvation penalty associated with the unfulfilled polar groups could reduce the rate of false positive hits in docking. The current study demonstrates that the combination of docking with free energy methods can be very useful for more accurate ligand screening against valuable drug targets.

  12. Promoting Renewable Energy Technologies

    DEFF Research Database (Denmark)

    Olsen, Ole Jess; Skytte, Klaus

    % of its annual electricity production. In this paper, we present and discuss the Danish experience as a case of promoting renewable energy technologies. The development path of the two technologies has been very different. Wind power is considered an outright success with fast deployment to decreasing...... technology and its particular context, it is possible to formulate some general principles that can help to create an effective and efficient policy for promoting new renewable energy technologies....

  13. Promoting Renewable Energy Technologies

    DEFF Research Database (Denmark)

    Olsen, Ole Jess; Skytte, Klaus

    % of its annual electricity production. In this paper, we present and discuss the Danish experience as a case of promoting renewable energy technologies. The development path of the two technologies has been very different. Wind power is considered an outright success with fast deployment to decreasing...... technology and its particular context, it is possible to formulate some general principles that can help to create an effective and efficient policy for promoting new renewable energy technologies....

  14. Effect of modified humic acid binder on pelletisation of specularite concentrates

    Institute of Scientific and Technical Information of China (English)

    周友连; 张元波; 刘兵兵; 李光辉; 姜涛

    2015-01-01

    A modified humic acid (MHA) binder was tested as a substitute for bentonite to prepare qualified specularite pellets. The results show that there is stronger chemisorption between organic functional groups in MHA binder molecular and specularite particles, improving the green pellet strength. MHA binder has obvious effect on the strength and microstructure of preheated pellets due to the thermal decomposition of organic matters in MHA binder. Appropriately increasing preheating temperature or time can eliminate the adverse impact of organic matters on the preheated pellet strength. Compared with the bentonite pellets, the roasted pellets with MHA binder have a more compact microstructure, and the recrystallization of the Fe2O3 crystal grains is better. Consequently, under optimal conditions, 0.75%(mass fraction) MHA binder pellets have equal or better pellet strengths and contain 1.06%more total iron than 2%bentonite pellets. The testing results indicate that MHA binder is a promising and effective alternative to bentonite for the specularite pellets.

  15. Investigation of Ageing Effects on Organic Binders used for Mineral Wool Products

    DEFF Research Database (Denmark)

    Zafar, Ashar

    for the same duration of ageing. The main purpose of the present work is to examine the chemical changes occurring in the phenol-urea-formaldehyde binder based mineral fibres due to ageing, which cause deterioration of the mechanical properties of mineral wool products. This has been done using surface...... properties is the PUF binder, therefore further research work was performed to the pure PUF binder coatings to directly observe the ageing effects on the surface chemistry of the binder. High mass resolution ToFSIMS spectra of the pure PUF binder coatings confirmed that the depolymerisation of the cured......Phenol-Urea-Formaldehyde (PUF) binder based mineral wool products’ mechanical properties have been observed to degrade during ageing at elevated temperatures and humidity, while mineral wool products based on a newly developed alkanol amine-acid anhydride binder exhibited better ageing properties...

  16. Hygroscopicity -resistant mechanism of an α -starch based composite binder for dry sand molds and cores

    Directory of Open Access Journals (Sweden)

    Xia ZHOU

    2005-05-01

    Full Text Available Hygroscopicity-resistance of an α-starch based composite binder for dry sand molds (cores has been studied experimentally and theoretically. Focus is placed on the relationship between the hardening structure and humidity-resistance of the composite binder. The results show that the α-starch composite binder has good humidity-resistance due to its special complex structure. SEM observations illustrate that the composite binder consists of reticular matrix and a ball- or lump-shaped reinforcement phase, and the specific property of the binding membrane with heterogeneous structure is affected by humidity to a small extent. Based on the analyses on the interplays of different ingredients in the binder at hardening, the structure model and hygroscopicity-resistant mechanisms of the hardening composite binder were further proposed. Moreover, the reasons for good humidity-resistance of the composite binder bonded sand are well explained by the humidity-resistant mechanisms.

  17. Effects of egg albumen as binder, on yield and sensory characteristics of frankfurter sausages

    Directory of Open Access Journals (Sweden)

    M. Teye

    2012-09-01

    Full Text Available This study was conducted to find alternative binders to substitute for polyphosphate in frankfurter-type sausages. Fresh albumen (FA at 32.5 (FA1, 49 (FA2 and 65 (FA3 g/kg meat (equivalent to 5, 7.5 and 10g dry matter/kg meat, and dried albumen (DA at 5 (DA1, 7.5 (DA2 and 10 (DA3 g/kg meat were used to formulate the products, and compared with those formulated with polyphosphate (5g/kg meat as binder. The Completely Randomized Design was used, and products were formulated in triplicates. They were vacuum-packed in transparent packaging bags and stored at 2°C for sensory and laboratory analyses. From the results, egg albumen had no significant (P>0.05 effects on the cooking losses of the FA1, FA2, DA1 and DA2 products, but the losses in these products were significantly (P0.05 different. The egg albumen however, increased the crude protein and reduced fat contents of the DA and FA products. It was cheaper acquiring egg albumen for the FA1 products than acquiring polyphosphates, but it’s more expensive acquiring dried albumen for the DA products, although the products had acceptable yield and sensory characteristics.

  18. High performance binder-free SiOx/C composite LIB electrode made of SiOx and lignin

    Science.gov (United States)

    Chen, Tao; Hu, Jiazhi; Zhang, Long; Pan, Jie; Liu, Yiyang; Cheng, Yang-Tse

    2017-09-01

    A high performance binder-free SiOx/C composite electrode was synthesized by mixing SiOx particles and Kraft lignin in a cryo-mill followed by heat treatment at 600 °C. After the heat treatment, lignin formed a conductive matrix hosting SiOx particles, ensuring electronic conductivity, connectivity, and accommodation of volume changes during lithiation/delithiation. As the result, no conventional binder or conductive agent was necessary. When electrochemically cycled, the composite electrode delivered excellent performance, maintaining ∼900 mAh g-1 after 250 cycles at a rate of 200 mA g-1, and good rate capability. The robustness of the electrode was also examined by post-cycling SEM images, where few cracks were observed. The excellent electrochemical performance can be attributed to the comparatively small volume change of SiOx-based electrodes (160%) and the flexibility of the lignin derived carbon matrix to accommodate the volume change. This work should stimulate further interests in using bio-renewable resources in making advanced electrochemical energy storage systems.

  19. 2014 Renewable Energy Data Book

    Energy Technology Data Exchange (ETDEWEB)

    Beiter, Philipp

    2015-11-01

    The Renewable Energy Data Book for 2014 provides facts and figures on energy and electricity use, renewable electricity in the United States, global renewable energy development, wind power, solar power, geothermal power, biopower, hydropower, marine and hydrokinetic power, hydrogen, renewable fuels, and clean energy investment.

  20. 2015 Renewable Energy Data Book

    Energy Technology Data Exchange (ETDEWEB)

    Beiter, Philipp; Tian, Tian

    2016-11-01

    The 2015 Renewable Energy Data Book provides facts and figures on energy and electricity use, renewable electricity in the United States, global renewable energy development, wind power, solar power, geothermal power, biopower, hydropower, marine and hydrokinetic power, hydrogen, renewable fuels, and clean energy investment.

  1. 2015 Renewable Energy Data Book

    Energy Technology Data Exchange (ETDEWEB)

    Beiter, Philipp [National Renewable Energy Lab. (NREL), Golden, CO (United States); Tian, Tian [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    2016-11-01

    The Renewable Energy Data Book for 2015 provides facts and figures on energy and electricity use, renewable electricity in the United States, global renewable energy development, wind power, solar power, geothermal power, biopower, hydropower, marine and hydrokinetic power, hydrogen, renewable fuels, and clean energy investment.

  2. 2008 Renewable Energy Data Book

    Energy Technology Data Exchange (ETDEWEB)

    2009-07-01

    This Renewable Energy Data Book for 2008 provides facts and figures on energy in general, renewable electricity in the United States, global renewable energy development, wind power, solar energy, geothermal power, biopower, hydropower, advanced water power, hydrogen, renewable fuels, and clean energy investments.

  3. 2010 Renewable Energy Data Book

    Energy Technology Data Exchange (ETDEWEB)

    Gelman, Rachel [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    2011-10-01

    This Renewable Energy Data Book for 2010 provides facts and figures on energy in general, renewable electricity in the United States, global renewable energy development, wind power, solar energy, geothermal power, biopower, hydropower, advanced waterpower, hydrogen, renewable fuels, and clean energy investments.

  4. 2009 Renewable Energy Data Book

    Energy Technology Data Exchange (ETDEWEB)

    Gelman, R.

    2010-08-01

    This Renewable Energy Data Book for 2009 provides facts and figures on energy in general, renewable electricity in the United States, global renewable energy development, wind power, solar energy, geothermal power, biopower, hydropower, advanced waterpower, hydrogen, renewable fuels, and clean energy investments.

  5. 2011 Renewable Energy Data Book

    Energy Technology Data Exchange (ETDEWEB)

    R. Gelman

    2013-02-01

    This Renewable Energy Data Book for 2011 provides facts and figures on energy in general, renewable electricity in the United States, global renewable energy development, wind power, solar energy, geothermal power, biopower, hydropower, advanced water power, hydrogen, renewable fuels, and clean energy investments.

  6. 2014 Renewable Energy Data Book

    Energy Technology Data Exchange (ETDEWEB)

    Beiter, Philipp [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    2015-11-15

    The Renewable Energy Data Book for 2014 provides facts and figures on energy and electricity use, renewable electricity in the United States, global renewable energy development, wind power, solar power, geothermal power, biopower, hydropower, marine and hydrokinetic power, hydrogen, renewable fuels, and clean energy investment.

  7. A review on cellulose and lignin based binders and electrodes: Small steps towards a sustainable lithium ion battery.

    Science.gov (United States)

    Nirmale, Trupti C; Kale, Bharat B; Varma, Anjani J

    2017-10-01

    Lithium ion batteries (LIB) are the most promising energy storage systems for portable electronics and future electric or hybrid-electric vehicles. However making them safer, cost effective and environment friendly is the key challenge. In this regard, replacing petro-derived materials by introducing renewable biomass derived cellulose derivatives and lignin based materials into the battery system is a promising approach for the development of green materials for LIB. These biomaterials introduce sustainability as well as improved safety in the final disposal of LIB batteries. In this review we introduce LIB materials technology in brief and recent developments in electrodes and binders based on cellulose and their derivatives and lignin for lithium ion batteries. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. A binder phase of TiO based cermets

    Institute of Scientific and Technical Information of China (English)

    LI Qing-kui; GUAN Shao-kang; ZHONH Hui; LI Jiang; ZHONG Hai-yun

    2005-01-01

    A binder phase of TiO based cermets, a kind of imitated gold materials, was developed by adding active element Si to Fe-Cr alloy, and the related mechanisms were studied. The wettability, matching in thermodynamics and interfacial strength were investigated by the high temperature sessile drop method and element area scanning. The linear expansion coefficients of the materials were measured using TAH100 thermal analyzer. The results show that the wettability of Fe-Cr alloy on TiO are small, with a wetting angle about 90°. After adding some Si in Fe-Cr alloy, its wetting angle can be decreased to about 25°, the interfacial reactions can be prevented effectively and high interface binding can be formed. Fe-25%Cr-1.5%Si matches the thermal expansion coefficient of TiO, so it is a kind of relatively perfect binder for TiO based cermets imitated gold.

  9. Preparation of Flame Retardant Modified with Titanate for Asphalt Binder

    Directory of Open Access Journals (Sweden)

    Bo Li

    2014-01-01

    Full Text Available Improving the compatibility between flame retardant and asphalt is a difficult task due to the complex nature of the materials. This study explores a low dosage compound flame retardant and seeks to improve the compatibility between flame retardants and asphalt. An orthogonal experiment was designed taking magnesium hydroxide, ammonium polyphosphate, and melamine as factors. The oil absorption and activation index were tested to determine the effect of titanate on the flame retardant additive. The pavement performance test was conducted to evaluate the effect of the flame retardant additive. Oxygen index test was conducted to confirm the effect of flame retardant on flame ability of asphalt binder. The results of this study showed that the new composite flame retardant is more effective in improving the compatibility between flame retardant and asphalt and reducing the limiting oxygen index of asphalt binder tested in this study.

  10. Studies on organic binders with high infrared transparency*

    Institute of Scientific and Technical Information of China (English)

    Fu Cheng-Wu; Zhou Hao-Shen; Chen Ming-Qing

    2009-01-01

    This paper reports that two kinds of polymers with high infrared transparency and good mechanical and physical properties have been prepared. An internal standard method is used to evaluate the infrared transparency of the binders.The physical and mechanical properties of the binders are measured according to corresponding standards. The results show the absorbance of polymer A in 8-14 μm range is 26% that of the ethylene-vinyl acetate copolymer (EVA), and polymer B is 9% that of the EVA correspondingly. The film of polymer A shows good flexibility of above 1 mm, a hardness of grade 1, and adhesion of grade 2. The film of polymer B shows good flexibility of above 1 mm, a hardness of grade 1, and adhesion of grade 1.

  11. Characterization of low-purity clays for geopolymer binder formulation

    Science.gov (United States)

    Mostafa, Nasser Y.; Mohsen, Q.; El-maghraby, A.

    2014-06-01

    The production of geopolymer binders from low-purity clays was investigated. Three low-purity clays were calcined at 750°C for 4 h. The calcined clays were chemically activated by the alkaline solutions of NaOH and Na2SiO3. The compressive strength was measured as a function of curing time at room temperature and 85°C. The results were compared with those of a pure kaolin sample. An amorphous aluminosilicate polymer was formed in all binders at both processing temperatures. The results show that, the mechanical properties depend on the type and amount of active aluminum silicates in the starting clay material, the impurities, and the processing temperature.

  12. Characterization of low-purity clays for geopolymer binder formulation

    Institute of Scientific and Technical Information of China (English)

    Nasser Y.Mostafa; Q.Mohsen; A.El-maghraby

    2014-01-01

    The production of geopolymer binders from low-purity clays was investigated. Three low-purity clays were calcined at 750°C for 4 h. The calcined clays were chemically activated by the alkaline solutions of NaOH and Na2SiO3. The compressive strength was measured as a function of curing time at room temperature and 85°C. The results were compared with those of a pure kaolin sample. An amorphous aluminosilicate polymer was formed in all binders at both processing temperatures. The results show that, the mechanical properties depend on the type and amount of active aluminum silicates in the starting clay material, the impurities, and the processing temperature.

  13. Electronically conductive polymer binder for lithium-ion battery electrode

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Gao; Battaglia, Vincent S.; Park, Sang -Jae

    2015-10-06

    A family of carboxylic acid groups containing fluorene/fluorenon copolymers is disclosed as binders of silicon particles in the fabrication of negative electrodes for use with lithium ion batteries. Triethyleneoxide side chains provide improved adhesion to materials such as, graphite, silicon, silicon alloy, tin, tin alloy. These binders enable the use of silicon as an electrode material as they significantly improve the cycle-ability of silicon by preventing electrode degradation over time. In particular, these polymers, which become conductive on first charge, bind to the silicon particles of the electrode, are flexible so as to better accommodate the expansion and contraction of the electrode during charge/discharge, and being conductive promote the flow battery current.

  14. Electronically conductive polymer binder for lithium-ion battery electrode

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Gao; Xun, Shidi; Battaglia, Vincent S.; Zheng, Honghe; Wu, Mingyan

    2015-07-07

    A family of carboxylic acid groups containing fluorene/fluorenon copolymers is disclosed as binders of silicon particles in the fabrication of negative electrodes for use with lithium ion batteries. Triethyleneoxide side chains provide improved adhesion to materials such as, graphite, silicon, silicon alloy, tin, tin alloy. These binders enable the use of silicon as an electrode material as they significantly improve the cycle-ability of silicon by preventing electrode degradation over time. In particular, these polymers, which become conductive on first charge, bind to the silicon particles of the electrode, are flexible so as to better accommodate the expansion and contraction of the electrode during charge/discharge, and being conductive promote the flow battery current.

  15. Compressive strength and rheology of environmentally-friendly binders

    Directory of Open Access Journals (Sweden)

    Juan Manuel Lizarazo Marriaga

    2010-07-01

    Full Text Available Ordinary Portland cement production accounts for 9% of worldwide greenhouse gas emissions. This paper summarises the results of research aimed at developing environmentally-friendly binders which can be used as an alternative in civil construction, aimed at generating alternatives and sustainable materials. Mixes of the combination of granulated ground blast furnace slag, basic oxygen slag, cement kiln dust and plasterboard gypsum were used for optimising the binders, according to their compressive strength, to obtain 5 concrete mixtures made partially or completely with industrial waste. The results showed that the compressive strength of mixtures of Portland cement and industrial waste were suitable for different civil construction applications and, although mixtures formed entirely from industrial waste had a significant decrease in their compressive strength, the results sho- wed great potential for specific industrial applications. In addition to compressive strength, the rheological properties of these mixtures were determined for defining flow and workability characteristics.

  16. Effectiveness and cost-efficiency of phosphate binders in hemodialysis

    Directory of Open Access Journals (Sweden)

    Zsifkovits, Johannes

    2009-06-01

    Full Text Available Health political background: In 2006, the prevalence of chronic renal insufficiency in Germany was 91,718, of which 66,508 patients were on dialysis. The tendency is clearly growing. Scientific background: Chronic renal insufficiency results in a disturbance of the mineral balance. It leads to hyperphosphataemia, which is the strongest independent risk factor for mortality in renal patients. Usually, a reduction in the phosphate intake through nutrition and the amount of phosphate filtered out during dialysis are not sufficient to reduce the serum phosphate values to the recommended value. Therefore, phosphate binders are used to bind ingested phosphate in the digestive tract in order to lower the phosphate concentration in the serum. Four different groups of phosphate binders are available: calcium- and aluminium salts are the traditional therapies. Sevelamer and Lanthanum are recent developments on the market. In varying doses, all phosphate binders are able to effectively lower phosphate concentrations. However, drug therapies have achieved recommended phosphate levels in only 50 percent of patients during the last years. Research questions: How effective and efficient are the different phosphate binders in chronic renal insufficient patients? Methods: The systematic literature search yielded 1,251 abstracts. Following a two-part selection process with predefined criteria 18 publications were included in the assessment. Results: All studies evaluated conclude that serum phosphate, serum calcium and intact parathyroid hormone can be controlled effectively with all phosphate binders. Only the number of episodes of hypercalcaemia is higher when using calcium-containing phosphatebinders compared to Sevelamer and Lanthanum. Regarding the mortality rate, the cardiovascular artery calcification and bone metabolism no definite conclusions can be drawn. In any case, the amount of calcification at study start seems to be crucial for the further

  17. Electronically conductive polymer binder for lithium-ion battery electrode

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Gao; Xun, Shidi; Battaglia, Vincent S.; Zheng, Honghe; Wu, Mingyan

    2017-08-01

    A family of carboxylic acid groups containing fluorene/fluorenon copolymers is disclosed as binders of silicon particles in the fabrication of negative electrodes for use with lithium ion batteries. Triethyleneoxide side chains provide improved adhesion to materials such as, graphite, silicon, silicon alloy, tin, tin alloy. These binders enable the use of silicon as an electrode material as they significantly improve the cycle-ability of silicon by preventing electrode degradation over time. In particular, these polymers, which become conductive on first charge, bind to the silicon particles of the electrode, are flexible so as to better accommodate the expansion and contraction of the electrode during charge/discharge, and being conductive promote the flow battery current.

  18. Optimization of propellant binders - part I: statistical methodology

    Energy Technology Data Exchange (ETDEWEB)

    Niehaus, Michael; Greeb, Olaf [Fraunhofer Institut fuer Chemische Technologie, D-76327 Pfinztal (Germany)

    2004-06-01

    The development of new propellant binder systems requires the thermodynamic calculation of physico-chemical data as well as the adaption of the mechanical properties in order to achieve a reliable innerballistic profile of the resulting propellant. However, in most cases the mechanical data may not be easily predicted due to the complex interactions between the components of the binder like the resin, the curing agent or possibly plasticizers and curing catalysts. Therefore, this study focusses on the capability of the multivariate analysis on the prediction of the E-modulus of a system comprising nitrocellulose as well as GAP, Desmodur N100 and an energetic plasticiser. Using this method, an equation has been derived which, within the regression intervall, may be used for the prediction of the E-modulus as a function of the components mentioned above. (Abstract Copyright [2004], Wiley Periodicals, Inc.)

  19. Mechanical Activation of Construction Binder Materials by Various Mills

    Science.gov (United States)

    Fediuk, R. S.

    2016-04-01

    The paper deals with the mechanical grinding down to the nano powder of construction materials. During mechanical activation a composite binder active molecules cement minerals occur in the destruction of the molecular defects in the areas of packaging and breaking metastable phase decompensation intermolecular forces. The process is accompanied by a change in the kinetics of hardening of portland cement. Mechanical processes during grinding mineral materials cause, along with the increase in their surface energy, increase the Gibbs energy of powders and, respectively, their chemical activity, which also contributes to the high adhesion strength when contacting them with binders. Thus, the set of measures for mechanical activation makes better use of the weight of components filled with cement systems and adjust their properties. At relatively low cost is possible to provide a spectacular and, importantly, easily repeatable results in a production environment.

  20. Effect of base bitumen composition on asphalt rubber binder properties

    OpenAIRE

    Partl, M.N.; Ould-Henia, M.; Dumont, A.-G.

    2008-01-01

    The asphalt rubber blend properties are strongly related to its base components properties. The base bitumen composition is considered as a key factor influencing the final rheological properties of asphalt rubber binder. This paper describes results from a laboratory investigation of the interaction between crumb rubber and different composition bitumen according to the wet process. The bitumen composition is determined according to the SARA decomposition approac...

  1. Comparative Assessment of Stabilised Polybutadiene Binder under Accelerated Ageing

    Directory of Open Access Journals (Sweden)

    Luiz Felipe Cannaval Sbegue

    2016-04-01

    Full Text Available Polybutadiene elastomers are versatile materials, being employed at several applications from rocket propellant binder to adhesives and sealants. The elastomers derived from hydroxyl-terminated polybutadiene are usually stabilised with antioxidants to prevent degradation. In this study, a comparative assessment among 2,2’-methylene-bis (4-methyl-6-tert-butylphenol (AO2246, 2,6-di-tert-butyl-4-methylphenol (BHT, p-phenylenediamine (pPDA, and triphenylphosphine (TPP regarding stabilisation of hydroxyl-terminated polybutadiene binder under accelerated ageing (six months at 65 °C was carried out. Evaluation of antioxidants effectiveness was examined through Oxidation Induction time, sol/gel extraction, swelling and mechanical testing, dynamic mechanical analysis, and mass variation measurement. AO2246 yielded the best performance, meanwhile BHT was poorly protective. TPP acted as prooxidant, causing a severe degradation of the binder, and pPDA was not manageable to be assessed due to the lower curing degree of the resulted polyurethane.

  2. Preparation of carbon brushes with thermosetting resin binder

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Carbon brushes with a resin binder were prepared according to an industrial process and the effects of the molding pressure, grains size and cure temperature on the properties of brush samples were discussed. The results show that the bulk density,bending strength and Rockwell hardness increase, while resistivity decreases with increasing molding pressure. Cure temperature has much more influence on the properties of brushes than molding pressure and grains size. Isothermal differential scanning calorimetry(DSC) was used to estimate the degree of cure of resin binder and a novel method of using the true density to measure the degree of cure of resin binder was presented and discussed briefly. Based on optimal process parameters carbon brushes were manufactured, durability tests for brushes were carried out on an alternate current motor and scanning electron microscope(SEM)was adopted to observe the morphology of worn surface of brushes. The results show that a luster oxide film can be formed on the surface of brushes and their service life reaches 380 h.

  3. New insight into the molecular mechanisms of the biological effects of DNA minor groove binders.

    Directory of Open Access Journals (Sweden)

    Xinbo Zhang

    Full Text Available BACKGROUND: Bisbenzimides, or Hoechst 33258 (H258, and its derivative Hoechst 33342 (H342 are archetypal molecules for designing minor groove binders, and widely used as tools for staining DNA and analyzing side population cells. They are supravital DNA minor groove binders with AT selectivity. H342 and H258 share similar biological effects based on the similarity of their chemical structures, but also have their unique biological effects. For example, H342, but not H258, is a potent apoptotic inducer and both H342 and H258 can induce transgene overexpression in in vitro studies. However, the molecular mechanisms by which Hoechst dyes induce apoptosis and enhance transgene overexpression are unclear. METHODOLOGY/PRINCIPAL FINDINGS: To determine the molecular mechanisms underlying different biological effects between H342 and H258, microarray technique coupled with bioinformatics analyses and multiple other techniques has been utilized to detect differential global gene expression profiles, Hoechst dye-specific gene expression signatures, and changes in cell morphology and levels of apoptosis-associated proteins in malignant mesothelioma cells. H342-induced apoptosis occurs in a dose-dependent fashion and is associated with morphological changes, caspase-3 activation, cytochrome c mitochondrial translocation, and cleavage of apoptosis-associated proteins. The antagonistic effect of H258 on H342-induced apoptosis indicates a pharmacokinetic basis for the two dyes' different biological effects. Differential global gene expression profiles induced by H258 and H342 are accompanied by unique gene expression signatures determined by DNA microarray and bioinformatics software, indicating a genetic basis for their different biological effects. CONCLUSIONS/SIGNIFICANCE: A unique gene expression signature associated with H342-induced apoptosis provides a new avenue to predict and classify the therapeutic class of minor groove binders in the drug

  4. Integrated renewable energy networks

    Science.gov (United States)

    Mansouri Kouhestani, F.; Byrne, J. M.; Hazendonk, P.; Brown, M. B.; Spencer, L.

    2015-12-01

    This multidisciplinary research is focused on studying implementation of diverse renewable energy networks. Our modern economy now depends heavily on large-scale, energy-intensive technologies. A transition to low carbon, renewable sources of energy is needed. We will develop a procedure for designing and analyzing renewable energy systems based on the magnitude, distribution, temporal characteristics, reliability and costs of the various renewable resources (including biomass waste streams) in combination with various measures to control the magnitude and timing of energy demand. The southern Canadian prairies are an ideal location for developing renewable energy networks. The region is blessed with steady, westerly winds and bright sunshine for more hours annually than Houston Texas. Extensive irrigation agriculture provides huge waste streams that can be processed biologically and chemically to create a range of biofuels. The first stage involves mapping existing energy and waste flows on a neighbourhood, municipal, and regional level. Optimal sites and combinations of sites for solar and wind electrical generation, such as ridges, rooftops and valley walls, will be identified. Geomatics based site and grid analyses will identify best locations for energy production based on efficient production and connectivity to regional grids.

  5. Organometallics and renewables

    Energy Technology Data Exchange (ETDEWEB)

    Meier, Michael A.R. [Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany). Inst. of Organic Chemistry; Weckhuysen, Bert M.; Bruijnincx, Pieter C.A. (eds.) [Utrecht Univ. (Netherlands). Debye Inst. of Nanomaterials Science

    2012-11-01

    USPs - BPF Each volume of Topics in Organometallic Chemistry provides the broad scientific readership with a comprehensive summary and critical overview of a specific topic in organometallic chemistry. Research in this rapidly developing transdisciplinary field is having profound influence on other areas of scientific investigation, ranging from catalytic organic synthesis to biology, medicine and material science. With contributions by international experts. Lucas Montero de Espinosa and Michael A. R. Meier: Olefin Metathesis of Renewable Platform Chemicals.- Pieter C. A. Bruijnincx, Robin Jastrzebski, Peter J. C. Hausoul, Robertus J. M. Klein Gebbink, and Bert M. Weckhuysen: Pd-Catalysed Telomerisation of 1,3-Dienes with Multifunctional Renewable Substrates - Versatile Routes for the Valorisation of Biomass-Derived Platform Molecules.- A Behr, A. J. Vorholt: Hydroformylation and related reactions of renewable resources.- Ties J. Korstanje, Robertus J.M. Klein Gebbink: Catalytic oxidation and deoxygenation of renewables with rhenium complexes.- Antoine Buchard, Clare M. Bakewell, Jonathan Weiner and Charlotte K. Williams: Recent Developments In Catalytic Activation Of Renewable Resources For Polymer Synthesis.

  6. Comparative evaluation of an experimental binder in hot-mix asphalt: correlating the predicted performance of the binder with asphalt testing

    CSIR Research Space (South Africa)

    O'Connell, Johannes S

    2014-07-01

    Full Text Available The binder is an important constituent of an asphalt mix and it affects the overall performance of the mix, especially with regards to permanent deformation and fatigue cracking. The stiffest binder available from the Chevron refinery in the Western...

  7. mSEL-1L (Suppressor/enhancer Lin12-like) protein levels influence murine neural stem cell self-renewal and lineage commitment.

    Science.gov (United States)

    Cardano, Marina; Diaferia, Giuseppe R; Cattaneo, Monica; Dessì, Sara S; Long, Qiaoming; Conti, Luciano; Deblasio, Pasquale; Cattaneo, Elena; Biunno, Ida

    2011-05-27

    Murine SEL-1L (mSEL-1L) is a key component of the endoplasmic reticulum-associated degradation pathway. It is essential during development as revealed by the multi-organ dysfunction and in uterus lethality occurring in homozygous mSEL-1L-deficient mice. Here we show that mSEL-1L is highly expressed in pluripotent embryonic stem cells and multipotent neural stem cells (NSCs) but silenced in all mature neural derivatives (i.e. astrocytes, oligodendrocytes, and neurons) by mmu-miR-183. NSCs derived from homozygous mSEL-1L-deficient embryos (mSEL-1L(-/-) NSCs) fail to proliferate in vitro, show a drastic reduction of the Notch effector HES-5, and reveal a significant down-modulation of the early neural progenitor markers PAX-6 and OLIG-2, when compared with the wild type (mSEL-1L(+/+) NSCs) counterpart. Furthermore, these cells are almost completely deprived of the neural marker Nestin, display a significant decrease of SOX-2 expression, and rapidly undergo premature astrocytic commitment and apoptosis. The data suggest severe self-renewal defects occurring in these cells probably mediated by misregulation of the Notch signaling. The results reported here denote mSEL-1L as a primitive marker with a possible involvement in the regulation of neural progenitor stemness maintenance and lineage determination.

  8. mSEL-1L (Suppressor/Enhancer Lin12-like) Protein Levels Influence Murine Neural Stem Cell Self-renewal and Lineage Commitment*

    Science.gov (United States)

    Cardano, Marina; Diaferia, Giuseppe R.; Cattaneo, Monica; Dessì, Sara S.; Long, Qiaoming; Conti, Luciano; DeBlasio, Pasquale; Cattaneo, Elena; Biunno, Ida

    2011-01-01

    Murine SEL-1L (mSEL-1L) is a key component of the endoplasmic reticulum-associated degradation pathway. It is essential during development as revealed by the multi-organ dysfunction and in uterus lethality occurring in homozygous mSEL-1L-deficient mice. Here we show that mSEL-1L is highly expressed in pluripotent embryonic stem cells and multipotent neural stem cells (NSCs) but silenced in all mature neural derivatives (i.e. astrocytes, oligodendrocytes, and neurons) by mmu-miR-183. NSCs derived from homozygous mSEL-1L-deficient embryos (mSEL-1L−/− NSCs) fail to proliferate in vitro, show a drastic reduction of the Notch effector HES-5, and reveal a significant down-modulation of the early neural progenitor markers PAX-6 and OLIG-2, when compared with the wild type (mSEL-1L+/+ NSCs) counterpart. Furthermore, these cells are almost completely deprived of the neural marker Nestin, display a significant decrease of SOX-2 expression, and rapidly undergo premature astrocytic commitment and apoptosis. The data suggest severe self-renewal defects occurring in these cells probably mediated by misregulation of the Notch signaling. The results reported here denote mSEL-1L as a primitive marker with a possible involvement in the regulation of neural progenitor stemness maintenance and lineage determination. PMID:21454627

  9. Application of a bio-binder as a rejuvenator for wet processed asphalt shingles in pavement construction

    OpenAIRE

    2015-01-01

    This paper investigates the merits of application of bio-binder to enhance rheological properties of asphalt binder in the presence of wet processed recycled asphalt shingles (RAS). It will further examine the performance and workability of asphalt designed with and without a specified percentage of a bio-binder produced from swine manure and RAS. Bio-binder was introduced to liquid asphalt binder modified with four different percentages of RAS; the high and low temperature properties of each...

  10. Why is the electroanalytical performance of carbon paste electrodes involving an ionic liquid binder higher than paraffinic binders? A simulation investigation.

    Science.gov (United States)

    Ghatee, M H; Namvar, S; Zolghadr, A R; Moosavi, F

    2015-10-14

    Recently, carbon paste electrodes (CPE) fabricated using an ionic liquid (IL) binder have shown enhanced electroanalytical performance over conventional paraffinic binders. Molecular dynamics (MD) simulations of graphite mixed with ionic liquid and with paraffin binder can unravel the potential atomistic factors responsible for such enhancement. Based on an experimentally optimized binder/graphite mass ratio, which has been reported to be crucial for such a performance, comprehensive simulations (at 323 K) are performed with the ensembles involving an ionic liquid binder (1-butyl-3-methylimidazolium hexafluorophosphate, [C4mim]PF6) and a paraffin binder (n-C20H42) mixed with graphite comprising large-size hexagonal-shaped double graphene plates. Structural analysis indicates both binders form only a monolayer on the graphite surface, covering the surface locally by IL but all-encompassing by paraffin. With charged and uncharged graphite, the IL monolayer tends to cover mainly the graphite center without approaching the edge planes. On the contrary, a monolayer of the paraffin binder covers uniformly the center, near the center, and the edge planes. Cations and anions of the IL form well-defined two dimensional pentagonal matrixes with characteristic high adsorption energy, almost 2.4 times higher than paraffin adsorption. The cation and anion coordination ability of the IL is responsible for such a local distribution. The simulation of these phenomena under experimental conditions unravels strong two-dimensional coordination properties inherent to the ionic liquid when distributed over the graphite surface. This direct MD simulation comparison of the IL properties with an organic liquid counterpart, made for the first time, can be used to explain the high electroanalytical performance (electron transfer) of CPEs involving an IL binder over paraffin binders.

  11. Pharmaceutical equivalence of gabapentin tablets with various extragranular binders Pharmaceutical equivalence of gabapentin tablets with various extragranular binders

    Directory of Open Access Journals (Sweden)

    SWATI C. JAGDALE

    2010-06-01

    Full Text Available Gabapentin is a high-dose drug widely used as an oral anti-epilepticagent. Due to high crystalline and has poor compaction properties it is difficult to form tablets by direct compression. The aim of this study was to develop gabapentin tablets, pharmaceutically equivalent to the reference product Neurontin (marketed in USA. Gabapentin 800mg tablets were produced by wet granulation by keeping intragranular binder as well as its concentration constant and by changing with various extragranular binders with its concentration (A = PVPK 30, B = HPMC 15 cps, C = Kollidon VA 64, D =Klucel EXF.The tablet having no weight, thickness and hardness variation and having appropriate, friability as well as disintegration profile were coated with a 3% film coating solution .Seven formulations F1 (A in lower concentration F2 (A in higher concentration, F3 (B in lower concentration and F4 (B in higher concentration, F5 (C in lower concentration, F6 (C in higher concentration, F7 (D in lower concentration were formulated. Among them F6 demonstrated adequate hardness, friability, disintegration, uniformity of content, and total drug dissolution after 45minutes. The dissimilarity factor (f1 is 5.93 and the similarity factor (f2 is 67.85. So F6 was found to be equivalent to Neurontin.Gabapentin is widely used as an oral anti-epileptic agent. However, owing to its high crystallinity and poor compaction properties, it is difficult to form tablets of this drug by direct compression. The aim of this study was to develop gabapentin tablets, pharmaceutically equivalent to the brand-name pioneer product Neurontin® (marketed in USA. Gabapentin 800mg tablets were produced by wet granulation with a constant concentration of intragranular binder and a varying concentration of extragranular binders (A = polyvinylpyrrolidone K30, B = hydroxypropylmethylcellulose 15 cps, C = Kollidon VA64, D =Klucel EXF. The tablets that did not vary in weight, thickness or hardness and had

  12. Calcium acetate versus calcium carbonate as phosphorus binders in patients on chronic haemodialysis: a controlled study.

    Science.gov (United States)

    Ring, T; Nielsen, C; Andersen, S P; Behrens, J K; Sodemann, B; Kornerup, H J

    1993-01-01

    The first reported double-blind cross-over comparison between the phosphorus binders calcium carbonate and calcium acetate was undertaken in 15 stable patients on chronic maintenance haemodialysis. Detailed registration of diet and analysis of the protein catabolic rate suggested an unchanged phosphorus intake during the study. It was found that predialytic serum phosphate concentration was significantly decreased by 0.11 mmol/l (0.34 mg/dl) (P = 0.021, 95% confidence limits 0.02-0.21 mmol/l; 0.06-0.65 mg/dl) during calcium acetate treatment. The calcium phosphate product was insignificantly decreased during treatment with calcium acetate whereas we could not exclude the possibility that calcium concentration had increased.

  13. Binder fraction reduction in non-ferrous metals concentrates briquetting process

    Directory of Open Access Journals (Sweden)

    M. Jodkowski

    2016-10-01

    Full Text Available The research results on a method of reducing the amount of binder applied during formation of metal concentrates are presented. Research was done on a model copper concentrate, which was mixed in assumed mass fraction with binder, as well as binder with addition of waste polyols. Such mixtures were formed and tested using static compressive strength, both immediately after forming and after the assumed seasoning times: 24, 96, 192 and 336 hours. The results confirm the possibility of binder dose lowering using high-efficiency system of binder dispersing with small addition of waste polyols and by homogeneous mixing of the binder with the material. In all examined cases increase in seasoning time influenced mechanical strength of the formed shapes advantageously.

  14. Briquetting of coal fines and sawdust. Part 1: binder and briquetting-parameters evaluations

    Energy Technology Data Exchange (ETDEWEB)

    D. Taulbee; D.P. Patil; Rick Q. Honaker; B.K. Parekh [University of Kentucky, Lexington, KY (United States). Center for Applied Energy Research

    2009-01-15

    Various technical and economic aspects relating to the briquetting of fine coal with sawdust have been evaluated with the results for two segments of that study presented here: binder and briquetting-parameter evaluations. Approximately 50 potential binder formulations were subjected to a series of screening evaluations to identify three formulations that were the most cost effective for briquetting fine coal with sawdust. Two of the binders, guar gum and wheat starch, were selected as most suitable for the pulverized coal market while the third formulation, lignosulfonate/lime, was targeted for the stoker market. Following binder selection, a number of briquetting parameters including binder and sawdust concentration, sawdust type, briquetting pressure and dwell time, coal and sawdust particle size, clay content, moisture content, and cure temperature and cure time were evaluated. Briquetting pressure and dwell time have the least impact while binder and sawdust concentrations, sawdust type, and curing conditions exerted the greatest influence on briquette quality. 7 refs.

  15. Influence of Mycotoxin Binders on the Oral Bioavailability of Doxycycline in Pigs.

    Science.gov (United States)

    De Mil, Thomas; Devreese, Mathias; De Saeger, Sarah; Eeckhout, Mia; De Backer, Patrick; Croubels, Siska

    2016-03-16

    Mycotoxin binders are feed additives that aim to adsorb mycotoxins in the gastrointestinal tract of animals, making them unavailable for systemic absorption. The antimicrobial drug doxycycline (DOX) is often used in pigs and is administered through feed or drinking water; hence, DOX can come in contact with mycotoxin binders in the gastrointestinal tract. This paper describes the effect of four mycotoxin binders on the absorption of orally administered DOX in pigs. Two experiments were conducted: The first used a setup with bolus administration to fasted pigs at two different dosages of mycotoxin binder. In the second experiment, DOX and the binders were mixed in the feed at dosages recommended by the manufacturers (= field conditions). Interactions are possible between some of the mycotoxin binders dosed at 10 g/kg feed but not at 2 g/kg feed. When applying field conditions, no influences were seen on the plasma concentrations of DOX.

  16. Development of water soluble binder systems for low pressure injection molding of alumina

    Energy Technology Data Exchange (ETDEWEB)

    Bakan, H.I.; Gunes, M. [TUBITAK-MRC Materials and Chemical Technologies Research Inst., Kocaeli (Turkey)

    2004-07-01

    Low pressure injection molding of alumina powder using a water-soluble binder system has been carried out successfully. The water-soluble based binder system consisted of poly (2-ethyl-2-oxaline), low density polyethylene and stearic acid. The critical powder loading of the binder-powder mixture was determined based on torque rheometry experiments. The rheological properties of the powder-binder mixture were investigated systematically. The binder system used provides satisfactory mixture stability, excellent mouldability and reasonably fast water leaching and thermal debinding rates. The water-soluble constituent, poly (2-ethyl-2-oxaline), was removed by leaching in convecting water at 60 C within 6 hour. The remaining binder constituents were thermally removed during heating to 450 C. Sintering of the parts was conducted at 1550 C for an hour in air. (orig.)

  17. Renewable Energy for Microenterprise

    Energy Technology Data Exchange (ETDEWEB)

    Allderdice, A.; Rogers, J.H.

    2000-11-28

    This guide provides readers with a broad understanding of the potential benefits that current renewable energy technologies can offer rural microenterprises. It also introduces the institutional approaches that have been developed to make RE technologies accessible to microentrepreneurs and the challenges that these entrepreneurs have encountered.

  18. Renewable Energies, Present & Future

    Institute of Scientific and Technical Information of China (English)

    X. S. Cai

    2005-01-01

    Fossil fuels are major cause of environmental destruction in pollutions. It has created much needed momentum for renewable energies, which are environmentally benign, generated locally, and can play a significant role in developing economy. As a sustainable energy sources, it can grow at a rapid pace to meet increasing demands for electricity in a cost-effective way.

  19. Renew, refuel, and rebuild.

    Science.gov (United States)

    Chin, Allison

    2009-01-01

    We can renew, refuel, and rebuild America with millions of green jobs, but they must be good jobs. Participants at the conference understand that environmental and economic stability go hand-in-hand, that the challenges of global warming are urgent and that huge opportunities exist for building a clean energy economy.

  20. Learning about Renewable Energy.

    Science.gov (United States)

    Conservation and Renewable Energy Inquiry and Referral Service (DOE), Silver Spring, MD.

    This booklet provides an introduction to renewable energy, discussing: (1) the production of electricity from sunlight; (2) wind power; (3) hydroelectric power; (4) geothermal energy; and (5) biomass. Also provided are nine questions to answer (based on the readings), four additional questions to answer (which require additional information), and…

  1. Mid-Career Renewal

    Science.gov (United States)

    Leider, Richard J.

    1976-01-01

    Since "life/career renewal issues will be among the most discussed of society's problems in the next five years and one of the hottest problems business and industry will be faced with," the author reviews work ethic history and recommends approaches individuals may take in view of the probable future. (Author/BP)

  2. Renewable Energy Essentials: Hydropower

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2010-07-01

    Hydropower is currently the most common form of renewable energy and plays an important part in global power generation. Worldwide hydropower produced 3 288 TWh, just over 16% of global electricity production in 2008, and the overall technical potential for hydropower is estimated to be more than 16 400 TWh/yr.

  3. ALTERNATIVE BINDERS TO BENTONITE FOR IRON ORE PELLETIZING: PART I: EFFECTS ON PHYSICAL AND MECHANICAL PROPERTIES

    Directory of Open Access Journals (Sweden)

    Osman Sivrikaya

    2014-07-01

    Full Text Available The use of conventional bentonite binder is favorable in terms of mechanical and metallurgical pellet properties, however, because of its acid constituents bentonite is considered as impurity especially for iron ores with high acidic content. Therefore, alternative binders to bentonite have been tested. Organic binders are the most studied binders and they yield pellets with good wet strength; they fail in terms of preheated and fired pellet strengths. This study was conducted to investigate how insufficient pellet strengths can be improved when organic binders are used as binder. The addition of a low-melting temperature and slag bonding/strength increasing constituent (free in acidic contents into pellet feed was proposed. Addition of boron compounds such as colemanite, tincal, borax pentahydrate, boric acid together with organic binders such as CMC, starch, dextrin and some organic based binders, into iron oxide pellet was tested. Wet and thermally treated pellet physical-mechanical qualities (balling - moisture content - size - shape - drop number - compressive strengths - porosity - dustiness were determined. The results showed that good quality wet, dry, preheated and fired pellets can be produced with combined binders (an organic binder plus a boron compound when compared with bentonite-bonded pellets. While organic binders provided sufficient wet and dry pellet strengths, the boron compounds provided the required preheated and fired pellet strengths at even lower firing temperature. Especially, the contribution of boron compound addition is most pronounced for hematite pellets which do not have strengthening mechanism through oxidation like magnetite pellets during firing. Therefore, addition of boron compound is beneficial to recover the low physical-mechanical qualities of pellets produced with organic binders through slag bonding mechanism. Furthermore, lowering the firing temperature thanks to low-melting boron compounds will be cost

  4. Renewable Substitutability Index: Maximizing Renewable Resource Use in Buildings

    Directory of Open Access Journals (Sweden)

    Ravi S. Srinivasan

    2015-05-01

    Full Text Available In order to achieve a material and energy balance in buildings that is sustainable in the long run, there is an urgent need to assess the renewable and non-renewable resources used in the manufacturing process and to progressively replace non-renewable resources with renewables. Such progressive disinvestment in the non-renewable resources that may be substituted with renewable resources is referred to as “Renewable Substitutability” and if implemented, this process will lead to a paradigm shift in the way building materials are manufactured. This paper discusses the development of a Renewable Substitutability Index (RSI that is designed to maximize the use of renewable resources in a building and quantifies the substitution process using solar emergy (i.e., the solar equivalent joules required for any item. The RSI of a building or a building component, i.e., floor or wall systems, etc., is the ratio of the renewable resources used during construction, including replacement and maintenance, to the building’s maximum renewable emergy potential. RSI values range between 0 and 1.0. A higher RSI achieves a low-energy building strategy promoting a higher order of sustainability by optimizing the use of renewables over a building’s lifetime from formation-extraction-manufacturing to maintenance, operation, demolition, and recycle.

  5. The Renewable Energy Data Explorer: Mapping Our Renewable Energy Future

    Energy Technology Data Exchange (ETDEWEB)

    2017-04-13

    The Renewable Energy (RE) Data Explorer, developed by the National Renewable Energy Laboratory, is an innovative web-based platform that allows users to visualize and analyze renewable energy potential. The RE Data Explorer informs prospecting, integrated planning, and policymaking to enable low emission development.

  6. Sustainable Housing Renewal

    Directory of Open Access Journals (Sweden)

    M. Sitar

    2008-01-01

    Full Text Available Following the already proved models the sustainable planning culture is endangering several methods directed towards the needs of tenants in the existing post-war housing stock. The case-study of our project is the renewal of the multi stored building in the housing estate Metalna, Maribor/Tezno (1949. It is based on the sustainable renovation principle for the quality of sustainable housing in functional, technological and environmental point of view. According to it, the idea of the project was to improve the functionality of the building as well as of individual housing units. One of the main goals was to introduce the variety of space and typology of individual housing units. Beside, there was an intention to rebuild and redesign the green area, especially the problems of parking and playground for children. On the other hand, the project is introducing the low-energy renovation principle including new technologies, structural elements and materials. Two scenarios of technological renewal were suggested. The first one was a classical one using additional thermal insulation of the building envelope and fitting of new structural elements such as windows, doors, balconies, windbreaks etc. (Renewal 1. The second scenario, however, included the sunspace construction used as a new passive solar structural element, modifying the envelope (Renewal 2. The energy efficiency of the suggested scenarios were calculated according to the procedures given in EN 832 standard considering the attached sunspace as integral part of the building in first case and as a passive solar object adjacent to the thermal envelope of the building in the second case. The results show that the last case yields the most energy efficient renewal of the existing residential building.

  7. Renewable Systems Interconnection: Executive Summary

    Energy Technology Data Exchange (ETDEWEB)

    Kroposki, B.; Margolis, R.; Kuswa, G.; Torres, J.; Bower, W.; Key, T.; Ton, D.

    2008-02-01

    The U.S. Department of Energy launched the Renewable Systems Interconnection (RSI) study in 2007 to address the challenges to high penetrations of distributed renewable energy technologies. The RSI study consists of 14 additional reports.

  8. Renewable Energy on Tribal Lands

    Science.gov (United States)

    This page contains presentations from the Brown to Green: Make the Connection to Renewable Energy workshop held in Santa Fe, New Mexico, during December 10-11, 2008 regarding Renewable Energy on Tribal Lands.

  9. Environmentally-Friendly Geopolymeric Binders Made with Silica

    Science.gov (United States)

    Erdogan, S. T.

    2013-12-01

    Portland cement (PC) is the ubiquitous binding material for constructions works. It is a big contributor to global warming and climate change since its production is responsible for 5-10 % of all anthropogenic CO2 emissions. Half of this emission arises from the calcination of calcareous raw materials and half from kiln fuel burning and cement clinker grinding. Recently there have been efforts to develop alternative binders with lower greenhouse gas emissions. One such class of binders is geopolymers, formed by activating natural or waste materials with suitable alkaline or acidic solutions. These binders use natural or industrial waste raw materials with a very low CO2 footprint from grinding of the starting materials, and some from the production of the activating chemicals. The total CO2 emissions from carefully formulated mixtures can be as low as 1/10th - 1/5th of those of PC concrete mixtures with comparable properties. While use of industrial wastes as raw materials is environmentally preferable, the variability of their chemical compositions over time renders their use difficult. Use of natural materials depletes resources but can have more consistent properties and can be more easily accepted. Silica sand is a natural material containing very high amounts of quartz. Silica fume is a very fine waste from silicon metal production that is mostly non-crystalline silica. This study describes the use of sodium hydroxide and sodium silicate solutions to yield mortars with mechanical properties comparable to those of portland cement mortars and with better chemical and thermal durability. Strength gain is slower than with PC mixtures at room temperature but adequate ultimate strength can be achieved with curing at slightly elevated temperatures in less than 24 h. The consistency of the chemical compositions of these materials and their abundance in several large, developing countries makes silica attractive for producing sustainable concretes with reduced carbon

  10. Sustainable asphalt pavement: Application of slaughterhouse waste oil and fly ash in asphalt binder

    Science.gov (United States)

    Sanchez Ramos, Jorge Luis

    Increasing energy costs, lack of sufficient natural resources and the overwhelming demand for petroleum has stimulated the development of alternative binders to modify or replace petroleum-based asphalt binders. In the United States, the petroleum-based asphalt binder is mainly used to produce the Hot Mix Asphalt (HMA). There are approximately 4000 asphalt plants that make 500 million tons of asphalt binder valued at roughly 3 billion/year. The instability of the world's oil market has pushed oil prices to more than 80 per barrel in 2012, which increased the cost of asphalt binder up to $570 per ton. Therefore, there is a timely need to find alternative sustainable resources to the asphalt binder. This paper investigates the possibility of the partial replacement of the asphalt binder with slaughterhouse waste and/or fly ash. In order to achieve this objective, the asphalt binder is mixed with different percentages of waste oil and/or fly ash. In order to investigate the effect of these additives to the performance of the asphalt binder, a complete performance grade test performed on multiple samples. The results of the performance grade tests are compared with a control sample to observe how the addition of the waste oil and/or fly ash affects the sample. Considering the increasing cost and demand of asphalt, the use of slaughterhouse waste oil and/or fly ash as a partial replacement may result in environmental and monetary improvements in the transportation sector.

  11. Next Generation Advanced Binder Chemistries for High Performance, Environmetally DurableThermal Control Material Systems. Project

    Data.gov (United States)

    National Aeronautics and Space Administration — This innovative SBIR Phase I proposal will develop new binder systems through the systematic investigations to tailor required unique performance properties and...

  12. Novel anti-flooding poly(dimethylsiloxane) (PDMS) catalyst binder for microbial fuel cell cathodes

    KAUST Repository

    Zhang, Fang

    2012-11-01

    Poly(dimethylsiloxane) (PDMS) was investigated as an alternative to Nafion as an air cathode catalyst binder in microbial fuel cells (MFCs). Cathodes were constructed around either stainless steel (SS) mesh or copper mesh using PDMS as both catalyst binder and diffusion layer, and compared to cathodes of the same structure having a Nafion binder. With PDMS binder, copper mesh cathodes produced a maximum power of 1710 ± 1 mW m -2, while SS mesh had a slightly lower power of 1680 ± 12 mW m -2, with both values comparable to those obtained with Nafion binder. Cathodes with PDMS binder had stable power production of 1510 ± 22 mW m -2 (copper) and 1480 ± 56 mW m -2 (SS) over 15 days at cycle 15, compared to a 40% decrease in power with the Nafion binder. Cathodes with the PDMS binder had lower total cathode impedance than those with Nafion. This is due to a large decrease in diffusion resistance, because hydrophobic PDMS effectively prevented catalyst sites from filling up with water, improving oxygen mass transfer. The cost of PDMS is only 0.23% of that of Nafion. These results showed that PDMS is a very effective and low-cost alternative to Nafion binder that will be useful for large scale construction of these cathodes for MFC applications. © 2012 Elsevier B.V.

  13. Targeted Knockdown of RNA-Binding Protein TIAR for Promoting Self-Renewal and Attenuating Differentiation of Mouse Embryonic Stem Cells

    OpenAIRE

    Zhe Geng; Ping Li; Li Tan; Houyan Song

    2015-01-01

    RNA-binding protein TIAR has been suggested to mediate the translational silencing of ARE-containing mRNAs. To analyze the functions of TIAR, we established RNAi and genetic rescue assays. We evaluated the expression of neuroectoderm markers Pax6 and nestin, mesoderm markers brachyury and Flk1, and hypoblast and definitive endoderm markers Sox17 and Gata6 during EB differentiation and found that knockdown TIAR expression restrained the differentiation of E14 cells. We assessed gene expression...

  14. Chitosan chemical hydrogel electrode binder for direct borohydride fuel cells

    Energy Technology Data Exchange (ETDEWEB)

    Choudhury, Nurul A.; Sahai, Yogeshwar; Buchheit, Rudolph G. [Department of Materials Science and Engineering, Ohio State University, Columbus, OH (United States)

    2011-01-15

    A novel and cost-effective electrode binder consisting of chitosan chemical hydrogel (CCH) is reported for direct borohydride fuel cells (DBFCs). The DBFCs have been assembled with Misch-metal-based AB{sub 5} alloy as anode, carbon-supported palladium (Pd/C) as cathode and polyvinyl alcohol (PVA) hydrogel membrane electrolyte (PHME) as well as Nafion {sup registered} -117 membrane electrolyte (NME) as separators. Operating in passive mode without using peristaltic pump and under ambient conditions of temperature as well as pressure, the DBFC exhibited a maximum peak power density of about 81 mW cm{sup -2}. (author)

  15. Hexacyanoferrates and bentonite as binders of radiocaesium for reindeer

    Directory of Open Access Journals (Sweden)

    Knut Hove

    1991-10-01

    Full Text Available The effects of varying doses of caesium binders (Bentonite and several forms of iron-hexacyanoferrates on radiocaesium accumulation in red blood cells and on radiocaesium transfer to urine and faeces were studied in feeding experiments with reindeer calves. The caesium binders were added to a ration of lichen (containing 9.5 kBq of 134Cs+137Cs originating from the Chernobyl accident and fed together with a pelleted reindeer feed (RF-71 for 42 days. A 50% reduction in red blood cell radiocaesium concentration was obtained with a daily dose of 1 mg/kg body weigth of ammoniumironhexacyanoferrate (AFCF and with 500 mg/kg of bentonite. Three mg/kg of AFCF or 2 g/kg of bentonite reduced both urinary excretion and RBC concentrations with more than 80%. It is concluded that iron-hexacyanoferrates, as a result of their high caesium binding capacity, are particularly useful as caesium binders for free ranging ruminants like the reindeer.Hexacynoferrater og bentonitt som bindere av radiocesium i reinAbstract in Norwegian / Sammendrag: Effekten av bentonitt og ulike typer jernhexacyanoferrater (Berlinerblått på akkumulering av radioaktivt cesium i røde blodlegemer og på utskilling av radioaktivt cesium i urin ble undersøkt i foringsforsøk med reinkalver. Cesiumbinderne ble gitt daglig sammen med lav som inneholdt 9.5 kBq 134Cs+137Cs fra Tsjernobyl ulykken, og 1 kg reinfor (RF-71 i en periode på 42 dager. En daglig dose på 1 mg/kg kroppsvekt av ammoniumjernhexacyano-ferrat (AFCF reduserte radiocesiuminnholdet i blodlegemer med 50%, mens en dose pa 500 mg/kg bentonitt var nødvendig for å oppnå samme effekt. Tre mg/kg AFCF eller 2 g/kg/bentonitt var nødvendig for å oppnå mer enn 80% reduksjon i radiocesium konsentrasjonen i blodlegemer og i radiocesium utskilling med urinen. På grunn av de små daglige mengder som kreves er jern-hexacyanoferratene spesielt velegnete som cesiumbindere for beitedyr.

  16. Nanomodified compositions based on finely dispersed binders for soil reinforcement

    Directory of Open Access Journals (Sweden)

    Alimov Lev

    2017-01-01

    Full Text Available Theoretical prerequisites on the possibility of improvement of physical and mechanical properties of soils at underground space development, their stability at different aggressive actions by means of their structure impregnation with nanomodified suspensions on the basis of especially finely dispersed mineral binders are developed. The features of influence of plasticizers on penetration ability and sedimentation stability of suspensions are revealed. Soil body reinforcement after its impregnation may achieve considerable values, which is related to the features of interaction of components of impregnating composition with extended surface of soil pore space.

  17. Introducing the Affinity Binder Knockdown Initiative—A public–private partnership for validation of affinity reagents

    Directory of Open Access Journals (Sweden)

    Tove Alm

    2016-03-01

    Full Text Available The newly launched Affinity Binder Knockdown Initiative encourages antibody suppliers and users to join this public–private partnership, which uses crowdsourcing to collect characterization data on antibodies. Researchers are asked to share validation data from experiments where gene-editing techniques (such as siRNA or CRISPR have been used to verify antibody binding. The initiative is launched under the aegis of Antibodypedia, a database designed to allow comparisons and scoring of publicly available antibodies towards human protein targets. What is known about an antibody is the foundation of the scoring and ranking system in Antibodypedia.

  18. Renewable energy and wildlife conservation

    Science.gov (United States)

    Khalil, Mona

    2016-09-09

    The renewable energy sector is rapidly expanding and diversifying the power supply of the country. Yet, as our Nation works to advance renewable energy and to conserve wildlife, some conflicts arise. To address these challenges, the U.S. Geological Survey (USGS) is conducting innovative research and developing workable solutions to reduce impacts of renewable energy production on wildlife.

  19. Renewable Energy Systems

    DEFF Research Database (Denmark)

    Lund, Henrik

    2014-01-01

    are to be found when the electricity sector is combined with the heating and cooling sectors and/or the transportation sector. Moreover, the combination of electricity and gas infrastructures may play an important role in the design of future renewable energy systems. The paper illustrates why electricity smart......This paper presents the learning of a series of studies that analyse the problems and perspectives of converting the present energy system into a 100 % renewable energy system using a smart energy systems approach. As opposed to, for instance, the smart grid concept, which takes a sole focus...... on the electricity sector, smart energy systems include the entire energy system in its approach to identifying suitable energy infrastructure designs and operation strategies. The typical smart grid sole focus on the electricity sector often leads to the conclusion that transmission lines, flexible electricity...

  20. RENEWABLE ENERGY IN TOURISM

    Directory of Open Access Journals (Sweden)

    MĂDĂLINA MIHĂILĂ

    2012-06-01

    Full Text Available Recent reports published by the International Energy Agency and U.S. Department of Energy, regarding the global energy outlook for the first three decades of the XXI century, warns of global trends on energy demand, increasing dependence on energy imports, coal use and volume emissions of greenhouse gases, torism industry being one of the biggest energy consumption industry. Uncertainties on different models of regional development and access of the world to traditional energy resources require a change of orientation towards long-term scenarios for assessing energy domain, increasing the share of energy from renewable resources beeing one of the solutions. Intourism the renewable energy is a solution for a positive impact on enviroment , reduced operational costs and even won an extra-profit.

  1. Bolivia renewable energy development

    Energy Technology Data Exchange (ETDEWEB)

    Smith, P.

    1997-12-01

    The author summarizes changes which have occurred in Bolivia in the past year which have had an impact on renewable energy source development. Political changes have included the privatization of power generation and power distribution, and resulted in a new role for state level government and participation by the individual. A National Rural Electrification Plan was adopted in 1996, which stresses the use of GIS analysis and emphasizes factors such as off grid, economic index, population density, maintenance risk, and local organizational structure. The USAID program has chosen to stress economic development, environmental programs, and health over village power programs. The national renewables program has adopted a new development direction, with state projects, geothermal projects, and private sector involvement stressed.

  2. Renewable Energy Systems

    DEFF Research Database (Denmark)

    Lund, Henrik; Mathiesen, Brian Vad; Connolly, David

    2014-01-01

    This paper presents the learning of a series of studies that analyse the problems and perspectives of converting the present energy system into a 100 % renewable energy system using a smart energy systems approach. As opposed to, for instance, the smart grid concept, which takes a sole focus...... on the electricity sector, smart energy systems include the entire energy system in its approach to identifying suitable energy infrastructure designs and operation strategies. The typical smart grid sole focus on the electricity sector often leads to the conclusion that transmission lines, flexible electricity...... are to be found when the electricity sector is combined with the heating and cooling sectors and/or the transportation sector. Moreover, the combination of electricity and gas infrastructures may play an important role in the design of future renewable energy systems. The paper illustrates why electricity smart...

  3. The curious case of zeolite-clay/binder interactions and their consequences for catalyst preparation.

    Science.gov (United States)

    Whiting, Gareth T; Chowdhury, Abhishek Dutta; Oord, Ramon; Paalanen, Pasi; Weckhuysen, Bert M

    2016-07-04

    Zeolite-based catalyst bodies are commonly employed in a range of important industrial processes. Depending on the binder and shaping method chosen, vast differences in the reactivity, selectivity and stability are obtained. Here, three highly complementary micro-spectroscopic techniques were employed to study zeolite ZSM-5-binder interactions in SiO2-, Al2O3-, SiO2 : Al2O3- (2 : 1 mix) and kaolinite-bound catalyst pellets. We establish how their preparation influences the zeolite-clay/binder interactions. Using thiophene as an acid-catalyzed staining reaction, light absorbing oligomers produced in each sample were followed. To our surprise, kaolinite decreased the overall reactivity of the sample due to the phase change of the binder, creating a hard impenetrable outer layer. Aluminum migration to the zeolite was observed when Al2O3 was selected as a binder, creating additional Brønsted acid sites, which favored the formation of ring-opened thiophene oligomers compared to the larger oligomer species produced when SiO2 was used as a binder. In the latter case, the interaction of the Si-OH groups in the binder with thiophene was revealed to have a large impact in creating such large oligomer species. Furthermore, the combination of a SiO2 : Al2O3 mix as a binder enhanced the reactivity, possibly due to the creation of additional Brønsted acid sites between the two binder components during pellet preparation. It is evident that, independent of the shaping method, the intimate contact between the zeolite and binder heavily impacts the reactivity and product selectivity, with the type of binder playing a vital role.

  4. Interpenetrating Polymer Networks as Binders for Solid Composite Propellants

    Directory of Open Access Journals (Sweden)

    S. Parthiban

    1992-07-01

    Full Text Available A new family of polymeric binders for solid composite propellants is proposed, based on two component interpenetrating polymer networks (IPNs. These networks comprise two different polyurethanes based on hydroxy terminated polybutadiene and ISRO polyol interpenetrated with two different vinyl polymers, viz poly methyl methacrylate and polystyrene. the networks synthesized by the simultaneous interpenetrating technique have been characterized for their properties, such as stress-strain, density, viscosity, thermal degradation, and heat of combustion. Phase morphologies have been determined using electron microscopy. Suitable explanations have been adduced to rationalize the properties of IPNs in terms of their structures and chain interactions. A study of the mechanical properties and burning rates of the ammonium perchlorate (AP-based solid propellant using the newly synthesised IPNs as binders, has been carried out. The results show that both mechanical strength and burning rate of solid propellants could be suitably modified by simply changing the nature and/or the ratio of the two interpenetrating polymer components.

  5. Rheological evaluation of polymer-modified asphalt binders

    Directory of Open Access Journals (Sweden)

    Mônica Romero Santos Fernandes

    2008-09-01

    Full Text Available Currently, the most used polymer for asphalt binder modification is the thermoplastic elastomer styrene butadiene styrene (SBS and aromatic oil is commonly added to the mixtures to improve their compatibly. This paper proposes the use of oil shale from sedimentary rock as a compatibilizer agent for polymer-modified asphalt binder (PMB. PMBs were produced by mixing a bitumen with a linear SBS copolymer (3.5% (w.w-1 using two oil shale contents (2 and 4% and petroleum aromatic oil to evaluate comparatively the effect of the compatibilizer agent on the SBS PMB properties. The rheological characteristics of the SBS PMBs were analyzed in a dynamic shear rheometer (DSR and the morphology accessed by fluorescence optical microscopy. The viscoelastic behavior of the samples corroborated the results for the classical properties and varied according to the sample morphology and composition. The results indicate that the aromatic and shale oils have similar effects on the microstructure, storage stability and viscoelastic behavior of the PMBs. Thus, shale oil could be successfully used as a compatibilizer agent without loss of properties or could even replace the aromatic oil. Following the Superpave methodology it was observed that the linear- and radial-SBS PMBs and linear-SBS PMB with 2% of shale oil can be used up to 70 °C, and the linear-SBS PMBs with 4% of shale oil or 2% of aromatic oil can be used only up to 64 °C.

  6. Emissions of tar-containing binders: field studies.

    Science.gov (United States)

    Hugener, Martin; Emmenegger, Lukas; Mattrel, Peter

    2009-01-01

    This study describes the measurement of emissions during field construction of asphalt pavements using tar-containing recycled asphalt pavement (RAP), which is known to release harmful substances, such as polycyclic aromatic hydrocarbons (PAH). At three different test sites, the main emission sources were identified and the total emission rates of fumes and PAHs of the paving process were determined. For this purpose, the paver was temporarily enclosed. While the screed area was the main emission source, the hopper area and freshly compacted pavement were also significant. In comparison with previous laboratory tests, the binder composition and the resulting emissions were comparable, except for Naphthalene. Benzo(a)pyrene (BaP) as a representative for carcinogenic PAHs was identified as a good leading compound, correlating well with the toxicity weighted sum of PAHs. In contrast, the unweighted, mass related sum of all EPA PAHs does not seem to be a good parameter to assess workplace concentrations because emissions by mass are dominated by the less hazardous 2-, 3- and 4-ring PAHs. Workplace concentrations for bitumen fumes and PAHs were below limit values in all three field studies. However, the margin was not large and the field tests were done under favourable meteorological conditions. Therefore, we suggest maintaining the current Swiss limit of 5000 mg EPA-PAH per kg binder in the RAP-containing hot mix.

  7. Predictive cartography of metal binders using generative topographic mapping

    Science.gov (United States)

    Baskin, Igor I.; Solov'ev, Vitaly P.; Bagatur'yants, Alexander A.; Varnek, Alexandre

    2017-08-01

    Generative topographic mapping (GTM) approach is used to visualize the chemical space of organic molecules (L) with respect to binding a wide range of 41 different metal cations (M) and also to build predictive models for stability constants (log K) of 1:1 (M:L) complexes using "density maps," "activity landscapes," and "selectivity landscapes" techniques. A two-dimensional map describing the entire set of 2962 metal binders reveals the selectivity and promiscuity zones with respect to individual metals or groups of metals with similar chemical properties (lanthanides, transition metals, etc). The GTM-based global (for entire set) and local (for selected subsets) models demonstrate a good predictive performance in the cross-validation procedure. It is also shown that the data likelihood could be used as a definition of the applicability domain of GTM-based models. Thus, the GTM approach represents an efficient tool for the predictive cartography of metal binders, which can both visualize their chemical space and predict the affinity profile of metals for new ligands.

  8. Marine Renewable Energy Seascape

    OpenAIRE

    Borthwick, Alistair G. L.

    2015-01-01

    Marine renewable energy has a major part to play in closing the world’s energy gap and lowering carbon emissions. Key global challenges relate to technology, grid infrastructure, cost and investment, environmental impact, and marine governance. Offshore wind turbines typically consist of three blades rotating about a hub. Although offshore wind technology is rapidly being implemented, there remain many fascinating engineering problems to overcome. These include: offshore foundations and float...

  9. Biotechnology for renewable chemicals

    DEFF Research Database (Denmark)

    Borodina, Irina; Kildegaard, Kanchana Rueksomtawin; Jensen, Niels Bjerg

    2014-01-01

    The majority of the industrial organic chemicals are derived from fossil sources. With the oil and gas resources becoming limiting, biotechnology offers a sustainable alternative for production ofchemicals from renewable feedstocks. Yeast is an attractive cell factory forsustainable production of...... for the production of non-native 3-hydroxypropionic acid (3HP).3HP can be chemically dehydrated into acrylic acid and thus can serve as a biosustainable building block for acrylate-based products (diapers, acrylic paints, acrylic polymers, etc.)...

  10. Sustainable Housing Renewal

    OpenAIRE

    M. Sitar; K. Krajnc

    2008-01-01

    Following the already proved models the sustainable planning culture is endangering several methods directed towards the needs of tenants in the existing post-war housing stock. The case-study of our project is the renewal of the multi stored building in the housing estate Metalna, Maribor/Tezno (1949). It is based on the sustainable renovation principle for the quality of sustainable housing in functional, technological and environmental point of view. According to it, the idea of the projec...

  11. Renewable energy project development

    Energy Technology Data Exchange (ETDEWEB)

    Ohi, J.

    1996-12-31

    The author presents this paper with three main thrusts. The first is to discuss the implementation of renewable energy options in China, the second is to identify the key project development steps necessary to implement such programs, and finally is to develop recommendations in the form of key issues which must be addressed in developing such a program, and key technical assistance needs which must be addressed to make such a program practical.

  12. Renewable Energy in Latvia

    Energy Technology Data Exchange (ETDEWEB)

    Shipkovs, P.; Kashkarova, G. [Latvian Energy Agency, Riga (Latvia); Shipkovs, M. [Energy-R Ltd., Riga (Latvia)

    1997-12-31

    Latvia is among those countries that do not have gas, coal and, for the time being, also oil resources of its own. The amount of power produced in Latvia does not meet the demand, consequently a part of the power has to be purchased from neighbouring countries. Firewood, peat and hydro resources are the only significant domestic energy resources. Massive decrease of energy consumption has been observed since Latvia regained independence. Domestic and renewable energy resources have been examined and estimated. There are already 13 modern boiler houses operating in Latvia with total installed capacity 45 MW that are fired with wood chips. Latvian companies are involved in the production of equipment. 7 small HPPs have been renewed with the installed capacity 1.85 MW. Wind plant in Ainazi has started its operation, where two modern wind turbines with the capacity of 0.6 MW each have been installed. Mechanism of tariff setting is aligned. Favourable power energy purchasing prices are set for renewable energy sources and small cogeneration plants

  13. Effect of different binders and encapsulation techniques in the structure and functional properties of microdiets for fish larvae

    Directory of Open Access Journals (Sweden)

    Ana Grenha

    2014-05-01

    Full Text Available The improvement of micro diets, for fish larvae, has been a major challenge in past years; however some problems remain without a resolution. Besides its tremendous growth rates, at early developmental stages, fish larvae present an immature digestive system and a progressive metamorphic process that suggest special nutritional requirements. It is therefore essential to provide fish larvae with easy and/or quickly metabolized protein sources, like protein hydrolisates, high bioavailable forms of vitamins and trace minerals. The low molecular weight of such compounds, in association to the high surface area of the micro-particles, makes them highly soluble and prone to water leaching losses. These nutrient losses, not only makes these nutrients unavailable to the larvae, but originate an important increase of organic matter in the rearing tanks, leading to detrimental water quality criteria. The development of high-performing micro-particulate diets for fish larvae requires a delicate balance between an adequate quantitative and qualitative nutritional supply and good water stability of the feeds, without compromising the palatability and the digestive breakdown. A series of binders, protein-based (e.g. fish gelatin, wheat gluten, spray-dried plasma and carbohydrate-based (gums, alginates, pectins, starches, dextrin, polyols were incorporated at graded levels (1, 2.5 and 5% in a standard formulation for seabream larvae. Diets were manufactured by a proprietary low-shear extrusion process and afterwards processed to obtain a 200-400 micron fraction. All diets were analyzed for the following criteria: water leaching of nitrogenous compounds, turbidimetry and particle water stability. An additionally approach relied on the use of various encapsulation techniques (spray-drying, fluid-bed drying and vacuum coating to incorporate trace minerals (Zn and Mn and amino acids (taurine, lysine and methionine. Technological results show that the beneficial

  14. Renewable energy education in Turkey

    Energy Technology Data Exchange (ETDEWEB)

    Acikgoz, Caglayan [Department of Chemical and Process Engineering, Faculty of Engineering, Bilecik University, P.O.11030, Bilecik (Turkey)

    2011-02-15

    Utilization of renewable energy sources and the application of environmentally sound energy technologies are essential to sustainable development and will help to secure the quality of living and the well-being of the future generations. Turkey presently has considerable renewable energy sources. The most important renewable sources are hydropower, wind, solar, geothermal, and biomass. The use of renewable energy as a topic to study energy and its forms permits a novel way to motivate students, particularly those who energy topics taking conscience with the environment. This paper presents the analysis and classification of renewable energy sources and how to find out their origin and a way to motivate students in energy topics related to renewable sources and also, the development of didactic competencies in special blended learning arrangements for educationalists, trainers and lecturers in adult education in the field of renewable energies in Turkey. (author)

  15. Effects of binders on the electrochemical performance of rechargeable magnesium batteries

    Science.gov (United States)

    Wang, Nan; NuLi, Yanna; Su, Shuojian; Yang, Jun; Wang, Jiulin

    2017-02-01

    A comparative study on the effects of different binders on the electrochemical performance of rechargeable magnesium batteries with Mo6S8 cathode is conducted for the first time. The selected binders are commercial organic-soluble polyvinylidene fluoride (PVDF), water-soluble poly(acrylic acid) (PAA), poly(vinyl alcohol) (PVA), gelatin, sodium alginate (SA) and Beta-cyclodextrin (β-CD). The binders significantly affect the physical properties, thus the electrochemical performance of Mo6S8 cathode. Compared with those using traditional PVDF binder, Mo6S8 electrodes with PAA and PVA exhibit enhanced cycling stabilities and rate capabilities, which are attributed to the improved cohesion among the electrode constituents and adhesion between the electrode laminate and the current collector. In addition, the anodic stability of these binders is not only related to the chemical structure of binders, but also to the uniformity of electrode surface. SA binder shows low anodic stability duo to containing easily oxidized groups. Non-uniform electrode surface decreases the anodic stability of PVDF based Mo6S8 electrode. Gelatin can be used as a binder in the formulation of high voltage cathodes for rechargeable magnesium batteries.

  16. Setup of Columellar Height with Costal Cartilage Graft Modification in a Patient with Binder Syndrome

    Directory of Open Access Journals (Sweden)

    Şafak Uygur

    2016-03-01

    Full Text Available Binder syndrome is an uncommon disorder of unknown etiology. It is characterized by hypoplasia of the nose and maxilla and altered morphology of the associated soft tissue. We present a surgical technique for setting up the columellar height in a patient with Binder syndrome.

  17. 14 CFR 198.15 - Non-premium insurance-payment of registration binders.

    Science.gov (United States)

    2010-01-01

    ... OF TRANSPORTATION (CONTINUED) WAR RISK INSURANCE AVIATION INSURANCE § 198.15 Non-premium insurance... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Non-premium insurance-payment of...-premium insurance must be accompanied by the proper binder, payable to the FAA. A binder is not...

  18. Evaluation of bitumen-rubber asphalt manufactured from modified binder at lower viscosity

    CSIR Research Space (South Africa)

    O'Connell, Johannes S

    2010-08-01

    Full Text Available In South Africa, crumb tyre-modified bitumen commnly known as bitumen-rubber binder has viscosity limits specified by the current edition of TG1: The Use of Modified Bituminous Binders in Road Construction. As the crumb rubber is 'digested...

  19. The influence of metakaolin substitution by slag in alkali-activated inorganic binders for civil engineering

    Science.gov (United States)

    Kadlec, J.; Rieger, D.; Kovářík, T.; Novotný, P.; Franče, P.; Pola, M.

    2017-02-01

    In this study the effect of metakaolin replacement by milled blast furnace slag in alkali-activated geopolymeric binder was investigated in accordance to their rheological and mechanical properties. It was demonstrated that slag addition into the metakaolin binder can improve mechanical properties of final products. Our investigation was focused on broad interval of metakaolin substitution in the range from 100 to 40 volume per cents of metakaolin so that the volume content of solids in final binder was maintained constant. Prepared binders were activated by alkaline solution of potassium silicate with silicate module of 1.61. The particle size analyses were performed for determination of particle size distribution. The rheological properties were determined in accordance to flow properties by measurements on Ford viscosity cup and by oscillatory measurements of hardening process. For the investigation of hardening process, the strain controlled small amplitude oscillatory rheometry was used in plane-plate geometry. For determination of applied mechanical properties were binders filled by ceramic grog in the granularity range 0-1 mm. The filling was maintained constant at 275 volume per cents in accordance to ratio of solids in dry binder. The mechanical properties were investigated after 1, 7 and 28 days and microstructure was documented by scanning electron microscopy. The results indicate that slag addition have beneficial effect not only on mechanical properties of hardened binder but also on flow properties of fresh geopolymer paste and subsequent hardening kinetics of alkali-activated binders.

  20. Binder-Free and Carbon-Free Nanoparticle Batteries: A Method for Nanoparticle Electrodes without Polymeric Binders or Carbon Black

    KAUST Repository

    Ha, Don-Hyung

    2012-10-10

    In this work, we have developed a new fabrication method for nanoparticle (NP) assemblies for Li-ion battery electrodes that require no additional support or conductive materials such as polymeric binders or carbon black. By eliminating these additives, we are able to improve the battery capacity/weight ratio. The NP film is formed by using electrophoretic deposition (EPD) of colloidally synthesized, monodisperse cobalt NPs that are transformed through the nanoscale Kirkendall effect into hollow Co 3O 4. EPD forms a network of NPs that are mechanically very robust and electrically connected, enabling them to act as the Li-ion battery anode. The morphology change through cycles indicates stable 5-10 nm NPs form after the first lithiation remained throughout the cycling process. This NP-film battery made without binders and conductive additives shows high gravimetric (>830 mAh/g) and volumetric capacities (>2100 mAh/cm 3) even after 50 cycles. Because similar films made from drop-casting do not perform well under equal conditions, EPD is seen as the critical step to create good contacts between the particles and electrodes resulting in this significant improvement in battery electrode assembly. This is a promising system for colloidal nanoparticles and a template for investigating the mechanism of lithiation and delithiation of NPs. © 2012 American Chemical Society.

  1. Production of Steel Casts in Two-Layer Moulds with Alkaline Binders Part 1. Backing sand with the alkaline inorganic binder RUDAL

    Directory of Open Access Journals (Sweden)

    M. Holtzer

    2011-04-01

    Full Text Available Steel casts in Z.N. POMET were produced in moulds made of the moulding sand Floster. This sand did not have good knocking outproperties, required a significant binder addition (4.5-5.0 parts by weight, and the casting surface quality gave rise to clients objections.Therefore a decision of implementing two-layer moulds, in which the facing sand would consist of the moulding sand with an alkalineorganic binder while the backing sand would be made of the moulding sand with an inorganic binder also of an alkaline character - wasundertaken. The fraction of this last binder in the moulding sand mass would be smaller than that of the binder used up to now (waterglass. The application of two moulding sands of the same chemical character (highly alkaline should facilitate the reclamation processand improve the obtained reclaimed material quality, due to which it would be possible to increase the reclaim fraction in the mouldingsand (up to now it was 50%. The results of the laboratory investigations of sands with the RUDAL binder are presented in the paper.

  2. Investigation of binder distribution in graphite anodes for lithium-ion batteries

    Science.gov (United States)

    Müller, Marcus; Pfaffmann, Lukas; Jaiser, Stefan; Baunach, Michael; Trouillet, Vanessa; Scheiba, Frieder; Scharfer, Philip; Schabel, Wilhelm; Bauer, Werner

    2017-02-01

    Energy dispersive x-ray spectroscopy (EDS) is evaluated regarding its applicability for revealing the binder distribution in lithium-ion battery electrode films. Graphite anodes comprising carbon black and PVDF binder are subject to varying drying conditions during solvent removal in order to adjust different binder distributions; fluorine is used as a marker for the presence of PVDF. For electrodes of about 70 μm thickness the fluorine concentration is detected at the surface of the electrode film as well as at the interface between electrode film and current collector foil. It is clearly visible by EDS that increasing drying temperatures (and drying rates) result in an accumulation of binder at the surface and a corresponding depletion at the interface. It is demonstrated on the basis of ion-milled cross-sections of thick electrodes (ca. 400 μm) that a quantitative mapping of the binder distribution delivers additional information about concentration gradients in dependence of the drying parameters.

  3. Study of chloride ion transport of composite by using cement and starch as a binder

    Energy Technology Data Exchange (ETDEWEB)

    Armynah, Bidayatul; Halide, Halmar; Zahrawani,; Reski, Nurhadi; Tahir, Dahlang, E-mail: dtahir@fmipa.unhas.ac.id [Department of Physics, Hasanuddin University, Makassar 90245 Indonesia (Indonesia)

    2016-03-11

    This study presents the chemical bonding and the structural properties of composites from accelerator chloride test migration (ACTM). The volume fractions between binder (cement and starch) and charcoal in composites are 20:80 and 60:40. The effect of the binder to the chemical composition, chemical bonding, and structural properties before and after chloride ion passing through the composites was determined by X-ray fluorescence (XRF), by Fourier transform infra-red (FTIR), and x-ray diffraction (XRD), respectively. From the XRD data, XRF data, and the FTIR data shows the amount of chemical composition, the type of binding, and the structure of composites are depending on the type of binder. The amount of chloride migration using starch as binder is higher than that of cement as a binder due to the density effects.

  4. Flexible Paper Electrodes for Li-Ion Batteries Using Low Amount of TEMPO-Oxidized Cellulose Nanofibrils as Binder.

    Science.gov (United States)

    Lu, Huiran; Behm, Mårten; Leijonmarck, Simon; Lindbergh, Göran; Cornell, Ann

    2016-07-20

    Flexible Li-ion batteries attract increasing interest for applications in bendable and wearable electronic devices. TEMPO-oxidized cellulose nanofibrils (TOCNF), a renewable material, is a promising candidate as binder for flexible Li-ion batteries with good mechanical properties. Paper batteries can be produced using a water-based paper making process, avoiding the use of toxic solvents. In this work, finely dispersed TOCNF was used and showed good binding properties at concentrations as low as 4 wt %. The TOCNF was characterized using atomic force microscopy and found to be well dispersed with fibrils of average widths of about 2.7 nm and lengths of approximately 0.1-1 μm. Traces of moisture, trapped in the hygroscopic cellulose, is a concern when the material is used in Li-ion batteries. The low amount of binder reduces possible moisture and also increases the capacity of the electrodes, based on total weight. Effects of moisture on electrochemical battery performance were studied on electrodes dried at 110 °C in a vacuum for varying periods. It was found that increased drying time slightly increased the specific capacities of the LiFePO4 electrodes, whereas the capacities of the graphite electrodes decreased. The Coulombic efficiencies of the electrodes were not much affected by the varying drying times. Drying the electrodes for 1 h was enough to achieve good electrochemical performance. Addition of vinylene carbonate to the electrolyte had a positive effect on cycling for both graphite and LiFePO4. A failure mechanism observed at high TOCNF concentrations is the formation of compact films in the electrodes.

  5. Development of partitioning method: adsorption behavior of Sr on titanic acid pelletized with binder

    Energy Technology Data Exchange (ETDEWEB)

    Mizoguchi, Kenichi; Yamaguchi, Isoo; Morita, Yasuji; Yamagishi, Isao; Fujiwara, Takeshi; Kubota, Masumitsu [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    1998-05-01

    The adsorption behavior of Sr was examined with the titanic acid with the binder and with binderless titanic acid. Then the effect of the difference of the neutralizer was also examined. When the initial concentration of Sr was constant, distribution coefficient (Kd) increased with pH after adsorption. At pH 4, Kd decreased in order of the titanic acid neutralized with NH{sub 4}OH solution without the binder > the titanic acid neutralized with NH{sub 4}OH solution and pelletized with the binder > the titanic acid neutralized with KOH solution and pelletized with the binder. At pH 6, Kd decreased with increasing the concentration of Sr in the solution, but the decreasing tendency of Kd for each titanic acid was the same. Adsorption kinetics was examined with titanic acids neutralized with NH{sub 4}OH solution, keeping the initial concentration of Sr and the initial pH constant. It took about one hour to reach Kd of 100mL/g for the titanic acid without the binder but over 10 hours for the titanic acid pelletized with the binder. It was confirmed that by pelletizing titanic acid with the binder, Kd of Sr became small and it took very long time to reach the adsorption equilibrium. However, by sufficient conditioning with water of the titanic acid pelletized with the binder, 1) it took about half time of titanic acid without conditioning to reach Kd of 100mL/g, 2) after 24 hours mixing, Kd for the titanic acid pelletized with the binder was almost equal to that for the titanic acid without the binder, 3) apparent ion exchange capacity obtained through a column test became over about 1meq/g. (J.P.N.)

  6. Regional Renewable Energy Cooperatives

    Science.gov (United States)

    Hazendonk, P.; Brown, M. B.; Byrne, J. M.; Harrison, T.; Mueller, R.; Peacock, K.; Usher, J.; Yalamova, R.; Kroebel, R.; Larsen, J.; McNaughton, R.

    2014-12-01

    We are building a multidisciplinary research program linking researchers in agriculture, business, earth science, engineering, humanities and social science. Our goal is to match renewable energy supply and reformed energy demands. The program will be focused on (i) understanding and modifying energy demand, (ii) design and implementation of diverse renewable energy networks. Geomatics technology will be used to map existing energy and waste flows on a neighbourhood, municipal, and regional level. Optimal sites and combinations of sites for solar and wind electrical generation (ridges, rooftops, valley walls) will be identified. Geomatics based site and grid analyses will identify best locations for energy production based on efficient production and connectivity to regional grids and transportation. Design of networks for utilization of waste streams of heat, water, animal and human waste for energy production will be investigated. Agriculture, cities and industry produce many waste streams that are not well utilized. Therefore, establishing a renewable energy resource mapping and planning program for electrical generation, waste heat and energy recovery, biomass collection, and biochar, biodiesel and syngas production is critical to regional energy optimization. Electrical storage and demand management are two priorities that will be investigated. Regional scale cooperatives may use electric vehicle batteries and innovations such as pump storage and concentrated solar molten salt heat storage for steam turbine electrical generation. Energy demand management is poorly explored in Canada and elsewhere - our homes and businesses operate on an unrestricted demand. Simple monitoring and energy demand-ranking software can easily reduce peaks demands and move lower ranked uses to non-peak periods, thereby reducing the grid size needed to meet peak demands. Peak demand strains the current energy grid capacity and often requires demand balancing projects and

  7. Introduction to renewable energy

    CERN Document Server

    Nelson, Vaughn C

    2011-01-01

    IntroductionEnergy and SocietyTypes of EnergyRenewable EnergyAdvantages/DisadvantagesEconomicsGlobal WarmingOrder of Magnitude EstimatesGrowth (Exponential)SolutionsEnergyIntroductionDefinition of Energy and PowerHeatThermodynamicsEnergy Dilemma in Light of the Laws of ThermodynamicsUse of Fossil FuelsNuclearFinite ResourceSummarySunSolar PowerElectromagnetic SpectrumEnergy Balance of the EarthEarth-Sun MotionInsolationSolar ResourceGreenhouse EffectHeat Transfer and StorageIntroductionConductionConvectionRadiationThermal MassSeasonal Heating or CoolingThermal ComfortSolar Heating and CoolingB

  8. Renewables | Energies renouvelables

    Directory of Open Access Journals (Sweden)

    2012-05-01

    Full Text Available World Energy Generated for Commercial Use by Type*Production mondiale d’énergie destinée à des applications commerciales, par type*­Main ProducersPrincipaux producteurs* Renewables also include biomass, yet most of it is used for energy generation for non-commercial purposes. | Les énergies renouvelables incluent la biomasse, mais celle-ci sert essentiellement à générer de l’énergie qui ne rentre pas dans les circuits commerciaux.Source: British Petroleum, BP Statistical Review of World Energ...

  9. Renewable Energy Opportunity Assessment

    Energy Technology Data Exchange (ETDEWEB)

    Hancock, Ed [National Renewable Energy Lab. (NREL), Golden, CO (United States); Mas, Carl [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    1998-11-13

    Presently, the US EPA is constructing a new complex at Research Triangle Park, North Carolina to consolidate its research operations in the Raleigh-Durham area. The National Computer Center (NCC) is currently in the design process and is planned for construction as part of this complex. Implementation of the new technologies can be planned as part of the normal construction process, and full credit for elimination of the conventional technologies can be taken. Several renewable technologies are specified in the current plans for the buildings. The objective of this study is to identify measures that are likely to be both technically and economically feasible.

  10. Fracture properties of concrete specimens made from alkali activated binders

    Science.gov (United States)

    Šimonová, Hana; Kucharczyková, Barbara; Topolář, Libor; Bílek, Vlastimil, Jr.; Keršner, Zbyněk

    2017-09-01

    The aim of this paper is to quantify crack initiation and other fracture properties – effective fracture toughness and specific fracture energy – of two types of concrete with an alkali activated binder. The beam specimens with a stress concentrator were tested in a three-point bending test after 28, 90, and 365 days of maturing. Records of fracture tests in the form of load versus deflection (P–d) diagrams were evaluated using effective crack model and work-of-fracture method and load versus mouth crack opening displacement (P–CMOD) diagrams were evaluated using the Double-K fracture model. The initiation of cracks during the fracture tests for all ages was also monitored by the acoustic emission method. The higher value of monitored mechanical fracture parameters of concrete with alkali activated blast furnace slag were achieved with substitution blast furnace slag by low calcium fly ash in comparison with substitution by cement kiln dust.

  11. Thermal Degradation Studies of A Polyurethane Propellant Binder

    Energy Technology Data Exchange (ETDEWEB)

    Assink, R.A.; Celina, M.; Gillen, K.T.; Graham, A.C.; Minier, L.M.

    1999-06-12

    The thermal oxidative aging of a crosslinked hydroxy-terminated polybutadiene (HTPB)/isophorone diisocyanate (IPDI) based polyurethane rubber, used as a polymeric binder in solid propellant grain, was investigated at temperatures from 25 C to 125 C. The changes in tensile elongation, polymer network properties and chain dynamics, mechanical hardening and density were determined with a range of techniques including modulus profiling, solvent swelling, NMR relaxation and O{sub 2} permeability measurements. We critically evaluated the Arrhenius methodology that is commonly used with a linear extrapolation of high temperature aging data using extensive data superposition and highly sensitive oxygen consumption experiments. The effects of other constituents in the propellant formulation on aging were also investigated. We conclude that crosslinking is the dominant process at higher temperatures and that the degradation involves only limited hardening in the bulk of the material. Significant curvature in the Arrhenius diagram of the oxidation rates was observed. This is similar to results for other rubber materials.

  12. Thermal Degradation Studies of A Polyurethane Propellant Binder

    Energy Technology Data Exchange (ETDEWEB)

    Assink, R.A.; Celina, M.; Gillen, K.T.; Graham, A.C.; Minier, L.M.

    1999-06-12

    The thermal oxidative aging of a crosslinked hydroxy-terminated polybutadiene (HTPB)/isophorone diisocyanate (IPDI) based polyurethane rubber, used as a polymeric binder in solid propellant grain, was investigated at temperatures from 25 C to 125 C. The changes in tensile elongation, polymer network properties and chain dynamics, mechanical hardening and density were determined with a range of techniques including modulus profiling, solvent swelling, NMR relaxation and O{sub 2} permeability measurements. We critically evaluated the Arrhenius methodology that is commonly used with a linear extrapolation of high temperature aging data using extensive data superposition and highly sensitive oxygen consumption experiments. The effects of other constituents in the propellant formulation on aging were also investigated. We conclude that crosslinking is the dominant process at higher temperatures and that the degradation involves only limited hardening in the bulk of the material. Significant curvature in the Arrhenius diagram of the oxidation rates was observed. This is similar to results for other rubber materials.

  13. Zeolite and bentonite as caesium binders in reindeer feed

    Directory of Open Access Journals (Sweden)

    Birgitta Åhman

    1990-09-01

    Full Text Available The effects of zeolite and bentonite on the accumulation and excretion of radiocaesium (Cs-137 in reindeer were studied in two feeding experiments. Six animals in each experiment were given lichens contaminated with radiocaesium from fallout after the Chernobyl nuclear power plant accident. In addition, they were fed pellets containing bentonite (Experiment I or zeolite (Experiment II. Two animals, controls, in each experiment received no caesium-binder. The activity concentration of radiocaesium in blood was used to evalute the radiocaesium level in the body. Faeces and urine were collected to measue the excration of radiocaesium. The animals in Experiment I were depleted of radiocaesium before the start of the experiment. After three weeks, with an intake of 17 - 18 kBq Cs-137/day, the controls had reached activity concentrations of radiocaesium in blood corresponding to 4 - 4.5 kBq Cs-137/kg in muscle. Reindeer fed 23 or 46 g of bentonite per day stabilized at values below 0.8 kfiq/kg in muscle. In Experiment II, the reindeer started with radiocaesium activity concentrations in blood corresponding to 2 - 4.5 kBq Cs-137/kg in muscle. After four weeks of feeding, with an intake at about 8.5 kBq Cs-137/day, controls had increased their radiocaesium values by an average of 40%. Reindeer receiving 25 or 50 g zeolite per day decreased with 18 and 45%, respectively. Net absorption of radiocaesium from the gastro-intestinal tract was calculated at 50 -70% in animals receiving no caesium-binder. Reindeer fed bentonite had an absorption below 10% while those fed zeolite absorbed around 35%.

  14. Pharmaceutical equivalence of metformin tablets with various binders

    Directory of Open Access Journals (Sweden)

    L. C. Block

    2009-01-01

    Full Text Available

    Metformin hydrochloride is a high-dose drug widely used as an oral anti-hyperglycemic agent. As it is highly crystalline and has poor compaction properties, it is difficult to form tablets by direct compression. The aim of this study was to develop adequate metformin tablets, pharmaceutically equivalent to the reference product, Glucophage® (marketed as Glifage® in Brazil. Metformin 500mg tablets were produced by wet granulation with various binders (A = starch, B = starch 1500®, C = PVP K30®, D = PVP K90®. The tablets were analyzed for their hardness, friability, disintegration, dissolution, content uniformity and dissolution profile (basket apparatus at 50 rpm, pH 6.8 phosphate buffer. The 4 formulations, F1 (5% A and 5% C, F2 (5% B and 5% C, F3 (10% C and F4 (5% D, demonstrated adequate uniformity of content, hardness, friability, disintegration and total drug dissolution after 30 minutes (F1, F2 and F4, and after 60 minutes (F3. The drug release time profiles fitted a Higuchi model (F1, F2 and F3, similarly to the pharmaceutical reference, or a zero order model (F4. The dissolution efficiency for all the formulations was 75%, except for F3 (45%. F1 and F2 were thus equivalent to Glifage®. Keywords: dissolution; metformin; tablet; binder; pharmaceutical equivalence

  15. Modeling of human prokineticin receptors: interactions with novel small-molecule binders and potential off-target drugs.

    Directory of Open Access Journals (Sweden)

    Anat Levit

    Full Text Available BACKGROUND AND MOTIVATION: The Prokineticin receptor (PKR 1 and 2 subtypes are novel members of family A GPCRs, which exhibit an unusually high degree of sequence similarity. Prokineticins (PKs, their cognate ligands, are small secreted proteins of ∼80 amino acids; however, non-peptidic low-molecular weight antagonists have also been identified. PKs and their receptors play important roles under various physiological conditions such as maintaining circadian rhythm and pain perception, as well as regulating angiogenesis and modulating immunity. Identifying binding sites for known antagonists and for additional potential binders will facilitate studying and regulating these novel receptors. Blocking PKRs may serve as a therapeutic tool for various diseases, including acute pain, inflammation and cancer. METHODS AND RESULTS: Ligand-based pharmacophore models were derived from known antagonists, and virtual screening performed on the DrugBank dataset identified potential human PKR (hPKR ligands with novel scaffolds. Interestingly, these included several HIV protease inhibitors for which endothelial cell dysfunction is a documented side effect. Our results suggest that the side effects might be due to inhibition of the PKR signaling pathway. Docking of known binders to a 3D homology model of hPKR1 is in agreement with the well-established canonical TM-bundle binding site of family A GPCRs. Furthermore, the docking results highlight residues that may form specific contacts with the ligands. These contacts provide structural explanation for the importance of several chemical features that were obtained from the structure-activity analysis of known binders. With the exception of a single loop residue that might be perused in the future for obtaining subtype-specific regulation, the results suggest an identical TM-bundle binding site for hPKR1 and hPKR2. In addition, analysis of the intracellular regions highlights variable regions that may provide

  16. Renewable energy development in China

    Energy Technology Data Exchange (ETDEWEB)

    Junfeng, Li

    1996-12-31

    This paper presents the resources availability, technologies development and their costs of renewable energies in China and introduces the programs of renewable energies technologies development and their adaptation for rural economic development in China. As the conclusion of this paper, renewable energies technologies are suitable for some rural areas, especially in the remote areas for both household energy and business activities energy demand. The paper looks at issues involving hydropower, wind energy, biomass combustion, geothermal energy, and solar energy.

  17. PROSPECTS OF RENEWED POWER

    Directory of Open Access Journals (Sweden)

    Dizendorf A. V.

    2015-12-01

    Full Text Available The article considers the main types of wind and solar electric installations, and provides a comparative analysis of the renewable energy potential of the Krasnodar region. Currently, humankind cannot live without electricity. Production and consumption of electricity is constantly increasing and the cost of it is constantly becoming more expensive. The cost of oil production (to get oil out of the ground increases. The cost of electricity is going up because the cost of basic materials such as copper is at an unprecedented high. Such alternatives energy sources such as solar and wind are real solutions to these problems, moreover, the cost of "traditional" energy sources will only increase. To date, the most popular and invest renewable energy sources are the solar energy and the wind. The solar energy in the Krasnodar region is more profitable than wind, despite the fact that the production of solar installations is more expensive. But every year, the price of solar energy is being reduced and soon will be equal to the price of wind energy, and science and technology do not stand still, and considering the abundance of sunlight in the Krasnodar region, the solar installation will pay off much faster

  18. Time-dependent deformation behavior of polyvinylidene fluoride binder: Implications on the mechanics of composite electrodes

    Science.gov (United States)

    Santimetaneedol, Arnuparp; Tripuraneni, Rajasekhar; Chester, Shawn A.; Nadimpalli, Siva P. V.

    2016-11-01

    The majority of existing battery models that simulate composite electrode behavior assume the binder as a linear elastic material due to lack of a thorough understanding of time-dependent mechanical behavior of binders. Here, thin films of polyvinylidene fluoride binder, prepared according to commercial battery manufacturing method, are subjected to standard monotonic, load-unload, and relaxation tests to characterize the time-dependent mechanical behavior. The strain in the binder samples is measured with the digital image correlation technique to eliminate experimental errors. The experimental data showed that for (charging/discharging) time scales of practical importance, polyvinylidene fluoride behaves more like an elastic-viscoplastic material as opposed to a visco-elastic material; based on this observation, a simple elastic-viscoplastic model, calibrated against the data is adopted to represent the deformation behavior of binder in a Si-based composite electrode; the lithiation/delithiation process of this composite was simulated at different C rates and the stress/strain behavior was monitored. It is observed that the linear elastic assumption of the binder leads to inaccurate results and the time-dependent constitutive behavior of the binder not only leads to accurate prediction of the mechanics but is an essential step towards developing advanced multi-physics models for simulating the degradation behavior of batteries.

  19. Characterization of zirconia-based slurries with different binders for titanium investment casting

    Directory of Open Access Journals (Sweden)

    Zhao Ertuan

    2012-05-01

    Full Text Available The materials and physical properties of primary slurry are crucial to the surface quality of the finished castings, especially for high reactivity titanium alloys. The aim of this study is to investigate the influence of different binders on the physical properties of primary slurry for titanium alloy investment casting. The zirconia-based slurries with different binders were evaluated by comparing the parameters: viscosity, bulk density, plate weight, suspensibility, gel velocity and strength. The results indicate that a higher viscosity of binder leads to a higher viscosity and suspensibility of slurry with the same powder/binder ratio. The retention rate and thickness of primary layer increase with an increase in the viscosity of the slurry, and a higher retention rate is associated with a thicker primary layer. The gel velocity of the slurry is correlated with the gel velocity of the binder. The green strength and the baked strength of the primary layer are determined by the properties of the binder after gel and by the production of the binder after fired, respectively.

  20. Application of Microbial Biopolymers as an Alternative Construction Binder for Earth Buildings in Underdeveloped Countries

    Directory of Open Access Journals (Sweden)

    Ilhan Chang

    2015-01-01

    Full Text Available Earth buildings are still a common type of residence for one-third of the world’s population. However, these buildings are not durable or resistant against earthquakes and floods, and this amplifies their potential harm to humans. Earthen construction without soil binders (e.g., cement is known to result in poor strength and durability performance of earth buildings. Failure to use construction binders is related to the imbalance in binder prices in different countries. In particular, the price of cement in Africa, Middle East, and Southwest Asia countries is extremely high relative to the global trend of consumer goods and accounts for the limited usage of cement in those regions. Moreover, environmental concerns regarding cement usage have recently risen due to high CO2 emissions. Meanwhile, biopolymers have been introduced as an alternative binder for soil strengthening. Previous studies and feasibility attempts in this area show that the mechanical properties (i.e., compressive strength of biopolymer mixed soil blocks (i.e, both 1% xanthan gum and 1% gellan gum satisfied the international criteria for binders used in earthen structures. Economic and market analyses have demonstrated that the biopolymer binder has high potential as a self-sufficient local construction binder for earth buildings where the usage of ordinary cement is restricted.

  1. Comparison of cathode catalyst binders for the hydrogen evolution reaction in microbial electrolysis cells

    KAUST Repository

    Ivanov, Ivan

    2017-06-02

    Nafion is commonly used as a catalyst binder in many types of electrochemical cells, but less expensive binders are needed for the cathodes in microbial electrolysis cells (MECs) which are operated in neutral pH buffers, and reverse electrodialysis stacks (RED),which use thermolytic solutions such as ammonium bicarbonate. Six different binders were examined based on differences in ion exchange properties (anionic: Nafion, BPSH20, BPSH40, S-Radel; cationic: Q-Radel; and neutral: Radel, BAEH) and hydrophobicity based on water uptake (0%, Radel; 17–56% for the other binders). BPSH40 had similar performance to Nafion based on steady-state polarization single electrode experiments in a neutral pH phosphate buffer, and slightly better performance in ammonium bicarbonate. Three different Mo-based catalysts were examined as alternatives to Pt, with MoB showing the best performance under steady-state polarization. In MECs, MoB/BPSH40 performed similarly to Pt with Nafion or Radel binders. The main distinguishing feature of the BPSH40 was that it is very hydrophilic, and thus it had a greater water content (56%) than the other binders (0–44%). These results suggest the binders for hydrogen evolution in MECs should be designed to have a high water content without sacrificing ionic or electronic conductivity in the electrode.

  2. Experimental evaluation on high temperature rheological properties of various fiber modified asphalt binders

    Institute of Scientific and Technical Information of China (English)

    陈筝; 吴少鹏; 朱祖煌; 刘杰胜

    2008-01-01

    High temperature rheological properties of fiber modified asphalt binders and impact of the type and content on such properties were studied.Three types of fiber,including polyester(PET),polyacrylonitrile(PAN) and cellulose(CEL),a control content(0%) and four levels of fiber content(2%,4%,6% and 8% by total asphalt binder mass) were used with asphalt binders.The high temperature rheological properties,consisting of complex modulus(G*) and phase angle δ,were measured using SHRP’s dynamic shear rheometer(DSR) between 46-82 ℃.Experimental results indicate that the changes of G* and tan δ of fiber modified asphalt binders with the increase of test temperature tend to slow down,and the temperature susceptibility is improved obviously compared to that of original asphalt binder.Fiber modification results in the increase of rutting parameter(G*/sin δ) at high temperatures,the decrease of temperature susceptibility,and further improved high temperature performance of asphalt binder.An excellent correlation exhibits between fiber content and high temperature performance of asphalt binder.Moreover,fiber type also has different influences on the improvement of G*/sin δ,G*/sin δ of PET and PAN fiber asphalt binders are both higher than that of CEL fiber,but G*/sin δ of CEL fiber is still higher than that of original asphalt.However,there is a critical fiber content when fibers start to interact with each other.Therefore,based on the critical fiber content and economic consideration,the optimum fiber contents for various fiber-modified asphalt binders are obtained.

  3. Shear resistance properties of TPS modified bitumen binders and asphalt mixtures

    Institute of Scientific and Technical Information of China (English)

    曹庭维; 吴少鹏; 刘聪慧; 张涛

    2008-01-01

    Shear resistance properties of the virgin bitumen and modified bitumen binders with Tafpack Super(TPS) modifier and SBS modified bitumen were discussed.Dynamic shear rheometer(DSR) was used to measure the laboratory creep data for these binders over a wide range of constant shear stresses at 20 ℃ to characterize the shear creep behaviors of all kinds of asphalt binders,and the rutting test system was used to investigate the permanent deformation of porous asphalt mixtures using the above bitumen binders for a fixed compressive stress.The shear strain rate and shear creep modulus were used to characterize the shear creep behavior of the TPS modified bitumen,and the rutting test results were used to show the consistency of porous asphalt mixtures with the bitumen binders.Results indicate that a distinction of shear creep strain can be made among different contents of TPS modified bitumen at the same stress level,where the shear creep strain-time response curve of the SBS modified bitumen binder is between the curves of the 8% TPS and 12% TPS modified bitumen binders.The shear strain rate and the shear creep modulus of the TPS modified bitumen binders are obtained to compare with those of the SBS modified bitumen binder which results in the same trend as the shear creep strain-time response curve.Permanent deformation results of all the porous asphalt mixtures from the rutting test show reasonable agreement with the findings of the shear strain rates and shear creep modulus over the range of shear stress levels.

  4. EDITORIAL: Renewing energy technology Renewing energy technology

    Science.gov (United States)

    Demming, Anna

    2011-06-01

    Renewable energy is now a mainstream concern among businesses and governments across the world, and could be considered a characteristic preoccupation of our time. It is interesting to note that many of the energy technologies currently being developed date back to very different eras, and even predate the industrial revolution. The fuel cell was first invented as long ago as 1838 by the Swiss--German chemist Christian Friedrich Schönbein [1], and the idea of harnessing solar power dates back to ancient Greece [2]. The enduring fascination with new means of harnessing energy is no doubt linked to man's innate delight in expending it, whether it be to satisfy the drive of curiosity, or from a hunger for entertainment, or to power automated labour-saving devices. But this must be galvanized by the sustained ability to improve device performance, unearthing original science, and asking new questions, for example regarding the durability of photovoltaic devices [3]. As in so many fields, advances in hydrogen storage technology for fuel cells have benefited significantly from nanotechnology. The idea is that the kinetics of hydrogen uptake and release may be reduced by decreasing the particle size. An understanding of how effective this may be has been hampered by limited knowledge of the way the thermodynamics are affected by atom or molecule cluster size. Detailed calculations of individual atoms in clusters are limited by computational resources as to the number of atoms that can studied, and other innovative approaches that deal with force fields derived by extrapolating the difference between the properties of clusters and bulk matter require labour-intensive modifications when extending such studies to new materials. In [4], researchers in the US use an alternative approach, considering the nanoparticle as having the same crystal structure as the bulk but relaxing the few layers of atoms near the surface. The favourable features of nanostructures for catalysis

  5. Influence of microcrystalline wax on properties of MIM multi-component wax matrix binder

    Institute of Scientific and Technical Information of China (English)

    张健; 黄伯云; 李益民; 李松林

    2002-01-01

    The properties of PW-EVA-HDPE binder with the addition of MW were studied. It shows that the addition of MW from 1% to 20%(mass fraction) causes an increase in the tensile strength and a decrease in shrinkage of the binder. After blending PW with MW, the crystallation behavior of wax base changes, which results in fine grain for the binder and more isotropic microstructure for the feedstock. The powder loading capacity increases and homogeneity of feedstock becomes better. The reason of the modification is also discussed.

  6. Polyolefin Backbone Substitution in Binders for Low Temperature Powder Injection Moulding Feedstocks

    Directory of Open Access Journals (Sweden)

    Berenika Hausnerova

    2014-02-01

    Full Text Available This paper reports the substitution of polyolefin backbone binder components with low melting temperature carnauba wax for powder injection moulding applications. The effect of various binder compositions of Al2O3 feedstock on thermal degradation parameters is investigated by thermogravimetric analysis. Within the experimental framework 29 original feedstock compositions were prepared and the superiority of carnauba wax over the polyethylene binder backbone was demonstrated in compositions containing polyethylene glycol as the initial opening agent and governing the proper mechanism of the degradation process. Moreover, the replacement of synthetic polymer by the natural wax contributes to an increase of environmental sustainability of modern industrial technologies.

  7. Burn Rate Studies on AN-Based Propellants: Effect of N-N Bonded Binders.

    Directory of Open Access Journals (Sweden)

    C. Oommen

    1996-12-01

    Full Text Available New epoxy resins having N-N bonds in their structures have been employed as binders for ammonium nitrate (AN-based propellants. The resins have been characterized by various analytical techniques. The effect of the new binders on the burn rates of AN-based compositions including the metallized systems has been examined. The overall enhancement in the burn rate, as compared to that observed with conventional binders, has been explained in terms of the combustion reactivity of the N-N bondwiththe oxidizing speciesproduced duringcombustion. Furtherincreasein burn rate canbe achieved by inclusion of magnesium metal or ammonium perchlorate into these compositions.

  8. Do aluminium-based phosphate binders continue to have a role in contemporary nephrology practice?

    Science.gov (United States)

    Mudge, David W; Johnson, David W; Hawley, Carmel M; Campbell, Scott B; Isbel, Nicole M; van Eps, Carolyn L; Petrie, James J B

    2011-05-13

    Aluminium-containing phosphate binders have long been used for treatment of hyperphosphatemia in dialysis patients. Their safety became controversial in the early 1980's after reports of aluminium related neurological and bone disease began to appear. Available historical evidence however, suggests that neurological toxicity may have primarily been caused by excessive exposure to aluminium in dialysis fluid, rather than aluminium-containing oral phosphate binders. Limited evidence suggests that aluminium bone disease may also be on the decline in the era of aluminium removal from dialysis fluid, even with continued use of aluminium binders. The K/DOQI and KDIGO guidelines both suggest avoiding aluminium-containing binders. These guidelines will tend to promote the use of the newer, more expensive binders (lanthanum, sevelamer), which have limited evidence for benefit and, like aluminium, limited long-term safety data. Treating hyperphosphatemia in dialysis patients continues to represent a major challenge, and there is a large body of evidence linking serum phosphate concentrations with mortality. Most nephrologists agree that phosphate binders have the potential to meaningfully reduce mortality in dialysis patients. Aluminium is one of the cheapest, most effective and well tolerated of the class, however there are no prospective or randomised trials examining the efficacy and safety of aluminium as a binder. Aluminium continues to be used as a binder in Australia as well as some other countries, despite concern about the potential for toxicity. There are some data from selected case series that aluminium bone disease may be declining in the era of reduced aluminium content in dialysis fluid, due to rigorous water testing. This paper seeks to revisit the contemporary evidence for the safety record of aluminium-containing binders in dialysis patients. It puts their use into the context of the newer, more expensive binders and increasing concerns about the risks of

  9. The curious case of zeolite-clay/binder interactions and their consequences for catalyst preparation

    OpenAIRE

    Whiting, Gareth T.; Chowdhury, Abhishek Dutta; Oord, R. van; Paalanen, Pasi; Weckhuysen, Bert M.

    2016-01-01

    Zeolite-based catalyst bodies are commonly employed in a range of important industrial processes. Depending on the binder and shaping method chosen, vast differences in the reactivity, selectivity and stability are obtained. Here, three highly complementary micro-spectroscopic techniques were employed to study zeolite ZSM-5-binder interactions in SiO2-, Al2O3-, SiO2 : Al2O3- (2 : 1 mix) and kaolinite-bound catalyst pellets. We establish how their preparation influences the zeolite-clay/binder...

  10. Study on catalysis effect of TEPB on the curing reaction of HTPB binder system

    Science.gov (United States)

    Chang, S. J.; Tang, J.; Liu, X.; Yan, W.

    2016-07-01

    The catalysis effect of tri (exhoxyphenyl) bismuthine (TEPB) on the curing reaction of HTPB binder system was studied by using DSC method. The curing peak temperatures of the catalyst systems were measured to calculate kinetic parameters by using Kissinger and Crane methods, respectively. Two curing reaction kinetic equations were established. The results show that TEPB has high catalytic activity and can decrease the curing temperature of HTPB binder system, down to 35 °C, in which the optimum volume of TEPB is 0.5% of HTPB binder system.

  11. Influence of crumb rubber and digestion time on the asphalt rubber binders

    OpenAIRE

    Neto, Silvrano Adonias Dantas; De Farias, Márcio Muniz; Pais, Jorge C.; Pereira, Paulo A. A.; Sousa, Jorge B.

    2006-01-01

    This paper shows the results of a study about the mechanical behavior of dense graded asphalt-rubber hot mixes prepared with two different types of asphalt-rubber binders. These asphalt-rubber binders were obtained with penetration grade asphalt (AC 50/70) mixed with 21% and 25% of crumb rubber in weight. The rubber was recycled from unserviceable tires using the ambient grinding process. Hot mixes made with the conventional binder AC 50/70 were also studied for comparison. The...

  12. A Binder Viscosity Effect on the Wet-Wounded Composite Porosity in the Impregnating Bath

    Directory of Open Access Journals (Sweden)

    M. A. Komkov

    2014-01-01

    Full Text Available The aim of this work is to define experimentally an impregnation rate of VM-1 glass fibers and CBM aramid bundles with the epoxy binder EDB-10 using wet method of winding. During the impregnation process of the fibrous fillers by the liquid binder, air is displaced from the interfiber space of fiber and bundle. With the composite product winding a fiber impregnation process is short. That is why gas inclusions or pores are formed in the polymer-fiber compositeThe impregnation rate or porosity of wound material will depend directly on the binder viscosity. To reduce an epoxy binder viscosity temporarily is possible by two ways. The first is to heat a liquid epoxy composition EDB-10 to the maximum possible temperature during the winding process of the product. The second method is to dilute the binder by a solvent, such as acetone or alcohol. However, the solvent reduces its strength.The paper presents experimental data to show the volumetric content of pores in the wound composite affected only by the viscosity of the epoxy binder. Heating a binder allowed us to regulate a changing conditional viscosity of the binder in the impregnating bath for the normal conditions of impregnation. Other impacts on the impregnation and filament-winding processes, such as filler kinks, squeeze, vacuuming binder, highly tensioned winding, and others were not used.Experimentally obtained dependences of the porosity value of wound composite on the conditional viscosity of binder are nonlinear and can be used to design heaters for impregnating devices of winders. The research technique and results can be used in development of technological processes to manufacture composite structures by winding from the other reinforcing fibrous fillers and thermo-active binders.The results show that the volumetric content of pores can significantly vary within 8 - 14 % of material volume. Therefore, to reduce the number of pores in the wound composite to 1-2 %, auxiliary

  13. FTIR spectroscopy of water glass - the binder moulding modified by ZnO nanoparticles

    Directory of Open Access Journals (Sweden)

    A. Bobrowski

    2012-10-01

    Full Text Available The subject of the paper is the determination of the infl uence of the colloidal nanoparticles of zinc oxide on the structure of sodium water glass. Nanoparticles of zinc oxide in ethanol solvent were introduced into the water glass. The modification and structural changes were determined by means of the FT-IR absorption spectra. In order to determine the kind of infl uence: binder-modifier the spectroscopic FTIR analysis of samples of a fresh binder and of a binder hardened for 24 h in the air was performed by means of the spectrometer Digilab Excalibur with a standard DTGS detector.

  14. Cirugía ortognática y rinoplastia en el síndrome de Binder Orthognathic surgery and rhinoplasty in Binder syndrome

    Directory of Open Access Journals (Sweden)

    M. Tito

    2007-04-01

    Full Text Available El síndrome de Binder es una patología caracterizada por hipoplasia nariz-maxilar, ángulo naso-frontal plano, senos frontales hipoplasicos, ausencia de la espina nasal anterior, columela corta y ángulo nasolabial agudo. El tratamiento del los pacientes con síndrome de Binder puede ser ortodóntico o quirúrgico según la gravedad de la malformación. En este trabajo hemos realizado una revision bibliográfica sobre la etiología, el diagnóstico diferential y el tratamiento de la sindrome de Binder y presentamos un caso clínico de un paciente binderiano sometido a intervención de cirugía ortognática y rinoplastia con injerto de cartílago costal para recostruir el dorso y la punta nasal.Binder syndrome is a disorder characterized by nasomaxillary hypoplasia that results in a short nose, a frontonasal angle of almost 180 degrees, hypoplasia of the frontal sinuses, an absent anterior nasal spine, a short columella and an acute nasolabial angle. The patient can be treated orthodontically or surgically depending on the seriousness of the malformation. We review the literature on the etiology, differential diagnosis and treatment of Binder syndrome. We present the case of a boy with this syndrome surgically treated with orthognatic surgery and rhinoplasty with an L-shaped rib cartilage graft.

  15. Marine Renewable Energy Seascape

    Directory of Open Access Journals (Sweden)

    Alistair G.L. Borthwick

    2016-03-01

    Full Text Available Energy production based on fossil fuel reserves is largely responsible for carbon emissions, and hence global warming. The planet needs concerted action to reduce fossil fuel usage and to implement carbon mitigation measures. Ocean energy has huge potential, but there are major interdisciplinary problems to be overcome regarding technology, cost reduction, investment, environmental impact, governance, and so forth. This article briefly reviews ocean energy production from offshore wind, tidal stream, ocean current, tidal range, wave, thermal, salinity gradients, and biomass sources. Future areas of research and development are outlined that could make exploitation of the marine renewable energy (MRE seascape a viable proposition; these areas include energy storage, advanced materials, robotics, and informatics. The article concludes with a sustainability perspective on the MRE seascape encompassing ethics, legislation, the regulatory environment, governance and consenting, economic, social, and environmental constraints. A new generation of engineers is needed with the ingenuity and spirit of adventure to meet the global challenge posed by MRE.

  16. Participatory urban renewal

    Directory of Open Access Journals (Sweden)

    Drago Kos

    2005-01-01

    Full Text Available The article consists of two parts. The first deals with the theoretical framework of urban rehabilitation. Literature provides the basis for a conclusion, which is that the key issue in rehabilitation projects is legitimate negotiation of various interests between participating individuals and institutions. In the second part this presentation and analyses of events that took place at the urban design workshop organised within the framework of the research project Renewal of housing estates in Ljubljana, provide experiential confirmation of the starting thesis. We established that the directly involved residents were willing to actively participate in rehabilitation procedures, however the process is never triggered, because of insufficient capacities in institutional frameworks. In conclusion several real proposals are shown, namely, how to surmount obstacles in urban rehabilitation and especially in larger housing estates built after World War 2.

  17. Renewable Energy Certificate Program

    Energy Technology Data Exchange (ETDEWEB)

    Gwendolyn S. Andersen

    2012-07-17

    This project was primarily to develop and implement a curriculum which will train undergraduate and graduate students at the University seeking a degree as well as training for enrollees in a special certification program to prepare individuals to be employed in a broad range of occupations in the field of renewable energy and energy conservation. Curriculum development was by teams of Saint Francis University Faculty in the Business Administration and Science Departments and industry experts. Students seeking undergraduate and graduate degrees are able to enroll in courses offered within these departments which will combine theory and hands-on training in the various elements of wind power development. For example, the business department curriculum areas include economic modeling, finance, contracting, etc. The science areas include meteorology, energy conversion and projection, species identification, habitat protection, field data collection and analysis, etc.

  18. Renewable jet fuel.

    Science.gov (United States)

    Kallio, Pauli; Pásztor, András; Akhtar, M Kalim; Jones, Patrik R

    2014-04-01

    Novel strategies for sustainable replacement of finite fossil fuels are intensely pursued in fundamental research, applied science and industry. In the case of jet fuels used in gas-turbine engine aircrafts, the production and use of synthetic bio-derived kerosenes are advancing rapidly. Microbial biotechnology could potentially also be used to complement the renewable production of jet fuel, as demonstrated by the production of bioethanol and biodiesel for piston engine vehicles. Engineered microbial biosynthesis of medium chain length alkanes, which constitute the major fraction of petroleum-based jet fuels, was recently demonstrated. Although efficiencies currently are far from that needed for commercial application, this discovery has spurred research towards future production platforms using both fermentative and direct photobiological routes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Renewal of radiological equipment.

    Science.gov (United States)

    2014-10-01

    In this century, medical imaging is at the heart of medical practice. Besides providing fast and accurate diagnosis, advances in radiology equipment offer new and previously non-existing options for treatment guidance with quite low morbidity, resulting in the improvement of health outcomes and quality of life for the patients. Although rapid technological development created new medical imaging modalities and methods, the same progress speed resulted in accelerated technical and functional obsolescence of the same medical imaging equipment, consequently creating a need for renewal. Older equipment has a high risk of failures and breakdowns, which might cause delays in diagnosis and treatment of the patient, and safety problems both for the patient and the medical staff. The European Society of Radiology is promoting the use of up-to-date equipment, especially in the context of the EuroSafe Imaging Campaign, as the use of up-to-date equipment will improve quality and safety in medical imaging. Every healthcare institution or authority should have a plan for medical imaging equipment upgrade or renewal. This plan should look forward a minimum of 5 years, with annual updates. Teaching points • Radiological equipment has a definite life cycle span, resulting in unavoidable breakdown and decrease or loss of image quality which renders equipment useless after a certain time period.• Equipment older than 10 years is no longer state-of-the art equipment and replacement is essential. Operating costs of older equipment will be high when compared with new equipment, and sometimes maintenance will be impossible if no spare parts are available.• Older equipment has a high risk of failure and breakdown, causing delays in diagnosis and treatment of the patient and safety problems both for the patient and the medical staff.• Every healthcare institution or authority should have a plan for medical imaging equipment upgrade or replacement. This plan should look forward a

  20. Renewable Energy in European Regions

    NARCIS (Netherlands)

    Krozer, Y.

    2012-01-01

    The regional dynamics of energy innovation, in particular the shift from fossil fuels to renewable energy in the EU, is discussed within the framework of neo-Schumpeterian theory. The EU’s 4.2% average annual growth in renewable energy production in the last decade has been accompanied by diverging

  1. PYRAMID LAKE RENEWEABLE ENERGY PLAN

    Energy Technology Data Exchange (ETDEWEB)

    HIGH DESERT GEOCULTURE, LLC

    2009-06-06

    The Pyramid Lake Renewable Energy Plan covers these areas: energy potential (primarily focusing on geothermal resource potential, but also more generally addressing wind energy potential); renewable energy market potential; transmission system development; geothermal direct use potential; and business structures to accomplish the development objectives of the Pyramid Lake Paiute Tribe.

  2. Business development in renewable energy

    NARCIS (Netherlands)

    Krozer, Yoram; Visa, Ion

    2014-01-01

    This paper discusses how to foster development of renewable energy business. Factors that impede or enhance renewable energy in the EU 27 member states in the period 1998–2008 are analyzed. Nine factors are considered: population density, production output and energy sector output to indicate market

  3. Business development in renewable energy

    NARCIS (Netherlands)

    Krozer, Yoram; Visa, Ion

    2014-01-01

    This paper discusses how to foster development of renewable energy business. Factors that impede or enhance renewable energy in the EU 27 member states in the period 1998–2008 are analyzed. Nine factors are considered: population density, production output and energy sector output to indicate market

  4. High sensitive and selective electrochemical biosensor: Label-free detection of human norovirus using affinity peptide as molecular binder.

    Science.gov (United States)

    Hwang, Hye Jin; Ryu, Myung Yi; Park, Chan Young; Ahn, Junki; Park, Hyun Gyu; Choi, Changsun; Ha, Sang-Do; Park, Tae Jung; Park, Jong Pil

    2017-01-15

    Norovirus is known as the major cause of highly infection for gastrointestinal tracts. In this study, robust and highly sensitive biosensors for detecting human norovirus by employing a recognition affinity peptide-based electrochemical platform were described. A series of amino acid-substituted and cysteine-incorporated recognition peptides isolated from evolutionary phage display technique was chemically synthesized and immobilized to a gold sensor layer, the detection performance of the gold-immobilized synthetic peptide-based sensor system was assessed using QCM, CV and EIS. Using EIS, the limit of detection with Noro-1 as a molecular binder was found to be 99.8nM for recombinant noroviral capsid proteins (rP2) and 7.8copies/mL for human norovirus, thereby demonstrating a high degree of sensitivity for their corresponding targets. These results suggest that a biosensor which consists of affinity peptides as a molecular binder and miniaturized microdevices as diagnostic tool could be served as a new type of biosensing platform for point-of-care testing.

  5. Renewables in Global Energy Supply

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2007-07-01

    Renewable energies are essential contributors to the energy supply portfolio as they contribute to world energy supply security, reducing dependency on fossil fuel resources, and provide opportunities for mitigating greenhouse gases. Differences in definition and lack of adequate data complicated the discussion between participants on these key issues. The International Energy Agency believes that this fact sheet can be of use to all to facilitate the debate on the past, current and future place and role of renewables in total energy supply. Our goal is to present as objectively as possible the main elements of the current renewables energy situation. The definitions and coverage of national statistics vary between countries and organisations. In this fact sheet, the renewables definition includes combustible renewables and waste (CRW), hydro, geothermal, solar, wind, tide and wave energy.

  6. Somerset County Renewable Energy Initiative

    Energy Technology Data Exchange (ETDEWEB)

    Katula, Denise [County of Somerset, Somervile, NJ (United States)

    2014-05-07

    The County of Somerset, New Jersey, through the Somerset County Improvement Authority (SCIA), applied Federal funding through the U.S. Department of Energy to will apply project funds to buy-down the capital costs of equipment associated with the installation of solar photovoltaic (PV) systems at two sites owned by the County. This Renewable Energy Initiative allows the County to take advantage of clean renewable energy, without any adverse debt impacts, and at a price that results in operating budget savings beyond what is presently available in the marketplace. This project addressed the objectives of the Office of Energy Efficiency and Renewable Energy by making the acquisition of renewable energy more affordable for the County, thereby, encouraging other counties and local units to develop similar programs and increase the deployment of solar energy technologies. The two sites that were funded by the DOE grant are part of a much larger, ambitious, and unique renewable energy project, described in the next section.

  7. Integrating Renewables in Electricity Markets

    DEFF Research Database (Denmark)

    Morales González, Juan Miguel; Conejo, Antonio J.; Madsen, Henrik

    This addition to the ISOR series addresses the analytics of the operations of electric energy systems with increasing penetration of stochastic renewable production facilities, such as wind- and solar-based generation units. As stochastic renewable production units become ubiquitous throughout...... electric energy systems, an increasing level of flexible backup provided by non-stochastic units and other system agents is needed if supply security and quality are to be maintained. Within the context above, this book provides up-to-date analytical tools to address challenging operational problems...... such as: • The modeling and forecasting of stochastic renewable power production. • The characterization of the impact of renewable production on market outcomes. • The clearing of electricity markets with high penetration of stochastic renewable units. • The development of mechanisms to counteract...

  8. Renewable energy sources; Erneuerbare Energien

    Energy Technology Data Exchange (ETDEWEB)

    Lenz, Volker [Deutsches BiomasseForschungsZentrum gGmbH (DBFZ), Leipzig (Germany); Kaltschmitt, Martin [Technische Univ. Hamburg-Harburg, Hamburg (Germany). Inst. fuer Umwelttechnik und Energiewirtschaft

    2012-07-01

    The development of the use of renewable energy sources in Germany in 2011 significantly was influenced by the disaster in Fukushima (Japan) and the change of course in the German energy policy. In addition, there is the amendment of the Renewable Energy Law (EEG) in an increasingly controversial area of tension between climate protection, energy utilization, cost minimization and considerations on sustainability. With this in mind, the authors of the contribution under consideration report on developments in Germany in the year 2011 in the field of energy supply and fuel supply from renewable energies. Beside the energy-economic framework conditions for the various possibilities for the use of renewable energies, the current status, developments and prospects are analysed. The contribution gives an outlook on the possible expansion of the supply of renewable energies in 2012.

  9. High performance binder-free SiO x /C composite LIB electrode made of SiO x and lignin

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Tao; Hu, Jiazhi; Zhang, Long; Pan, Jie; Liu, Yiyang; Cheng, Yang-Tse

    2017-09-01

    A high performance binder-free SiOx/C composite electrode was synthesized by mixing SiOx particles and Kraft lignin in a cryo-mill followed by heat treatment at 600 degrees C. After the heat treatment, lignin formed a conductive matrix hosting SiOx particles, ensuring electronic conductivity, connectivity, and accommodation of volume changes during lithiation/delithiation. As the result, no conventional binder or conductive agent was necessary. When electrochemically cycled, the composite electrode delivered excellent performance, maintaining ~900 mAh g-1 after 250 cycles at a rate of 200 mA g-1, and good rate capability. The robustness of the electrode was also examined by post-cycling SEM images, where few cracks were observed. The excellent electrochemical performance can be attributed to the comparatively small volume change of SiOx-based electrodes (160%) and the flexibility of the lignin derived carbon matrix to accommodate the volume change. This work should stimulate further interests in using bio-renewable resources in making advanced electrochemical energy storage systems.

  10. Chemical Characterization of Lime-Based Binders in Historic Buildings of Latvia

    Science.gov (United States)

    Kirilovica, I.; Gulbe, L.; Vitina, I.; Igaune-Blumberga, S.

    2015-11-01

    The aim of this research is to investigate the chemical composition of stone materials of several local historic buildings with a purpose of elaboration of restoration strategy, including the choice of restoration materials. Most of the examined mortars are lime- based hydraulic mortars, characteristic of the architecture of 19th/20th century. Pure aerial lime binders show reduced compatibility with historic materials, that is why lime binders with pozzolan additive (cement) are an appropriate choice for restoration. In order to examine the changes of hydraulicity (i.e. the property of binders to harden when exposed to water) of perspective restoration binders, a series of blended lime-cement mixtures were synthesized with growing content of cement (up to 10% by weight). A significant relationship between cement content and hydraulic properties has been shown.

  11. Process Development of Porcelain Ceramic Material with Binder Jetting Process for Dental Applications

    Science.gov (United States)

    Miyanaji, Hadi; Zhang, Shanshan; Lassell, Austin; Zandinejad, Amirali; Yang, Li

    2016-03-01

    Custom ceramic structures possess significant potentials in many applications such as dentistry and aerospace where extreme environments are present. Specifically, highly customized geometries with adequate performance are needed for various dental prostheses applications. This paper demonstrates the development of process and post-process parameters for a dental porcelain ceramic material using binder jetting additive manufacturing (AM). Various process parameters such as binder amount, drying power level, drying time and powder spread speed were studied experimentally for their effect on geometrical and mechanical characteristics of green parts. In addition, the effects of sintering and printing parameters on the qualities of the densified ceramic structures were also investigated experimentally. The results provide insights into the process-property relationships for the binder jetting AM process, and some of the challenges of the process that need to be further characterized for the successful adoption of the binder jetting technology in high quality ceramic fabrications are discussed.

  12. Optimum Parameters for the Formulation of Charcoal Briquettes Using Bagasse and Clay as Binder

    National Research Council Canada - National Science Library

    M.S. Rao; B.N. Chikamai; J.M. Onchieku

    2012-01-01

    ... for the formulation of charcoal briquettes for household use tosupplement wood charcoal. In this study briquettes were formulated usingcarbonized bagasse, clay as a binder and molasses as a filler...

  13. Optimum Parameters for the Formulation of Charcoal Briquettes Using Bagasse and Clay as Binder

    National Research Council Canada - National Science Library

    J.M. Onchieku; B.N. Chikamai; M.S. Rao

    2014-01-01

    ... for the formulation of charcoal briquettes for household use tosupplement wood charcoal. In this study briquettes were formulated usingcarbonized bagasse, clay as a binder and molasses as a filler...

  14. Study of Rheological Properties of Bituminous Binders in Middle and High Temperatures

    Directory of Open Access Journals (Sweden)

    Remišová Eva

    2016-05-01

    Full Text Available The bitumen binders in road pavements are exposed traffic loading effect at different climatic conditions. A resistance to these stresses depends on bitumen properties as well. The paper presents rheological properties (G*, δ, ν* determined and compared for four bituminous binders (unmodified and polymer modified bitumen at temperature 46 – 60 (80 °C and dynamic viscosity at temperature 130 – 190 °C (Brookfield viscometer. On the basis of viscosity results it is possible to set optimal production and compaction temperatures. Elastic and viscous behavior of binder in the middle temperature is determined in rheometers. The higher value of complex modulus, the stiffer bitumen binder is able to resist deformation. The greater content of elastic components (e.g. polymer in bitumen varies mainly elastic-viscous properties of primary bitumen.

  15. Tungsten carbide coatings with different binders prepared by low power plasma spray system

    Institute of Scientific and Technical Information of China (English)

    GAO Yang; M.F.Morks; FU Ying-qing

    2004-01-01

    Thermal spraying of cermet coatings is widely used for protection of machining parts against wear and corrosion. These coatings consist of WC particles in metal binders such as Co, Cr and Ni. Three kinds of WC powders with different metal binders (Co, NiCr and CoCr) were sprayed by low power plasma spray system on Al-Si-Cu alloy substrate. Fundamental aspects of sprayed cermet coatings, including (i) the effects of binder type on the coating structure, (ii) the hardness and (iii) the microstructure, were investigated. All cermet coatings have the same phase structure such as WC and W2 C. However, the intensities of these phases are different in each coating, mainly due to the difference in solidification rate in each case. Moreover, the hardness measurements are found to be different in each coating. The results show that, binder type has a significant effect on the physical and mechanical properties of the sprayed coatings.

  16. Some aspects on improvement of water resistant perfornace of gypsum binders

    Directory of Open Access Journals (Sweden)

    Fomina Ekaterina

    2016-01-01

    Full Text Available The study reports that control of water resistant and strength performance of composite binder can be accomplished by using nanostructured gypsum silicate binder and portland cement and reduction of calcium sulfate dihydrate. Formation of an arranged more dense packing in crystal matrix of binder structure can be achieved through polydispersity of nanostructured silicon component. Highly reactive silica particles participate in synthesis of microcrystalline compounds such as hydroxylellestadite and serve as nucleation sites providing an increase of surface contact area between crystal structures. Cement in the system provides conditions to synthesis of stable flat-like hydroxysulfoaluminates. Upon hydration of a binder crystals of calcium sulfate dihydrate impound to a mass of water resistant crystalhydrate new formations, type and morphology of which promotes decreasing of intercrystal porosity followed by density, strength and water resistance increase of the composite.

  17. Testing a Novel Geopolymer Binder as a Refractory Material for Rocket Plume Environments at SSC Project

    Data.gov (United States)

    National Aeronautics and Space Administration — The project involved the development and testing of a new alumina-silicate based multi-purpose, cost-effective, ‘green’ cementitious binder (geopolymer)...

  18. Organically modified clays as binders of fumonisins in feedstocks.

    Science.gov (United States)

    Baglieri, Andrea; Reyneri, Amedeo; Gennari, Mara; Nègre, Michèle

    2013-01-01

    This study reports an investigation on the ability of organically modified clays to bind mycotoxins, fumonisins B1 (FB1) and B2 (FB2). Organically modified clays are commercia materials prepared from natural clays, generally montmorillonite, by exchanging the inorganic cation with an ammonium organic cation. A screening experiment conducted on 13 organically modified clays and 3 nonmodified clays, used as controls, has confirmed that the presence of an organic cation in the clay interlayer promoted the adsorption of both fumonisins. On the basis of the results of the screening test, four modified clays and a Na-montmorillonite were selected for the determination of the adsorption kinetics and isotherms. On all the tested materials adsorption took place within one hour of contact with fumonisins solutions. Adsorption isotherms have pointed out that the modified clays exhibited a higher adsorptive capacity than the unmodified clay. It was also demonstrated that, notwithstanding the reduced structural difference between FB1 and FB2, they were differently adsorbed on the modified clays. Addition of 2% modified clays to contaminated maize allowed a reduction of more than 70% and 60% of the amount of FB1and FB2 released in solution. Although in vivo experiments are required to confirm the effectiveness of the organically modified clays, these preliminary results suggest that these materials are promising as fumonisins binders.

  19. Poly(lactic acid) degradable plastics, coatings, and binders

    Energy Technology Data Exchange (ETDEWEB)

    Bonsignore, P.V.; Coleman, R.D.; Mudde, J.P.

    1992-01-01

    Biochemical processes to derive value from the management of high carbohydrate food wastes, such as potato starch, corn starch, and cheese whey permeate, have typically been limited to the production of either ethanol or methane. Argonne National Laboratory (ANL) believes that lactic acid presents an attractive option for an alternate fermentation end product, especially in light of lactic acids' being a viable candidate for conversion to environmentally safe poly(lactic acid) (PLA) degradable plastics, coatings, and binders. Technology is being developed at ANL to permit a more cost effective route to modified high molecular weight PLA. Preliminary data on the degradation behavior of these modified PLAs shows the retention to the inherent hydrolytic degradability of the PLA modified, however, by introduced compositional variables. A limited study was done on the hydrolytic stability of soluble oligomers of poly(L-lactic acid). Over a 34 day hold period, water-methanol solutions of Pl-LA oligomers in the 2-10 DP range retained some 75% of their original molecular weight.

  20. Poly(lactic acid) degradable plastics, coatings, and binders

    Energy Technology Data Exchange (ETDEWEB)

    Bonsignore, P.V.; Coleman, R.D.; Mudde, J.P.

    1992-05-01

    Biochemical processes to derive value from the management of high carbohydrate food wastes, such as potato starch, corn starch, and cheese whey permeate, have typically been limited to the production of either ethanol or methane. Argonne National Laboratory (ANL) believes that lactic acid presents an attractive option for an alternate fermentation end product, especially in light of lactic acids` being a viable candidate for conversion to environmentally safe poly(lactic acid) (PLA) degradable plastics, coatings, and binders. Technology is being developed at ANL to permit a more cost effective route to modified high molecular weight PLA. Preliminary data on the degradation behavior of these modified PLAs shows the retention to the inherent hydrolytic degradability of the PLA modified, however, by introduced compositional variables. A limited study was done on the hydrolytic stability of soluble oligomers of poly(L-lactic acid). Over a 34 day hold period, water-methanol solutions of Pl-LA oligomers in the 2-10 DP range retained some 75% of their original molecular weight.

  1. Recent developments in binder design for advanced media

    Science.gov (United States)

    Kim, K. J.; Farkas, J.; Hasman, D.; Miller, T.; Zellia, J.; Jacobs, P.

    1999-03-01

    This study is aimed to examine the technical issue, the rheological requirements, in accomplishing successful processing of the dispersion made with wetting binders to produce tapes with excellent mechanical properties. The results indicate that the dispersions made with DTPU or NTPU (new dispersing TPU for metal pigments), can be characterized using RFS 8400 and Bolin CSM. For this type of dispersion, a higher strain is required to start flow or to break the primary structure, a wider range of shear rate is needed for the structural breakdown. It also shows that the recovery time is shorter with longer time to reach a steady state that is a lower recovery compliance level. G'/ G″ cross-over point was defining the needed strain level and the strain rate for the structural breakdown. It is expected that the results of the study could be applied to define the mechanical properties of the final tape affected by various operations such as mixing/agitation, high coating speed, drying/calendering, and curing and high speed duplicating process.

  2. Study on the hardening mechanism of cement asphalt binder

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    The hydration and hardening mechanism of cement asphalt binder(CAB) was studied.The early hydration process,hydration products and paste microstructure of CAB made by Portland cement and anionic asphalt emulsion were investigated by calorimetry,X-ray diffraction,and environmental scanning electron microscopy.The early hydration process of CAB can be characterized as 5 stages similar to those of Portland cement.There is no chemical reaction detected between cement and asphalt,hence no new hydration products other than those of Portland cement are produced.The hardening of CAB begins with the hydration of cement.When the hydration of cement comes into the acceleration period and its exothermic rate comes to the maximum,the coalescence of asphalt particles in asphalt emulsion is triggered.In the hardened system of CAB,it was found that the hydration products of cement form the skeleton and are covered by the continuous asphalt film.They formed an interpenetrating network system.The emulsifiers in the asphalt emulsion may retard the hydration process of cement.

  3. Building a sustainable market for renewables

    Energy Technology Data Exchange (ETDEWEB)

    Rader, N.

    1996-12-31

    Opinions regarding marketing approaches for electricity generation from renewable resources are presented in the paper. The Renewables Portfolio Standard of the California Public Utilities Commission is described. This system is based on renewable energy credits. Other marketing approaches, including surcharges, auctioned renewables credit, green pricing, and green marketing are also assessed. It is concluded that the Renewables Portfolio Standard creates a stable economic environment for the renewable energy industries.

  4. Characterization of hydrocarbon emissions from green sand foundry core binders by analytical pyrolysis

    Energy Technology Data Exchange (ETDEWEB)

    Yujue Wang; Fred S. Cannon; Magda Salama; Jeff Goudzwaard; James C. Furness [Pennsylvania State University, University Park, PA (United States). Department of Civil and Environmental Engineering

    2007-11-15

    Analytical pyrolysis was conducted to compare the hydrocarbon and greenhouse gas emissions of three foundry sand binders: (a) conventional phenolic urethane resin, (b) biodiesel phenolic urethane resin, and (c) collagen-based binder. These binders are used in the metal casting industry to create internal cavities within castings. Green sand contains silica sand, clay, carbonaceous additives (eg bituminous coal) and water. The core samples were flash pyrolyzed in a Curie-point pyrolyzer at 920{sup o}C with a heating rate of about 3000{sup o}C/sec. This simulated some key features of the fast heating conditions that the core binders would experience at the metal-core interface when molten metal is poured into green sand molds. The core samples were also pyrolyzed in a thermogravimetric analyzer (TGA) from ambient temperature to 1000{sup o}C with a heating rate of 30{sup o}C/min, and this simulated key features of the slow heating conditions that the core binders would experience at distances that are further away from the metal-core interface during casting cooling. Hydrocarbon emissions from flash pyrolysis were analyzed with a gas chromatography-flame ionization detector, while hydrocarbon and greenhouse gas emissions from TGA pyrolysis were monitored with mass spectrometry. The prominent hazardous air pollutant emissions during pyrolysis of the three binders were phenol, cresols, benzene, and toluene for the conventional phenolic urethane resin and biodiesel resin, and benzene and toluene for the collagen-based binder. Bench-scale analytical pyrolysis techniques could be a useful screening tool for the foundries to compare the relative emissions of alternative core binders and to choose proper materials in order to comply with air-emission regulations. 20 refs., 4 figs., 1 tab.

  5. Characterization of zirconia-based slurries with different binders for titanium investment casting

    OpenAIRE

    Zhao Ertuan; Kong Fantao; Chen Yanfei

    2012-01-01

    The materials and physical properties of primary slurry are crucial to the surface quality of the finished castings, especially for high reactivity titanium alloys. The aim of this study is to investigate the influence of different binders on the physical properties of primary slurry for titanium alloy investment casting. The zirconia-based slurries with different binders were evaluated by comparing the parameters: viscosity, bulk density, plate weight, suspensibility, gel velocity and streng...

  6. Water-soluble binders for MCMB carbon anodes for lithium-ion batteries

    Energy Technology Data Exchange (ETDEWEB)

    Courtel, Fabrice M.; Niketic, Svetlana; Duguay, Dominique; Abu-Lebdeh, Yaser; Davidson, Isobel J. [National Research Council Canada, 1200 Montreal Road, Ottawa, Ontario, K1A 0R6 (Canada)

    2011-02-15

    We have investigated the suitability of four different binders for the conventional mesocarbon microbeads (MCMBs) anode material in Li-ion batteries. Unlike the conventional polyvinylidene fluoride (PVDF), the binders were water soluble and were either cellulose based, such as the lithium and sodium salts of carboxymethyl cellulose (NaCMC, and LiCMC) and Xanthan Gum (XG), or the conjugated polymer: poly(3,4-ethylendioxythiophene) (PEDOT, a.k.a. Baytron). All binders were commercially available except LiCMC, which was synthesized and characterized by FTIR and NMR. Thermal studies of the binders by TGA and DSC showed that, in air, the binders have a broad melting event at 100-150 C, with an onset temperature for decomposition above 220 C. Li/MCMB half-cell batteries were assembled using the studied binders. Slow scan voltammograms of all cells showed characteristic lithium insertion and de-insertion peaks including that of the SEI formation which was found to be embedded into the insertion peaks during the first cycle. Cycling of the cells showed that the one containing XG binder gave the highest capacities reaching 350 mAh g{sup -1} after 100 cycles at C/12, while the others gave comparable capacities to those of the conventional binder PVDF. The rate capabilities of cells were examined and found to perform well up to the studied C/2 rate with more than 50% capacity retained. Further studies of the XG-based MCMB electrodes were performed and concluded that an optimal thickness of 300-365 {mu}m gave the highest capacities and sustained high C-rates. (author)

  7. A Review on Decomposition Deflagration of Oxidizer and Binders in Composite Solid Propellants

    Directory of Open Access Journals (Sweden)

    K. Kishore

    1979-01-01

    Full Text Available Binder and oxidizer decomposition play very significant role during the combustion of composite solid propellants. Ammonium perchlorate (AP is the practical oxidizer in composite propellant formulations. Available information on binder decomposition in general and AP decomposition in particular have been collected and reviewed from the viewpoint of their application in propellants. This review may be useful in understanding the mechanism of propellant combustion.

  8. A new low carbon cementitious binder for stabilising weak ground conditions through deep soil mixing.

    OpenAIRE

    Sargent, P.; Hughes, P. N.; Rouainia, M.

    2016-01-01

    Soft alluvial soils present unfavourable conditions for engineering developments due to their poor bearing capacities and high potential for experiencing shrinkage and swelling. This paper focusses on deep dry soil mixing (DDSM), which introduces cementitious binders to soft soils via a rotating auger drill, thereby producing soil-cement columns. Ordinary Portland cement (CEM-I) is globally used across the construction industry and is the most commonly used binder for DDSM applications due to...

  9. Research of gypsum binder of phosphogypsum and dry mortar on its basis

    OpenAIRE

    Казимагомедов, Ибрагим Эмирчубанович; Дехтярюк, Ольга Игоревна

    2015-01-01

    Gypsum binder was received by the method of intensive dehydration and the influence of admixture in phosphogypsum on the hydration process of gypsum binder was researched. Phase composition of phosphogypsum before and after calcination, using XFA, IR-spectroscopy and crystal optic analysis was defined. Dry mortar for plaster of interior walls of buildings on the basis of CaSO4·0,5H2O obtained from phosphogypsum is investigated. Its advantages and physical and chemical characteristics are shown

  10. Calcium salts of keto-amino acids, a phosphate binder alternative for patients on CAPD.

    Science.gov (United States)

    Macia, M; Coronel, F; Navarro, J F; Gallego, E; Herrero, J A; Méndez, M L; Chahin, J; García, J

    1997-09-01

    Control of hyperphosphoremia is crucial to the prevention of secondary hyperparathyroidism. Calcium salts of keto-amino acids (KAA) were employed as phosphate binders in hemodialysis patients. We wanted to assess the efficacy of these substances as quelating agents in patients under continuous ambulatory peritoneal dialysis (CAPD). Also, as an amino acid supplement, we determined their possible effect on some parameters related to nutritional status. We studied 13 patients (7 M; 6 F) with a mean age of 45.2 +/- 17 years and a mean time on CAPD of 18.4 +/- 11.4 months. None had severe secondary hyperparathyroidism and/or clinically relevant aluminium intoxication. They were not receiving calcitriol and none were using low-calcium peritoneal dialysis fluids. All were under aluminum hydroxide (AlOH3) treatment and 8 patients also received calcium carbonate. These quelating agents were withdrawn and after 21 days (wash-out period) KAA were initiated. We analyzed serum levels of bone metabolism parameters (calcium, phosphate, osteocalcin [OC], intact parathyroid hormone [iPTH], alkaline phosphatase [AP]) and nutritional parameters (total protein, albumin, pre-albumin, transferrin) in four periods: (A) during AlOH3; (B) immediately after the washout period; (C) after 1.5 months; and (D) after 3 months of KAA therapy. In 5 patients serum aluminum level was also measured in periods (A) and (D). The serum phosphate level at period (B) was significantly higher than in other periods. After 3 months of treatment phosphate levels decreased significantly (A = 1.77 +/- 0.3 mmol/l vs D = 1.48 +/- 0.2; p < 0.05). Serum calcium levels increased, while iPTH and OC decreased (p = ns). AP remained stable during the study. All nutritional parameters increased at the end of the study (p = ns). Calcium salts of keto-amino acids showed to be an effective alternative to aluminum-containing phosphate binders. They were well tolerated, without relevant side-effects. These compounds could also

  11. Renewables 2013. Global Status Report

    Energy Technology Data Exchange (ETDEWEB)

    Sawin, J.L. (ed.) [and others

    2013-07-01

    Renewable energy markets, industries, and policy frameworks have evolved rapidly in recent years. The Renewables Global Status Report provides a comprehensive and timely overview of renewable energy market, industry, investment, and policy developments worldwide. It relies on the most recent data available, provided by many contributors and researchers from around the world, all of which is brought together by a multi-disciplinary authoring team. The report covers recent developments, current status, and key trends; by design, it does not provide analysis or forecasts. This latest Renewables Global Status Report saw: a shift in investment patterns that led to a global decrease in clean energy investment; continuing growth in installed capacity due to significant technology cost reductions and increased investment in developing countries; renewables progressively supplementing established electricity systems, demonstrating that the implementation of suitable policies can enable the successful integration of higher shares of variable renewables; and the emergence of integrated policy approaches that link energy efficiency measures with the implementation of renewable energy technologies.

  12. Developing Government Renewable Energy Projects

    Energy Technology Data Exchange (ETDEWEB)

    Kurt S. Myers; Thomas L. Baldwin; Jason W. Bush; Jake P. Gentle

    2012-07-01

    The US Army Corps of Engineers has retained Idaho National Laboratory (INL) to conduct a study of past INL experiences and complete a report that identifies the processes that are needed for the development of renewable energy projects on government properties. The INL has always maintained expertise in power systems and applied engineering and INL’s renewable energy experiences date back to the 1980’s when our engineers began performing US Air Force wind energy feasibility studies and development projects. Over the last 20+ years of working with Department of Defense and other government agencies to study, design, and build government renewable projects, INL has experienced the do’s and don’ts for being successful with a project. These compiled guidelines for government renewable energy projects could include wind, hydro, geothermal, solar, biomass, or a variety of hybrid systems; however, for the purpose of narrowing the focus of this report, wind projects are the main topic discussed throughout this report. It is our thought that a lot of what is discussed could be applied, possibly with some modifications, to other areas of renewable energy. It is also important to note that individual projects (regardless the type) vary to some degree depending on location, size, and need but in general these concepts and directions can be carried over to the majority of government renewable energy projects. This report focuses on the initial development that needs to occur for any project to be a successful government renewable energy project.

  13. OPTIMIZING THE COMPOSITION AND THE FEATURES OF GYPSUM BINDER PRODUCED IN A KETTLE

    Directory of Open Access Journals (Sweden)

    Pustovgar Andrey Petrovich

    2016-06-01

    Full Text Available The authors considered the gypsum binder obtained in a kettle SMA-158A in the enterprise LLC “MaykopGipsStroy”. The initial gypsum binder burnt at a temperature of 120 °Сwith the following unloading out of the kettle possessed unstable physical, mechanical and operational characteristics, that’s why the grade of gypsum binder was changed from G4-AII to G5-BII for different lots, which greatly reduced its application in the composition of dry mortars. It was stated, that instability of the features of gypsum binder is determined by the essential underburning of the system, which was characterized by residual content of calcium sulfate dihydrate in amount from 2 to 7 % by weight. In frames of the investigation the authors succeeded in raising the grade of the produced gypsum binder (from G4-5 to G6 due to optimization of the technological parameters of the burning process, as well as to stabilize the composition and features, to lay down temperature and time parameters allowing to control the technological process in order to obtain the gypsum binder with specified characteristics.

  14. Application of gelatin as a binder for the sulfur cathode in lithium-sulfur batteries

    Energy Technology Data Exchange (ETDEWEB)

    Sun Jing [Department of Material Science and Engineering, Beijing University of Chemical Technology, 15 BeiSanhuan East Road, Beijing 100029 (China); Huang Yaqin [Department of Material Science and Engineering, Beijing University of Chemical Technology, 15 BeiSanhuan East Road, Beijing 100029 (China)], E-mail: huangyaqin9@sina.com; Wang Weikun; Yu Zhongbao; Wang Anbang; Yuan Keguo [Military Power Sources Research and Development Center, Chemical Defense Institute, 35 Huayuan North Road, Beijing 100083 (China)

    2008-10-15

    Gelatin, a natural biological macromolecule, was successfully used as a new binder in place of poly(ethylene oxide) (PEO) in the fabrication of the sulfur cathode in lithium-sulfur batteries. The structure and electrochemical performance of the two types of sulfur cathodes, with gelatin and PEO as binders, respectively, were compared in 1 M LiClO{sub 4} DME/DOL (V/V = 1/1) electrolyte. The results showed that the gelatin binder had multifunctional effects on the sulfur cathode: it not only functioned as a highly adhesive agent and an effective dispersion agent for the cathode materials, but also an electrochemically stable binder. The gelatin binder-sulfur cathode achieved a high initial capacity of 1132 mAh g{sup -1}, and remained at a reversible capacity of 408 mAh g{sup -1} after 50 cycles, all of which were better than with the PEO binder-sulfur cathode under the same conditions.

  15. Application of gelatin as a binder for the sulfur cathode in lithium-sulfur batteries

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Jing; Huang, Yaqin [Department of Material Science and Engineering, Beijing University of Chemical Technology, 15 BeiSanhuan East Road, Beijing 100029 (China); Wang, Weikun; Yu, Zhongbao; Wang, Anbang; Yuan, Keguo [Military Power Sources Research and Development Center, Chemical Defense Institute, 35 Huayuan North Road, Beijing 100083 (China)

    2008-10-15

    Gelatin, a natural biological macromolecule, was successfully used as a new binder in place of poly(ethylene oxide) (PEO) in the fabrication of the sulfur cathode in lithium-sulfur batteries. The structure and electrochemical performance of the two types of sulfur cathodes, with gelatin and PEO as binders, respectively, were compared in 1 M LiClO{sub 4} DME/DOL (V/V = 1/1) electrolyte. The results showed that the gelatin binder had multifunctional effects on the sulfur cathode: it not only functioned as a highly adhesive agent and an effective dispersion agent for the cathode materials, but also an electrochemically stable binder. The gelatin binder-sulfur cathode achieved a high initial capacity of 1132 mAh g{sup -1}, and remained at a reversible capacity of 408 mAh g{sup -1} after 50 cycles, all of which were better than with the PEO binder-sulfur cathode under the same conditions. (author)

  16. An improved sodium silicate binder modified by ultra-fine powder materials

    Institute of Scientific and Technical Information of China (English)

    WANG Ji-na; FAN Zi-tian; WANG Hua-fang; DONG Xuan-pu; HUANG Nai-yu

    2007-01-01

    This paper presents a new method of modifying sodium silicate binder with ultra-fine powders. The sodium silicate binder modified by ultra-fine powder A and the organic B can reduce the addition amount of the binder. The results indicate that the 24 h strength has increased by 39.9% at room temperature and the residual strength has decreased by 30.7% at 800℃, compared to the conventional sodium silicate. An available material to improve the moisture resistance was also found by adding about 2% more inorganic C, and it can increase the moist strength by 20%. In the end, the microanalyses are given to explain the modifying machanism, i. e., the ultra-fine powder A can refine the sodium silicate binder to avoid holes in the binder bond, which can increase the 24 h strength at room temperture, and can lead to more cracks in the bond after the molding sand is heated to 800℃. This is because of the stress caused by the new eutectic complex of modified sodium silicate binder.

  17. Effects of an abdominal binder and electrical stimulation on cough in patients with spinal cord injury.

    Science.gov (United States)

    Lin, K H; Lai, Y L; Wu, H D; Wang, T Q; Wang, Y H

    1998-04-01

    We explored the effect of an abdominal binder, with or without electrical stimulation, on peak expiratory flow rate (PEFR) in 12 paraplegics with complete thoracic cord (T2-T12) injury (mean age 36.0 +/- 1.5 yr) and 12 quadriplegics with complete cervical cord (C4-C8) injury (mean age 36.2 +/- 1.9 yr). The cough was assessed by measuring the PEFR during forceful expiration in a sitting position. The subjects underwent the following experimental maneuvers in a random order with a 10-minute interval between any two maneuvers: 1) voluntary coughing, 2) voluntary coughing with an abdominal binder, and 3) voluntary coughing with an abdominal binder and electrical stimulation. The electrical stimulator (50 Hz with 300 microseconds pulse width) was applied to the abdominal wall. Data were analyzed using multivariate analysis of variance for repeated measures. The abdominal binder did not significantly increase PEFR in either paraplegics or quadriplegics; the abdominal binder combined with electrical stimulation significantly increased PEFR by 15% in the paraplegics and 18% in the quadriplegics. These results indicate that electrical stimulation combined with an abdominal binder improves the cough ability in patients with cervical or thoracic spinal cord injury.

  18. Analysis of the binder yield energy test as an indicator of fatigue behaviour of asphalt mixes

    Science.gov (United States)

    O’Connell, Johan; Mturi, Georges A. J.; Komba, Julius; Du Plessis, Louw

    2017-09-01

    Empirical binder testing has increasingly failed to predict pavement performance in South Africa, with fatigue cracking being one of the major forms of premature pavement distress. In response, it has become a national aspiration to incorporate a performance related fatigue test into the binder specifications for South Africa. The Binder Yield Energy Test (BYET) was the first in a series of tests analysed for its potential to predict the fatigue performance of the binder. The test is performed with the dynamic shear rheometer, giving two key parameters, namely, yield energy and shear strain at maximum shear stress (γτmax). The objective of the investigation was to perform a rudimentary evaluation of the BYET; followed by a more in-depth investigation should the initial BYET results prove promising. The paper discusses the results generated from the BYET under eight different conditions, using six different binders. The results are then correlated with four point bending beam fatigue test results obtained from asphalt mix samples that were manufactured from the same binders. Final results indicate that the BYET is not ideal as an indicator of fatigue performance.

  19. Small things make a big difference: binder effects on the performance of Li and Na batteries.

    Science.gov (United States)

    Chou, Shu-Lei; Pan, Yuede; Wang, Jia-Zhao; Liu, Hua-Kun; Dou, Shi-Xue

    2014-10-14

    Li and Na batteries are very important as energy storage devices for electric vehicles and smart grids. It is well known that, when an electrode is analysed in detail, each of the components (the active material, the conductive carbon, the current collector and the binder) makes a portion of contribution to the battery performance in terms of specific capacity, rate capability, cycle life, etc. However, there has not yet been a review on the binder, though there are already many review papers on the active materials. Binders make up only a small part of the electrode composition, but in some cases, they play an important role in affecting the cycling stability and rate capability for Li-ion and Na-ion batteries. Poly(vinylidene difluoride) (PVDF) has been the mainstream binder, but there have been discoveries that aqueous binders can sometimes make a battery perform better, not to mention they are cheaper, greener, and easier to use for electrode fabrication. In this review, we focus on several kinds of promising electrode materials, to show how their battery performance can be affected significantly by binder materials: anode materials such as Si, Sn and transitional metal oxides; cathode materials such as LiFePO4, LiNi1/3Co1/3Mn1/3O2, LiCoO2 and sulphur.

  20. Essential work of fracture approach to fatigue grading of asphalt binders

    Science.gov (United States)

    Andriescu, Adrian

    The main objective of this thesis was to apply failure mechanics principles to the characterization of fatigue cracking of asphalt pavements and to identify the correlations between the pavement performance and the composition of binders. The essential work of fracture (EWF) method developed herein is an energy-based testing approach used for the fracture characterization of ductile materials. Developed for both binders and asphalt mixtures, the method provides fundamental parameters, such as specific essential work of fracture and critical tip opening displacement, as potential candidates for a better fatigue specification. It was shown that binders from different sources and with the same performance grade can have very different levels of fatigue susceptibility depending on their manufacturing method and hence failure properties. Also, the currently used binder loss modulus as developed by the Strategic Highway Research Program does not correlate with the newly proposed fracture mechanics based parameters. An extensive theological and ductile failure investigation on a large interval of testing conditions was performed for a group of binders that are used in the recently built test sections of Highway 655 in northern Ontario. It was found that the shift factors used in the construction of the master curves of the ductile fracture parameters differ from the shift factors of the rheological master curves. The difference was attributed to the response of the internal structure of the binder at the high strain levels that precede the failure phenomenon.

  1. Advancing the Use of Secondary Inputs in Geopolymer Binders for Sustainable Cementitious Composites: A Review

    Directory of Open Access Journals (Sweden)

    Esther Obonyo

    2011-02-01

    Full Text Available Because of concerns over the construction industry‘s heavy use of cement and the general dissatisfaction with the performance of building envelopes with respect to durability, there is a growing demand for a novel class of ―green‖ binders. Geopolymer binders have re-emerged as binders that can be used as a replacement for Portland cement given their numerous advantages over the latter including lower carbon dioxide emissions, greater chemical and thermal resistance, combined with enhanced mechanical properties at both normal and extreme exposure conditions. The paper focuses on the use of geopolymer binders in building applications. It discusses the various options for starting materials and describes key engineering properties associated with geopolymer compositions that are ideal for structural applications. Specific properties, such as compressive strength, density, pore size distribution, cumulative water absorption, and acid resistance, are comparable to the specifications for structures incorporating conventional binders. This paper presents geopolymer binders, with their three dimensional microstructure, as material for structural elements that can be used to advance the realization of sustainable building systems.

  2. Investigation of film solidification and binder migration during drying of Li-Ion battery anodes

    Science.gov (United States)

    Jaiser, Stefan; Müller, Marcus; Baunach, Michael; Bauer, Werner; Scharfer, Philip; Schabel, Wilhelm

    2016-06-01

    The property determining micro-structure of battery electrodes essentially evolves during drying, appointing it a paramount, yet insufficiently understood processing step in cell manufacturing. The distribution of functional additives such as binder or carbon black throughout the film strongly depends on the drying process. A representative state-of-the-art model system comprising graphite, polymeric binder, carbon black and solvent is investigated to gain an insight into the underlying processes. A new experimental approach is introduced that allows for revelation of the evolution of binder concentration gradients throughout the film during drying. Binder is detected by means of energy-dispersive x-ray spectroscopy (EDS) at the top and bottom surface. Drying kinetics is investigated and the impact of the drying process on electrochemical performance is disclosed. The enrichment of binder at the surface, which is observed while applying high drying rates, is shown to depend on two fundamental processes, namely capillary action and diffusion. The findings reveal characteristic drying stages that provide fundamental insights into film solidification. Based on that, a top-down consolidation mechanism capable of explaining the experimental findings is disclosed. Adhesion of the active layer to the substrate is shown to strongly depend on the local binder concentration in the vicinity of the substrate.

  3. Tapioca binder for porous zinc anodes electrode in zinc–air batteries

    Directory of Open Access Journals (Sweden)

    Mohamad Najmi Masri

    2015-07-01

    Full Text Available Tapioca was used as a binder for porous Zn anodes in an electrochemical zinc-air (Zn-air battery system. The tapioca binder concentrations varied to find the optimum composition. The effect of the discharge rate at 100 mA on the constant current, current–potential and current density–power density of the Zn-air battery was measured and analyzed. At concentrations of 60–80 mg cm−3, the tapioca binder exhibited the optimum discharge capability, with a specific capacity of approximately 500 mA h g−1 and a power density of 17 mW cm−2. A morphological analysis proved that at this concentration, the binder is able to provide excellent binding between the Zn powders. Moreover, the structure of Zn as the active material was not affected by the addition of tapioca as the binder, as shown by the X-ray diffraction analysis. Furthermore, the conversion of Zn into ZnO represents the full utilization of the active material, which is a good indication that tapioca can be used as the binder.

  4. Renew Europe - Technological developments in renewable energy. Proceedings

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2007-07-01

    This event is a symposium for international stakeholders in the field of renewable energy. An accompanying fair addresses the public in the Northern German regions. Especially SMEs interested in meeting their energy demands with renewable energy sources are invited. The main focus of the symposium will be technological aspects of renewable energy production, with a special emphasis to the political and economic framework conditions for renewable energies in North Sea countries and in Central and Eastern Europe. We will introduce and showcase the latest technology trends and research. The symposium aims to stimulate further innovation in the efficient production of energy, especially polygeneration technologies (combined electricity and heat production) for small and decentralised use in companies, schools and housing estates. Best practice examples will be shown and solutions shall be worked out by manufacturers, researchers and policy makers. Only power point presentations available.

  5. Marine Renewable Energy Center

    Energy Technology Data Exchange (ETDEWEB)

    Vigeant, Paul [Univ. of Massachusetts, Dartmouth, MA (United States); Miller, John [Univ. of Massachusetts, Dartmouth, MA (United States); Howes, Brian [Univ. of Massachusetts, Dartmouth, MA (United States); McGowan, Jon G. [Univ. of Massachusetts, Amherst, MA (United States); Baldwin, Kenneth [Univ. of New Hampshire, Durham, NH (United States); Grilli, Annette [Univ. of Rhode Island, Kingston, RI (United States); Terray, Eugene [Woods Hole Oceanographic Inst., Woods Hole, MA (United States)

    2013-10-08

    Project Goals: The funding provided by this contract supported the following activities: A) Test Site Development; B) Seed Grant Funded Technology Development; C) Stakeholder Activities The first year of funding was dedicated to the formation of the NE MREC University Consortium which was comprised of University of Massachusetts Dartmouth (UMD) and Amherst (UMA), Massachusetts Institute of Technology (MIT), Woods Hole Oceanographic Institution (WHOI), University of New Hampshire (UNH), and the University of Rhode Island (URI). The consortium worked together to encourage research and promote benefits of obtaining energy from ocean wind, waves, tides and currents. In addition, NE MREC’s goal was to fund projects aimed at potential test sites with the first year funding going to studies of the potential for tidal device testing in Muskeget Channel, at the General Sullivan Bridge in New Hampshire, and for wave device testing at the proposed National Offshore Renewable Energy Innovation Zone (NOREIZ) located off the Massachusetts coast. The project spanned 4.5 years and addressed three specific tasks that are interrelated but also served as independent investigations.

  6. Renewables 2005. Global status report

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2005-07-01

    This report provides an overview of the status of renewable energy worldwide in 2005. It covers markets, investments, industries, policies, and rural (off-grid) renewable energy in developing countries. By design, the report does not provide analysis, recommendations, or conclusions. An extensive research and review process over several months involving more than 100 researchers and contributors has kept inaccuracies to a minimum. REN21 sees this report as the beginning of an active exchange of views and information. This report reveals some surprising facts about renewable energy, many reflecting strong growth trends and increasing significance relative to conventional energy. (au)

  7. Innovation strategies for renewable energy

    Energy Technology Data Exchange (ETDEWEB)

    McCarthy, S.

    1999-01-01

    Innovation is the commercial exploitation of an invention requiring marketing, management, financial and legal skills. Renewable energy is a high technology, knowledge-based business with a global market and, being decentralised, is suited to all regions of the world. Key issues for an innovation strategy for renewable energy are identified. They include: accessing the available finance for innovation; developing local expertise; networking with renewable energy experts; identifying the best available technology, expertise and technology transfer arrangements and adapting these to the region and enterprise. The ultimate success of the strategy will be judged by the new level of economic activity in the enterprise. (UK)

  8. Coordinated renewable energy support schemes

    DEFF Research Database (Denmark)

    Morthorst, P.E.; Jensen, S.G.

    2006-01-01

    This paper illustrates the effect that can be observed when support schemes for renewable energy are regionalised. Two theoretical examples are used to explain interactive effects on, e.g., the price of power, conditions for conventional power producers, and changes in import and export of power...... RES-E support schemes already has a common liberalised power market. In this case the introduction of a common support scheme for renewable technologies will lead to more efficient sitings of renewable plants, improving economic and environmental performance of the total power system...

  9. Protein

    Science.gov (United States)

    ... Food Service Resources Additional Resources About FAQ Contact Protein Protein is found throughout the body—in muscle, ... the heart and respiratory system, and death. All Protein Isn’t Alike Protein is built from building ...

  10. VT Renewable Energy Sites - Geothermal

    Data.gov (United States)

    Vermont Center for Geographic Information — (Link to Metadata) The Renewable Energy Atlas of Vermont and this dataset were created to assist town energy committees, the Clean Energy Development Fund and other...

  11. VT Renewable Energy Sites - Hydroelectric

    Data.gov (United States)

    Vermont Center for Geographic Information — (Link to Metadata) The Renewable Energy Atlas of Vermont and this dataset were created to assist town energy committees, the Clean Energy Development Fund and other...

  12. VT Renewable Energy Sites - Wind

    Data.gov (United States)

    Vermont Center for Geographic Information — (Link to Metadata) The Renewable Energy Atlas of Vermont and this dataset were created to assist town energy committees, the Clean Energy Development Fund and other...

  13. VT Renewable Energy Sites - Solar

    Data.gov (United States)

    Vermont Center for Geographic Information — (Link to Metadata) The Renewable Energy Atlas of Vermont and this dataset were created to assist town energy committees, the Clean Energy Development Fund and other...

  14. VT Renewable Energy Sites - Landfills

    Data.gov (United States)

    Vermont Center for Geographic Information — (Link to Metadata) The Renewable Energy Atlas of Vermont and this dataset were created to assist town energy committees, the Clean Energy Development Fund and other...

  15. GRENADA. Renewables Readiness Assessment 2012

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-07-01

    Grenada, like many Caribbean islands, is dependent on costly oil imports for its energy needs, including the generation of electricity. The transition to renewable energy could potentially support price reductions and improve the overall competitiveness of key sectors of the economy, particularly tourism. This report provides facts and analysis to support the country's discussion on ways to move forward with the renewable energy agenda. IRENA is ready to provide support in the implementation of the actions identified in this report.

  16. Novel, inorganic composites using porous, alkali-activated, aluminosilicate binders

    Science.gov (United States)

    Musil, Sean

    Geopolymers are an inorganic polymeric material composed of alumina, silica, and alkali metal oxides. Geopolymers are chemical and fire resistant, can be used as refractory adhesives, and are processed at or near ambient temperature. These properties make geopolymer an attractive choice as a matrix material for elevated temperature composites. This body of research investigated numerous different reinforcement possibilities and variants of geopolymer matrix material and characterized their mechanical performance in tension, flexure and flexural creep. Reinforcements can then be chosen based on the resulting properties to tailor the geopolymer matrix composites to a specific application condition. Geopolymer matrix composites combine the ease of processing of polymer matrix composites with the high temperature capability of ceramic matrix composites. This study incorporated particulate, unidirectional fiber and woven fiber reinforcements. Sodium, potassium, and cesium based geopolymer matrices were evaluated with cesium based geopolymer showing great promise as a high temperature matrix material. It showed the best strength retention at elevated temperature, as well as a very low coefficient of thermal expansion when crystallized into pollucite. These qualities made cesium geopolymer the best choice for creep resistant applications. Cesium geopolymer binders were combined with unidirectional continuous polycrystalline mullite fibers (Nextel(TM) 720) and single crystal mullite fibers, then the matrix was crystallized to form cubic pollucite. Single crystal mullite fibers were obtained by the internal crystallization method and show excellent creep resistance up to 1400°C. High temperature flexural strength and flexural creep resistance of pollucite and polycrystalline/single-crystal fibers was evaluated at 1000-1400°C.

  17. Conductive Polymeric Binder for Lithium-Ion Battery Anode

    Science.gov (United States)

    Gao, Tianxiang

    Tin (Sn) has a high-specific capacity (993 mAhg-1) as an anode material for Li-ion batteries. To overcome the poor cycling performance issue caused by its large volume expansion and pulverization during the charging and discharging process, many researchers put efforts into it. Most of the strategies are through nanostructured material design and introducing conductive polymer binders that serve as matrix of the active material in anode. This thesis aims for developing a novel method for preparing the anode to improve the capacity retention rate. This would require the anode to have high electrical conductivity, high ionic conductivity, and good mechanical properties, especially elasticity. Here the incorporation of a conducting polymer and a conductive hydrogel in Sn-based anodes using a one-step electrochemical deposition via a 3-electrode cell method is reported: the Sn particles and conductive component can be electrochemically synthesized and simultaneously deposited into a hybrid thin film onto the working electrode directly forming the anode. A well-defined three dimensional network structure consisting of Sn nanoparticles coated by conducting polymers is achieved. Such a conductive polymer-hydrogel network has multiple advantageous features: meshporous polymeric structure can offer the pathway for lithium ion transfer between the anode and electrolyte; the continuous electrically conductive polypyrrole network, with the electrostatic interaction with elastic, porous hydrogel, poly (2-acrylamido-2-methyl-1-propanesulfonic acid-co-acrylonitrile) (PAMPS) as both the crosslinker and doping anion for polypyrrole (PPy) can decrease the volume expansion by creating porous scaffold and softening the system itself. Furthermore, by increasing the amount of PAMPS and creating an interval can improve the cycling performance, resulting in improved capacity retention about 80% after 20 cycles, compared with only 54% of that of the control sample without PAMPS. The cycle

  18. Renewable Energy Country Profiles. Pacific

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-09-15

    The IRENA Renewable Energy Country Profiles take stock of the latest development of renewable energy in two regions where renewable energy can make a significant contribution to combat climate change and bring modern energy services to everyone: Africa and the Pacific. These two regions are presented separately in this volume and its sister publication. The country profiles combine elements of IRENA analysis with the latest information available from a vast array of sources in order to give a brief yet comprehensive and up-to-date picture of the situation of renewable energy that includes energy supply, electrical capacity, energy access, policies, targets, investment climate, projects and endowment in renewable energy resources. Because of the different timelines of these sources, data presented here refer to years between 2008 and 2012. Data availability also differs from country to country, which makes comparison with a wider regional group possible only for the year for which figures are available for all the members of the group; while this may not be the most recent year, the differences between countries, regions and the world remain striking. The current country profiles are just a starting point; they will be extended upon with new indicators to make them more informative, and maintained as a live product on the IRENA website as a key source of information on renewable energy.

  19. Renewable energy islands in Europe

    Energy Technology Data Exchange (ETDEWEB)

    Oestergaard, Iben [ed.

    1998-12-31

    This publication includes a compiled presentation of various aspects concerning the possible transformation of some European islands into renewable energy communities and these projects were presented by a selection of pioneer islands at the first European Seminar on Renewable Energy Islands, held on the Danish island of Samsoee, 29-30 June 1998. This issue has increased in importance with the presentation of the ambitious EU-White Paper: `Energy for the future: Renewable Sources of Energy` which was adopted in 1998. One of the key elements of the strategy for an accelerated implementation of renewable energy is to transform 100 localities within Europe into communities which are to be 100% self-sufficient with renewable energy before 2010. In line with this strategy, the Danish Government appointed the island of Samsoe towards the end of 1997 to be the first `official` Danish, renewable energy island. This is to serve as a demonstration project for other local communities, both in Denmark as well as in the rest Europe. Gothland, Madeira, Canary Islands, Cape Verde, Arki, Crete, Minorca and Orkney Islands were represented. Environmental advantages of wind, solar and wave power for distant island communities were indicated. Serious savings would be achieved by limitation of fossil fuel import and utilization of local resources. (EG)

  20. Renewable Energy Country Profiles. Africa

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-02-15

    The IRENA Renewable Energy Country Profiles take stock of the latest development of renewable energy in two regions where renewable energy can make a significant contribution to combat climate change and bring modern energy services to everyone: Africa and the Pacific. These two regions are presented separately in this volume and its sister publication. The country profiles combine elements of IRENA analysis with the latest information available from a vast array of sources in order to give a brief yet comprehensive and up-to-date picture of the situation of renewable energy that includes energy supply, electrical capacity, energy access, policies, targets, investment climate, projects and endowment in renewable energy resources. Because of the different timelines of these sources, data presented here refer to years between 2008 and 2012. Data availability also differs from country to country, which makes comparison with a wider regional group possible only for the year for which figures are available for all the members of the group; while this may not be the most recent year, the differences between countries, regions and the world remain striking. The current country profiles are just a starting point; they will be extended upon with new indicators to make them more informative, and maintained as a live product on the IRENA website as a key source of information on renewable energy.

  1. Evolution of microstructure and dimension of as-molded parts during thermal removal process of wax-based MIM binder

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The evolution of the microstructure and the dimension of as-molded parts were studied on the basis of the thermogravimetric analysis of wax-based MIM binder. The results show that the binder removal speeds are different in different temperature ranges during binder removal process. The evolution of the microstructure of as-molded parts during binder removal process clearly showed the initiation and formation of connected pore structure, which is the removal channel of the binder. The as-molded parts almost continuously shrank through binder removal process, except an expansion stage during 320~440  ℃, which is the dissolution expansion effect due to the dissolution of VPW in the polymer melt.

  2. The effect of crumb rubber particle size to the optimum binder content for open graded friction course.

    Science.gov (United States)

    Ibrahim, Mohd Rasdan; Katman, Herda Yati; Karim, Mohamed Rehan; Koting, Suhana; Mashaan, Nuha S

    2014-01-01

    The main objective of this paper is to investigate the relations of rubber size, rubber content, and binder content in determination of optimum binder content for open graded friction course (OGFC). Mix gradation type B as specified in Specification for Porous Asphalt produced by the Road Engineering Association of Malaysia (REAM) was used in this study. Marshall specimens were prepared with four different sizes of rubber, namely, 20 mesh size [0.841 mm], 40 mesh [0.42 mm], 80 mesh [0.177 mm], and 100 mesh [0.149 mm] with different concentrations of rubberised bitumen (4%, 8%, and 12%) and different percentages of binder content (4%-7%). The appropriate optimum binder content is then selected according to the results of the air voids, binder draindown, and abrasion loss test. Test results found that crumb rubber particle size can affect the optimum binder content for OGFC.

  3. [Use of the aluminum phosphate-binders in hemodialysis in the ultrapure water era].

    Science.gov (United States)

    Arenas, Maria D; Malek, T; Gil, M T; Moledous, A; Núñez, C; Alvarez-Ude, F

    2008-01-01

    Aluminium binder has been ill-advised, but his use remain applicable in the clinique practice in very seleccionated and particular patients. The repercussion of prolonged treatment with low doses of aluminium phosphate-binders in haemodialysis was studied. The haemodialysis unit had a double osmosis inverse and the aluminium levels in haemodialysis liquid was less than 2 micrograms/liter. 41 patients of the 295 on haemodialysis received aluminium phosphate-binders since the 2005 January to the 2007 November. The mean time of treatment was 17.8 months, and the doses was 3.9 tablets day (mean of 463 grams in the studied period). The association of low doses of aluminium phosphate-binders permitted a better control of phosphorus (6.8 to 4.8 mg/dl; p<0.0001), with a reduction of the others phosphate-binders: sevelamer (10.4 a 8 tablets/day; p<0.0001) and calcium phosphate-binders (4.6 to 3.1 tablets/day; p<0.0001). The serum aluminium increased after the aluminium treatment (6.8 to 13.8 mcg/l; p<0.0001), and no toxicity indirect signs were observed on CMV, haemoglobin, none PTH. Five patients (12.1%) reached aluminium serum levels higher 20 mcg/l, and none reached the 40 mcg/l. The aluminium phosphate-binders were effective, economical and, now, with an apparent better security profile than in a previous time, but it is very important to be careful with this use and to follow a vigilance strict on patients and haemodialysis liquid.

  4. 2011 Renewable Energy Data Book (Book)

    Energy Technology Data Exchange (ETDEWEB)

    Gelman, R.

    2012-10-01

    This Renewable Energy Data Book for 2011 provides facts and figures on energy in general, renewable electricity in the United States, global renewable energy development, wind power, solar energy, geothermal power, biopower, hydropower, advanced water power, hydrogen, renewable fuels, and clean energy investments.

  5. 2012 Renewable Energy Data Book (Book)

    Energy Technology Data Exchange (ETDEWEB)

    Gelman, R.

    2013-10-01

    This Renewable Energy Data Book for 2012 provides facts and figures in a graphical format on energy in general, renewable electricity in the United States, global renewable energy development, wind power, solar power, geothermal power, biopower, hydropower, advanced water power, hydrogen, renewable fuels, and clean energy investment.

  6. 2013 Renewable Energy Data Book (Book)

    Energy Technology Data Exchange (ETDEWEB)

    Esterly, S.

    2014-12-01

    This Renewable Energy Data Book for 2013 provides facts and figures on energy in general, renewable electricity in the United States, global renewable energy development, wind power, solar power, geothermal power, biopower, hydropower, advanced water power, hydrogen, renewable fuels, and clean energy investment.

  7. 2010 Renewable Energy Data Book (Book)

    Energy Technology Data Exchange (ETDEWEB)

    Gelman, R.

    2011-10-01

    This Renewable Energy Data Book for 2010 provides facts and figures on energy in general, renewable electricity in the United States, global renewable energy development, wind power, solar energy, geothermal power, biopower, hydropower, advanced water power, hydrogen, renewable fuels, and clean energy investments.

  8. 2009 Renewable Energy Data Book, August 2010

    Energy Technology Data Exchange (ETDEWEB)

    2010-08-01

    This Renewable Energy Data Book for 2009 provides facts and figures on energy in general, renewable electricity in the United States, global renewable energy development, wind power, solar energy, geothermal power, biopower, hydropower, advanced water power, hydrogen, renewable fuels, and clean energy investments.

  9. Comparison of the activities of binder-added and binder-free Mo/HZSM-5 catalysts in methane dehydroaromatization at 1073 K in periodic CH4-H2 switch operation mode

    Institute of Scientific and Technical Information of China (English)

    Yuebing Xu; Hongtao Ma; Yo Yamamoto; Yoshizo Suzuki; Zhanguo Zhang

    2012-01-01

    Three industry-supplied,well-shaped Mo/HZSM-5 catalysts,two binder-added and one binder-free,were tested for the first time in methane dehydroaromatization to benzene at 1073 K and 10000 mL/(g.h) in periodic CH4-H2 switch operation mode,and their catalytic performances were compared with those of three self-prepared,binder-free powder Mo/HZSM-5 catalysts.XRD,27Al NMR,SEM,BET and NH3-TPD characterizations of all the catalysts show that the zeolites in the two binder-added catalysts are comparable to those in the three binder-free powder catalysts in crystallinity,crystal size,micropore volume and Br(¢)nsted acidity.The test results,on the other hand,show that the catalytic performances of the two binder-added catalysts are worse than those of the four binder-free catalysts on both catalyst mass and zeolite mass bases.Then,TPO and BET measurements of all spent samples were conducted to get a deep insight into the negative effects of binder addition,and the results suggest that the binder additives functioned mainly to enhance the polyaromatization of formed aromatics to coke on their external surfaces and consequently lower the benzene formation activity and selectivity of the catalyst.

  10. In Silico Design of Smart Binders to Anthrax PA

    Science.gov (United States)

    2012-09-01

    34GRAMM-X public web server for protein-protein docking," Nucleic Acids Research , vol. 34, pp. 310-314, 2006. [3] A. Saladin, et al., "PTools: an...Online]. [13] H. M. Berman, et al., "The Protein Data Bank," Nucleic Acids Research , vol. 28, pp. 235-242, 1999. [14] J. A. D. MacKerell, et al

  11. Influence of fluoropolymer binders on the electrochemical performance of C-LiFePO4 based cathodes

    OpenAIRE

    A. Goren; Costa, C M; Silva, Maria Manuela; Lanceros-Méndez, S.

    2016-01-01

    The polymer binder plays a relevant role in the performance of battery electrodes. This work proposes poly(vinylidene fluoride-co-trifluoroethylene), PVDF-TrFE, as a polymer binder for C-LiFePO4 based cathodes and investigates its effect in the electrochemical properties of the cathodes. Morphological, electrical, swelling and electrochemical properties were investigated for this polymer binder and the results were compared with the ones from two other fluoropolymers, poly(v...

  12. Meat & bone meal extract and gelatin as renewable flocculants

    Science.gov (United States)

    The purpose of this research was to determine whether proteins have a nonfood use as renewable clay flocculants to potentially replace polyacrylamide (PAM), a flocculant derived from petroleum. A laboratory test for clay sedimentation was developed as a measure of flocculation ability. This test w...

  13. Evaluation of strength-enhancing factors of a ductile binder in direct compression of sodium bicarbonate and calcium carbonate powders.

    Science.gov (United States)

    Mattsson, S; Nyström, C

    2000-03-01

    This study evaluated the effectiveness of a ductile binder in direct compression of sodium bicarbonate and calcium carbonate powders. Properties associated with both the binder and the compound were studied. The addition of binder materials, such as polyethylene glycols (PEGs) of differing molecular weights or microcrystalline cellulose, generally resulted in an increase in the axial tensile strength of the corresponding compacts. The increase in tablet strength was generally greater with the PEGs than with microcrystalline cellulose. The results indicate that the improvement in tablet strength caused by the binder is dependent on properties of both the binder and the compound. By utilising different methods it was established that the fracture during tablet strength testing mainly occurred around the compound particles. As a consequence of this, it appears that the ability of the binder to fill the voids between the compound particles is a determinative factor for increasing tablet strength. The binder appeared to have less effect when added to compounds that fragmented during compaction. Characteristics of the binder resulting in the greatest decrease in porosity, and thus the greatest increase in the tensile strength of the compound, included a high degree of plastic deformation with a limited elastic component and a small particle size. Obviously, the amount of binder added to the mixture also affected the results.

  14. Adhesive Bonding and Self-Curing Characteristics of α-Starch Based Composite Binder for Green Sand Mould/Core

    Institute of Scientific and Technical Information of China (English)

    Xia ZHOU; Jinzong YANG; Guohui QU

    2004-01-01

    Interactions between different components in α-starch based composite binder for green sand mould/core were investigated by using XRD, IR spectra, 1H NMR spectra and SEM. Several adhesive hardening structures and theories of the binder at room temperature were proposed according to the interactions between various compositions. Thus,the reasons for the binder to have excellent combination properties and unique adhesive bonding and self-curing characteristics were explained by these theories successfully. And the theories are of great directive importance to design and development of composite binder for green sand mould/core.

  15. Emission of organic compounds from mould and core binders used for casting iron, aluminium and bronze in sand moulds.

    Science.gov (United States)

    Tiedje, Niels; Crepaz, Rudolf; Eggert, Torben; Bey, Niki

    2010-12-01

    Emissions from mould and core sand binders commonly used in the foundry industry have been investigated. Degradation of three different types of binders was investigated: Furfuryl alcohol (FA), phenolic urethane (PU) and resol-CO2 (RC). In each group of binders, at least two different binder compositions were tested. A test method that provides uniform test conditions is described. The method can be used as a general test method to analyse off gases from binders. Moulds, containing a standard size casting, were produced and the amount and type of organic compounds, resulting from thermal degradation of binders, was monitored when cast iron, bronze and aluminium was poured in the moulds. Binder degradation was measured by collecting off gases in a specially designed ventilation hood at a constant flow rate. Samples were taken from the ventilation system and analysed for hydrocarbons and CO content. It is shown how off-gases vary with time after pouring and shake out. Also the composition of off-gases is analysed and shown. It is further shown how the composition of off-gasses varies between different types of binders and with varying composition of the binders as well as function of the thermal load on the moulding sand.

  16. Strength loss in MA-MOX green pellets from radiation damage to binders

    Science.gov (United States)

    Lessing, Paul A.; Cannon, W. Roger; Egeland, Gerald W.; Zuck, Larry D.; Jewell, James K.; Akers, Douglas W.; Groenewold, Gary S.

    2013-06-01

    The fracture strength of green Minor Actinides (MA)-MOX pellets containing 75 wt.% DUO2, 20 wt.% PuO2, 3 wt.% AmO2 and 2 wt.% NpO2 was studied as a function of storage time, after mixing with the binder and before sintering, to test the effect of radiation damage on binders. Fracture strength degraded continuously over the 10 days of the study for all three binders studied: PEG binder (Carbowax 8000), microcrystalline wax (Mobilcer X) and styrene-acrylic copolymer (Duramax B1022) but the fracture strength of Duramax B1022 degraded the least. For instance, for several hours after mixing Carbowax 8000 with MA-MOX, the fracture strength of a pellet was reasonably high and pellets were easily handled without breaking but the pellets were too weak to handle after 10 days. Strength measured using diametral compression test showed that strength degradation was more rapid in pellets containing 1.0 wt.% Carbowax PEG 8000 compared to those containing only 0.2 wt.%, suggesting that irradiation not only left the binder less effective but also reduced the pellet strength. In contrast the strength of pellets containing Duramax B1022 degraded very little over the 10 days period. It was suggested that the styrene portion present in the Duramax B1022 copolymer provided the radiation resistance.

  17. Strength Loss in MA-MOX Green Pellets from Radiation Damage to Binders

    Energy Technology Data Exchange (ETDEWEB)

    Paul A. Lessing; W.R. Cannon; Gerald W. Egeland; Larry D. Zuck; James K. Jewell; Douglas W. Akers; Gary S. Groenewold

    2013-06-01

    The fracture strength of green Minor Actinides (MA)-MOX pellets containing 75 wt.% DUO2, 20 wt. % PuO2, 3 wt. % AmO2 and 2 wt. % NpO2 was studied as a function of storage time, after mixing in the binder and before sintering, to test the effect of radiation damage on binders. Fracture strength degraded continuously over the 10 days of the study for all three binders studied: PEG binder (Carbowax 8000), microcrystalline wax (Mobilcer X) and Styrene-acrylic copolymer (Duramax B1022) but the fracture strength of Duramax B1022 degraded the least. For instance, for several hours after mixing Carbowax 8000 with MA MOX, the fracture strength of a pellet was reasonably high and pellets were easily handled without breaking but the pellets were too weak to handle after 10 days. Strength measured using diametral compression test showed strength degradation was more rapid in pellets containing 1.0 wt. % Carbowax PEG 8000 compared to those containing only 0.2 wt. %, suggesting that irradiation not only left the binder less effective but also reduced the pellet strength. In contrast the strength of pellets containing Duramax B1022 degraded very little over the 10 day period. It was suggested that the styrene portion of the Duramax B1022 copolymer provided the radiation resistance.

  18. Strength loss in MA-MOX green pellets from radiation damage to binders

    Energy Technology Data Exchange (ETDEWEB)

    Lessing, Paul A. [Idaho National Laboratory, Idaho Falls, ID 83415 (United States); Cannon, W. Roger, E-mail: wrogercannon@gmail.com [Idaho National Laboratory, Idaho Falls, ID 83415 (United States); Egeland, Gerald W.; Zuck, Larry D.; Jewell, James K.; Akers, Douglas W.; Groenewold, Gary S. [Idaho National Laboratory, Idaho Falls, ID 83415 (United States)

    2013-06-15

    The fracture strength of green Minor Actinides (MA)-MOX pellets containing 75 wt.% DUO{sub 2}, 20 wt.% PuO{sub 2}, 3 wt.% AmO{sub 2} and 2 wt.% NpO{sub 2} was studied as a function of storage time, after mixing with the binder and before sintering, to test the effect of radiation damage on binders. Fracture strength degraded continuously over the 10 days of the study for all three binders studied: PEG binder (Carbowax 8000), microcrystalline wax (Mobilcer X) and styrene–acrylic copolymer (Duramax B1022) but the fracture strength of Duramax B1022 degraded the least. For instance, for several hours after mixing Carbowax 8000 with MA-MOX, the fracture strength of a pellet was reasonably high and pellets were easily handled without breaking but the pellets were too weak to handle after 10 days. Strength measured using diametral compression test showed that strength degradation was more rapid in pellets containing 1.0 wt.% Carbowax PEG 8000 compared to those containing only 0.2 wt.%, suggesting that irradiation not only left the binder less effective but also reduced the pellet strength. In contrast the strength of pellets containing Duramax B1022 degraded very little over the 10 days period. It was suggested that the styrene portion present in the Duramax B1022 copolymer provided the radiation resistance.

  19. Evaluation of the rheological behavior of asphaltic binder modified with zeolite material

    Energy Technology Data Exchange (ETDEWEB)

    Silveira, E.M. da; Sant' ana, Hosiberto B.; Soares, Sandra A.; Soares, Jorge B. [Federal University of Ceara, Fortaleza, CE (Brazil)

    2008-07-01

    Several new processes have been developed to reduce mixing and compaction temperatures of hot mix asphalt without sacrificing the quality of the resulting pavement. One of these processes utilizes the zeolite, a crystalline hydrated aluminum silicate. A laboratory study was conducted to determine the applicability of zeolite to improve the rheological and chemical behavior of an asphaltic binder. The synthetic asphaltic binder was produced with different zeolite contents (0,1; 0.3; and 0.5% w/w) by wet process. The rheological and chemical behavior was verified by Dynamic Shear Rheometer and Infrared Spectroscopy, respectively. The zeolite's chemical composition and morphology was studied by Dispersive X-ray Spectroscopy (EDX). Additionally, the scanning electron microscope (SEM) was utilized to establish the zeolite elemental composition. The results showed that investigated zeolite was classified as a sodium aluminum silicate and it was able to modify the rheological properties of the neat asphalt binder. The G*/sin{delta} parameter was affected by the zeolite presence, indicating better performance for the binders with zeolite. The results show that synthetic binders can partly replicate the rheological properties of conventional AB. Comparable complex modulus values was obtained. No significant difference was found in viscoelastic response, given by the phase angles as a function of both temperature and frequency. (author)

  20. Physical and Combustion Characteristics of Briquettes Made from Water Hyacinth and Phytoplankton Scum as Binder

    Directory of Open Access Journals (Sweden)

    R. M. Davies

    2013-01-01

    Full Text Available The study investigated the potential of water hyacinths and phytoplankton scum, an aquatic weed, as binder for production of fuel briquettes. It also evaluated some physical and combustion characteristics. The water hyacinths were manually harvested, cleaned, sun-dried, and milled to particle sizes distribution ranging from <0.25 to 4.75 mm using hammer mill. The water hyacinth grinds and binder (phytoplankton scum at 10% (B1, 20% (B2, 30% (B3, 40% (B4, and 50% (B5 by weight of each feedstock were fed into a steel cylindrical die of dimension 14.3 cm height and 4.7 cm diameter and compressed by hydraulic press at pressure 20 MPa with dwell time of 45 seconds. Data were analysed using analysis of variance and descriptive statistics. Initial bulk density of uncompressed mixture of water hyacinth and phytoplankton scum at different binder levels varied between 113.86 ± 3.75 (B1 and 156.93 ± 4.82 kg/m3 (B5. Compressed and relaxed densities of water hyacinth briquettes at different binder proportions showed significant difference . Durability of the briquettes improved with increased binder proportion. Phytoplankton scum improved the mechanical handling characteristics of the briquettes. It could be concluded that production of water hyacinth briquettes is feasible, cheaper, and environmentally friendly and that they compete favourably with other agricultural products.

  1. Influence of Cellulosic Binders on Sensitivity and Combustion Behaviour of B-KNO3 Ignition System

    Directory of Open Access Journals (Sweden)

    Varsha Bhingarkar

    2006-07-01

    Full Text Available Boron-potassium nitrate (B-KNO3-based compositions have been used as an effective ignitersystem for solid rocket propellants. A systematic study was undertaken to generate exhaustivedata on B-KNO3 (25:65-based ignition systems with cellulosic binders, viz., nitrocellulose, ethylcellulose and plasticised ethyl cellulose. In addition, detailed investigations were carried outwith PEC as binder by varying its concentration from 2-10 per cent in the same system. Theexperimental compositions (B-KNO3: binder were evaluated by closed-vessel firing, thermalanalysis, sensitivity, mechanical properties and cal-val determination. The binders significantlyinfluenced the sensitivity and combustion behaviour of B-KNO3 compositions. The compositionwith nitrocellulose as binder produced high flame temperature and cal-val as compared to ethylcellulose and plasticised ethyl cellulose-based compositions. The data indicated that thecalculated flame temperature for all compositions was in the range 2716 K to 2957 K. As theplasticised ethyl cellulose content increased from 2 per cent to 10 per cent, the maximum pressureincreased with decrease in heat of combustion.

  2. Rheological and thermal performance of newly developed binder systems for ceramic injection molding

    Science.gov (United States)

    Hausnerova, Berenika; Kasparkova, Vera; Hnatkova, Eva

    2016-05-01

    In a novel binder system, carnauba wax was considered to replace the synthetic backbone polymers (polyolefins) enhancing the environmental sustainability of Ceramic Injection Molding (CIM) technology. The paper presents comparison of the rheological performance and thermal behavior of the aluminum oxide CIM feedstocks based on a binder containing carnauba wax with those consisting of a commercial binder. Further, acrawax (N, N'-Ethylene Bis-stearamide) has been considered as another possible substitute of polyolefins. For both proposed substitutes there is a significant reduction in viscosity, and in case of carnauba wax based feedstock also in processing temperature, which is essential for injection molding of reactive powders. Thermal characterization comprised analyses of single neat binders, their mixtures and mixtures with aluminum oxide. The presence of powder lowered melting temperatures of all tested binders except of polyolefin. Further depression in melting point of poly(ethylene glycol) is observed in combination with polyolefin in the presence of powder, and it is related to changes in size of the crystalline domains.

  3. Influence of binder droplet dimension on granulation rate during fluidized bed granulation.

    Science.gov (United States)

    Fujiwara, Maya; Dohi, Masafumi; Otsuka, Tomoko; Yamashita, Kazunari; Sako, Kazuhiro

    2013-01-01

    Here, we statistically identified the critical factor of the granulation rate during the fluidized bed granulation process. Lactose was selected as the excipient and was granulated with several binders, including hydroxypropyl cellulose, hydroxypropyl methyl cellulose, and polyvinylpyrrolidone. The viscosity, density, and surface tension of the binder solution, contact angle, and the work done during adhesion and cohesion between the binder and lactose, mist diameter, Stokes number, and the dimension of the droplet were considered. The Stokes number was defined as the ratio of the inertial force to the viscous-damping force of a particle. We confirmed that droplet diameter after adhesion had the highest correlation coefficient with the granulation rate constant in our investigated parameters. Partial least squares regression revealed two critical principal components of the granulation rate: one relating to the droplet dimension, which is composed of mist diameter and diameter and thickness of the droplet after adhesion of the binder to the lactose surface; and the other relating to wettability, which involves the work done during adhesion and cohesion, surface tension, and the thickness of the droplet after adhesion of the binder to the lactose surface.

  4. Influence of solidification accelerators on structure formation of anhydrite-containing binders

    Energy Technology Data Exchange (ETDEWEB)

    Anikanova, L., E-mail: alasmit@mail.ru; Volkova, O., E-mail: v.olga.nikitina@gmail.com; Kudyakov, A.; Sarkisov, Y.; Tolstov, D. [Tomsk State University of Architecture and Building, 2 Solyanaya sq., Tomsk, 634003 (Russian Federation)

    2016-01-15

    The article presents results of scientific analysis of chemical additives influence on acid fluoride binder. It was found that the influence of sulfate nature additives on the process of hydration and solidification of the binder is similar to influence of additives on indissoluble anhydrite. Additives with SO{sub 4}{sup 2−} anion NO{sup −} are more efficient. The mentioned additives according to accelerating effect belong to the following succession: K{sub 2}SO{sub 4} > Na{sub 2}SO{sub 4} > FeSO{sub 4} > MgSO{sub 4}. Facilitation of the process of hydration and solidification of the binder, increase in density and durability of the binder (32 MPa) is to the greatest extent achieved with the introduction of 2% sodium sulfate additive of the binder’s mass into the composition of the binder along with the ultrasonic treatment of water solution. Directed crystal formation process with healing of porous structure by new growths presented as calcium sulfate dehydrate and hydroglauberite provides positive effect.

  5. Control of binder viscosity and hygroscopicity on particle aggregation efficiency

    Science.gov (United States)

    Mueller, Sebastian B.; Kueppers, Ulrich; Ayris, Paul M.; Jacob, Michael; Delmelle, Pierre; Dingwell, Donald B.

    2016-04-01

    In the course of explosive volcanic eruptions, large amounts of ash are released into the atmosphere and may subsequently pose a threat to infrastructure, such as aviation industry. Ash plume forecasting is therefore a crucial tool for volcanic hazard mitigation but may be significantly affected by aggregation, altering the aerodynamic properties of particles. Models struggle with the implementation of aggregation since external conditions promoting aggregation have not been completely understood; in a previous study we have shown the rapid generation of ash aggregates through liquid bonding via the use of fluidization bed technology and further defined humidity and temperature ranges necessary to trigger aggregation. Salt (NaCl) was required for the recovery of stable aggregates, acting as a cementation agent and granting aggregate cohesion. A numerical model was used to explain the physics behind particle aggregation mechanisms and further predicted a dependency of aggregation efficiency on liquid binder viscosity. In this study we proof the effect of viscosity on particle aggregation. HCl and H2SO4 solutions were diluted to various concentrations resulting in viscosities between 1 and 2 mPas. Phonolitic and rhyolitic ash samples as well as soda-lime glass beads (serving as analogue material) were fluidized in the ProCell Lab® of Glatt Ingenieurtechnik GmbH and treated with the acids via a bottom-spray technique. Chemically driven interaction between acid liquids and surfaces of the three used materials led to crystal precipitation. Salt crystals (e.g. NaCl) have been confirmed through scanning electron microscopy (SEM) and leachate analysis. Both volcanic ash samples as well as the glass beads showed a clear dependency of aggregation efficiency on viscosity of the sprayed HCl solution. Spraying H2SO4 provoked a collapse of the fluidized bed and no aggregation has been observed. This is accounted by the high hygroscopicity of H2SO4. Dissolving CaCl2 (known to be

  6. Technology and mechanism of a new protein-based core sand for aluminum casting

    Institute of Scientific and Technical Information of China (English)

    石晶玉; 黄天佑; 石红玉; 何镇明

    2001-01-01

    The protein-based binding material is from natural products, which is nontoxic and recyclable. This kind of green binder is earnestly needed by aluminum casting products. The new protein-based core possesses higher strength and easier shakeout. Its tensile strength is close to that of common resin sands. The micro-mechanism of protein binder was investigated by using infrared spectrum, chemical element analysis, SEM and thermal lost-mass analysis.

  7. Thermodynamics of the interaction between bovine binder of sperm BSP1 and low-density lipoprotein from hen's egg yolk

    Energy Technology Data Exchange (ETDEWEB)

    Lusignan, Marie-France; Manjunath, Puttaswamy [Maisonneuve-Rosemont Hospital Research Center and Department of Medicine, Universite de Montreal, C.P. 6128, Succ. Centre Ville, Montreal, Quebec, Canada H3C 3J7 (Canada); Lafleur, Michel, E-mail: michel.lafleur@umontreal.ca [Department of Chemistry, Centre for Self-Assembled Chemical Structures (CSACS), Universite de Montreal, C.P. 6128, Succ. Centre Ville, Montreal, Quebec, Canada H3C 3J7 (Canada)

    2011-03-20

    Research highlights: {yields} Isothermal titration calorimetry revealed Binder-of-SPerm BSP1 protein has high affinity for egg yolk low density lipoproteins. {yields} It is estimated that 104 BSP1 molecules could bind one LDL particle. {yields} BSP1 has 2 phosphocholine binding sites and the BSP1/LDL ratio corresponds to 1.6 phosphatidylcholine per bound BSP1. {yields} The strong interaction between LDL particles and BSP1 is proposed to be important for sperm protection by egg yolk extender. - Abstract: Egg yolk is used in extender to protect sperm from cold shock and freezing during preservation. It is the low-density lipoprotein (LDL) fraction of egg yolk that protects sperm. Even though essential for sperm capacitation, the major proteins from bull seminal plasma, the Binder of SPerm (BSP) proteins, are detrimental for sperm preservation because they induce a continual phospholipids and cholesterol efflux from sperm membranes. The BSP proteins were proposed to bind to egg yolk LDL, preventing the sperm membrane damage. We characterized the binding between the BSP proteins and the LDL by isothermal titration calorimetry, providing the thermodynamics and quantitative description of this putative association. The association between BSP1 (major BSP proteins) and LDL is characterized by an affinity constant (K{sub a}) of 3.4 {+-} 0.4 {mu}M{sup -1}. A protein/LDL ratio of 104 {+-} 5 was determined indicating that 104 molecules of BSP1 would bind to one LDL particle. This stoichiometry leads to proposing that the association involves 1.6 {+-} 0.1 phosphatidylcholines (PC) per BSP protein. This finding is satisfactorily consistent with the fact that each BSP1 protein has 2 binding sites for choline group. In conclusion, the formation of a high affinity complex between BSP1 and LDL is proposed to be important for the protection of sperm by egg yolk extender.

  8. MENA Renewables Status Report 2013

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2013-06-15

    The MENA Renewables Status Report is an outcome of ADIREC, the Abu Dhabi International Renewable Energy Conference. The report provides a status overview of renewable energy markets, industry, policy and investment trends in the region, drawing on the most recent data available. It is produced in cooperation with over 50 contributors and researchers in the region and reveals massive growth in the renewable energy markets of the Middle East and North Africa (MENA). Regional investment topped US$2.9 billion in 2012, up 40% from 2011 and 650% from 2004. With over 100 projects under development, the region could see a 450% increase in non-hydro renewable energy generating capacity in the next few years. For the report, the 21 MENA countries were clustered into two sub-groups: Net Oil-Exporting Countries (NOEC) -- Algeria, Bahrain, Egypt, Iran, Iraq, Kuwait, Libya, Oman, Qatar, Saudi Arabia, Syria, United Arab Emirates, and Yemen; and Net Oil-Importing Countries (NOIC) -- Djibouti, Israel, Jordan, Lebanon, Malta, Morocco, Palestine, and Tunisia.

  9. Superstatistics and renewal critical events

    Science.gov (United States)

    Paradisi, Paolo; Cesari, Rita; Grigolini, Paolo

    2009-09-01

    An approach to intermittent systems based on renewal processes is reviewed. The Waiting Times (WTs) between events are the main variables of interest in intermittent systems. A crucial role is played by the class of critical events, characterized by Non-Poisson statistics and non-exponential WT distribution. A particular important case is given by WT distributions with power tail. Critical events play a crucial role in the behavior of a property known as Renewal Aging. Focusing on the role of critical events, the relation between superstatistics and non-homogeneous Poisson processes is discussed, and the role of Renewal Aging is illustrated by comparing a Non-Poisson model with a Poisson one, both of them modulated by a periodic forcing. It is shown that the analysis of Renewal Aging is sensitive to the presence of critical events and that this property can be exploited to detect Non-Poisson statistics in a time series. As a consequence, it is claimed that, apart from the characterization of superstatistical features such as the distribution of the intensive parameter or the separation of the time scales, the Renewal Aging property can give some effort to better determine the role of Non-Poisson critical events in intermittent systems.

  10. Renewal and Change (Editorial

    Directory of Open Access Journals (Sweden)

    Denise Koufogiannakis

    2011-01-01

    Full Text Available The end of yet another calendar year leads to a time of new beginnings and new challenges. For me, this is the end of my three year term as Editor-in-Chief of EBLIP, which has been a very rewarding challenge personally and professionally. I would like to thank each and every person who has contributed to the success of the journal. EBLIP relies on the talented and professional people who regularly give of their time and expertise. I particularly want to thank the Editorial Team who has worked so closely with me over the past three years: Alison Brettle, Lorie Kloda, Katrine Mallan, Jonathan Eldredge, Michelle Dunaway, and our former intern Andrea Baer. Thank you!In the past three years, EBLIP has continued to grow and thrive. We currently have more than 3400 registered readers, and an Editorial Advisory Board comprised of 70 people from 11 countries. Several of our papers have had more than 5000 pdf downloads, and the average number of downloads is 1308. I am also pleased to let you know that we have recently been accepted for inclusion in Scopus.In looking back and reflecting on the past three years, we have continued to build a strong open access journal that is relevant to LIS practitioners. We have increased the number of articles being published, and the overall number of submissions. Content is wide ranging, including multiple sectors within library and information studies. Our evidence summaries continue to be the heart of our journal, with more and more research from our field being critically appraised in this way. We have also added new sections such as Using Evidence in Practice, in which authors reflect on incorporating evidence into practice.And now it is time yet again for renewal and change. I am very pleased to welcome Alison Brettle of the University of Salford, as she begins her three year term as Editor-in-Chief. Alison has been the Associate Editor (Articles since the very early days of publication and brings extensive

  11. Nanoparticles from Renewable Polymers

    Science.gov (United States)

    Wurm, Frederik; Weiss, Clemens

    2014-07-01

    The use of polymers from natural resources can bring many benefits for novel polymeric nanoparticle systems. Such polymers have a variety of beneficial properties such as biodegradability and biocompatibility, they are readily available on large scale and at low cost. As the amount of fossil fuels decrease, their application becomes more interesting even if characterization is in many cases more challenging due to structural complexity, either by broad distribution of their molecular weights polysaccharides, polyesters, lignin) or by complex structure (proteins, lignin). This review summarizes different sources and methods for the preparation of biopolymer-based nanoparticle systems for various applications.

  12. Introduction to Renewable Energy Systems

    DEFF Research Database (Denmark)

    Ma, Ke; Yang, Yongheng; Blaabjerg, Frede

    2014-01-01

    In this chapter, the state-of-the-arts developments of renewable energy are reviewed in respect to the installed power and market share, where wind power and photovoltaic power generation are the main focuses due to the fast growing speed and large share of installed capacity. Some basic principles...... of operation, mission profiles, as well as power electronics solutions and corresponding controls are discussed respectively in the case of wind power and photovoltaic power systems. Finally a few development trends for renewable energy conversions are also given from a power electronics point of view....... It is concluded that as the quick development of renewable energy, wind power and PV power both show great potential to be largely integrated into the power grid. Power electronics is playing essential role in both of the systems to achieve more controllable, efficient, and reliable energy production...

  13. Effect of Tar-resin Binder on Properties of MgO-C Monolithic Refractories

    Institute of Scientific and Technical Information of China (English)

    Hady EFENDY; Wan Mohd.Farid BIN WAN MOHAMAD

    2010-01-01

    Based on the newly developed bonding system,a new generation of carbon-bonded MgO-C monolithic refractories product with low toxic potential has been developed.Results of an on-going investigation on properties of MgO-C monolithic refractories with tar-resin as binder are presented.Furthermore,the binder is an extremely strong carbon bonding.Further significant advantages of this system are high oxidation resistance of the highly-ordered carbon structure and the excellent stress-absorbing structure.To improve the strength and erosion resistance,and to decrease evaporation during heating,a preliminary treated tar-resin with higher melting temperature and lower content of volatile component was investigated.The binder specimens were treated at 800 ℃ and the mechanical properties of MgO-C refractories specimens treated at 200,400,and 1 200 ℃ were determined.

  14. The role of the binder phase in the WC-Co sintering

    Directory of Open Access Journals (Sweden)

    Silva A.G.P. da

    2001-01-01

    Full Text Available The sintering of hardmetal in the solid state is studied. The influence of the WC particle size on the sintering kinetics, the role of the binder phase in the densification process and how sintering depends on the heating conditions are investigated. It is observed that alloys with different WC particle size show quite different structural evolution during sintering, although the densification mechanisms are the same. This is explained by the formation of agglomerates of WC and Co. Hardmetal alloys can sinter very rapidly when high heating rates are used, since rapid heating accelerates the binder spreading and the formation of WC-Co agglomerates. The binder phase (Co spreads on the WC particles initially as a thin layer. Subsequently, more Co spreads on this layer and WC-Co agglomerates are formed.

  15. STRUCTURE AND PROPERTIES OF COMPOSITE MATERIAL BASED ON GYPSUM BINDER AND CARBON NANOTUBES

    Directory of Open Access Journals (Sweden)

    CHUMAK Anastasia Gennadievna

    2013-04-01

    Full Text Available The aim of this work is to carry out a number of studies in the area of nanomodi­fication of gypsum binder matrix and to investigate the influence of multilayer carbon nanotubes on the structure, physical and mechanical properties of obtained compos­ites. The study of the gypsum binders structure formation mechanisms with the use of nanoadditives makes it possible to control the production processes of gypsum materi­als and articles with the given set of properties. The main tasks of the binder nanomodification are: even distribution of carbon nanostructures over the whole volume of material and provision of stability for the nanodimensional modifier during production process of the construction composite.

  16. Springback Control With Variable Binder Force — Experiments And FEA Simulation

    Science.gov (United States)

    Du, Changqing; Wu, Jin; Militisky, Marcio; Principe, James; Garnett, Mark; Zhang, Li

    2004-06-01

    Side-wall-curl is a springback phenomena in typical automotive structural components, such as channel like rails and cross members. Minimizing or eliminating the side-wall-curl is one of the major challenges in stamping production. This challenge is exasperated when the component is formed from advanced high strength steels (AHSS). In this study a standard three-piece draw die is used, in a series of experimental tests, to form a stamping with a hat-shaped section from dual phase 590 (DP590). During the forming stroke, the binder force is varied to evaluate its influence on side-wall-curl. FEA springback simulations for two types of experiments with varied binder forces are also performed. The binder force profiles for several sheet materials are discussed and the correlation between the simulation results and the actual part measurements are illustrated.

  17. Studying asphalt binder fatigue pattern by using a dynamic shear rheometer

    Directory of Open Access Journals (Sweden)

    Oscar Javier Reyes Ortiz

    2011-01-01

    Full Text Available This article was aimed at determining fatigue test results regarding different types of binder when using a dynamic shear rheometer (DSR. The tests were carried out in stress conditions at 20ºC. The stress input signal was a constant amplitude, 1.59 Hz frequency sine wave. Asphalt binders B-13/22, B-40/50, B-60/70, B-80/00, B-150/200 and BM-3c (modified asphalt were studied. The test measured strain, complex modulus (G*, dissipated energy and dissipated energy ratio (DER with the number of cycles. Strain criteria were used for determining binder fatigue failure (DER. Failure was defined as the point at which (DER dropped 10% after peaking. Laws of asphalt fatigue were obtained from the strain and failure cycle results.

  18. Chloride accelerated test: influence of silica fume, water/binder ratio and concrete cover thickness

    Directory of Open Access Journals (Sweden)

    E. Pereira

    Full Text Available In developed countries like the UK, France, Italy and Germany, it is estimated that spending on maintenance and repair is practically the same as investment in new constructions. Therefore, this paper aims to study different ways of interfering in the corrosion kinetic using an accelerated corrosion test - CAIM, that simulates the chloride attack. The three variables are: concrete cover thickness, use of silica fume and the water/binder ratio. It was found, by analysis of variance of the weight loss of the steel bars and chloride content in the concrete cover thickness, there is significant influence of the three variables. Also, the results indicate that the addition of silica fume is the path to improve the corrosion protection of low water/binder ratio concretes (like 0.4 and elevation of the concrete cover thickness is the most effective solution to increase protection of high water/binder ratio concrete (above 0.5.

  19. Development of a Polyuretbane Binder System Giving a 'Knottable' Composite Solid Propellant

    Directory of Open Access Journals (Sweden)

    E. Devadoss

    1985-01-01

    Full Text Available Polyurethane propellants, which constitute one of the 'work-horse' binder systems in modern solid rocketry are easily amenable for tailoring the mechanical properties in terms of variations in the molecular structure of the backbone polyols, the isocyanates and stoichiometry of the reactants. The paper deals with studies in developing an advanced binder system based on poly (oxy propylene glycol and toluene-di-isocyanate, which is capable of accommodating high solids loading and conceding elongatlon at maximum stress, of more than 125 per cent. The gum-stock properties of the binder are related with those of a low molecular weight version and the results are explained based on the network theory of condensation polymers.

  20. Effect of Hydration Aging and Water Binder Ratio on Microstructure and Mechanical Properties of Sprayed Concrete

    Institute of Scientific and Technical Information of China (English)

    NIU Ditao; WANG Jiabin; WANG Yan

    2015-01-01

    In order to study the durability of sprayed concrete (shotcrete), effects of different hydration aging and water-binder ratio (w/b) on the microstructure of cement paste and basic mechanical properties of test specimens were investigated. The phase composition, mass percentage of ettringite and portland in hydration production and microstructure were characterized by X-ray diffraction (XRD), thermo gravimetry-differential scanning calorimetry (TG-DSC) and scanning electron microscopy (SEM), respectively. The experimental results showed that changes in phase composition was more signiifcant than those of water-binder ratio. With hydration aging and water-binder ratio increased, the mass percentage of ettringite and portland was decreased from 4.42%, 1.49% to 3.31%, 1.35%, respectively and the microstructure of paste was signiifcantly compacted. Likewise, the mechanical properties including cubic compressive strength and splitting tensile strength were rised obviously.

  1. Potential of the application of the modified polysaccharides water solutions as binders of moulding sands

    Directory of Open Access Journals (Sweden)

    K. Kaczmarska

    2015-10-01

    Full Text Available The results of preliminary tests of selected properties of the moulding sands with the binder in the form of a 5 % water solution of the sodium salt of carboxymethyl starch (with a degree of substitution (DS of 0,2 and 0,87 arepresented in this study. The moulding sand properties such as permeability, abrasion resistance, tensile and bendingstrength - after curing - are shown in series of tests. The cure process was conducted in a field of electromagnetic radiation within the microwave range. The effect of the microwave treatment on the moulding sand was evaporating of water (solvent in a binder and cross-linking of the polymeric binder. As a result the cured moulding sands with particular properties, essential in the context of its application in the mould technology in the foundry industry, were obtained.

  2. Equilibrium Transitions from Non Renewable Energy to Renewable Energy under Capacity Constraints

    OpenAIRE

    Amigues, Jean-Pierre; Ayong Le Kama, Alain; Moreaux, Michel

    2013-01-01

    We study the transition between non renewable and renewable energy sources with adjustment costs over the production capacity of renewable energy. Assuming constant variable marginal costs for both energy sources, convex adjustment costs and a more expensive renewable energy, we show the following. With sufficiently abundant non renewable energy endowments, the dynamic equilibrium path is composed of a first time phase of only non renewable energy use followed by a transition phase substituti...

  3. Equilibrium transitions from non-renewable energy to renewable energy under capacity constraints

    OpenAIRE

    Amigues, Jean-Pierre; Ayong Le Kama, Alain; Moreaux, Michel

    2015-01-01

    We study the transition between non-renewable and renewable energy sources with adjustment costs over the production capacity of renewable energy. Assuming constant variable marginal costs for both energy sources, convex adjustment costs and a more expensive renewable energy, we show the following. With sufficiently abundant non-renewable energy endowments, the dynamic equilibrium path is composed of a first time phase of only non-renewable energy use followed by a transition phase substituti...

  4. Comment: The Economics of Interdependent Renewable and Non-renewable Resources revisited.

    OpenAIRE

    Viktoria Kahui; Armstrong, Claire W.

    2009-01-01

    This work expands upon Swallow's theoretical analysis of interactions between renewable and non-renewable resources. In this comment the interaction is such that the renewable resource prefers the non-renewable environment, as opposed to SwallowÕs (op cit) case of the non-renewable environment being essential to the renewable resource. We find that this difference strongly affects the results, and makes the resources change from being complements to being substitutes, i.e. in the essential ca...

  5. Renewables 2012. Global Status Report

    Energy Technology Data Exchange (ETDEWEB)

    Sawin, J.L. (ed.) [and others

    2012-08-15

    Renewable energy markets and policy frameworks have evolved rapidly in recent years. This report provides a comprehensive and timely overview of renewable energy market, industry, investment, and policy developments worldwide. It relies on the most recent data available, provided by a network of more than 400 contributors and researchers from around the world, all of which is brought together by a multi-disciplinary authoring team. The report covers recent developments, current status, and key trends; by design, it does not provide analysis or forecast the future.

  6. Who Owns Renewable Energy Certificates?

    Energy Technology Data Exchange (ETDEWEB)

    Holt, Edward; Wiser, Ryan; Bolinger, Mark

    2006-06-01

    Renewable energy certificates (RECs) are tradable instruments that convey the attributes of a renewable energy generator and the right to make certain claims about energy purchases. RECs first appeared in US markets in the late 1990s and are particularly important in states that accept or require them as evidence of compliance with renewables portfolio standards (RPS). The emergence of RECs as a tradable commodity has made utilities, generators, and regulators increasingly aware of the need to specify who owns the RECs in energy transactions. In voluntary transactions, most agree that the question of REC ownership can and should be negotiated privately between the buyer and the seller, and should be clearly established by contract. Claims about purchasing or using renewable energy should only be made if REC ownership can be documented. In many other cases, however, renewable energy transactions are either mandated or encouraged through state or federal policy. Because of the recent appearance of RECs, legislation and regulation mandating the purchase of renewable energy has sometimes been silent on the disposition of the RECs associated with that generation. Furthermore, some renewable energy contracts pre-date the existence of RECs, and therefore do not address REC ownership. In both of these instances, the issue of REC ownership must often be answered by legislative or regulatory authorities. The resulting uncertainty in REC ownership has hindered the development of robust REC markets and has, in some cases, led to contention between buyers and sellers of renewable generation. This article, which is based on a longer Berkeley Lab report, reviews federal and state efforts to clarify the ownership of RECs from Qualifying Facilities (QFs) that sell their generation under the Public Utility Regulatory Policies Act (PURPA) of 1978. The full report also addresses state efforts to clarify REC ownership in two other situations, customer-owned generation that benefits

  7. Renewable energy prospects for implementation

    CERN Document Server

    Jackson, Tim

    1993-01-01

    Renewable Energy: Prospects for Implementation contains papers that were originally commissioned by the journal Energy Policy for a series on renewable energy appearing between January 1991 to September 1992. In view of the fast-changing demands on conventional energy supply to meet environmental imperatives, it seemed timely to reproduce here a selection of those papers with a new introduction and a revised concluding chapter by the Editor of the series, Dr Tim Jackson, a research fellow with the Stockholm Environment Institute. The book is organized into four parts. The papers in Part I

  8. World potential of renewable energies

    Energy Technology Data Exchange (ETDEWEB)

    Dessus, B.; Devin, B.; Pharabod, F.

    1991-07-01

    A comprehensive analysis, region by region, of the actually accessible renewable energies at a given horizon, is presented. The same methodology as the one employed to derive ``proven fossil energy reserves`` from ``energy resources`` is adopted, in which resources are defined by quantitative information on physical potential, while reserves take into account technical and economical accessibility. As renewable resources are fluctuating with time and are diluted in space and not readily transportable or storeable, it is necessary to consider the presence of populations or activities near enough to be able to profit by these diluted and volatile energies.

  9. Linking asphalt binder fatigue to asphalt mixture fatigue performance using viscoelastic continuum damage modeling

    Science.gov (United States)

    Safaei, Farinaz; Castorena, Cassie; Kim, Y. Richard

    2016-08-01

    Fatigue cracking is a major form of distress in asphalt pavements. Asphalt binder is the weakest asphalt concrete constituent and, thus, plays a critical role in determining the fatigue resistance of pavements. Therefore, the ability to characterize and model the inherent fatigue performance of an asphalt binder is a necessary first step to design mixtures and pavements that are not susceptible to premature fatigue failure. The simplified viscoelastic continuum damage (S-VECD) model has been used successfully by researchers to predict the damage evolution in asphalt mixtures for various traffic and climatic conditions using limited uniaxial test data. In this study, the S-VECD model, developed for asphalt mixtures, is adapted for asphalt binders tested under cyclic torsion in a dynamic shear rheometer. Derivation of the model framework is presented. The model is verified by producing damage characteristic curves that are both temperature- and loading history-independent based on time sweep tests, given that the effects of plasticity and adhesion loss on the material behavior are minimal. The applicability of the S-VECD model to the accelerated loading that is inherent of the linear amplitude sweep test is demonstrated, which reveals reasonable performance predictions, but with some loss in accuracy compared to time sweep tests due to the confounding effects of nonlinearity imposed by the high strain amplitudes included in the test. The asphalt binder S-VECD model is validated through comparisons to asphalt mixture S-VECD model results derived from cyclic direct tension tests and Accelerated Loading Facility performance tests. The results demonstrate good agreement between the asphalt binder and mixture test results and pavement performance, indicating that the developed model framework is able to capture the asphalt binder's contribution to mixture fatigue and pavement fatigue cracking performance.

  10. On the measurement of surface tension in binders used for moulding sands

    Directory of Open Access Journals (Sweden)

    B. Hutera

    2008-07-01

    Full Text Available The surface tension of foundry binders is a very important parameter affecting the properties of a sand-binder system. Combined with other parameters, its value determines an outcome of the process of moulding sand preparation and the mechanical properties of the ready moulding composition. The problem of how to measure the surface tension of binders used in preparation of moulding sands is discussed only occasionally. Indirectly, the surface tension is characterised by the value of a contact angle, but it never means that these two parameters can be considered identical. Numerous methods are available and used at present to measure the surface tension, among others, the capillary rise method, the spinning drop method, the sessile drop method, the pendant drop method, the method of pulled out ring (or plate, or frame. There is also a rich variety of devices offered with different measuring methods. The devices are modern and represent a high level of the technical skill and art. Unfortunately, also their price is high. It is, however, possible to obtain the reliable results of the surface tension measurement using relatively simple methods, viz. the stalagmometric method and the capillary rise method. What is necessary are proper conditions of the measurement, directly related with the specific properties of binders. The present paper gives examples of the results obtained during measurement of the surface tension of some selected binders. Attention was drawn to the methods of taking measurements, and the obtained results were discussed and analysed. The possibilities of detemining the surface tension of the examined binders from the results of the contact angle measurements using the “sessile drop” and “pendant drop” methods were outlined.

  11. Application of microwave energy for curing of molding sands containing oil binders

    Directory of Open Access Journals (Sweden)

    M. Stachowicz

    2008-07-01

    Full Text Available This works presents the results of studies concerning possibility of application of microwave heating in the curing process of molding sands containing oil binders. Molding sands prepared with three kinds of binders, that is oils C, DL and Retanol, have been subject to experiments. The sands have been dried with two methods: in a microwave chamber of 750W power and, for comparison, with classical method at the temperature of 200°C for 120 minutes. Tensile and bending strength of the samples have been determined after cooling down. It has been found that microwave drying in the low-power device used for experiments is effective only in case of molding sand prepared with addition of DL binder. The temperature of heated, even up to 32 minutes in a microwave chamber, blocks prepared from the remaining two masses, was insufficient to initiate binding process. The undertaken attempts of binder modification and introduction of additives intensifying microwave heating process allowed for achievement of satisfactory results. It has been found that power of the heating device is the main factor determining efficiency of microwave curing of molding sands containing oil binders. An additional experiment has been conducted on a laboratory workstation allowing for microwave heating of small mass samples with a high output power of magnetron concentrated in a small substrate volume. It has been observed that microwave drying process of molding sands was of dynamic character over a short period of time, not exceeding 120 seconds, thus assuring efficient curing of the sands containing the used oil binders. Therefore, application of devices of properly high microwave output power allows for efficient drying of oil molding sands, while simultaneously assuring the possibility to reduce time and energy consumption necessary for production of foundry cores of proper functional characteristics.

  12. Renewing City Renewal: A call for strong design

    NARCIS (Netherlands)

    Engel, H.; Van Velzen, E.; Van der Wal, O.

    2013-01-01

    Between 1970 and 1990 the prewar districts of Dutch cities underwent an unparalleled process of renewal. What began as ‘building for the neighbourhood’ in protest against extensive demolition has now come to be known as ‘city renewal’. Large numbers of affordable dwellings and social facilities were

  13. EVALUATION OF MORINGA OLEIFERA GUM AS A BINDER IN TABLET FORMULATION

    OpenAIRE

    Patil Basawaraj S; Soodam Srinivas R.; Kulkarni Upendra; Korwar Prakassh G.

    2010-01-01

    Various plant gums have been used as binders in tablet formulations. But still finding novel binder for the manufacture of tablets, in pharmaceutical industry. The Moringa oleifera gum was found its binding property. In the present study Moringa oleifera gum was employed as a binding agent in Chloroquine phosphate tablets at concentrations of 4.0, 6.0 and 8.0 % w/w, in comparison with potato starch. The properties of Moringa oleifera gum were evaluated for angle of repose, bulk density, tappe...

  14. Guanidine based vehicle/binders for use with oxides, metals and ceramics

    Science.gov (United States)

    Philipp, Warren H. (Inventor); Weitch, Lisa C. (Inventor); Jaskowiak, Martha H. (Inventor)

    1995-01-01

    The use of guanidine salts of organic fatty acids (guanidine soaps) as vehicles and binders for coating substrate surfaces is disclosed. Being completely organic, the guanidine soaps can be burned off leaving no undesirable residue. Of special interest is the use of guanidine 2-ethyl hexanoate as the vehicle and binder for coating problematic surfaces such as in coating alumina fibers with platinum or zirconia. For this application the guanidine soap is used as a melt. For other applications the guanidine soap may be used in a solution with a variety of solvents, the solution containing chlorometalates or powdered metals, refractories or ceramics.

  15. Selective catalytic reduction system and process using a pre-sulfated zirconia binder

    Science.gov (United States)

    Sobolevskiy, Anatoly; Rossin, Joseph A.

    2010-06-29

    A selective catalytic reduction (SCR) process with a palladium catalyst for reducing NOx in a gas, using hydrogen as a reducing agent is provided. The process comprises contacting the gas stream with a catalyst system, the catalyst system comprising (ZrO.sub.2)SO.sub.4, palladium, and a pre-sulfated zirconia binder. The inclusion of a pre-sulfated zirconia binder substantially increases the durability of a Pd-based SCR catalyst system. A system for implementing the disclosed process is further provided.

  16. Azidated Ether-Butadiene-Ether Block Copolymers as Binders for Solid Propellants

    Science.gov (United States)

    Cappello, Miriam; Lamia, Pietro; Mura, Claudio; Polacco, Giovanni; Filippi, Sara

    2016-07-01

    Polymeric binders for solid propellants are usually based on hydroxyl-terminated polybutadiene (HTPB), which does not contribute to the overall energy output. Azidic polyethers represent an interesting alternative but may have poorer mechanical properties. Polybutadiene-polyether copolymers may combine the advantages of both. Four different ether-butadiene-ether triblock copolymers were prepared and azidated starting from halogenated and/or tosylated monomers using HTPB as initiator. The presence of the butadiene block complicates the azidation step and reduces the storage stability of the azidic polymer. Nevertheless, the procedure allows modifying the binder properties by varying the type and lengths of the energetic blocks.

  17. ISRO Polyol - The Versatile Binder for Composite Solid Propellants for Launch Vehicles and Missiles

    Directory of Open Access Journals (Sweden)

    V. N. Krishnamurthy

    1987-01-01

    Full Text Available A family of propellants based on a low cost hydroxy terminated binder has been developed and proved in large size motors. It can meet the requirements of Apogee motors as well as large boosters. The system offers advantages comparable with HTPB propellants in terms of high ballistic performance, stringent mechanical properties, ease and reliability of cure even at ambient conditions and high storage stability. The near-Newtonian flow behaviour, simplicity and processing characteristics of this saturated binder propellant are particularly note-worthy.

  18. Study on Heat Hardening Mechanism of Starch Composite Binder for Sand Mold (Core) by IR Spectra

    Institute of Scientific and Technical Information of China (English)

    Xia ZHOU; Jinzong YANG; Qin GAO; Guohui QU

    2001-01-01

    The heat hardening mechanism of starch composite binder for sand mold (core) was studied by way of IR spectra. It is thought that the bonding strength of molding sand is mainly depended on the strength of the adhesive membrane itself. During heating the binder at certain temperature between 160~200℃ for one hour, a special composite structure is formed because of the interactions between different components, thus, it has higher low-temperature drying strength,better humidity resistance and higher high-temperature strength.

  19. Lignin as renewable raw material.

    Science.gov (United States)

    Calvo-Flores, Francisco García; Dobado, José A

    2010-11-22

    Lignin is by far the most abundant substance based on aromatic moieties in nature, and the largest contributor to soil organic matter. Millions of tonnes of several lignin preparations are produced by the paper industry every year, and a minimal amount of lignin is isolated by direct extraction of lignin from plants. Lignin is used either directly or chemically modified, as a binder, dispersant agent for pesticides, emulsifier, heavy metal sequestrant, or component for composites and copolymers. For value-added applications of lignin to be improved, medium- and long-term conversion technologies must be developed, especially for the preparation of low-molecular-weight compounds as an alternative to the petrochemical industry.

  20. Alaska's renewable energy potential.

    Energy Technology Data Exchange (ETDEWEB)

    2009-02-01

    This paper delivers a brief survey of renewable energy technologies applicable to Alaska's climate, latitude, geography, and geology. We first identify Alaska's natural renewable energy resources and which renewable energy technologies would be most productive. e survey the current state of renewable energy technologies and research efforts within the U.S. and, where appropriate, internationally. We also present information on the current state of Alaska's renewable energy assets, incentives, and commercial enterprises. Finally, we escribe places where research efforts at Sandia National Laboratories could assist the state of Alaska with its renewable energy technology investment efforts.

  1. VISCOSITY AND BINDER COMPOSITION EFFECTS ON TYROSINASE-BASED CARBON PASTE ELECTRODE FOR DETECTION OF PHENOL AND CATECHOL

    Science.gov (United States)

    The systematic study of the effect of binder viscosity on the sensitivity of a tyrosinase-based carbon paste electrode (CPE) biosensor for phenol and catechol is reported. Silicon oil binders with similar (polydimethylsiloxane) chemical composition were used to represent a wid...

  2. Effects of Nanosilica on Compressive Strength and Durability Properties of Concrete with Different Water to Binder Ratios

    Directory of Open Access Journals (Sweden)

    Forood Torabian Isfahani

    2016-01-01

    Full Text Available The effects of the addition of different nanosilica dosages (0.5%, 1%, and 1.5% with respect to cement on compressive strength and durability properties of concrete with water/binder ratios 0.65, 0.55, and 0.5 were investigated. Water sorptivity, apparent chloride diffusion coefficient, electrical resistivity, and carbonation coefficient of concrete were measured. The results showed that compressive strength significantly improved in case of water/binder = 0.65, while for water/binder = 0.5 no change was found. Increasing nanosilica content, the water sorptivity decreased only for water/binder = 0.55. The addition of 0.5% nanosilica decreased the apparent chloride diffusion coefficient for water/binder = 0.65 and 0.55; however, higher nanosilica dosages did not decrease it with respect to reference value. The resistivity was elevated by 0.5% nanosilica for all water/binder ratios and by 1.5% nanosilica only for water/binder = 0.5. The carbonation coefficient was not notably affected by increasing nanosilica dosages and even adverse effect was observed for water/binder = 0.65. Further information of microstructure was also provided through characterization techniques such as X-ray diffraction, thermal gravimetric analysis, mercury intrusion porosimetry, and scanning electron microscopy. The effectiveness of a certain nanosilica dosage addition into lower strength mixes was more noticeable, while, for the higher strength mix, the effectiveness was less.

  3. First Observation of the Blending Zone Morphology at the Interface of Reclaimed Asphalt Binder and Virgin Bitumen

    NARCIS (Netherlands)

    Nahar, S.N.; Mohajeri, M.; Schmets, A.J.M.; Scarpas, T.; Van de Ven, M.F.C.; Schitter, G.

    2013-01-01

    One of the challenges in designing recycled asphalt mixtures with a high amount of RAP is to estimate the blending degree between RAP binder and the added virgin bitumen. The extent of blending is crucial in this case as asphalt concrete response is influenced by the final binder properties. This pa

  4. Power marketing and renewable energy

    Energy Technology Data Exchange (ETDEWEB)

    Fang, J.M.

    1997-09-01

    Power marketing refers to wholesale and retail transactions of electric power made by companies other than public power entities and the regulated utilities that own the generation and distribution lines. The growth in power marketing has been a major development in the electric power industry during the last few years, and power marketers are expected to realize even more market opportunities as electric industry deregulation proceeds from wholesale competition to retail competition. This Topical Issues Brief examines the nature of the power marketing business and its relationship with renewable power. The information presented is based on interviews conducted with nine power marketing companies, which accounted for almost 54% of total power sales by power marketers in 1995. These interviews provided information on various viewpoints of power marketers, their experience with renewables, and their respective outlooks for including renewables in their resource portfolios. Some basic differences exist between wholesale and retail competition that should be recognized when discussing power marketing and renewable power. At the wholesale level, the majority of power marketers stress the commodity nature of electricity. The primary criteria for developing resource portfolios are the same as those of their wholesale customers: the cost and reliability of power supplies. At the retail level, electricity may be viewed as a product that includes value-added characteristics or services determined by customer preferences.

  5. Renewable Energy Devices and Systems

    DEFF Research Database (Denmark)

    Blaabjerg, Frede; Ionel, Dan M.

    2015-01-01

    In this paper, essential statistics demonstrating the increasing role of renewable energy generation are firstly discussed. A state of the art review section covers fundamentals of wind turbines and PV systems. Included are schematic diagrams illustrating the main components and system topologies...

  6. Renewables exceed even optimistic expectations

    Energy Technology Data Exchange (ETDEWEB)

    Seltmann, Thomas [Energy Watch Group, Berlin (Germany). Projektmanagement

    2010-07-01

    The growth of renewables has outpaced even the most optimistic forecasts. However, even the expansion rate we've seen so far won't be enough to close the energy gap threatening to open up within conventional energy sources. (orig.)

  7. Issues in Renewable Energy Education

    Science.gov (United States)

    Thomas, Chacko; Jennings, Philip; Lloyd, Bob

    2008-01-01

    Renewable energy education is evolving rapidly in response to drivers such as oil depletion and global warming. There is a rapidly increasing level of student interest in these topics and a growing demand from industry and government for skilled personnel to develop sustainable energy systems and greenhouse solutions. Several Australian and New…

  8. Analysis of renewable portfolio standards

    Energy Technology Data Exchange (ETDEWEB)

    Bernow, S.; Dougherty, W.; Duckworth, M.

    1997-12-31

    A national RPS would increase the fraction of U.S. electricity generation from renewable technologies at least cost. It would help ensure that the cost and performance of these technologies would improve with manufacturing experience, scale economies, and learning-by-doing from their integration into electric systems. Thus, their economic, environmental, energy security, and sustainability benefits would be realized.

  9. Innovative biofibers from renewable resources

    CERN Document Server

    Reddy, Narendra

    2015-01-01

    This book will be a one-stop-shop for readers seeking information on biofibers that are sustainable and environmentally friendly and those that can replace the non-renewable synthetic polymer based fibers. Emphasis will be on fibers that are derived from agricultural byproducts and coproducts without the need for additional natural resources.

  10. Renewable Energy Country Profiles. Caribbean

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-09-15

    IRENA Renewable Energy Country Profiles take stock of the latest developments in the field of renewables at country level around the world. Each profile combines analysis by IRENA's specialists with the latest available country data and additional information from a wide array of sources. The resulting reports provide a brief yet comprehensive picture of the situation with regard to renewable energy, including energy supply, electrical generation and grid capacity, and access. Energy policies, targets and projects are also considered, along with each country's investment climate and endowment with renewable energy resources. The energy statistics presented here span the period from 2009 until 2012, reflecting varying timelines in the source material. Since data availability differs from country to country, wider regional comparisons are possible only for the latest year with figures available for every country included. Despite the time lag in some cases, the evident differences and disparities between countries and regions around the world remain striking. The current package of country profiles is just a starting point. The geographic scope will continue to expand, and existing profiles will be enhanced with new indicators, with the whole series maintained as a live product on the IRENA website (www.irena.org)

  11. Introduction to Renewable Energy Systems

    DEFF Research Database (Denmark)

    Ma, Ke; Yang, Yongheng; Blaabjerg, Frede

    2014-01-01

    In this chapter, the state-of-the-arts developments of renewable energy are reviewed in respect to the installed power and market share, where wind power and photovoltaic power generation are the main focuses due to the fast growing speed and large share of installed capacity. Some basic principles...

  12. Heliodromus: Renewable energy from space

    NARCIS (Netherlands)

    Kuiper, J.M.

    2010-01-01

    Climate change and the related running out of fossil fuel reserves drive the development of renewable energy sources. To contribute to a solution of these problems, we present the results of a BSc student design synthesis exercise project on Space Based Solar Power (SBSP). A SBSP system generates po

  13. Solar Renewable Energy. Teaching Unit.

    Science.gov (United States)

    Buchanan, Marion; And Others

    This unit develops the concept of solar energy as a renewable resource. It includes: (1) an introductory section (developing understandings of photosynthesis and impact of solar energy); (2) information on solar energy use (including applications and geographic limitations of solar energy use); and (3) future considerations of solar energy…

  14. New Quebec renewable energy organization

    Energy Technology Data Exchange (ETDEWEB)

    McArthur, D.; Salaff, S.

    1998-04-01

    The recent formation of the Quebec Association for the Production of Renewable Energy (l`Association quebecoise de la production d`energie renouvelable - AQPER) was announced. The Association is becoming the centre of the Quebec private electricity generation industry. By communicating the industry`s message to the public the organization gives much needed visibility to renewable resources, new forms of energy and sustainable development. The new group is an outgrowth of the former Quebec Association of Private Hydroelectricity Producers. In its new reincarnation, the organization represents all forms of renewables, small and medium hydro, wind, solar, forest and agricultural biomass and urban waste. With deregulation of the electricity market, specifically the creation of the Regie de l`energie` in Quebec, the wider role is a welcome boost for renewable energy development in the province. In one of its first actions the AQPER recommended that all hydroelectric sites up to 50 MW be reserved for development exclusively by the private sector, in conformity with the Quebec energy policy announced in 1996.

  15. PEV Integration with Renewables (Presentation)

    Energy Technology Data Exchange (ETDEWEB)

    Markel, T.

    2014-06-18

    This presentation discusses current research at NREL on integrating plug-in electric vehicles with the grid and using renewable energy to charge the grid. The Electric Vehicle Grid Integration (EVGI) and Integrated Network Testbed for Energy Grid Research and Technology Experimentation (INTEGRATE) are addressing the opportunities and technical requirements for vehicle grid integration that will increase marketability and lead to greater petroleum reduction.

  16. The potential of renewable energy

    Energy Technology Data Exchange (ETDEWEB)

    1990-03-01

    On June 27 and 28, 1989, the US Department of Energy (DOE) national laboratories were convened to discuss plans for the development of a National Energy Strategy (NES) and, in particular, the analytic needs in support of NES that could be addressed by the laboratories. As a result of that meeting, interlaboratory teams were formed to produce analytic white papers on key topics, and a lead laboratory was designated for each core laboratory team. The broad-ranging renewables assignment is summarized by the following issue statement from the Office of Policy, Planning and Analysis: to what extent can renewable energy technologies contribute to diversifying sources of energy supply What are the major barriers to greater renewable energy use and what is the potential timing of widespread commercialization for various categories of applications This report presents the results of the intensive activity initiated by the June 1989 meeting to produce a white paper on renewable energy. Scores of scientists, analysts, and engineers in the five core laboratories gave generously of their time over the past eight months to produce this document. Their generous, constructive efforts are hereby gratefully acknowledged. 126 refs., 44 figs., 32 tabs.

  17. Issues in Renewable Energy Education

    Science.gov (United States)

    Thomas, Chacko; Jennings, Philip; Lloyd, Bob

    2008-01-01

    Renewable energy education is evolving rapidly in response to drivers such as oil depletion and global warming. There is a rapidly increasing level of student interest in these topics and a growing demand from industry and government for skilled personnel to develop sustainable energy systems and greenhouse solutions. Several Australian and New…

  18. Low toxicity binder systems for tape cast Ce0.9Gd0.1O1.95 laminates

    DEFF Research Database (Denmark)

    Klemensø, Trine; Menon, Mohan; Ramousse, Severine

    2010-01-01

    Conventional binder systems for tape casting contain toxic phthalate plasticizers and butanone (MEK) as part of the solvent. The effects of exchanging the phthalate with a non-toxic alternative, and butanone with ethanol, were studied on laminates of high-green density CGO (Ce0.9Gd0.1O1.95) tapes....... Samples were prepared with a binder system containing DBP (dibutyl phthalate) plasticizer and MEK solvent, and with a binder system based on a non-toxic non-phthalate plasticizer and ethanol. In both systems, the weight ratio of plasticizer to the PVB (polyvinyl butyral) binder was varied between 0.......4 and 0.7. Substitution to the less toxic binder system had no adverse impacts on the microstructure. In fact, denser packing and improved homogeneity were observed with the non-phthalate-based system at ratio 0.5 indicating improved dispersion in this system. The denser packing also coincided...

  19. A facile approach to derive binder protective film on high voltage spinel cathode materials against high temperature degradation

    Science.gov (United States)

    Chou, Wei-Yu; Jin, Yi-Chun; Duh, Jenq-Gong; Lu, Cheng-Zhang; Liao, Shih-Chieh

    2015-11-01

    The electrochemical performance of spinel LiNi0.5Mn1.5O4 cathode combined with different binders at elevated temperature is firstly investigated. The water soluble binder, such as sodium carboxymethyl cellulose (CMC) and sodium alginate (SA), is compared with the polyvinylidene difluoride (PVdF) binder used in non-aqueous process. The aqueous process can meet the need of Li-ion battery industry due to environmental-friendly and cost effectiveness by replacing toxic organic solvent, such as N-methyl-pyrrolidone (NMP). In this study, a significantly improved high temperature cycling performance is successfully obtained as compared to the traditional PVdF binder. The aqueous binder can serve as a protective film which inhibits the serious Ni and Mn dissolution especially at elevated temperature. Our result demonstrates a facile approach to solve the problem of capacity fading for high voltage spinel cathodes.

  20. Design of a novel system allowing the selection of an adequate binder for solidification/stabilization of wastes

    Energy Technology Data Exchange (ETDEWEB)

    Pera, J.; Thevenin, G.; Chabannet, M. [INSA de Lyon, Villeurbanne (France)

    1997-10-01

    Literature review shows that there is a lack of complete and consistent data on waste-binder interactions. Few links exist between research on the Solidification/Stabilization (S/S) mechanisms and the formulation of binders for immobilization. Therefore, a twofold program was developed allowing both to be done in parallel. This protocol had two targets: understanding the mechanisms involved in the S/S of heavy metals for each type of binder and rating the binder capacity for fixing heavy metals. The experimental procedure relies on two substrates: (1) the study of suspensions by means of conductimetry, XRD, FTIR, DTA, SEM-EDXA, ICP, ion chromatography, and colorimetry; and (2) the study of pure pastes for leaching tests and microstructural characterization (XRD, FTIR, DTA, SEM-EDXA). Results confirm whether the pollutant modifies the hydration or not, give access to the extent of binder stabilization without taking into account the solidification part, and elucidate the mechanisms involved.

  1. In Vitro Adsorption and in Vivo Pharmacokinetic Interaction between Doxycycline and Frequently Used Mycotoxin Binders in Broiler Chickens.

    Science.gov (United States)

    De Mil, Thomas; Devreese, Mathias; Broekaert, Nathan; Fraeyman, Sophie; De Backer, Patrick; Croubels, Siska

    2015-05-06

    Mycotoxin binders are readily mixed in feeds to prevent uptake of mycotoxins by the animal. Concerns were raised for nonspecific binding with orally administered veterinary drugs by the European Food Safety Authority in 2010. This paper describes the screening for in vitro adsorption of doxycycline-a broad-spectrum tetracycline antibiotic-to six different binders that were able to bind >75% of the doxycycline. Next, an in vivo pharmacokinetic interaction study of doxycycline with two of the binders, which demonstrated significant in vitro binding, was performed in broiler chickens using an oral bolus model. It was shown that two montmorillonite-based binders were able to lower the area under the plasma concentration-time curve of doxycycline by >60% compared to the control group. These results may indicate a possible risk for reduced efficacy of doxycycline when used concomitantly with montmorillonite-based mycotoxin binders.

  2. [Alternative scaffold proteins].

    Science.gov (United States)

    Petrovskaia, L E; Shingarova, L N; Dolgikh, D A; Kirpichnikov, M P

    2011-01-01

    Review is devoted to the challenging direction in modem molecular biology and bioengineering - the properties of alternative scaffold proteins (ASP) and methods for obtaining ASP binding molecules. ASP molecules incorporate conservative protein core and hypervariable regions, providing for the binding function. Structural classification of ASP includes several types which differ also in their molecular targets and potential applications. Construction of artificial binding proteins on the ASP basis implies a combinatorial library design with subsequent selection of specific binders with the use of phage display or the modem cell-free systems. Alternative binding proteins on non-immunoglobulin scaffolds find broad applications in different fields ofbiotechnology and molecular medicine.

  3. Enhanced electrochemical properties of LiFePO4 (LFP) cathode using the carboxymethyl cellulose lithium (CMC-Li) as novel binder in lithium-ion battery.

    Science.gov (United States)

    Qiu, Lei; Shao, Ziqiang; Wang, Daxiong; Wang, Wenjun; Wang, Feijun; Wang, Jianquan

    2014-10-13

    Novel water-based binder CMC-Li is synthesized using cotton as raw material. The mechanism of the CMC-Li as a binder is reported. Electrochemical properties of batteries cathodes based on commercially available lithium iron phosphate (LiFePO4, LFP) and CMC-Li as a water-soluble binder are investigated. CMC-Li is a novel lithium-ion binder. Compare with conventional poly(vinylidene fluoride) (PVDF) binder, and the battery with CMC-Li as the binder retained 97.8% of initial reversible capacity after 200 cycles at 176 mAh g(-1), which is beyond the theoretical specific capacity of LFP. Constant current charge-discharge test results demonstrate that the LFP electrode using CMC-Li as the binder has the highest rate capability, follow closely by that using PVDF binder. The batteries have good electrochemical property, outstanding pollution-free and excellent stability.

  4. Renewable energy resources; Erneuerbare Energien

    Energy Technology Data Exchange (ETDEWEB)

    Lenz, Volker; Naumann, Karin [DBFZ Deutsches Biomasseforschungszentrum gemeinnuetzige GmbH, Leipzig (Germany); Kaltschmitt, Martin; Janczik, Sebastian [Technische Univ. Hamburg-Harburg (Germany). Inst. fuer Umwelttechnik und Energiewirtschaft

    2015-07-01

    Although the need to decarbonise our global economy and thus in particular the supply of energy to limit the global temperature increase is internationally undisputed the German politics in 2014 has significantly contributed less compared to previous years in order to attain this objective. The expansion of renewable energies in the electricity sector has decelerated significantly; and in the heating and mobility area no new impulses were set in relation to renewable energies. In addition, a dramatic fallen oil price makes it difficult to increase the use of renewable energy supply. Based on these deteriorated framework conditions compared to conditions of the previous years, the developments in Germany of 2014 are shown in the electricity, heat and transport sector in the field of renewable energy. For this purpose - in addition to a discussion of the current energy economic framework - for each option to use renewable energies the state and looming trends are analyzed. [German] Obwohl die Notwendigkeit zur Dekarbonisierung unserer globalen Wirtschaft und damit insbesondere der Energiebereitstellung zur Begrenzung des globalen Temperaturanstiegs international unstrittig ist, hat die deutsche Politik im Jahr 2014 im Vergleich zu den Vorjahren deutlich weniger zur Erreichung dieses Zieles beigetragen. Der Ausbau der Stromerzeugung aus erneuerbaren Energien im Stromsektor wurde deutlich verlangsamt; und im Waerme- und Mobilitaetsbereich wurden keine neuen Impulse in Bezug auf regenerative Energien gesetzt. Zusaetzlich erschwert ein drastisch gefallener Rohoelpreis die verstaerkte Nutzung des erneuerbaren Energieangebots. Ausgehend von diesen im Vergleich zu den Vorjahren verschlechterten Rahmenbedingungen werden nachfolgend die Entwicklungen in Deutschland des Jahres 2014 im Strom-, Waerme- und Transportsektor fuer den Bereich der erneuerbaren Energien aufgezeigt. Dazu werden - neben einer Diskussion des derzeitigen energiewirtschaftlichen Rahmens - fuer die

  5. Christmas Valley Renewable Energy Assessment

    Energy Technology Data Exchange (ETDEWEB)

    Del Mar, Robert [Oregon Department of Energy, Salem, OR (United States)

    2017-05-22

    In partnership with the Oregon Military Department, the Department of Energy used the award to assess and evaluate renewable resources in a 2,622-acre location in Lake County, central Oregon, leading to future development of up to 200 MW of solar electricity. In partnership with the Oregon Military Department, the Department of Energy used the award to assess and evaluate renewable resources in a 2,622-acre location in Lake County, central Oregon, leading to future development of up to 200 MW of solar electricity. The Oregon Military Department (Military) acquired a large parcel of land located in south central Oregon. The land was previously owned by the US Air Force and developed for an Over-the-Horizon Backscatter Radar Transmitter Facility, located about 10 miles east of the town of Christmas Valley. The Military is investigating a number of uses for the site, including Research and Development (R&D) laboratory, emergency response, military operations, developing renewable energy and related educational programs. One of the key potential uses would be for a large scale solar photovoltaic power plant. This is an attractive use because the site has excellent solar exposure; an existing strong electrical interconnection to the power grid; and a secure location at a moderate cost per acre. The project objectives include: 1. Site evaluation 2. Research and Development (R&D) facility analysis 3. Utility interconnection studies and agreements 4. Additional on-site renewable energy resources analysis 5. Community education, outreach and mitigation 6. Renewable energy and emergency readiness training program for veterans

  6. Renewable Energy: Ready to Meet Its Promise?

    Energy Technology Data Exchange (ETDEWEB)

    Bull, S. R.; Billman, L. L.

    1999-01-01

    This paper will briefly review the technical status, cost, and applications of major renewable energy technologies in 1998, and also discuss some of the socioeconomic impacts of wide-scale adoption of renewables.

  7. Probabilistic sampling of finite renewal processes

    CERN Document Server

    Antunes, Nelson; 10.3150/10-BEJ321

    2012-01-01

    Consider a finite renewal process in the sense that interrenewal times are positive i.i.d. variables and the total number of renewals is a random variable, independent of interrenewal times. A finite point process can be obtained by probabilistic sampling of the finite renewal process, where each renewal is sampled with a fixed probability and independently of other renewals. The problem addressed in this work concerns statistical inference of the original distributions of the total number of renewals and interrenewal times from a sample of i.i.d. finite point processes obtained by sampling finite renewal processes. This problem is motivated by traffic measurements in the Internet in order to characterize flows of packets (which can be seen as finite renewal processes) and where the use of packet sampling is becoming prevalent due to increasing link speeds and limited storage and processing capacities.

  8. Renewable Energy Resources in the United Kingdom.

    Science.gov (United States)

    Roberts, Michael J.; Thomas, M. Pugh

    1990-01-01

    This paper defines renewable energy and outlines possible sources of this energy. Supplies, and ethics are considered. The position of renewable energy sources in the energy policy of Great Britain are discussed. (CW)

  9. Renewable Energy Park - Preliminary Feasibility & Engineering Report

    Energy Technology Data Exchange (ETDEWEB)

    Ariwite, Roderick [Fallon Paiute Shoshone Tribe, NV (United States)

    2015-07-31

    This "Renewable Energy Park - Preliminary Feasibility & Engineering Report" seeks to provide an overall assessment and review of renewable energy development opportunities on the Fallon Indian Reservation and Colony Lands.

  10. Renewable Energy Potential for New Mexico

    Science.gov (United States)

    RE-Powering America's Land: Renewable Energy on Contaminated Land and Mining Sites was presented by Penelope McDaniel, during the 2008 Brown to Green: Make the Connection to Renewable Energy workshop.

  11. In Vitro and In Vivo Assessment of Humic Acid as an Aflatoxin Binder in Broiler Chickens

    National Research Council Canada - National Science Library

    van Rensburg, C. Jansen; Van Rensburg, C. E. J; Van Ryssen, J. B. J; Casey, N. H; Rottinghaus, G. E

    2006-01-01

    ..., and 11.9 mg of AFB1/g of oxihumate at pH 3, 5, and 7, respectively, were calculated. The in vivo efficacy of oxihumate as an aflatoxin binder in male broiler chickens exposed to aflatoxin-contaminated feed from 7 to 42 d of age was also assessed...

  12. Polyols as filler-binders for disintegrating tablets prepared by direct compaction

    NARCIS (Netherlands)

    Bolhuis, Gerad K.; Rexwinkel, Erik G.; Zuurman, Klaas

    2009-01-01

    Background: Although polyols are frequently used as tablet excipients in lozenges, chewing tablets, and orodisperse tablets, special directly compressible (DC) forms are recommended as filler-binder in common disintegrating tablets. Aim: In this article, DC types of isomalt, lactitol, mannitol, sorb

  13. Utilization of Cellulose from Luffa cylindrica Fiber as Binder in Acetaminophen Tablets

    Directory of Open Access Journals (Sweden)

    John Carlo O. Macuja

    2015-01-01

    Full Text Available Cellulose is an important pharmaceutical excipient. This study aimed to produce cellulose from the fiber of Luffa cylindrica as an effective binder in the formulation of acetaminophen tablets. This study was divided into three phases, namely, (I preparation of cellulose from Luffa cylindrica, (II determination of the powder properties of the LC-cellulose, and (III production and evaluation of acetaminophen of the tablets produced using LC-cellulose as binder. The percentage yield of LC-cellulose was 61%. The values of the powder properties of LC-cellulose produced show fair and passable flow properties and are within the specifications of a powdered pharmaceutical excipient. The mean tablet hardness and disintegration time of the LC-cellulose tablets have a significant difference in the mean tablet hardness and disintegration time of the tablets without binder; thus the cellulose produced improved the suitability of acetaminophen in the dry compression process. However, the tablet properties of the tablets produced using LC-cellulose as binder do not conform to the specifications of the US pharmacopeia; thus the study of additional methods and excipients is recommended.

  14. Use of Deep Peat-Processing Products for Hydrophobic Modification of Gypsum Binder

    Directory of Open Access Journals (Sweden)

    Misnikov Oleg

    2017-01-01

    Full Text Available The article deals with the issue of gypsum binder quality reduction during its storage and transportation. The study provides the main methods to protect gypsum from unauthorized exposure to moisture and water vapor. The author proposes hydrophobic modification as a perspective method for the preservation of gypsum activity and its water absorption reduction. The substantiation of cement hydrophobization with the bitumen released during peat thermolysis is provided. The author proposes to use this method in the technology of gypsum binder production. The basic idea is to combine the hydrophobization process with the calcination of calcium sulfate dehydrate. This is facilitated by temperature ranges used for dehydration of natural gypsum and the initial stage of thermal decomposition of the organic matter of peat. The author defined experimentally an optimal concentration of the organic component in gypsum binder. After adding 0.5-1% of the peat additive, the gypsum plaster preserved its grade strength and increased its storage time without caking and hydration, also under adverse conditions. The proposed method is adapted to the technological processes presently used in the production and doesn’t require changing any equipment. The price of mineral raw materials and semi-finished products of peat are approximately equal which reduces the probability of increasing of the cost of hydrophobically modified gypsum binder.

  15. Towards an Accurate Stress Dependant Time & Frequency Domain VE Response Model for Bituminous Binders

    NARCIS (Netherlands)

    Woldekidan, M.F.; Huurman, M.; Pronk, A.C.

    2010-01-01

    Linear viscoelastic properties of bituminous binders for short loading times are analyzed using dynamic mechanical analysis methods. Dynamic Shear Rheometer (DSR) test with parallel plate (PP) configuration is widely used for this purpose. Due to the complex stress distribution over the cross-sectio

  16. High-performance binders with reduced autogenous shrinkage on the basis of fine cement

    Energy Technology Data Exchange (ETDEWEB)

    Martschuk, V. [Inst. of the Cement Industry, Dusseldorf (Germany)

    2001-07-01

    A study on the hydration of portland cement was presented. The paper presented special features of the chemical shrinkage of cement paste at high and low water-cement ratios. It also described the effect of silica fume on the deformation behaviour of cement paste, as well as on the behaviour of hardened binder paste at water-binder ratios of 0.40 and 0.25. High performance concrete has a high density and a tendency to chemically shrink because of its low water-cement ratio. The study showed that the autogenous shrinkage increases if silica fume is added. Theoretical calculations were performed and showed that the typical addition of silica fume results in an increase in total porosity, and therefore, to the deterioration of the packing density of the binder mixture. The specific surface area of the dry powder is also increased. It was concluded that replacing cement by optimized fine cements improves the theoretical packing density in binders. The hardened cement paste studies showed that this makes a cement that is denser with less tendency to shrink. 7 refs., 3 tabs., 8 figs.

  17. Abdominal binders may reduce pain and improve physical function after major abdominal surgery - a systematic review

    DEFF Research Database (Denmark)

    Rothman, Josephine Philip; Gunnarsson, Ulf; Bisgaard, Thue

    2014-01-01

    . The PubMed, EMBASE and Cochrane databases were searched for studies on the use of abdominal binders after abdominal surgery or abdominoplasty. All types of clinical studies were included. Two independent assessors evaluated the scientific quality of the studies. The primary outcomes were pain, seroma...

  18. The curious case of zeolite-clay/binder interactions and their consequences for catalyst preparation

    NARCIS (Netherlands)

    Whiting, Gareth T; Chowdhury, Abhishek Dutta|info:eu-repo/dai/nl/412438003; Oord, R.; Paalanen, Pasi|info:eu-repo/dai/nl/370602013; Weckhuysen, Bert M|info:eu-repo/dai/nl/285484397

    2016-01-01

    Zeolite-based catalyst bodies are commonly employed in a range of important industrial processes. Depending on the binder and shaping method chosen, vast differences in the reactivity, selectivity and stability are obtained. Here, three highly complementary micro-spectroscopic techniques were

  19. Selection of a mineral binder with potentialities for the stabilization/solidification of aluminum metal

    Energy Technology Data Exchange (ETDEWEB)

    Cau Dit Coumes, C., E-mail: celine.cau-dit-coumes@cea.fr [Commissariat à l’Energie Atomique et aux Energies Alternatives, CEA/DEN/MAR/DTCD/SPDE, BP17171, 30207 Bagnols-sur-Cèze cedex (France); Lambertin, D.; Lahalle, H.; Antonucci, P. [Commissariat à l’Energie Atomique et aux Energies Alternatives, CEA/DEN/MAR/DTCD/SPDE, BP17171, 30207 Bagnols-sur-Cèze cedex (France); Cannes, C.; Delpech, S. [Institut de Physique Nucléaire, CNRS, Univ. Paris-Sud 11, 91406 Orsay Cedex (France)

    2014-10-15

    Highlights: • Binders capable of reducing the pore solution pH compared with Portland cements are reviewed. • The binders are then tested against aluminum corrosion. • Corrosion of aluminum metal is minimal with magnesium phosphate cement. • The H{sub 2} release can be reduced still further by adding LiNO{sub 3} to the mixing solution. • Electrochemical characterizations show that aluminum tends to a passive state. - Abstract: In a strongly alkaline medium, such as that encountered in conventional cementitious materials based on Portland cement, aluminum metal is corroded, with continued production of hydrogen. In order to develop a mineral matrix having enhanced compatibility with aluminum, a literature review was first undertaken to identify binders capable of reducing the pore solution pH compared with Portland cement. An experimental study was then carried out to measure the hydrogen production resulting from corrosion of aluminum metal rods encapsulated in the different selected cement pastes. The best results were achieved with magnesium phosphate cement, which released very little hydrogen over the duration of the study. This production could be reduced still further by adding a corrosion inhibitor (lithium nitrate) to the mixing solution. Open circuit potential measurement and Electrochemical Impedance Spectroscopy of aluminum electrode encapsulated in two pastes based on Portland cement and magnesium phosphate cement showed different redox behaviors. In the Portland cement paste, the electrochemical data confirmed the corrosion of aluminum whereas this latter tended to a passive state in the magnesium phosphate binder.

  20. Towards an Accurate Stress Dependant Time & Frequency Domain VE Response Model for Bituminous Binders

    NARCIS (Netherlands)

    Woldekidan, M.F.; Huurman, M.; Pronk, A.C.

    2010-01-01

    Linear viscoelastic properties of bituminous binders for short loading times are analyzed using dynamic mechanical analysis methods. Dynamic Shear Rheometer (DSR) test with parallel plate (PP) configuration is widely used for this purpose. Due to the complex stress distribution over the cross-sectio

  1. Creep recovery behaviour of bituminous binders - relevance to permanent deformation of asphalt pavements

    CSIR Research Space (South Africa)

    Mturi, GAJ

    2012-05-01

    Full Text Available different modifiers has expanded the range of PMBs to select from when designing pavements in order to avoid pavement deformation. The new binder selection criterion using the Multiple Stress Creep and Recovery (MSCR) protocol as per ASTM D7405 is meant...

  2. Advanced Graphene-Based Binder-Free Electrodes for High-Performance Energy Storage.

    Science.gov (United States)

    Ji, Junyi; Li, Yang; Peng, Wenchao; Zhang, Guoliang; Zhang, Fengbao; Fan, Xiaobin

    2015-09-23

    The increasing demand for energy has triggered tremendous research effort for the development of high-performance and durable energy-storage devices. Advanced graphene-based electrodes with high electrical conductivity and ion accessibility can exhibit superior electrochemical performance in energy-storage devices. Among them, binder-free configurations can enhance the electron conductivity of the electrode, which leads to a higher capacity by avoiding the addition of non-conductive and inactive binders. Graphene, a 2D material, can be fabricated into a porous and flexible structure with an interconnected conductive network. Such a conductive structure is favorable for both electron and ion transport to the entire electrode surface. In this review, the main processes used to prepare binder-free graphene-based hybrids with high porosity and well-designed electron conductive networks are summarized. Then, the applications of free-standing binder-free graphene-based electrodes in energy-storage devices are discussed. Future research aspects with regard to overcoming the technological bottlenecks are also proposed.

  3. Interactions between TiAl alloy and AZC/AMT binder systems in investment casting

    Directory of Open Access Journals (Sweden)

    Yi Jia

    2015-11-01

    Full Text Available In this work, two kinds of binders, Ammonium Zirconium Carbonate (AZC and Ammonium Metatungstate (AMT hydrate, and three kinds of powders (ZrO2, Al2O3 and Y2O3 were mixed to fabricate six kinds of face coating systems. The thermal behaviors of the AZC and AMT dried binders were investigated by TG-DTA, and the phase transformation of the two binders was determined by XRD. Monoclinic ZrO2 phase was formed from AZC at 620 °C and WO3 at 700 °C, and the phase transformation was completed at lower than 1000 °C in both binders, and therefore, the sintering temperature for the molds was selected at 950 °C. The interaction between the ceramic molds with different face coatings and the Ti-48Al-2Cr-2Nb alloy during investment casting was studied. Results showed no α-case reaction in the TiAl-mold reaction, and the AMT + Y2O3 face coating appeared to be the best choice for investment casting of TiAl alloys under the experimental conditions.

  4. Preparation of Granular Red Mud Adsorbent using Different Binders by Microwave Pore - Making and Activation Method

    Science.gov (United States)

    Le, Thiquynhxuan; Wang, Hanrui; Ju, Shaohua; Peng, Jinhui; Zhou, Liexing; Wang, Shixing; Yin, Shaohua; Liu, Chao

    2016-04-01

    In this work, microwave energy is used for preparing a granular red mud (GRM) adsorbent made of red mud with different binders, such as starch, sodium silicate and cement. The effects of the preparation parameters, such as binder type, binder addition ratio, microwave heating temperature, microwave power and holding time, on the absorption property of GRM are investigated. The BET surface area, strength, pore structure, XRD and SEM of the GRM absorbent are analyzed. The results show that the microwave roasting has a good effect on pore-making of GRM, especially when using organic binder. Both the BET surface area and the strength of GRM obtained by microwave heating are significantly higher than that by conventional heating. The optimum conditions are obtained as follows: 6:100 (w/w) of starch to red mud ratio, microwave roasting with a power of 2.6 kW at 500℃ for holding time of 30 min. The BET surface area, pore volume and average pore diameter of GRM prepared at the optimum conditions are 15.58 m2/g, 0.0337 cm3/g and 3.1693 A0, respectively.

  5. Iron-based phosphate binders--a new element in management of hyperphosphatemia.

    Science.gov (United States)

    Pai, Amy Barton; Jang, Soo Min; Wegrzyn, Nicole

    2016-01-01

    Management of serum phosphorus in patients with chronic kidney disease remains a significant clinical challenge. A pivotal component of the clinical approach to maintaining serum phosphorus concentrations towards the normal range is the use of phosphate binding agents in addition to comprehensive dietary counseling. The available agents work similarly by capitalizing on a cation within the agent to bind negatively charged phosphorus, forming an insoluble complex and reducing ingested phosphorus absorption. Despite several effective options for phosphate binder therapies, patient adherence remains an issue, mainly due to adverse effect profiles and large daily pill burdens. Two new iron-based phosphate binder therapies have recently become available in the United States, sucroferric oxyhydroxide and ferric citrate. These agents have both been shown to effectively reduce serum phosphorus comparably to widely used calcium-based binders and sevelamer salts. The two new iron-based binders differ substantially with regard to phosphate binding chemistry and iron absorption profiles. Their place in therapy is still evolving and the impact of pill burden, gastrointestinal adverse effect profiles, potential cost reduction of anemia therapies and physiologic effects of long-term iron exposure need to be further evaluated.

  6. QSAR classification of estrogen receptor binders and pre-screening of potential pleiotropic EDCs.

    Science.gov (United States)

    Li, J; Gramatica, P

    2010-10-01

    Endocrine disrupting chemicals (EDCs) are suspected of posing serious threats to human and wildlife health through a variety of mechanisms, these being mainly receptor-mediated modes of action. It is reported that some EDCs exhibit dual activities as estrogen receptor (ER) and androgen receptor (AR) binders. Indeed, such compounds can affect the normal endocrine system through a dual complex mechanism, so steps should be taken not only to identify them a priori from their chemical structure, but also to prioritize them for experimental tests in order to reduce and even forbid their usage. To date, very few EDCs with dual activities have been identified. The present research uses QSARs, to investigate what, so far, is the largest and most heterogeneous ER binder data set (combined METI and EDKB databases). New predictive classification models were derived using different modelling methods and a consensus approach, and these were used to virtually screen a large AR binder data set after strict validation. As a result, 46 AR antagonists were predicted from their chemical structure to also have potential ER binding activities, i.e. pleiotropic EDCs. In addition, 48 not yet recognized ER binders were in silico identified, which increases the number of potential EDCs that are substances of very high concern (SVHC) in REACH. Thus, the proposed screening models, based only on structure information, have the main aim to prioritize experimental tests for the highlighted compounds with potential estrogenic activities and also to design safer alternatives.

  7. Incinerated sewage sludge ash as alternative binder in cement-based materials

    DEFF Research Database (Denmark)

    Krejcirikova, Barbora; Goltermann, Per; Hodicky, Kamil

    2013-01-01

    it can minimize the need of ash landfill disposal. The objective of this study is to show potential use of incinerated sewage sludge ash (ISSA), an industrial byproduct, as possible binder in cement-based materials. Chemical and mechanical characteristics are presented and compared with results obtained...

  8. Conductivity Enhancement of Binder-Based Graphene Inks by Photonic Annealing and Subsequent Compression Rolling

    NARCIS (Netherlands)

    Arapov, K.; Bex, G.; Hendriks, R.; Rubingh, E.; Abbel, R.; de With, G.; Friedrich, H.

    2016-01-01

    This paper describes a combination of photonic annealing and compression rolling to improve the conductive properties of printed binder-based graphene inks. High-density light pulses result in temperatures up to 500 °C that along with a decrease of resistivity lead to layer expansion. The structural

  9. Mimosa pudica seed mucilage: isolation; characterization and evaluation as tablet disintegrant and binder.

    Science.gov (United States)

    Ahuja, Munish; Kumar, Ashok; Yadav, Parvinder; Singh, Kuldeep

    2013-06-01

    In the present study Mimosa pudica seed mucilage was isolated, characterized and evaluated as tablet binder and disintegrant. Several properties of mucilage like high swelling index and gelling nature prompted us to explore its applications as disintegrating and binding agent. Disintegrant properties were evaluated by formulating directly compressed hydrochlorothiazide tablets containing 1%-10% (w/w) of seed mucilage as disintegrant and compared with the standard disintegrants. The disintegration time of mucilage containing tablets was found to be in the order of 3%>1%>5%>7.5%>10%. On comparative evaluation with standard disintegrants, it was observed that the order of disintegration of tablets was Ac-Di-SolMimosa mucilage at 6%, 8%, and 10% (w/w) concentration as the binder and compared with tablets prepared using PVP-K25 (1.7%, w/w) and acacia (6.8%, w/w) as the binder. Mimosa mucilage at 10% (w/w) concentration provided tablets with adequate hardness and friability. In conclusion, M. pudica seed mucilage is a potential tablet disintegrant and binder. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Conductivity Enhancement of Binder-Based Graphene Inks by Photonic Annealing and Subsequent Compression Rolling

    NARCIS (Netherlands)

    Arapov, K.; Bex, G.; Hendriks, R.; Rubingh, E.; Abbel, R.; de With, G.; Friedrich, H.

    2016-01-01

    This paper describes a combination of photonic annealing and compression rolling to improve the conductive properties of printed binder-based graphene inks. High-density light pulses result in temperatures up to 500 °C that along with a decrease of resistivity lead to layer expansion. The structural

  11. Wind, hydro or mixed renewable energy source

    DEFF Research Database (Denmark)

    Yang, Yingkui; Solgaard, Hans Stubbe; Haider, Wolfgang

    2016-01-01

    While the share of renewable energy, especially wind power, increases in the energy mix, the risk of temporary energy shortage increases as well. Thus, it is important to understand consumers' preference for the renewable energy towards the continuous growing renewable energy society. We use...

  12. Binder characterisation of mortars used at different ages in the San Lorenzo church in Milan

    Energy Technology Data Exchange (ETDEWEB)

    Bertolini, Luca, E-mail: luca.bertolini@polimi.it; Carsana, Maddalena, E-mail: maddalena.carsana@polimi.it; Gastaldi, Matteo, E-mail: matteo.gastaldi@polimi.it; Lollini, Federica, E-mail: federica.lollini@polimi.it; Redaelli, Elena, E-mail: elena.redaelli@polimi.it

    2013-06-15

    The paper describes a study on the mortars of the basilica of San Lorenzo in Milan, which was carried out to support an archaeological study aimed at dating and documenting the construction techniques used throughout the centuries. The church, which was founded between the 4th and 5th century, at the end of the period when Milan was the capital of the Roman Empire, was subjected in time to extensions, collapses and reconstructions that lasted until the Renaissance period and even later on. Thanks to the good state of conservation, San Lorenzo church is a collection of materials and construction techniques throughout a period of more than a millennium. Mortars were investigated in order to compare the binders used for structural elements built in different historical ages. From an archaeological study, samples of mortars attributed to the late Roman period, the Middle Ages and the Renaissance were available. The binder of each sample was separated by the aggregates and it was characterised on the basis of X-ray diffraction analysis, thermogravimetric analysis and scanning electron microscopy. Constituents of the binder were identified and their origin is discussed in order to investigate if they could be attributed to the original composition of the binder or to possible alteration in time due to atmospheric pollution. Results show that, even though the binder is mainly based on magnesian lime, there are significant differences in the microstructure of the binding matrix used in mortars ascribed to the different historical periods. In the Roman period, in correspondence of the structural elements that required higher strength, also hydraulic cocciopesto mortars were detected. Gypsum was found in most samples, which was maybe added intentionally. - Highlights: • Binders of mortars of San Lorenzo church in Milan were investigated. • Roman, Middle Ages and Renaissance samples were studied by XRD, TG and SEM. • Magnesian-lime binders containing silico

  13. Cold in-place recycling characterization framework for single or multiple component binder systems

    Science.gov (United States)

    Cox, Benjamin C.

    Cold in-place recycling (CIR) is a pavement rehabilitation technique which has gained momentum in recent years. This momentum is due partly to its economic and sustainability characteristics, which has led to CIR market expansion. When pavement network deterioration is considered alongside increasing material costs, it is not beyond reason to expect demands on CIR to continue to increase. Historically, single component binder (SCB) systems, those with one stabilization binder (or two if the secondary binder dosage is 1% or less), have dominated the CIR market and could be considered the general state of practice. Common stabilization binders are either bituminous or cementitious. Two example SCB systems would be: 1) 3% portland cement, or 2) 3% asphalt emulsion with 1% hydrated lime. While traditional SCB systems have demonstrated positive economic and sustainability impacts, this dissertation focuses on multiple component binder (MCB) systems (bituminous and cementitious combined) which exhibit the potential to provide better overall economics and performance. Use of MCBs has the potential to alleviate SCB issues to some extent (e.g. cracking with cementitious SCBs, rutting with bituminous SCBs). Furthermore, to fairly represent both binders in an MCB system a universal design method which can accommodate multiple binder types is needed. The main objectives of this dissertation are to develop a universal CIR design framework and, using this framework, characterize multiple SCB and MCB systems. Approximately 1500 CIR specimens were tested herein along with approximately 300 asphalt concrete specimens which serve as a reference data set for CIR characterization. A case study of a high-traffic Mississippi CIR project which included cement SCB and emulsion SCB sections is also presented to support laboratory efforts. Individual components needed to comprise a universal design framework, such as curing protocols, were developed. SCB and MCB characterization indicated

  14. Protective Influence of Gamma Rays and Electron-Beam Irradiation with a Commercial Toxin Binder on Toxic Effects of Aflatoxin B1 in Japanese Quails

    Directory of Open Access Journals (Sweden)

    Saeed Hasanpour

    2015-11-01

    Full Text Available Background: This cross sectional study was conducted to evaluate the effect of γ-rays and electron-beam irradiation with a commercial toxin binder-milbond-TX on the performance, feed components, and meat quality of Japanese quails challenged with aflatoxin B1. Methods: Overall, 168 One-d-old chicks (Japanese quails were allocated to eight treatments with three replicates based on a completely randomized design in a 2×4 factorial arrangement. Two levels of aflatoxin (Zero and 2 ppm were considered as the essential factor. The secondary factor was involved in four levels (Control, 27 k Gy doses of γ-rays, electron-beam irradiation, and 0.3% commercial toxin binder-milbond-TX. Results: In vitro condition showed that experiment diets do not have any effect on meat quality and feed components such as malondialdehyde, protein, fat, ash, and the dry matter. However, the highest and the lowest levels of feed intake and body weight gain were observed in the 7th treatment (2-ppm aflatoxin B1 + electron-beam irradiation and the 2nd treatment (2-ppm aflatoxin B1 alone, respectively in 1-15 and 29-42 days (P≤0.05. In addition, the highest liver weight (1.73, spleen (0.57 and bursa (0.18 were seen in the second treatment (2 ppm aflatoxin B1 alone (P≤0.05 at the age of 42 days. Conclusion: γ-rays and electron-beam irradiation plus commercial toxin binder-milbond-TX can be used for aflatoxin B1 absorption in poultry diets.

  15. Phage display-derived binders able to distinguish Listeria monocytogenes from other Listeria species.

    Directory of Open Access Journals (Sweden)

    Josephine Morton

    Full Text Available The objective of this study was to produce phage display-derived binders with the ability to distinguish Listeria monocytogenes from other Listeria spp., which may have potential utility to enhance detection of Listeria monocytogenes. To obtain binders with the desired binding specificity a series of surface and solution phage-display biopannings were performed. Initially, three rounds of surface biopanning against gamma-irradiated L. monocytogenes serovar 4b cells were performed followed by an additional surface biopanning round against L. monocytogenes 4b which included prior subtraction biopanning against gamma-irradiated L. innocua cells. In an attempt to further enhance binder specificity for L. monocytogenes 4b two rounds of solution biopanning were performed, both rounds included initial subtraction solution biopanning against L. innocua. Subsequent evaluations were performed on the phage clones by phage binding ELISA. All phage clones tested from the second round of solution biopanning had higher specificity for L. monocytogenes 4b than for L. innocua and three other foodborne pathogens (Salmonella spp., Escherichia coli and Campylobacter jejuni. Further evaluation with five other Listeria spp. revealed that one phage clone in particular, expressing peptide GRIADLPPLKPN, was highly specific for L. monocytogenes with at least 43-fold more binding capability to L. monocytogenes 4b than to any other Listeria sp. This proof-of-principle study demonstrates how a combination of surface, solution and subtractive biopanning was used to maximise binder specificity. L. monocytogenes-specific binders were obtained which could have potential application in novel detection tests for L. monocytogenes, benefiting both the food and medical industries.

  16. Mechanical strength development of mortars containing volcanic scoria-based binders with different fineness

    Directory of Open Access Journals (Sweden)

    Aref M. al-Swaidani

    2016-06-01

    Full Text Available The benefits of using natural pozzolan as cement replacement are often associated with shortcomings such as the need to moist-curing for longer time and a reduction of strength at early ages. The objective of the study is to investigate the influence of binder fineness on the mechanical strength development of scoria-based binder mortars. In the study, mortar specimens have been produced with four types of binder: one plain Portland cement (control and three scoria-based binders with three replacement levels: 25%, 30% and 35%, respectively. All scoria-based binders have been inter-ground into four different Blaine fineness: 2400, 3200, 4200 and 5100 cm2/g. The development of the compressive and flexural tensile strength of all mortar specimens with curing time has been investigated. The effects of the Blaine fineness of the scoria-based blended cement on the compressive and flexural strengths of mortar have been evaluated at curing ages of 2, 7, 28 and 90 days, respectively. Particle size distribution measured by a laser diffractometer has been considered in the study. Test results revealed that there is a decrease in strength with increasing amounts of scoria. In addition, there was found an increase in strength with increasing the Blaine fineness values. No direct relationship between Blaine and particle size distribution was observed. Effects of Blaine fineness on some physical properties of blended cements such as water demand, setting times and soundness have also been investigated. Further, an estimation equation for strength development incorporating the effects of fineness measured either by Blaine or by particle size distribution has been derived by the authors.

  17. Phage display-derived binders able to distinguish Listeria monocytogenes from other Listeria species.

    Science.gov (United States)

    Morton, Josephine; Karoonuthaisiri, Nitsara; Charlermroj, Ratthaphol; Stewart, Linda D; Elliott, Christopher T; Grant, Irene R

    2013-01-01

    The objective of this study was to produce phage display-derived binders with the ability to distinguish Listeria monocytogenes from other Listeria spp., which may have potential utility to enhance detection of Listeria monocytogenes. To obtain binders with the desired binding specificity a series of surface and solution phage-display biopannings were performed. Initially, three rounds of surface biopanning against gamma-irradiated L. monocytogenes serovar 4b cells were performed followed by an additional surface biopanning round against L. monocytogenes 4b which included prior subtraction biopanning against gamma-irradiated L. innocua cells. In an attempt to further enhance binder specificity for L. monocytogenes 4b two rounds of solution biopanning were performed, both rounds included initial subtraction solution biopanning against L. innocua. Subsequent evaluations were performed on the phage clones by phage binding ELISA. All phage clones tested from the second round of solution biopanning had higher specificity for L. monocytogenes 4b than for L. innocua and three other foodborne pathogens (Salmonella spp., Escherichia coli and Campylobacter jejuni). Further evaluation with five other Listeria spp. revealed that one phage clone in particular, expressing peptide GRIADLPPLKPN, was highly specific for L. monocytogenes with at least 43-fold more binding capability to L. monocytogenes 4b than to any other Listeria sp. This proof-of-principle study demonstrates how a combination of surface, solution and subtractive biopanning was used to maximise binder specificity. L. monocytogenes-specific binders were obtained which could have potential application in novel detection tests for L. monocytogenes, benefiting both the food and medical industries.

  18. A review of binders used in cemented paste tailings for underground and surface disposal practices.

    Science.gov (United States)

    Tariq, Amjad; Yanful, Ernest K

    2013-12-15

    Increased public awareness of environmental issues coupled with increasingly stringent environmental regulations pertaining to the disposal of sulphidic mine waste necessitates the mining industry to adopt more competent and efficient approaches to manage acid rock drainage. Cemented paste tailings (CPT) is an innovative form of amalgamated material currently available to the mining industry in developed countries. It is made usually from mill tailings mingled with a small amount of binder (customarily Portland cement) and water. The high cost associated with production and haulage of ordinary Portland cement and its alleged average performance as a sole binder in the long term (due to vulnerability to internal sulphate attack) have prompted users to appraise less expensive and technically efficient substitutes for mine tailings paste formulations. Generally, these binders include but are not limited to sulphate resistant cements, and/or as a partial replacement for Portland cement by artificial pozzolans, natural pozzolans, calcium sulphate substances and sodium silicates. The approach to designing environmentally efficient CPT is to ensure long-term stability and effective control over environmental contaminants through the use of composite binder systems with enhanced engineering properties to cater for inherit deficiencies in the individual constituents. The alkaline pore solution created by high free calcium rich cement kiln dust (CKD) (byproduct of cement manufacturing) is capable of disintegrating the solid glassy network of artificial pozzolans to produce reactive silicate and aluminate species when attacked by (OH(-)) ions. The augmented pozzolanic reactivity of CKD-slag and CKD-fly ash systems may produce resilient CPT. Since cemented paste comprising mine tailings and binders is a relatively new technology, a review of the binding materials used in such formulations and their performance evaluation in mechanical fill behaviour was considered pertinent in

  19. Polyamidoamine dendrimer-based binders for high-loading lithium–sulfur battery cathodes

    Energy Technology Data Exchange (ETDEWEB)

    Bhattacharya, Priyanka; Nandasiri, Manjula I.; Lv, Dongping; Schwarz, Ashleigh M.; Darsell, Jens T.; Henderson, Wesley A.; Tomalia, Donald A.; Liu, Jun; Zhang, Ji-Guang; Xiao, Jie

    2016-01-01

    Lithium-sulfur (Li-S) batteries are regarded as one of the most promising candidates for next generation energy storage systems because of their ultra high theoretical specific energy. To realize the practical application of Li-S batteries, however, a high S active material loading is essential (>70 wt% in the carbon-sulfur (C-S) composite cathode and >2 mg cm-2 in the electrode). A critical challenge to achieving this high capacity in practical electrodes is the dissolution of the longer lithium polysulfide reaction intermediates in the electrolyte (resulting in loss of active material from the cathode and contamination of the anode due to the polysulfide shuttle mechanism). The binder material used for the cathode is therefore crucial as this is a key determinant of the bonding interactions between the active material (S) and electronic conducting support (C), as well as the maintenance of intimate contact between the electrode materials and current collector. The battery performance can thus be directly correlated with the choice of binder, but this has received only minimal attention in the relevant Li-S battery published literature. Here, we investigated the application of polyamidoamine (PAMAM) dendrimers as functional binders in Li-S batteries—a class of materials which has been unexplored for electrode design. By using dendrimers, it is demonstrated that high S loadings (>4 mg cm-2) can be easily achieved using "standard" (not specifically tailored) materials and simple processing methods. An exceptional electrochemical cycling performance was obtained (as compared to cathodes with conventional linear polymeric binders such as carboxymethyl cellulose (CMC) and styrene-butadiene rubber (SBR)) with >100 cycles and 85-98% capacity retention, thus demonstrating the significant utility of this new binder architecture which exhibits critical physicochemical properties and flexible nanoscale design parameters (CNDP's).

  20. Prediction of antigenic epitopes and MHC binders of neurotoxin ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-12-01

    Dec 1, 2009 ... Hydrophobicity plot of neurotoxin alpha-KTx 3.8 by Hopp TP, Woods KR (1981). tion methods are ... protein is hydrophobic in nature and contains segments of low complexity ..... Hydrophobicity indices at ph 3.4 determined by ...

  1. Inventor networks in renewable energies

    DEFF Research Database (Denmark)

    Cantner, Uwe; Graf, Holger; Herrmann, Johannes

    2016-01-01

    Technological change and gains in efficiency of renewable power generation technologies are to a large extent driven by governmental support. Various policy instruments that can broadly be categorized as technology push, demand pull or systemic constitute part of the policy mix for renewable...... energies. Our goal is to gain insights into the influence of this policy mix on the intensity and organization of inventive activities for wind power and photovoltaics in Germany since the 1980s. We examine the effect of different instruments on the size and structure of co-inventor networks based...... a consistent mix of policy instruments. The structure of the networks is driven by demand pull for both technologies. Systemic instruments increase interaction, especially in the wind power network, and are complementary to demand pull in fostering collaboration....

  2. Photon Science for Renewable Energy

    Energy Technology Data Exchange (ETDEWEB)

    Hussain, Zahid; Tamura, Lori; Padmore, Howard; Schoenlein, Bob; Bailey, Sue

    2010-03-31

    Our current fossil-fuel-based system is causing potentially catastrophic changes to our planet. The quest for renewable, nonpolluting sources of energy requires us to understand, predict, and ultimately control matter and energy at the electronic, atomic, and molecular levels. Light-source facilities - the synchrotrons of today and the next-generation light sources of tomorrow - are the scientific tools of choice for exploring the electronic and atomic structure of matter. As such, these photon-science facilities are uniquely positioned to jump-start a global revolution in renewable and carbonneutral energy technologies. In these pages, we outline and illustrate through examples from our nation's light sources possible scientific directions for addressing these profound yet urgent challenges.

  3. Photon Science for Renewable Energy

    Energy Technology Data Exchange (ETDEWEB)

    Hussain, Zahid; Tamura, Lori; Padmore, Howard; Schoenlein, Bob; Bailey, Sue

    2010-03-31

    Our current fossil-fuel-based system is causing potentially catastrophic changes to our planet. The quest for renewable, nonpolluting sources of energy requires us to understand, predict, and ultimately control matter and energy at the electronic, atomic, and molecular levels. Light-source facilities - the synchrotrons of today and the next-generation light sources of tomorrow - are the scientific tools of choice for exploring the electronic and atomic structure of matter. As such, these photon-science facilities are uniquely positioned to jump-start a global revolution in renewable and carbonneutral energy technologies. In these pages, we outline and illustrate through examples from our nation's light sources possible scientific directions for addressing these profound yet urgent challenges.

  4. Renewables for Heating and Cooling

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2007-07-01

    This timely report examines the technologies, current markets and relative costs for heat and cold production using biomass, geothermal and solar-assisted systems. It evaluates a range of national case studies and relevant policies. Should the successful and more cost-effective policies be implemented by other countries, then the relatively untapped economic potential of renewable energy heating and cooling systems could be better realised, resulting in potential doubling of the present market within the next few years.

  5. Renewable Energy Development in India

    Energy Technology Data Exchange (ETDEWEB)

    Gupta, K.M.

    2007-07-01

    India has done a significant progress in the power generation in the country. The installed generation capacity was 1300 megawatt (MW) at the time of Independence i.e. about 60 years back. The total generating capacity anticipated at the end of the Tenth Plan on 31-03-2007, is 1, 44,520 MW which includes the generation through various sectors like Hydro, Thermal and Nuclear. Emphasis is given to the renewable energy programme towards gradual commercialization. This programme is looked after by the Ministry of Non-Conventional Sources of energy. Since the availability of fossil fuel is on the decline therefore, in this backdrop the norms for conventional or renewable sources of energy (RSE) is given importance not only in India but has attracted the global attention. The main items under RSE are as follows: (i) Hydro Power (ii) Solar Power (iii) Wind Power (iv) Bio-mass Power (v) Energy from waste (vi) Ocean energy, and (vii) Alternative fuel for surface transportation. Evolution of power transformer technology in the country during the past five decades is quite impressive. There are manufacturers in the country with full access to the latest technology at the global level. Some of the manufacturers have impressive R&D set up to support the technology. Renewable energy is very much promoted by the Chinese Government. At the same time as the law was passed, the Chinese Government set a target for renewable energy to contribute 10% of the country's gross energy consumption by 2020, a huge increase from the current 1%. It has been felt that there is rising demand for energy, food and raw materials by a population of 2.5 billion Chinese and Indians. Both these countries have large coal dominated energy systems in the world and the use of fossil fuels such as coal and oil releases carbon dioxide (CO2) into the air which adds to the greenhouse gases which lead to global warming. (auth)

  6. Energy Transition to Renewables: Problems

    OpenAIRE

    2014-01-01

    What will come first ? non-acceptable global warming or extinction of oil reserves? Both processes can bring substantial costs to the mankind, but their order has important economic implications. The answer to this question will either lower oil price in the long run or will lead to its further rise. It is very important for Russian economy. From the global perspective, both dangers should be taken into account, and transition to renewable energies is the only remedy for both. However, the op...

  7. Customer choice and renewable energy

    Energy Technology Data Exchange (ETDEWEB)

    Schaefer, D.

    1996-12-31

    Opinions on political and social factors affecting the U.S. market for wind power are presented in this paper. The position of and activities taken by U.S. Congressman Dan Schaefer as Chairman of the House Energy and Power Subcommittee are outlined. Background information used as input to subcommittee hearings is summarized. The formation and activities of the House Renewable Energy Caucus are very briefly described.

  8. A proteomics strategy to elucidate functional protein-protein interactions applied to EGF signaling

    DEFF Research Database (Denmark)

    Blagoev, B.; Kratchmarova, I.; Ong, S.E.

    2003-01-01

    Mass spectrometry-based proteomics can reveal protein-protein interactions on a large scale, but it has been difficult to separate background binding from functionally important interactions and still preserve weak binders. To investigate the epidermal growth factor receptor (EGFR) pathway, we...

  9. Renewable energy annual 1997. Volume 1

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-02-01

    This report presents information on renewable energy consumption, capacity, and electricity generation data, as well as data on US solar thermal and photovoltaic collector manufacturing activities. The renewable energy resources included in the report are: biomass (wood, ethanol, and biodiesel); municipal solid waste; geothermal; wind; and solar (solar thermal and photovoltaic). The first chapter of the report provides an overview of renewable energy use and capability from 1992 through 1996. It contains renewable energy consumption, capacity, and electricity generation data, as well as descriptive text. Chapter 2 presents current (through 1996) information on the US solar energy industry. A glossary of renewable energy terms is also included. 15 figs., 42 tabs.

  10. Renewable energy for rural electrification

    Energy Technology Data Exchange (ETDEWEB)

    Strebkov, D. [All Russian Research Institute for Electrification of the Agriculture, Moscow (Russian Federation); Bezrukich, P. [Ministry for Fuel and Energy of Russian Federation, Moscow (Russian Federation); Kozlov, V. [Intersolarcenter Association, Moscow (Russian Federation)

    1997-12-31

    In spite of quite good centralized power supply system, rural electrification level across Russia vary widely: in some regions there are densely populated communities which lack power, while in the other the most pressing need is to electrify dispersed, isolated villages or homes. The main objective of the Russian project `Renewable energy for rural electrification` is the elaboration and application of new technologies of rural electrification in order to ensure the sustainable development of unelectrified areas of the Russia. The long-term objective of the project are: to improve the living standards of people in rural areas, who lack centralized energy supply systems, by introducing a new system for generation, transmission and distribution of electric power on the base of renewable energy systems; to provide a reliable cost-effective electric service for electrified and uncertified communities; to reduce the consumption of organic fuel in power generation systems; to support the military industry in converting their activity into the renewable energy sector; and to protect the environment

  11. Optimal Foraging of Renewable Resources

    CERN Document Server

    Enright, John J

    2011-01-01

    Consider a team of agents in the plane searching for and visiting target points that appear in a bounded environment according to a stochastic renewal process with a known absolutely continuous spatial distribution. Agents must detect targets with limited-range onboard sensors. It is desired to minimize the expected waiting time between the appearance of a target point, and the instant it is visited. When the sensing radius is small, the system time is dominated by time spent searching, and it is shown that the optimal policy requires the agents to search a region at a relative frequency proportional to the square root of its renewal rate. On the other hand, when targets appear frequently, the system time is dominated by time spent servicing known targets, and it is shown that the optimal policy requires the agents to service a region at a relative frequency proportional to the cube root of its renewal rate. Furthermore, the presented algorithms in this case recover the optimal performance achieved by agents ...

  12. Characterization of 27 Mycotoxin Binders and the Relation with in Vitro Zearalenone Adsorption at a Single Concentration

    Science.gov (United States)

    De Mil, Thomas; Devreese, Mathias; De Baere, Siegrid; Van Ranst, Eric; Eeckhout, Mia; De Backer, Patrick; Croubels, Siska

    2015-01-01

    The aim of this study was to characterize 27 feed additives marketed as mycotoxin binders and to screen them for their in vitro zearalenone (ZEN) adsorption. Firstly, 27 mycotoxin binders, commercially available in Belgium and The Netherlands, were selected and characterized. Characterization was comprised of X-ray diffraction (XRD) profiling of the mineral content and d-spacing, determination of the cation exchange capacity (CEC) and the exchangeable base cations, acidity, mineral fraction, relative humidity (RH) and swelling volume. Secondly, an in vitro screening experiment was performed to evaluate the adsorption of a single concentration of ZEN in a ZEN:binder ratio of 1:20,000. The free concentration of ZEN was measured after 4 h of incubation with each of the 27 mycotoxin binders at a pH of 2.5, 6.5 and 8.0. A significant correlation between the free concentration of ZEN and both the d-spacing and mineral fraction of the mycotoxin binders was seen at the three pH levels. A low free concentration of ZEN was demonstrated using binders containing mixed-layered smectites and binders containing humic acids. PMID:25568976

  13. Characterization of 27 Mycotoxin Binders and the Relation with in Vitro Zearalenone Adsorption at a Single Concentration

    Directory of Open Access Journals (Sweden)

    Thomas De Mil

    2015-01-01

    Full Text Available The aim of this study was to characterize 27 feed additives marketed as mycotoxin binders and to screen them for their in vitro zearalenone (ZEN adsorption. Firstly, 27 mycotoxin binders, commercially available in Belgium and The Netherlands, were selected and characterized. Characterization was comprised of X-ray diffraction (XRD profiling of the mineral content and d-spacing, determination of the cation exchange capacity (CEC and the exchangeable base cations, acidity, mineral fraction, relative humidity (RH and swelling volume. Secondly, an in vitro screening experiment was performed to evaluate the adsorption of a single concentration of ZEN in a ZEN:binder ratio of 1:20,000. The free concentration of ZEN was measured after 4 h of incubation with each of the 27 mycotoxin binders at a pH of 2.5, 6.5 and 8.0. A significant correlation between the free concentration of ZEN and both the d-spacing and mineral fraction of the mycotoxin binders was seen at the three pH levels. A low free concentration of ZEN was demonstrated using binders containing mixed-layered smectites and binders containing humic acids.

  14. Influence of binder system and temperature on rheological properties of water atomized 316L powder injection moulding feedstocks

    Directory of Open Access Journals (Sweden)

    Uğur GÖKMEN

    2016-02-01

    Full Text Available In order to obtain a proper powder injection molding the rheological behavior of feedstocks should be known. To determine the binder effect on the rheological behavior of 316L stainless steel powders feedstock two different feedstock were prepared. In the current experiments water atomized 316L stainless steel powders (-20 µm were used. Two types of binders, one of which is mainly paraffin wax can be dissolved in heptane and the other Polietilenglikol (PEG based and can be dissolved in water, were used. Polypropylene was used as binder and steric acid was used as lubricant for both binder systems as skeleton binder. Dry binder system were mixed for 30 min in a three dimensional Turbola. Capillary rheometer was used to characterize the rheological properties of feed stocks at 150-200 °C and a pressures of 0.165-2.069 MPa. Powder loading capacity of PEG and PW based feed stocks were found to be %55 and %61 respectively. The lowest viscosity of PEG and PW based feed stocks were found to be 304.707 Pa.s and 48.857 Pa.s respectively.Keywords: PIM, Binder, Rheological properties

  15. Influence of binder composition on the rheological behavior of injection-molded microsized SiC suspensions

    Institute of Scientific and Technical Information of China (English)

    Shubin Ren; Xinbo He; Xuanhui Qu; Islam S. Humail; Yanping Wei

    2008-01-01

    The influence of four kinds of binders consisting of paraffin wax (PW), random-polypropylene (RPP), high-density poly-ethylene (HDPE), and stearic acid (SA) on the theological behavior of injection-molded SiC feedstocks was investigated over a tem-perature range of 150℃ to 180℃ and a shear rate range of 4 s-1 to 1259 s-1. The results showed that all the feedstocks exhibited pseudoplastic flow behavior. The wax-based binder of multipolymer components (PW-RPP-HDPE) exhibited better comprehensive rheological properties compared with the binder of monopolymer components (PW-RPP or PW-HDPE). The addition of 5wt% SA to the binder could reduce the viscosity of the feedstock but enhance the rbeological stability by improving the wettability between the binder and the SiC powder. The binder of 65wt% PW + 15wt% HDPE + 15wt% RPP + 5wt% SA was found to be a better binder for microsized SiC injection molding.

  16. US Renewable Futures in the GCAM

    Energy Technology Data Exchange (ETDEWEB)

    Smith, Steven J.; Mizrahi, Andrew H.; Karas, Joseph F.; Nathan, Mayda

    2011-10-06

    This project examines renewable energy deployment in the United States using a version of the GCAM integrated assessment model with detailed a representation of renewables, the GCAM-RE. Electricity generation was modeled in four generation segments and 12-subregions. This level of regional and sectoral detail allows a more explicit representation of renewable energy generation. Wind, solar thermal power, and central solar PV plants are implemented in explicit resource classes with new intermittency parameterizations appropriate for each technology. A scenario analysis examines a range of assumptions for technology characteristics, climate policy, and long-distance transmission. We find that renewable generation levels grow over the century in all scenarios. As expected, renewable generation increases with lower renewable technology costs, more stringent climate policy, and if alternative low-carbon technology are not available. The availability of long distance transmission lowers policy costs and changes the renewable generation mix.

  17. Renewable energy costs, potentials, barriers: Conceptual issues

    Energy Technology Data Exchange (ETDEWEB)

    Verbruggen, Aviel, E-mail: aviel.verbruggen@ua.ac.b [University of Antwerp (Belgium); Fischedick, Manfred [Wuppertal Institute for Climate, Environment, Energy (Germany); Moomaw, William [Tufts University, Center for International Environment and Resource Policy (United States); Weir, Tony [University of the South Pacific, Fiji Islands (Fiji); Nadai, Alain [Centre International de Recherche sur nvironnement et le Developpement CIRED (France); Nilsson, Lars J. [University of Lund (Sweden); Nyboer, John [Simon Fraser University, School of Resource and Environmental Management (Canada); Sathaye, Jayant [Lawrence Berkeley Laboratory (United States)

    2010-02-15

    Renewable energy can become the major energy supply option in low-carbon energy economies. Disruptive transformations in all energy systems are necessary for tapping widely available renewable energy resources. Organizing the energy transition from non-sustainable to renewable energy is often described as the major challenge of the first half of the 21st century. Technological innovation, the economy (costs and prices) and policies have to be aligned to achieve full renewable energy potentials, and barriers impeding that growth need to be removed. These issues are also covered by IPCC's special report on renewable energy and climate change to be completed in 2010. This article focuses on the interrelations among the drivers. It clarifies definitions of costs and prices, and of barriers. After reviewing how the third and fourth assessment reports of IPCC cover mitigation potentials and commenting on definitions of renewable energy potentials in the literature, we propose a consistent set of potentials of renewable energy supplies.

  18. Injection Molding of Titanium Alloy Implant For Biomedical Application Using Novel Binder System Based on Palm Oil Derivatives

    Directory of Open Access Journals (Sweden)

    R. Ibrahim

    2010-01-01

    Full Text Available Problem statement: Titanium alloy (Ti6Al4V has been widely used as an implant for biomedical application. In this study, the implant had been fabricated using high technology of Powder Injection Molding (PIM process due to the cost effective technique for producing small, complex and precision parts in high volume compared with conventional method through machining. Approach: Through PIM, the binder system is one of the most important criteria in order to successfully fabricate the implants. Even though, the binder system is a temporary, but failure in the selection and removal of the binder system will affect on the final properties of the sintered parts. Therefore, the binder system based on palm oil derivative which is palm stearin had been formulated and developed to replace the conventional binder system. Results: The rheological studies of the mixture between the powder and binders system had been determined properly in order to be successful during injection into injection molding machine. After molding, the binder held the particles in place. The binder system had to be removed completely through debinding step. During debinding step, solvent debinding and thermal pyrolysis had been used to remove completely of the binder system. The debound part was then sintered to give the required physical and mechanical properties. The in vitro biocompatibility also was tested using Neutral Red (NR and mouse fibroblast cell lines L-929 for the direct contact assay. Conclusion: The results showed that the properties of the final sintered parts fulfill the Standard Metal Powder Industries Federation (MPIF 35 for PIM parts except for tensile strength and elongation due to the formation of titanium carbide. The in vitro biocompatibility on the extraction using mouse fibroblast cell line L-929 by means of NR assays showed non toxic for the sintered specimen titanium alloy parts.

  19. Randomized Clinical Trial on the postoperative use of an abdominal binder after laparoscopic umbilical and epigastric hernia repair

    DEFF Research Database (Denmark)

    Christoffersen, Mette; Olsen, B H; Rosenberg, J;

    2015-01-01

    -reducing effect of an abdominal binder in patients undergoing laparoscopic umbilical or epigastric hernia repair. METHODS: Based on power analysis, a minimum of 54 patients undergoing laparoscopic umbilical and epigastric hernia repair were to be included. Patients were randomized to abdominal binders vs......PURPOSE: Application of an abdominal binder is often part of a standard postoperative regimen after ventral hernia repair to reduce pain and seroma formation. However, there is lack of evidence of the clinical effects. The aim of the present study was to investigate the pain- and seroma...

  20. Emission of organic compounds from mould and core binders used for casting iron, aluminium and bronze in sand moulds

    DEFF Research Database (Denmark)

    Tiedje, Niels Skat; Crepaz, Rudolf; Eggert, Torben;

    2010-01-01

    of binders was monitored when cast iron, bronze and aluminium was poured in the moulds. Binder degradation was measured by collecting off gasses in a specially designed ventilation hood at a constant flow rate. Samples were taken from the ventilation system and analysed for hydrocarbons and CO content...... compositions were tested. A test method that provides uniform test conditions is described. The method can be used as general test method to analyse off gasses from binders. Moulds containing a standard size casting were produced and the amount and type of organic compounds resulting from thermal degradation...