WorldWideScience

Sample records for release fetal erythroid

  1. Erythroid differentiation of fetal, newborn and adult haemopoietic stem cells

    International Nuclear Information System (INIS)

    Rencricca, N.J.; Howard, D.; Kubanek, B.; Stohlman, F.; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron ( 59 Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments. (author)

  2. Erythroid differentiation of fetal, newborn, and adult haemopoietic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Rencricca, N J; Howard, D; Kubanek, B; Stohlman, F [Boston Univ., Mass. (USA). School of Medicine; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron (/sup 59/Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments.

  3. A common signaling pathway is activated in erythroid cells expressing high levels of fetal hemoglobin: a potential role for cAMP-elevating agents in β-globin disorders

    Directory of Open Access Journals (Sweden)

    Ikuta T

    2013-12-01

    Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to

  4. Synergistic Effect of Sodium Butyrate and Thalidomide in the Induction of Fetal Hemoglobin Expression in Erythroid Progenitors Derived from Cord Blood CD133 + Cells

    Directory of Open Access Journals (Sweden)

    Ali Dehghanifard

    2012-07-01

    Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.

  5. Monomethylfumarate induces γ-globin expression and fetal hemoglobin production in cultured human retinal pigment epithelial (RPE) and erythroid cells, and in intact retina.

    Science.gov (United States)

    Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M

    2014-05-13

    Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

  6. The effects of corticotrophin-releasing factor and two antagonists on breathing movements in fetal sheep.

    Science.gov (United States)

    Bennet, L; Johnston, B M; Vale, W W; Gluckman, P D

    1990-01-01

    1. The respiratory effects of corticotrophin-releasing factor (CRF) and the CRF antagonists alpha-helical CRF 9-41 (alpha hCRF) and [DPhe 12, Nle 21-38] rCRF (12-41) (DPhe CRF) have been studied in unanaesthetized fetal lambs of 125-140 days gestation. 2. CRF when given as a 10 micrograms bolus followed by a 5 micrograms h-1 infusion into a lateral cerebral ventricle caused prolonged continuous fetal breathing movements which were stimulated in both amplitude and frequency but which did not persist during hypoxia. 3. Lower doses of CRF (20 ng bolus followed by 10 ng h-1) increased the amplitude but not the frequency of fetal breathing movements which did not become continuous. 4. At higher doses (20 micrograms bolus followed by 10-15 micrograms h-1) CRF induced cerebral convulsions which were also associated with fetal breathing movements of increased amplitude and frequency. 5. The CRF antagonists alpha hCRF and DPhe CRF both inhibited fetal breathing movements and induced a prolonged apnoea which was resistant to the stimulatory effects of 5-6% hypercapnia. 6. We conclude that CRF stimulates breathing movements in the fetal lamb. The finding that administration of the CRF antagonists alone cause apnoea suggests that CRF may have a tonic role in the regulation of fetal breathing movements. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:2348387

  7. Minimal alteration in the ratio of circulatory fetal DNA to fetal corticotropin-releasing hormone mRNA level in preeclampsia.

    Science.gov (United States)

    Zhong, Xiao Yan; Holzgreve, Wolfgang; Gebhardt, Stefan; Hillermann, Renate; Tofa, Kashefa Carelse; Gupta, Anurag Kumar; Huppertz, Berthold; Hahn, Sinuhe

    2006-01-01

    We have recently observed that fetal DNA and fetal corticotropin-releasing hormone (CRH) mRNA are associated with in vitro generated syncytiotrophoblast-derived microparticles, and that the ratio of fetal DNA to mRNA (CRH) varied according to whether the particles were derived by predominantly apoptotic, apo-necrotic or necrotic pathways. Hence, we examined whether these ratios varied in maternal plasma samples taken from normotensive and preeclamptic pregnancies in vivo. Maternal plasma samples were collected from 18 cases with preeclampsia and 29 normotensive term controls. Circulatory fetal CRH mRNA and DNA levels were quantified by real-time PCR and RT-PCR. Circulatory fetal mRNA and fetal DNA levels were significantly elevated in the preeclampsia study group when compared to normotensive controls. Alterations in the fetal mRNA to DNA ratio between the study and control groups were minimal, even when stratified into early (34 weeks of gestation) onset preeclampsia. Our data suggest that although circulatory fetal DNA and mRNA levels are significantly elevated in preeclampsia, the ratios in maternal plasma are not dramatically altered. Copyright 2006 S. Karger AG, Basel.

  8. Maternal-fetal distribution of mercury ( sup 203 Hg) released from dental amalgam fillings

    Energy Technology Data Exchange (ETDEWEB)

    Vimy, M.J.; Takahashi, Y.; Lorscheider, F.L. (Univ. of Calgary, Alberta (Canada))

    1990-04-01

    In humans, the continuous release of Hg vapor from dental amalgam tooth restorations is markedly increased for prolonged periods after chewing. The present study establishes a time-course distribution for amalgam Hg in body tissues of adult and fetal sheep. Under general anesthesia, five pregnant ewes had twelve occlusal amalgam fillings containing radioactive 203Hg placed in teeth at 112 days gestation. Blood, amniotic fluid, feces, and urine specimens were collected at 1- to 3-day intervals for 16 days. From days 16-140 after amalgam placement (16-41 days for fetal lambs), tissue specimens were analyzed for radioactivity, and total Hg concentrations were calculated. Results demonstrate that Hg from dental amalgam will appear in maternal and fetal blood and amniotic fluid within 2 days after placement of amalgam tooth restorations. Excretion of some of this Hg will also commence within 2 days. All tissues examined displayed Hg accumulation. Highest concentrations of Hg from amalgam in the adult occurred in kidney and liver, whereas in the fetus the highest amalgam Hg concentrations appeared in liver and pituitary gland. The placenta progressively concentrated Hg as gestation advanced to term, and milk concentration of amalgam Hg postpartum provides a potential source of Hg exposure to the newborn. It is concluded that accumulation of amalgam Hg progresses in maternal and fetal tissues to a steady state with advancing gestation and is maintained. Dental amalgam usage as a tooth restorative material in pregnant women and children should be reconsidered.

  9. Maternal-fetal distribution of mercury (203Hg) released from dental amalgam fillings

    International Nuclear Information System (INIS)

    Vimy, M.J.; Takahashi, Y.; Lorscheider, F.L.

    1990-01-01

    In humans, the continuous release of Hg vapor from dental amalgam tooth restorations is markedly increased for prolonged periods after chewing. The present study establishes a time-course distribution for amalgam Hg in body tissues of adult and fetal sheep. Under general anesthesia, five pregnant ewes had twelve occlusal amalgam fillings containing radioactive 203Hg placed in teeth at 112 days gestation. Blood, amniotic fluid, feces, and urine specimens were collected at 1- to 3-day intervals for 16 days. From days 16-140 after amalgam placement (16-41 days for fetal lambs), tissue specimens were analyzed for radioactivity, and total Hg concentrations were calculated. Results demonstrate that Hg from dental amalgam will appear in maternal and fetal blood and amniotic fluid within 2 days after placement of amalgam tooth restorations. Excretion of some of this Hg will also commence within 2 days. All tissues examined displayed Hg accumulation. Highest concentrations of Hg from amalgam in the adult occurred in kidney and liver, whereas in the fetus the highest amalgam Hg concentrations appeared in liver and pituitary gland. The placenta progressively concentrated Hg as gestation advanced to term, and milk concentration of amalgam Hg postpartum provides a potential source of Hg exposure to the newborn. It is concluded that accumulation of amalgam Hg progresses in maternal and fetal tissues to a steady state with advancing gestation and is maintained. Dental amalgam usage as a tooth restorative material in pregnant women and children should be reconsidered

  10. Gonadotropin-releasing hormone immunoreactivity in the adult and fetal human olfactory system.

    Science.gov (United States)

    Kim, K H; Patel, L; Tobet, S A; King, J C; Rubin, B S; Stopa, E G

    1999-05-01

    Studies in fetal brain tissue of rodents, nonhuman primates and birds have demonstrated that cells containing gonadotropin-releasing hormone (GnRH) migrate from the olfactory placode across the nasal septum into the forebrain. The purpose of this study was to examine GnRH neurons in components of the adult and fetal human olfactory system. In the adult human brain (n=4), immunoreactive GnRH was evident within diffusely scattered cell bodies and processes in the olfactory bulb, olfactory nerve, olfactory cortex, and nervus terminalis located on the anterior surface of the gyrus rectus. GnRH-immunoreactive structures showed a similar distribution in 20-week human fetal brains (n=2), indicating that the migration of GnRH neurons is complete at this time. In 10-11-week fetal brains (n=2), more cells were noted in the nasal cavity than in the brain. Our data are consistent with observations made in other species, confirming olfactory derivation and migration of GnRH neurons into the brain from the olfactory placode. Copyright 1999 Elsevier Science B.V.

  11. Serum-free Erythroid Differentiation for Efficient Genetic Modification and High-Level Adult Hemoglobin Production.

    Science.gov (United States)

    Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F

    2018-06-15

    In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.

  12. TMEM14C is required for erythroid mitochondrial heme metabolism.

    Science.gov (United States)

    Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H

    2014-10-01

    The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.

  13. Hemozoin (malarial pigment directly promotes apoptosis of erythroid precursors.

    Directory of Open Access Journals (Sweden)

    Abigail A Lamikanra

    2009-12-01

    Full Text Available Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that

  14. Release of LHRH-activity from human fetal membranes upon exposure to PGE/sub 2/, oxytocin and isoproterenol

    Energy Technology Data Exchange (ETDEWEB)

    Poisner, A.M.; Poisner, R.; Becca, C.R.; Conn, P.M.

    1986-03-01

    The authors have previously reported that superfused chorion laeve (fetal membranes) release LHRH-like immunoreactivity upon exposure to angiotensin II. They have now studied the effects of other agonists on the release of LHRH-activity and something of its chemical nature. Fetal membranes were obtained from placentas delivered by cesarean section, the amnion stripped from the chorion, and the chorion superfused in an Amicon thin-channel device with the maternal surface facing up. The whole device was submerged in a 37 C water bath and perfused with a modified Locke's solution at 0.4 - 1.0 ml/min. LHRH-activity was measured by radioimmunoassay using three different antisera against LHRH. The release of LHRH-activity was stimulated by 6-10 min exposure to PGE/sub 2/, oxytocin, and isoproterenol. Extracts of chorion were studied using gel filtration on Sephacryl S-200 and ultrafiltration with Amicon PM-10 filters. The bulk of the LHRH-activity appeared as a higher molecular weight form (about 70,000 daltons). Since oxytocin has been reported to release PGE/sub 2/ from chorion, it may release LHRH-activity by virtue of liberating endogenous PGE/sub 2/. The chemical nature of the LHRH-activity is presently under investigation.

  15. Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

    International Nuclear Information System (INIS)

    Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

    1987-01-01

    The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes

  16. Simultaneous Transplantation of Fetal Ventral Mesencephalic Tissue and Encapsulated Genetically Modified Cells Releasing GDNF in a Hemi-Parkinsonian Rat Model of Parkinson’s Disease

    DEFF Research Database (Denmark)

    Perez-Bouza, Alberto; Di Santo, Stefano; Seiler, Stefanie

    2017-01-01

    Transplantation of fetal ventral mesencephalic (VM) neurons for Parkinson's disease (PD) is limited by poor survival and suboptimal integration of grafted tissue into the host brain. In a 6-OHDA rat model of PD we investigated the feasibility of simultaneous transplantation of rat fetal VM tissue...... between groups were observed for the number of surviving TH-ir neurons or graft volume. In conclusion, our findings demonstrate that simultaneous transplantation of fetal VM tissue and encapsulated GDNF-releasing cells is feasible and support the graft survival and function. Pre-treatment of donor tissue...

  17. Let-7 microRNAs are developmentally regulated in circulating human erythroid cells

    Directory of Open Access Journals (Sweden)

    Reed Christopher

    2009-11-01

    Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.

  18. Comparison of the effects of stimulators and inhibitors of resorption on the release of lysosomal enzymes and radioactive calcium from fetal bone in organ culture

    International Nuclear Information System (INIS)

    Eilon, G.; Raisz, L.G.

    1978-01-01

    The release of lysosomal enzymes, collagenase, and previously incorporated 45 Ca from fetal rat long bones cultured in a chemically defined medium is compared. Parathyroid hormone (PTH) and prostaglandin E 2 increased the release of β-glucuronidase, acetylglucosaminidase, and cathepsin D, but showed little effect on collagenase activity in the medium at 48 h. The dose-response relations for β-glucuronidase and 45 Ca release were similar. However, the increase in lysosomal enzyme release was proportionally greater and occurred earlier than the increase in 45 Ca release. PTH also caused a significant increase in total β-glucuronidase activity in bone plus medium. Several agents which stimulate 45 Ca release at an optimal concentration, but not at a higher concentration, including dibutyryl cAMP, isobutylmethylxanthine, and the calcium ionophore, A23187, all increased lysosomal enzyme release at the concentration which increased 45 Ca release. Three inhibitors of bone resorption (calcitonin, cortisol, and colchicine) blocked lysosomal enzyme release at the same time that 45 Ca release decreased. When the bones escaped from calcitonin inhibition, both 45 Ca and lysosomalenzyme release increased. While colchicine blocked both lysosomal enzymes and 45 CA release, it actually increased the release of bone collagenase, and together with PTH or prostaglandin E 2 caused a large increase in free collagenase activity in the medium. These data indicate that lysosomal enzyme release is closely linked to bone resorption and suggest that lysosomal enzymes may have a primary role in initiating resorption, perhaps by acting on noncollagenous matrix or tissue components before mineral removal and collagen degradation

  19. Erythroid differentiation of human induced pluripotent stem cells is independent of donor cell type of origin.

    Science.gov (United States)

    Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F; Psathaki, Olympia E; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R; Schlenke, Peter; Zaehres, Holm

    2015-01-01

    Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34(+) hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34(+) hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34(+) hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34(+) cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. Copyright© Ferrata Storti Foundation.

  20. A hanging drop culture method to study terminal erythroid differentiation.

    Science.gov (United States)

    Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak

    2005-10-01

    To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.

  1. Phosphorylated STAT5 directly facilitates parvovirus B19 DNA replication in human erythroid progenitors through interaction with the MCM complex.

    Science.gov (United States)

    Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming

    2017-05-01

    Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.

  2. Fetal MRI; Fetales MRT

    Energy Technology Data Exchange (ETDEWEB)

    Blondin, D. [Inst. fuer Diagn. Radiologie, Uniklinikum Duesseldorf (Germany); Turowski, B. [Inst. fuer Diagn. Radiologie, Neuroradiologie, Uniklinikum Duesseldorf (Germany); Schaper, J. [Inst. fuer Diagn. Radiologie, Kinderradiologie, Uniklinikum Duesseldorf (Germany)

    2007-02-15

    Ultrasonography is the method of choice for prenatal malformation screening, but it does not always provide sufficient information for correct diagnosis or adequate abnormality evaluation. Fetal MRI is increasingly being used to complete sonographic findings. It was initially used for evaluation of cerebral abnormalities but is increasingly being applied to other fetal areas. In vivo investigation of fetal brain maturation has been enhanced by MRI. An adequate analysis of fetal chest and abdomen can be achieved with fast T2-, T1-weighted and diffusion-weighted imaging (DWI). The advantages include the great field of view and the excellent soft tissue contrast. This allows correct diagnosis of congenital diaphragmatic hernia and evaluation of the consequences on pulmonary growth. Other pulmonary malformations, such as cystic adenomatoid malformation, sequestration and brochogenic cysts, can also be easily identified. Renal position can be quickly determined using DWI sequences and renal agenesia can be easily diagnosed with only one sequence. Prenatal MRI is virtually as effective as postnatal examination, dispenses with transport of a potentially very ill newborn, and provides logistic advantages. Therefore, prenatal MRI is useful for adequate postnatal treatment of newborns with malformations. (orig.)

  3. Fetal echocardiography

    International Nuclear Information System (INIS)

    Chaubal, Nitin G.; Chaubal, Jyoti

    2009-01-01

    USG performed with a high-end machine, using a good cine-loop facility is extremely helpful in the diagnosis of fetal cardiac anomalies. In fetal echocardiography, the four-chamber view and the outflow-tract view are used to diagnose cardiac anomalies. The most important objective during a targeted anomaly scan is to identify those cases that need a dedicated fetal echocardiogram. Associated truncal and chromosomal anomalies need to be identified. This review shows how fetal echocardiography, apart from identifying structural defects in the fetal heart, can be used to look at rhythm abnormalities and other functional aspects of the fetal heart

  4. Fetal echocardiography

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/007340.htm Fetal echocardiography To use the sharing features on this page, please enable JavaScript. Fetal echocardiography is a test that uses sound waves ( ultrasound ) ...

  5. Measurement of the capability of DNA synthesis of human fetal liver cells by the assay of 3H-TdR incorporation

    International Nuclear Information System (INIS)

    Wang Tao; Ma Xiangrui; Wang Hongyun; Cao Xia

    1987-01-01

    The fetal liver is one of the major sites of hematopoiesis during gestation. Under erythropoietin (EPO) stimulation, in erythroid precusor cells of fetal liver, proliferation and differentiation occurred and function of metabolism was enhanced. The technique of 3 H-TdR incorporation was used to measure the function of fetal liver cellular DNA synthesis. As EPO concentration at the range of approximately 20 ∼ 100 mU/ml, the counts of 3 H-TdR incorporation into fetal liver cells increased. As the concentration of EPO increased, however, its incorporation counts are lower than that in bone marrow of either the fetal or the adult. It suggested that precusors of erythrocyte of fetal liver has differentiated to later phases with the progressive accumulation of mature cells, therefore, both proliferation and function of metabolism are more or less decreased respectively. Under EPO stimulation, however, precusor of erythroid of fetal liver can greatly increase potential effects on DNA synthesis

  6. Enhancement of erythroid colony growth in culture by hemin

    International Nuclear Information System (INIS)

    Porter, P.N.; Meints, R.H.; Mesner, K.

    1979-01-01

    Hemin was found to enhance the growth of murine erythroid colonies in culture. In the presence of 100 mU/ml erythropoietin (EPO), the addition of hemin (0.05-0.2 mM) resulted in the growth of twice as many colonies as were obtained with EPO alone. Hemin also significantly increased erythroid colony formation in culture in the absence of added EPO. Hemoblobin synthesis as measured by the incorporation of 59 Fe into cyclohexanone extractable heme was augmented in culture by hemin. Neither Δ-aminolevulinic acid, a hemin precursor, nor FeCl 3 increased colony number. (author)

  7. The first trimester human placenta is a site for terminal maturation of primitive erythroid cells.

    Science.gov (United States)

    Van Handel, Ben; Prashad, Sacha L; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I; Mikkola, Hanna K A

    2010-10-28

    Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in first trimester placental villi. Extravascular ζ-globin(+) primitive erythroid cells were found in placental villi between 5-7 weeks of development, at which time the frequency of enucleated RBCs was higher in the villous stroma than in circulation. RBC enucleation was further evidenced by the presence of primitive reticulocytes and pyrenocytes (ejected RBC nuclei) in the placenta. Extravascular RBCs were found to associate with placental macrophages, which contained ingested nuclei. Clonogenic macrophage progenitors of fetal origin were present in the chorionic plate of the placenta before the onset of fetoplacental circulation, after which macrophages had migrated to the villi. These findings indicate that placental macrophages may assist the enucleation process of primitive RBCs in placental villi, implying an unexpectedly broad role for the placenta in embryonic hematopoiesis.

  8. Fetal MSCs

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Derived from extra embryonic tissues (amniotic fluid, placenta, cord blood, Wharton's Jelly) and fetal tissues (aborted fetuses). Derived from extra embryonic tissues (amniotic fluid, placenta, cord blood, Wharton's Jelly) and fetal tissues (aborted fetuses). In comparison ...

  9. Studies of globin gene expression in differentiating erythroid cells

    International Nuclear Information System (INIS)

    Sullivan, T.D.

    1985-01-01

    The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation

  10. Expression, biosynthesis and release of preadipocyte factor-1/ delta-like protein/fetal antigen-1 in pancreatic beta-cells

    DEFF Research Database (Denmark)

    Friedrichsen, B N; Carlsson, C; Møldrup, Annette

    2003-01-01

    Preadipocyte factor-1 (Pref-1)/delta-like protein/fetal antigen-1 (FA1) is a member of the epidermal growth factor-like family. It is widely expressed in embryonic tissues, whereas in adults it is confined to the adrenal gland, the anterior pituitary, the endocrine pancreas, the testis...

  11. Fetal Ultrasound

    Science.gov (United States)

    ... isn't recommended simply to determine a baby's sex. Similarly, fetal ultrasound isn't recommended solely for the purpose of producing keepsake videos or pictures. If your health care provider doesn' ...

  12. Fetal Macrosomia

    Science.gov (United States)

    ... re more likely to have a large baby. Maternal obesity. Fetal macrosomia is more likely if you're ... is more likely to be a result of maternal diabetes, obesity or weight gain during pregnancy than other causes. ...

  13. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  14. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

    2012-01-01

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  15. Chromosome 11-linked determinant controls fetal globin expression and the fetal-to-adult globin switch

    International Nuclear Information System (INIS)

    Melis, M.; Demopulos, G.; Najfeld, V.; Zhang, J.W.; Brice, M.; Papayannopoulou, T.; Stamatoyannopoulos, G.

    1987-01-01

    Hybrids formed by fusing mouse erythroleukemia (MEL) cells with human fetal erythroid cells produce human fetal globin, but they switch to adult globin production as culture time advances. To obtain information on the chromosomal assignment of the elements that control γ-to-β switching, the authors analyzed the chromosomal composition of hybrids producing exclusively or predominantly human fetal globin and hybrids producing only adult human globin. No human chromosome was consistently present in hybrids expressing fetal globin and consistently absent in hybrids expressing adult globin. Subcloning experiments demonstrated identical chromosomal compositions in subclones displaying the fetal globin program and those that had switched to expression of the adult globin program. These data indicate that retention of only one human chromosome -- i.e., chromosome 11 -- is sufficient for expression of human fetal globin and the subsequent γ-to-β switch. The results suggest that the γ-to-β switch is controlled either cis to the β-globin locus of by a trans-acting mechanism, the genes of which reside on human chromosome 11

  16. In Vitro Large Scale Production of Human Mature Red Blood Cells from Hematopoietic Stem Cells by Coculturing with Human Fetal Liver Stromal Cells

    Directory of Open Access Journals (Sweden)

    Jiafei Xi

    2013-01-01

    Full Text Available In vitro models of human erythropoiesis are useful in studying the mechanisms of erythroid differentiation in normal and pathological conditions. Here we describe an erythroid liquid culture system starting from cord blood derived hematopoietic stem cells (HSCs. HSCs were cultured for more than 50 days in erythroid differentiation conditions and resulted in a more than 109-fold expansion within 50 days under optimal conditions. Homogeneous erythroid cells were characterized by cell morphology, flow cytometry, and hematopoietic colony assays. Furthermore, terminal erythroid maturation was improved by cosculturing with human fetal liver stromal cells. Cocultured erythroid cells underwent multiple maturation events, including decrease in size, increase in glycophorin A expression, and nuclear condensation. This process resulted in extrusion of the pycnotic nuclei in up to 80% of the cells. Importantly, they possessed the capacity to express the adult definitive β-globin chain upon further maturation. We also show that the oxygen equilibrium curves of the cord blood-differentiated red blood cells (RBCs are comparable to normal RBCs. The large number and purity of erythroid cells and RBCs produced from cord blood make this method useful for fundamental research in erythroid development, and they also provide a basis for future production of available RBCs for transfusion.

  17. Delayed Mesoderm and Erythroid Differentiation of Murine Embryonic Stem Cells in the Absence of the Transcriptional Regulator FUBP1

    Directory of Open Access Journals (Sweden)

    Josephine Wesely

    2017-01-01

    Full Text Available The transcriptional regulator far upstream binding protein 1 (FUBP1 is essential for fetal and adult hematopoietic stem cell (HSC self-renewal, and the constitutive absence of FUBP1 activity during early development leads to embryonic lethality in homozygous mutant mice. To investigate the role of FUBP1 in murine embryonic stem cells (ESCs and in particular during differentiation into hematopoietic lineages, we generated Fubp1 knockout (KO ESC clones using CRISPR/Cas9 technology. Although FUBP1 is expressed in undifferentiated ESCs and during spontaneous differentiation following aggregation into embryoid bodies (EBs, absence of FUBP1 did not affect ESC maintenance. Interestingly, we observed a delayed differentiation of FUBP1-deficient ESCs into the mesoderm germ layer, as indicated by impaired expression of several mesoderm markers including Brachyury at an early time point of ESC differentiation upon aggregation to EBs. Coculture experiments with OP9 cells in the presence of erythropoietin revealed a diminished differentiation capacity of Fubp1 KO ESCs into the erythroid lineage. Our data showed that FUBP1 is important for the onset of mesoderm differentiation and maturation of hematopoietic progenitor cells into the erythroid lineage, a finding that is supported by the phenotype of FUBP1-deficient mice.

  18. Fetal cardiology

    International Nuclear Information System (INIS)

    Meijboom, E.J.; Rijsterborgh, N.; Bom, N.

    1986-01-01

    Doppler echocardiography makes it possible to diagnose congenital heart disease in early pregnancy. It allows us to study the anatomical configuration of the fetal heart, and additionally, to evaluate the physiological conditions of the fetus. Evaluation of the direction, velocity, wave form pattern, and quantification of blood flow at the various sites in the fetal heart helps us to assess the characteristics of the fetal circulation and condition of the fetal heart. In order to use this technique in pathological situations, an initial study of the developing normal human fetal circulation was necessary. The authors studied 34 uncomplicated pregnancies by serial Doppler echocardiography. The studies were performed every 4 weeks from 16-weeks gestation to term. The pulsed Doppler sector scanner provided cardiac cross-sectional images, mitral and tricuspid blood velocities were obtained from apical four-chamber views. Angle corrected maximal and mean temporal velocities were calculated by digitizing the Doppler frequency shift recording on a graphic tablet computed with a minicomputer. The angle between the Doppler interrogation beam and the direction of blood flow was kept as small as possible in order to minimize the error

  19. Fetal MRI

    International Nuclear Information System (INIS)

    Prayer, D.; Brugger, P.C.

    2004-01-01

    New, ultrafast sequences have made it possible to obtain MR images of the fetus without maternal sedation or immobilization of the fetus itself. While fetal MRI began as an adjunct to ultrasound, it has now been shown that MRI can provide additional information that may change prognosis, the management of pregnancy, or the treatment of the newborn child. It is of particular value in the assessment of malformations of the central nervous system. The steady development and adaptation of MR-sequences to the needs of fetal imaging has led to new indications that can support prognostic and therapeutic decisions. (orig.)

  20. Fetal MRI

    Energy Technology Data Exchange (ETDEWEB)

    Prayer, D.; Brugger, P.C. [University Hospital of Vienna (Austria). Division of Neuroradiology

    2004-07-01

    New, ultrafast sequences have made it possible to obtain MR images of the fetus without maternal sedation or immobilization of the fetus itself. While fetal MRI began as an adjunct to ultrasound, it has now been shown that MRI can provide additional information that may change prognosis, the management of pregnancy, or the treatment of the newborn child. It is of particular value in the assessment of malformations of the central nervous system. The steady development and adaptation of MR-sequences to the needs of fetal imaging has led to new indications that can support prognostic and therapeutic decisions. (orig.)

  1. Fetal pain

    NARCIS (Netherlands)

    Adama van Scheltema, Phebe

    2011-01-01

    Recent studies have suggested that the fetus is capable of exhibiting a stress response to intrauterine needling, resulting in alterations in fetal stress hormone levels. Intrauterine transfusions are performed by inserting a needle either in the umbilical cord root at the placental surface (PCI),

  2. Passive immunization of fetal rats with antiserum to luteinizing hormone-releasing hormone (LHRH) or transection of the central roots of the nervus terminalis does not affect rat pups' preference for home nest.

    Science.gov (United States)

    Schwanzel-Fukuda, M; Pfaff, D W

    1987-01-01

    Luteinizing hormone-releasing hormone (LHRH) is found immunocytochemically in cell bodies and fibers of the nervus terminalis, a cranial nerve which courses from the nasal septum through the cribriform plate of the ethmoid bone (medial to the olfactory and vomeronasal nerves) and enters the forebrain, caudal to the olfactory bulbs. Immunoreactive LHRH is first detected in the nervus terminalis of the fetal rat at 15 days of gestation, preceding its detection by immunocytochemistry in any other area of the brain, including the median eminence, and preceding detection of immunoreactive luteinizing hormone (LH) in the anterior pituitary. During development of the rat fetus, the nervus terminalis is the principal source of LHRH in the nervous system from days 15 through 19 of a 21 day gestation period. We tested the notion that the LHRH system of the nervus terminalis is important for olfactory performance by examining the effects of administration of antisera to LHRH during fetal development (versus saline controls), or medial olfactory peduncle transections, in the neonatal rat, which would sever the central projections of the nervus terminalis (versus lateral peduncle transection, complete transection of the olfactory peduncles and the central nervus terminalis or controls) on preferences of rat pups for home nest. The hypothesis that LHRH is important for this chemosensory response was not confirmed. Neither antisera to LHRH nor medical olfactory peduncle transection disrupted preference for home shavings. Only complete olfactory peduncle transection had a significant effect compared to unoperated and sham-operated controls.

  3. Erythroid cell mitochondria receive endosomal iron by a "kiss-and-run" mechanism.

    Science.gov (United States)

    Hamdi, Amel; Roshan, Tariq M; Kahawita, Tanya M; Mason, Anne B; Sheftel, Alex D; Ponka, Prem

    2016-12-01

    In erythroid cells, more than 90% of transferrin-derived iron enters mitochondria where ferrochelatase inserts Fe 2+ into protoporphyrin IX. However, the path of iron from endosomes to mitochondrial ferrochelatase remains elusive. The prevailing opinion is that, after its export from endosomes, the redox-active metal spreads into the cytosol and mysteriously finds its way into mitochondria through passive diffusion. In contrast, this study supports the hypothesis that the highly efficient transport of iron toward ferrochelatase in erythroid cells requires a direct interaction between transferrin-endosomes and mitochondria (the "kiss-and-run" hypothesis). Using a novel method (flow sub-cytometry), we analyze lysates of reticulocytes after labeling these organelles with different fluorophores. We have identified a double-labeled population definitively representing endosomes interacting with mitochondria, as demonstrated by confocal microscopy. Moreover, we conclude that this endosome-mitochondrion association is reversible, since a "chase" with unlabeled holotransferrin causes a time-dependent decrease in the size of the double-labeled population. Importantly, the dissociation of endosomes from mitochondria does not occur in the absence of holotransferrin. Additionally, mutated recombinant holotransferrin, that cannot release iron, significantly decreases the uptake of 59 Fe by reticulocytes and diminishes 59 Fe incorporation into heme. This suggests that endosomes, which are unable to provide iron to mitochondria, cause a "traffic jam" leading to decreased endocytosis of holotransferrin. Altogether, our results suggest that a molecular mechanism exists to coordinate the iron status of endosomal transferrin with its trafficking. Besides its contribution to the field of iron metabolism, this study provides evidence for a new intracellular trafficking pathway of organelles. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.

    Directory of Open Access Journals (Sweden)

    Gloria Bua

    Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.

  5. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells

    Science.gov (United States)

    Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio

    2016-01-01

    The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771

  6. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    Directory of Open Access Journals (Sweden)

    Ah Ram Kim

    2015-06-01

    Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

  7. Muerte fetal

    Directory of Open Access Journals (Sweden)

    G. Andrés Pons, DR

    2014-11-01

    Full Text Available La muerte fetal es un evento poco frecuente pero de gran repercusión afectiva para los padres involucrados y su entorno. En el presente artículo revisaremos la epidemiología, las causas, orientaremos a los médicos en los pasos a seguir para realizar adecuadamente el estudio, la resolución del embarazo y el manejo del embarazo siguiente junto con las estrategias para prevenirlo.

  8. Muerte fetal

    OpenAIRE

    Andrés Pons, G.; Eduardo Sepúlveda, S.; Juan Luis Leiva, B.; Gustavo Rencoret, P.; Alfredo Germain, A.

    2014-01-01

    La muerte fetal es un evento poco frecuente pero de gran repercusión afectiva para los padres involucrados y su entorno. En el presente artículo revisaremos la epidemiología, las causas, orientaremos a los médicos en los pasos a seguir para realizar adecuadamente el estudio, la resolución del embarazo y el manejo del embarazo siguiente junto con las estrategias para prevenirlo.

  9. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria; Ronchi, Antonella; Ruoppolo, Margherita; Santorelli, Lucia; Steinfelder, Robert; Elangovan, Sudharshan; Fugazza, Cristina; Caterino, Marianna

    2017-01-01

    are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark

  10. Expression of assayable residual stem cell damage in erythroid differentiation

    International Nuclear Information System (INIS)

    Huebner, G.E.; Miller, M.E.; Cronkite, E.P.

    1985-01-01

    In rodents, residual damage is inducible in hematopoietic stem cells by exposure to ionizing radiation or alkylating agents. This damage can b e assayed in mice by transferring bone marrow into lethally irradiated syngeneic recipients and subsequently measuring the incremental increase of-( 125 I)iodo-2'-deoxyuridine incorporation in spleens. In this study, bone marrow from mice treated 3 weeks previously with Methylnitrosourea (50 mg/kg) or 450 rad was injected into recipients in order to determine possible residual effects of treatment of erythroid cell differentiation following stem cell seeding. Such effects were detected by a reduced amount of 59 Fe incorporation into spleens, thus indicatin g transfer of residual stem cell damage to differentiating cells. (orig.)

  11. Reduction of erythroid progenitors in protein-energy malnutrition.

    Science.gov (United States)

    Borelli, Primavera; Blatt, Solange; Pereira, Juliana; de Maurino, Beatriz Beutler; Tsujita, Maristela; de Souza, Ana Cristina; Xavier, José Guilherme; Fock, Ricardo Ambrósio

    2007-02-01

    Protein-energy malnutrition is a syndrome in which anaemia together with multivitamin and mineral deficiency may be present. The pathophysiological mechanisms involved have not, however, yet been completely elucidated. The aim of the present study was to evaluate the pathophysiological processes that occur in this anaemia in animals that were submitted to protein-energy malnutrition, in particular with respect to Fe concentration and the proliferative activity of haemopoietic cells. For this, histological, histochemical, cell culture and immunophenotyping techniques were used. Two-month-old male Swiss mice were submitted to protein-energy malnutrition with a low-protein diet (20 g/kg) compared with control diet (400 g/kg). When the experimental group had attained a 20 % loss of their original body weight, the animals from both groups received, intravenously, 20 IU erythropoietin every other day for 14 d. Malnourished animals showed a decrease in red blood cells, Hb concentration and reticulocytopenia, as well as severe bone marrow and splenic atrophy. The results for serum Fe, total Fe-binding capacity, transferrin and erythropoietin in malnourished animals were no different from those of the control animals. Fe reserves in the spleen, liver and bone marrow were found to be greater in the malnourished animals. The mixed colony-forming unit assays revealed a smaller production of granulocyte-macrophage colony-forming units, erythroid burst-forming units, erythroid colony-forming units and CD45, CD117, CD119 and CD71 expression in the bone marrow and spleen cells of malnourished animals. These findings suggest that, in this protein-energy malnutrition model, anaemia is not caused by Fe deficiency or erythropoietin deficiency, but is a result of ineffective erythropoiesis.

  12. Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

    Science.gov (United States)

    Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

    2011-01-01

    Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

  13. [Fetal urology].

    Science.gov (United States)

    Jakobovits, Akos; Jakobovits, Antal

    2009-06-14

    Although it becomes vitally important only after birth, renal function already plays significant role in maintaining fetal metabolic equilibrium. The kidneys significantly contribute to production of amniotic fluid. Adequate amount of amniotic fluid is needed to stimulate the intrauterine fetal respiratory activity. Intrauterine breathing is essential for lung development. As a result, oligohydramnion is conducive to pulmonary hypoplasia. The latter may lead to neonatal demise soon after birth. In extrauterine life kidneys eliminate nitrogen containing metabolic byproducts. Inadequate renal function results therefore lethal uremia. Integrity of ureters and the urethra is essential for the maintenance of renal function. Retention of urine causes degeneration of the functional units of the kidneys and ensuing deterioration of renal function. Intrauterine kidney puncture or shunt procedure may delay this process in some cases. On the other hand, once renal function has been damaged, no therapy can restart it. Certain anomalies of renal excretory pathways may also be associated with other congenital abnormalities, making the therapeutic efforts pointless. Presence of these associated intrauterine defects makes early pregnancy termination a management alternative, as well as it affects favorably perinatal mortality rates.

  14. Erythroblastic Sarcoma Presenting as Bilateral Ovarian Masses in an Infant with Pure Erythroid Leukemia

    Science.gov (United States)

    Wang, Huan-You; Huang, Lily Jun-shen; Garcia, Rolando; Li, Shiyong; Galliani, Carlos A.

    2010-01-01

    Pure erythroid leukemia is a rare subtype of acute erythroid leukemia that is characterized by a predominant erythroid population, and erythroblastic sarcoma has not yet been described in the English literature. Here we report a first case of erythroblastic sarcoma which presented as bilateral ovarian masses in a three and half month old baby girl with pure erythroid leukemia. Bone marrow aspirate and biopsy showed the marrow was completely replaced by large-sized blasts consistent with erythroblasts. Immunophenotypically, both the tumor cells from the ovarian mass and bone marrow blasts were positive for CD117, glycophorin A, and hemoglobin A, demonstrating erythroid differentiation. Reverse transcriptase polymerase chain reaction showed the tumor cells from ovarian mass expressed hemoglobin F and α1 spectrin, confirming their erythroid lineage. Conventional karyotype of the bone marrow aspirates revealed del(6) (q23q25) and trisomy 7 in all 21 cells examined. Fluorescence in situ hybridization of the ovarian mass demonstrated loss of C-MYB at 6q23 locus in 41% of the cells, and deletion of chromosome 7 and 7q in 37% and 66% of cells, respectively. Taken together, we showed, for the first time, that pure erythroid leukemia presented as a myeloid sarcoma in the form of ovarian masses. PMID:21237494

  15. Medio ambiente fetal Fetal environment

    Directory of Open Access Journals (Sweden)

    César Bernardo Ospina Arcila

    1996-04-01

    Full Text Available Con base en el artículo clásico "Monte Everest in utero" se hace un análisis de la situación que afronta el feto con respecto a la disponibilidad de oxígeno; para una mejor comprensión del sufrimiento fetal se revisan los siguientes conceptos: presión barométrica, presión parcial del oxígeno atmosférico, presión parcial del oxígeno inspirado, presión barométrica intranasal, ecuación del gas alveolar y difusión de gases a través de la membrana alvéolo capilar. Based on the classical paper by Eastman "Mount Everest in utero" an analysis is made of the situation faced by the fetus with respect to the availability of oxygen; for a better under. standing of fetal distress the following concepts are reviewed: barometric pressure, partial pressure of atmosferic oxygen, partial pressure of inspired oxygen, barometric intranasal pressure, alveolar gas equation and gas diffusion through alveolo-capilar membrane.

  16. Activated Fps/Fes tyrosine kinase regulates erythroid differentiation and survival.

    Science.gov (United States)

    Sangrar, Waheed; Gao, Yan; Bates, Barbara; Zirngibl, Ralph; Greer, Peter A

    2004-10-01

    A substantial body of evidence implicates the cytoplasmic protein tyrosine kinase Fps/Fes in regulation of myeloid differentiation and survival. In this study we wished to determine if Fps/Fes also plays a role in the regulation of erythropoiesis. Mice tissue-specifically expressing a "gain-of-function" mutant fps/fes transgene (fps(MF)) encoding an activated variant of Fps/Fes (MFps), were used to explore the in vivo biological role of Fps/Fes. Erythropoiesis in these mice was assessed by hematological analysis, lineage marker analysis, bone-marrow colony assays, and biochemical approaches. fps(MF) mice displayed reductions in peripheral red cell counts. However, there was an accumulation of immature erythroid precursors, which displayed increased survival. Fps/Fes and the related Fer kinase were both detected in early erythroid progenitors/blasts and in mature red cells. Fps/Fes was also activated in response to erythropoietin (EPO) and stem cell factor (SCF), two critical factors in erythroid development. In addition, increased Stat5A/B activation and reduced Erk1/2 phosphorylation was observed in fps(MF) primary erythroid cells in response to EPO or SCF, respectively. These data support a role for Fps/Fes in regulating the survival and differentiation of erythroid cells through modulation of Stat5A/B and Erk kinase pathways induced by EPO and SCF. The increased numbers and survival of erythroid progenitors from fps(MF) mice, and their differential responsiveness to SCF and EPO, implicates Fps/Fes in the commitment of multilineage progenitors to the erythroid lineage. The anemic phenotype in fps(MF) mice suggests that downregulation of Fps/Fes activity might be required for terminal erythroid differentiation.

  17. Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation

    International Nuclear Information System (INIS)

    Finaurini, Sara; Ronzoni, Luisa; Colancecco, Alessandra; Cattaneo, Alessandra; Cappellini, Maria Domenica; Ward, Stephen A.; Taramelli, Donatella

    2010-01-01

    Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment

  18. Hydroxyurea inhibits parvovirus B19 replication in erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Conti, Ilaria; Manaresi, Elisabetta; Gallinella, Giorgio

    2017-07-15

    Parvovirus B19 (B19V) infection is restricted to erythroid progenitor cells (EPCs) of the human bone marrow, leading to transient arrest of erythropoiesis and severe complications mainly in subjects with underlying hematological disorders or with immune system deficits. Currently, there are no specific antiviral drugs for B19V treatment, but identification of compounds inhibiting B19V replication can be pursued by a drug repositioning strategy. In this frame, the present study investigates the activity of hydroxyurea (HU), the only disease-modifying therapy approved for sickle cell disease (SCD), towards B19V replication in the two relevant cellular systems, the UT7/EpoS1 cell line and EPCs. Results demonstrate that HU inhibits B19V replication with EC 50 values of 96.2µM and 147.1µM in UT7/EpoS1 and EPCs, respectively, providing experimental evidence of the antiviral activity of HU towards B19V replication, and confirming the efficacy of a drug discovery process by drug repositioning strategy. The antiviral activity occurs in vitro at concentrations lower than those affecting cellular DNA replication and viability, and at levels measured in plasma samples of SCD patients undergoing HU therapy. HU might determine a dual beneficial effect on SCD patients, not only for the treatment of the disease but also towards a virus responsible for severe complications. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  20. [Update on the biology of heme synthesis in erythroid cells].

    Science.gov (United States)

    Fujiwara, Tohru; Harigae, Hideo

    2015-02-01

    Heme is a prosthetic group of hemoproteins playing important roles in oxygen transport, detoxification, circadian rhythm, microRNA processing, regulation of transcription, and translation. The majority of heme (-85%) is synthesized in red blood cells mainly for hemoglobin production, whereas hepatocytes account for most of the rest, functioning primarily in the synthesis of cytochrome P450 enzymes and mitochondrial respiratory enzymes. Thus, failure of heme biosynthesis causes severe inherited or acquired disorders in humans, including porphyria and sideroblastic anemia. The heme biosynthetic pathway is composed of eight enzymes that work in either mitochondria or the cytoplasm, which have been extensively researched and frequently reviewed. On the other hand, the mechanisms governing transport and intracellular trafficking of heme intermediates, as well as their potential links to human diseases, are poorly understood. Herein, we focus on recent understanding of the heme biosynthetic pathway and on human disorders due to defective heme synthesis in erythroid cells, such as X-linked sideroblastic anemia and erythropoietic protoporphyria.

  1. Prospective identification of erythroid elements in cultured peripheral blood.

    Science.gov (United States)

    Miller, J L; Njoroge, J M; Gubin, A N; Rodgers, G P

    1999-04-01

    We have developed a prospective approach to identify the generation of erythroid cells derived from cultured peripheral blood mononuclear cells (PBMC) by monitoring the expression of the cell surface protein CD48. Unpurified populations of PBMC obtained from the buffy coats of normal volunteers were grown in suspension culture in the absence or presence of erythropoietin. A profile of surface CD48 expression permitted a flow cytometric identification of erythropoietin responsive populations at various stages of their maturation. In the absence of erythropoietin (EPO) supplemented media, the CD48- cells represented <5% of the total population of PBMC remaining in culture. In cultures supplemented with 1 U/mL EPO, the mean percentage of CD48- cells increased to 34.7 + 14.9% (p < 0.01) after 14 days in culture. Coordinated CD34 and CD71 (transferrin receptor) expression, morphology, gamma-globin transcription, and colony formation in methylcellulose were observed during the 14-day culture period. Flow cytometric monitoring of bulk cultured PBMC provides a simple and reliable means for the prospective or real-time study of human erythropoiesis.

  2. Developmental programming: Impact of fetal exposure to endocrine-disrupting chemicals on gonadotropin-releasing hormone and estrogen receptor mRNA in sheep hypothalamus

    International Nuclear Information System (INIS)

    Mahoney, Megan M.; Padmanabhan, Vasantha

    2010-01-01

    Bisphenol-A (BPA) and methoxychlor (MXC), two endocrine-disrupting chemicals (EDCs) with estrogenic and antiandrogenic effects, disrupt the reproductive system. BPA has profound effects on luteinizing hormone (LH) surge amplitude, and MXC has profound effects on on LH surge timing in sheep. The neural mechanisms involved in the differential disruption of the LH surge by these two EDCs remain to be elucidated. We tested the hypothesis that the differential effects of BPA and MXC on LH surge system involved changes in hypothalamic gonadotropin-releasing hormone (GnRH) and estrogen receptors (ESR), ESR1 and ESR2, mRNA expression. Pregnant sheep were given daily injections of cottonseed oil (controls), MXC, or BPA (5 mg/kg/day) from day 30 to 90 of gestation (term 147 d). Offspring from these animals were euthanized as adults, during the late follicular phase following synchronization of estrus with prostaglandin F 2α , just before the expected onset of preovulatory LH surge and changes in mRNA expression of hypothalamic GnRH, ESR1, and ESR2 quantified following in situ hybridization. GnRH mRNA expression was significantly lower in both groups of EDC-treated females compared to controls. ESR1 expression was increased in prenatal BPA- but not MXC-treated females in medial preoptic area relative to controls. In contrast, ESR2 expression was reduced in the medial preoptic area of both EDC-treated groups. Differences in expression of ESR1/ESR2 receptors may contribute to the differential effects of BPA and MXC on the LH surge system. These findings provide support that prenatal exposure to EDCs alters the neural developmental trajectory leading to long-term reproductive consequences in the adult female.

  3. Developmental programming: impact of fetal exposure to endocrine-disrupting chemicals on gonadotropin-releasing hormone and estrogen receptor mRNA in sheep hypothalamus.

    Science.gov (United States)

    Mahoney, Megan M; Padmanabhan, Vasantha

    2010-09-01

    Bisphenol-A (BPA) and methoxychlor (MXC), two endocrine-disrupting chemicals (EDCs) with estrogenic and antiandrogenic effects, disrupt the reproductive system. BPA has profound effects on luteinizing hormone (LH) surge amplitude, and MXC has profound effects on on LH surge timing in sheep. The neural mechanisms involved in the differential disruption of the LH surge by these two EDCs remain to be elucidated. We tested the hypothesis that the differential effects of BPA and MXC on LH surge system involved changes in hypothalamic gonadotropin-releasing hormone (GnRH) and estrogen receptors (ESR), ESR1 and ESR2, mRNA expression. Pregnant sheep were given daily injections of cottonseed oil (controls), MXC, or BPA (5mg/kg/day) from day 30 to 90 of gestation (term 147d). Offspring from these animals were euthanized as adults, during the late follicular phase following synchronization of estrus with prostaglandin F(2alpha), just before the expected onset of preovulatory LH surge and changes in mRNA expression of hypothalamic GnRH, ESR1, and ESR2 quantified following in situ hybridization. GnRH mRNA expression was significantly lower in both groups of EDC-treated females compared to controls. ESR1 expression was increased in prenatal BPA- but not MXC-treated females in medial preoptic area relative to controls. In contrast, ESR2 expression was reduced in the medial preoptic area of both EDC-treated groups. Differences in expression of ESR1/ESR2 receptors may contribute to the differential effects of BPA and MXC on the LH surge system. These findings provide support that prenatal exposure to EDCs alters the neural developmental trajectory leading to long-term reproductive consequences in the adult female. 2010 Elsevier Inc. All rights reserved.

  4. Antisense myb inhibition of purified erythroid progenitors in development and differentiation is linked to cycling activity and expression of DNA polymerase alpha

    International Nuclear Information System (INIS)

    Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C.

    1991-01-01

    These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase

  5. Recombinant human parvovirus B19 vectors: erythroid cell-specific delivery and expression of transduced genes.

    Science.gov (United States)

    Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A

    1998-06-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and

  6. Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes

    Science.gov (United States)

    Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun

    1998-01-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited

  7. Fetal behavioral teratology.

    Science.gov (United States)

    Visser, Gerard H A; Mulder, Eduard J H; Tessa Ververs, F F

    2010-10-01

    Ultrasound studies of fetal motor behavior provide direct – in vivo – insight in the functioning of the motor component of the fetal central nervous system. In this article, studies are reviewed showing changes in the first timetable of appearance of fetal movements, changes in quality and/or quantity of movements and disturbances in the development of fetal behavioral states in case of endogenous malfunctions, maternal diseases and exogenous behavioral teratogens.

  8. Acute erythroid neoplastic proliferations. A biological study based on 62 patients.

    Science.gov (United States)

    Domingo-Claros, Alicia; Larriba, Itziar; Rozman, Maruja; Irriguible, Dolors; Vallespí, Teresa; Aventin, Anna; Ayats, Ramon; Millá, Fuensanta; Solé, Francesc; Florensa, Lourdes; Gallart, Miquel; Tuset, Esperanza; Lopez, Carmen; Woessner, Soledad

    2002-02-01

    The terms acute erythroleukemia and AML-M6 are defined in the FAB classification as proliferations of dysplastic erythroid elements mixed with blasts of myeloid origin, but pure erythroid leukemias are not included. The recent WHO classification has a category of acute myeloid leukemia not otherwise categorized, which includes acute erythroid leukemia (M6) of two subtypes: M6a-erythroleukemia (erythroid/myeloid) and M6b-pure erythroid leukemia. The aims of this co-operative study were to discover the incidences of these different subtypes, and pay special attention to the morphology of these entities. We reviewed a series of 62 patients with erythroid neoplastic proliferations. Previous medical history, age, sex, peripheral blood and bone marrow cell counts, cytochemical stains, immunophenotype, and cytogenetics were evaluated at presentation. We analyzed the incidence of erythrocyte, leukocyte and platelet abnormalities in the peripheral blood. In bone marrow we analyzed dysplastic features of erythroblasts, granulocytic elements and the megakaryocytic lineage. Fifty-three patients met the criteria of M6a subtype of the WHO classification, and 2 were classified as having pure erythremia (M6b); 7 cases could not be classified according to the WHO criteria. Fifty-five patients presented with de novo acute leukemia, and seven patients had secondary acute leukemia. The most frequent dysplastic features in blood smears were: schistocytes, tear-drop and pincered cells in erythrocytes; hypogranulation and hyposegmentation in leukocytes; gigantism and hypogranulation in platelets. In bone marrow, megaloblastic changes, multinuclearity, karyorrhexis and basophilic stippling in erythroblasts; hypogranulation and gigantism in granulocytic series, and micromegakaryocytes and unconnected nuclei in megakarocytes were the most dysplastic features. A positive PAS reaction and increase of bone marrow iron with ring sideroblasts were common features. Trilineage dysplasia was

  9. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria

    2017-10-20

    The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.

  10. Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands.

    Directory of Open Access Journals (Sweden)

    Eyayu Belay

    Full Text Available Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP, intercellular adhesion molecule 4 (ICAM-4, CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions.

  11. Dynamics of GATA1 binding and expression response in a GATA1-induced erythroid differentiation system

    Directory of Open Access Journals (Sweden)

    Deepti Jain

    2015-06-01

    Full Text Available During the maturation phase of mammalian erythroid differentiation, highly proliferative cells committed to the erythroid lineage undergo dramatic changes in morphology and function to produce circulating, enucleated erythrocytes. These changes are caused by equally dramatic alterations in gene expression, which in turn are driven by changes in the abundance and binding patterns of transcription factors such as GATA1. We have studied the dynamics of GATA1 binding by ChIP-seq and the global expression responses by RNA-seq in a GATA1-dependent mouse cell line model for erythroid maturation, in both cases examining seven progressive stages during differentiation. Analyses of these data should provide insights both into mechanisms of regulation (early versus late targets and the consequences in cell physiology (e.g., distinctive categories of genes regulated at progressive stages of differentiation. The data are deposited in the Gene Expression Omnibus, series GSE36029, GSE40522, GSE49847, and GSE51338.

  12. A Rare Case of Pure Erythroid Sarcoma in a Pediatric Patient: Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    Pablo Manresa

    2017-12-01

    Full Text Available We describe an exceptional case of erythroid sarcoma in a pediatric patient as a growing orbital mass with no evidence of morphologic bone marrow involvement, who was finally diagnosed of pure erythroid sarcoma based on histopathology and flow cytometry criteria. We discuss the contribution of standardized eight-color flow cytometry as a rapid and reliable diagnostic method. The use of normal bone marrow databases allowed us to identify small aberrant populations in bone marrow and later confirm the diagnosis in the neoplastic tissue.

  13. THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA

    NARCIS (Netherlands)

    DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    1994-01-01

    Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using

  14. Fusion of ZMYND8 and RELA genes in acute erythroid leukemia

    DEFF Research Database (Denmark)

    Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim

    2013-01-01

    Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...

  15. Probing Conformational Stability and Dynamics of Erythroid and Nonerythroid Spectrin: Effects of Urea and Guanidine Hydrochloride

    Science.gov (United States)

    Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit

    2015-01-01

    We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGu H 2 0) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632

  16. Dimethyl sulfoxide-inducible cytoplasmic factor involved in erythroid differentiation in mouse erythroleukemia (Friend) cells

    International Nuclear Information System (INIS)

    Watanabe, T.; Oishi, M.

    1987-01-01

    A previous report described an intracellular factor (differentiation-inducing factor I, or DIF-I) that seem to play a role in erythroid differentiation in mouse erythroleukemia (MEL) cells. The authors have detected another erythroid-inducing factor in cell-free extracts from dimethyl sulfoxide- or hexamethylenebis(acetamide)-treated MEL cells, which acts synergistically with DIF-I. The partially purified factor (termed DIF-II) triggered erythroid differentiation when introduced into undifferentiated MEL cells that had been potentiated by the induction of DIF-I. The activity in the extracts appeared in an inducible manner after addition of dimethyl sulfoxide or hexamethylenebis(acetamide), reached a maximum at 6 hr, and then rapidly decreased. The induction was inhibited by phorbol 12-myristate 13-acetate and also by cycloheximide. No induction was observed in a mutant MEL cell line defective in erythroid differentiation. These characteristics are consistent with the supposition that DIF-II is one of the putative dimethyl sulfoxide-inducible factors detected in previously reported cell-fusion and cytoplast-fusion experiments. The role of DIF-II in MEL-cell differentiation and in vitro differentiation in general is discussed

  17. Establishment of immortalized human erythroid progenitor cell lines able to produce enucleated red blood cells.

    Directory of Open Access Journals (Sweden)

    Ryo Kurita

    Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.

  18. PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis.

    Science.gov (United States)

    Ryu, Moon-Suhn; Zhang, Deliang; Protchenko, Olga; Shakoury-Elizeh, Minoo; Philpott, Caroline C

    2017-05-01

    Developing erythrocytes take up exceptionally large amounts of iron, which must be transferred to mitochondria for incorporation into heme. This massive iron flux must be precisely controlled to permit the coordinated synthesis of heme and hemoglobin while avoiding the toxic effects of chemically reactive iron. In cultured animal cells, iron chaperones poly rC-binding protein 1 (PCBP1) and PCBP2 deliver iron to ferritin, the sole cytosolic iron storage protein, and nuclear receptor coactivator 4 (NCOA4) mediates the autophagic turnover of ferritin. The roles of PCBP, ferritin, and NCOA4 in erythroid development remain unclear. Here, we show that PCBP1, NCOA4, and ferritin are critical for murine red cell development. Using a cultured cell model of erythroid differentiation, depletion of PCBP1 or NCOA4 impaired iron trafficking through ferritin, which resulted in reduced heme synthesis, reduced hemoglobin formation, and perturbation of erythroid regulatory systems. Mice lacking Pcbp1 exhibited microcytic anemia and activation of compensatory erythropoiesis via the regulators erythropoietin and erythroferrone. Ex vivo differentiation of erythroid precursors from Pcbp1-deficient mice confirmed defects in ferritin iron flux and heme synthesis. These studies demonstrate the importance of ferritin for the vectorial transfer of imported iron to mitochondria in developing red cells and of PCBP1 and NCOA4 in mediating iron flux through ferritin.

  19. Hypoxia-inducible factor 1-mediated human GATA1 induction promotes erythroid differentiation under hypoxic conditions.

    Science.gov (United States)

    Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu

    2012-08-01

    Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.

  20. Accounting for Fetal Origins

    DEFF Research Database (Denmark)

    Dalgaard, Carl-Johan Lars; Hansen, Casper Worm; Strulik, Holger

    2017-01-01

    The Fetal Origins hypothesis has received considerable empirical support, both within epidemiology and economics. The present study compares the ability of two rival theoretical frameworks in accounting for the kind of path dependence implied by the Fetal Origins Hypothesis. We argue that while...

  1. Fetal scalp pH testing

    Science.gov (United States)

    Fetal scalp blood; Scalp pH testing; Fetal blood testing - scalp; Fetal distress - fetal scalp testing; Labor - fetal scalp testing ... a baby. In these cases, testing the scalp pH can help the doctor decide whether the fetus ...

  2. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-01-01

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation

  3. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.

  4. Fetal Echocardiography and Indications

    Directory of Open Access Journals (Sweden)

    Melih Atahan Güven

    2008-09-01

    Full Text Available Congenital heart diseases are encountered in 0.8% of live births and are among the most frequently diagnosed malformations. At least half of these anomalies end up with death or require surgical interventions and are responsible for 30% of the perinatal mortality. Fetal echocardiography is the sum of knowledge, skill and orientation rather than knowing the embryologic details of the fetal heart. The purpose of fetal echocardiography is to document the presence of normal fetal cardiac anatomy and rhythm in high risk group and to define the anomaly and arrhythmia if present. A certain sequence should be followed during the evaluation of fetal heart. Sequential segmental analysis (SSA and basic definition terminology made it possible to determine a lot of complex cardiac anomalies during prenatal period. By the end of 1970’s, Shinebourne started using sequential segmental analysis for fetal cardiac evaluation and today, prenatal diagnosis of congenital heart disease is possible without any confusion. In this manner, whole fetal heart can be evaluated as the relation of three segments (atria, ventricles and the great arteries with each other, irrelevant of complexity of a possible cardiac anomaly. Presence of increased nuchal thickness during early gestation and abnormal four-chamber-view during ultrasonography by the obstetrician presents a clear indication for fetal echocardiography,however, one should keep in mind that 80-90% of the babies born with a congenital heart disease do not have a familial or maternal risk factor. In addition, it should be remembered that expectant mothers with diabetes mellitus pose an indication for fetal echocardiography.

  5. Fetal tachycardia : diagnosis and treatment

    NARCIS (Netherlands)

    Oudijk, Martijn Alexander

    2003-01-01

    Part I: Fetal tachyarrhythmias Diagnosis Fetal tachycardia is a serious condition warranting specialized evaluation. In chapter 2, methods of diagnosis of fetal tachycardia are described, including doppler and M-mode echocardiography and fetal magnetocardiography. The study presented in chapter 3

  6. Fetal body movement monitoring.

    Science.gov (United States)

    Rayburn, W F

    1990-03-01

    Recording fetal activity serves as an indirect measure of central nervous system integrity and function. The coordination of whole body movement, which requires complex neurologic control, is likely similar to that of the newborn infant. Short-term observations of the fetus are best performed using real-time ultrasound imaging. Monitoring fetal motion has been shown to be clinically worthwhile in predicting impending death or compromise, especially when placental insufficiency is longstanding. The presence of a vigorous fetus is reassuring. Perceived inactivity requires a reassessment of any underlying antepartum complication and a more precise evaluation by fetal heart rate testing or real-time ultrasonography before delivery is contemplated.

  7. Fetal blood drawing.

    Science.gov (United States)

    Hobbins, J C; Mahoney, M J

    1975-07-19

    A small sample of fetal blood suitable for studies of haemoglobin synthesis was obtained from a placental vessel under endoscopic visualisation in 23 of 26 patients in whom the procedure was attempted prior to second-trimester abortion. Fetal blood loss, calculated in 23 cases, was between 0-2 ml. and 2-5 ml., and fetal blood-volume depletion varied from 0-5% to 15%. No short-term ill-effects were demonstrated in mother or fetus in any of 16 patients in whom the injection of aborti-facient was postponed for between 16 and 24 hours after the procedure.

  8. Erythroid precursors from patients with low-risk myelodysplasia demonstrate ultrastructural features of enhanced autophagy of mitochondria

    NARCIS (Netherlands)

    Houwerzijl, E. J.; Pol, H-W D.; Blom, N. R.; van der Want, J. J. L.; de Wolf, J. Thm; Vellenga, E.

    Recent studies in erythroid cells have shown that autophagy is an important process for the physiological clearance of mitochondria during terminal differentiation. However, autophagy also plays an important role in removing damaged and dysfunctional mitochondria. Defective mitochondria and impaired

  9. Two different in vitro growth patterns for erythroid precursors in 18 patients with pure erythrocytosis

    International Nuclear Information System (INIS)

    Clement, S.; Eberlin, A.; Najean, Y.; Chedeville, A.

    1982-01-01

    Growth patterns of marrow and blood erythroid progenitors were studied in 18 cases of pure erythrocytosis using different doses of erythropoietin. 8 cases demonstrated ''spontaneous'' growth of CFU-E and blood BFU-E as observed in myeloproliferative disorders, but without an excess of circulating CFU-GM. 3 of these patients also had other symptoms of a pan-myelopathy. All these cases showed good sensitivity to 32 P myelo-suppression. 10 cases demonstrated growth patterns of erythroid progenitors similar to those observed in normal subjects, except for an excess of blood BFU-E, which suggests an abnormality of homeostatic regulation. In 5 of these cases, myelo-suppression was not effective. It is suggested that a stem cell study could differentiate patients with pure erythrocytosis due to ''autonomous'' abnormal stem cell growth from cases due to abnormal regulation factors, and that such a discrimination might be usefull for the choice of theraphy. (authors)

  10. Dexamethasone targeted directly to macrophages induces macrophage niches that promote erythroid expansion

    DEFF Research Database (Denmark)

    Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio

    2015-01-01

    Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...

  11. Non-erythroid alpha spectrin prevents telomere dysfunction after DNA interstrand cross-link damage

    OpenAIRE

    Zhang, Pan; Herbig, Utz; Coffman, Frederick; Lambert, Muriel W.

    2013-01-01

    Telomere integrity is critical for telomere function and genomic stability. We previously demonstrated that non-erythroid ?-spectrin (?IISp) is present in mammalian cell nuclei where it is important in repair of DNA interstrand cross-links (ICLs) and chromosome stability. We now demonstrate that ?IISp is also important for telomere maintenance after ICL damage. It localizes to telomeres in S phase after ICL damage where it has enhanced association with TRF1 and TRF2 and is required for recrui...

  12. Erythroid differentiation and commitment in rat erythroleukemia cells with hypertonic culture conditions.

    OpenAIRE

    Yamaguchi, Y; Kluge, N; Ostertag, W; Furusawa, M

    1981-01-01

    Cell cultures of 7,12-dimethylbenz[a]anthracene-induced rat erythroleukemia can be stimulated to synthesize hemoglobin when cultured in hypertonic media. During hypertonic treatment the intracellular osmotic conditions immediately readjust to those of the extracellular medium. None of the Friend virus-induced mouse erythroleukemia cell lines was inducible for differentiation with the same hypertonic culture conditions used for rat cells. Earliest commitment to erythroid terminal differentiati...

  13. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells.

    Science.gov (United States)

    Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.

  14. Fetal Alcohol Spectrum Disorders

    Science.gov (United States)

    Alcohol can harm your baby at any stage during a pregnancy. That includes the earliest stages, before ... can cause a group of conditions called fetal alcohol spectrum disorders (FASDs). Children who are born with ...

  15. Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice

    Directory of Open Access Journals (Sweden)

    Ibrahim Mansur

    2016-01-01

    Full Text Available Radiotherapy is commonly used to kill malignant cells, but it can significantly deplete hematopoietic and splenic erythroblasts. Radioprotective agents are therefore very important in clinical radiotherapy. We examined the effect of poly-herbal EMSA ERITIN on immunological responses when administered to sublethally irradiated mice with the aim of highlighting promotes erythroid lineages and lymphocytes migration in irradiated mice with the parameter are TER119+CD123+in bone marrow and SDF-1 in bone marrow and spleen organ. Normal BALB/c mice were sublethally irradiated with 600 rad. EMSA ERITIN was administered orally at different doses:(1.04, 3.125 and 9.375 mg/g body weight for 15 days. On day 16 erythroid lineages (TER-119+CD123+ were observed in bone marrow and lymphocytes migration by the production of SDF-1 in spleen and bone marrow. Lymphocytes migration was indicated by the production of SDF-1 in spleen and bone marrow using flow cytometry analysis. EMSA ERITIN increased the generation of erythroid lineage cells marked by TER119+CD123+ and promoted lymphocyte migration by increasing SDF-1 production in bone marrow and spleen. EMSA ERITIN appears to be a powerful medicinal herb with potential as a food supplement to normalize homeostasis and erythropoiesis after radiation.

  16. Fetal and neonatal thyrotoxicosis

    Science.gov (United States)

    Batra, Chandar Mohan

    2013-01-01

    Fetal thyrotoxicosis is a rare disease occurring in 1 out of 70 pregnancies with Grave's disease or in 1 out of 4000-50,000 deliveries. The mortality is 12-20%, usually from heart failure, but other complications are tracheal compression, infections and thrombocytopenia. It results from transfer of thyroid stimulating immunoglobulins from mother to fetus through the placenta. This transplacental transfer begins around 20th week of pregnancy and reaches its maximum by 30th week. These autoantibodies bind to the fetal thyroid stimulating hormone (TSH) receptors and increase the secretion of the thyroid hormones. The mother has an active autoimmune thyroid disease or has been treated for it in the past. She may be absolutely euthyroid due to past treatment by drugs, surgery or radioiodine ablation, but still have active TSH receptor stimulating autoantibodies, which can cause fetal thyrotoxicosis. The other features of this disease are fetal tachycardia, fetal goiter and history of spontaneous abortions and findings of goiter, ascites, craniosyntosis, fetal growth retardation, maceration and hydrops at fetal autopsy. If untreated, this disease can result in intrauterine death. The treatment for this disease consists of giving carbimazole to the mother, which is transferred through the placenta to the fetus. The dose of carbimazole is titrated with the fetal heart rate. If the mother becomes hypothyroid due to carbimazole, thyroxine is added taking advantage of the fact that very little of thyroxine is transferred across the placenta. Neonatal thyrotoxicosis patients are very sick and require emergency treatment. The goal of the treatment is to normalize thyroid functions as quickly as possible, to avoid iatrogenic hypothyroidism while providing management and supportive therapy for the infant's specific signs and symptoms. PMID:24251220

  17. Intrapartum fetal heart rate profiles with and without fetal asphyxia.

    Science.gov (United States)

    Low, J A; Pancham, S R; Worthington, D N

    1977-04-01

    Fetal heart rate profiles for periods up to 12 hours prior to delivery have been reviewed in 515 patients with a fetus at risk. Mechanisms other than fetal asphyxia will cause fetal heart rate decelerations, and fetal asphyxia may in some instances develop in the absence of total or late decelerations. However, an increasing incidence of total decelerations and late decelerations and particularly a marked pattern of total decelerations and late decelerations are of value in the prediction of fetal asphyxia. Fetal heart rate deceleration patterns can predict the probability of fetal asphyxia at the time of initial intervention, while a progression of fetal heart rate deceleration patterns in the individual fetus can be of assistance in the subsequent scheduling of serial acid-base assessments during labor.

  18. Fetal abdominal magnetic resonance imaging

    International Nuclear Information System (INIS)

    Brugger, Peter C.; Prayer, Daniela

    2006-01-01

    This review deals with the in vivo magnetic resonance imaging (MRI) appearance of the human fetal abdomen. Imaging findings are correlated with current knowledge of human fetal anatomy and physiology, which are crucial to understand and interpret fetal abdominal MRI scans. As fetal MRI covers a period of more than 20 weeks, which is characterized not only by organ growth, but also by changes and maturation of organ function, a different MR appearance of the fetal abdomen results. This not only applies to the fetal intestines, but also to the fetal liver, spleen, and adrenal glands. Choosing the appropriate sequences, various aspects of age-related and organ-specific function can be visualized with fetal MRI, as these are mirrored by changes in signal intensities. Knowledge of normal development is essential to delineate normal from pathological findings in the respective developmental stages

  19. Fetal abdominal magnetic resonance imaging

    Energy Technology Data Exchange (ETDEWEB)

    Brugger, Peter C. [Center of Anatomy and Cell Biology, Integrative Morphology Group, Medical University of Vienna, Waehringerstrasse 13, 1090 Vienna (Austria)]. E-mail: peter.brugger@meduniwien.ac.at; Prayer, Daniela [Department of Radiology, Medical University of Vienna, Waehringerguertel 18-20, 1090 Vienna (Austria)

    2006-02-15

    This review deals with the in vivo magnetic resonance imaging (MRI) appearance of the human fetal abdomen. Imaging findings are correlated with current knowledge of human fetal anatomy and physiology, which are crucial to understand and interpret fetal abdominal MRI scans. As fetal MRI covers a period of more than 20 weeks, which is characterized not only by organ growth, but also by changes and maturation of organ function, a different MR appearance of the fetal abdomen results. This not only applies to the fetal intestines, but also to the fetal liver, spleen, and adrenal glands. Choosing the appropriate sequences, various aspects of age-related and organ-specific function can be visualized with fetal MRI, as these are mirrored by changes in signal intensities. Knowledge of normal development is essential to delineate normal from pathological findings in the respective developmental stages.

  20. Ultrasonic prediction of fetal mass

    African Journals Online (AJOL)

    1983-02-19

    Feb 19, 1983 ... Summary. A clinically accurate method for estimating fetal. mass from fetal body parameters is reviewed. The abdominal circumference is first calculated from ... reliable clinical parameter is the impression of uterine volume,.

  1. Unexplained fetal death

    OpenAIRE

    Sepúlveda, Janer; Quintero, Eliana Maribel

    2004-01-01

    El porcentaje de muertes fetales inexplicadas oscila entre un 21% a 50%; se define como la muerte que ocurre en fetos con edad gestacional mayor de 20 semanas o peso superior a 500 g, en la cual ni la autopsia ni el examen histológico del cordón umbilical, placenta y membranas, se logra identificar la causa. Los factores asociados con muerte fetal inexplicada son edad materna mayor de 35 años, sobrepeso, nivel educativo menor de 10 años, cigarrillo y bajo nivel socioeconómico, entre otros. La...

  2. Hormonal influences on growth of the fetal pig

    International Nuclear Information System (INIS)

    Spencer, G.S.

    1986-01-01

    Although there is considerable information on hormonal systems regulating growth postnatally, little is known about hormonal influences on growth in the fetuw. It has long been postulated that insulin is the major fetal growth promoting hormone. However, chronic administration of insulin to the fetal pig during 14 days in utero, although producing hyperinsulinaemia and elevated somatomedin levels, did not stimulate an increase in length, weight or cell number. Postnatally the principal growth promoting hormones are the growth hormone dependent somatomedins. It is thought that multiplication stimulating activity (MSA) is the fetal somatomedin. However, under similar conditions to those used for insulin administration, MSA did not affect growth in the fetal pig. Administration of somatostatin to chronically catheterized fetuses inhibited (p≤0.01) and thyrotrophin releasing factor stimulated (≤0.01) GH release. However, chronic administration of SRIF did not inhibit fetal growth. Thus there does seem to be some hypothalamic control over GH secretion but this may not play a major role in regulating fetal growth

  3. Induction of erythroid differentiation in human erythroleukemia cells by depletion of malic enzyme 2.

    Directory of Open Access Journals (Sweden)

    Jian-Guo Ren

    2010-09-01

    Full Text Available Malic enzyme 2 (ME2 is a mitochondrial enzyme that catalyzes the conversion of malate to pyruvate and CO2 and uses NAD as a cofactor. Higher expression of this enzyme correlates with the degree of cell de-differentiation. We found that ME2 is expressed in K562 erythroleukemia cells, in which a number of agents have been found to induce differentiation either along the erythroid or the myeloid lineage. We found that knockdown of ME2 led to diminished proliferation of tumor cells and increased apoptosis in vitro. These findings were accompanied by differentiation of K562 cells along the erythroid lineage, as confirmed by staining for glycophorin A and hemoglobin production. ME2 knockdown also totally abolished growth of K562 cells in nude mice. Increased ROS levels, likely reflecting increased mitochondrial production, and a decreased NADPH/NADP+ ratio were noted but use of a free radical scavenger to decrease inhibition of ROS levels did not reverse the differentiation or apoptotic phenotype, suggesting that ROS production is not causally involved in the resultant phenotype. As might be expected, depletion of ME2 induced an increase in the NAD+/NADH ratio and ATP levels fell significantly. Inhibition of the malate-aspartate shuttle was insufficient to induce K562 differentiation. We also examined several intracellular signaling pathways and expression of transcription factors and intermediate filament proteins whose expression is known to be modulated during erythroid differentiation in K562 cells. We found that silencing of ME2 leads to phospho-ERK1/2 inhibition, phospho-AKT activation, increased GATA-1 expression and diminished vimentin expression. Metabolomic analysis, conducted to gain insight into intermediary metabolic pathways that ME2 knockdown might affect, showed that ME2 depletion resulted in high orotate levels, suggesting potential impairment of pyrimidine metabolism. Collectively our data point to ME2 as a potentially novel

  4. Generation of erythroid cells from polyploid giant cancer cells: re-thinking about tumor blood supply.

    Science.gov (United States)

    Yang, Zhigang; Yao, Hong; Fei, Fei; Li, Yuwei; Qu, Jie; Li, Chunyuan; Zhang, Shiwu

    2018-04-01

    During development and tumor progression, cells need a sufficient blood supply to maintain development and rapid growth. It is reported that there are three patterns of blood supply for tumor growth: endothelium-dependent vessels, mosaic vessels, and vasculogenic mimicry (VM). VM was first reported in highly aggressive uveal melanomas, with tumor cells mimicking the presence and function of endothelial cells forming the walls of VM vessels. The walls of mosaic vessels are randomly lined with both endothelial cells and tumor cells. We previously proposed a three-stage process, beginning with VM, progressing to mosaic vessels, and eventually leading to endothelium-dependent vessels. However, many phenomena unique to VM channel formation remain to be elucidated, such as the origin of erythrocytes before VM vessels connect with endothelium-dependent vessels. In adults, erythroid cells are generally believed to be generated from hematopoietic stem cells in the bone marrow. In contrast, embryonic tissue obtains oxygen through formation of blood islands, which are largely composed of embryonic hemoglobin with a higher affinity with oxygen, in the absence of mature erythrocytes. Recent data from our laboratory suggest that embryonic blood-forming mechanisms also exist in cancer tissue, particularly when these tissues are under environmental stress such as hypoxia. We review the evidence from induced pluripotent stem cells in vitro and in vivo to support this previously underappreciated cell functionality in normal and cancer cells, including the ability to generate erythroid cells. We will also summarize the current understanding of tumor angiogenesis, VM, and our recent work on polyploid giant cancer cells, with emphasis on their ability to generate erythroid cells and their association with tumor growth under hypoxia. An alternative embryonic pathway to obtain oxygen in cancer cells exists, particularly when they are under hypoxic conditions.

  5. Iron overload promotes erythroid apoptosis through regulating HIF-1a/ROS signaling pathway in patients with myelodysplastic syndrome.

    Science.gov (United States)

    Zheng, Qing-Qing; Zhao, You-Shan; Guo, Juan; Zhao, Si-da; Song, Lu-Xi; Fei, Cheng-Ming; Zhang, Zheng; Li, Xiao; Chang, Chun-Kang

    2017-07-01

    Erythroid apoptosis increases significantly in myelodysplastic syndrome (MDS) patients with iron overload, but the underlying mechanism is not fully clear. In this study, we aim to explore the effect of HIF-1a/ROS on erythroid apoptosis in MDS patients with iron overload. We found that iron overload injured cellular functions through up-regulating ROS levels in MDS/AML cells, including inhibited cell viability, increased cell apoptosis and blocked cell cycle at G0/G1 phase. Interestingly, overexpression of hypoxia inducible factor-1a (HIF-1a), which was under-expressed in iron overload models, reduced ROS levels and attenuated cell damage caused by iron overload in MDS/AML cells. And gene knockdown of HIF-1a got the similar results as iron overload in MDS/AML cells. Furthermore, iron overload caused high erythroid apoptosis was closely related with ROS in MDS patients. Importantly, the HIF-1a protein levels of erythrocytes elevated obviously after incubation with desferrioxamine (DFO) from MDS patients with iron overload, accompanied by ROS levels inhibited and erythroid apoptosis reduced. Taken together, our findings determine that the HIF-1a/ROS signaling pathway plays a key role in promoting erythroid apoptosis in MDS patients with iron overload. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Proteomic analysis of erythroid differentiation induced by hexamethylene bisacetamide in murine erythroleukemia cells

    Czech Academy of Sciences Publication Activity Database

    Petrák, J.; Myslivcová, D.; Man, Petr; Čmejlová, J.; Čmejla, R.; Vyoral, D.

    2007-01-01

    Roč. 35, - (2007), s. 193-202 ISSN 0301-472X R&D Projects: GA MŠk LC545 Grant - others:CZ(CZ) 023736; GA ČR(CZ) GA303/04/0003; GA MŠk(CZ) LC06044 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : murine erythroleukemia cells * erythroid differentiation * hexamethylene bisacetamide Subject RIV: EE - Microbiology, Virology Impact factor: 3.147, year: 2007

  7. PRV-1, erythroid colonies and platelet Mpl are unrelated to thrombosis in essential thrombocythaemia

    DEFF Research Database (Denmark)

    Vannucchi, Alessandro M; Pancrazzi, Alessandro; Antonioli, Elisabetta

    2004-01-01

    markers of ET, namely PRV-1 overexpression, endogenous erythroid colony (EEC) formation, and reduced platelet Mpl content. Fifty-three (60%) of 88 subjects studied had monoclonal myelopoiesis and presented a 32% incidence of major thrombosis compared with 6% of polyclonal subjects (P = 0.......009). The frequency of abnormalities of PRV-1, EEC, or Mpl was similar in monoclonal and polyclonal subjects (respectively, 28%, 48%, 75%, and 37%, 27%, 63%), and none of them correlated with thrombosis. We conclude that the exploited epigenetic markers constitute independent phenotypic variations...

  8. Human fetal anatomy: MR imaging.

    Science.gov (United States)

    Weinreb, J C; Lowe, T; Cohen, J M; Kutler, M

    1985-12-01

    Twenty-four pregnant women carrying 26 fetuses (two sets of twins) were imaged with magnetic resonance (MR) imaging at 0.35 T following sonographic evaluation. Each study was retrospectively evaluated to determine which of 33 normal fetal structures were visible on the images and which imaging parameters were most useful for depicting fetal anatomy. Fetal motion degraded fetal images in all but two cases, both with oligohydramnios and in the third trimester of gestation. Nevertheless, many fetal structures were identifiable, particularly in the third trimester. Visualization of fetal anatomy improved with intravenous maternal sedation in five cases. Relatively T1-weighted images occasionally offered the advantage of less image degradation owing to fetal motion and improved contrast between different fetal structures. More T2 weighting was believed to be advantageous in one case for outlining the fetal head and in one case for delineation of the brain. In many cases, structures were similarly identifiable (though with different signal intensities) regardless of the parameters selected. The authors conclude that MR imaging of many fetal structures is currently unsatisfactory and is probably of limited value, particularly in the first and second trimesters. However, the relative frequency and detail with which the fetal head and liver can be depicted indicate that these may be areas for further investigation, and the potential utility of imaging fetal fat warrants further investigation.

  9. Ovine fetal necrobacillosis

    DEFF Research Database (Denmark)

    Agerholm, J.S.; Boye, Mette; Aalbæk, B.

    2007-01-01

    were found in several tissues. Histologically, placental lesions were characterized by locally diffuse infiltration of neutrophils, closely associated with abundant small Gram-negative and FISH-positive rods, thrombosis and necrosis. Lesions in the fetal-maternal interface were multifocal and consisted...

  10. Fetal Alcohol Syndrome.

    Science.gov (United States)

    Zerrer, Peggy

    The paper reviews Fetal Alcohol Syndrome (FAS), a series of effects seen in children whose mothers drink alcohol to excess during pregnancy. The identification of FAS and its recognition as a major health problem in need of prevention are traced. Characteristics of children with FAS are described and resultant growth retardation, abnormal physical…

  11. Fetal Alcohol Exposure

    Science.gov (United States)

    ... categories: 4 » Fetal Alcohol Syndrome (FAS) » Partial FAS (pFAS) » Alcohol-Related Neurodevelopmental Disorder (ARND) » Alcohol-Related Birth ... either prenatally, after birth, or both Partial FAS (pFAS) Partial FAS (pFAS) involves prenatal alcohol exposure, and ...

  12. Massive splenomegaly in acute erythroid leukaemia (FAB Class-M6): an unusual presentation.

    Science.gov (United States)

    Sherazi, Syed Furqan Haider; Butt, Zeeshan

    2012-09-01

    AML-M6 has a peak incidence in the seventh decade with slight male preponderance, and can also present at a younger age. The usual features are anaemia, thrombocytopenia, malaise, fatigue, easy bruising, epistaxis and petechiae. Splenomegaly may occur in 20-40 % of the cases but massive splenomegaly is rare presentation and have been only reported once in humans and once in animals. A 22 year Asian female, presented with fatigue, pallor, mild jaundice, exertional dyspnoea, epigastric pain, tender right hypochondrium and massive splenomegaly. Investigations revealed anaemia and thrombocytopenia, tear drop cells, basophilic stippling, piokilocytosis and anisochromia; increased uric acid and LDH. Abdominal ultrasound showed enlarged liver (22cm) and spleen (20cm). Bone marrow aspiration revealed 51% erythroid and 24% non-erythroid precursors, depressed leukopoeisis and megakarypoeisis. Erythroblasts were PAS and CD71 positive and also reacted to Antihaemoglobin-Antibody. This report highlights characteristic features and diagnostic criteria of erythroleukaemia, differential diagnosis of massive splenomegaly and their rare association.

  13. Erythroid cells in vitro: from developmental biology to blood transfusion products.

    Science.gov (United States)

    Migliaccio, Anna Rita; Whitsett, Carolyn; Migliaccio, Giovanni

    2009-07-01

    Red blood cells (RBCs) transfusion plays a critical role in numerous therapies. Disruption of blood collection by political unrest, natural disasters and emerging infections and implementation of restrictions on the use of erythropoiesis-stimulating agents in cancer may impact blood availability in the near future. These considerations highlight the importance of developing alternative blood products. Knowledge about the processes that control RBC production has been applied to the establishment of culture conditions allowing ex-vivo generation of RBCs in numbers close to those (2.5 x 10 cells/ml) present in a transfusion, from cord blood, donated blood units or embryonic stem cells. In addition, experimental studies demonstrate that such cells protect mice from lethal bleeding. Therefore, erythroid cells generated ex vivo may be suitable for transfusion provided they can be produced safely in adequate numbers. However, much remains to be done to translate a theoretical production of approximately 2.5 x 10 RBCs in the laboratory into a 'clinical grade production process'. This review summarizes the state-of-the-art in establishing ex-vivo culture conditions for erythroid cells and discusses the most compelling issues to be addressed to translate this progress into a clinical grade transfusion product.

  14. Characterization of human erythroid burst-promoting activity derived from bone marrow conditioned media

    International Nuclear Information System (INIS)

    Porter, P.N.; Ogawa, M.

    1982-01-01

    Bone marrow conditioned media (BMCM) increases burst number and the incorporation of 59 Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture

  15. Enhanced inhibition of parvovirus B19 replication by cidofovir in extendedly exposed erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio

    2016-07-15

    Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Parvovirus B19 integration into human CD36+ erythroid progenitor cells.

    Science.gov (United States)

    Janovitz, Tyler; Wong, Susan; Young, Neal S; Oliveira, Thiago; Falck-Pedersen, Erik

    2017-11-01

    The pathogenic autonomous human parvovirus B19 (B19V) productively infects erythroid progenitor cells (EPCs). Functional similarities between B19V nonstructural protein (NS1), a DNA binding endonuclease, and the Rep proteins of Adeno-Associated Virus (AAV) led us to hypothesize that NS1 may facilitate targeted nicking of the human genome and B19 vDNA integration. We adapted an integration capture sequencing protocol (IC-Seq) to screen B19V infected human CD36+ EPCs for viral integrants, and discovered 40,000 unique B19V integration events distributed throughout the human genome. Computational analysis of integration patterns revealed strong correlations with gene intronic regions, H3K9me3 sites, and the identification of 41 base pair consensus sequence with an octanucleotide core motif. The octanucleotide core has homology to a single region of B19V, adjacent to the P6 promoter TATA box. We present the first direct evidence that B19V infection of erythroid progenitor cells disrupts the human genome and facilitates viral DNA integration. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. The effect of fetal sex on customized fetal growth charts.

    Science.gov (United States)

    Rizzo, Giuseppe; Prefumo, Federico; Ferrazzi, Enrico; Zanardini, Cristina; Di Martino, Daniela; Boito, Simona; Aiello, Elisa; Ghi, Tullio

    2016-12-01

    To evaluate the effect of fetal sex on singleton pregnancy growth charts customized for parental characteristics, race, and parity Methods: In a multicentric cross-sectional study, 8070 ultrasonographic examinations from low-risk singleton pregnancies between 16 and 40 weeks of gestation were considered. The fetal measurements obtained were biparietal diameter (BPD), head circumference (HC), abdominal circumference (AC), and femur length (FL). Quantile regression was used to examine the impact of fetal sex across the biometric percentiles of the fetal measurements considered together with parents' height, weight, parity, and race. Fetal gender resulted to be a significant covariate for BDP, HC, and AC with higher values for male fetuses (p ≤ 0.0009). Minimal differences were found among sexes for FL. Parity, maternal race, paternal height and maternal height, and weight resulted significantly related to the fetal biometric parameters considered independently from fetal gender. In this study, we constructed customized biometric growth charts for fetal sex, parental, and obstetrical characteristics using quantile regression. The use of gender-specific charts offers the advantage to define individualized normal ranges of fetal biometric parameters at each specific centile. This approach may improve the antenatal identification of abnormal fetal growth.

  18. RECOMBINANT HUMAN MAST-CELL GROWTH-FACTOR SUPPORTS ERYTHROID COLONY FORMATION IN POLYCYTHEMIA-VERA IN THE PRESENCE AND ABSENCE OF ERYTHROPOIETIN AND SERUM

    NARCIS (Netherlands)

    MULLER, EW; DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral

  19. Effect of interleukin-9 on clonogenic maturation and cell-cycle status of fetal and adult hematopoietic progenitors

    Energy Technology Data Exchange (ETDEWEB)

    Holbrook, S.T.; Ohls, R.K.; Schibler, K.R.; Yang, Y.C.; Christensen, R.D. (Univ. of Utah School of Medicine, Salt Lake City (USA))

    1991-05-15

    We assessed the effect of interleukin-9 (IL-9) on clonogenic maturation and cell-cycle status of hematopoietic progenitors of fetal (umbilical cord blood) and adult (bone marrow) origin. As a single agent IL-9 supported, in a concentration-dependent fashion, maturation of burst-forming units-erythroid (BFU-E) of adult and fetal origin. However, only 1/3 the number of adult BFU-E colonies developed, as did in response to granulocyte-macrophage colony-stimulating factor (GM-CSF), and only 1/6 the number developed as did in response to IL-3. In contrast, the effect of IL-9 on fetal BFU-E colonies was equal to that of GM-CSF and IL-3. Synergistic effects of IL-9 with low concentrations (0.1 ng/mL) of GM-CSF and IL-3 were seen on adult BFU-E colony formation, but no effect was apparent at higher concentrations (1.0 ng/mL). In contrast, using fetal cells, synergistic effects of IL-9 with low and high concentrations of GM-CSF and IL-3 were apparent. Addition of IL-9 to plates containing fetal cells plus GM-CSF and IL-3 not only resulted in more BFU-E colonies, but also in more multicentered (greater than or equal to 10 individual centers) colonies, and more cells per colony. IL-9 had a wider spectrum of action on progenitors of fetal origin than on progenitors of adult origin, supporting the generation of fetal multipotent colony-forming unit (CFU)-Mix and CFU-GM colonies. Incubation with IL-9 did not accelerate cycling of adult or fetal BFU-E, CFU-Mix, or CFU-GM to the extent observed after incubation with IL-6.

  20. Effect of interleukin-9 on clonogenic maturation and cell-cycle status of fetal and adult hematopoietic progenitors

    International Nuclear Information System (INIS)

    Holbrook, S.T.; Ohls, R.K.; Schibler, K.R.; Yang, Y.C.; Christensen, R.D.

    1991-01-01

    We assessed the effect of interleukin-9 (IL-9) on clonogenic maturation and cell-cycle status of hematopoietic progenitors of fetal (umbilical cord blood) and adult (bone marrow) origin. As a single agent IL-9 supported, in a concentration-dependent fashion, maturation of burst-forming units-erythroid (BFU-E) of adult and fetal origin. However, only 1/3 the number of adult BFU-E colonies developed, as did in response to granulocyte-macrophage colony-stimulating factor (GM-CSF), and only 1/6 the number developed as did in response to IL-3. In contrast, the effect of IL-9 on fetal BFU-E colonies was equal to that of GM-CSF and IL-3. Synergistic effects of IL-9 with low concentrations (0.1 ng/mL) of GM-CSF and IL-3 were seen on adult BFU-E colony formation, but no effect was apparent at higher concentrations (1.0 ng/mL). In contrast, using fetal cells, synergistic effects of IL-9 with low and high concentrations of GM-CSF and IL-3 were apparent. Addition of IL-9 to plates containing fetal cells plus GM-CSF and IL-3 not only resulted in more BFU-E colonies, but also in more multicentered (greater than or equal to 10 individual centers) colonies, and more cells per colony. IL-9 had a wider spectrum of action on progenitors of fetal origin than on progenitors of adult origin, supporting the generation of fetal multipotent colony-forming unit (CFU)-Mix and CFU-GM colonies. Incubation with IL-9 did not accelerate cycling of adult or fetal BFU-E, CFU-Mix, or CFU-GM to the extent observed after incubation with IL-6

  1. Fetal cardiac assessment

    International Nuclear Information System (INIS)

    Greene, K.R.

    1983-01-01

    The better understanding of fetal cardiovascular physiology coupled with improved technology for non-invasive study of the fetus now enable much more detailed assessment of fetal cardiac status than by heart rate alone. Even the latter, relatively simple, measurement contains much more information than was previously realized. It is also increasingly clear that no single measurement will provide the answer to all clinical dilemmas either on cardiac function or the welfare of the fetus as a whole. There are obvious clinical advantages in measuring several variables from one signal and the measurement of heart rate, heart rate variation and waveform from the ECG in labour is a potentially useful combination. Systolic time intervals or flow measurements could easily be added or used separately by combining real-time and Doppler ultrasound probes

  2. Fetal chromosome analysis

    DEFF Research Database (Denmark)

    Philip, J; Tabor, A; Bang, J

    1983-01-01

    The aim of the study was to investigate the rationale of the current indications for fetal chromosome analysis. 5372 women had 5423 amniocentesis performed, this group constituting a consecutive sample at the chromosome laboratory, Rigshospitalet, Copenhagen from March 1973 to September 1980 (Group...... A + B). Pregnant women 35 years of age, women who previously had a chromosomally abnormal child, families with translocation carriers or other heritable chromosomal disease, families where the father was 50 years or more and women in families with a history of Down's syndrome (group A), were compared...... to women having amniocentesis, although considered not to have any increased risk of fetal chromosome abnormality (1390 pregnancies, group B). They were also compared with 750 consecutive pregnancies in women 25-34 years of age, in whom all heritable diseases were excluded (group C). The risk of unbalanced...

  3. Reactivation of fetal hemoglobin in thalassemia and sickle cell disease

    Directory of Open Access Journals (Sweden)

    Sandro Eridani

    2014-09-01

    Full Text Available Considerable attention has been recently devoted to mechanisms involved in the perinatal hemoglobin switch, as it was long ago established that the survival of fetal hemoglobin (HbF production in significant amount can reduce the severity of the clinical course in severe disorders like β-thalassemia and sickle cell disease (SCD. For instance, when β-thalassemia is associated with hereditary persistence of fetal hemoglobin (HPFH the disease takes a mild course, labeled as thalassemia intermedia. The same clinical amelioration occurs for the association between HPFH and SCD. As for the mechanism of this effect, some information has been obtained from the study of natural mutations at the human β-globin locus in patients with increased HbF, like the Corfu thalassemia mutations. Important evidence came from the discovery that drugs capable of improving the clinical picture of SCD, like decitabine ad hydroxycarbamide, are acting through the reactivation, to some extent, of HbF synthesis. The study of the mechanism of action of these compounds was followed by the identification of some genetic determinants, which promote this event. In particular, among a few genetic factors involved in this process, the most relevant appears the BCL11A gene, which is now credited to be able to silence γ-globin genes in the perinatal period by interaction with several erythroid-specific transcription factors and is actually considered as a barrier to HbF reactivation by known HbF inducing agents. Epigenetics is also a player in the process, mainly through DNA demethylation. This is certified by the recent demonstration that hypomethylating agents such as 5-azacytidine and decitabine, the first compounds used for HbF induction by pharmacology, act as irreversible inhibitors of demethyltransferase enzymes. Great interest has also been raised by the finding that several micro-RNAs, which act as negative regulators of gene expression, have been implicated in the

  4. The Normal Fetal Pancreas.

    Science.gov (United States)

    Kivilevitch, Zvi; Achiron, Reuven; Perlman, Sharon; Gilboa, Yinon

    2017-10-01

    The aim of the study was to assess the sonographic feasibility of measuring the fetal pancreas and its normal development throughout pregnancy. We conducted a cross-sectional prospective study between 19 and 36 weeks' gestation. The study included singleton pregnancies with normal pregnancy follow-up. The pancreas circumference was measured. The first 90 cases were tested to assess feasibility. Two hundred ninety-seven fetuses of nondiabetic mothers were recruited during a 3-year period. The overall satisfactory visualization rate was 61.6%. The intraobserver and interobserver variability had high interclass correlation coefficients of of 0.964 and 0.967, respectively. A cubic polynomial regression described best the correlation of pancreas circumference with gestational age (r = 0.744; P pancreas circumference percentiles for each week of gestation were calculated. During the study period, we detected 2 cases with overgrowth syndrome and 1 case with an annular pancreas. In this study, we assessed the feasibility of sonography for measuring the fetal pancreas and established a normal reference range for the fetal pancreas circumference throughout pregnancy. This database can be helpful when investigating fetomaternal disorders that can involve its normal development. © 2017 by the American Institute of Ultrasound in Medicine.

  5. Fetal magnetic resonance: technique applications and normal fetal anatomy

    International Nuclear Information System (INIS)

    Martin, C.; Darnell, A.; Duran, C.; Mellado, F.; Corona, M

    2003-01-01

    Ultrasonography is the preferred diagnostic imaging technique for intrauterine fetal examination. Nevertheless, circumstances sometimes dictate the use of other techniques in order to analyze fetal structures. The advent of ultra rapid magnetic resonance (MR) sequencing has led to the possibility of doing MR fetal studies, since images are obtained in an extradordiarily short time and are not affected by either maternal or fetal movements. It does not employ ionizing radiations, it provides high-contrast images and it can obtain such images in any plane of space without being influenced by either the child bearer's physical characteristics of fetal position. MR provides good quality images of most fetal organs. It is extremely useful in analysing distinct structures, as well as permitting an evaluation of cervical structures, lungs, diaphragms, intra-abdominal and retroperitoneal structures, and fetal extremities. It can also provide useful information regarding the placenta,umbilical cord, amniotic fluid and uterus. The objective of this work is to describe MR technique as applied to intrauterine fetal examination, and to illustrate normal fetal anatomy as manifested by MR and its applications. (Author) 42 refs

  6. Leukemic blast cell colony formation in semisolid culture with erythropoietin: a case report of acute poorly differentiated erythroid leukemia.

    Science.gov (United States)

    Tomonaga, M; Jinnai, I; Tagawa, M; Amenomori, T; Nishino, K; Yao, E; Nonaka, H; Kuriyama, K; Yoshida, Y; Matsuo, T

    1987-02-01

    The bone marrow of a patient with acute undifferentiated leukemia developed unique colonies after a 14-day culture in erythropoietin (EPO)-containing methylcellulose. The colonies consisted of 20 to 200 nonhemoglobinized large blast cells. Cytogenetic analysis of single colonies revealed hypotetraploid karyotypes with several marker chromosomes that were identical to those found in directly sampled bone marrow. The concurrently formed erythroid bursts showed only normal karyotypes. No leukemic colony formation was observed in other culture systems with either colony-stimulating activity (CSA) or phytohemagglutinin-stimulated leukocyte-conditioned medium (PHA-LCM). The leukemic colonies exhibited a complete EPO-dose dependency similar to that of the patient's normal BFU-E. Although cytochemical and immunologic marker studies of the bone marrow cells failed to clarify the cell lineage of the leukemic cells with extraordinarily large cell size, ultrastructural study revealed erythroid differentiation such as siderosome formation in the cytoplasm and ferritin particles in the rhophecytosis invaginations. These findings indicate that the patient had poorly differentiated erythroid leukemia and that some of the clonogenic cells might respond to EPO in vitro. Corresponding to this biological feature, the leukemic cells were markedly decreased in number in response to repeated RBC transfusions, and partial remission was obtained. These observations suggest that erythroid leukemia distinct from erythroleukemia (M6) with a myeloblastic component, can develop as a minor entity of human acute leukemia.

  7. MRI of the fetal spine

    International Nuclear Information System (INIS)

    Simon, Erin M.

    2004-01-01

    Magnetic resonance imaging of the fetal spine is a vital complement to fetal sonographic examination. Assessing the wide spectrum of spinal dysraphism, as well as spinal neoplasia, allows for more correct prenatal diagnoses, patient care planning, and patient counselling. Proper appraisal of the value of experimental procedures, such as fetal myelomeningocoele repair, requires a high level of diagnostic accuracy for the selection and follow-up of appropriate candidates. (orig.)

  8. MRI of the fetal spine

    Energy Technology Data Exchange (ETDEWEB)

    Simon, Erin M. [Departement of Radiology, Children' s Hospital of Philadelphia, PA (United States)

    2004-09-01

    Magnetic resonance imaging of the fetal spine is a vital complement to fetal sonographic examination. Assessing the wide spectrum of spinal dysraphism, as well as spinal neoplasia, allows for more correct prenatal diagnoses, patient care planning, and patient counselling. Proper appraisal of the value of experimental procedures, such as fetal myelomeningocoele repair, requires a high level of diagnostic accuracy for the selection and follow-up of appropriate candidates. (orig.)

  9. ROLE OF STEM CELL FACTOR IN THE REACTIVATION OF HUMAN FETAL HEMOGLOBIN

    Directory of Open Access Journals (Sweden)

    Ugo Testa

    2009-06-01

    Full Text Available

    In humans the switch from fetal to adult  hemoglobin (HbF→ HbA takes place in the perinatal and postnatal period, determining the progressive replacement of HbF with HbA synthesis ( i.e., the relative HbF content in red blood cells decreases from 80-90% to <1%. In spite of more than twenty years of intensive investigations on this classic model, the molecular mechanisms regulating the Hb switching, as well as HbF synthesis in adults, has been only in part elucidated. In adult life, the residual HbF, restricted to F cell compartment, may be reactivated up to 10-20% of total Hb synthesis in various conditions associated with “stress erythropoiesis”: this reactivation represented until now an interesting model of partial Hb switch reverse with important therapeutic implications in patients with hemoglobinopathies, and particularly in -thalassemia.
    In vitro and in vivo models have led to the identification of several chemical compounds able to reactivate HbF synthesis in adult erythroid cells. Although the impact of these HbF inducers, including hypomethylating agents, histone deacetylase inhibitors and hydroxyurea, was clear on the natural history of sickle cell anemia, the benefit on the clinical course of -thalassemia was only limited: particularly, the toxicity and the modest increase in γ-globin reactivation indicated the need for improved agents able to induce higher levels of HbF.
    In the present review we describe the biologic properties of Stem Cell Factor (SCF, a cytokine sustaining the survival and proliferation of erythroid cells, that at pharmacological doses acts as a potent stimulator of HbF synthesis in adult erythroid cells.

  10. Chemical Inhibition of Histone Deacetylases 1 and 2 Induces Fetal Hemoglobin through Activation of GATA2.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Shearstone

    Full Text Available Therapeutic intervention aimed at reactivation of fetal hemoglobin protein (HbF is a promising approach for ameliorating sickle cell disease (SCD and β-thalassemia. Previous studies showed genetic knockdown of histone deacetylase (HDAC 1 or 2 is sufficient to induce HbF. Here we show that ACY-957, a selective chemical inhibitor of HDAC1 and 2 (HDAC1/2, elicits a dose and time dependent induction of γ-globin mRNA (HBG and HbF in cultured primary cells derived from healthy individuals and sickle cell patients. Gene expression profiling of erythroid progenitors treated with ACY-957 identified global changes in gene expression that were significantly enriched in genes previously shown to be affected by HDAC1 or 2 knockdown. These genes included GATA2, which was induced greater than 3-fold. Lentiviral overexpression of GATA2 in primary erythroid progenitors increased HBG, and reduced adult β-globin mRNA (HBB. Furthermore, knockdown of GATA2 attenuated HBG induction by ACY-957. Chromatin immunoprecipitation and sequencing (ChIP-Seq of primary erythroid progenitors demonstrated that HDAC1 and 2 occupancy was highly correlated throughout the GATA2 locus and that HDAC1/2 inhibition led to elevated histone acetylation at well-known GATA2 autoregulatory regions. The GATA2 protein itself also showed increased binding at these regions in response to ACY-957 treatment. These data show that chemical inhibition of HDAC1/2 induces HBG and suggest that this effect is mediated, at least in part, by histone acetylation-induced activation of the GATA2 gene.

  11. Erythroid Differentiation Regulator 1 as a Novel Biomarker for Hair Loss Disorders.

    Science.gov (United States)

    Woo, Yu Ri; Hwang, Sewon; Jeong, Seo Won; Cho, Dae Ho; Park, Hyun Jeong

    2017-02-03

    Erythroid differentiation regulator 1 (Erdr1) is known to be involved in the inflammatory process via regulating the immune system in many cutaneous disorders, such as psoriasis and rosacea. However, the role of Erdr1 in various hair loss disorders remains unclear. The aim of this study was to investigate the putative role of Erdr1 in alopecias. Skin samples from 21 patients with hair loss disorders and five control subjects were retrieved, in order to assess their expression levels of Erdr1. Results revealed that expression of Erdr1 was significantly downregulated in the epidermis and hair follicles of patients with hair loss disorders, when compared to that in the control group. In particular, the expression of Erdr1 was significantly decreased in patients with alopecia areata. We propose that Erdr1 downregulation might be involved in the pathogenesis of hair loss, and could be considered as a novel biomarker for hair loss disorders.

  12. Comparison of different methods for erythroid differentiation in the K562 cell line.

    Science.gov (United States)

    Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein

    2016-08-01

    To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.

  13. The effect of ceruloplasmin on erythroid precursor cells in the marrow of irradiated mice

    International Nuclear Information System (INIS)

    Suda, Toshio; Miura, Yasusada; Ozawa, Keiya; Yamada, Masaaki.

    1981-01-01

    The effect of ceruloplasmine on erythroid colony forming unit (CFU-e) of irradiated mice was investigated. Whole body #betta# ray irradiation of 100rad decreased the number of CFU-e from 154 to 40 per 4 * 10 4 myeloid nucleated cells. When human #betta#-globulin of 1 mg/kg or ceruloplasmin of 1 mg/kg was administrated immediately after irradiation, the number of CFU-e increased to that of more than normal and normal value in 2 days, respectively. In the case where ceruloplasmin was begun to administrated 7 days before irradiation, though the CFU-e number decreased from 144 to 44, the number increased to 317 after 2 days, and gradually decreased to the normal value by 16 days after irradiation. (Nakanishi, T)

  14. Dihydroartemisinin inhibits the human erythroid cell differentiation by altering the cell cycle

    International Nuclear Information System (INIS)

    Finaurini, Sara; Basilico, Nicoletta; Corbett, Yolanda; D’Alessandro, Sarah; Parapini, Silvia; Olliaro, Piero; Haynes, Richard K.; Taramelli, Donatella

    2012-01-01

    Artemisinin derivatives such as dihydroartemisinin (DHA) induce significant depletion of early embryonic erythroblasts in animal models. We have reported previously that DHA specifically targets pro-erythroblasts and basophilic erythroblasts, when human CD34+ stem cells are differentiated toward the erythroid lineage, indicating that a window of susceptibility to artemisinins may exist also in human developmental erythropoiesis during pregnancy. To better investigate the toxicity of artemisinin derivatives, the structure–activity relationship was evaluated against the K562 leukaemia cell line, used as a model for differentiating early human erythroblasts. All artemisinins derivatives, except deoxyartemisinin, inhibited both spontaneous and induced erythroid differentiation, confirming that the peroxide bridge is responsible for the erythro-toxicity. On the contrary, cell growth was markedly reduced by DHA, artemisone and artesunate but not by artemisinin, 10-deoxoartemisinin or deoxy-artemisinin. The substituent at position C-10 is responsible only for the anti-proliferative effect, since 10-deoxoartemisinin did not reduce cell growth but arrested the differentiation of K562 cells. In particular, the results showed that DHA resulted the most potent and rapidly acting compound of the drug family, causing (i) the decreased expression of GpA surface receptors and the down regulation the γ-globin gene; (ii) the alteration of S phase of cell cycle and (iii) the induction of programmed cell death of early erythroblasts in a dose dependent manner within 24 h. In conclusion, these findings confirm that the active metabolite DHA is responsible for the erythro-toxicity of most of artemisinins used in therapy. Thus, as long as no further clinical data are available, current WHO recommendations of avoiding malaria treatment with artemisinins during the first trimester of pregnancy remain valid.

  15. CTCF and CohesinSA-1 Mark Active Promoters and Boundaries of Repressive Chromatin Domains in Primary Human Erythroid Cells.

    Directory of Open Access Journals (Sweden)

    Laurie A Steiner

    Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.

  16. Carbon monoxide induced erythroid differentiation of K562 cells mimics the central macrophage milieu in erythroblastic islands.

    Directory of Open Access Journals (Sweden)

    Shlomi Toobiak

    Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.

  17. Involvement of placental/umbilical cord blood acid-base status and gas values on the radiosensitivity of human fetal/neonatal hematopoietic stem/progenitor cells

    International Nuclear Information System (INIS)

    Yamaguchi, Masaru; Ebina, Satoko; Kashiwakura, Ikuo

    2013-01-01

    Arterial cord blood (CB) acid-base status and gas values, such as pH, PCO 2 , PO 2 , HCO 3 - and base excess, provide useful information on the fetal and neonatal condition. However, it remains unknown whether these values affect the radiosensitivity of fetal/neonatal hematopoiesis. The present study evaluated the relationship between arterial CB acid-base status, gas values, and the radiosensitivity of CB hematopoietic stem/progenitor cells (HSPCs). A total of 25 CB units were collected. The arterial CB acid-base status and gas values were measured within 30 min of delivery. The CD34 + HSPCs obtained from CB were exposed to 2 Gy X-irradiation, and then assayed for colony-forming unit-granulocyte-macrophage, burst-forming unit-erythroid (BFU-E), and colony-forming unit-granulocyte erythroid, macrophage and megakaryocyte cells. Acid-base status and gas values for PCO 2 and HCO 3 - showed a statistically significant negative correlation with the surviving fraction of BFU-E. In addition, a significant positive correlation was observed between gestational age and PCO 2 . Moreover, the surviving fraction of BFU-E showed a significant negative correlation with gestational age. Thus, HSPCs obtained from CB with high PCO 2 /HCO 3 - levels were sensitive to X-irradiation, which suggests that the status of arterial PCO 2 /HCO 3 - influences the radiosensitivity of fetal/neonatal hematopoiesis, especially erythropoiesis. (author)

  18. Fetal Echocardiography/Your Unborn Baby's Heart

    Science.gov (United States)

    ... Artery Disease Venous Thromboembolism Aortic Aneurysm More Fetal Echocardiography / Your Unborn Baby's Heart Updated:Oct 6,2016 ... Your Risk • Symptoms & Diagnosis Introduction Common Tests Fetal Echocardiography/Your Unborn Baby's Heart - Fetal Echocardiogram Test - Detection ...

  19. Fetal Alcohol Syndrome and Fetal Alcohol Effects in Child Development.

    Science.gov (United States)

    Pancratz, Diane R.

    This literature review defines Fetal Alcohol Syndrome (FAS) and Fetal Alcohol Effects (FAE) and considers their causes, diagnoses, prevalence, and educational ramifications. Effects of alcohol during each of the trimesters of pregnancy are summarized. Specific diagnostic characteristics of FAS are listed: (1) growth deficiency, (2) a…

  20. Molecular pathways of early CD105-positive erythroid cells as compared with CD34-positive common precursor cells by flow cytometric cell-sorting and gene expression profiling

    International Nuclear Information System (INIS)

    Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P

    2013-01-01

    Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository

  1. HEPATITIS ALOINMUNE FETAL

    Directory of Open Access Journals (Sweden)

    Fernando Álvarez C., Dr.

    2015-07-01

    Full Text Available La hepatitis aloinmune fetal, conocida anteriormente como hemocromatosis neonatal, ha demostrado en los últimos años ser una enfermedad completamente distinta a la hemocromatosis del adulto, tanto en su etiología como en su la fisiopatología. Este conocimiento abre nuevas perspectivas tanto en la prevención de la enfermedad en futuros embarazos, así como en el tratamiento con inmunoglobulina endovenosa en la madre durante el embarazo y eventualmente el tratamiento postnatal, en el que el trasplante de hígado juega un rol primordial.

  2. Impact of fetal echocardiography

    International Nuclear Information System (INIS)

    Simpson, John M

    2009-01-01

    Prenatal diagnosis of congenital heart disease is now well established for a wide range of cardiac anomalies. Diagnosis of congenital heart disease during fetal life not only identifies the cardiac lesion but may also lead to detection of associated abnormalities. This information allows a detailed discussion of the prognosis with parents. For continuing pregnancies, appropriate preparation can be made to optimize the postnatal outcome. Reduced morbidity and mortality, following antenatal diagnosis, has been reported for coarctation of the aorta, hypoplastic left heart syndrome, and transposition of the great arteries. With regard to screening policy, most affected fetuses are in the “low risk” population, emphasizing the importance of appropriate training for those who undertake such obstetric anomaly scans. As a minimum, the four chamber view of the fetal heart should be incorporated into midtrimester anomaly scans, and where feasible, views of the outflow tracts should also be included, to increase the diagnostic yield. Newer screening techniques, such as measurement of nuchal translucency, may contribute to identification of fetuses at high risk for congenital heart disease and prompt referral for detailed cardiac assessment

  3. MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B

    Directory of Open Access Journals (Sweden)

    Dongsheng Wang

    2018-03-01

    Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.

  4. MR evaluation of fetal demise

    International Nuclear Information System (INIS)

    Victoria, Teresa; Chauvin, Nancy Anne; Johnson, Ann M.; Kramer, Sandra Sue; Epelman, Monica; Capilla, Elena

    2011-01-01

    Fetal demise is an uncommon event encountered at MR imaging. When it occurs, recognition by the interpreting radiologist is important to initiate appropriate patient management. To identify MR findings of fetal demise. Following IRB approval, a retrospective search of the radiology fetal MR database was conducted searching the words ''fetal demise'' and ''fetal death.'' Fetuses with obvious maceration or no sonographic confirmation of death were excluded. Eleven cases formed the study group. These were matched randomly to live fetuses of similar gestational age. Images were reviewed independently by three pediatric radiologists. The deceased fetus demonstrates decreased MR soft-tissue contrast and definition of tissue planes, including loss of gray-white matter differentiation in the brain. The signal within the cardiac chambers, when visible, is bright on HASTE sequences from the stagnant blood; the heart is small. Pleural effusions and decreased lung volumes may be seen. Interestingly, the fetal orbits lose their anatomical round shape and become smaller and more elliptical; a dark, irregular rim resembling a mask may be seen. Although fetal demise is uncommonly encountered at MR imaging, radiologists should be aware of such imaging findings so prompt management can be instituted. (orig.)

  5. The glucocorticoid receptor cooperates with the erythropoietin receptor and c-Kit to enhance and sustain proliferation of erythroid progenitors in vitro

    NARCIS (Netherlands)

    von Lindern, M.; Zauner, W.; Mellitzer, G.; Steinlein, P.; Fritsch, G.; Huber, K.; Löwenberg, B.; Beug, H.

    1999-01-01

    Although erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormones cooperate with tyrosine kinase receptors

  6. Sustained enhancement of OCTN1 transporter expression in association with hydroxyurea induced gamma-globin expression in erythroid progenitors

    OpenAIRE

    Walker, Aisha L.; Ofori-Acquah, Solomon

    2016-01-01

    The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...

  7. Biosynthesis of heme in immature erythroid cells. The regulatory step for heme formation in the human erythron

    International Nuclear Information System (INIS)

    Gardner, L.C.; Cox, T.M.

    1988-01-01

    Heme formation in reticulocytes from rabbits and rodents is subject to end product negative feedback regulation: intracellular free heme has been shown to control acquisition of transferrin iron for heme synthesis. To identify the site of control of heme biosynthesis in the human erythron, immature erythroid cells were obtained from peripheral blood and aspirated bone marrow. After incubation with human 59Fe transferrin, 2-[14C]glycine, or 4-[14C]delta-aminolevulinate, isotopic incorporation into extracted heme was determined. Addition of cycloheximide to increase endogenous free heme, reduced incorporation of labeled glycine and iron but not delta-aminolevulinate into cell heme. Incorporation of glycine and iron was also sensitive to inhibition by exogenous hematin (Ki, 30 and 45 microM, respectively) i.e. at concentrations in the range which affect cell-free protein synthesis in reticulocyte lysates. Hematin treatment rapidly diminished incorporation of intracellular 59Fe into heme by human erythroid cells but assimilation of 4-[14C]delta-aminolevulinate into heme was insensitive to inhibition by hematin (Ki greater than 100 microM). In human reticulocytes (unlike those from rabbits), addition of ferric salicylaldehyde isonicotinoylhydrazone, to increase the pre-heme iron pool independently of the transferrin cycle, failed to promote heme synthesis or modify feedback inhibition induced by hematin. In human erythroid cells (but not rabbit reticulocytes) pre-incubation with unlabeled delta-aminolevulinate or protoporphyrin IX greatly stimulated utilization of cell 59Fe for heme synthesis and also attenuated end product inhibition. In human erythroid cells heme biosynthesis is thus primarily regulated by feedback inhibition at one or more steps which lead to delta-aminolevulinate formation

  8. Myelo-erythroid commitment after burn injury is under β-adrenergic control via MafB regulation.

    Science.gov (United States)

    Hasan, Shirin; Johnson, Nicholas B; Mosier, Michael J; Shankar, Ravi; Conrad, Peggie; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali

    2017-03-01

    Severely injured burn patients receive multiple blood transfusions for anemia of critical illness despite the adverse consequences. One limiting factor to consider alternate treatment strategies is the lack of a reliable test platform to study molecular mechanisms of impaired erythropoiesis. This study illustrates how conditions resulting in a high catecholamine microenvironment such as burns can instigate myelo-erythroid reprioritization influenced by β-adrenergic stimulation leading to anemia. In a mouse model of scald burn injury, we observed, along with a threefold increase in bone marrow LSK cells (lin neg Sca1 + cKit + ), that the myeloid shift is accompanied with a significant reduction in megakaryocyte erythrocyte progenitors (MEPs). β-Blocker administration (propranolol) for 6 days after burn, not only reduced the number of LSKs and MafB + cells in multipotent progenitors, but also influenced myelo-erythroid bifurcation by increasing the MEPs and reducing the granulocyte monocyte progenitors in the bone marrow of burn mice. Furthermore, similar results were observed in burn patients' peripheral blood mononuclear cell-derived ex vivo culture system, demonstrating that commitment stage of erythropoiesis is impaired in burn patients and intervention with propranolol (nonselective β1,2-adrenergic blocker) increases MEPs. Also, MafB + cells that were significantly increased following standard burn care could be mitigated when propranolol was administered to burn patients, establishing the mechanistic regulation of erythroid commitment by myeloid regulatory transcription factor MafB. Overall, results demonstrate that β-adrenergic blockers following burn injury can redirect the hematopoietic commitment toward erythroid lineage by lowering MafB expression in multipotent progenitors and be of potential therapeutic value to increase erythropoietin responsiveness in burn patients. Copyright © 2017 the American Physiological Society.

  9. 21 CFR 884.2900 - Fetal stethoscope.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Fetal stethoscope. 884.2900 Section 884.2900 Food... Fetal stethoscope. (a) Identification. A fetal stethoscope is a device used for listening to fetal heart... conventional stethoscopes. (b) Classification. Class I (general controls). The device is exempt from the...

  10. [Incidence of fetal macrosomia: maternal and fetal morbidity].

    Science.gov (United States)

    Rodríguez-Rojas, R R; Cantú-Esquivel, M G; Benavides-de la Garza, L; Benavides-de Anda, L

    1996-06-01

    The macrosomia is an obstetric eventuality associated to high maternal-fetal morbidity-mortality. This assay was planned in order to know the incidence of macrosomia in our institution, the relation between vaginal and abdominal deliveries and the fetal-maternal morbidity we reviewed 3590 records and we found 5.6% incidence of macrosomia in the global obstetric population. There was 58% of vaginal deliveries, 68% of the newborn were male. The main complications were in the C. sections, 2 laceration of the hysterectomy, and 2 peroperative atonias. In the vaginal deliveries, the lacerations of III and IV grade were 9 of each grade. The main fetal complications were 5 slight to severe asphyxia and 4 shoulder dystocias. This assay concludes that the macrosomia in our service is similar to the already published ones, a 42% were C. section and the maternal-fetal morbidity was low.

  11. Digital communication with fetal monitors.

    Science.gov (United States)

    Bozóki, Z

    1997-11-01

    Fetal heart rate (FHR) values in the averaged format that are provided by commercial computed cardiotocography analysis systems may be unsuitable for special analysis purposes. I developed a communication software program to obtain any measured values of fetal monitors for individual analysis of computed cardiotocography. The software program was used to study the data continuity of beat-to-beat FHR values as an experiment for chaos theory and power spectrum analysis. The results indicated that the signal loss was recognized at a precision of 95%. The described method of digital communication with fetal monitors was found to be useful for individual purposes in the field of computed cardiotocography analysis.

  12. Ultrasonographic determination of fetal gender

    International Nuclear Information System (INIS)

    Kim, Il Young; Kim, Dae Ho; Lee, Byung Ho; Bae, Dong Han

    1985-01-01

    Sonographic determination of fetal gender was attempted prospectively in most pregnancies of more than 26 weeks. We studied 193 cases of pregnancies with ultrasound for recent 9 months from June 1984 to February 1985 at department of radiology, Soonchunhyang university, Soonchunhyang Chunan hospital, and analysed ultrasonographic finding of fetal gender. The results were as follows; 1. Overall accuracy rate for fetal gender is 90%. 2. Accuracy rate for male fetus is 97.8%. 3. Accuracy rate for female fetus is 88.2%

  13. MRI of the fetal abdomen

    International Nuclear Information System (INIS)

    Hoermann, M.; Brugger, P.C.; Witzani, L.; Prayer, D.

    2006-01-01

    Magnetic resonance imaging (MRI) is an important diagnostic component for central nervous system and thoracic diseases during fetal development. Although ultrasound remains the method of choice for observing the fetus during pregnancy, fetal MRI is being increasingly used as an additional technique for the accurate diagnosis of abdominal diseases. Recent publications confirm the value of MRI in the diagnosis of fetal gastrointestinal tract and urogenital system diseases. The following report provides an overview of MRI-examination techniques for the most frequent diseases of the abdomen. (orig.) [de

  14. The Danish fetal medicine database

    DEFF Research Database (Denmark)

    Ekelund, Charlotte Kvist; Kopp, Tine Iskov; Tabor, Ann

    2016-01-01

    trimester ultrasound scan performed at all public hospitals in Denmark are registered in the database. Main variables/descriptive data: Data on maternal characteristics, ultrasonic, and biochemical variables are continuously sent from the fetal medicine units’Astraia databases to the central database via...... analyses are sent to the database. Conclusion: It has been possible to establish a fetal medicine database, which monitors first-trimester screening for chromosomal abnormalities and second-trimester screening for major fetal malformations with the input from already collected data. The database...

  15. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    OpenAIRE

    Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan

    2015-01-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...

  16. Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

    Science.gov (United States)

    Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

    2015-01-01

    Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

  17. FHL2 interacts with CALM and is highly expressed in acute erythroid leukemia

    International Nuclear Information System (INIS)

    Pašaliç, Z; Greif, P A; Jurinoviç, V; Mulaw, M; Kakadia, P M; Tizazu, B; Fröhlich-Archangelo, L; Krause, A; Bohlander, S K

    2011-01-01

    The t(10;11)(p13;q14) translocation results in the fusion of the CALM (clathrin assembly lymphoid myeloid leukemia protein) and AF10 genes. This translocation is observed in acute myeloblastic leukemia (AML M6), acute lymphoblastic leukemia (ALL) and malignant lymphoma. Using a yeast two-hybrid screen, the four and a half LIM domain protein 2 (FHL2) was identified as a CALM interacting protein. Recently, high expression of FHL2 in breast, gastric, colon, lung as well as in prostate cancer was shown to be associated with an adverse prognosis. The interaction between CALM and FHL2 was confirmed by glutathione S-transferase-pulldown assay and co-immunoprecipitation experiments. The FHL2 interaction domain of CALM was mapped to amino acids 294–335 of CALM. The transcriptional activation capacity of FHL2 was reduced by CALM, but not by CALM/AF10, which suggests that regulation of FHL2 by CALM might be disturbed in CALM/AF10-positive leukemia. Extremely high expression of FHL2 was seen in acute erythroid leukemia (AML M6). FHL2 was also highly expressed in chronic myeloid leukemia and in AML with complex aberrant karyotype. These results suggest that FHL2 may play an important role in leukemogenesis, especially in the case of AML M6

  18. Clinical implications from monitoring fetal activity.

    Science.gov (United States)

    Rayburn, W F

    1982-12-15

    The monitoring of fetal motion in high-risk pregnancies has been shown to be worthwhile in predicting fetal distress and impending fetal death. The maternal recording of perceived fetal activity is an inexpensive surveillance technique which is most useful when there is chronic uteroplacental insufficiency or when a stillbirth may be expected. The presence of an active, vigorous fetus is reassuring, but documented fetal inactivity required a reassessment of the underlying antepartum complication and further fetal evaluation with real-time ultrasonography, fetal heart rate testing, and biochemical testing. Fetal distress from such acute changes as abruptio placentae or umbilical cord compression may not be predicted by monitoring fetal motion. Although not used for routine clinical investigation, electromechanical devices such as tocodynamometry have provided much insight into fetal behavioral patterns at many stages of pregnancy and in pregnancies with an antepartum complication.

  19. Human primary erythroid cells as a more sensitive alternative in vitro hematological model for nanotoxicity studies: Toxicological effects of silver nanoparticles.

    Science.gov (United States)

    Rujanapun, Narawadee; Aueviriyavit, Sasitorn; Boonrungsiman, Suwimon; Rosena, Apiwan; Phummiratch, Duangkamol; Riolueang, Suchada; Chalaow, Nipon; Viprakasit, Vip; Maniratanachote, Rawiwan

    2015-12-01

    Although immortalized cells established from cancerous cells have been widely used for studies in nanotoxicology studies, the reliability of the results derived from immortalized cells has been questioned because of their different characteristics from normal cells. In the present study, human primary erythroid cells in liquid culture were used as an in vitro hematological cell model for investigation of the nanotoxicity of silver nanoparticles (AgNPs) and comparing the results to the immortalized hematological cell lines HL60 and K562. The AgNPs caused significant cytotoxic effects in the primary erythroid cells, as shown by the decreased cell viability and induction of intracellular ROS generation and apoptosis, whereas they showed much lower cytotoxic and apoptotic effects in HL60 and K562 cells and did not induced ROS generation in these cell lines. Scanning electron microcopy revealed an interaction of AgNPs to the cell membrane in both primary erythroid and immortalized cells. In addition, AgNPs induced hemolysis in the primary erythroid cells in a dose-dependent manner, and transmission electron microcopy analysis revealed that AgNPs damaged the erythroid cell membrane. Taken together, these results suggest that human primary erythroid cells in liquid culture are a more sensitive alternative in vitro hematological model for nanotoxicology studies. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. The first trimester human placenta is a site for terminal maturation of primitive erythroid cells

    OpenAIRE

    Van Handel, Ben; Prashad, Sacha L.; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I.; Mikkola, Hanna K. A.

    2010-01-01

    Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in fir...

  1. Fetal MRI: techniques and protocols

    International Nuclear Information System (INIS)

    Prayer, Daniela; Brugger, Peter Christian; Prayer, Lucas

    2004-01-01

    The development of ultrafast sequences has led to a significant improvement in fetal MRI. Imaging protocols have to be adjusted to the rapidly developing fetal central nervous system (CNS) and to the clinical question. Sequence parameters must be changed to cope with the respective developmental stage, to produce images free from motion artefacts and to provide optimum visualization of the region and focus of interest. In contrast to postnatal studies, every suspect fetal CNS abnormality requires examination of the whole fetus and the extrafetal intrauterine structures including the uterus. This approach covers both aspects of fetal CNS disorders: isolated and complex malformations and cerebral lesions arising from the impaired integrity of the feto-placental unit. (orig.)

  2. Fetal programming of renal function.

    Science.gov (United States)

    Dötsch, Jörg; Plank, Christian; Amann, Kerstin

    2012-04-01

    Results from large epidemiological studies suggest a clear relation between low birth weight and adverse renal outcome evident as early as during childhood. Such adverse outcomes may include glomerular disease, hypertension, and renal failure and contribute to a phenomenon called fetal programming. Other factors potentially leading to an adverse renal outcome following fetal programming are maternal diabetes mellitus, smoking, salt overload, and use of glucocorticoids during pregnancy. However, clinical data on the latter are scarce. Here, we discuss potential underlying mechanisms of fetal programming, including reduced nephron number via diminished nephrogenesis and other renal (e.g., via the intrarenal renin-angiotensin-aldosterone system) and non-renal (e.g., changes in endothelial function) alterations. It appears likely that the outcomes of fetal programming may be influenced or modified postnatally, for example, by the amount of nutrients given at critical times.

  3. Fetal MRI: techniques and protocols

    Energy Technology Data Exchange (ETDEWEB)

    Prayer, Daniela [Department of Neuroradiology, University Clinics of Radiodiagnostics, Medical University Vienna, Waehringerguertel 18-10, 1090, Vienna (Austria); Brugger, Peter Christian [Department of Anatomy, Integrative Morphology Group, Medical University Vienna (Austria); Prayer, Lucas [Diagnosezentrum Urania, Vienna (Austria)

    2004-09-01

    The development of ultrafast sequences has led to a significant improvement in fetal MRI. Imaging protocols have to be adjusted to the rapidly developing fetal central nervous system (CNS) and to the clinical question. Sequence parameters must be changed to cope with the respective developmental stage, to produce images free from motion artefacts and to provide optimum visualization of the region and focus of interest. In contrast to postnatal studies, every suspect fetal CNS abnormality requires examination of the whole fetus and the extrafetal intrauterine structures including the uterus. This approach covers both aspects of fetal CNS disorders: isolated and complex malformations and cerebral lesions arising from the impaired integrity of the feto-placental unit. (orig.)

  4. Analysis of fetal movements by Doppler actocardiogram and fetal B-mode imaging.

    Science.gov (United States)

    Maeda, K; Tatsumura, M; Utsu, M

    1999-12-01

    We have presented that fetal surveillance may be enhanced by use of the fetal actocardiogram and by computerized processing of fetal motion as well as fetal B-mode ultrasound imaging. Ultrasonic Doppler fetal actogram is a sensitive and objective method for detecting and recording fetal movements. Computer processing of the actograph output signals enables powerful, detailed, and convenient analysis of fetal physiologic phenomena. The actocardiogram is a useful measurement tool not only in fetal behavioral studies but also in evaluation of fetal well-being. It reduces false-positive, nonreactive NST and false-positive sinusoidal FHR pattern. It is a valuable tool to predict fetal distress. The results of intrapartum fetal monitoring are further improved by the antepartum application of the actocardiogram. Quantified fetal motion analysis is a useful, objective evaluation of the embryo and fetus. This method allows monitoring of changes in fetal movement, as well as frequency, amplitude, and duration. Furthermore, quantification of fetal motion enables evaluation of fetal behavior states and how these states relate to other measurements, such as changes in FHR. Numeric analysis of both fetal actogram and fetal motion from B-mode images is a promising application in the correlation of fetal activity or behavior with other fetal physiologic measurements.

  5. Prenatal diagnosis of fetal syndromes

    International Nuclear Information System (INIS)

    Murthy, BS Rama

    2008-01-01

    A syndrome is a pattern of multiple anomalies arising due to a single known causative factor. Ultrasonography has enabled us to recognize many fetal anomalies and dysmorphic features. Recognition of the anomaly pattern leads to the diagnosis of a particular syndrome. This enables us to counsel prospective parents and aids in management. We present a selection of fetal syndromes in the form of a pictorial essay

  6. IL-27 induces a pro-inflammatory response in human fetal membranes mediating preterm birth.

    Science.gov (United States)

    Yin, Nanlin; Wang, Hanbing; Zhang, Hua; Ge, Huisheng; Tan, Bing; Yuan, Yu; Luo, Xiaofang; Olson, David M; Baker, Philip N; Qi, Hongbo

    2017-09-01

    Inflammation at the maternal-fetal interface has been shown to be involved in the pathogenesis of preterm birth. Interleukin 27 (IL-27), a heterodimeric cytokine, is known to mediate an inflammatory response in some pregnancy complications. In this study, we aimed to determine whether IL-27 could induce an inflammatory reaction at the maternal-fetal interface that would mediate the onset of preterm birth. We found elevated expression of IL-27 in human peripheral serum and elevated expression of its specific receptor (wsx-1) on fetal membranes in cases of preterm birth. Moreover, the release of inflammatory markers (CXCL10, IFN-γ, MCP-1, IL-6, IL-1β and TNF-α), especially CXCL10, was markedly augmented upon stimulation of IL-27 in the fetal membranes. Additionally, IL-27 and IFN-γ cooperated to amplify the expression of CXCL10 in the fetal membranes. Moreover, the production of CXCL10 was increased in IL-27-treated fetal membrane through JNK, PI3K or Erk signaling pathways. Finally, MMP2 and MMP9 were activated by IL-27 in human fetal membranes, which may be related to the onset of preterm premature rupture of membranes (pPROM). In conclusion, for the first time, we reported that the aberrant expression of IL-27 could mediate an excessive inflammatory response in fetal membranes through the JNK, PI3K or Erk signaling pathways, which contributes to preterm birth. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Epigenetic regulation and fetal programming.

    Science.gov (United States)

    Gicquel, Christine; El-Osta, Assam; Le Bouc, Yves

    2008-02-01

    Fetal programming encompasses the role of developmental plasticity in response to environmental and nutritional signals during early life and its potential adverse consequences (risk of cardiovascular, metabolic and behavioural diseases) in later life. The first studies in this field highlighted an association between poor fetal growth and chronic adult diseases. However, environmental signals during early life may lead to adverse long-term effects independently of obvious effects on fetal growth. Adverse long-term effects reflect a mismatch between early (fetal and neonatal) environmental conditions and the conditions that the individual will confront later in life. The mechanisms underlying this risk remain unclear. However, experimental data in rodents and recent observations in humans suggest that epigenetic changes in regulatory genes and growth-related genes play a significant role in fetal programming. Improvements in our understanding of the biochemical and molecular mechanisms at play in fetal programming would make it possible to identify biomarkers for detecting infants at high risk of adult-onset diseases. Such improvements should also lead to the development of preventive and therapeutic strategies.

  8. Fetal programming of children's obesity risk.

    Science.gov (United States)

    Stout, Stephanie A; Espel, Emma V; Sandman, Curt A; Glynn, Laura M; Davis, Elysia Poggi

    2015-03-01

    Childhood obesity affects nearly 17% of children and adolescents in the United States. Increasing evidence indicates that prenatal maternal stress signals influence fetal growth, child obesity, and metabolic risk. Children exhibiting catch-up growth, a rapid and dramatic increase in body size, within the first two years of life are also at an increased risk for developing metabolic disorder and obesity. We evaluate the potential role of the maternal hypothalamic-pituitary-adrenal (HPA) and placental axis in programming risk for child obesity. This prospective longitudinal study measured placental corticotropin-releasing hormone (pCRH) and maternal plasma cortisol at 15, 19, 25, 30, and 37 gestational weeks and collected child body mass index (BMI) at birth, 3, 6, 12, and 24 months. Participants included 246 mothers and their healthy children born full term. Each child's BMI percentile (BMIP) was determined using World Health Organization (WHO) standards based on age and sex. Child BMIP profiles from birth to two years of age were characterized using general growth mixture modeling (GGMM). We evaluated whether fetal exposure to placental CRH and maternal cortisol are associated with BMIP profiles. Placental CRH at 30 gestational weeks was highly associated with both BMIP (pfetal programming of obesity risk. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Constitutive protein secretion from the exocrine pancreas of fetal rats

    International Nuclear Information System (INIS)

    Arvan, P.; Chang, A.

    1987-01-01

    Two general kinds of exocytotic secretion of proteins are known: that which is stimulated by secretagogues; and constitutive exocytosis, which is unable to be stimulated. The exocrine pancreas has often been cited as a model system for the first kind of secretion. However, the release of digestive enzymes from the exocrine pancreas of 1-day prenatal rats cannot be stimulated by secretagogues; therefore, its secretion is constitutive. To gain insight into the intracellular pathways which mediate secretion in the fetal gland, we examined the kinetics of release of newly synthesized proteins. We find that fetal pancreas in a steady state of secretion releases pulse-labeled secretory proteins in two kinetically distinct phases. The first phase occurring during 0-6.5 h of chase comprises approximately 12% of total incorporated radioactivity, the second phase beginning at greater than 7 h of chase comprises the remainder. Based on analysis by electron microscope autoradiography, radiolabel is localized during the first phase of secretion in immature granules/condensing vacuoles, Golgi compartments, and few mature granules. The second phase of secretion occurs when radiolabel is predominantly in mature granules. We propose that secretion occurs via (at least) 2 exocytotic routes, both of which are constitutive in fetal pancreatic tissue

  10. Average fetal depth in utero: data for estimation of fetal absorbed radiation dose

    International Nuclear Information System (INIS)

    Ragozzino, M.W.; Breckle, R.; Hill, L.M.; Gray, J.E.

    1986-01-01

    To estimate fetal absorbed dose from radiographic examinations, the depth from the anterior maternal surface to the midline of the fetal skull and abdomen was measured by ultrasound in 97 pregnant women. The relationships between fetal depth, fetal presentation, and maternal parameters of height, weight, anteroposterior (AP) thickness, gestational age, placental location, and bladder volume were analyzed. Maternal AP thickness (MAP) can be estimated from gestational age, maternal height, and maternal weight. Fetal midskull and abdominal depths were nearly equal. Fetal depth normalized to MAP was independent or nearly independent of maternal parameters and fetal presentation. These data enable a reasonable estimation of absorbed dose to fetal brain, abdomen, and whole body

  11. Antioxidant mechanism of black garlic extract involving nuclear factor erythroid 2-like factor 2 pathway.

    Science.gov (United States)

    Ha, Ae Wha; Kim, Woo Kyoung

    2017-06-01

    Although studies have revealed that black garlic is a potent antioxidant, its antioxidant mechanism remains unclear. The objective of this study was to determine black garlic's antioxidant activities and possible antioxidant mechanisms related to nuclear factor erythroid 2-like factor 2 (Nrf2)-Keap1 complex. After four weeks of feeding rats with a normal fat diet (NF), a high-fat diet (HF), a high-fat diet with 0.5% black garlic extract (HF+BGE 0.5), a high-fat diet with 1.0% black garlic extract (HF+BGE 1.0), or a high-fat diet with 1.5% black garlic extract (HF+BGE 1.5), plasma concentrations of glucose, insulin,homeostatic model assessment of insulin resistance (HOMA-IR) were determined. As oxidative stress indices, plasma concentrations of thiobarbituric acid reactive substances (TBARS) and 8-isoprostaglandin F2α (8-iso-PGF) were determined. To measure antioxidant capacities, plasma total antioxidant capacity (TAC) and activities of antioxidant enzymes in plasma and liver were determined. The mRNA expression levels of antioxidant related proteins such as Nrf2, NAD(P)H: quinone-oxidoreductase-1 (NQO1), heme oxygenase-1 (HO-1), glutathione reductase (GR), and glutathione S-transferase alpha 2 (GSTA2) were examined. Plasma glucose level, plasma insulin level, and HOMA-IR in black garlic supplemented groups were significantly ( P concentration and TAC in the HF+BGE 1.5 group were significantly decreased compared to those of the HF group. The activities of catalase and glutathione peroxidase were significantly ( P antioxidant systems in rats fed with black garlic extract were related to mRNA expression levels of Nrf2 related genes.

  12. No changes in heme synthesis in human Friedreich´s ataxia erythroid progenitor cells.

    Science.gov (United States)

    Steinkellner, Hannes; Singh, Himanshu Narayan; Muckenthaler, Martina U; Goldenberg, Hans; Moganty, Rajeswari R; Scheiber-Mojdehkar, Barbara; Sturm, Brigitte

    2017-07-20

    Friedreich's ataxia (FRDA) is a neurodegenerative disease caused by reduced expression of the protein frataxin. Frataxin is thought to play a role in iron-sulfur cluster biogenesis and heme synthesis. In this study, we used erythroid progenitor stem cells obtained from FRDA patients and healthy donors to investigate the putative role, if any, of frataxin deficiency in heme synthesis. We used electrochemiluminescence and qRT-PCR for frataxin protein and mRNA quantification. We used atomic absorption spectrophotometry for iron levels and a photometric assay for hemoglobin levels. Protoporphyrin IX and Ferrochelatase were analyzed using auto-fluorescence. An "IronChip" microarray analysis followed by a protein-protein interaction analysis was performed. FRDA patient cells showed no significant changes in iron levels, hemoglobin synthesis, protoporphyrin IX levels, and ferrochelatase activity. Microarray analysis presented 11 genes that were significantly changed in all patients compared to controls. The genes are especially involved in oxidative stress, iron homeostasis and angiogenesis. The mystery about the involvement of frataxin on iron metabolism raises the question why frataxin deficiency in primary FRDA cells did not lead to changes in biochemical parameters of heme synthesis. It seems that alternative pathways can circumvent the impact of frataxin deficiency on heme synthesis. We show for the first time in primary FRDA patient cells that reduced frataxin levels are still sufficient for heme synthesis and possibly other mechanisms can overcome reduced frataxin levels in this process. Our data strongly support the fact that so far no anemia in FRDA patients was reported. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. The Danish Fetal Medicine Database

    Directory of Open Access Journals (Sweden)

    Ekelund CK

    2016-10-01

    Full Text Available Charlotte Kvist Ekelund,1 Tine Iskov Kopp,2 Ann Tabor,1 Olav Bjørn Petersen3 1Department of Obstetrics, Center of Fetal Medicine, Rigshospitalet, University of Copenhagen, Copenhagen, Denmark; 2Registry Support Centre (East – Epidemiology and Biostatistics, Research Centre for Prevention and Health, Glostrup, Denmark; 3Fetal Medicine Unit, Aarhus University Hospital, Aarhus Nord, Denmark Aim: The aim of this study is to set up a database in order to monitor the detection rates and false-positive rates of first-trimester screening for chromosomal abnormalities and prenatal detection rates of fetal malformations in Denmark. Study population: Pregnant women with a first or second trimester ultrasound scan performed at all public hospitals in Denmark are registered in the database. Main variables/descriptive data: Data on maternal characteristics, ultrasonic, and biochemical variables are continuously sent from the fetal medicine units' Astraia databases to the central database via web service. Information about outcome of pregnancy (miscarriage, termination, live birth, or stillbirth is received from the National Patient Register and National Birth Register and linked via the Danish unique personal registration number. Furthermore, results of all pre- and postnatal chromosome analyses are sent to the database. Conclusion: It has been possible to establish a fetal medicine database, which monitors first-trimester screening for chromosomal abnormalities and second-trimester screening for major fetal malformations with the input from already collected data. The database is valuable to assess the performance at a regional level and to compare Danish performance with international results at a national level. Keywords: prenatal screening, nuchal translucency, fetal malformations, chromosomal abnormalities

  14. Fetal electrocardiogram (ECG) for fetal monitoring during labour.

    Science.gov (United States)

    Neilson, James P

    2015-12-21

    Hypoxaemia during labour can alter the shape of the fetal electrocardiogram (ECG) waveform, notably the relation of the PR to RR intervals, and elevation or depression of the ST segment. Technical systems have therefore been developed to monitor the fetal ECG during labour as an adjunct to continuous electronic fetal heart rate monitoring with the aim of improving fetal outcome and minimising unnecessary obstetric interference. To compare the effects of analysis of fetal ECG waveforms during labour with alternative methods of fetal monitoring. The Cochrane Pregnancy and Childbirth Group's Trials Register (latest search 23 September 2015) and reference lists of retrieved studies. Randomised trials comparing fetal ECG waveform analysis with alternative methods of fetal monitoring during labour. One review author independently assessed trials for inclusion and risk of bias, extracted data and checked them for accuracy. One review author assessed the quality of the evidence using the GRADE approach. Seven trials (27,403 women) were included: six trials of ST waveform analysis (26,446 women) and one trial of PR interval analysis (957 women). The trials were generally at low risk of bias for most domains and the quality of evidence for ST waveform analysis trials was graded moderate to high. In comparison to continuous electronic fetal heart rate monitoring alone, the use of adjunctive ST waveform analysis made no obvious difference to primary outcomes: births by caesarean section (risk ratio (RR) 1.02, 95% confidence interval (CI) 0.96 to 1.08; six trials, 26,446 women; high quality evidence); the number of babies with severe metabolic acidosis at birth (cord arterial pH less than 7.05 and base deficit greater than 12 mmol/L) (average RR 0.72, 95% CI 0.43 to 1.20; six trials, 25,682 babies; moderate quality evidence); or babies with neonatal encephalopathy (RR 0.61, 95% CI 0.30 to 1.22; six trials, 26,410 babies; high quality evidence). There were, however, on average

  15. Fetal Programming and Cardiovascular Pathology

    Science.gov (United States)

    Alexander, Barbara T.; Dasinger, John Henry; Intapad, Suttira

    2016-01-01

    Low birth weight serves as a crude proxy for impaired growth during fetal life and indicates a failure for the fetus to achieve its full growth potential. Low birth weight can occur in response to numerous etiologies that include complications during pregnancy, poor prenatal care, parental smoking, maternal alcohol consumption or stress. Numerous epidemiological and experimental studies demonstrate that birth weight is inversely associated with blood pressure and coronary heart disease. Sex and age impact the developmental programming of hypertension. In addition, impaired growth during fetal life also programs enhanced vulnerability to a secondary insult. Macrosomia, which occurs in response to maternal obesity, diabetes and excessive weight gain during gestation, is also associated with increased cardiovascular risk. Yet, the exact mechanisms that permanently change the structure, physiology and endocrine health of an individual across their lifespan following altered growth during fetal life are not entirely clear. Transmission of increased risk from one generation to the next in the absence of an additional prenatal insult indicates an important role for epigenetic processes. Experimental studies also indicate that the sympathetic nervous system, the renin angiotensin system, increased production of oxidative stress and increased endothelin play an important role in the developmental programming of blood pressure in later life. Thus, this review will highlight how adverse influences during fetal life and early development program an increased risk for cardiovascular disease including high blood pressure and provide an overview of the underlying mechanisms that contribute to the fetal origins of cardiovascular pathology. PMID:25880521

  16. Fetal programming and cardiovascular pathology.

    Science.gov (United States)

    Alexander, Barbara T; Dasinger, John Henry; Intapad, Suttira

    2015-04-01

    Low birth weight serves as a crude proxy for impaired growth during fetal life and indicates a failure for the fetus to achieve its full growth potential. Low birth weight can occur in response to numerous etiologies that include complications during pregnancy, poor prenatal care, parental smoking, maternal alcohol consumption, or stress. Numerous epidemiological and experimental studies demonstrate that birth weight is inversely associated with blood pressure and coronary heart disease. Sex and age impact the developmental programming of hypertension. In addition, impaired growth during fetal life also programs enhanced vulnerability to a secondary insult. Macrosomia, which occurs in response to maternal obesity, diabetes, and excessive weight gain during gestation, is also associated with increased cardiovascular risk. Yet, the exact mechanisms that permanently change the structure, physiology, and endocrine health of an individual across their lifespan following altered growth during fetal life are not entirely clear. Transmission of increased risk from one generation to the next in the absence of an additional prenatal insult indicates an important role for epigenetic processes. Experimental studies also indicate that the sympathetic nervous system, the renin angiotensin system, increased production of oxidative stress, and increased endothelin play an important role in the developmental programming of blood pressure in later life. Thus, this review will highlight how adverse influences during fetal life and early development program an increased risk for cardiovascular disease including high blood pressure and provide an overview of the underlying mechanisms that contribute to the fetal origins of cardiovascular pathology. © 2015 American Physiological Society.

  17. Comparative Analysis of the Hematopoietic Progenitor Cells from Placenta, Cord Blood, and Fetal Liver, Based on Their Immunophenotype

    Directory of Open Access Journals (Sweden)

    Maria D. Kuchma

    2015-01-01

    Full Text Available We have investigated the characteristics of human hematopoietic progenitor cells (HPCs with the CD34+CD45lowSSClow phenotype from full-term placental tissue (FTPT as compared to cord blood (CB and fetal liver (FL cells. We demonstrated the presence of cell subpopulations at various stages of the differentiation with such immunophenotypes as CD34+/lowCD45low/-, CD34++CD45low/-, CD34+++CD45low/-, CD34+/lowCD45hi, and CD34++CD45hi in both first trimester placental tissue (FiTPT and FTPT which implies their higher phenotypic heterogeneity compared to CB. HPCs of the FTPT origin expressed the CD90 antigen at a higher level compared to its expression by the CB HPCs and the CD133 antigen expression being at the same level in both cases. The HPCs compartment of FTPT versus CB contained higher number of myeloid and erythroid committed cells but lower number of myeloid and lymphoid ones compared to FL HPCs. HPCs of the FTPT and CB origin possess similar potentials for the multilineage differentiation in vitro and similar ratios of myeloid and erythroid progenitors among the committed cells. This observation suggests that the active hematopoiesis occurs in the FTPT. We obtained viable HPCs from cryopreserved placental tissue fragments allowing us to develop procedures for banking and testing of placenta-derived HPCs for clinical use.

  18. PI3 kinase is important for Ras, MEK and Erk activation of Epo-stimulated human erythroid progenitors

    Directory of Open Access Journals (Sweden)

    Schmidt Enrico K

    2004-05-01

    Full Text Available Abstract Background Erythropoietin is a multifunctional cytokine which regulates the number of erythrocytes circulating in mammalian blood. This is crucial in order to maintain an appropriate oxygen supply throughout the body. Stimulation of primary human erythroid progenitors (PEPs with erythropoietin (Epo leads to the activation of the mitogenic kinases (MEKs and Erks. How this is accomplished mechanistically remained unclear. Results Biochemical studies with human cord blood-derived PEPs now show that Ras and the class Ib enzyme of the phosphatidylinositol-3 kinase (PI3K family, PI3K gamma, are activated in response to minimal Epo concentrations. Surprisingly, three structurally different PI3K inhibitors block Ras, MEK and Erk activation in PEPs by Epo. Furthermore, Erk activation in PEPs is insensitive to the inhibition of Raf kinases but suppressed upon PKC inhibition. In contrast, Erk activation induced by stem cell factor, which activates c-Kit in the same cells, is sensitive to Raf inhibition and insensitive to PI3K and PKC inhibitors. Conclusions These unexpected findings contrast with previous results in human primary cells using Epo at supraphysiological concentrations and open new doors to eventually understanding how low Epo concentrations mediate the moderate proliferation of erythroid progenitors under homeostatic blood oxygen levels. They indicate that the basal activation of MEKs and Erks in PEPs by minimal concentrations of Epo does not occur through the classical cascade Shc/Grb2/Sos/Ras/Raf/MEK/Erk. Instead, MEKs and Erks are signal mediators of PI3K, probably the recently described PI3K gamma, through a Raf-independent signaling pathway which requires PKC activity. It is likely that higher concentrations of Epo that are induced by hypoxia, for example, following blood loss, lead to additional mitogenic signals which greatly accelerate erythroid progenitor proliferation.

  19. [Fetal version as ambulatory intervention].

    Science.gov (United States)

    Nohe, G; Hartmann, W; Klapproth, C E

    1996-06-01

    The external cephalic version (ECV) of the fetus at term reduces the maternal and fetal risks of intrapartum breech presentation and Caesarean delivery. Since 1986 over 800 external cephalic versions were performed in the outpatient Department of Obstetrics and Gynaecology of the Städtische Frauenklinik Stuttgart. 60.5% were successful. NO severe complications occurred. Sufficient amniotic fluid as well as the mobility of the fetal breech is a major criterion for the success of the ECV. Management requires a safe technique for mother and fetus. This includes ultrasonography, elektronic fetal monitoring and the ability to perform immediate caesarean delivery as well as the performance of ECV without analgesicas and sedatives. More than 70% of the ECV were successful without tocolysis. In unsuccessful cases the additional use of tocolysis improves the success rate only slightly. Therefore routine use of tocolysis does not appear necessary. External cephalic version can be recommended as an outpatient treatment without tocolysis.

  20. The Danish Fetal Medicine Database

    DEFF Research Database (Denmark)

    Ekelund, Charlotte K; Petersen, Olav B; Jørgensen, Finn S

    2015-01-01

    OBJECTIVE: To describe the establishment and organization of the Danish Fetal Medicine Database and to report national results of first-trimester combined screening for trisomy 21 in the 5-year period 2008-2012. DESIGN: National register study using prospectively collected first-trimester screening...... data from the Danish Fetal Medicine Database. POPULATION: Pregnant women in Denmark undergoing first-trimester screening for trisomy 21. METHODS: Data on maternal characteristics, biochemical and ultrasonic markers are continuously sent electronically from local fetal medicine databases (Astraia Gmbh...... software) to a central national database. Data are linked to outcome data from the National Birth Register, the National Patient Register and the National Cytogenetic Register via the mother's unique personal registration number. First-trimester screening data from 2008 to 2012 were retrieved. MAIN OUTCOME...

  1. Fetal exposure in diagnostic radiology

    International Nuclear Information System (INIS)

    Baker, M.L.; Vandergrift, J.F.; Dalrymple, G.V.

    1979-01-01

    The problem of possible radiation damage to the fetus or embryo as a result of diagnostic radiography during pregnancy, particularly in the early stages, is discussed. Recommendations of therapeutic abortion after fetal exposure require an adequate knowledge of the doses involved. In the absence of actual dose measurements or estimates, approximate exposure levels may be determined from the literature. A summary of published values for radiography involving the lower abdomen is given. Data is also presented from a series of fetal exposures resulting mostly from routine diagnostic radiography when pregnancy was not known at the time but was established later. Results of actual dose measurements using a phantom and of dose calculations based on published values are in reasonable agreement indicating that literature values of dose provide a satisfactory alternative to measurement. These data suggest that diagnostic radiography rarely, if ever, results in fetal exposures high enough to justify therapeutic abortion. (author)

  2. Fetal Heart Rate Monitoring during Labor

    Science.gov (United States)

    ... What are the types of monitoring? • How is auscultation performed? • How is electronic fetal monitoring performed? • How ... methods of fetal heart rate monitoring in labor. Auscultation is a method of periodically listening to the ...

  3. Births and deaths including fetal deaths

    Data.gov (United States)

    U.S. Department of Health & Human Services — Access to a variety of United States birth and death files including fetal deaths: Birth Files, 1968-2009; 1995-2005; Fetal death file, 1982-2005; Mortality files,...

  4. Fetal scalp blood sampling during labor

    DEFF Research Database (Denmark)

    Chandraharan, Edwin; Wiberg, Nana

    2014-01-01

    Fetal cardiotocography is characterized by low specificity; therefore, in an attempt to ensure fetal well-being, fetal scalp blood sampling has been recommended by most obstetric societies in the case of a non-reassuring cardiotocography. The scientific agreement on the evidence for using fetal...... scalp blood sampling to decrease the rate of operative delivery for fetal distress is ambiguous. Based on the same studies, a Cochrane review states that fetal scalp blood sampling increases the rate of instrumental delivery while decreasing neonatal acidosis, whereas the National Institute of Health...... and Clinical Excellence guideline considers that fetal scalp blood sampling decreases instrumental delivery without differences in other outcome variables. The fetal scalp is supplied by vessels outside the skull below the level of the cranial vault, which is likely to be compressed during contractions...

  5. Identification of a human erythroid progenitor cell population which expresses the CD34 antigen and binds the plant lectin Ulex europaeus I.

    Science.gov (United States)

    Unverzagt, K L; Martinson, J; Lee, W; Stiff, P J; Williams, S; Bender, J G

    1996-01-01

    Two and three color flow cytometry of normal human bone marrow was used to identify CD34+ progenitor cells and examine their binding to the plant lectin Ulex europaeus I (Ulex). In normal bone marrow, 48.48 +/- 17.4% of the CD34+ cells bind to Ulex. Two color flow cytometry was used to sort CD34 + cells, and subsets of CD34+ cells, CD34+ Ulex+ and CD34+ Ulex-. These populations were sorted into colony assays to assess myeloid (CFU-GM) and erythroid (BFU-E) progenitors. The CD34+ Ulex+ subset was 84 +/- 14% BFU-E colonies (mean +/- S.D.) and had the highest cloning efficiency of 28 +/- 13%. Three color analysis of CD34+ Ulex+ cells showed staining with other erythroid (CD71, GlyA) antibodies and lack of stain. ing with myeloid (CD13, CD45RA) antibodies. These studies confirmed the erythroid characteristics of this subpopulation.

  6. Fetal Alcohol Syndrome "Chemical Genocide."

    Science.gov (United States)

    Asetoyer, Charon

    In the Northern Plains of the United States, 100% of Indian reservations are affected by alcohol related problems. Approximately 90% of Native American adults are currently alcohol users or abusers or are recovering from alcohol abuse. Alcohol consumption has a devastating effect on the unborn. Fetal Alcohol Syndrome (FAS) is an irreversible birth…

  7. Fetal programming and environmental exposures ...

    Science.gov (United States)

    Fetal programming is an enormously complex process that relies on numerous environmental inputs from uterine tissue, the placenta, the maternal blood supply, and other sources. Recent evidence has made clear that the process is not based entirely on genetics, but rather on a delicate series of interactions between genes and the environment. It is likely that epigenctic (“above the genome”) changes are responsible for modifying gene expression in the developing fetus, and these modifications can have long-lasting health impacts. Determining which epigenetic regulators are most vital in embryonic development will improve pregnancy outcomes and our ability to treat and prevent disorders that emerge later in life. “Fetal Programming and Environmental Exposures: Implications for Prenatal Care and Preterm Birth’ began with a keynote address by Frederick vom Saal, who explained that low-level exposure to endocrine disrupting chemicals (EDCs) perturbs hormone systems in utero and can have negative effects on fetal development. vom Saal presented data on the LOC bisphenol A (BPA), an estrogen-mimicking compound found in many plastics. He suggested that low-dose exposure to LOCs can alter the development process and enhance chances of acquiring adult diseases, such as breastcancer, diabetes, and even developmental disorders such as attention deficit disorder (ADHD).’ Fetal programming is an enormously complex process that relies on numerous environmental inputs

  8. Fetal programming of neuropsychiatric disorders.

    Science.gov (United States)

    Faa, Gavino; Manchia, Mirko; Pintus, Roberta; Gerosa, Clara; Marcialis, Maria Antonietta; Fanos, Vassilios

    2016-09-01

    Starting from the Developmental Origins of Health and Disease (DOHaD) hypotheses proposed by David Barker, namely fetal programming, in the past years, there is a growing evidence of the major role played by epigenetic factors during the intrauterine life and the perinatal period. Furthermore, it has been assessed that these factors can affect the health status in infancy and even in adulthood. In this review, we focus our attention on the fetal programming of the brain, analyzing the most recent literature concerning the epigenetic factors that can influence the development of neuropsychiatric disorders such as bipolar disorders, major depressive disorders, and schizophrenia. The perinatal epigenetic factors have been divided in two main groups: maternal factors and fetal factors. The maternal factors include diet, smoking, alcoholism, hypertension, malnutrition, trace elements, stress, diabetes, substance abuse, and exposure to environmental toxicants, while the fetal factors include hypoxia/asphyxia, placental insufficiency, prematurity, low birth weight, drugs administered to the mother or to the baby, and all factors causing intrauterine growth restriction. A better comprehension of the possible mechanisms underlying the pathogenesis of these diseases may help researchers and clinicians develop new diagnostic tools and treatments to offer these patients a tailored medical treatment strategy to improve their quality of life. Birth Defects Research (Part C) 108:207-223, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  9. Role of the mitochondrial amino acid pool in the differential sensitivity of erythroid and myeloid cells to chloramphenicol

    International Nuclear Information System (INIS)

    Abou-Khalil, S.; Abou-Khalil, W.H.; Whitney, P.L.; Yunis, A.A.

    1986-01-01

    Previous studies in the authors laboratory have suggested that mitochondrial amino acid (AA) pool is involved in the differential sensitivity of erythroid and myeloid cells to chloramphenicol (CAP). The present study examines the role of AA pool by analysis of its composition and testing the effects of its major components. The endogenous AA composition of isolated mitochondria protein was determined using a JEOL 5AH AA analyzer. L-( 14 C) leucine incorporation into mitochondrial protein was used to measure the rate of protein synthesis. Analysis of the endogenous pool in erythroleukemia (EM) and chloroleukemia (CM) mitochrondria showed similar total amount of AAs. However, some AAs were present in significantly higher or lower quantity within EM and CM (i.e. EM had about 2-fold higher glycine content). When compensating for each low AA addition of that particular acid to the reaction medium, only glycine and serine had significant effect. Thus, the addition of increasing concentrations of glycine or serine enhanced the sensitivity to CAP from 14% to 49-51% in CM but not in EM. Other AAs gave little or no effect. Since glycine is one of the first reactants in heme biosynthesis within mitochondria and is interconvertible with serine, it would appear that erythroid cells sensitivity to CAP is determined by the mitochondrial glycine-serine pool and may be somehow related of the pathway to heme biosynthesis in these cells

  10. Fetal magnetic resonance imaging and human genetics

    International Nuclear Information System (INIS)

    Hengstschlaeger, Markus

    2006-01-01

    The use of fetal magnetic resonance imaging (MRI), in addition to prenatal genetic testing and sonography, has the potential to improve prenatal diagnosis of genetic disorders. MRI plays an important role in the evaluation of fetal abnormalities and malformations. Fetal MRI often enables a differential diagnosis, a determination of the extent of the disorder, the prognosis, and an improvement in therapeutic management. For counseling of parents, as well as to basically understand how genetic aberrations affect fetal development, it is of great importance to correlate different genotypes with fetal MRI data

  11. Fetal magnetic resonance imaging and human genetics

    Energy Technology Data Exchange (ETDEWEB)

    Hengstschlaeger, Markus [Medical Genetics, Obstetrics and Gynecology, Medical University of Vienna, Waehringer Guertel 18-20, 1090 Vienna (Austria)]. E-mail: markus.hengstschlaeger@meduniwien.ac.at

    2006-02-15

    The use of fetal magnetic resonance imaging (MRI), in addition to prenatal genetic testing and sonography, has the potential to improve prenatal diagnosis of genetic disorders. MRI plays an important role in the evaluation of fetal abnormalities and malformations. Fetal MRI often enables a differential diagnosis, a determination of the extent of the disorder, the prognosis, and an improvement in therapeutic management. For counseling of parents, as well as to basically understand how genetic aberrations affect fetal development, it is of great importance to correlate different genotypes with fetal MRI data.

  12. Fetal anatomy revealed with fast MR sequences.

    Science.gov (United States)

    Levine, D; Hatabu, H; Gaa, J; Atkinson, M W; Edelman, R R

    1996-10-01

    Although all the imaging studies in this pictorial essay were done for maternal rather than fetal indications, fetal anatomy was well visualized. However, when scans are undertaken for fetal indications, fetal motion in between scout views and imaging sequences may make specific image planes difficult to obtain. Of the different techniques described in this review, we preferred the HASTE technique and use it almost exclusively for scanning pregnant patients. The T2-weighting is ideal for delineating fetal organs. Also, the HASTE technique allows images to be obtained in 430 msec, limiting artifacts arising from maternal and fetal motion. MR imaging should play a more important role in evaluating equivocal sonographic cases as fast scanning techniques are more widely used. Obstetric MR imaging no longer will be limited by fetal motion artifacts. When complex anatomy requires definition in a complicated pregnant patient, MR imaging should be considered as a useful adjunct to sonography.

  13. Antithyroid drug-induced fetal goitrous hypothyroidism

    DEFF Research Database (Denmark)

    Bliddal, Sofie; Rasmussen, Ase Krogh; Sundberg, Karin

    2011-01-01

    Maternal overtreatment with antithyroid drugs can induce fetal goitrous hypothyroidism. This condition can have a critical effect on pregnancy outcome, as well as on fetal growth and neurological development. The purpose of this Review is to clarify if and how fetal goitrous hypothyroidism can...... be prevented, and how to react when prevention has failed. Understanding the importance of pregnancy-related changes in maternal thyroid status when treating a pregnant woman is crucial to preventing fetal goitrous hypothyroidism. Maternal levels of free T(4) are the most consistent indication of maternal...... and fetal thyroid status. In patients with fetal goitrous hypothyroidism, intra-amniotic levothyroxine injections improve fetal outcome. The best way to avoid maternal overtreatment with antithyroid drugs is to monitor closely the maternal thyroid status, especially estimates of free T(4) levels....

  14. The nuclear factor-erythroid 2-related factor/heme oxygenase-1 axis is critical for the inflammatory features of type 2 diabetes-associated osteoarthritis.

    Science.gov (United States)

    Vaamonde-Garcia, Carlos; Courties, Alice; Pigenet, Audrey; Laiguillon, Marie-Charlotte; Sautet, Alain; Houard, Xavier; Kerdine-Römer, Saadia; Meijide, Rosa; Berenbaum, Francis; Sellam, Jérémie

    2017-09-01

    Epidemiological findings support the hypothesis that type 2 diabetes mellitus (T2DM) is a risk factor for osteoarthritis (OA). Moreover, OA cartilage from patients with T2DM exhibits a greater response to inflammatory stress, but the molecular mechanism is unclear. To investigate whether the antioxidant defense system participates in this response, we examined here the expression of nuclear factor-erythroid 2-related factor (Nrf-2), a master antioxidant transcription factor, and of heme oxygenase-1 (HO-1), one of its main target genes, in OA cartilage from T2DM and non-T2DM patients as well as in murine chondrocytes exposed to high glucose (HG). Ex vivo experiments indicated that Nrf-2 and HO-1 expression is reduced in T2DM versus non-T2DM OA cartilage (0.57-fold Nrf-2 and 0.34-fold HO-1), and prostaglandin E 2 (PGE 2 ) release was increased in samples with low HO-1 expression. HG-exposed, IL-1β-stimulated chondrocytes had lower Nrf-2 levels in vitro , particularly in the nuclear fraction, than chondrocytes exposed to normal glucose (NG). Accordingly, HO-1 levels were also decreased (0.49-fold) in these cells. The HO-1 inducer cobalt protoporphyrin IX more efficiently attenuated PGE 2 and IL-6 release in HG+IL-1β-treated cells than in NG+IL-1β-treated cells. Greater reductions in HO-1 expression and increase in PGE 2 /IL-6 production were observed in HG+IL-1β-stimulated chondrocytes from Nrf-2 -/- mice than in chondrocytes from wild-type mice. We conclude that the Nrf-2/HO-1 axis is a critical pathway in the hyperglucidic-mediated dysregulation of chondrocytes. Impairments in this antioxidant system may explain the greater inflammatory responsiveness of OA cartilage from T2DM patients and may inform treatments of such patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Programmed Fetal Membrane Senescence and Exosome-Mediated Signaling: A Mechanism Associated With Timing of Human Parturition

    Directory of Open Access Journals (Sweden)

    Ramkumar Menon

    2017-08-01

    Full Text Available Human parturition is an inflammatory process that involves both fetal and maternal compartments. The precise immune cell interactions have not been well delineated in human uterine tissues during parturition, but insights into human labor initiation have been informed by studies in animal models. Unfortunately, the timing of parturition relative to fetal maturation varies among viviparous species—indicative of different phylogenetic clocks and alarms—but what is clear is that important common pathways must converge to control the birth process. Herein, we hypothesize a novel signaling mechanism initiated by human fetal membrane aging and senescence-associated inflammation. Programmed events of fetal membrane aging coincide with fetal growth and organ maturation. Mechanistically, senescence involves in telomere shortening and activation of p38 mitogen-activated signaling kinase resulting in aging-associated phenotypic transition. Senescent tissues release inflammatory signals that are propagated via exosomes to cause functional changes in maternal uterine tissues. In vitro, oxidative stress causes increased release of inflammatory mediators (senescence-associated secretory phenotype and damage-associated molecular pattern markers that can be packaged inside the exosomes. These exosomes traverse through tissues layers, reach maternal tissues to increase overall inflammatory load transitioning them from a quiescent to active state. Animal model studies have shown that fetal exosomes can travel from fetal to the maternal side. Thus, aging fetal membranes and membrane-derived exosomes cargo fetal signals to the uterus and cervix and may trigger parturition. This review highlights a novel hypothesis in human parturition research based on data from ongoing research using human fetal membrane model system.

  16. Fetal body weight and the development of the control of the cardiovascular system in fetal sheep.

    Science.gov (United States)

    Frasch, M G; Müller, T; Wicher, C; Weiss, C; Löhle, M; Schwab, K; Schubert, H; Nathanielsz, P W; Witte, O W; Schwab, M

    2007-03-15

    Reduced birth weight predisposes to cardiovascular diseases in later life. We examined in fetal sheep at 0.76 (n = 18) and 0.87 (n = 17) gestation whether spontaneously occurring variations in fetal weight affect maturation of autonomic control of cardiovascular function. Fetal weights at both gestational ages were grouped statistically in low (LW) and normal weights (NW) (P fetal sheep not constituting a major malnutritive condition. Mean fetal blood pressure (FBP) of all fetuses was negatively correlated to fetal weight at 0.76 but not 0.87 gestation (P fetal heart rate depended on fetal weight (P fetal weight within the normal weight span is accompanied by a different trajectory of development of sympathetic blood pressure and vagal heart rate control. This may contribute to the development of elevated blood pressure in later life. Examination of the underlying mechanisms and consequences may contribute to the understanding of programming of cardiovascular diseases.

  17. Pulmonary Hypoplasia Caused by Fetal Ascites in Congenital Cytomegalovirus Infection Despite Fetal Therapy

    Directory of Open Access Journals (Sweden)

    Kazumichi Fujioka

    2017-11-01

    Full Text Available We report two cases of pulmonary hypoplasia due to fetal ascites in symptomatic congenital cytomegalovirus (CMV infections despite fetal therapy. The patients died soon after birth. The pathogenesis of pulmonary hypoplasia in our cases might be thoracic compression due to massive fetal ascites as a result of liver insufficiency. Despite aggressive fetal treatment, including multiple immunoglobulin administration, which was supposed to diminish the pathogenic effects of CMV either by neutralization or immunomodulatory effects, the fetal ascites was uncontrollable. To prevent development of pulmonary hypoplasia in symptomatic congenital CMV infections, further fetal intervention to reduce ascites should be considered.

  18. Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Ruth Merkle

    2016-08-01

    Full Text Available Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC, is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO. However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR. The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in

  19. Fetal evaluation of spine dysraphism

    International Nuclear Information System (INIS)

    Bulas, Dorothy

    2010-01-01

    Spinal dysraphism or neural tube defects (NTD) encompass a heterogeneous group of congenital spinal anomalies that result from the defective closure of the neural tube early in gestation with anomalous development of the caudal cell mass. Advances in ultrasound and MRI have dramatically improved the diagnosis and therapy of spinal dysraphism and caudal spinal anomalies both prenatally and postnatally. Advances in prenatal US including high frequency linear transducers and three dimensional imaging can provide detailed information concerning spinal anomalies. MR imaging is a complementary tool that can further elucidate spine abnormalities as well as associated central nervous system and non-CNS anomalies. Recent studies have suggested that 3-D CT can help further assess fetal spine anomalies in the third trimester. With the advent of fetal therapy including surgery, accurate prenatal diagnosis of open and closed spinal dysraphism becomes critical in appropriate counselling and perinatal management. (orig.)

  20. Fetal origin of vascular aging

    Directory of Open Access Journals (Sweden)

    Shailesh Pitale

    2011-01-01

    Full Text Available Aging is increasingly regarded as an independent risk factor for development of cardiovascular diseases such as atherosclerosis and hypertension and their complications (e.g. MI and Stroke. It is well known that vascular disease evolve over decades with progressive accumulation of cellular and extracellular materials and many inflammatory processes. Metabolic syndrome, obesity and diabetes are conventionally recognized as risk factors for development of coronary vascular disease (CVD. These conditions are known to accelerate ageing process in general and vascular ageing in particular. Adverse events during intrauterine life may programme organ growth and favour disease later in life, popularly known as, ′Barker′s Hypothesis′. The notion of fetal programming implies that during critical periods of prenatal growth, changes in the hormonal and nutritional milieu of the conceptus may alter the full expression of the fetal genome, leading to permanent effects on a range of physiological.

  1. Fetal evaluation of spine dysraphism

    Energy Technology Data Exchange (ETDEWEB)

    Bulas, Dorothy [George Washington University Medical Center, Division of Diagnostic Imaging and Radiology, Children' s National Medical Center, Washington, DC (United States)

    2010-06-15

    Spinal dysraphism or neural tube defects (NTD) encompass a heterogeneous group of congenital spinal anomalies that result from the defective closure of the neural tube early in gestation with anomalous development of the caudal cell mass. Advances in ultrasound and MRI have dramatically improved the diagnosis and therapy of spinal dysraphism and caudal spinal anomalies both prenatally and postnatally. Advances in prenatal US including high frequency linear transducers and three dimensional imaging can provide detailed information concerning spinal anomalies. MR imaging is a complementary tool that can further elucidate spine abnormalities as well as associated central nervous system and non-CNS anomalies. Recent studies have suggested that 3-D CT can help further assess fetal spine anomalies in the third trimester. With the advent of fetal therapy including surgery, accurate prenatal diagnosis of open and closed spinal dysraphism becomes critical in appropriate counselling and perinatal management. (orig.)

  2. Clinical significance of perceptible fetal motion.

    Science.gov (United States)

    Rayburn, W F

    1980-09-15

    The monitoring of fetal activity during the last trimester of pregnancy has been proposed to be useful in assessing fetal welfare. The maternal perception of fetal activity was tested among 82 patients using real-time ultrasonography. All perceived fetal movements were visualized on the scanner and involved motion of the lower limbs. Conversely, 82% of all visualized motions of fetal limbs were perceived by the patients. All combined motions of fetal trunk with limbs were preceived by the patients and described as strong movements, whereas clusters of isolated, weak motions of the fetal limbs were less accurately perceived (56% accuracy). The number of fetal movements perceived during the 15-minute test period was significantly (p fetal motion was present (44 of 45 cases) than when it was absent (five of 10 cases). These findings reveal that perceived fetal motion is: (1) reliable; (2) related to the strength of lower limb motion; (3) increased with ruptured amniotic membranes; and (4) reassuring if considered to be active.

  3. Epigenetic and molecular profiles of erythroid cells after hydroxyurea treatment in sickle cell anemia

    Science.gov (United States)

    Steward, Shirley; Howard, Thad A.; Mortier, Nicole; Smeltzer, Matthew; Wang, Yong-Dong; Ware, Russell E.

    2011-01-01

    Hydroxyurea has been shown to be efficacious for the treatment of sickle cell anemia (SCA), primarily through the induction of fetal hemoglobin (HbF). However, the exact mechanisms by which hydroxyurea can induce HbF remain incompletely defined, although direct transcriptional effects and altered cell cycle kinetics have been proposed. In this study, we investigated potential epigenetic and alternative molecular mechanisms of hydroxyurea-mediated HbF induction by examining methylation patterns within the Gγ-globin promoter and miRNA expression within primary CD71+ erythrocytes of patients with SCA, both at baseline before beginning hydroxyurea therapy and after reaching maximum tolerated dose (MTD). Using both cross-sectional analysis and paired-sample analysis, we found that the highly methylated Gγ-globin promoter was inversely correlated to baseline HbF levels, but only slightly altered by hydroxyurea treatment. Conversely, expression of several specific miRNAs was significantly increased after hydroxyurea treatment, and expression of miR-26b and miR-151-3p were both associated with HbF levels at MTD. The significant associations identified in these studies suggest that methylation may be important for regulation of baseline HbF, but not after hydroxyurea treatment, whereas changes in miRNA expression may be associated with hydroxyurea-mediated HbF induction. This study was registered at ClinicalTrials.gov (NCT00305175). PMID:21921042

  4. Generation of a High Number of Healthy Erythroid Cells from Gene-Edited Pyruvate Kinase Deficiency Patient-Specific Induced Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Zita Garate

    2015-12-01

    Full Text Available Pyruvate kinase deficiency (PKD is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs from peripheral blood mononuclear cells (PB-MNCs of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR. Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.

  5. Fetal programming in meat production.

    Science.gov (United States)

    Du, Min; Wang, Bo; Fu, Xing; Yang, Qiyuan; Zhu, Mei-Jun

    2015-11-01

    Nutrient fluctuations during the fetal stage affects fetal development, which has long-term impacts on the production efficiency and quality of meat. During the early development, a pool of mesenchymal progenitor cells proliferate and then diverge into either myogenic or adipogenic/fibrogenic lineages. Myogenic progenitor cells further develop into muscle fibers and satellite cells, while adipogenic/fibrogenic lineage cells develop into adipocytes, fibroblasts and resident fibro-adipogenic progenitor cells. Enhancing the proliferation and myogenic commitment of progenitor cells during fetal development enhances muscle growth and lean production in offspring. On the other hand, promoting the adipogenic differentiation of adipogenic/fibrogenic progenitor cells inside the muscle increases intramuscular adipocytes and reduces connective tissue, which improves meat marbling and tenderness. Available studies in mammalian livestock, including cattle, sheep and pigs, clearly show the link between maternal nutrition and the quantity and quality of meat production. Similarly, chicken muscle fibers develop before hatching and, thus, egg and yolk sizes and hatching temperature affect long-term growth performance and meat production of chicken. On the contrary, because fishes are able to generate new muscle fibers lifelong, the impact of early nutrition on fish growth performance is expected to be minor, which requires further studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Fetal growth and developmental programming.

    Science.gov (United States)

    Galjaard, Sander; Devlieger, Roland; Van Assche, Frans A

    2013-01-01

    The environment in utero and in early neonatal life may induce a permanent response in the fetus and the newborn, leading to enhanced susceptibility to later diseases. This review concentrates on the role and mechanisms of events during the antenatal and immediate postnatal period resulting in later life diseases, concentrating on abnormal growth patterns of the fetus. Fetal overgrowth is related to exposure to a diabetic intra uterine environment, increasing the vulnerability to transgenerational obesity and hence an increased sensitivity to more diabetic mothers. This effect has been supported by animal data. Fetal growth restriction is complex due to malnutrition in utero, catch up growth due to a high caloric intake and low physical activity in later life. Metabolic changes and a transgenerational effect of intra uterine malnutrition has been supported by animal data. In recent years the discovery of alterations of the genome due to different influences during embryonic life, called epigenetics, has led to the phenomenon of fetal programming resulting in changing transgenerational metabolic effects.

  7. The use of non-invasive fetal electrocardiography in diagnosing second-degree fetal atrioventricular block.

    Science.gov (United States)

    Lakhno, Igor; Behar, Joachim A; Oster, Julien; Shulgin, Vyacheslav; Ostras, Oleksii; Andreotti, Fernando

    2017-01-01

    Complete atrioventricular block in fetuses is known to be mostly associated with autoimmune disease and can be irreversible if no steroids treatment is provided. Conventional methods used in clinical practice for diagnosing fetal arrhythmia are limited since they do not reflect the primary electrophysiological conduction processes that take place in the myocardium. The non-invasive fetal electrocardiogram has the potential to better support fetal arrhythmias diagnosis through the continuous analysis of the beat to beat variation of the fetal heart rate and morphological analysis of the PQRST complex. We present two retrospective case reports on which atrioventricular block diagnosis could have been supported by the non-invasive fetal electrocardiogram. The two cases comprised a 22-year-old pregnant woman with the gestational age of 31 weeks and a 25-year-old pregnant woman with the gestational age of 41 weeks. Both women were admitted to the Department of Maternal and Fetal Medicine at the Kyiv and Kharkiv municipal perinatal clinics. Patients were observed using standard fetal monitoring methods as well as the non-invasive fetal electrocardiogram. The non-invasive fetal electrocardiographic recordings were analyzed retrospectively, where it is possible to identify the presence of the atrioventricular block. This study demonstrates, for the first time, the feasibility of the non-invasive fetal electrocardiogram as a supplementary method to diagnose of the fetal atrioventricular block. Combined with current fetal monitoring techniques, non-invasive fetal electrocardiography could support clinical decisions.

  8. Generation and Characterization of Erythroid Cells from Human Embryonic Stem Cells and Induced Pluripotent Stem Cells: An Overview

    Directory of Open Access Journals (Sweden)

    Kai-Hsin Chang

    2011-01-01

    Full Text Available Because of the imbalance in the supply and demand of red blood cells (RBCs, especially for alloimmunized patients or patients with rare blood phenotypes, extensive research has been done to generate therapeutic quantities of mature RBCs from hematopoietic stem cells of various sources, such as bone marrow, peripheral blood, and cord blood. Since human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs can be maintained indefinitely in vitro, they represent potentially inexhaustible sources of donor-free RBCs. In contrast to other ex vivo stem-cell-derived cellular therapeutics, tumorigenesis is not a concern, as RBCs can be irradiated without marked adverse effects on in vivo function. Here, we provide a comprehensive review of the recent publications relevant to the generation and characterization of hESC- and iPSC-derived erythroid cells and discuss challenges to be met before the eventual realization of clinical usage of these cells.

  9. Fetal microchimeric cells in autoimmune thyroid diseases

    Science.gov (United States)

    Lepez, Trees; Vandewoestyne, Mado; Deforce, Dieter

    2013-01-01

    Autoimmune thyroid diseases (AITD) show a female predominance, with an increased incidence in the years following parturition. Fetal microchimerism has been suggested to play a role in the pathogenesis of AITD. However, only the presence of fetal microchimeric cells in blood and in the thyroid gland of these patients has been proven, but not an actual active role in AITD. Is fetal microchimerism harmful for the thyroid gland by initiating a Graft versus Host reaction (GvHR) or being the target of a Host versus Graft reaction (HvGR)? Is fetal microchimerism beneficial for the thyroid gland by being a part of tissue repair or are fetal cells just innocent bystanders in the process of autoimmunity? This review explores every hypothesis concerning the role of fetal microchimerism in AITD. PMID:23723083

  10. Increasing fetal ovine number per gestation alters fetal plasma clinical chemistry values.

    Science.gov (United States)

    Zywicki, Micaela; Blohowiak, Sharon E; Magness, Ronald R; Segar, Jeffrey L; Kling, Pamela J

    2016-08-01

    Intrauterine growth restriction (IUGR) is interconnected with developmental programming of lifelong pathophysiology. IUGR is seen in human multifetal pregnancies, with stepwise rises in fetal numbers interfering with placental nutrient delivery. It remains unknown whether fetal blood analyses would reflect fetal nutrition, liver, and excretory function in the last trimester of human or ovine IUGR In an ovine model, we hypothesized that fetal plasma biochemical values would reflect progressive placental, fetal liver, and fetal kidney dysfunction as the number of fetuses per gestation rose. To determine fetal plasma biochemical values in singleton, twin, triplet, and quadruplet/quintuplet ovine gestation, we investigated morphometric measures and comprehensive metabolic panels with nutritional measures, liver enzymes, and placental and fetal kidney excretory measures at gestational day (GD) 130 (90% gestation). As anticipated, placental dysfunction was supported by a stepwise fall in fetal weight, fetal plasma glucose, and triglyceride levels as fetal number per ewe rose. Fetal glucose and triglycerides were directly related to fetal weight. Plasma creatinine, reflecting fetal renal excretory function, and plasma cholesterol, reflecting placental excretory function, were inversely correlated with fetal weight. Progressive biochemical disturbances and growth restriction accompanied the rise in fetal number. Understanding the compensatory and adaptive responses of growth-restricted fetuses at the biochemical level may help explain how metabolic pathways in growth restriction can be predetermined at birth. This physiological understanding is important for clinical care and generating interventional strategies to prevent altered developmental programming in multifetal gestation. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  11. In an in-vitro model using human fetal membranes, 17-α hydroxyprogesterone caproate is not an optimal progestogen for inhibition of fetal membrane weakening.

    Science.gov (United States)

    Kumar, Deepak; Moore, Robert M; Mercer, Brian M; Mansour, Joseph M; Mesiano, Sam; Schatz, Frederick; Lockwood, Charles J; Moore, John J

    2017-12-01

    The progestogen 17-α hydroxyprogesterone caproate (17-OHPC) is 1 of only 2 agents recommended for clinical use in the prevention of spontaneous preterm delivery, and studies of its efficacy have been conflicting. We have developed an in-vitro model to study the fetal membrane weakening process that leads to rupture in preterm premature rupture of the fetal membranes (pPROM). Inflammation/infection associated with tumor necrosis factor-α (TNF-α) induction and decidual bleeding/abruption associated thrombin release are leading causes of preterm premature rupture of the fetal membranes. Both agents (TNF-α and thrombin) cause fetal membrane weakening in the model system. Furthermore, granulocyte-macrophage colony-stimulating factor (GM-CSF) is a critical intermediate for both TNF-α and thrombin-induced fetal membrane weakening. In a previous report, we demonstrated that 3 progestogens, progesterone, 17-alpha hydroxyprogesterone (17-OHP), and medroxyprogesterone acetate (MPA), each inhibit both TNF-α- and thrombin-induced fetal membrane weakening at 2 distinct points of the fetal membrane weakening pathway. Each block both the production of and the downstream action of the critical intermediate granulocyte-macrophage colony-stimulating factor. The objective of the study was to characterize the inhibitory effects of 17-OHPC on TNF-α- and thrombin-induced fetal membrane weakening in vitro. Full-thickness human fetal membrane fragments from uncomplicated term repeat cesarean deliveries were mounted in 2.5 cm Transwell inserts and cultured with/without 17-alpha hydroxyprogesterone caproate (10 -9 to 10 -7 M). After 24 hours, medium (supernatant) was removed and replaced with/without the addition of tumor necrosis factor-alpha (20 ng/mL) or thrombin (10 U/mL) or granulocyte-macrophage colony-stimulating factor (200 ng/mL). After 48 hours of culture, medium from the maternal side compartment of the model was assayed for granulocyte-macrophage colony

  12. The World Health Organization Fetal Growth Charts

    DEFF Research Database (Denmark)

    Kiserud, Torvid; Piaggio, Gilda; Carroli, Guillermo

    2017-01-01

    BACKGROUND: Perinatal mortality and morbidity continue to be major global health challenges strongly associated with prematurity and reduced fetal growth, an issue of further interest given the mounting evidence that fetal growth in general is linked to degrees of risk of common noncommunicable...... longitudinal study of fetal growth in low-risk singleton pregnancies of women of high or middle socioeconomic status and without known environmental constraints on fetal growth. Centers in ten countries (Argentina, Brazil, Democratic Republic of the Congo, Denmark, Egypt, France, Germany, India, Norway...

  13. Digital atlas of fetal brain MRI.

    Science.gov (United States)

    Chapman, Teresa; Matesan, Manuela; Weinberger, Ed; Bulas, Dorothy I

    2010-02-01

    Fetal MRI can be performed in the second and third trimesters. During this time, the fetal brain undergoes profound structural changes. Interpretation of appropriate development might require comparison with normal age-based models. Consultation of a hard-copy atlas is limited by the inability to compare multiple ages simultaneously. To provide images of normal fetal brains from weeks 18 through 37 in a digital format that can be reviewed interactively. This will facilitate recognition of abnormal brain development. T2-W images for the atlas were obtained from fetal MR studies of normal brains scanned for other indications from 2005 to 2007. Images were oriented in standard axial, coronal and sagittal projections, with laterality established by situs. Gestational age was determined by last menstrual period, earliest US measurements and sonogram performed on the same day as the MR. The software program used for viewing the atlas, written in C#, permits linked scrolling and resizing the images. Simultaneous comparison of varying gestational ages is permissible. Fetal brain images across gestational ages 18 to 37 weeks are provided as an interactive digital atlas and are available for free download from http://radiology.seattlechildrens.org/teaching/fetal_brain . Improved interpretation of fetal brain abnormalities can be facilitated by the use of digital atlas cataloging of the normal changes throughout fetal development. Here we provide a description of the atlas and a discussion of normal fetal brain development.

  14. MR imaging of the fetal brain

    International Nuclear Information System (INIS)

    Glenn, Orit A.

    2010-01-01

    Fetal MRI is clinically performed to evaluate the brain in cases where an abnormality is detected by prenatal sonography. These most commonly include ventriculomegaly, abnormalities of the corpus callosum, and abnormalities of the posterior fossa. Fetal MRI is also increasingly performed to evaluate fetuses who have normal brain findings on prenatal sonogram but who are at increased risk for neurodevelopmental abnormalities, such as complicated monochorionic twin pregnancies. This paper will briefly discuss the common clinical conditions imaged by fetal MRI as well as recent advances in fetal MRI research. (orig.)

  15. MR imaging of the fetal brain

    Energy Technology Data Exchange (ETDEWEB)

    Glenn, Orit A. [University of California, San Francisco, Department of Radiology, Neuroradiology Section, San Francisco, CA (United States)

    2010-01-15

    Fetal MRI is clinically performed to evaluate the brain in cases where an abnormality is detected by prenatal sonography. These most commonly include ventriculomegaly, abnormalities of the corpus callosum, and abnormalities of the posterior fossa. Fetal MRI is also increasingly performed to evaluate fetuses who have normal brain findings on prenatal sonogram but who are at increased risk for neurodevelopmental abnormalities, such as complicated monochorionic twin pregnancies. This paper will briefly discuss the common clinical conditions imaged by fetal MRI as well as recent advances in fetal MRI research. (orig.)

  16. Prenatal smoking exposure and asymmetric fetal growth restriction

    NARCIS (Netherlands)

    Delpisheh, Ali; Brabin, Loretta; Drummond, Sandra; Brabin, Bernard J.

    2008-01-01

    Background: Prenatal smoking exposure causes intrauterine fetal growth restriction ( IUGR), although its effects on fetal proportionality are less clearly defined. Aim: The present study assessed fetal proportionality in babies with IUGR using maternal salivary cotinine to indicate maternal smoking

  17. Development of the Human Placenta and Fetal Heart: Synergic or Independent?

    Directory of Open Access Journals (Sweden)

    Graham J. Burton

    2018-04-01

    Full Text Available The placenta is the largest fetal organ, and toward the end of pregnancy the umbilical circulation receives at least 40% of the biventricular cardiac output. It is not surprising, therefore, that there are likely to be close haemodynamic links between the development of the placenta and the fetal heart. Development of the placenta is precocious, and in advance of that of the fetus. The placenta undergoes considerable remodeling at the end of the first trimester of pregnancy, and its vasculature is capable of adapting to environmental conditions and to variations in the blood supply received from the mother. There are two components to the placental membranes to consider, the secondary yolk sac and the chorioallantoic placenta. The yolk sac is the first of the extraembryonic membranes to be vascularized, and condensations in the mesenchyme at ~17 days post-conception (p.c. give rise to endothelial and erythroid precursors. A network of blood vessels is established ~24 days p.c., with the vitelline vein draining through the region of the developing liver into the sinus venosus. Gestational sacs of early pregnancy failures often display aberrant development of the yolk sac, which is likely to be secondary to abnormal fetal development. Vasculogenesis occurs in the villous mesenchyme of the chorioallantoic placenta at a similarly early stage. Nucleated erythrocytes occupy the lumens of the placental capillaries and end-diastolic flow is absent in the umbilical arterial circulation throughout most of the first trimester, indicating a high resistance to blood flow. Resistance begins to fall in the umbilico-placental circulation around 12–14 weeks. During normal early pregnancy the placental capillary network is plastic, and considerable remodeling occurs in response to the local oxygen concentration, and in particular to oxidative stress. In pregnancies complicated by preeclampsia and/or fetal growth restriction, utero-placental malperfusion induces

  18. Review: Fetal-maternal communication via extracellular vesicles - Implications for complications of pregnancies.

    Science.gov (United States)

    Adam, Stefanie; Elfeky, Omar; Kinhal, Vyjayanthi; Dutta, Suchismita; Lai, Andrew; Jayabalan, Nanthini; Nuzhat, Zarin; Palma, Carlos; Rice, Gregory E; Salomon, Carlos

    2017-06-01

    The maternal physiology experiences numerous changes during pregnancy which are essential in controlling and maintaining maternal metabolic adaptations and fetal development. The human placenta is an organ that serves as the primary interface between the maternal and fetal circulation, thereby supplying the fetus with nutrients, blood and oxygen through the umbilical cord. During gestation, the placenta continuously releases several molecules into maternal circulation, including hormones, proteins, RNA and DNA. Interestingly, the presence of extracellular vesicles (EVs) of placental origin has been identified in maternal circulation across gestation. EVs can be categorised according to their size and/or origin into microvesicles (∼150-1000 nm) and exosomes (∼40-120 nm). Microvesicles are released by budding from the plasmatic membrane, whereas exosome release is by fusion of multivesicular bodies with the plasmatic membrane. Exosomes released from placental cells have been found to be regulated by oxygen tension and glucose concentration. Furthermore, maternal exosomes have the ability to stimulate cytokine release from endothelial cells. In this review, we will discuss the role of EVs during fetal-maternal communication during gestation with a special emphasis on exosomes. Copyright © 2016. Published by Elsevier Ltd.

  19. Imaging of fetal chest masses

    Energy Technology Data Exchange (ETDEWEB)

    Barth, Richard A. [Lucile Packard Children' s Hospital, Stanford University School of Medicine, Department of Radiology, Stanford, CA (United States)

    2012-01-15

    Prenatal imaging with high-resolution US and rapid acquisition MRI plays a key role in the accurate diagnosis of congenital chest masses. Imaging has enhanced our understanding of the natural history of fetal lung masses, allowing for accurate prediction of outcome, parental counseling, and planning of pregnancy and newborn management. This paper will focus on congenital bronchopulmonary malformations, which account for the vast majority of primary lung masses in the fetus. In addition, anomalies that mimic masses and less common causes of lung masses will be discussed. (orig.)

  20. Digital atlas of fetal brain MRI

    International Nuclear Information System (INIS)

    Chapman, Teresa; Weinberger, E.; Matesan, Manuela; Bulas, Dorothy I.

    2010-01-01

    Fetal MRI can be performed in the second and third trimesters. During this time, the fetal brain undergoes profound structural changes. Interpretation of appropriate development might require comparison with normal age-based models. Consultation of a hard-copy atlas is limited by the inability to compare multiple ages simultaneously. To provide images of normal fetal brains from weeks 18 through 37 in a digital format that can be reviewed interactively. This will facilitate recognition of abnormal brain development. T2-W images for the atlas were obtained from fetal MR studies of normal brains scanned for other indications from 2005 to 2007. Images were oriented in standard axial, coronal and sagittal projections, with laterality established by situs. Gestational age was determined by last menstrual period, earliest US measurements and sonogram performed on the same day as the MR. The software program used for viewing the atlas, written in C, permits linked scrolling and resizing the images. Simultaneous comparison of varying gestational ages is permissible. Fetal brain images across gestational ages 18 to 37 weeks are provided as an interactive digital atlas and are available for free download. Improved interpretation of fetal brain abnormalities can be facilitated by the use of digital atlas cataloging of the normal changes throughout fetal development. Here we provide a description of the atlas and a discussion of normal fetal brain development. (orig.)

  1. Fetal microchimerism in breast and colon cancer

    DEFF Research Database (Denmark)

    Kamper-Jørgensen, M; Biggar, R J; Stamper, Casey L

    2011-01-01

    1574 Background: Cells acquired by a woman from her baby that durably persist in her blood and tissues is known as fetal microchimerism (FMc). In women with breast cancer, frequency and quantity of FMc in blood and breast tissue is reduced compared to healthy women. Whether the absence of fetal...

  2. Digital atlas of fetal brain MRI

    Energy Technology Data Exchange (ETDEWEB)

    Chapman, Teresa; Weinberger, E. [Department of Radiology, Seattle Children' s Hospital, Seattle, WA (United States); Matesan, Manuela [University of Washington, Department of Radiology, Seattle, WA (United States); Bulas, Dorothy I. [Division of Diagnostic Imaging and Radiology, Children' s National Medical Center, Washington, DC (United States)

    2010-02-15

    Fetal MRI can be performed in the second and third trimesters. During this time, the fetal brain undergoes profound structural changes. Interpretation of appropriate development might require comparison with normal age-based models. Consultation of a hard-copy atlas is limited by the inability to compare multiple ages simultaneously. To provide images of normal fetal brains from weeks 18 through 37 in a digital format that can be reviewed interactively. This will facilitate recognition of abnormal brain development. T2-W images for the atlas were obtained from fetal MR studies of normal brains scanned for other indications from 2005 to 2007. Images were oriented in standard axial, coronal and sagittal projections, with laterality established by situs. Gestational age was determined by last menstrual period, earliest US measurements and sonogram performed on the same day as the MR. The software program used for viewing the atlas, written in C, permits linked scrolling and resizing the images. Simultaneous comparison of varying gestational ages is permissible. Fetal brain images across gestational ages 18 to 37 weeks are provided as an interactive digital atlas and are available for free download. Improved interpretation of fetal brain abnormalities can be facilitated by the use of digital atlas cataloging of the normal changes throughout fetal development. Here we provide a description of the atlas and a discussion of normal fetal brain development. (orig.)

  3. Expert systems for fetal assessment in labour

    NARCIS (Netherlands)

    Lutomski, J.E.; Meaney, S.; Greene, R.A.; Ryan, A.C.; Devane, D.

    2015-01-01

    BACKGROUND: Cardiotocography (CTG) records the fetal heart rate in relation to maternal uterine contractions and is one of the most common forms of fetal assessment during labour. Despite guidelines for CTG interpretation, substantial inter- and intra-observer variation in interpretation has been

  4. PREVENTION FETAL ALCOHOL SYNDROME IN RUSSIA

    Directory of Open Access Journals (Sweden)

    L. V. Skitnevskaya

    2013-01-01

    Full Text Available The article is devoted to the influence of alcohol problems in women of childbearing age during pregnancy on the unborn child. The concept of a fetal alcohol syndrome (FAS. We describe the stages of the research project "Prevention of fetal FAS in Russia."

  5. New treatment of early fetal chylothorax

    DEFF Research Database (Denmark)

    Nygaard, Ulrikka; Sundberg, Karin; Nielsen, Henriette Svarre

    2007-01-01

    OBJECTIVE: To evaluate OK-432, a preparation of Streptococcus pyogenes, in the treatment of early fetal chylothorax. METHODS: A prospective study of all fetuses (n=7) with persistent early chylothorax (gestational ages 16-21 weeks) referred to the tertiary center of fetal medicine in Denmark in 2...

  6. Fetal hydronephrosis: is there hope for consensus?

    Energy Technology Data Exchange (ETDEWEB)

    Toiviainen-Salo, Sanna; Dubois, Josee; Rypens, Francoise; Boisvert, Jacques; Perreault, Gilles; Decarie, Jean Claude; Filiatrault, Denis; Lapierre, Chantale; Miron, Marie-Claude; Bechard, Nancy [Department of Medical Imaging, Hopital Ste-Justine, 3175 Cote Ste-Catherine, H3T 1C5, Montreal, Quebec (Canada); Garel, Laurent; Grignon, Andree [Department of Medical Imaging, Hopital Ste-Justine, 3175 Cote Ste-Catherine, H3T 1C5, Montreal, Quebec (Canada); Department of Radiology, Universite de Montreal, 3175 Cote Ste-Catherine, H3T 1C5, Montreal, Quebec (Canada)

    2004-07-01

    This review article aims at summarizing the data regarding fetal and neonatal hydronephrosis, at correlating controversial data with the differences in the practice of obstetrical sonography from one country to another, and finally, at presenting our own criteria for fetal renal collecting system dilatation along with our own guidelines of postnatal investigation. (orig.)

  7. Fetal DNA: strategies for optimal recovery

    NARCIS (Netherlands)

    Legler, Tobias J.; Heermann, Klaus-Hinrich; Liu, Zhong; Soussan, Aicha Ait; van der Schoot, C. Ellen

    2008-01-01

    For fetal DNA extraction, in principle each DNA extraction method can be used; however, because most methods have been optimized for genomic DNA from leucocytes, we describe here the methods that have been optimized for the extraction of fetal DNA from maternal plasma and validated for this purpose

  8. Ultrasonic Diagnosis of Fetal Ascites and Toxoplasmosis

    DEFF Research Database (Denmark)

    Blaakær, Jan

    1986-01-01

    The ultrasonic diagnosis of fetal ascites caused by Toxoplasma Gondii is presented. When a diagnosis of fetal ascites without obvious etiological malformation is established, toxoplasmosis should be suspected. A serological test should be performed, in view of the possibility of antenatal treatme...

  9. Fetal behavior in normal dichorionic twin pregnancy

    NARCIS (Netherlands)

    Mulder, E. J. H.; Derks, J. B.; de Laat, M. W. M.; Visser, G. H. A.

    2012-01-01

    Objectives: A prospective study was performed to compare fetal behavioral development in healthy dichorionic twins and singletons, and identify twin intra-pair associations (synchrony) of fetal movements and rest-activity cycles using different criteria to define synchrony. Subjects and methods:

  10. Value of amniocentesis versus fetal tissue for cytogenetic analysis in cases of fetal demise.

    Science.gov (United States)

    Bryant Borders, Ann E; Greenberg, Jessica; Plaga, Stacey; Shepard-Hinton, Megan; Yates, Carin; Elias, Sherman; Shulman, Lee P

    2009-01-01

    Use of fetal tissue for cytogenetic analysis in cases of second- and third-trimester fetal demise frequently results in unacceptably high failure rates. We reviewed our ongoing use of amniocentesis prior to uterine evacuation to determine if this provided a better source of cells for cytogenetic analysis. We compared cytogenetic results using fetal tissues obtained following uterine evacuation to our ongoing use of amniotic fluid cell obtained by transabdominal amniocentesis prior to uterine evacuation from 2003 to 2008. In 49 of the 63 cases evaluated by fetal tissue biopsies performed after uterine evacuation, a karyotypic analysis was obtained (77.8%). Among the 38 cases evaluated by amniocentesis, an amniotic fluid sample and fetal cytogenetic results were obtained in all 38 (100%) cases. Our findings indicate that amniocentesis is a more reliable source of cytogenetic information than fetal tissue in cases of second- and third-trimester fetal demise.

  11. Fetal Origin of Sensorimotor Behavior

    Directory of Open Access Journals (Sweden)

    Jaqueline Fagard

    2018-05-01

    Full Text Available The aim of this article is to track the fetal origin of infants’ sensorimotor behavior. We consider development as the self-organizing emergence of complex forms from spontaneously generated activity, governed by the innate capacity to detect and memorize the consequences of spontaneous activity (contingencies, and constrained by the sensory and motor maturation of the body. In support of this view, we show how observations on fetuses and also several fetal experiments suggest that the fetus’s first motor activity allows it to feel the space around it and to feel its body and the consequences of its movements on its body. This primitive motor babbling gives way progressively to sensorimotor behavior which already possesses most of the characteristics of infants’ later behavior: repetition of actions leading to sensations, intentionality, some motor control and oriented reactions to sensory stimulation. In this way the fetus can start developing a body map and acquiring knowledge of its limited physical and social environment.

  12. Inequality in Fetal Autopsy in Canada.

    Science.gov (United States)

    Auger, Nathalie; Tiandrazana, Rémi-Claude; Healy-Profitós, Jessica; Costopoulos, André

    2016-01-01

    Inequality in use of fetal autopsy is poorly understood, despite the importance of autopsy in establishing the cause of stillbirth for future prevention. We examined fetal autopsy rates between linguistic minorities in Quebec, Canada, and assessed trends over three decades. Using registry data on 11,992 stillbirths from 1981-2011, we calculated fetal autopsy rates for Francophones, Anglophones, and Allophones by decade. We found lower fetal autopsy rates for Allophones (54.4%) than Francophones (68.5%) and Anglophones (63.4%), but rates decreased over time for all language groups. After 2000, Allophones had 25% higher risk of non-autopsy relative to Francophones, with 8.8 fewer autopsies for every 100 stillbirths. Allophones who were not autopsied had 32% higher risk of having an undetermined cause of death. Inequality in use of fetal autopsy may be widespread for minorities in Canada. Efforts to decrease stillbirth in minorities may require policies to increase autopsy rates.

  13. Fetal activity patterns in hypertensive pregnancies.

    Science.gov (United States)

    Rayburn, W F

    1982-01-01

    This prospective investigation attempts to determine whether the maternal recording of perceived fetal motion is useful for fetal assessment in pregnancies complicated by hypertension. During a 21 month period, 124 patients whose pregnancies were complicated by either chronic or pregnancy-induced hypertension participated. The number of perceived movements per hour (24 +/- 11, mean +/- S.D.) and evidence for fetal inactivity (7 cases, 6%) did not vary significantly from a control group of normotensive pregnancies (p greater than 0.05). Fetal inactivity was predictive of an unfavorable perinatal outcome in 6 of 7 cases, including the three stillborn infants. No perinatal deaths occurred among the 117 hypertensive pregnancies with active fetuses, and the 6 cases with an unfavorable outcome were associated with mild intrauterine growth delay, prematurity, or acute changes such as placental abruption or umbilical cord accidents. Realizing these limitations, a record of fetal inactivity is worthwhile in managing the pregnancy complicated by hypertension.

  14. Fetal neonatal hyperthyroidism: diagnostic and therapeutic approachment

    Science.gov (United States)

    Kurtoğlu, Selim; Özdemir, Ahmet

    2017-01-01

    Fetal and neonatal hyperthyroidism may occur in mothers with Graves’ disease. Fetal thyrotoxicosis manifestation is observed with the transition of TSH receptor stimulating antibodies to the fetus from the 17th–20th weeks of pregnancy and with the fetal TSH receptors becoming responsive after 20 weeks. The diagnosis is confirmed by fetal tachycardia, goiter and bone age advancement in pregnancy and maternal treatment is conducted in accordance. The probability of neonatal hyperthyroidism is high in the babies of mothers that have ongoing antithyroid requirement and higher antibody levels in the last months of pregnancy. Clinical manifestation may be delayed by 7–17 days because of the antithyroid drugs taken by the mother. Neonatal hyperthyroidism symptoms can be confused with sepsis and congenital viral infections. Herein, the diagnosis and therapeutic approach are reviewed in cases of fetal neonatal hyperthyroidism. PMID:28439194

  15. Genetic manipulation of RPS5 gene expression modulates the initiation of commitment of MEL cells to erythroid maturation: Implications in understanding ribosomopathies.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Papachristou, Eleni T; Andreadis, Panagiotis; Zopounidou, Elena; Matragkou, Christina N; Tsiftsoglou, Asterios S

    2015-07-01

    Impairment of ribosome biogenesis contributes to the molecular pathophysiology of ribosomopathies by deregulating cell-lineage specific proliferation, differentiation and apoptosis decisions of haematopoietic progenitor cells. Here, using pro-erythroblast-like murine erythroleukemia (MEL) cells, a model system of erythroid maturation, we aimed to investigate whether genetic manipulation of RPS5 expression affects the capacity of cells to grow and differentiate in culture. Parental MEL cells stably transfected with full length RPS5 cDNA in sense (MEL-C14 culture) or antisense (MEL-antisenseRPS5 culture) orientation, as well as MEL cells transiently transfected with siRNAs specific for RPS5 gene silencing (MEL-RPS5siRNA culture) were assessed for their ability to fully execute their erythroid maturation program in culture. The data obtained thus far indicate that: a) MEL-antisenseRPS5 exhibit a pronounced delay in the initiation of differentiation, as well as an impairment of commitment, since the continuous presence of the inducer in culture is required for the cells to fully execute their erythroid maturation program. b) RNAi-mediating silencing of RPS5 gene expression resulted in the inability of MEL cells to differentiate; however, when these cells were allowed to recapitulate normal RPS5 gene expression levels they regained their differentiation capacity by accumulating high proportion of erythroid mature cells. c) Interestingly the latter, is accompanied by morphological changes of cells and an impairment of their proliferation and apoptosis potential. Such data for the first time correlate the RPS5 gene expression levels with the differentiation capacity of MEL cells in vitro, a fact that might also have implications in understanding ribosomopathies.

  16. Possible interaction between B1 retrotransposon-containing sequences and β(major) globin gene transcriptional activation during MEL cell erythroid differentiation.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S

    2012-01-01

    Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited

  17. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    Science.gov (United States)

    Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

    2015-11-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.

  18. [FETAL PROGRAMMING OF METABOLIC DISORDERS].

    Science.gov (United States)

    Varadinova, M R; Metodieva, R; Boyadzhieva, N

    2015-01-01

    Our knowledge of fetal programming has developed notably over the years and recent data suggest that an unbalanced diet prior and during pregnancy can have early-onset and long-lasting consequences on the health of the offspring. Specific negative influences of high dietary glucose and lipid consumption, as well as undernutrition, are associated with development of metabolic syndrome, insulin resistance and diabetes in the offspring. The mechanisms underlying the effects of maternal hyperglycemia on the fetus may involve structural, metabolic and epigenetic changes. The aim of this review is to illustrate how adverse intrauterine environment may influence molecular modifications in the fetus and cause epigenetic alterations in particular. It has been demonstrated that prenatal epigenetic modifications may be linked to the pathogenesis and progression of the adult chronic disorders. Studies on epigenetic alterations will contribute to a better understanding of the long-term effects of in utero exposure and may open new perspectives for disease prevention and treatment.

  19. An intelligent fetal monitoring system

    International Nuclear Information System (INIS)

    Inaba, J.; Akatsuka, T.; Kubo, T.; Iwasaki, H.

    1986-01-01

    An intelligent monitoring system is constructed by a multi-micro-computer system. The monitoring signals are fetal heart rate (FHR) and uterine contraction (UC) through the conventional monitoring device for a day until the delivery. These signals are fed to a micro-computer in digital format, and evaluated by the computer in real time according to the diagnostic algorithm of the expert physician. Monitoring signals are always displayed on the CRT screen and in the case of dangerous state of the fetus, warning signal will appear on the screen and the doctor or nurse will be called. All these signals are sent to the next micro-computer with 10MB hard disk system. On this computer, the doctor and nurse can retrieve and inspect the details of the process by clock-key and/or events-key. After finishing monitoring process, summarized report is constructed and printed out on the paper

  20. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    International Nuclear Information System (INIS)

    Uziel, Orit; Kanfer, Gil; Beery, Einat; Yelin, Dana; Shepshelovich, Daniel; Bakhanashvili, Mary; Nordenberg, Jardena; Lahav, Meir

    2014-01-01

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway

  1. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    International Nuclear Information System (INIS)

    Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon

    2010-01-01

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  2. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation.

    Science.gov (United States)

    Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique

    2017-07-11

    Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  3. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)

    2010-08-07

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  4. Role of Nuclear Factor (Erythroid-Derived 2-Like 2 Signaling for Effects of Fumaric Acid Esters on Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Anna Hammer

    2017-12-01

    Full Text Available To date, the intracellular signaling pathways involved in dendritic cell (DC function are poorly understood. The antioxidative transcription factor nuclear factor (erythroid-derived 2-like 2 (Nrf2 has been shown to affect maturation, function, and subsequent DC-mediated T cell responses of murine and human DCs. In experimental autoimmune encephalomyelitis (EAE, as prototype animal model for a T helper cell-mediated autoimmune disease, antigen presentation, cytokine production, and costimulation by DCs play a major role. We explore the role of Nrf2 in DC function, and DC-mediated T cell responses during T cell-mediated autoimmunity of the central nervous system using genetic ablation and pharmacological activation in mice and men to corroborate our data in a translational setting. In murine and human DCs, monomethyl fumarate induced Nrf2 signaling inhibits DC maturation and DC-mediated T cell proliferation by reducing inflammatory cytokine production and expression of costimulatory molecules. In contrast, Nrf2-deficient DCs generate more activated T helper cells (Th1/Th17 but fewer regulatory T cells and foster T cell proliferation. Transfer of DCs with Nrf2 activation during active EAE reduces disease severity and T cell infiltration. Our data demonstrate that Nrf2 signaling modulates autoimmunity in murine and human systems via inhibiting DC maturation and function thus shedding further light on the mechanism of action of antioxidative stress pathways in antigen-presenting cells.

  5. Nuclear factor erythroid 2-related factor-2 activity controls 4-hydroxynonenal metabolism and activity in prostate cancer cells.

    Science.gov (United States)

    Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina

    2011-10-15

    4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    Energy Technology Data Exchange (ETDEWEB)

    Uziel, Orit, E-mail: Oritu@clalit.org.il [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Kanfer, Gil [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Beery, Einat [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Yelin, Dana; Shepshelovich, Daniel [Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Bakhanashvili, Mary [Unit of Infectious Diseases, Sheba Medical Center, Tel-Hashomer (Israel); Nordenberg, Jardena [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Endocrinology Laboratory, Beilinson Medical Center, Petah-Tikva (Israel); Lahav, Meir [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel)

    2014-07-18

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway.

  7. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation

    Directory of Open Access Journals (Sweden)

    Alessandro Di Tullio

    2017-07-01

    Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.

  8. Hypoxia: From Placental Development to Fetal Programming.

    Science.gov (United States)

    Fajersztajn, Lais; Veras, Mariana Matera

    2017-10-16

    Hypoxia may influence normal and different pathological processes. Low oxygenation activates a variety of responses, many of them regulated by hypoxia-inducible factor 1 complex, which is mostly involved in cellular control of O 2 consumption and delivery, inhibition of growth and development, and promotion of anaerobic metabolism. Hypoxia plays a significant physiological role in fetal development; it is involved in different embryonic processes, for example, placentation, angiogenesis, and hematopoiesis. More recently, fetal hypoxia has been associated directly or indirectly with fetal programming of heart, brain, and kidney function and metabolism in adulthood. In this review, the role of hypoxia in fetal development, placentation, and fetal programming is summarized. Hypoxia is a basic mechanism involved in different pregnancy disorders and fetal health developmental complications. Although there are scientific data showing that hypoxia mediates changes in the growth trajectory of the fetus, modulates gene expression by epigenetic mechanisms, and determines the health status later in adulthood, more mechanistic studies are needed. Furthermore, if we consider that intrauterine hypoxia is not a rare event, and can be a consequence of unavoidable exposures to air pollution, nutritional deficiencies, obesity, and other very common conditions (drug addiction and stress), the health of future generations may be damaged and the incidence of some diseases will markedly increase as a consequence of disturbed fetal programming. Birth Defects Research 109:1377-1385, 2017.© 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  9. Awareness of fetal echo in Indian scenario

    International Nuclear Information System (INIS)

    Warrier, Dhanya; Saraf, Rahul; Maheshwari, Sunita; Suresh, PV; Shah, Sejal

    2012-01-01

    Fetal echocardiography is a well established sensitive tool to diagnose congenital heart disease (CHD) in utero. One of the determinants of effective utilization of fetal echocardiography is its awareness in the general population. The present hospital based study was undertaken to assess the awareness of the need for fetal echocardiography amongst Indian parents. One thousand one hundred and thirty eight consecutive parents who visited the pediatric cardiology outpatient department of a tertiary care centre over a period of two months were asked to fill up a questionnaire that included their demographic data, educational status, history of CHD in children, awareness of fetal echocardiography and source of information and timing of fetal echocardiogram if performed. The data was categorized and awareness was noted in different groups. The awareness in the study population was 2.2%. Awareness was found to be similar across the study population irrespective of the demographics and high risk status of the parents. The awareness of fetal echocardiography, an important tool in reducing the incidence of complex CHD, thereby impacting public health, is alarmingly low in the population studied. Appropriate action to increase awareness of fetal echocardiography needs to be looked into

  10. Fetal stimulation by pulsed diagnostic ultrasound.

    Science.gov (United States)

    Fatemi, M; Ogburn, P L; Greenleaf, J F

    2001-08-01

    To show that pulsed ultrasound from a clinical ultrasonic imaging system can stimulate the fetus. Stimulation is defined mainly as increased fetal gross body movements in response to excitation. Fetuses of a group of 9 volunteer women (mean gestational age, 33.37 weeks; range, 25-40 weeks) were evaluated for body movement under 3 different conditions: (1) control, with no ultrasound exposure; (2) ultrasound in continuous wave Doppler mode; and (3) pulsed ultrasound in pulsed Doppler and B modes. A conventional external fetal monitor, with negligible ultrasonic output, was used to monitor fetal gross body motions. After an initial rest period of 3 minutes with 1 or no fetal motion, fetuses were monitored for an additional 3 minutes under the exposure criterion defined for each condition. Resulting fetal motions under the 3 conditions were compared using the Wilcoxon signed rank test. The test showed that fetuses moved significantly more frequently under condition 3 (mean +/- SD, 3.43 +/- 1.93 movements per minute) than under condition 1 (0.40 +/- 7.33 movements per minute) or condition 2 (0.63 +/- 7.67 movements per minute); P = .004 and .016, respectively. Fetal movements under conditions 1 and 2 did not differ significantly. Diagnostic ultrasound may stimulate fetal body motion.

  11. MRI of fetal acquired brain lesions

    International Nuclear Information System (INIS)

    Prayer, Daniela; Brugger, Peter C.; Kasprian, Gregor; Witzani, Linde; Helmer, Hanns; Dietrich, Wolfgang; Eppel, Wolfgang; Langer, Martin

    2006-01-01

    Acquired fetal brain damage is suspected in cases of destruction of previously normally formed tissue, the primary cause of which is hypoxia. Fetal brain damage may occur as a consequence of acute or chronic maternal diseases, with acute diseases causing impairment of oxygen delivery to the fetal brain, and chronic diseases interfering with normal, placental development. Infections, metabolic diseases, feto-fetal transfusion syndrome, toxic agents, mechanical traumatic events, iatrogenic accidents, and space-occupying lesions may also qualify as pathologic conditions that initiate intrauterine brain damage. MR manifestations of acute fetal brain injury (such as hemorrhage or acute ischemic lesions) can easily be recognized, as they are hardly different from postnatal lesions. The availability of diffusion-weighted sequences enhances the sensitivity in recognizing acute ischemic lesions. Recent hemorrhages are usually readily depicted on T2 (*) sequences, where they display hypointense signals. Chronic fetal brain injury may be characterized by nonspecific changes that must be attributable to the presence of an acquired cerebral pathology. The workup in suspected acquired fetal brain injury also includes the assessment of extra-CNS organs that may be affected by an underlying pathology. Finally, the placenta, as the organ that mediates oxygen delivery from the maternal circulation to the fetus, must be examined on MR images

  12. Fetal Primary Cardiac Tumors During Perinatal Period

    Directory of Open Access Journals (Sweden)

    Shi-Min Yuan

    2017-06-01

    Full Text Available Fetal primary cardiac tumors are rare, but they may cause complications, which are sometimes life threatening, including arrhythmias, hydrops fetalis, ventricular outflow/inflow obstruction, cardiac failure, and even sudden death. Among fetal primary cardiac tumors, rhabdomyomas are most common, followed by teratomas, fibromas, hemangiomas, and myxomas. Everolimus, a mammalian target of rapamycin inhibitor, has been reported to be an effective drug to cause tumor remission in three neonates with multiple cardiac rhabdomyomas. Neonatal cardiac surgery for the resection of primary cardiac tumors found by fetal echocardiography has been reported sporadically. However, open fetal surgery for pericardial teratoma resection, which was performed successfully via a fetal median sternotomy in one case report, could be a promising intervention to rescue these patients with large pericardial effusions. These recent achievements undoubtedly encourage further development in early management of fetal cardiac tumors. Owing to the rarity of fetal primary cardiac tumors, relevant information in terms of prenatal diagnosis, treatment, and prognosis remains to be clarified.

  13. First Trimester Fetal Gender Assignment by Ultrasound

    Directory of Open Access Journals (Sweden)

    Sabahattin Altunyurt

    2010-03-01

    Full Text Available Objective: To investigate the efficiency of genital tubercule angle on detecting fetal gender in first trimester by ultrasonography. Material-Method: Fetal sex assignment by ultrasound was carried out in 172 pregnancies at 11-13+6 weeks between 2007 June and 2007 December. Gestational age was determined by the measurement of crown-rump length (CRL. The ultrasound predictions were compared with actual sex at birth. Mid-sagittal planes of a section of the fetal genital tubercle were performed to identify the gender. Results: 155 of 172 patients’ data were achieved. The overall success rate was 92.3 % in sonographic assignment of fetal sex. The correct assignment rate in female fetuses was significantly higher than males (95.9 % - 88.8 % [p=0,001]. The correct identification of fetal sex improved with advancing gestational age from 89.3 % between 11-11+6 weeks, 92.5 % between 12-12+6 weeks and 93.4 % between 13-13+6 weeks (p=0,96. Conclusion: The fetal sex assignment by ultrasonography between 11-13+6 weeks had high success rate. The sensitivity of fetal sex assignment was not affected with fetus position and gestational age.

  14. MRI of fetal acquired brain lesions

    Energy Technology Data Exchange (ETDEWEB)

    Prayer, Daniela [Department of Radiodiagnostics, Medical University of Vienna (Austria)]. E-mail: daniela.prayer@meduniwien.ac.at; Brugger, Peter C. [Center of Anatomy and Cell Biology, Medical University of Vienna (Austria); Kasprian, Gregor [Department of Radiodiagnostics, Medical University of Vienna (Austria); Witzani, Linde [Department of Radiodiagnostics, Medical University of Vienna (Austria); Helmer, Hanns [Department of Obstetrics and Gynecology, Medical University of Vienna (Austria); Dietrich, Wolfgang [Department of Neurosurgery, Medical University of Vienna (Austria); Eppel, Wolfgang [Department of Obstetrics and Gynecology, Medical University of Vienna (Austria); Langer, Martin [Department of Obstetrics and Gynecology, Medical University of Vienna (Austria)

    2006-02-15

    Acquired fetal brain damage is suspected in cases of destruction of previously normally formed tissue, the primary cause of which is hypoxia. Fetal brain damage may occur as a consequence of acute or chronic maternal diseases, with acute diseases causing impairment of oxygen delivery to the fetal brain, and chronic diseases interfering with normal, placental development. Infections, metabolic diseases, feto-fetal transfusion syndrome, toxic agents, mechanical traumatic events, iatrogenic accidents, and space-occupying lesions may also qualify as pathologic conditions that initiate intrauterine brain damage. MR manifestations of acute fetal brain injury (such as hemorrhage or acute ischemic lesions) can easily be recognized, as they are hardly different from postnatal lesions. The availability of diffusion-weighted sequences enhances the sensitivity in recognizing acute ischemic lesions. Recent hemorrhages are usually readily depicted on T2 (*) sequences, where they display hypointense signals. Chronic fetal brain injury may be characterized by nonspecific changes that must be attributable to the presence of an acquired cerebral pathology. The workup in suspected acquired fetal brain injury also includes the assessment of extra-CNS organs that may be affected by an underlying pathology. Finally, the placenta, as the organ that mediates oxygen delivery from the maternal circulation to the fetus, must be examined on MR images.

  15. Advanced MRI techniques of the fetal brain

    International Nuclear Information System (INIS)

    Schoepf, V.; Dittrich, E.; Berger-Kulemann, V.; Kasprian, G.; Kollndorfer, K.; Prayer, D.

    2013-01-01

    Evaluation of the normal and pathological fetal brain. Magnetic resonance imaging (MRI). Advanced MRI of the fetal brain. Diffusion tensor imaging (DTI) is used in clinical practice, all other methods are used at a research level. Serving as standard methods in the future. Combined structural and functional data for all gestational ages will allow more specific insight into the developmental processes of the fetal brain. This gain of information will help provide a common understanding of complex spatial and temporal procedures of early morphological features and their impact on cognitive and sensory abilities. (orig.) [de

  16. Fetal abuse and neglect: an emerging controversy.

    Science.gov (United States)

    Landwirth, J

    1987-04-01

    Advances in fetal medicine have expanded opportunities for protection of fetal health and intrauterine management of an increasing number of fetal disorders. The legal rights and duties of parents to provide necessary medical treatment for the child may extend to the prenatal period. Resolution of the conflict between the rights of the fetus to be born healthy and the pregnant woman's right of privacy is difficult and controversial. It is suggested that intrusion into a woman's individual fundamental rights for the potential benefit of her fetus should be permissible only in narrowly defined circumstances.

  17. Real-Time Automatic Fetal Brain Extraction in Fetal MRI by Deep Learning

    OpenAIRE

    Salehi, Seyed Sadegh Mohseni; Hashemi, Seyed Raein; Velasco-Annis, Clemente; Ouaalam, Abdelhakim; Estroff, Judy A.; Erdogmus, Deniz; Warfield, Simon K.; Gholipour, Ali

    2017-01-01

    Brain segmentation is a fundamental first step in neuroimage analysis. In the case of fetal MRI, it is particularly challenging and important due to the arbitrary orientation of the fetus, organs that surround the fetal head, and intermittent fetal motion. Several promising methods have been proposed but are limited in their performance in challenging cases and in real-time segmentation. We aimed to develop a fully automatic segmentation method that independently segments sections of the feta...

  18. Fetal thrombocytopenia in pregnancies with fetal human parvovirus-B19 infection.

    Science.gov (United States)

    Melamed, Nir; Whittle, Wendy; Kelly, Edmond N; Windrim, Rory; Seaward, P Gareth R; Keunen, Johannes; Keating, Sarah; Ryan, Greg

    2015-06-01

    Fetal infection with human parvovirus B19 (hParvo-B19) has been associated mainly with fetal anemia, although data regarding other fetal hematologic effects are limited. Our aim was to assess the rate and consequences of severe fetal thrombocytopenia after fetal hParvo-B19 infection. We conducted a retrospective study of pregnancies that were complicated by fetal hParvo-B19 infection that underwent fetal blood sampling (FBS). The characteristics and outcomes of fetuses with severe thrombocytopenia (B19 infection. A total of 37 pregnancies that were affected by fetal hParvo-B19 infection were identified. Of the 29 cases that underwent FBS and had information regarding fetal platelets, 11 cases (38%) were complicated by severe fetal thrombocytopenia. Severely thrombocytopenic fetuses were characterized by a lower hemoglobin concentration (2.6 ± 0.9 g/dL vs 5.5 ± 3.6 g/dL; P = .01), lower reticulocyte count (9.1% ± 2.8% vs 17.3% ± 10.6%; P = .02), and lower gestational age at the time of diagnosis (21.4 ± 3.1 wk vs 23.6 ± 2.2 wk; P = .03). Both the fetal death rate within 48 hours of FBS (27.3% vs 0%; P = .02) and the risk of prematurity (100.0% vs 13.3%; P B19 infection, can be further worsened by IUT, and may be associated with an increased risk of procedure-related fetal loss after either FBS or IUT. Copyright © 2015. Published by Elsevier Inc.

  19. Methane release

    International Nuclear Information System (INIS)

    Seifert, M.

    1999-01-01

    The Swiss Gas Industry has carried out a systematic, technical estimate of methane release from the complete supply chain from production to consumption for the years 1992/1993. The result of this survey provided a conservative value, amounting to 0.9% of the Swiss domestic output. A continuation of the study taking into account new findings with regard to emission factors and the effect of the climate is now available, which provides a value of 0.8% for the target year of 1996. These results show that the renovation of the network has brought about lower losses in the local gas supplies, particularly for the grey cast iron pipelines. (author)

  20. Fetal magnetic resonance imaging: methods and techniques; Fetale Magnetresonanztomographie: Methoden und Technik

    Energy Technology Data Exchange (ETDEWEB)

    Brugger, P.C. [Zentrum fuer Anatomie und Zellbiologie, Medizinische Universitaet Wien (Austria). Arbeitsgruppe Integrative Morphologie; Stuhr, F.; Lindner, C.; Prayer, D. [Medizinische Universitaet Wien (Austria). Klinik fuer Radiodiagnostik

    2006-02-15

    Since the introduction of fetal magnetic resonance imaging (MRI) into prenatal diagnostics, advances in coil technology and development of ultrafast sequences have further enhanced this technique. At present numerous sequences are available to visualize the whole fetus with high resolution and image quality, even in late stages of pregnancy. Taking into consideration the special circumstances of examination and adjusting sequence parameters to gestational age, fetal anatomy can be accurately depicted. The variety of sequences also allows further characterization of fetal tissues and pathologies. Fetal MRI not only supplies additional information to routine ultrasound studies, but also reveals fetal morphology and pathology in a way hitherto not possible. (orig.) [German] Seit Einfuehrung der fetalen Magnetresonanztomographie (MRT) in die praenatale Diagnostik wurde das Verfahren durch neue Spulentechniken und die Entwicklung ultraschneller Sequenzen kontinuierlich weiter entwickelt. Gegenwaertig steht eine Vielzahl von Sequenzen zur Verfuegung, die es erlauben, mit hoher Bildqualitaet und raeumlicher Aufloesung selbst in fortgeschrittenen Schwangerschaftsstadien den gesamten Feten darzustellen. Unter Beruecksichtigung der speziellen Untersuchungsbedingungen und des Schwangerschaftsalters kann so die fetale Anatomie genau abgebildet werden. Die Vielfalt an Sequenzen und deren gezielter Einsatz ermoeglichen es weiter, fetale Gewebe und Pathologien naeher zu charakterisierten. Auf diese Weise liefert die fetale MRT nicht nur Zusatzinformationen zur Routineultraschalluntersuchung, sie gibt auch Aufschluss ueber bestimmte fetale Morphologien und Pathologien, die bisher nicht darstellbar waren. (orig.)

  1. Indications and technique of fetal magnetic resonance imaging

    International Nuclear Information System (INIS)

    Asenbaum, U.; Woitek, R.; Furtner, J.; Prayer, D.; Brugger, P.C.

    2013-01-01

    Evaluation and confirmation of fetal pathologies previously suspected or diagnosed with ultrasound. Ultrasound and magnetic resonance imaging (MRI). Technique for prenatal fetal examination. Fetal MRI is an established supplementary technique to prenatal ultrasound. Fetal MRI should only be used as an additional method in prenatal diagnostics and not for routine screening. Fetal MRI should only be performed in perinatal medicine centers after a previous level III ultrasound examination. (orig.) [de

  2. Fetal responses to induced maternal relaxation during pregnancy

    OpenAIRE

    DiPietro, Janet A.; Costigan, Kathleen A.; Nelson, Priscilla; Gurewitsch, Edith D.; Laudenslager, Mark L.

    2007-01-01

    Fetal responses to induced maternal relaxation during the 32nd week of pregnancy were recorded in 100 maternal-fetal pairs using a digitized data collection system. The 18-minute guided imagery relaxation manipulation generated significant changes in maternal heart rate, skin conductance, respiration period, and respiratory sinus arrhythmia. Significant alterations in fetal neurobehavior were observed, including decreased fetal heart rate (FHR), increased FHR variability, suppression of fetal...

  3. Factors Related to Fetal Death in Pregnant Women with Cholera, Haiti, 2011–2014

    Centers for Disease Control (CDC) Podcasts

    2016-03-14

    Reginald Tucker reads an abridged version of the EID article Factors Related to Fetal Death in Pregnant Women with Cholera, Haiti, 2011–2014.  Created: 3/14/2016 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 3/14/2016.

  4. Human fetal antehypophysis in vitro. Immunocytological study and radioimmunoassay of LH and FSH

    International Nuclear Information System (INIS)

    Li, J.Y.; Begeot, M.; Dubois, P.M.; Claustrat, B.

    1977-01-01

    Human fetal antehypophysis (16 males, 16 females and 4 unknown sex) were cultivated during several weeks. By immunocytochemistry LH gonadotroph cells were determined with anti-hTSH and anti-pLH serum. The release in vitro of LH and FSH was studied by radioimmunoassay. At the first medium change, the quantity of LH and FSH release was related to the gestational age and sex. A rapid decline of both LH and FSH occured over the 10 first days. There after, a basal release of LH was maintained during several months; the release of FSH was generally maintained at the lower limit of the assay. After 1 month in vitro, the level of LH could not be related to the sex. Release of LH was stimulated by synthetic LRF. A significant increase was observed independently of the sex and age of the fetuses studied [fr

  5. Animal models in fetal medicine and obstetrics

    DEFF Research Database (Denmark)

    Dahl Andersen, Maria; Alstrup, Aage Kristian Olsen; Duvald, Christina Søndergaard

    2018-01-01

    Animal models remain essential to understand the fundamental mechanisms occurring in fetal medicine and obstetric diseases, such as intrauterine growth restriction, preeclampsia and gestational diabetes. These vary regarding the employed method used for induction of the disease, and vary regardin...

  6. Fetal bowel anomalies - US and MR assessment

    Energy Technology Data Exchange (ETDEWEB)

    Rubesova, Erika [Stanford University, Department of Radiology, Lucile Packard Children' s Hospital, Stanford, CA (United States)

    2012-01-15

    The technical quality of prenatal US and fetal MRI has significantly improved during the last decade and allows an accurate diagnosis of bowel pathology prenatally. Accurate diagnosis of bowel pathology in utero is important for parental counseling and postnatal management. It is essential to recognize the US presentation of bowel pathology in the fetus in order to refer the patient for further evaluation or follow-up. Fetal MRI has been shown to offer some advantages over US for specific bowel abnormalities. In this paper, we review the normal appearance of the fetal bowel on US and MRI as well as the typical presentations of bowel pathologies. We discuss more specifically the importance of recognizing on fetal MRI the abnormalities of size and T1-weighted signal of the meconium-filled distal bowel. (orig.)

  7. Society for Maternal-Fetal Medicine

    Science.gov (United States)

    ... checklists in obstetrics Coding update of the SMFM definition of low risk for cesarean delivery from ICD- ... DC 20024 Email: smfm@smfm.org © 2000-2017, Society for Maternal-Fetal Medicine. All rights reserved The ...

  8. Fetal MRI of pathological brain development

    International Nuclear Information System (INIS)

    Brugger, P.C.; Prayer, D.

    2006-01-01

    Because of the superior tissue contrast, high spatial resolution, and multiplanar capabilities, fetal magnetic resonance imaging (MRI) can depict fetal brain pathologies with high accuracy. Pathological fetal brain development may result from malformations or acquired conditions. Differentiation of these etiologies is important with respect to managing the actual pregnancy or counseling future pregnancies. As a widened ventricular system is a common hallmark of both maldevelopment and acquired conditions, it may cause problems in the differential diagnosis. Fetal MRI can provide detailed morphological information, which allows refinement of the diagnosis of ventricular enlargement in a large number of cases. Systematic work-up of morphological details that may be recognized on MR images provides an approach for achieving a correct diagnosis in cases of ventricle enlargement. (orig.) [de

  9. Piracetam for fetal distress in labour.

    Science.gov (United States)

    Hofmeyr, G Justus; Kulier, Regina

    2012-06-13

    Piracetam is thought to promote the metabolism of brain cells when they are hypoxic. It has been used to prevent adverse effects of fetal distress. The objective of this review was to assess the effects of piracetam for suspected fetal distress in labour on method of delivery and perinatal morbidity. We searched the Cochrane Pregnancy and Childbirth Group's Trials Register (15 February 2012). Randomised trials of piracetam compared with placebo or no treatment for suspected fetal distress in labour. Both review authors assessed eligibility and trial quality. One study of 96 women was included. Piracetam compared with placebo was associated with a trend to reduced need for caesarean section (risk ratio 0.57, 95% confidence interval 0.32 to 1.03). There were no statistically significant differences between the piracetam and placebo group for neonatal morbidity (measured by neonatal respiratory distress) or Apgar score. There is not enough evidence to evaluate the use of piracetam for fetal distress in labour.

  10. Evaluation of fetal anomalies with MR imaging

    International Nuclear Information System (INIS)

    Benson, R.C.; Platt, L.D.; Colletti, P.M.; Raval, J.K.; Boswell, W.D. Jr.; Halls, J.M.

    1987-01-01

    Twenty pregnant women underwent MR imaging (0.5 T) after US disclosed a significant fetal anomaly. The ability of MR imaging to depict the abnormalities was assessed. Of 20 abnormalities, 17 were visualized with MR imaging. Abnormalities included conjoined twins, omphalocele, gastroschisis, hydrocephalus, hydronephrosis, fetal ascites, facial teratoma, anencephaly, bladder outlet obstruction, thanatophoric dwarfism, cystic, hygroma, and fetal ovarian cyst. Thirteen of 14 abnormalities in third-trimester fetuses were visualized, as were four of six abnormalities in second-trimester fetuses. Associated polyhydramnios or oligohydramnios was evident in six of six cases. Anomalies were best delineated with T1-weighted sequences. The study suggests that MR imaging is potentially useful as a complementary imaging modality in the evaluation of fetal anomalies

  11. [Effect of music on fetal behaviour].

    Science.gov (United States)

    Malinova, M; Malinova, M

    2004-01-01

    Antenatal music stimulation shown to elicit fetal heart rate and body movement responses, indicating that prenatal experience with music influences auditory functional development. The slower tempo resulted in less movement variation.

  12. Fetal MR imaging of Kniest dysplasia

    International Nuclear Information System (INIS)

    Yazici, Zeynep; Kline-Fath, Beth M.; Laor, Tal; Tinkle, Bradley T.

    2010-01-01

    We present a case of Kniest dysplasia, a rare form of the type II collagenopathies, with prenatal MRI. Sonography revealed only short limbs in the fetus. Fetal MRI findings included enlarged hyaline cartilaginous structures with abnormally high T2 signal intensity, delayed ossification of the pubic and ischial bones, and platyspondyly. By delineating the cartilaginous abnormalities, fetal MRI can contribute to the prenatal diagnosis of chondrodysplasias. (orig.)

  13. Metabolomics Application in Maternal-Fetal Medicine

    OpenAIRE

    Fanos, Vassilios; Atzori, Luigi; Makarenko, Karina; Melis, Gian Benedetto; Ferrazzi, Enrico

    2013-01-01

    Metabolomics in maternal-fetal medicine is still an “embryonic” science. However, there is already an increasing interest in metabolome of normal and complicated pregnancies, and neonatal outcomes. Tissues used for metabolomics interrogations of pregnant women, fetuses and newborns are amniotic fluid, blood, plasma, cord blood, placenta, urine, and vaginal secretions. All published papers highlight the strong correlation between biomarkers found in these tissues and fetal malformations, prete...

  14. Fetal Exposure to Environmental Neurotoxins in Taiwan

    OpenAIRE

    Jiang, Chuen-Bin; Hsi, Hsing-Cheng; Fan, Chun-Hua; Chien, Ling-Chu

    2014-01-01

    Mercury (Hg), lead (Pb), cadmium (Cd), and arsenic (As) are recognized neurotoxins in children that particularly affect neurodevelopment and intellectual performance. Based on the hypothesis that the fetal basis of adult disease is fetal toxic exposure that results in adverse outcomes in adulthood, we explored the concentrations of key neurotoxins (i.e., Hg, Pb, Cd, and As) in meconium to identify the risk factors associated with these concentrations. From January 2007 to December 2009, 545 m...

  15. Impact of Oxidative Stress in Fetal Programming

    OpenAIRE

    Thompson, Loren P.; Al-Hasan, Yazan

    2012-01-01

    Intrauterine stress induces increased risk of adult disease through fetal programming mechanisms. Oxidative stress can be generated by several conditions, such as, prenatal hypoxia, maternal under- and overnutrition, and excessive glucocorticoid exposure. The role of oxidant molecules as signaling factors in fetal programming via epigenetic mechanisms is discussed. By linking oxidative stress with dysregulation of specific target genes, we may be able to develop therapeutic strategies that pr...

  16. Impact of Oxidative Stress in Fetal Programming

    Directory of Open Access Journals (Sweden)

    Loren P. Thompson

    2012-01-01

    Full Text Available Intrauterine stress induces increased risk of adult disease through fetal programming mechanisms. Oxidative stress can be generated by several conditions, such as, prenatal hypoxia, maternal under- and overnutrition, and excessive glucocorticoid exposure. The role of oxidant molecules as signaling factors in fetal programming via epigenetic mechanisms is discussed. By linking oxidative stress with dysregulation of specific target genes, we may be able to develop therapeutic strategies that protect against organ dysfunction in the programmed offspring.

  17. Fetal MR imaging of Kniest dysplasia

    Energy Technology Data Exchange (ETDEWEB)

    Yazici, Zeynep [Uludag University, Faculty of Medicine, Department of Radiology, Gorukle (Turkey); Kline-Fath, Beth M.; Laor, Tal [Cincinnati Children' s Hospital Medical Center, Department of Radiology, Cincinnati, OH (United States); Tinkle, Bradley T. [Cincinnati Children' s Hospital Medical Center, Division of Human Genetics, Cincinnati, OH (United States)

    2010-03-15

    We present a case of Kniest dysplasia, a rare form of the type II collagenopathies, with prenatal MRI. Sonography revealed only short limbs in the fetus. Fetal MRI findings included enlarged hyaline cartilaginous structures with abnormally high T2 signal intensity, delayed ossification of the pubic and ischial bones, and platyspondyly. By delineating the cartilaginous abnormalities, fetal MRI can contribute to the prenatal diagnosis of chondrodysplasias. (orig.)

  18. Maternal methadone dosing schedule and fetal neurobehavior

    Science.gov (United States)

    Jansson, Lauren M.; DiPietro, Janet A.; Velez, Martha; Elko, Andrea; Knauer, Heather; Kivlighan, Katie T.

    2008-01-01

    Objective Daily methadone maintenance is the standard of care for opiate dependency during pregnancy. Previous research has indicated that single-dose maternal methadone administration significantly suppresses fetal neurobehaviors. The purpose of this study was to determine if split-dosing would have less impact on fetal neurobehavior than single-dose administration. Methods Forty methadone-maintained women were evaluated at peak and trough maternal methadone levels on single- and split-dosing schedules. Monitoring sessions occurred at 36 and 37 weeks gestation in a counterbalanced study design. Fetal measures included heart rate, variability, accelerations, motor activity and fetal movement-heart rate coupling (FM-FHR). Maternal measures included heart period, variability, skin conductance, respiration and vagal tone. Repeated measure analysis of variance was used to evaluate within-subject changes between split- and single-dosing regimens. Results All fetal neurobehavioral parameters were suppressed by maternal methadone administration, regardless of dosing regimen. Fetal parameters at peak were significantly lower during single vs. split methadone administration. FM-FHR coupling was less suppressed from trough to peak during split-dosing vs. single-dosing. Maternal physiologic parameters were generally unaffected by dosing condition. Conclusion Split- dosed fetuses displayed less neurobehavioral suppression from trough to peak maternal methadone levels as compared to single-dosed fetuses. Split-dosing may be beneficial for methadone-maintained pregnant women. PMID:19085624

  19. Ultrasonographic Findings of Fetal Congenital Intracranial Teratoma

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hak Jong [Seoul National University College of Medicine, Seoul (Korea, Republic of); Lee, Young Ho; Song, Mi Jin; Cho, Jeong Yeon; Min, Jee Yeon; Moon, Min Hwan; Kim, Jeong Ah [Seoul National University Bundang Hospital, Seongnam (Korea, Republic of)

    2005-06-15

    To evaluate the sonographic findings of fetal congenital intracranial teratoma. From 1994 to 2002, of the 11 fetuses which had been diagnosed with fetal intracranial tumors after second level fetal ultrasonography, the six that were confirmed after autopsy as congenital intracranial teratomas were included in our study. The sonographic findings, including size, homogeneity, echogenicity compared with surrounding normal brain tissues, cystic components, and tumor related calcification, were retrospectively evaluated. The incidence of fetal congenital intracranial teratoma out of all fetal intracranial tumors was 54.5% (6 of 11 cases) during the 8-year period. The mean mass size was 7.4 cm (3.0-15.0 cm). Two thirds of (4/6) of the teratoma cases showed high echogenicity compared with normal brain tissues, and two thirds (4/6) showed heterogeneous echogenicity. Four teratoma cases (67%) showed cysts in the mass with a mean size of 1.9cm. One third (2/6) showed calcifications within the tumor. Out of the six cases, two had oropharyngeal teratoma with extension into the intracranial portion (so called epignathus) and showed homogenous mass without any cysts or calcifications. The typical sonographic appearance of intracranial teratoma was a heterogeneous, hyperechoic mass with cysts. In the epignathus cases, the sonographic appearances differed somewhat from the others. An understanding of the sonographic findings of fetal intracranial teratoma will help in the timely counseling of the parents and in obstetric decision making

  20. The Use of Fetal Noninvasive Electrocardiography

    Directory of Open Access Journals (Sweden)

    Igor Lakhno

    2016-01-01

    Full Text Available Preeclampsia (PE is one of the severe complications of pregnancy that leads to fetal deterioration. The aim was to survey the validity of fetal distress diagnostics in case of Doppler ultrasonic umbilical vein and arteries blood flow velocity investigation and ECG parameters analysis obtained from maternal abdominal signal before labor in preeclamptic patients. Fetal noninvasive ECG and umbilical arterial and venous Doppler investigation were performed in 120 patients at 34–40 weeks of gestation. And 30 of them had physiological gestation and were involved in Group I. In Group II 52 pregnant women with mild-moderate PE were observed. 38 patients with severe PE were monitored in Group III. The most considerable negative correlation was determined in pair Apgar score 1 versus T/QRS (R=-0.50; p<0.05. So the increased T/QRS ratio was the most evident marker of fetal distress. Fetal noninvasive ECG showed sensitivity of 96.6% and specificity of 98.4% and, therefore, was determined as more accurate method for fetal monitoring.

  1. Biomedical Instruments for Fetal and Neonatal Surveillance

    International Nuclear Information System (INIS)

    Rolfe, P; Scopesi, F; Serra, G

    2006-01-01

    Specialised instruments have been developed to aid the care of the fetus and the newborn baby. Miniature sensors using optical, electrical, chemical, mechanical and magnetic principles have been produced for capturing key measurands. These include temperature, pressure, flow and dimension, as well as several specific molecules such as glucose, oxygen and carbon dioxide. During pregnancy ultrasound imaging and blood flow techniques provide valuable information concerning fetal abnormalities, fetal growth, fetal breathing and fetal heart rate. Signal processing and pattern recognition can be useful for deriving indicators of fetal distress and clinical status, based on biopotentials as well as ultrasound signals. Fetal pH measurement is a critical requirement during labour and delivery. The intensive care of ill preterm babies involves provision of an optimal thermal environment and respiratory support. Monitoring of blood gas and acid-base status is essential, and this involves both blood sampling for in vitro analysis as well as the use of invasive or non-invasive sensors. For the future it will be vital that the technologies used are subjected to controlled trials to establish benefit or otherwise

  2. Maternal feeding controls fetal biological clock.

    Directory of Open Access Journals (Sweden)

    Hidenobu Ohta

    Full Text Available BACKGROUND: It is widely accepted that circadian physiological rhythms of the fetus are affected by oscillators in the maternal brain that are coupled to the environmental light-dark (LD cycle. METHODOLOGY/PRINCIPAL FINDINGS: To study the link between fetal and maternal biological clocks, we investigated the effects of cycles of maternal food availability on the rhythms of Per1 gene expression in the fetal suprachiasmatic nucleus (SCN and liver using a transgenic rat model whose tissues express luciferase in vitro. Although the maternal SCN remained phase-locked to the LD cycle, maternal restricted feeding phase-advanced the fetal SCN and liver by 5 and 7 hours respectively within the 22-day pregnancy. CONCLUSIONS/SIGNIFICANCE: Our results demonstrate that maternal feeding entrains the fetal SCN and liver independently of both the maternal SCN and the LD cycle. This indicates that maternal-feeding signals can be more influential for the fetal SCN and particular organ oscillators than hormonal signals controlled by the maternal SCN, suggesting the importance of a regular maternal feeding schedule for appropriate fetal molecular clockwork during pregnancy.

  3. The negative impact of Wnt signaling on megakaryocyte and primitive erythroid progenitors derived from human embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Prasuna Paluru

    2014-03-01

    Full Text Available The Wnt gene family consists of structurally related genes encoding secreted signaling molecules that have been implicated in many developmental processes, including regulation of cell fate and patterning during embryogenesis. Previously, we found that Wnt signaling is required for primitive or yolk sac-derived-erythropoiesis using the murine embryonic stem cell (ESC system. Here, we examine the effect of Wnt signaling on the formation of early hematopoietic progenitors derived from human ESCs. The first hematopoietic progenitor cells in the human ESC system express the pan-hematopoietic marker CD41 and the erythrocyte marker, glycophorin A or CD235. We have developed a novel serum-free, feeder-free, adherent differentiation system that can efficiently generate large numbers of CD41 + CD235+ cells. We demonstrate that this cell population contains progenitors not just for primitive erythroid and megakaryocyte cells but for the myeloid lineage as well and term this population the primitive common myeloid progenitor (CMP. Treatment of mesoderm-specified cells with Wnt3a led to a loss of hematopoietic colony-forming ability while the inhibition of canonical Wnt signaling with DKK1 led to an increase in the number of primitive CMPs. Canonical Wnt signaling also inhibits the expansion and/or survival of primitive erythrocytes and megakaryocytes, but not myeloid cells, derived from this progenitor population. These findings are in contrast to the role of Wnt signaling during mouse ESC differentiation and demonstrate the importance of the human ESC system in studying species-specific differences in development.

  4. Nuclear factor erythroid 2-related factor 2 deletion impairs glucose tolerance and exacerbates hyperglycemia in type 1 diabetic mice.

    Science.gov (United States)

    Aleksunes, Lauren M; Reisman, Scott A; Yeager, Ronnie L; Goedken, Michael J; Klaassen, Curtis D

    2010-04-01

    The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic beta-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum beta-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels.

  5. Inhibition of erythroid cell growth by allogeneic murine lymphocytes. Evidence for a synergism between lymph node cells and thymocytes

    International Nuclear Information System (INIS)

    Blomgren, H.; Jacobsson, H.

    1974-01-01

    Murine lymphoid cells from thymus and lymph nodes were tested for synergistic response in a graft-vs-host test. The test is based on the principle that allogeneic lymphocytes inhibit erythroid cell proliferation in the spleens of irradiated mice infused with syngeneic bone marrow cells. Mixtures of thymocytes and lymph node cells from the same parental strain yielded graft-vs-host responses in irradiated F 1 -hybrids higher than expected by summing the responses of the two cell populations tested separately. A similar synergistic response was obtained using mixtures of thymocytes and lymph node cells obtained from the two parental strains of the hybrid, whereas such an effect was not detected using mixtures of lymph node cells or mixtures of thymocytes from the two parental strains. Nor could synergy be demonstrated between parental strain lymph node cells and thymocytes syngeneic with the bone marrow target cells. Thymocytes obtained from one parental strain which was injected into its irradiated F 1 -hybrid transformed into a population of sensitized cells in the spleens of the recipients. This transformation was suppressed by the simultaneous injection of lymph node cells from the second parental strain. Since there is a synergistic immune response by such cell mixtures it is concluded that thymocytes may enhance the graft-vs-host response of lymph node cells. Parental strain thymocytes and lymph node cells, the latter being specifically immunologically tolerant to the bone marrow target cells, failed to give a synergistic response indicating that thymocytes do not transform unresponsive lymphocytes into responsive, but rather enhance the reactivity of existing, specifically responsive cells. The results thus show that thymocytes may enhance the response of lymph node cells in this specific graft-vs-host assay

  6. DJ-1 Modulates Nuclear Erythroid 2-Related Factor-2-Mediated Protection in Human Primary Alveolar Type II Cells in Smokers.

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M; Zhou, Wenbo; Tuder, Rubin M; Freed, Curt R; Chu, Hong Wei; Kelsen, Steven G; Bowler, Russell P; Mason, Robert J; Kosmider, Beata

    2016-09-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2-related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases.

  7. Fetal brain extracellular matrix boosts neuronal network formation in 3D bioengineered model of cortical brain tissue.

    Science.gov (United States)

    Sood, Disha; Chwalek, Karolina; Stuntz, Emily; Pouli, Dimitra; Du, Chuang; Tang-Schomer, Min; Georgakoudi, Irene; Black, Lauren D; Kaplan, David L

    2016-01-01

    The extracellular matrix (ECM) constituting up to 20% of the organ volume is a significant component of the brain due to its instructive role in the compartmentalization of functional microdomains in every brain structure. The composition, quantity and structure of ECM changes dramatically during the development of an organism greatly contributing to the remarkably sophisticated architecture and function of the brain. Since fetal brain is highly plastic, we hypothesize that the fetal brain ECM may contain cues promoting neural growth and differentiation, highly desired in regenerative medicine. Thus, we studied the effect of brain-derived fetal and adult ECM complemented with matricellular proteins on cortical neurons using in vitro 3D bioengineered model of cortical brain tissue. The tested parameters included neuronal network density, cell viability, calcium signaling and electrophysiology. Both, adult and fetal brain ECM as well as matricellular proteins significantly improved neural network formation as compared to single component, collagen I matrix. Additionally, the brain ECM improved cell viability and lowered glutamate release. The fetal brain ECM induced superior neural network formation, calcium signaling and spontaneous spiking activity over adult brain ECM. This study highlights the difference in the neuroinductive properties of fetal and adult brain ECM and suggests that delineating the basis for this divergence may have implications for regenerative medicine.

  8. Antenatal assessment of fetal maturity

    International Nuclear Information System (INIS)

    Gerstner, G.; Reinold, E.; Wolf, G.

    1979-01-01

    334 ultrasound-cephalometries and 231 X-ray fetographies were performed for antenatal assessment of fetal maturity as well as for exact estimation of gestational age in women with unknown date of confinement. The accuracy of the predictions was compared. Ultrasound-cephalometry gave best results when performed until the 20th week of gestation. A correct prediction was obtained in 80.4% of cases. After the 20th week of gestation, the accuracy of prediction decreased. Radiology on the contrary gave optimal results at the end of pregnancy. A correct prediction of the date of confinement was obtained in 73.8% of cases, when the X-ray fetography was performed between the 37th and 40th week of gestation. At the end of gestation radiography should be performed, if there is a discrepancy between ultrasound and clinical estimation or if ultrasound-cephalometry was not carried out in early pregnancy - especially if induction of labour is necessary. (author)

  9. Percutaneously Inject able Fetal Pacemaker: Electrodes, Mechanical Design and Implantation*

    Science.gov (United States)

    Zhou, Li; Chmait, Ramen; Bar-Cohen, Yaniv; Peck, Raymond A.; Loeb, Gerald E.

    2015-01-01

    We are developing a self-contained cardiac pacemaker with a small, cylindrical shape (~3×20mm) that permits it to be implanted percutaneously into a fetus to treat complete heart block and consequent hydrops fetalis, which is otherwise fatal. The device uses off-the-shelf components including a rechargeable lithium cell and a highly efficient relaxation oscillator encapsulated in epoxy and glass. A corkscrew electrode made from activated iridium can be screwed into the myocardium, followed by release of the pacemaker and a short, flexible lead entirely within the chest of the fetus to avoid dislodgement from fetal movement. The feasibility of implanting the device percutaneously under ultrasonic imaging guidance was demonstrated in acute adult rabbit experiments. PMID:23367442

  10. Percutaneously injectable fetal pacemaker: electrodes, mechanical design and implantation.

    Science.gov (United States)

    Zhou, Li; Chmait, Ramen; Bar-Cohen, Yaniv; Peck, Raymond A; Loeb, Gerald E

    2012-01-01

    We are developing a self-contained cardiac pacemaker with a small, cylindrical shape (~3 × 20 mm) that permits it to be implanted percutaneously into a fetus to treat complete heart block and consequent hydrops fetalis, which is otherwise fatal. The device uses off-the-shelf components including a rechargeable lithium cell and a highly efficient relaxation oscillator encapsulated in epoxy and glass. A corkscrew electrode made from activated iridium can be screwed into the myocardium, followed by release of the pacemaker and a short, flexible lead entirely within the chest of the fetus to avoid dislodgement from fetal movement. The feasibility of implanting the device percutaneously under ultrasonic imaging guidance was demonstrated in acute adult rabbit experiments.

  11. Hydroxyurea responsiveness in β-thalassemic patients is determined by the stress response adaptation of erythroid progenitors and their differentiation propensity

    NARCIS (Netherlands)

    F. Pourfarzad, F. (Farzin); M.M. von Lindern (Marieke); A. Azarkeivan (Azita); J. Hou (Jun); S.K. Kia; F. Esteghamat (Fatemehsadat); W.F.J. van IJcken (Wilfred); J.N.J. Philipsen (Sjaak); H. Najmabadi (Hossein); F.G. Grosveld (Frank)

    2013-01-01

    textabstractβ-thalassemia is caused by mutations in the β-globin locus resulting in loss of, or reduced, hemoglobin A (adult hemoglobin, HbA, α2β2) production. Hydroxyurea treatment increases fetal γ-globin (fetal hemoglobin, HbF, α2γ2) expression in postnatal life substituting for the missing adult

  12. Hydroxyurea responsiveness in β-thalassemic patients is determined by the stress response adaptation of erythroid progenitors and their differentiation propensity

    NARCIS (Netherlands)

    Pourfarzad, Farzin; von Lindern, Marieke; Azarkeivan, Azita; Hou, Jun; Kia, Sima Kheradmand; Esteghamat, Fatemehsadat; van Ijcken, Wilfred; Philipsen, Sjaak; Najmabadi, Hossein; Grosveld, Frank

    2013-01-01

    β-thalassemia is caused by mutations in the β-globin locus resulting in loss of, or reduced, hemoglobin A (adult hemoglobin, HbA, α2β2) production. Hydroxyurea treatment increases fetal γ-globin (fetal hemoglobin, HbF, α2γ2) expression in postnatal life substituting for the missing adult β-globin

  13. Intrapartum fetal monitoring by ST-analysis of the fetal ECG

    NARCIS (Netherlands)

    Westerhuis, M.E.M.H.

    2010-01-01

    Objective Intrapartum fetal monitoring aims to identify fetuses at risk for neonatal and long-term injury due to asphyxia. To serve this purpose, cardiotocography (CTG) combined with ST-analysis of the fetal electrocardiogram (ECG), which is a relatively new method, may be used. The main aim of this

  14. The number of fetal cells in maternal blood is associated to exercise and fetal gender

    DEFF Research Database (Denmark)

    Schlütter, Jacob Mørup; Kirkegaard, Ida; Christensen, Connie Britta

    Introduction: We have established a robust method to specifically identify and isolate a placental fetal cell in maternal blood (fcmbs) at a gestational age of 12 weeks. The concentration of these cells, however, varies considerably among pregnant women (median 3 fcmbs/30 mL blood, range 0...... activity was obtained by a questionnaire and a structured interview. The number of fcmbs was assessed in 30 mL blood processed by a proprietary method developed in-house. Fetal cells in the blood, binding to fetal cell specific antibodies, were initially isolated by magnetic cell sorting. The fetal cells...... vs. 4, p=0.06) decreased the number of fcmbs, whereas coitus the evening before increased the number (4 vs. 3, p=0.11). Conclusion: The number of fcmbs is affected by normal activities. This should be taken into account when planning collection of fetal cells in connection for prenatal diagnosis...

  15. Amniocentesis for fetal lung maturity: will it become obsolete?

    Science.gov (United States)

    Varner, Stephen; Sherman, Craig; Lewis, David; Owens, Sheri; Bodie, Frankie; McCathran, C Eric; Holliday, Nicolette

    2013-01-01

    AMNIOCENTESIS FOR FETAL LUNG MATURITY HAS HISTORICALLY BEEN PERFORMED FOR MANY REASONS: uterine and placental complications, maternal comorbidities, fetal issues, and even obstetric problems. Even though the risks associated with third trimester amniocentesis are extremely low, complications have been documented, including preterm labor, placental abruptions, intrauterine rupture, maternal sepsis, fetal heart rate abnormalities, and fetal-maternal hemorrhage. This review presents the types of tests for fetal lung maturity, presents the indications and tests utilized, and discusses recommendations for when amniocentesis for fetal lung maturity may be appropriate.

  16. Identification of Stages of Erythroid Differentiation in Bone Marrow and Erythrocyte Subpopulations in Blood Circulation that Are Preferentially Lost in Autoimmune Hemolytic Anemia in Mouse.

    Directory of Open Access Journals (Sweden)

    Sreoshi Chatterjee

    Full Text Available Repeated weekly injections of rat erythrocytes produced autoimmune hemolytic anemia (AIHA in C57BL/6 mice after 5-6 weeks. Using the double in vivo biotinylation (DIB technique, recently developed in our laboratory, turnover of erythrocyte cohorts of different age groups during AIHA was monitored. Results indicate a significant decline in the proportion of reticulocytes, young and intermediate age groups of erythrocytes, but a significant increase in the proportion of old erythrocytes in blood circulation. Binding of the autoantibody was relatively higher to the young erythrocytes and higher levels of intracellular reactive oxygen species (ROS were also seen in these cells. Erythropoietic activity in the bone marrows and the spleen of AIHA induced mice was examined by monitoring the relative proportion of erythroid cells at various stages of differentiation in these organs. Cells at different stages of differentiation were enumerated flow cytometrically by double staining with anti-Ter119 and anti-transferrin receptor (CD71 monoclonal antibodies. Erythroid cells in bone marrow declined significantly in AIHA induced mice, erythroblast C being most affected (50% decline. Erythroblast C also recorded high intracellular ROS level along with increased levels of membrane-bound autoantibody. No such decline was observed in spleen. A model of AIHA has been proposed indicating that binding of autoantibodies may not be a sufficient condition for destruction of erythroid cells in bone marrow and in blood circulation. Last stage of erythropoietic differentiation in bone marrow and early stages of erythrocytes in blood circulation are specifically susceptible to removal in AIHA.

  17. INTRAUTERINE FETAL DEATH CASES AT TERTIARY CENTER

    Directory of Open Access Journals (Sweden)

    Babu Lal Bishnoi

    2018-01-01

    Full Text Available BACKGROUND Intrauterine fetal death is a tragic event for the parents and a great cause of stress for the caregiver. It is an important indicator of maternal and perinatal health of a given population. This study was undertaken to study the maternal and fetal factors associated with intrauterine fetal death. Aim and Objective- This was an Analytical study aimed to evaluate and understand the prevalence, socio-epidemiological and etiological factors of IUFD methodology should not be mixed with aims and objectives MATERIALS AND METHODS The study was carried out at March 2017 to June 2017 (4 months study which was conducted at Dr. S. N. Medical College, Jodhpur, Rajasthan. The details were entered in a preformed proforma. IUD is defined as fetal death beyond 20 weeks of gestation and/or birth weight >500g. The details of complaints at admission, obstetrics history, menstrual history, examination findings, per vaginal examination findings, mode and method of delivery and fetal outcomes and investigation reports were recorded. RESULTS A total of 227 intrauterine fetal deaths were reported amongst 6264 deliveries conducted during the study period. The incidence rate of intrauterine fetal death was 36/1000 live births. 192 (84.56% deliveries were unbooked and unsupervised and 133 (58.59% belonged to rural population and 126 (55.5% were preterm and 221 (97.55% were singleton pregnancy. Among the identifiable causes hypertensive disorders (24.22% and severe anemia (13.10% were most common followed by placental causes (9.97%. Congenital malformations were responsible for 12.39% and unidentifiable causes were 11.01%. Induction was done in 103 patients, 94 patients had spontaneous onset of labour and caesarean section was done in 30 patients. Incidence of intrauterine foetal demise gradually decreased as parity advanced. CONCLUSION Institutional deliveries should be promoted to prevent intrapartum fetal deaths. Decrease in the incidence of IUD would

  18. Activation of Fetal γ-globin Gene Expression via Direct Protein Delivery of Synthetic Zinc-finger DNA-Binding Domains

    Directory of Open Access Journals (Sweden)

    Mir A Hossain

    2016-01-01

    Full Text Available Reactivation of γ-globin expression has been shown to ameliorate disease phenotypes associated with mutations in the adult β-globin gene, including sickle cell disease. Specific mutations in the promoter of the γ-globin genes are known to prevent repression of the genes in the adult and thus lead to hereditary persistence of fetal hemoglobin. One such hereditary persistence of fetal hemoglobin is associated with a sequence located 567 bp upstream of the Gγ-globin gene which assembles a GATA-containing repressor complex. We generated two synthetic zinc-finger DNA-binding domains (ZF-DBDs targeting this sequence. The -567Gγ ZF-DBDs associated with high affinity and specificity with the target site in the γ-globin gene promoter. We delivered the -567Gγ ZF-DBDs directly to primary erythroid cells. Exposure of these cells to the recombinant -567Gγ ZF-DBDs led to increased expression of the γ-globin gene. Direct protein delivery of ZF-DBDs that compete with transcription regulatory proteins will have broad implications for modulating gene expression in analytical or therapeutic settings.

  19. [Embryo-fetal diseases in multiple pregnancies].

    Science.gov (United States)

    Colla, F; Alba, E; Grio, R

    2001-04-01

    Embryo-fetal diseases are the consequence of prenatal (progenetic and metagenetic or environmental) and intranatal (of a traumatic, infective, toxic nature) pathological factors. In multiple pregnancies this complex etiopathogenesis also includes an altered didymous embriogenesis. This study aimed to evaluate the pathologies affecting the fetus in multiple pregnancy, a special biological situation leading to the potential onset of severe fetal and neonatal damage. The authors studied 205 patients with multiple pregnancies, including 199 bigeminal, 5 trigeminal and 1 quadrigeminal, admitted to the Department B of the Obstetrics and Gynecological Clinic of Turin University between 1989-1999. Possible embyro-fetal damage was examined using a chronological criterion: namely following the development of the multiple fetuses from the zygotic to the neonatal phase. Pregnancies were biamniotic bichorionic in 54% of cases, biamniotic monochorionic in 45% and monochorionic monoamniotic in 1%. There were a total of 154 (79.38%) premature births out of 194 and neonatal birth weight was always SGA (small for gestational age). 66.84% of newborns were LBW (<2500 g) and 7.14% were VLBW (<1500 g). Fetal mortality (2.29%) was higher than early neonatal mortality (1.53%). Perinatal mortality (3.82%) was three times higher than in all neonates from the same period (1.03%). The severe embryo-fetal and neonatal damage found in multiple pregnancies is a clinical reality that calls for adequate diagnostic and therapeutic measures, and above all specific medical and social prevention to limit maternal pathogenic risks.

  20. Occupational lifting, fetal death and preterm birth

    DEFF Research Database (Denmark)

    Mocevic, Emina; Svendsen, Susanne Wulff; Jørgensen, Kristian Tore

    2014-01-01

    OBJECTIVE: We examined the association between occupational lifting during pregnancy and risk of fetal death and preterm birth using a job exposure matrix (JEM). METHODS: For 68,086 occupationally active women in the Danish National Birth Cohort, interview information on occupational lifting...... the JEM. We used Cox regression models with gestational age as underlying time variable and adjustment for covariates. RESULTS: We observed 2,717 fetal deaths and 3,128 preterm births within the study cohort. No exposure-response relation was observed for fetal death, but for women with a prior fetal...... death, we found a hazard ratio (HR) of 2.87 (95% CI 1.37, 6.01) for stillbirth (fetal death ≥22 completed gestational weeks) among those who lifted >200 kg/day. For preterm birth, we found an exposure-response relation for primigravid women, reaching a HR of 1.43 (95% CI 1.13, 1.80) for total loads >200...

  1. ABO alleles are linked with haplotypes of an erythroid cell-specific regulatory element in intron 1 with a few exceptions attributable to genetic recombination.

    Science.gov (United States)

    Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y

    2016-01-01

    Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles. © 2015 International Society of Blood Transfusion.

  2. The relationship between maternal and fetal vitamin D, insulin resistance, and fetal growth.

    LENUS (Irish Health Repository)

    Walsh, Jennifer M

    2013-05-01

    Evidence for a role of vitamin D in maintaining normal glucose homeostasis is inconclusive. We sought to clarify the relationship between maternal and fetal insulin resistance and vitamin D status. This is a prospective cohort study of 60 caucasian pregnant women. Concentrations of 25-hydroxyvitamin D (25-OHD), glucose, insulin, and leptin were measured in early pregnancy and at 28 weeks. Ultrasound at 34 weeks assessed fetal anthropometry including abdominal wall width, a marker of fetal adiposity. At delivery birth weight was recorded and fetal 25-OHD, glucose, C-peptide, and leptin measured in cord blood. Insulin resistance was calculated using the Homeostasis Model Assessment (HOMA) equation. We found that those with lower 25-OHD in early pregnancy had higher HOMA indices at 28 weeks, (r = -.32, P = .02). No significant relationship existed between maternal or fetal leptin and 25-OHD, or between maternal or fetal 25-OHD and fetal anthropometry or birth weight. The incidence of vitamin D deficiency was high at each time point (15%-45%). These findings lend support to routine antenatal supplementation with vitamin D in at risk populations.

  3. Fetal magnetic resonance imaging of thoracic and abdominal malformations; Fetale Magnetresonanztomographie thorakaler und abdomineller Malformationen

    Energy Technology Data Exchange (ETDEWEB)

    Woitek, R.; Asenbaum, U.; Furtner, J.; Prayer, D. [Medizinische Universitaet Wien, Abteilung fuer Neuroradiologie und Muskuloskelettale Radiologie, Universitaetsklinik fuer Radiodiagnostik, Wien (Austria); Brugger, P.C. [Medizinische Universitaet Wien, Zentrum fuer Anatomie und Zellbiologie, Wien (Austria)

    2013-02-15

    Diagnosis and differential diagnosis of fetal thoracic and abdominal malformations. Ultrasound and magnetic resonance imaging (MRI). In cases of suspected pathologies based on fetal ultrasound MRI can be used for more detailed examinations and can be of assistance in the differential diagnostic process. Improved imaging of anatomical structures and of the composition of different tissues by the use of different MRI sequences. Fetal MRI has become a part of clinical routine in thoracic and abdominal malformations and is the basis for scientific research in this field. In cases of thoracic or abdominal malformations fetal MRI provides important information additional to ultrasound to improve diagnostic accuracy, prognostic evaluation and surgical planning. (orig.) [German] Diagnose und Differenzialdiagnose fetaler thorakaler und abdomineller Malformationen. Ultraschall, MRT. MRT zur weiteren Abklaerung und genaueren Differenzierung bei vielen im Ultraschall gestellten Verdachtsdiagnosen. Verbesserte anatomische Darstellung mittels MRT und Darstellung unterschiedlicher Gewebezusammensetzung mittels verschiedener MR-Sequenzen. Die fetale MRT ist bei der angegebenen Fragestellung in die klinische Routine eingegangen und liefert weiterhin die Basis fuer wissenschaftliche Untersuchungen in diesem Bereich. Die fetale MRT liefert beim Vorliegen thorakaler oder abdomineller Malformationen komplementaer zum Ultraschall wichtige Zusatzinformationen, um die diagnostische Genauigkeit zu erhoehen, die Prognoseabschaetzung zu verbessern und ggf. eine bessere chirurgische Planung zu ermoeglichen. (orig.)

  4. Octreotide therapy and restricted fetal growth

    DEFF Research Database (Denmark)

    Geilswijk, Marianne; Andersen, Lise Lotte Torvin; Frost, Morten

    2017-01-01

    that octreotide treatment in pregnancy, as well as hypoglycemia in itself, may pose a risk of fetal growth restriction. During pregnancy, management of blood glucose levels in familial hyperinsulinemic hypoglycemia thus forms a medical dilemma. We report on pregnancy outcomes in a woman with symptomatic familial...... hyperinsulinemic hypoglycemia, type 3. During the patient's first pregnancy with a viable fetus octreotide treatment was instituted in gestational age 23 weeks to prevent severe hypoglycemic incidences. Fetal growth velocity declined, and at 37 weeks of gestation, intrauterine growth retardation was evident...... growth velocity was normal. We conclude that octreotide treatment during pregnancy may pose a risk of fetal growth restriction and warrants careful consideration. In some cases of familial hyperinsulinemic hypoglycemia, blood glucose levels can be successfully managed through diet only, also during...

  5. STORY AND HISTORY IN FETAL BEHAVIOR RESEARCH.

    Science.gov (United States)

    Brakke, Karen

    2015-09-01

    In their monograph, DiPietro, Costigan, and Voegtline present an important and thoughtful portrait of low-risk fetal development during the last trimester of gestation, and they also pay tribute to the Fels Longitudinal Study investigators' early work in this area. In this commentary, the history and legacy of the Fels Institute is further explored within the broader context of fetal research, and DiPietro et al.'s findings are placed in alignment with contemporary dynamic systems' theoretical approaches that emphasize longitudinal analysis of emergent behavior and process during early development. The commentary puts forth the assertion that the work reported by DiPietro and her colleagues tells a story that sets the stage for a new generation of technology-enhanced and culturally expanded investigations of fetal behavior. © 2015 The Society for Research in Child Development, Inc.

  6. Glucocorticoids and fetal programming part 1: Outcomes.

    Science.gov (United States)

    Moisiadis, Vasilis G; Matthews, Stephen G

    2014-07-01

    Fetal development is a critical period for shaping the lifelong health of an individual. However, the fetus is susceptible to internal and external stimuli that can lead to adverse long-term health consequences. Glucocorticoids are an important developmental switch, driving changes in gene regulation that are necessary for normal growth and maturation. The fetal hypothalamic-pituitary-adrenal (HPA) axis is particularly susceptible to long-term programming by glucocorticoids; these effects can persist throughout the life of an organism. Dysfunction of the HPA axis as a result of fetal programming has been associated with impaired brain growth, altered behaviour and increased susceptibility to chronic disease (such as metabolic and cardiovascular disease). Moreover, the effects of glucocorticoid-mediated programming are evident in subsequent generations, and transmission of these changes can occur through both maternal and paternal lineages.

  7. Fetal programming and eating disorder risk.

    Science.gov (United States)

    Jones, Candace; Pearce, Brad; Barrera, Ingrid; Mummert, Amanda

    2017-09-07

    Fetal programming describes the process by which environmental stimuli impact fetal development to influence disease development later in life. Our analysis summarizes evidence for the role of fetal programming in eating disorder etiology through review of studies demonstrating specific obstetric complications and later eating risk of anorexia or bulimia. Using Pubmed, we found thirteen studies investigating obstetric factors and eating disorder risk published between 1999 and 2016. We then discuss modifiable maternal risk factors, including nutrition and stress, that influence anorexia or bulimia risk of their offspring. Translation of these findings applies to preventative strategies by health organizations and physicians to provide optimal health for mothers and their children to prevent development of medical and psychiatric illnesses. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Mechanisms of Fetal Programming in Hypertension

    Directory of Open Access Journals (Sweden)

    John Edward Jones

    2012-01-01

    Full Text Available Events that occur in the early fetal environment have been linked to long-term health and lifespan consequences in the adult. Intrauterine growth restriction (IUGR, which may occur as a result of nutrient insufficiency, exposure to hormones, or disruptions in placental structure or function, may induce the fetus to alter its developmental program in order to adapt to the new conditions. IUGR may result in a decrease in the expression of genes that are responsible for nephrogenesis as nutrients are rerouted to the development of more essential organs. Fetal survival under these conditions often results in low birth weight and a deficit in nephron endowment, which are associated with hypertension in adults. Interestingly, male IUGR offspring appear to be more severely affected than females, suggesting that sex hormones may be involved. The processes of fetal programming of hypertension are complex, and we are only beginning to understand the underlying mechanisms.

  9. Fetal dosimetry in diagnostic radiology

    International Nuclear Information System (INIS)

    Faulkner, K.

    2002-01-01

    Diagnostic radiology examinations are frequently performed in all countries because of the benefit that the patient derives from the resultant diagnosis. Given that so many examinations are performed it is inevitable that there will be occasions when the planned exposure of a woman who is known to be pregnant is contemplated. In these circumstances, there must be rigorous justification of the examination and the procedure itself must be optimised as well. Radiation risks from fetal irradiation are well established. These risks fall into three categories: 1) a cancer induction risk (mainly leukaemia); 2) hereditary effects (as the fetus is a potential parent); 3) a risk of serious mental retardation (if the fetus is exposed in the critical 8-15 weeks period when the forebrain is being developed). Risk factors for these effects have been reviewed by the International Commission on Radiological Protection. Special rules apply to the radiology of women who are or who may be pregnant. These rules have been developed to avoid he unintended irradiation of the fetus. These rules have been variously referred to as the 10-day rule and the 28-day rules, in which radiology of potentially pregnant women is restricted to the first 10 or 28 days following menstruation. It is apparent that the advice provided by national bodies varies, as different rules apply internationally, due presumably to a lack of an international consensus on the subject. The advice from the National Radiological Protection Board, the College of Radiographers and the Royal College of Radiologists applies in the United Kingdom. In summary, the advice is that women of child bearing age are asked before a diagnostic radiology examination in which the pelvis is in, or near, the primary beam are asked if they are, or may be, pregnant. If pregnancy can be excluded then the examination can proceed. If it is likely that the patient is pregnant, then the proposed examination must undergo rigorous justification. If

  10. Magnetic resonance imaging of the fetal brain.

    Science.gov (United States)

    Tee, L Mf; Kan, E Yl; Cheung, J Cy; Leung, W C

    2016-06-01

    This review covers the recent literature on fetal brain magnetic resonance imaging, with emphasis on techniques, advances, common indications, and safety. We conducted a search of MEDLINE for articles published after 2010. The search terms used were "(fetal OR foetal OR fetus OR foetus) AND (MR OR MRI OR [magnetic resonance]) AND (brain OR cerebral)". Consensus statements from major authorities were also included. As a result, 44 relevant articles were included and formed the basis of this review. One major challenge is fetal motion that is largely overcome by ultra-fast sequences. Currently, single-shot fast spin-echo T2-weighted imaging remains the mainstay for motion resistance and anatomical delineation. Recently, a snap-shot inversion recovery sequence has enabled robust T1-weighted images to be obtained, which is previously a challenge for standard gradient-echo acquisitions. Fetal diffusion-weighted imaging, diffusion tensor imaging, and magnetic resonance spectroscopy are also being developed. With multiplanar capabilities, superior contrast resolution and field of view, magnetic resonance imaging does not have the limitations of sonography, and can provide additional important information. Common indications include ventriculomegaly, callosum and posterior fossa abnormalities, and twin complications. There are safety concerns about magnetic resonance-induced heating and acoustic damage but current literature showed no conclusive evidence of deleterious fetal effects. The American College of Radiology guideline states that pregnant patients can be accepted to undergo magnetic resonance imaging at any stage of pregnancy if risk-benefit ratio to patients warrants that the study be performed. Magnetic resonance imaging of the fetal brain is a safe and powerful adjunct to sonography in prenatal diagnosis. It can provide additional information that aids clinical management, prognostication, and counselling.

  11. Routine screening for fetal anomalies: expectations.

    Science.gov (United States)

    Goldberg, James D

    2004-03-01

    Ultrasound has become a routine part of prenatal care. Despite this, the sensitivity and specificity of the procedure is unclear to many patients and healthcare providers. In a small study from Canada, 54.9% of women reported that they had received no information about ultrasound before their examination. In addition, 37.2% of women indicated that they were unaware of any fetal problems that ultrasound could not detect. Most centers that perform ultrasound do not have their own statistics regarding sensitivity and specificity; it is necessary to rely on large collaborative studies. Unfortunately, wide variations exist in these studies with detection rates for fetal anomalies between 13.3% and 82.4%. The Eurofetus study is the largest prospective study performed to date and because of the time and expense involved in this type of study, a similar study is not likely to be repeated. The overall fetal detection rate for anomalous fetuses was 64.1%. It is important to note that in this study, ultrasounds were performed in tertiary centers with significant experience in detecting fetal malformations. The RADIUS study also demonstrated a significantly improved detection rate of anomalies before 24 weeks in tertiary versus community centers (35% versus 13%). Two concepts seem to emerge from reviewing these data. First, patients must be made aware of the limitations of ultrasound in detecting fetal anomalies. This information is critical to allow them to make informed decisions whether to undergo ultrasound examination and to prepare them for potential outcomes.Second, to achieve the detection rates reported in the Eurofetus study, ultrasound examination must be performed in centers that have extensive experience in the detection of fetal anomalies.

  12. Fundal Height: An Accurate Indicator of Fetal Growth?

    Science.gov (United States)

    ... could indicate conditions such as: Slow fetal growth (intrauterine growth restriction) A significantly larger than average baby (fetal macrosomia) ... Butler Tobah, M.D. Figueras F, et al. Intrauterine growth restriction: New concepts in antenatal surveillance, diagnosis, and management. ...

  13. Fetal megacystis : prediction of spontaneous resolution and outcome

    NARCIS (Netherlands)

    Fontanella, F.; Duin, L.; Adama van Scheltema, P. N.; Cohen-Overbeek, T. E.; Pajkrt, E.; Bekker, M.; Willekes, C.; Bax, C. J.; Bilardo, C. M.

    2017-01-01

    Objectives: To investigate the natural history of fetal megacystis from diagnosis in utero to postnatal outcome, and to identify prognostic indicators of spontaneous resolution and postnatal outcome after resolution. Methods: This was a national retrospective cohort study. Fetal megacystis was

  14. Fetal responses to induced maternal relaxation during pregnancy.

    Science.gov (United States)

    DiPietro, Janet A; Costigan, Kathleen A; Nelson, Priscilla; Gurewitsch, Edith D; Laudenslager, Mark L

    2008-01-01

    Fetal responses to induced maternal relaxation during the 32nd week of pregnancy were recorded in 100 maternal-fetal pairs using a digitized data collection system. The 18-min guided imagery relaxation manipulation generated significant changes in maternal heart rate, skin conductance, respiration period, and respiratory sinus arrhythmia. Significant alterations in fetal neurobehavior were observed, including decreased fetal heart rate (FHR), increased FHR variability, suppression of fetal motor activity (FM), and increased FM-FHR coupling. Attribution of the two fetal cardiac responses to the guided imagery procedure itself, as opposed to simple rest or recumbency, is tempered by the observed pattern of response. Evaluation of correspondence between changes within individual maternal-fetal pairs revealed significant associations between maternal autonomic measures and fetal cardiac patterns, lower umbilical and uterine artery resistance and increased FHR variability, and declining salivary cortisol and FM activity. Potential mechanisms that may mediate the observed results are discussed.

  15. A means for fetal monitoring and reducing stillbirth

    African Journals Online (AJOL)

    2013-11-25

    Nov 25, 2013 ... Aims: This study aimed to determine maternal knowledge, behavior, and concerns about abnormal fetal movement in the third trimester of ..... diminution of gross fetal activity is suggestive of adverse pregnancy outcomes.[9,15 ...

  16. Telefetalcare: a first prototype of a wearable fetal electrocardiograph.

    Science.gov (United States)

    Fanelli, A; Signorini, M G; Ferrario, M; Perego, P; Piccini, L; Andreoni, G; Magenes, G

    2011-01-01

    Fetal heart rate monitoring is fundamental to infer information about fetal health state during pregnancy. The cardiotocography (CTG) is the most common antepartum monitoring technique. Abdominal ECG recording represents the most valuable alternative to cardiotocography, as it allows passive, non invasive and long term fetal monitoring. Unluckily fetal ECG has low SNR and needs to be extracted from abdominal recordings using ad hoc algorithms. This work describes a prototype of a wearable fetal ECG electrocardiograph. The system has flat band frequency response between 1-60 Hz and guarantees good signal quality. It was tested on pregnant women between the 30(th) and 34(th) gestational week. Several electrodes configurations were tested, in order to identify the best solution. Implementation of a simple algorithm for FECG extraction permitted the reliable detection of maternal and fetal QRS complexes. The system will allow continuative and deep screening of fetal heart rate, introducing the possibility of home fetal monitoring.

  17. Prenatal ultrasound findings of fetal neoplasms

    International Nuclear Information System (INIS)

    Lee, Soo Hyun; Cho, Jeong Yeon; Song, Mi Jin; Min, Jee Yeon; Han, Byoung Hee; Lee, Young Ho; Cho, Byung Jae; Kim, Seung Hyup

    2002-01-01

    A variety of neoplasms can develop in each tetal organ. Most fetal neoplasms can be detected by careful prenatal ultrasonographic examination. Some neoplosms show specific ultrasonographic findings suggesting the differential diagnosis, but others do not. Knowledge of the presence of a neoplasm in the fetus may alter the prenatal management of a pregnancy and the mode of delivery, and facilitates immediate postnatal treatment. During the last five years, we experienced 32 cases of fetal neoplasms in a variety of organs. We describe their typical and ultrasonographic findings with correlating postnatal CT, MRI, and pathologic findings

  18. Pontomedullary disconnection: fetal and neonatal considerations

    International Nuclear Information System (INIS)

    McCann, Emma; Sweeney, Elizabeth; Pilling, David; Hesseling, Markus; Subhedar, Nim; Roberts, Devender

    2005-01-01

    The cerebellar and pontocerebellar hypoplasias present a unique challenge when detected in the developing fetus. A diverse aetiology and prognosis make counselling of these families difficult. Advances in fetal imaging allow for more accurate diagnosis and counselling, but postnatal MRI is still required. A case is presented in which cerebellar hypoplasia was detected at 20 weeks gestation. Later fetal imaging provided further information, but a diagnosis of pontomedullary disconnection was not made until the postnatal MRI scan. The clinical findings and possible causes of such pontocerebellar abnormalities are discussed. (orig.)

  19. Fetal goiter and bilateral ovarian cysts

    DEFF Research Database (Denmark)

    Lassen, Pernille; Sundberg, Karin; Juul, Anders

    2008-01-01

    by each injection and followed by a gradual reduction of fetal goiter as well as the left ovarian cyst. The right cyst ruptured spontaneously. At 36 weeks + 4 days, the patient underwent elective caesarean section and gave birth to a female, weighing 2,880 g with 1- and 5-min Apgar scores of 10....... The thyroid gland appeared normal in size, and cord blood TSH and free T 4 were both within normal limits. At ultrasound control 6 days later, the right ovarian cyst was not visible, while the left cyst was still present. Thus, our report supports previous findings that fetal goiter can be treated...

  20. Fetal MRI of the urinary system

    International Nuclear Information System (INIS)

    Hoermann, Marcus; Brugger, Peter C.; Balassy, Csilla; Witzani, Linde; Prayer, Daniela

    2006-01-01

    The assessment of the urinary system is typically performed by ultrasound. Nevertheless, an ultrasound may be inconclusive in fetuses with renal diseases that result in anhydramnios or oligohydramnios. In such cases, and in other cases in which ultrasound is limited, further investigation with MR should be considered. In the following article, we will provide an overview of the most commonly encountered disorders of the urinary system and their appearance on fetal MR imaging. Fetal MR imaging can accurately diagnose a wide variety of urinary tract disorders and must be seen as a valuable complementary tool to ultrasound in the assessment of the urinary system, particularly in cases of inconclusive ultrasound findings

  1. Pontomedullary disconnection: fetal and neonatal considerations

    Energy Technology Data Exchange (ETDEWEB)

    McCann, Emma; Sweeney, Elizabeth [Royal Liverpool Children' s Hospital, Department of Clinical Genetics, Liverpool (United Kingdom); Pilling, David [Royal Liverpool Children' s Hospital, Department of Paediatric Radiology, Liverpool (United Kingdom); Hesseling, Markus; Subhedar, Nim [Liverpool Women' s Hospital, Department of Neonatology, Liverpool (United Kingdom); Roberts, Devender [Liverpool Women' s Hospital, Department of Fetal Medicine, Liverpool (United Kingdom)

    2005-08-01

    The cerebellar and pontocerebellar hypoplasias present a unique challenge when detected in the developing fetus. A diverse aetiology and prognosis make counselling of these families difficult. Advances in fetal imaging allow for more accurate diagnosis and counselling, but postnatal MRI is still required. A case is presented in which cerebellar hypoplasia was detected at 20 weeks gestation. Later fetal imaging provided further information, but a diagnosis of pontomedullary disconnection was not made until the postnatal MRI scan. The clinical findings and possible causes of such pontocerebellar abnormalities are discussed. (orig.)

  2. Tumours of the fetal body: a review

    Energy Technology Data Exchange (ETDEWEB)

    Avni, Fred E.; Massez, Anne; Cassart, Marie [University Clinics of Brussels - Erasme Hospital, Department of Medical Imaging, Brussels (Belgium)

    2009-11-15

    Tumours of the fetal body are rare, but lesions have been reported in all spaces, especially in the mediastinum, the pericardial space, the adrenals, the kidney, and the liver. Lymphangioma and teratoma are the commonest histological types encountered, followed by cardiac rhabdomyoma. Adrenal neuroblastoma is the commonest malignant tumour. Imaging plays an essential role in the detection and work-up of these tumours. In addition to assisting clinicians it also helps in counselling parents. Most tumours are detected by antenatal US, but fetal MRI is increasingly used as it brings significant additional information in terms of tumour extent, composition and complications. (orig.)

  3. Fetal MRI of the urinary system

    Energy Technology Data Exchange (ETDEWEB)

    Hoermann, Marcus [Department of Radiodiagnostics, Medical University of Vienna, Waehringerguertel 18-20, A-1090 Vienna (Austria)]. E-mail: marcus.hoermann@meduniwien.ac.at; Brugger, Peter C. [Center of Anatomy and Cell Biology, Medical University of Vienna (Austria); Balassy, Csilla [Department of Radiodiagnostics, Medical University of Vienna, Waehringerguertel 18-20, A-1090 Vienna (Austria); Witzani, Linde [Department of Radiodiagnostics, Medical University of Vienna, Waehringerguertel 18-20, A-1090 Vienna (Austria); Prayer, Daniela [Department of Radiodiagnostics, Medical University of Vienna, Waehringerguertel 18-20, A-1090 Vienna (Austria)

    2006-02-15

    The assessment of the urinary system is typically performed by ultrasound. Nevertheless, an ultrasound may be inconclusive in fetuses with renal diseases that result in anhydramnios or oligohydramnios. In such cases, and in other cases in which ultrasound is limited, further investigation with MR should be considered. In the following article, we will provide an overview of the most commonly encountered disorders of the urinary system and their appearance on fetal MR imaging. Fetal MR imaging can accurately diagnose a wide variety of urinary tract disorders and must be seen as a valuable complementary tool to ultrasound in the assessment of the urinary system, particularly in cases of inconclusive ultrasound findings.

  4. Fetal absorbed doses by radiopharmaceutical administration

    International Nuclear Information System (INIS)

    Rojo, Ana M; Gomez Parada, Ines M.; Di Trano, Jose L.

    2000-01-01

    The radiopharmaceutical administration with diagnostic or therapeutic purpose during pregnancy implies a prenatal radiation dose. The dose assessment and the evaluation of the radiological risks become relevant due to the great radiosensitivity of the fetal tissues in development. This paper is a revision of the available data for estimating fetal doses in the cases of the more frequently used radiopharmaceuticals in nuclear medicine, taking into account recent investigation in placental crossover. The more frequent diagnostic and therapeutic procedures were analyzed according to the radiation doses implied. (author)

  5. Maternal hemodynamics, fetal biometry and Dopplers in pregnancies followed up for suspected fetal growth restriction.

    Science.gov (United States)

    Roberts, Llinos A; Ling, Hua Zen; Poon, Liona; Nicolaides, Kypros H; Kametas, Nikos A

    2018-04-01

    To assess whether in a cohort of patients with small for gestational age (SGA) foetuses with estimated fetal weight ≤10 th percentile, maternal hemodynamics, fetal biometry and Dopplers at presentation, can predict the subsequent development of abnormal fetal Dopplers or delivery with birthweight Cheetah), mean arterial pressure, fetal biometry, umbilical artery (UA), middle cerebral artery (MCA) and uterine artery (UT) pulsatility index (PI) and the deepest vertical pool (DVP) of amniotic fluid. Z-scores of these variables were calculated based on reported reference ranges and the values were compared between those with evidence of abnormal fetal Dopplers at presentation (group 1), those that developed abnormal Dopplers in subsequent visits (group 2) and those who did not develop abnormal Dopplers throughout pregnancy (group 3). Abnormal fetal Dopplers were defined as UAPI >95 th percentile, or MCA PI <5 th percentile. Differences in measured variables at presentation were also compared between pregnancies delivering a baby with birthweight <3 rd and ≥3 rd percentile. Multivariate logistic regression analysis was used to determine significant predictors of birthweight <3 rd percentile and evolution from normal fetal Dopplers to abnormal fetal Dopplers in groups 2 and 3. In the study population 14 (16%) cases were in group 1, 19 (22%) in group 2 and 53 (62%) in group 3. The birthweight was <3 rd percentile in 39 (45%) cases and ≥3 rd percentile in 47 (55%). In the study groups, compared to normal populations, there was decreased cardiac output and stroke volume and increased peripheral vascular resistance and mean arterial pressure (MAP) and the deviations from normal were most marked in group 1. Pregnancies with a birthweight <3 rd , compared to those ≥3 rd percentile, had higher deviations from normal in fetal biometry, maternal cardiac output, stroke volume, heart rate and peripheral vascular resistance and UT-PI. Multivariate logistic regression

  6. Screening for fetal growth restriction using fetal biometry combined with maternal biomarkers.

    Science.gov (United States)

    Gaccioli, Francesca; Aye, Irving L M H; Sovio, Ulla; Charnock-Jones, D Stephen; Smith, Gordon C S

    2018-02-01

    Fetal growth restriction is a major determinant of perinatal morbidity and mortality. Screening for fetal growth restriction is a key element of prenatal care but it is recognized to be problematic. Screening using clinical risk assessment and targeting ultrasound to high-risk women is the standard of care in the United States and United Kingdom, but the approach is known to have low sensitivity. Systematic reviews of randomized controlled trials do not demonstrate any benefit from universal ultrasound screening for fetal growth restriction in the third trimester, but the evidence base is not strong. Implementation of universal ultrasound screening in low-risk women in France failed to reduce the risk of complications among small-for-gestational-age infants but did appear to cause iatrogenic harm to false positives. One strategy to making progress is to improve screening by developing more sensitive and specific tests with the key goal of differentiating between healthy small fetuses and those that are small through fetal growth restriction. As abnormal placentation is thought to be the major cause of fetal growth restriction, one approach is to combine fetal biometry with an indicator of placental dysfunction. In the past, these indicators were generally ultrasonic measurements, such as Doppler flow velocimetry of the uteroplacental circulation. However, another promising approach is to combine ultrasonic suspicion of small-for-gestational-age infant with a blood test indicating placental dysfunction. Thus far, much of the research on maternal serum biomarkers for fetal growth restriction has involved the secondary analysis of tests performed for other indications, such as fetal aneuploidies. An exemplar of this is pregnancy-associated plasma protein A. This blood test is performed primarily to assess the risk of Down syndrome, but women with low first-trimester levels are now serially scanned in later pregnancy due to associations with placental causes of

  7. Expression of P190 and P210 BCR/ABL1 in normal human CD34(+) cells induces similar gene expression profiles and results in a STAT5-dependent expansion of the erythroid lineage

    DEFF Research Database (Denmark)

    Järås, Marcus; Johnels, Petra; Agerstam, Helena

    2009-01-01

    OBJECTIVE: The P190 and P210 BCR/ABL1 fusion genes are mainly associated with different types of hematologic malignancies, but it is presently unclear whether they are functionally different following expression in primitive human hematopoietic cells. MATERIALS AND METHODS: We investigated...... and systematically compared the effects of retroviral P190 BCR/ABL1 and P210 BCR/ABL1 expression on cell proliferation, differentiation, and global gene expression in human CD34(+) cells from cord blood. RESULTS: Expression of either P190 BCR/ABL1 or P210 BCR/ABL1 resulted in expansion of erythroid cells...... and stimulated erythropoietin-independent burst-forming unit-erythroid colony formation. By using a lentiviral anti-signal transducer and activator of transcription 5 (STAT5) short-hairpin RNA, we found that both P190 BCR/ABL1- and P210 BCR/ABL1-induced erythroid cell expansion were STAT5-dependent. Under...

  8. Reactivating Fetal Hemoglobin Expression in Human Adult Erythroblasts Through BCL11A Knockdown Using Targeted Endonucleases

    Directory of Open Access Journals (Sweden)

    Carmen F Bjurström

    2016-01-01

    Full Text Available We examined the efficiency, specificity, and mutational signatures of zinc finger nucleases (ZFNs, transcriptional activator-like effector nucleases (TALENs, and clustered regularly interspaced short palindromic repeat (CRISPR/Cas9 systems designed to target the gene encoding the transcriptional repressor BCL11A, in human K562 cells and human CD34+ progenitor cells. ZFNs and TALENs were delivered as in vitro transcribed mRNA through electroporation; CRISPR/Cas9 was codelivered by Cas9 mRNA with plasmid-encoded guideRNA (gRNA (pU6.g1 or in vitro transcribed gRNA (gR.1. Analyses of efficacy revealed that for these specific reagents and the delivery methods used, the ZFNs gave rise to more allelic disruption in the targeted locus compared to the TALENs and CRISPR/Cas9, which was associated with increased levels of fetal hemoglobin in erythroid cells produced in vitro from nuclease-treated CD34+ cells. Genome-wide analysis to evaluate the specificity of the nucleases revealed high specificity of this specific ZFN to the target site, while specific TALENs and CRISPRs evaluated showed off-target cleavage activity. ZFN gene-edited CD34+ cells had the capacity to engraft in NOD-PrkdcSCID-IL2Rγnull mice, while retaining multi-lineage potential, in contrast to TALEN gene-edited CD34+ cells. CRISPR engraftment levels mirrored the increased relative plasmid-mediated toxicity of pU6.g1/Cas9 in hematopoietic stem/progenitor cells (HSPCs, highlighting the value for the further improvements of CRISPR/Cas9 delivery in primary human HSPCs.

  9. Adult, embryonic and fetal hemoglobin are expressed in human glioblastoma cells.

    Science.gov (United States)

    Emara, Marwan; Turner, A Robert; Allalunis-Turner, Joan

    2014-02-01

    Hemoglobin is a hemoprotein, produced mainly in erythrocytes circulating in the blood. However, non-erythroid hemoglobins have been previously reported in other cell types including human and rodent neurons of embryonic and adult brain, but not astrocytes and oligodendrocytes. Human glioblastoma multiforme (GBM) is the most aggressive tumor among gliomas. However, despite extensive basic and clinical research studies on GBM cells, little is known about glial defence mechanisms that allow these cells to survive and resist various types of treatment. We have shown previously that the newest members of vertebrate globin family, neuroglobin (Ngb) and cytoglobin (Cygb), are expressed in human GBM cells. In this study, we sought to determine whether hemoglobin is also expressed in GBM cells. Conventional RT-PCR, DNA sequencing, western blot analysis, mass spectrometry and fluorescence microscopy were used to investigate globin expression in GBM cell lines (M006x, M059J, M059K, M010b, U87R and U87T) that have unique characteristics in terms of tumor invasion and response to radiotherapy and hypoxia. The data showed that α, β, γ, δ, ζ and ε globins are expressed in all tested GBM cell lines. To our knowledge, we are the first to report expression of fetal, embryonic and adult hemoglobin in GBM cells under normal physiological conditions that may suggest an undefined function of those expressed hemoglobins. Together with our previous reports on globins (Ngb and Cygb) expression in GBM cells, the expression of different hemoglobins may constitute a part of series of active defence mechanisms supporting these cells to resist various types of treatments including chemotherapy and radiotherapy.

  10. Effects of low-level (1.0 R) x-irradiation on the erythroid response of the rat bone marrow

    International Nuclear Information System (INIS)

    Gong, J.K.; Glomski, C.A.; Frederiksen, N.L.; Lawson, A.J.; Daley, J.P.

    1976-01-01

    The levels of normoblasts in the bone marrow of six groups of female Sprague--Dawley rats previously exposed to a 1.0 R dose of x rays were compared with those in sham-exposed animals at intervals from 14 hr to 10 weeks postirradiation. Four parameters were analyzed, the percentage of normoblasts in Wright's Giemsa stained marrow smears, and the number of erythroid precursors per milligram of isolated marrow sample, per whole femur, and per entire skeleton. The studies were based on marrow examinations and on 59 Fe tracer data. At all intervals except the earliest, [14 hr], significant elevations in the percentage of normoblasts were found in the bone marrow. In addition, at 6 and 10 weeks postirradiation increases were found in the number of normoblasts in the isolated marrow samples, whole femurs, and total skeletons. When compared 81 hr after phlebotomy, subnormal increases in normoblast levels were found in all four parameters of the irradiated subjects. The results suggest that x irradiation at this dose level can induce an abnormal marrow function manifested by an elevated number of normoblasts and, after phlebotomy, by a subnormal proliferation of the erythroid precursors

  11. Natural killer cells recognize friend retrovirus-infected erythroid progenitor cells through NKG2D-RAE-1 interactions In Vivo.

    Science.gov (United States)

    Ogawa, Tatsuya; Tsuji-Kawahara, Sachiyo; Yuasa, Takae; Kinoshita, Saori; Chikaishi, Tomomi; Takamura, Shiki; Matsumura, Haruo; Seya, Tsukasa; Saga, Toshihiko; Miyazawa, Masaaki

    2011-06-01

    Natural killer (NK) cells function as early effector cells in the innate immune defense against viral infections and also participate in the regulation of normal and malignant hematopoiesis. NK cell activities have been associated with early clearance of viremia in experimental simian immunodeficiency virus and clinical human immunodeficiency virus type 1 (HIV-1) infections. We have previously shown that NK cells function as major cytotoxic effector cells in vaccine-induced immune protection against Friend virus (FV)-induced leukemia, and NK cell depletion totally abrogates the above protective immunity. However, how NK cells recognize retrovirus-infected cells remains largely unclear. The present study demonstrates a correlation between the expression of the products of retinoic acid early transcript-1 (RAE-1) genes in target cells and their susceptibility to killing by NK cells isolated from FV-infected animals. This killing was abrogated by antibodies blocking the NKG2D receptor in vitro. Further, the expression of RAE-1 proteins on erythroblast surfaces increased early after FV inoculation, and administration of an RAE-1-blocking antibody resulted in increased spleen infectious centers and exaggerated pathology, indicating that FV-infected erythroid cells are recognized by NK cells mainly through the NKG2D-RAE-1 interactions in vivo. Enhanced retroviral replication due to host gene-targeting resulted in markedly increased RAE-1 expression in the absence of massive erythroid cell proliferation, indicating a direct role of retroviral replication in RAE-1 upregulation.

  12. Fetal short time variation during labor: a non-invasive alternative to fetal scalp pH measurements?

    Science.gov (United States)

    Schiermeier, Sven; Reinhard, Joscha; Hatzmann, Hendrike; Zimmermann, Ralf C; Westhof, Gregor

    2009-01-01

    To determine whether short time variation (STV) of fetal heart beat correlates with scalp pH measurements during labor. From 1279 deliveries, 197 women had at least one fetal scalp pH measurement. Using the CTG-Player, STVs were calculated from the electronically saved cardiotocography (CTG) traces and related to the fetal scalp pH measurements. There was no correlation between STV and fetal scalp pH measurements (r=-0.0592). Fetal STV is an important parameter with high sensitivity for antenatal fetal acidosis. This study shows that STV calculations do not correlate with fetal scalp pH measurements during labor, hence are not helpful in identifying fetal acidosis.

  13. Prognostic Significance of Preterm Isolated Decreased Fetal Movement

    Directory of Open Access Journals (Sweden)

    Ertuğrul Karahanoğlu

    2017-12-01

    Full Text Available Objective: Our aim is to evaluate the prognostic significance of isolated, preterm decreased fetal movement following normal initial full diagnostic workup. Study design: A retrospective observational study was conducted at a tertiary centre. The applied protocol was approved by the Medical Research Ethics Department of the hospital where the research was conducted. Obstetrics outcomes of preterm- and term-decreased fetal movement were compared following an initial, normal diagnostic work up. Evaluated outcomes were birth weight, mode of delivery, stillbirth rate, induction of labour, development of gestational hypertension, small for gestational age and oligohydramnios, polyhydramnios during the follow up period. Result: Obstetric complications related to placental insufficiency develops more frequently for decreased fetal movement in preterm cases with respect to that of in term cases. Following the diagnosis of decreased fetal movement, pregnancy hypertension occurred in 17% of preterm decreased fetal movement cases and in 4.7% of term decreased fetal movement cases. Fetal growth restriction developed in 6.6% of preterm decreased fetal movement and in 2.3% of term decreased fetal movement. Amniotic fluid abnormalities more frequently developed in preterm decreased fetal movement. Conclusion: Following an initial normal diagnostic workup, preterm decreased fetal movement convey a higher risk for the development of pregnancy complications associated with placental insufficiency. The patient should be monitored closely and management protocols must be developed for initial normal diagnostic workups in cases of preterm decreased fetal movement.

  14. Perspectives of fetal dystocia in cattle and buffalo

    Directory of Open Access Journals (Sweden)

    Govind Narayan Purohit

    2012-04-01

    Full Text Available We review the causes of fetal dystocia in cows and buffalo. Two fetal causes are distinct fetal oversize and fetal abnormalities. Fetal oversize is common in heifers, cows of beef cattle breeds, prolonged gestations, increased calf birth weight, male calves and perinatal fetal death with resultant emphysema. Fetal abnormalities include monsters, fetal diseases and fetal maldispositions, and it is difficult to deliver such fetuses because of their altered shape. Although monsters are rare in cattle, a large number of monstrosities have been reported in river buffalo; yet also here, overall incidence is low. Diseases of the fetus resulting in dystocia include hydrocephalus, ascites, anasarca and hydrothorax. The most common cause of dystocia in cattle seems to be fetal maldispositions, of which limb flexion and head deviation appear to be the most frequent. We provide a brief description of the management of dystocia from different causes in cattle and buffalo. A case analysis of 192 and 112 dystocia in cattle and buffalo, respectively, at our referral center revealed that dystocia is significantly higher (P<0.05 in first and second parity cows and buffalo, and that dystocia of fetal origin is common in cows (65.62% but less frequent (40.17% in buffalo. In buffalo, the single biggest cause of dystocia was uterine torsion (53.57%. Fetal survival was significantly (P<0.05 higher both in cows and buffalo when delivery was completed within 12 h of second stage of labor.

  15. Longitudinal study of computerized cardiotocography in early fetal growth restriction

    NARCIS (Netherlands)

    Wolf, H.; Arabin, B.; Lees, Christoph C.; Oepkes, D.; Prefumo, Federico; Thilaganathan, B.; Todros, T.; Visser, G.H.A.; Bilardo, Caterina M.; Derks, J. B.; Diemert, A.; Duvekot, Johannes J.; Ferrazzi, E.; Frusca, T.; Hecher, K.; Marlow, N.; Martinelli, P.; Ostermayer, E.; Papageorghiou, Aris T.; Scheepers, Hubertina C. J.; Schlembach, D.; Schneider, K. T M; Valcamonico, A.; van Wassenaer-Leemhuis, A.; Ganzevoort, W.; Aktas, Ayse; Borgione, Silvia; Brezinka, Christoph; Calvert, Sandra; Chaoui, Rabih; Cornette, Jerome M J; Diehl, Thilo; van Eyck, Jim; Fratelli, Nicola; van Haastert, Inge Lot; Johnson, Samantha; Lobmaier, Silvia; Lopriore, Enrico; Mansi, Giuseppina; Missfelder-Lobos, Hannah; Martelli, Paola; Maso, Gianpaolo; Maurer-Fellbaum, Ute; Van Charante, Nico Mensing; De Tollenaer, Susanne Mulder; Moore, Tamanna; Napolitano, Raffaele; Oberto, Manuela; Ogge, Giovanna; van der Post, Joris Am; Preston, Lucy; Raimondi, Francesco; Reiss, Irwin K M; Rigano, Serena; Schuit, Ewoud; Skabar, Aldo; Spaanderman, Marc E.; Weisglas-Kuperus, Nynke; Zimmermann, Andrea

    2017-01-01

    Objectives: To explore whether, in early fetal growth restriction (FGR), the longitudinal pattern of fetal heart rate (FHR) short-term variation (STV) can be used to identify imminent fetal distress and whether abnormalities of FHR recordings are associated with 2-year infant outcome. Methods: The

  16. Fetal Ascites and Second Trimester Maternal Hepatitis C Virus Infection

    Directory of Open Access Journals (Sweden)

    Pei-Ying Ling

    2006-09-01

    Conclusion: Second trimester perinatal HCV infection with possible CMV coinfection associated with fetal ascites is a rare event. Fetal therapy resulting in a successful outcome has not been reported. Prompt fetal therapy with paracentesis in this case led to the delivery of a healthy term liveborn baby with anti-HCV seropositivity.

  17. A means for fetal monitoring and reducing stillbirth

    African Journals Online (AJOL)

    2013-11-25

    Nov 25, 2013 ... Nigerian Journal of Clinical Practice • Jul-Aug 2014 • Vol 17 • Issue 4 ... perceived alteration in regular fetal movement after the age of viability may signify impending adverse ... alarm signal” (MAS) – absent fetal movement for a duration ... excessive fetal movement especially in low‑income countries.

  18. Human fetal growth is constrained below optimal for perinatal survival

    NARCIS (Netherlands)

    Vasak, B.; Koenen, S. V.; Koster, M. P. H.; Hukkelhoven, C. W. P. M.; Franx, A.; Hanson, M. A.; Visser, GHA

    ObjectiveThe use of fetal growth charts assumes that the optimal size at birth is at the 50(th) birth-weight centile, but interaction between maternal constraints on fetal growth and the risks associated with small and large fetal size at birth may indicate that this assumption is not valid for

  19. Agonist mediated fetal muscle-type nicotinic acetylcholine receptor desensitization

    Science.gov (United States)

    The exposure of a developing embryo or fetus to teratogenic alkaloids from plants has the potential to cause developmental defects in livestock due to the inhibition of fetal movement by alkaloids. The mechanism behind the inhibition of fetal movement is the desensitization of fetal muscle-type nico...

  20. Fetal magnetic resonance imaging: indications, technique, anatomical considerations and a review of fetal abnormalities

    Energy Technology Data Exchange (ETDEWEB)

    Ertl-Wagner, Birgit [Department of Radiology, Klinikum Grosshadern, University of Munich, Marchioninistrasse 15, 81377 Munich (Germany); Present address: Institute of Clinical Radiology, Klinikum Grosshadern, University of Munich, Marchioninistrasse 15, 81377 Munich (Germany); Lienemann, Andreas; Reiser, Maximilian F. [Department of Radiology, Klinikum Grosshadern, University of Munich, Marchioninistrasse 15, 81377 Munich (Germany); Strauss, Alexander [Department of Obstetrics and Gynecology, Klinikum Grosshadern, University of Munich, Marchioninistrasse 15, 81377 Munich (Germany)

    2002-08-01

    Fetal MR imaging often poses a diagnostic challenge for the radiologist. Both fetal anatomy and pathology differ decidedly from pediatric and adult MR imaging. While ultrasound remains the method of choice for screening examinations of the fetus, MR imaging is playing an increasingly important role in the detection and classification of malformations not diagnosable by ultrasonography alone. Recently, advances in fast single-shot MR sequences have allowed high-resolution, high-quality imaging of the moving fetus. Preferable sequences to be applied are a true fast imaging steady precession (true-FISP) or a half-Fourier acquired single-shot turbo spin-echo (HASTE) sequence. Premedication is generally no longer required. In all fetal MR imaging, every aspect of fetal anatomy has to be scrutinized. Subsequently, any abnormalities need to be described and classified. A close collaboration with the referring obstetrician is of paramount importance. (orig.)

  1. Fetal Alcohol Syndrome: A Behavioral Teratology.

    Science.gov (United States)

    Kavale, Kenneth A.; Karge, Belinda D.

    1986-01-01

    The review examines the literature on the behaviorally teratogenic aspects of Fetal Alcohol Syndrome, including: (1) prevalence of alcohol abuse among women, (2) acute and chronic effects of alcohol on the fetus, (3) genetic susceptibility, (4) neuropathology, (5) correlative conditions, and (6) animal studies. (Author/DB)

  2. Indicators of fetal and infant health outcomes

    NARCIS (Netherlands)

    Buitendijk, Simone; Zeitlin, Jennifer; Cuttini, Marina; Langhoff-Roos, Jens; Bottu, Jean

    2003-01-01

    OBJECTIVE: To assess the ability of the member states of the European Union to produce the indicators recommended by the PERISTAT project on perinatal health indicators and to provide an overview of fetal and infant health outcomes for these countries according to the information now available.

  3. Fetal Alcohol Syndrome in Adolescents and Adults.

    Science.gov (United States)

    Bert, Cynthia R. Greene; Bert, Minnie

    Persons with fetal alcohol syndrome (FAS) may be diagnosed at birth based on specific symptoms and anomalies. These are history of prenatal alcohol exposure, mental retardation, central nervous system dysfunctions, growth deficiency, particular physical anomalies, and speech and language anomalies. With aging, cranial and skeletal anomalies become…

  4. Fetal goiter and bilateral ovarian cysts

    DEFF Research Database (Denmark)

    Lassen, Pernille; Sundberg, Karin; Juul, Anders

    2008-01-01

    by each injection and followed by a gradual reduction of fetal goiter as well as the left ovarian cyst. The right cyst ruptured spontaneously. At 36 weeks + 4 days, the patient underwent elective caesarean section and gave birth to a female, weighing 2,880 g with 1- and 5-min Apgar scores of 10...

  5. Noninvasive fetal RhD genotyping

    DEFF Research Database (Denmark)

    Clausen, Frederik Banch; Damkjær, Merete Berthu; Dziegiel, Morten Hanefeld

    2014-01-01

    Immunization against RhD is the major cause of hemolytic disease of the fetus and newborn (HDFN), which causes fetal or neonatal death. The introduction of postnatal immune prophylaxis in the 1960s drastically reduced immunization incidents in pregnant, D-negative women. In several countries, ant...

  6. Imaging of the fetal central nervous system

    NARCIS (Netherlands)

    Pistorius, L.R.

    2008-01-01

    Introduction : Ultrasound and MR imaging of the fetal central nervous system (CNS) develop at an ever-increasing rate. Theoretically, the two modalities should be synergistic, but a literature review revealed the difficulties of determining the merit of either technique and revealed gaps in our

  7. Normal renal development investigated with fetal MRI

    International Nuclear Information System (INIS)

    Witzani, Linde; Brugger, Peter Christian; Hoermann, Marcus; Kasprian, Gregor; Csapone-Balassy, Csilla; Prayer, Daniela

    2006-01-01

    Objective: To evaluate age-dependent changes in fetal kidney measurements with MRI. Patients and methods: Fetal MRI examinations were used to study the kidney length (218 fetuses), signal intensities of renal tissue, renal pelvis, and liver tissue on T2-weighted images (223 fetuses), and the whole-kidney apparent diffusion coefficient (107 fetuses). A 1.5 T superconducting unit with a phased array coil was used in patients from 16 to 39 weeks' gestation. The imaging protocol included T2-weighted single-shot fast spin-echo, T2-weighted balanced angiography and diffusion-weighted sequences. Slice thickness ranged from 3 to 5 mm. Results: Fetal kidney length as a function of gestational age was expressed by the linear regression: kidney length (mm) = 0.190 x gestational age (d) - 8.034 (R 2 0.883, p 2 /s) = 0.0302 x square (gestational age (d)) - 14.202 x gestational age (d) + 2728.6 (R 2 = 0.225, p < 0.001). Conclusion: The length, signal intensity on T2-weighted images, and apparent diffusion coefficient of the fetal kidney change significantly with gestational age. The presented data may help in the prenatal diagnosis of renal anomalies

  8. National natality and fetal mortality surveys

    International Nuclear Information System (INIS)

    Roney, P.L.

    1980-01-01

    A project is described in which the Epidemiologic Studies Branch, DBE, is cooperating with the National Center for Health Statistics in a National Natality Survey and a National Fetal Mortality Survey of a sample of live births and of late fetal deaths (28 or more weeks gestation) in 1979. Questionnaires will be sent to a sample of mothers who had a live born infant or late fetal death in 1979, to hospitals in which the deliveries took place, to attending physicians, and all other possible sources of health care. The survey will provide quantitative information regarding use of ionizing and nonionizing radiation, including ultrasound, during pregnancy and possible associations between radiation and late fetal mortality. Specifically the study will provide information on the demographic and socioeconomic characteristics of the mothers and complications of pregnancy, labor, and delivery. The physical condition of the infant at birth is also included. This is one of many health surveys conducted routinely by the NCHS under the National Health Survey program

  9. Abnormal fetal head shape: aetiology and management

    DEFF Research Database (Denmark)

    Petersen, Olav Bjørn; David, Anna; Thomasson, Louise

    2007-01-01

    (lemon-shaped), 18.4% with aneuploidy (mostly strawberry-shaped). 19.5% were dolicocephalic, most secondary to fetal position or oligohydramnios (see table). 13 had confirmed craniosynostosis, including thanatophoric dysplasia, Craniofrontonasal dysplasia, Aperts syndrome, Baller-Gerold syndrome, I...

  10. Fetal Intracranial Hemorrhage (Fetal Stroke: Report of Four Antenatally Diagnosed Casesand Review of the Literature

    Directory of Open Access Journals (Sweden)

    Ying-Fen Huang

    2006-06-01

    Conclusion: This small series demonstrate that an antenatal diagnosis of fetal stroke with intraventricular hemorrhage Grades III and IV or with brain parenchymal involvement appears to be associated with poor neurologic outcome. Due to the significant neonatal neurologic impairment and potential medicolegal implications of antepartum fetal ICH, it follows that obstetricians and sonographers should be familiar with predisposing factors and typical diagnostic imaging findings of rare in utero ICH events.

  11. Thrombophilic disorders and fetal loss: a meta-analysis.

    Science.gov (United States)

    Rey, Evelyne; Kahn, Susan R; David, Michèle; Shrier, Ian

    2003-03-15

    Our aim was to assess the strength of the controversial association between thrombophilia and fetal loss, and to examine whether it varies according to the timing or definition of fetal loss. We searched Medline and Current Contents for articles published between 1975 and 2002 and their references with terms denoting recurrent fetal and non-recurrent fetal loss combined with various thrombophilic disorders. We included in our meta-analysis case-control, cohort, and cross-sectional studies published in English, the methodological quality of which was rated as moderate or strong. Pooled odds ratios (OR) with 95% CI were generated by random effects models with Cochrane Review Manager software. We included 31 studies. Factor V Leiden was associated with early (OR 2.01, 95% CI 1.13-3.58) and late (7.83, 2.83-21.67) recurrent fetal loss, and late non-recurrent fetal loss (3.26, 1.82-5.83). Exclusion of women with other pathologies that could explain fetal loss strengthened the association between Factor V Leiden and recurrent fetal loss. Activated protein C resistance was associated with early recurrent fetal loss (3.48, 1.58-7.69), and prothrombin G20210A mutation with early recurrent (2.56, 1.04-.29) and late non-recurrent (2.30, 1.09-4.87) fetal loss. Protein S deficiency was associated with recurrent fetal loss (14.72, 0.99-218.01) and late non-recurrent fetal loss (7.39, 1.28-42.63). Methylenetetrahydrofolate mutation, protein C, and antithrombin deficiencies were not significantly associated with fetal loss. The magnitude of the association between thrombophilia and fetal loss varies, according to type of fetal loss and type of thrombophilia.

  12. Prevention of fetal demise and growth restriction in a mouse model of fetal alcohol syndrome.

    Science.gov (United States)

    Spong, C Y; Abebe, D T; Gozes, I; Brenneman, D E; Hill, J M

    2001-05-01

    Two peptides [NAPVSIPQ (NAP) and SALLRSIPA (ADNF-9)], that are associated with novel glial proteins regulated by vasoactive intestinal peptide, are shown now to provide protective intervention in a model of fetal alcohol syndrome. Fetal demise and growth restrictions were produced after intraperitoneal injection of ethanol to pregnant mice during midgestation (E8). Death and growth abnormalities elicited by alcohol treatment during development are believed to be associated, in part, with severe oxidative damage. NAP and ADNF-9 have been shown to exhibit antioxidative and antiapoptotic actions in vitro. Pretreatment with an equimolar combination of the peptides prevented the alcohol-induced fetal death and growth abnormalities. Pretreatment with NAP alone resulted in a significant decrease in alcohol-associated fetal death; whereas ADNF-9 alone had no detectable effect on fetal survival after alcohol exposure, indicating a pharmacological distinction between the peptides. Biochemical assessment of the fetuses indicated that the combination peptide treatment prevented the alcohol-induced decreases in reduced glutathione. Peptide efficacy was evident with either 30-min pretreatment or with 1-h post-alcohol administration. Bioavailability studies with [(3)H]NAPVSIPQ indicated that 39% of the total radioactivity comigrated with intact peptide in the fetus 60 min after administration. These studies demonstrate that fetal death and growth restriction associated with prenatal alcohol exposure were prevented by combinatorial peptide treatment and suggest that this therapeutic strategy be explored in other models/diseases associated with oxidative stress.

  13. Fetal MRI of pathological brain development; Fetale MRT der pathologischen Hirnentwicklung

    Energy Technology Data Exchange (ETDEWEB)

    Brugger, P.C. [Medizinische Universitaet Wien (Austria). Arbeitsgruppe Integrative Morphologie, Zentrum fuer Anatomie und Zellbiologie; Prayer, D. [Medizinische Universitaet Wien (Austria). Klinik fuer Radiodiagnostik

    2006-02-15

    Because of the superior tissue contrast, high spatial resolution, and multiplanar capabilities, fetal magnetic resonance imaging (MRI) can depict fetal brain pathologies with high accuracy. Pathological fetal brain development may result from malformations or acquired conditions. Differentiation of these etiologies is important with respect to managing the actual pregnancy or counseling future pregnancies. As a widened ventricular system is a common hallmark of both maldevelopment and acquired conditions, it may cause problems in the differential diagnosis. Fetal MRI can provide detailed morphological information, which allows refinement of the diagnosis of ventricular enlargement in a large number of cases. Systematic work-up of morphological details that may be recognized on MR images provides an approach for achieving a correct diagnosis in cases of ventricle enlargement. (orig.) [German] Aufgrund des hervorragenden Gewebekontrastes, der hohen raeumlichen Aufloesung und multiplanaren Moeglichkeiten erlaubt die fetale Magnetresonanztomographie (MRT) eine detaillierte Darstellung fetaler Hirnpathologien. Eine pathologische Hirnentwicklung kann sowohl auf Fehlbildungen als auch waehrend der Schwangerschaft erworbenen Stoerungen beruhen. Nachdem die weiteren Konsequenzen fuer die bestehende, aber auch fuer folgende Schwangerschaften zu einem grossen Teil von einer Differenzierung dieser Aetiologien abhaengig sein kann, ist ein Erkennen der jeweiligen Pathologie wesentlich. Die morphologische Praesentation erworbener und fehlbildungsbedingter Veraenderungen auf MR-Bildern ist u. U. sehr aehnlich. Besondere differenzialdiagnostische Probleme bereitet dabei das Vorliegen eines erweiterten Ventrikelsystems, das als Symptom unterschiedlichster Veraenderungen vorliegen kann. Anhand einer systematischen Darstellung mittels MR-erfassbarer morphologischer Details wird eine Anleitung gegeben, bei Bestehen dieses Leitsymptoms zu einer moeglichst genauen Diagnose zu kommen

  14. The "Fetal Reserve Index": Re-Engineering the Interpretation and Responses to Fetal Heart Rate Patterns.

    Science.gov (United States)

    Eden, Robert D; Evans, Mark I; Evans, Shara M; Schifrin, Barry S

    2018-01-01

    Electronic fetal monitoring (EFM) correlates poorly with neonatal outcome. We present a new metric: the "Fetal Reserve Index" (FRI), formally incorporating EFM with maternal, obstetrical, fetal risk factors, and excessive uterine activity for assessment of risk for cerebral palsy (CP). We performed a retrospective, case-control series of 50 term CP cases with apparent intrapartum neurological injury and 200 controls. All were deemed neurologically normal on admission. We compared the FRI against ACOG Category (I-III) system and long-term outcome parameters against ACOG monograph (NEACP) requirements for labor-induced fetal neurological injury. Abnormal FRI's identified 100% of CP cases and did so hours before injury. ACOG Category III identified only 44% and much later. Retrospective ACOG monograph criteria were found in at most 30% of intrapartum-acquired CP patients; only 27% had umbilical or neonatal pH <7.0. In this initial, retrospective trial, an abnormal FRI identified all cases of labor-related neurological injury more reliably and earlier than Category III, which may allow fetal therapy by intrauterine resuscitation. The combination of traditional EFM with maternal, obstetrical, and fetal risk factors creating the FRI performed much better as a screening test than EFM alone. Our quantified screening system needs further evaluation in prospective trials. © 2017 S. Karger AG, Basel.

  15. Fetal Eye Movements on Magnetic Resonance Imaging

    Science.gov (United States)

    Woitek, Ramona; Kasprian, Gregor; Lindner, Christian; Stuhr, Fritz; Weber, Michael; Schöpf, Veronika; Brugger, Peter C.; Asenbaum, Ulrika; Furtner, Julia; Bettelheim, Dieter; Seidl, Rainer; Prayer, Daniela

    2013-01-01

    Objectives Eye movements are the physical expression of upper fetal brainstem function. Our aim was to identify and differentiate specific types of fetal eye movement patterns using dynamic MRI sequences. Their occurrence as well as the presence of conjugated eyeball motion and consistently parallel eyeball position was systematically analyzed. Methods Dynamic SSFP sequences were acquired in 72 singleton fetuses (17–40 GW, three age groups [17–23 GW, 24–32 GW, 33–40 GW]). Fetal eye movements were evaluated according to a modified classification originally published by Birnholz (1981): Type 0: no eye movements; Type I: single transient deviations; Type Ia: fast deviation, slower reposition; Type Ib: fast deviation, fast reposition; Type II: single prolonged eye movements; Type III: complex sequences; and Type IV: nystagmoid. Results In 95.8% of fetuses, the evaluation of eye movements was possible using MRI, with a mean acquisition time of 70 seconds. Due to head motion, 4.2% of the fetuses and 20.1% of all dynamic SSFP sequences were excluded. Eye movements were observed in 45 fetuses (65.2%). Significant differences between the age groups were found for Type I (p = 0.03), Type Ia (p = 0.031), and Type IV eye movements (p = 0.033). Consistently parallel bulbs were found in 27.3–45%. Conclusions In human fetuses, different eye movement patterns can be identified and described by MRI in utero. In addition to the originally classified eye movement patterns, a novel subtype has been observed, which apparently characterizes an important step in fetal brainstem development. We evaluated, for the first time, eyeball position in fetuses. Ultimately, the assessment of fetal eye movements by MRI yields the potential to identify early signs of brainstem dysfunction, as encountered in brain malformations such as Chiari II or molar tooth malformations. PMID:24194885

  16. Metabolism of lipoproteins by human fetal hepatocytes

    International Nuclear Information System (INIS)

    Carr, B.R.

    1987-01-01

    The rate of clearance of lipoproteins from plasma appears to play a role in the development of atherogenesis. The liver may account for as much as two thirds of the removal of low-density lipoprotein and one third of the clearance of high-density lipoprotein in certain animal species and humans, mainly by receptor-mediated pathways. The purpose of the present investigation was to determine if human fetal hepatocytes maintained in vitro take up and degrade lipoproteins. We first determined that the maximal binding capacity of iodine 125-iodo-LDL was approximately 300 ng of low-density lipoprotein protein/mg of membrane protein and an apparent dissociation constant of approximately 60 micrograms low-density lipoprotein protein/ml in membranes prepared from human fetal liver. We found that the maximal uptake of [ 125 I]iodo-LDL and [ 125 I]iodo-HDL by fetal hepatocytes occurred after 12 hours of incubation. Low-density lipoprotein uptake preceded the appearance of degradation products by 4 hours, and thereafter the degradation of low-density lipoprotein increased linearly for at least 24 hours. In contrast, high-density lipoprotein was not degraded to any extent by fetal hepatocytes. [ 125 I]Iodo-LDL uptake and degradation were inhibited more than 75% by preincubation with low-density lipoprotein but not significantly by high-density lipoprotein, whereas [ 125 I]iodo-HDL uptake was inhibited 70% by preincubation with high-density lipoprotein but not by low-density lipoprotein. In summary, human fetal hepatocytes take up and degrade low-density lipoprotein by a receptor-mediated process similar to that described for human extrahepatic tissues

  17. Fetal eye movements on magnetic resonance imaging.

    Science.gov (United States)

    Woitek, Ramona; Kasprian, Gregor; Lindner, Christian; Stuhr, Fritz; Weber, Michael; Schöpf, Veronika; Brugger, Peter C; Asenbaum, Ulrika; Furtner, Julia; Bettelheim, Dieter; Seidl, Rainer; Prayer, Daniela

    2013-01-01

    Eye movements are the physical expression of upper fetal brainstem function. Our aim was to identify and differentiate specific types of fetal eye movement patterns using dynamic MRI sequences. Their occurrence as well as the presence of conjugated eyeball motion and consistently parallel eyeball position was systematically analyzed. Dynamic SSFP sequences were acquired in 72 singleton fetuses (17-40 GW, three age groups [17-23 GW, 24-32 GW, 33-40 GW]). Fetal eye movements were evaluated according to a modified classification originally published by Birnholz (1981): Type 0: no eye movements; Type I: single transient deviations; Type Ia: fast deviation, slower reposition; Type Ib: fast deviation, fast reposition; Type II: single prolonged eye movements; Type III: complex sequences; and Type IV: nystagmoid. In 95.8% of fetuses, the evaluation of eye movements was possible using MRI, with a mean acquisition time of 70 seconds. Due to head motion, 4.2% of the fetuses and 20.1% of all dynamic SSFP sequences were excluded. Eye movements were observed in 45 fetuses (65.2%). Significant differences between the age groups were found for Type I (p = 0.03), Type Ia (p = 0.031), and Type IV eye movements (p = 0.033). Consistently parallel bulbs were found in 27.3-45%. In human fetuses, different eye movement patterns can be identified and described by MRI in utero. In addition to the originally classified eye movement patterns, a novel subtype has been observed, which apparently characterizes an important step in fetal brainstem development. We evaluated, for the first time, eyeball position in fetuses. Ultimately, the assessment of fetal eye movements by MRI yields the potential to identify early signs of brainstem dysfunction, as encountered in brain malformations such as Chiari II or molar tooth malformations.

  18. MRI of normal fetal brain development

    International Nuclear Information System (INIS)

    Prayer, Daniela; Kasprian, Gregor; Krampl, Elisabeth; Ulm, Barbara; Witzani, Linde; Prayer, Lucas; Brugger, Peter C.

    2006-01-01

    Normal fetal brain maturation can be studied by in vivo magnetic resonance imaging (MRI) from the 18th gestational week (GW) to term, and relies primarily on T2-weighted and diffusion-weighted (DW) sequences. These maturational changes must be interpreted with a knowledge of the histological background and the temporal course of the respective developmental steps. In addition, MR presentation of developing and transient structures must be considered. Signal changes associated with maturational processes can mainly be ascribed to the following changes in tissue composition and organization, which occur at the histological level: (1) a decrease in water content and increasing cell-density can be recognized as a shortening of T1- and T2-relaxation times, leading to increased T1-weighted and decreased T2-weighted intensity, respectively; (2) the arrangement of microanatomical structures to create a symmetrical or asymmetrical environment, leading to structural differences that may be demonstrated by DW-anisotropy; (3) changes in non-structural qualities, such as the onset of a membrane potential in premyelinating axons. The latter process also influences the appearance of a structure on DW sequences. Thus, we will review the in vivo MR appearance of different maturational states of the fetal brain and relate these maturational states to anatomical, histological, and in vitro MRI data. Then, the development of the cerebral cortex, white matter, temporal lobe, and cerebellum will be reviewed, and the MR appearance of transient structures of the fetal brain will be shown. Emphasis will be placed on the appearance of the different structures with the various sequences. In addition, the possible utility of dynamic fetal sequences in assessing spontaneous fetal movements is discussed

  19. Actual imaging time in fetal MRI

    International Nuclear Information System (INIS)

    Brugger, Peter C.; Prayer, Daniela

    2012-01-01

    Objective: Safety issues in magnetic resonance imaging (MRI) are important, especially in fetal MRI. However, since basic data with respect of the effective exposure time in fetal MRI are not available, this study aimed to determine the actual imaging time during a fetal MRI study. Methods: 100 fetal MRI studies of singleton pregnancies performed on a 1.5 T system were analysed with respect to study duration (from starting the survey scan until the end of study), the number of sequences acquired, and the actual imaging time, which was calculated by adding up scan time of each sequence. Furthermore, each sequence type was analysed regarding the number of acquisitions, specific absorption rates (SAR), and duration. Results: Mean study duration was 34.6 min (range: 14–58 min; standard deviation (SD): 9.7 min), the average number of sequences acquired was 26.6 (range: 11–44, SD: 6.6). Actual scan time averaged 11.4 min (range: 4–19 min, SD: 4.0 min). Ultrafast T2-weighted and steady-state free-precession sequences accounted for 62.3% of actual scan time, and were distributed over the whole duration of the study. Conclusion: Actual imaging time only accounts for 33% of total study time and is not continuous. The remaining time is consumed by the preparation phases of the scanner, and is spent with planning sequences and the eventual repositioning of the coil and/or pregnant woman. These data may help to more accurately estimate the exposure to radiofrequency deposition and noise during fetal MRI studies.

  20. MRI of normal fetal brain development

    Energy Technology Data Exchange (ETDEWEB)

    Prayer, Daniela [Department of Radiodiagnostics, Medical University of Vienna, Vienna (Austria)]. E-mail: Daniela.prayer@meduniwien.ac.at; Kasprian, Gregor [Department of Radiodiagnostics, Medical University of Vienna, Vienna (Austria); Krampl, Elisabeth [Department of Obstetrics and Gynecology, Medical University of Vienna, Vienna (Austria); Ulm, Barbara [Department of Prenatal Diagnosis, Medical University of Vienna, Vienna (Austria); Witzani, Linde [Department of Radiodiagnostics, Medical University of Vienna, Vienna (Austria); Prayer, Lucas [Diagnosezentrum Urania, Vienna (Austria); Brugger, Peter C. [Center of Anatomy and Cell Biology, Medical University of Vienna, Vienna (Austria)

    2006-02-15

    Normal fetal brain maturation can be studied by in vivo magnetic resonance imaging (MRI) from the 18th gestational week (GW) to term, and relies primarily on T2-weighted and diffusion-weighted (DW) sequences. These maturational changes must be interpreted with a knowledge of the histological background and the temporal course of the respective developmental steps. In addition, MR presentation of developing and transient structures must be considered. Signal changes associated with maturational processes can mainly be ascribed to the following changes in tissue composition and organization, which occur at the histological level: (1) a decrease in water content and increasing cell-density can be recognized as a shortening of T1- and T2-relaxation times, leading to increased T1-weighted and decreased T2-weighted intensity, respectively; (2) the arrangement of microanatomical structures to create a symmetrical or asymmetrical environment, leading to structural differences that may be demonstrated by DW-anisotropy; (3) changes in non-structural qualities, such as the onset of a membrane potential in premyelinating axons. The latter process also influences the appearance of a structure on DW sequences. Thus, we will review the in vivo MR appearance of different maturational states of the fetal brain and relate these maturational states to anatomical, histological, and in vitro MRI data. Then, the development of the cerebral cortex, white matter, temporal lobe, and cerebellum will be reviewed, and the MR appearance of transient structures of the fetal brain will be shown. Emphasis will be placed on the appearance of the different structures with the various sequences. In addition, the possible utility of dynamic fetal sequences in assessing spontaneous fetal movements is discussed.

  1. Characterization of the fetal blood transcriptome and proteome in maternal anti-fetal rejection: evidence of a distinct and novel type of human fetal systemic inflammatory response.

    Science.gov (United States)

    Lee, Joonho; Romero, Roberto; Chaiworapongsa, Tinnakorn; Dong, Zhong; Tarca, Adi L; Xu, Yi; Chiang, Po Jen; Kusanovic, Juan Pedro; Hassan, Sonia S; Yeo, Lami; Yoon, Bo Hyun; Than, Nandor Gabor; Kim, Chong Jai

    2013-10-01

    The human fetus is able to mount a systemic inflammatory response when exposed to microorganisms. This stereotypic response has been termed the 'fetal inflammatory response syndrome' (FIRS), defined as an elevation of fetal plasma interleukin-6 (IL-6). FIRS is frequently observed in patients whose preterm deliveries are associated with intra-amniotic infection, acute inflammatory lesions of the placenta, and a high rate of neonatal morbidity. Recently, a novel form of fetal systemic inflammation, characterized by an elevation of fetal plasma CXCL10, has been identified in patients with placental lesions consistent with 'maternal anti-fetal rejection'. These lesions include chronic chorioamnionitis, plasma cell deciduitis, and villitis of unknown etiology. In addition, positivity for human leukocyte antigen (HLA) panel-reactive antibodies (PRA) in maternal sera can also be used to increase the index of suspicion for maternal anti-fetal rejection. The purpose of this study was to determine (i) the frequency of pathologic lesions consistent with maternal anti-fetal rejection in term and spontaneous preterm births; (ii) the fetal serum concentration of CXCL10 in patients with and without evidence of maternal anti-fetal rejection; and (iii) the fetal blood transcriptome and proteome in cases with a fetal inflammatory response associated with maternal anti-fetal rejection. Maternal and fetal sera were obtained from normal term (n = 150) and spontaneous preterm births (n = 150). A fetal inflammatory response associated with maternal anti-fetal rejection was diagnosed when the patients met two or more of the following criteria: (i) presence of chronic placental inflammation; (ii) ≥80% of maternal HLA class I PRA positivity; and (iii) fetal serum CXCL10 concentration >75th percentile. Maternal HLA PRA was analyzed by flow cytometry. The concentrations of fetal CXCL10 and IL-6 were determined by ELISA. Transcriptome analysis was undertaken after the extraction of total RNA

  2. News/Press Releases

    Data.gov (United States)

    Office of Personnel Management — A press release, news release, media release, press statement is written communication directed at members of the news media for the purpose of announcing programs...

  3. Prenatal diagnostic evaluation of fetal ventricular dilatation by MRI

    International Nuclear Information System (INIS)

    Kawabata, Ichiro; Tamaya, Teruhiko; Iwata, Tatsuo; Ando, Takashi; Yamada, Hiromu

    1992-01-01

    Recent advances in MRI have contributed to the antenatal confirmatory diagnosis of fetal anomalies, especially in the fetal brain and central nervous system. In this study, eight infants with fetal ventricular dilatation, suggested by prenatal ultrasonography, were evaluated with confirmatory diagnosis by MRI (SIGNA; General Electric Company, 1.5 tesla). These anomalies were demonstrated at 19 to 36 weeks by ultrasonography. One of the eight died in utero at 22 weeks of gestation, another one day after birth (33 weeks of gestation). Two were delivered by Cesarean section. It has been proved that clear and effective images can be obtained by mother's walking without sedative drugs. Fetal MRI gave clear images not only in fetal horizontal section, but also in sagittal section, which is usually difficult to obtain by ultrasonography. Confirmatory diagnosis of eight cases were obtained by MRI. Fetal MRI can provide an effective prenatal diagnosis, especially in cases of fetal brain anomaly, even when compared with postnatal CT findings. (author)

  4. Prognostic value of three-dimensional ultrasound for fetal hydronephrosis

    Science.gov (United States)

    WANG, JUNMEI; YING, WEIWEN; TANG, DAXING; YANG, LIMING; LIU, DONGSHENG; LIU, YUANHUI; PAN, JIAOE; XIE, XING

    2015-01-01

    The present study evaluated the prognostic value of three-dimensional ultrasound for fetal hydronephrosis. Pregnant females with fetal hydronephrosis were enrolled and a novel three-dimensional ultrasound indicator, renal parenchymal volume/kidney volume, was introduced to predict the postnatal prognosis of fetal hydronephrosis in comparison with commonly used ultrasound indicators. All ultrasound indicators of fetal hydronephrosis could predict whether postnatal surgery was required for fetal hydronephrosis; however, the predictive performance of renal parenchymal volume/kidney volume measurements as an individual indicator was the highest. In conclusion, ultrasound is important in predicting whether postnatal surgery is required for fetal hydronephrosis, and the three-dimensional ultrasound indicator renal parenchymal volume/kidney volume has a high predictive performance. Furthermore, the majority of cases of fetal hydronephrosis spontaneously regress subsequent to birth, and the regression time is closely associated with ultrasound indicators. PMID:25667626

  5. Fetal short time variation during labor: a non-invasive alternative to fetal scalp pH measurements?

    OpenAIRE

    Schiermeier, Sven; Reinhard, Joscha; Hatzmann, Hendrike; Zimmermann, Ralf C.; Westhof, Gregor

    2009-01-01

    Objective: To determine whether short time variation (STV) of fetal heart beat correlates with scalp pH measurements during labor. Patients and methods: From 1279 deliveries, 197 women had at least one fetal scalp pH measurement. Using the CTG-Player®, STVs were calculated from the electronically saved cardiotocography (CTG) traces and related to the fetal scalp pH measurements. Results: There was no correlation between STV and fetal scalp pH measurements (r=−0.0592). Conclusions: Fetal ST...

  6. Prenatal sonographic measurement of the fetal thyroid gland

    Energy Technology Data Exchange (ETDEWEB)

    Ahn, Young Cheol; Kim, Young Hwa; Cho, Won Soo; Bae, Won Kyung; Kim, Il Young [Chunan Hospital, Soonchunhyang University College of Medicine, Chunan (Korea, Republic of)

    2001-03-15

    To investigate whether the fetal thyroid gland could be examined by prenatal ultrasonography and to established the normal range of fetal thyroid width according to the gestational age. The width of the fetal thyroid was determined by prenatal ultrasonography from 118 pregnant women. Three of the mothers had current or previous thyroid disease and the widths of the fetal thyroid were determined from 115 normal subjects. The width of the fetal thyroid was defined by a maximum transverse distance of the thyroid gland between two carotid arteries on transverse scan of the fetal neck. We analyzed the cause of non-measurable cases. The width of the fetal thyroid and Neo-TSH were compared in 19 subjects, including 3 subjects will current or previous thyroid disease. We could measure the fetal thyroid widths in 95 cases (80%). The fetal thyroid widths of mothers without current or previous thyroid disease was 0.9-2.36 cm,which showed linear correlation with gestational age (Y=0.0506 X + 0.0439, r{sup 2}=0.5661). Causes of non-measurable cases were neck flexion (65%), prone position (22%), and overlapped fetal neck by arm or shoulder (13%). Of the 19 neonates with Neo-TSH level, one case had a mother with a thyroid disease and showed increased width of the fetal and high Neo-TSH. The fetal thyroid was measured in 80% of prenatal ultrasonography and the width of the fetal thyroid showed linear correlated with gestational age. We assumed that the width of the thyroid could be useful for diagnosing fetal thyroid disorder when maternal thyroid disease exists.

  7. Prenatal sonographic measurement of the fetal thyroid gland

    International Nuclear Information System (INIS)

    Ahn, Young Cheol; Kim, Young Hwa; Cho, Won Soo; Bae, Won Kyung; Kim, Il Young

    2001-01-01

    To investigate whether the fetal thyroid gland could be examined by prenatal ultrasonography and to established the normal range of fetal thyroid width according to the gestational age. The width of the fetal thyroid was determined by prenatal ultrasonography from 118 pregnant women. Three of the mothers had current or previous thyroid disease and the widths of the fetal thyroid were determined from 115 normal subjects. The width of the fetal thyroid was defined by a maximum transverse distance of the thyroid gland between two carotid arteries on transverse scan of the fetal neck. We analyzed the cause of non-measurable cases. The width of the fetal thyroid and Neo-TSH were compared in 19 subjects, including 3 subjects will current or previous thyroid disease. We could measure the fetal thyroid widths in 95 cases (80%). The fetal thyroid widths of mothers without current or previous thyroid disease was 0.9-2.36 cm,which showed linear correlation with gestational age (Y=0.0506 X + 0.0439, r 2 =0.5661). Causes of non-measurable cases were neck flexion (65%), prone position (22%), and overlapped fetal neck by arm or shoulder (13%). Of the 19 neonates with Neo-TSH level, one case had a mother with a thyroid disease and showed increased width of the fetal and high Neo-TSH. The fetal thyroid was measured in 80% of prenatal ultrasonography and the width of the fetal thyroid showed linear correlated with gestational age. We assumed that the width of the thyroid could be useful for diagnosing fetal thyroid disorder when maternal thyroid disease exists.

  8. Extended flow cytometry characterization of normal bone marrow progenitor cells by simultaneous detection of aldehyde dehydrogenase and early hematopoietic antigens: implication for erythroid differentiation studies

    Directory of Open Access Journals (Sweden)

    Pascariello Caterina

    2008-05-01

    Full Text Available Abstract Background Aldehyde dehydrogenase (ALDH is a cytosolic enzyme highly expressed in hematopoietic precursors from cord blood and granulocyte-colony stimulating factor mobilized peripheral blood, as well as in bone marrow from patients with acute myeloblastic leukemia. As regards human normal bone marrow, detailed characterization of ALDH+ cells has been addressed by one single study (Gentry et al, 2007. The goal of our work was to provide new information about the dissection of normal bone marrow progenitor cells based upon the simultaneous detection by flow cytometry of ALDH and early hematopoietic antigens, with particular attention to the expression of ALDH on erythroid precursors. To this aim, we used three kinds of approach: i multidimensional analytical flow cytometry, detecting ALDH and early hematopoietic antigens in normal bone marrow; ii fluorescence activated cell sorting of distinct subpopulations of progenitor cells, followed by in vitro induction of erythroid differentiation; iii detection of ALDH+ cellular subsets in bone marrow from pure red cell aplasia patients. Results In normal bone marrow, we identified three populations of cells, namely ALDH+CD34+, ALDH-CD34+ and ALDH+CD34- (median percentages were 0.52, 0.53 and 0.57, respectively. As compared to ALDH-CD34+ cells, ALDH+CD34+ cells expressed the phenotypic profile of primitive hematopoietic progenitor cells, with brighter expression of CD117 and CD133, accompanied by lower display of CD38 and CD45RA. Of interest, ALDH+CD34- population disclosed a straightforward erythroid commitment, on the basis of three orders of evidences. First of all, ALDH+CD34- cells showed a CD71bright, CD105+, CD45- phenotype. Secondly, induction of differentiation experiments evidenced a clear-cut expression of glycophorin A (CD235a. Finally, ALDH+CD34- precursors were not detectable in patients with pure red cell aplasia (PRCA. Conclusion Our study, comparing surface antigen expression of

  9. Differential diagnosis between fetal extrarenal pelvis and obstructive uropathy on fetal ultrasonogram

    Energy Technology Data Exchange (ETDEWEB)

    Han, Byoung Hee; Cho, Jeong Yeon; Cho, Byung Jae; Lee, Kyung Sang [Samsung Cheil Hospital, Sungkyunkwan University School of Medicine, Seoul (Korea, Republic of)

    2003-03-15

    To establish the standard guideline for differentiating the extrarenal pelvis from obstructive uropathy on fetal ultrasonogram (US) to avoid unnecessary postnatal follow-up and other additional examinations. From July 2000 to July 2001, Thirty-four kidneys with hydronephrosis diagnosed on fetal ultrasonogram performed during the third trimester of pregnancy were included in this study. Hydronephrosis was defined as the pelvic anteroposterior (AP) diameter being 4 mm or greater before 33 weeks of gestation while 7 mm or greater at or after 33 weeks of gestation. The size of the renal pelvis was measured at intrarenal, intra-extrarenal junctional and extrarenal portions in every kidney on the transverse view of the fetal renal hiluin. Postnatally, all neonates underwent renal ultrasonogram 2 to 8 days after birth, and renal pelvic diameters were measured using the same method as the fetal US in 28 kidneys. We then compared the extrarenal-intrarenal ratio (E/I ratio) of pelvic diameter between fetal and neoatal kidneys. We presumed that the extrarenal pelvis in fetal US was the pelvis showing the normal intrarenal pelvic diameter accompanied by the most dilated exrtarenal pelvic diameter. Follow-up ultrasonograms were measured using the same method as the fetal US in 28 kidneys. We then compared the extrarenal intrarenal ratio (E/I ratio) of pelvic diameter between fetal and neonatal kidneys. We presumed that the extrarenal pelvis on fetal US was the pelvis showing the normal intrarenal pelvic diameter accompanied by the most dilated extrarenal pelvic diameter. Follow-up ultrasonograms were performed in 12 of 17 neonates who had the maximal diameter at extrarenal portion on fetal ultrasonogram. VCUG and IVU were taken in 2 patients with a persistent dilatation of the renal pelvis on follow-up ultrasonograms. On fetal US, 17/34 kidneys showed the extrarenal portion with the most dilatation while in 12/34 kidneys, the intra-extra renal junction portion was the most

  10. Differential diagnosis between fetal extrarenal pelvis and obstructive uropathy on fetal ultrasonogram

    International Nuclear Information System (INIS)

    Han, Byoung Hee; Cho, Jeong Yeon; Cho, Byung Jae; Lee, Kyung Sang

    2003-01-01

    To establish the standard guideline for differentiating the extrarenal pelvis from obstructive uropathy on fetal ultrasonogram (US) to avoid unnecessary postnatal follow-up and other additional examinations. From July 2000 to July 2001, Thirty-four kidneys with hydronephrosis diagnosed on fetal ultrasonogram performed during the third trimester of pregnancy were included in this study. Hydronephrosis was defined as the pelvic anteroposterior (AP) diameter being 4 mm or greater before 33 weeks of gestation while 7 mm or greater at or after 33 weeks of gestation. The size of the renal pelvis was measured at intrarenal, intra-extrarenal junctional and extrarenal portions in every kidney on the transverse view of the fetal renal hiluin. Postnatally, all neonates underwent renal ultrasonogram 2 to 8 days after birth, and renal pelvic diameters were measured using the same method as the fetal US in 28 kidneys. We then compared the extrarenal-intrarenal ratio (E/I ratio) of pelvic diameter between fetal and neoatal kidneys. We presumed that the extrarenal pelvis in fetal US was the pelvis showing the normal intrarenal pelvic diameter accompanied by the most dilated exrtarenal pelvic diameter. Follow-up ultrasonograms were measured using the same method as the fetal US in 28 kidneys. We then compared the extrarenal intrarenal ratio (E/I ratio) of pelvic diameter between fetal and neonatal kidneys. We presumed that the extrarenal pelvis on fetal US was the pelvis showing the normal intrarenal pelvic diameter accompanied by the most dilated extrarenal pelvic diameter. Follow-up ultrasonograms were performed in 12 of 17 neonates who had the maximal diameter at extrarenal portion on fetal ultrasonogram. VCUG and IVU were taken in 2 patients with a persistent dilatation of the renal pelvis on follow-up ultrasonograms. On fetal US, 17/34 kidneys showed the extrarenal portion with the most dilatation while in 12/34 kidneys, the intra-extra renal junction portion was the most

  11. Ultrasound diagnosis and evaluation of fetal tumors.

    Science.gov (United States)

    Kurjak, A; Zalud, I; Jurković, D; Alfirević, Z; Tomić, K

    1989-01-01

    Fetal tumors represent a rare and heterogeneous group of abnormalities. A significant proportion of them can now be diagnosed by using modern high resolution ultrasonic equipment. During 15 years there were 57 fetal tumours detected prenatally. Hygroma colli is the most frequent fetal tumor. It should be emphasized that cystic hygroma generally carries poor prognosis, and after an early diagnosis, termination of pregnancy is most logical approach. Contrary to the general opinion our own experience showed that there are cases in which prognosis could be much better as illustrated with our 4 cases. All of the treated fetuses, after surgical resection, had normal development and are now on the age of 5, 4, 3 and 2 years of life. An ovarian cyst can be suspected if a fluid-filled structure is visualized next to a fetal kidney and female external genitalia are recognizable. The ultrasound finding suggestive of an ovarian cyst is that of a pelvic cystic or complex mass in a female fetus with normal kidneys and urinary bladder and a normal gastrointestinal tract. In most cases, the normal course of fetal ovarian cyst is a spontaneous intrauterine or postnatal involution. Prenatal diagnosis improves neonatal outcome by allowing an appropriate choice of the optimal time, mode and place of delivery in order to avoid accidental and unexpected intrapartum and postnatal complications. The management of a fetus affected by an ovarian cyst depends on the size and on the echo-pattern of the cyst. It remains unclear whether in utero puncture of the cyst and evacuation of its content should be justified in cases of particularly large ovarian cyst. In our opinion intrauterine procedure can be attempted in the presence of large cyst fulfilling the fetal abdomen. We have treated actively two cases of large ovarian cysts by ultrasonically guided puncture before delivery and both fetuses underwent surgery later without complications. If properly performed puncture of the cyst seems to be

  12. Leukemic transformation of normal murine erythroid progenitors: v- and c-ErbB act through signaling pathways activated by the EpoR and c-Kit in stress erythropoiesis

    NARCIS (Netherlands)

    von Lindern, M.; Deiner, E. M.; Dolznig, H.; Parren-van Amelsvoort, M.; Hayman, M. J.; Mullner, E. W.; Beug, H.

    2001-01-01

    Primary erythroid progenitors can be expanded by the synergistic action of erythropoietin (Epo), stem cell factor (SCF) and glucocorticoids. While Epo is required for erythropoiesis in general, glucocorticoids and SCF mainly contribute to stress erythropoiesis in hypoxic mice. This ability of normal

  13. Sonographic large fetal head circumference and risk of cesarean delivery.

    Science.gov (United States)

    Lipschuetz, Michal; Cohen, Sarah M; Israel, Ariel; Baron, Joel; Porat, Shay; Valsky, Dan V; Yagel, Oren; Amsalem, Hagai; Kabiri, Doron; Gilboa, Yinon; Sivan, Eyal; Unger, Ron; Schiff, Eyal; Hershkovitz, Reli; Yagel, Simcha

    2018-03-01

    Persistently high rates of cesarean deliveries are cause for concern for physicians, patients, and health systems. Prelabor assessment might be refined by identifying factors that help predict an individual patient's risk of cesarean delivery. Such factors may contribute to patient safety and satisfaction as well as health system planning and resource allocation. In an earlier study, neonatal head circumference was shown to be more strongly associated with delivery mode and other outcome measures than neonatal birthweight. In the present study we aimed to evaluate the association of sonographically measured fetal head circumference measured within 1 week of delivery with delivery mode. This was a multicenter electronic medical record-based study of birth outcomes of primiparous women with term (37-42 weeks) singleton fetuses presenting for ultrasound with fetal biometry within 1 week of delivery. Fetal head circumference and estimated fetal weight were correlated with maternal background, obstetric, and neonatal outcome parameters. Elective cesarean deliveries were excluded. Multinomial regression analysis provided adjusted odds ratios for instrumental delivery and unplanned cesarean delivery when the fetal head circumference was ≥35 cm or estimated fetal weight ≥3900 g, while controlling for possible confounders. In all, 11,500 cases were collected; 906 elective cesarean deliveries were excluded. A fetal head circumference ≥35 cm increased the risk for unplanned cesarean delivery: 174 fetuses with fetal head circumference ≥35 cm (32%) were delivered by cesarean, vs 1712 (17%) when fetal head circumference cesarean delivery by an adjusted odds ratio of 1.75 (95% confidence interval, 1.4-2.18) controlling for gestational age, fetal gender, and epidural anesthesia. The rate of prolonged second stage of labor was significantly increased when either the fetal head circumference was ≥35 cm or the estimated fetal weight ≥3900 g, from 22.7% in the total

  14. Hemolytic disease of the fetus and newborn due to anti-Ge3: combined antibody-dependent hemolysis and erythroid precursor cell growth inhibition.

    Science.gov (United States)

    Blackall, Douglas P; Pesek, Gina D; Montgomery, Matthew M; Oza, Krishna K; Arndt, Patricia A; Garratty, George; Shahcheraghi, Ali; Denomme, Gregory A

    2008-10-01

    The Gerbich (Ge) antigens are a collection of high-incidence antigens carried on the red blood cell membrane glycoproteins, glycophorins C and D. Antibodies against these antigens are uncommon, and there have been only rare case reports of hemolytic disease of the fetus and newborn due to anti-Ge. In this case report, we present a neonate with severe anemia and hyperbilirubinemia due to anti-Ge3. Routine and special laboratory studies undertaken in this case suggested two mechanisms for the patient's hemolysis and persistent anemia. Antibody-dependent hemolysis was associated with early-onset hyperbilirubinemia, anemia, and a mild reticulocytosis, and inhibition of erythroid progenitor cell growth was associated with late anemia and normal bilirubin and reticulocyte values. Though rare, anti-Ge3 can be a dangerous antibody in pregnancy. Affected neonates may require intensive initial therapy and close follow-up for at least several weeks after delivery.

  15. Hemopoietic regeneration in murine spleen following transfusion of normal and irradiated marrow: different response of granulocyte/macrophage and erythroid precursors

    International Nuclear Information System (INIS)

    Wangenheim, K.-H. von; Peterson, H.-P.; Huebner, G.E.; Feinendegen, L.E.

    1987-01-01

    To investigate cell proliferation in regenerating spleen, bone marrow of normal and gamma-irradiated donor mice (3 weeks after 5 Gy) was transfused into lethally irradiated recipients. In the donors and in the recipient spleens numbers of CFU-S and progenitor cells were determined. In the irradiated donors the progenitors were at control level after 3 weeks of recovery although CFU-S were still at 50% of control. Recipients of the irradiated marrow received therefore an increased proportion of progenitors. CFU-C appeared to be self-renewing and/or increased in number due to enhanced CFU-S differentiation, but not the erythroid progenitors. CFU-S self-renewal was reduced after 5 Gy. The data suggest that cell differentiation and maturation proceed during early splenic regeneration. The quantity of CFU-C does not necessarily mirror the situation in the stem cell compartment. (author)

  16. Metabolomics Application in Maternal-Fetal Medicine

    Directory of Open Access Journals (Sweden)

    Vassilios Fanos

    2013-01-01

    Full Text Available Metabolomics in maternal-fetal medicine is still an “embryonic” science. However, there is already an increasing interest in metabolome of normal and complicated pregnancies, and neonatal outcomes. Tissues used for metabolomics interrogations of pregnant women, fetuses and newborns are amniotic fluid, blood, plasma, cord blood, placenta, urine, and vaginal secretions. All published papers highlight the strong correlation between biomarkers found in these tissues and fetal malformations, preterm delivery, premature rupture of membranes, gestational diabetes mellitus, preeclampsia, neonatal asphyxia, and hypoxic-ischemic encephalopathy. The aim of this review is to summarize and comment on original data available in relevant published works in order to emphasize the clinical potential of metabolomics in obstetrics in the immediate future.

  17. Diagnostic value of ultrafast fetal MRI

    International Nuclear Information System (INIS)

    Stoisa, Daniela; De Luca, Silvina E.; Florenzano, Nestor V.; Mondello, Eduardo J.; Eyheremendy, Eduardo; Heinen, Fernando; Margulies, Daniel

    2003-01-01

    Purpose: To analyze cases of fetal pathology evaluated by Ultra Fast MR sequences. Material and methods: 12 patients (2nd. and 3rd. trimester of pregnancy) have been studied by obstetric US and MR. Results: In our series we found intestinal duplication cyst, ureteropelvic junction obstruction and multicystic dysplastic kidney, esophageal atresia, acardia, anencephalic syndrome, semilobar holoprosencephaly, congenital diafragmatic hernia, cystic adenomatoid malformation, onphalocele and several scoliosis, duodenal stenosis, cervical teratoma and uretral atresia. In 8/12 cases (66%) MRI provide additional information as compared to US. Conclusion: The Ultra Fast MR sequences allows the evaluation of patients in the second and third trimester of pregnancy without sedation. It should be considered as a complementary method of the US to confirm fetal anomalies. The information provided by MRI is useful in planning adequate therapeutic decisions. (author)

  18. Fetal chromosome analysis: screening for chromosome disease?

    DEFF Research Database (Denmark)

    Philip, J; Tabor, Ann; Bang, J

    1983-01-01

    The aim of the study was to investigate the rationale of the current indications for fetal chromosome analysis. 5372 women had 5423 amniocentesis performed, this group constituting a consecutive sample at the chromosome laboratory, Rigshospitalet, Copenhagen from March 1973 to September 1980 (Group...... A + B). Pregnant women 35 years of age, women who previously had a chromosomally abnormal child, families with translocation carriers or other heritable chromosomal disease, families where the father was 50 years or more and women in families with a history of Down's syndrome (group A), were compared...... to women having amniocentesis, although considered not to have any increased risk of fetal chromosome abnormality (1390 pregnancies, group B). They were also compared with 750 consecutive pregnancies in women 25-34 years of age, in whom all heritable diseases were excluded (group C). The risk of unbalanced...

  19. Fetal programming and gestational diabetes mellitus.

    Science.gov (United States)

    Monteiro, Lara J; Norman, Jane E; Rice, Gregory E; Illanes, Sebastián E

    2016-12-01

    Gestational diabetes mellitus is defined by new-onset glucose intolerance during pregnancy. About 2-5% of all pregnant women develop gestational diabetes during their pregnancies and the prevalence has increased considerably during the last decade. This metabolic condition is manifested when pancreatic β-cells lose their ability to compensate for increased insulin resistance during pregnancy, however, the pathogenesis of the disease remains largely unknown. Gestational diabetes is strongly associated with adverse pregnancy outcome as well as with long-term adverse effects on the offspring which likely occurs due to epigenetic modifications of the fetal genome. In the current review we address gestational diabetes and the short and long term complications for both mothers and offspring focusing on the importance of fetal programming in conferring risk of developing diseases in adulthood. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Cadmium-induced fetal toxicity in the rat

    International Nuclear Information System (INIS)

    Levin, A.A.

    1980-01-01

    Cadmium, a heavy metal environment contaminant, induces fetal death and placental necrosis in the Wistar rat. This study investigated fetal, maternal, and placental responses to cadmium intoxication. Subcutaneous injection of CdCl 2 to dams on day 18 of pregnancy produced a high incidence of fetal death (75%) and placental necrosis. Death in the fetus was produced despite limited fetal accumulations of cadmium. Distribution studies using 109 Cd-labeled CdCl 2 demonstrated that less than 0.1% of the injected dose was associated with the fetus. To determine if fetuses were sensitive to these low levels of cadmium, direct injections of CdCl 2 into fetuses were performed in utero. Direct injections produced fetal accumulations 8-fold greater than those following maternal injections. The 8-fold greater fetal accumulations following direct injection were associated with only a 12% fetal mortality compared to the 75% mortality following maternal injections. The data indicated that the fetal toxicity of cadmium following maternal injections was not the result of direct effects of cadmium on the fetus. In conclusion, cadmium-induced fetal death was not the result of direct effects of cadmium on the fetus but may have been induced by placental cellular injury resulting from high accumulations of cadmium in the placenta. A vascular response to placental injury, leading to decreased utero-placental bood flow and cadmium-induced alterations in trophoblastic function, resulted in fetal death

  1. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: stephen.brandt@vanderbilt.edu [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)

    2009-12-11

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  2. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    International Nuclear Information System (INIS)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.

    2009-01-01

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  3. Value of fetal skeletal radiographs in the diagnosis of fetal death

    International Nuclear Information System (INIS)

    Bourliere-Najean, B.; Russel, A.S.; Petit, P.; Devred, P.; Panuel, M.; Piercecchi-Marti, M.D.; Fredouille, C.; Sigaudy, S.; Philip, N.

    2003-01-01

    The aim of this study was to assess the value of fetal skeletal radiographs in determining the etiology of fetal death. A total of 1193 post-mortem fetal skeletal radiographs were analysed. Fetuses were classified into one of three groups (group I: abnormality diagnosed during pregnancy; group II: maternal pathology; group III: spontaneous abortion of pregnancy, IIIa before 26 weeks of gestation (WG), IIIb after 26 weeks of gestation). Face, supine and lateral skeletal views were performed. Skeletal abnormalities were detected in 33.9% of the fetuses, including 22.7% with minor abnormalities (abnormal rib number, no nasal bone ossification, amesophalangia or P2 hypoplasia of the fifth digit) and 14.5% with major abnormalities (other skeletal abnormalities). Among the fetuses with major abnormalities, 98.8% came from group I, 2.9% came from group II, 2.3% came from group IIIa and none came from group IIIb. Fetal skeletal radiographs are not useful in fetuses arising from spontaneous abortion of pregnancy without abnormality on ultrasound screening, abnormality clinical examination or in fetuses with prenatal diagnosis of chromosomal abnormality. This practice is valuable only if there is a multidisciplinary team, with all the participants (pathologists, radiologists, geneticists) knowledgeable about fetal pathology. In the absence of this multidisciplinary approach, it is easier to X-ray all fetuses to avoid misdiagnosis and the important consequences for genetic counselling. (orig.)

  4. Anatomy of the normal fetal heart: The basis for understanding fetal echocardiography

    Directory of Open Access Journals (Sweden)

    Beatriz Picazo-Angelin

    2018-01-01

    Full Text Available The rapid changes that have taken place in recent years in relation to techniques used to image the fetal heart have emphasized the need to have a detailed knowledge ofnormal cardiac anatomy. Without such knowledge, it is difficult, if not impossible, to recognize the multiple facets of congenital cardiac disease. From the inception of fetal echocardiographic screening, the importance of basic knowledge of cardiac anatomy has been well recognized. The current machines used for imaging, however, now make it possible potentially to recognize features not appreciated at the start of the specialty. So as to match the advances made in imaging, we have now revisited our understanding of normal cardiac anatomy in the mid-gestational fetus. This was made possible by our dissection of 10 fetal hearts, followed by production of addition histological sections that mimic the standard ultrasound views. The fetuses ranged in gestational age from between 20 and 28 weeks. We then correlated the obtained anatomic images with the corresponding ultrasonic images used in the standard fetal screening scan. We also interrogated the anatomic sections so as to clarify ongoing controversies regarding detailed features of the normal cardiac anatomy. We have been able to show that the views now obtained using current technology reveal many details of anatomy not always appreciated at earlier times. Knowledge of these features should now permit diagnosis of most congenital cardiac malformations. The anatomic-echocardiographic correlations additionally provide a valuable resource for both the understanding and teaching of fetal echocardiography.

  5. Value of fetal skeletal radiographs in the diagnosis of fetal death

    Energy Technology Data Exchange (ETDEWEB)

    Bourliere-Najean, B.; Russel, A.S.; Petit, P.; Devred, P. [Department of Pediatric Radiology, CHU Timone, 264 rue St. Pierre, 13385 Marseille cedex 5 (France); Panuel, M. [Department of Radiology, Hopital Nord, chemin Bourrelys, 13915 Marseille cedex 20 (France); Piercecchi-Marti, M.D.; Fredouille, C. [Department of Pathology, CHU Timone, 264 rue St. Pierre, 13385 Marseille cedex 5 (France); Sigaudy, S.; Philip, N. [Department of Genetics, CHU Timone, 264 rue St. Pierre, 13385 Marseille cedex 5 (France)

    2003-05-01

    The aim of this study was to assess the value of fetal skeletal radiographs in determining the etiology of fetal death. A total of 1193 post-mortem fetal skeletal radiographs were analysed. Fetuses were classified into one of three groups (group I: abnormality diagnosed during pregnancy; group II: maternal pathology; group III: spontaneous abortion of pregnancy, IIIa before 26 weeks of gestation (WG), IIIb after 26 weeks of gestation). Face, supine and lateral skeletal views were performed. Skeletal abnormalities were detected in 33.9% of the fetuses, including 22.7% with minor abnormalities (abnormal rib number, no nasal bone ossification, amesophalangia or P2 hypoplasia of the fifth digit) and 14.5% with major abnormalities (other skeletal abnormalities). Among the fetuses with major abnormalities, 98.8% came from group I, 2.9% came from group II, 2.3% came from group IIIa and none came from group IIIb. Fetal skeletal radiographs are not useful in fetuses arising from spontaneous abortion of pregnancy without abnormality on ultrasound screening, abnormality clinical examination or in fetuses with prenatal diagnosis of chromosomal abnormality. This practice is valuable only if there is a multidisciplinary team, with all the participants (pathologists, radiologists, geneticists) knowledgeable about fetal pathology. In the absence of this multidisciplinary approach, it is easier to X-ray all fetuses to avoid misdiagnosis and the important consequences for genetic counselling. (orig.)

  6. O6-methylguanine DNA methyltransferase in human fetal tissues: fetal and maternal factors

    International Nuclear Information System (INIS)

    D'Ambrosio, S.M.; Samuel, M.J.; Dutta-Choudhury, T.A.; Wani, A.A.

    1986-01-01

    O 6 -Methylguanine methyltransferase (O 6 -MT) was measured and compared in extracts of 7 human fetal tissues obtained from 21 different fetal specimens as a function of fetal age and race, and maternal smoking and drug usage. Activity was determined from the proteinase-K solubilized radioactivity transferred from the DNA to the O 6 -MT. S9 homogenates were incubated with a heat depurinated [ 3 H]-methylnitrosourea alkylated DNA. Liver exhibited the highest activity followed by kidney, lung, small intestine, large intestine, skin and brain. Each of the tissues exhibited a 3- to 5-fold level of interindividual variation of O 6 -MT. There did not appear to be any significant difference of O 6 -MT in the tissues obtained from mothers who smoked cigarettes during pregnancy. Also, fetal race and age did not appear to account for the level of variation of O 6 -MT. The fetal tissues obtained from an individual using phenobarbital and smoking exhibited 4-fold increases in O 6 -MT activity. The tissues obtained from another individual on kidney dialysis were 2- to 3-fold higher than the normal population. These data suggest that the variation in human O 6 -MT can not be explained by racial or smoking factors, but may be modulated by certain drugs

  7. Placental adaptations to the maternal-fetal environment: implications for fetal growth and developmental programming.

    Science.gov (United States)

    Sandovici, Ionel; Hoelle, Katharina; Angiolini, Emily; Constância, Miguel

    2012-07-01

    The placenta is a transient organ found in eutherian mammals that evolved primarily to provide nutrients for the developing fetus. The placenta exchanges a wide array of nutrients, endocrine signals, cytokines and growth factors with the mother and the fetus, thereby regulating intrauterine development. Recent studies show that the placenta is not just a passive organ mediating maternal-fetal exchange. It can adapt its capacity to supply nutrients in response to intrinsic and extrinsic variations in the maternal-fetal environment. These dynamic adaptations are thought to occur to maximize fetal growth and viability at birth in the prevailing conditions in utero. However, some of these adaptations may also affect the development of individual fetal tissues, with patho-physiological consequences long after birth. Here, this review summarizes current knowledge on the causes, possible mechanisms and consequences of placental adaptive responses, with a focus on the regulation of transporter-mediated processes for nutrients. This review also highlights the emerging roles that imprinted genes and epigenetic mechanisms of gene regulation may play in placental adaptations to the maternal-fetal environment. Copyright © 2012 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  8. Fetal diprosopus (Double face): A case report

    OpenAIRE

    Onankpa BO, Ukwu E, Singh S, Adoke AU, Tahir A

    2014-01-01

    Diprosopus is an extremely rare form of congenital anomaly that results in partial or total duplication of the face. Most cases of diprosopus are delivered as stillborn or die few moments after delivery. The aim of this report is to alert clinicians that the antenatal finding of polyhydramnious may be strongly associated with fetal diprosopus, this routine high resolution anomaly scans should be recommended to help detect such anomaly early in pregnancy. We report a case of a female neonate w...

  9. Can postmortem fetal MR imaging replace autopsy?

    International Nuclear Information System (INIS)

    Cho, Jeong Yeon; Song, Mi Jin; Kim, Seoung Hyup

    2001-01-01

    The purposes of this study were to compare postmortem fetal MRI findings with autopsy findings and to assess whether postmortem MRI can replace autopsy. The study group consisted of 13 stillborn fetuses, seven that died immediately after birth, and five terminated because of anomalies seen on prenatal sonograms. A total 17 were male, and eight were female, and their gestational ages were from 20 to 41 (average;28.2) weeks. Spin-echo T1-and T2-weighted axial, sagittal, and coronal MR images were obtained, and autopsy findings were divided into major and minor. A major finding was defined as an anomaly or syndrome which caused fetal death or termination of the pregnancy: minor findings were classified, on the basis of gross inspection, as internal or external. MR images were retrospectively analyzed by two radiologists unaware of the autopsy findings, and by comparison with these, the postmortem MRI detection rates for major and minor findings was then determined. In seven of 25 fetuses, MR imaging revealed major findings, a dietction rate of 100%. There were two cases of anencephaly, two of trisomy-18, and one each of hydrops fetalis with large cystic hygroma, diaphragmatic hernia, and Dandy-Walker malformation. Twenty-three of 60 minor findings (38.3%) were detected by MRI. The detection rates for external and internal findings were 29.6%(8/27) and 45.5%(15/33), respectively. Although a limitation of our study is the low detection rate for minor findings, postmortem fetal MRI may help diagnose the major cause of fetal death

  10. Role of melatonin in embryo fetal development

    OpenAIRE

    Voiculescu, SE; Zygouropoulos, N; Zahiu, CD; Zagrean, AM

    2014-01-01

    Melatonin is an indoleamine produced by the pineal gland and secreted in a circadian manner. In the past few decades, research over this topic has been enhanced. Melatonin has many important roles in the human physiology: regulator of the circadian rhythms, sleep inducer, antioxidant, anticarcinogenic. This paper reviews the involvement of melatonin in embryo fetal development. The pineal gland develops completely postpartum, so both the embryo and the fetus are dependent on the maternal mela...

  11. Fetal programming of the metabolic syndrome

    Directory of Open Access Journals (Sweden)

    Aleksandra Marciniak

    2017-04-01

    Full Text Available Prenatal development is currently recognized as a critical period in the etiology of human diseases. This is particularly so when an unfavorable environment interacts with a genetic predisposition. The fetal programming concept suggests that maternal nutritional imbalance and metabolic disturbances may have a persistent and intergenerational effect on the health of offspring and on the risk of diseases such as obesity, diabetes, and cardiovascular diseases.

  12. Normal renal development investigated with fetal MRI

    Energy Technology Data Exchange (ETDEWEB)

    Witzani, Linde [Department of Radiology, Medical University of Vienna, Waehringer Guertel 18-20, A-1090 Vienna (Austria)]. E-mail: linde.witzani@aon.at; Brugger, Peter Christian [Center of Anatomy and Cell Biology, Integrative Morphology Group, Medical University of Vienna, Waehringerstrasse 13, A-1090 Vienna (Austria); Hoermann, Marcus [Department of Radiology, Medical University of Vienna, Waehringer Guertel 18-20, A-1090 Vienna (Austria); Kasprian, Gregor [Department of Radiology, Medical University of Vienna, Waehringer Guertel 18-20, A-1090 Vienna (Austria); Csapone-Balassy, Csilla [Department of Radiology, Medical University of Vienna, Waehringer Guertel 18-20, A-1090 Vienna (Austria); Prayer, Daniela [Department of Radiology, Medical University of Vienna, Waehringer Guertel 18-20, A-1090 Vienna (Austria)

    2006-02-15

    Objective: To evaluate age-dependent changes in fetal kidney measurements with MRI. Patients and methods: Fetal MRI examinations were used to study the kidney length (218 fetuses), signal intensities of renal tissue, renal pelvis, and liver tissue on T2-weighted images (223 fetuses), and the whole-kidney apparent diffusion coefficient (107 fetuses). A 1.5 T superconducting unit with a phased array coil was used in patients from 16 to 39 weeks' gestation. The imaging protocol included T2-weighted single-shot fast spin-echo, T2-weighted balanced angiography and diffusion-weighted sequences. Slice thickness ranged from 3 to 5 mm. Results: Fetal kidney length as a function of gestational age was expressed by the linear regression: kidney length (mm) = 0.190 x gestational age (d) - 8.034 (R {sup 2} 0.883, p < 0.001). Paired t-test analysis showed a highly statistically significant difference between the ratio of renal tissue signal intensity to renal pelvis signal intensity and the ratio of liver signal intensity to renal pelvis signal intensity on T2-weighted images (t = -50.963, d.f. = 162, p < 0.001), with renal tissue hyperintense to liver tissue. The apparent diffusion coefficient in relation to gestational age was described by the equation: ADC ({mu}m{sup 2}/s) = 0.0302 x square (gestational age (d)) - 14.202 x gestational age (d) + 2728.6 (R {sup 2} = 0.225, p < 0.001). Conclusion: The length, signal intensity on T2-weighted images, and apparent diffusion coefficient of the fetal kidney change significantly with gestational age. The presented data may help in the prenatal diagnosis of renal anomalies.

  13. Role of fetal DNA in preeclampsia (review).

    Science.gov (United States)

    Konečná, Barbora; Vlková, Barbora; Celec, Peter

    2015-02-01

    Preeclampsia is an autoimmune disorder characterized by hypertension. It begins with abnormal cytotrophoblast apoptosis, which leads to inflammation and an increase in the levels of anti-angiogenic factors followed by the disruption of the angiogenic status. Increased levels of fetal DNA and RNA coming from the placenta, one of the most commonly affected organs in pregnancies complicated by preeclampsia, have been found in pregnant women with the condition. However, it remains unknown as to whether this is a cause or a consequence of preeclampsia. Few studies have been carried out on preeclampsia in which an animal model of preeclampsia was induced by an injection of different types of DNA that are mimic fetal DNA and provoke inflammation through Toll-like receptor 9 (TLR9) or cyclic guanosine monophosphate-adenosine monophosphate (cGAMP). The specific mechanisms involved in the development of preeclampsia are not yet fully understood. It is hypothesized that the presence of different fragments of fetal DNA in maternal plasma may cause for the development of preeclampsia. The function of DNase during preeclampsia also remains unresolved. Studies have suggested that its activity is decreased or the DNA is protected against its effects. Further research is required to uncover the pathogenesis of preeclampsia and focus more on the condition of patients with the condition.

  14. Fetal MRI: incidental findings in the mother

    International Nuclear Information System (INIS)

    Abdullah, Selwan B.; Dietz, Kelly R.; Holm, Tara L.

    2016-01-01

    Fetal magnetic resonance imaging (MRI) is a routinely used tool in prenatal diagnosis; however, there is a lack of studies evaluating incidental findings observed in the mother. This study describes and quantifies incidental findings observed in the mother during fetal MRI. We reviewed all fetal MRI studies at the University of Minnesota Medical Center from February 2008 to September 2014. Two pediatric radiologists retrospectively conducted a consensus evaluation. The maternal findings were categorized into neurologic, gynecologic, urinary, gastrointestinal and musculoskeletal. Hydronephrosis consistent with the stage of pregnancy was recorded but was not included as an abnormal finding. Abnormal findings were classified into three groups, depending on their clinical significance: level I (low), level II (medium) and level III (high). We evaluated 332 pregnant patients with a mean age of 29.3 years and a mean gestational age of 29 weeks. Of these, 55.4% had at least 1 incidental finding, for a total of 262 incidental maternal findings. Of the 262 abnormalities, 113 (43.1%) were neurologic, 69 were gynecologic (26.3%), 36 (13.7%) urinary, 24 (9.2%) gastrointestinal and 20 (7.6%) musculoskeletal. Of the 262 incidental findings, 237 (90.5%) were level I, 24 (9.2%) were level II and 1 (0.4%) was level III. Our results suggest that although the vast majority of incidental maternal findings are benign, more significant findings are still encountered and should be expected. (orig.)

  15. Fetal MRI: incidental findings in the mother

    Energy Technology Data Exchange (ETDEWEB)

    Abdullah, Selwan B. [University of Maryland Medical Center, Diagnostic Radiology and Nuclear Medicine, Baltimore, MD (United States); University of Minnesota, Medical School, Minneapolis, MN (United States); Dietz, Kelly R.; Holm, Tara L. [University of Minnesota, Department of Radiology, Minneapolis, MN (United States)

    2016-11-15

    Fetal magnetic resonance imaging (MRI) is a routinely used tool in prenatal diagnosis; however, there is a lack of studies evaluating incidental findings observed in the mother. This study describes and quantifies incidental findings observed in the mother during fetal MRI. We reviewed all fetal MRI studies at the University of Minnesota Medical Center from February 2008 to September 2014. Two pediatric radiologists retrospectively conducted a consensus evaluation. The maternal findings were categorized into neurologic, gynecologic, urinary, gastrointestinal and musculoskeletal. Hydronephrosis consistent with the stage of pregnancy was recorded but was not included as an abnormal finding. Abnormal findings were classified into three groups, depending on their clinical significance: level I (low), level II (medium) and level III (high). We evaluated 332 pregnant patients with a mean age of 29.3 years and a mean gestational age of 29 weeks. Of these, 55.4% had at least 1 incidental finding, for a total of 262 incidental maternal findings. Of the 262 abnormalities, 113 (43.1%) were neurologic, 69 were gynecologic (26.3%), 36 (13.7%) urinary, 24 (9.2%) gastrointestinal and 20 (7.6%) musculoskeletal. Of the 262 incidental findings, 237 (90.5%) were level I, 24 (9.2%) were level II and 1 (0.4%) was level III. Our results suggest that although the vast majority of incidental maternal findings are benign, more significant findings are still encountered and should be expected. (orig.)

  16. Effects of Cremation on Fetal Bones.

    Science.gov (United States)

    Zana, Michela; Magli, Francesca; Mazzucchi, Alessandra; Castoldi, Elisa; Gibelli, Daniele; Caccia, Giulia; Cornacchia, Francesca; Gaudio, Daniel A; Mattia, Mirko; Cattaneo, Cristina

    2017-09-01

    The charring process is a weak point of anthropological analysis as it changes bone morphology and reduces information obtainable, specially in fetuses. This experiment aims at verifying the conservation of fetal bones after cremation. A total of 3138 fetuses of unknown sex and age were used, deriving from legal and therapeutic abortions from different hospitals of Milan. Cremations took place in modern crematoria. Nine cremation events were analyzed, each ranging from 57 to 915 simultaneously cremated fetuses. During the cremations, 4356 skeletal remains were recovered, 3756 of which (86.2%) were morphologically distinguishable. All types of fetal skeletal elements were found, with the exception of some cranial bones. Only 3.4% of individuals could be detected after the cremation process, because of the prevalence of abortions under 12 lunar weeks. All fire alterations were observed and the results were statistically analyzed. This pilot study confirmed the possibility of preservation of fetal skeletal elements after cremation. © 2017 American Academy of Forensic Sciences.

  17. Revisiting the argument from fetal potential

    Directory of Open Access Journals (Sweden)

    Manninen Bertha

    2007-05-01

    Full Text Available Abstract One of the most famous, and most derided, arguments against the morality of abortion is the argument from potential, which maintains that the fetus' potential to become a person and enjoy the valuable life common to persons, entails that its destruction is prima facie morally impermissible. In this paper, I will revisit and offer a defense of the argument from potential. First, I will criticize the classical arguments proffered against the importance of fetal potential, specifically the arguments put forth by philosophers Peter Singer and David Boonin, by carefully unpacking the claims made in these arguments and illustrating why they are flawed. Secondly, I will maintain that fetal potential is morally relevant when it comes to the morality of abortion, but that it must be accorded a proper place in the argument. This proper place, however, cannot be found until we first answer a very important and complex question: we must first address the issue of personal identity, and when the fetus becomes the type of being who is relevantly identical to a future person. I will illustrate why the question of fetal potential can only be meaningfully addressed after we have first answered the question of personal identity and how it relates to the human fetus.

  18. Assessment and control of fetal exposure

    International Nuclear Information System (INIS)

    Harty, R.; Swinth, K.L.; Traub, R.J.

    1991-10-01

    The assessment and control of fetal exposure to radiation in the workplace is an issue that is complicated by both biological and political/social ramifications. As a result of the dramatic increase in the number of women employed as radiation workers during the past 10 years, many facilities using radioactive materials have instituted fetal protection programs with special requirements for female radiation workers. It is necessary, however, to ensure that any fetal protection program be developed in such a way as to be nondiscriminatory. A study has been initiated whose purpose is to balance the political/social and the biological ramifications associated with occupational protection of the developing embryo/fetus. Several considerations are involved in properly balancing these factors. These considerations include appropriate methods of declaring the pregnancy, training workers, controlling the dose to the embryo/fetus, measuring and calculating the dose to the embryo/fetus, and recording the pertinent information. Alternative strategies for handling these factors while ensuring maximum protection of the embryo/fetus and the rights and responsibilities of employees and employers are discussed

  19. Thyroid hormones and fetal brain development.

    Science.gov (United States)

    Pemberton, H N; Franklyn, J A; Kilby, M D

    2005-08-01

    Thyroid hormones are intricately involved in the developing fetal brain. The fetal central nervous system is sensitive to the maternal thyroid status. Critical amounts of maternal T3 and T4 must be transported across the placenta to the fetus to ensure the correct development of the brain throughout ontogeny. Severe mental retardation of the child can occur due to compromised iodine intake or thyroid disease. This has been reported in areas of the world with iodine insufficiency, New Guinea, and also in mother with thyroid complications such as hypothyroxinaemia and hyperthyroidism. The molecular control of thyroid hormones by deiodinases for the activation of thyroid hormones is critical to ensure the correct amount of active thyroid hormones are temporally supplied to the fetus. These hormones provide timing signals for the induction of programmes for differentiation and maturation at specific stages of development. Understanding these molecular mechanisms further will have profound implications in the clinical management of individuals affected by abnormal maternal of fetal thyroid status.

  20. Fetal programming of schizophrenia: select mechanisms.

    Science.gov (United States)

    Debnath, Monojit; Venkatasubramanian, Ganesan; Berk, Michael

    2015-02-01

    Mounting evidence indicates that schizophrenia is associated with adverse intrauterine experiences. An adverse or suboptimal fetal environment can cause irreversible changes in brain that can subsequently exert long-lasting effects through resetting a diverse array of biological systems including endocrine, immune and nervous. It is evident from animal and imaging studies that subtle variations in the intrauterine environment can cause recognizable differences in brain structure and cognitive functions in the offspring. A wide variety of environmental factors may play a role in precipitating the emergent developmental dysregulation and the consequent evolution of psychiatric traits in early adulthood by inducing inflammatory, oxidative and nitrosative stress (IO&NS) pathways, mitochondrial dysfunction, apoptosis, and epigenetic dysregulation. However, the precise mechanisms behind such relationships and the specificity of the risk factors for schizophrenia remain exploratory. Considering the paucity of knowledge on fetal programming of schizophrenia, it is timely to consolidate the recent advances in the field and put forward an integrated overview of the mechanisms associated with fetal origin of schizophrenia. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Do fatty acids affect fetal programming?

    Science.gov (United States)

    Kabaran, Seray; Besler, H Tanju

    2015-08-13

    In this study discussed the primary and regulatory roles of fatty acids, and investigated the affects of fatty acids on metabolic programming. Review of the literature was carried out on three electronic databases to assess the roles of fatty acids in metabolic programming. All abstracts and full-text articles were examined, and the most relevant articles were selected for screening and inclusion in this review. The mother's nutritional environment during fetal period has important effects on long term health. Fatty acids play a primary role in growth and development. Alterations in fatty acid intake in the fetal period may increase the risk of obesity and metabolic disorders in later life. Maternal fatty acid intakes during pregnancy and lactation are passed to the fetus and the newborn via the placenta and breast milk, respectively. Imbalances in fatty acid intake during the fetal period change the fatty acid composition of membrane phospholipids, which can cause structural and functional problems in cells. Additionally, the metabolic and neuroendocrine environments of the fetus and the newborn play key roles in the regulation of energy balance. Imbalances in fatty acid intake during pregnancy and lactation may result in permanent changes in appetite control, neuroendocrine function and energy metabolism in the fetus, leading to metabolic programming. Further studies are needed to determine the role of fatty acid intake in metabolic programming.

  2. Fetal MRI in experimental tracheal occlusion

    Energy Technology Data Exchange (ETDEWEB)

    Wedegaertner, Ulrike [Department of Diagnostic and Interventional Radiology, Universitaetsklinikum Hamburg-Eppendorf, Martinistrasse 52, 20251 Hamburg (Germany)]. E-mail: wedegaer@uke.uni-hamburg.de; Schroeder, Hobe J. [Experimental Gynecology, Department of Obstetrics and Prenatal Medicine, Universitaetsklinikum Hamburg-Eppendorf, Hamburg (Germany); Adam, Gerhard [Department of Diagnostic and Interventional Radiology, Universitaetsklinikum Hamburg-Eppendorf, Hamburg (Germany)

    2006-02-15

    Congenital diaphragmatic hernia (CDH) is associated with a high mortality, which is mainly due to pulmonary hypoplasia and secondary pulmonary hypertension. In severely affected fetuses, tracheal occlusion (TO) is performed prenatally to reverse pulmonary hypoplasia, because TO leads to accelerated lung growth. Prenatal imaging is important to identify fetuses with pulmonary hypoplasia, to diagnose high-risk fetuses who would benefit from TO, and to monitor the effect of TO after surgery. In fetal imaging, ultrasound (US) is the method of choice, because it is widely available, less expensive, and less time-consuming to perform than magnetic resonance imaging (MRI). However, there are some limitations for US in the evaluation of CDH fetuses. In those cases, MRI is helpful because of a better tissue contrast between liver and lung, which enables evaluation of liver herniation for the diagnosis of a high-risk fetus. MRI provides the ability to determine absolute lung volumes to detect lung hypoplasia. In fetal sheep with normal and hyperplastic lungs after TO, lung growth was assessed on the basis of cross-sectional US measurements, after initial lung volume determination by MRI. To monitor fetal lung growth after prenatal TO, both MRI and US seem to be useful methods.

  3. Fetal pancreatic beta-cell function in pregnancies complicated by maternal diabetes mellitus: relationship to fetal acidemia and macrosomia.

    Science.gov (United States)

    Salvesen, D R; Brudenell, J M; Proudler, A J; Crook, D; Nicolaides, K H

    1993-05-01

    Our purpose was to investigate the relationship between fetal pancreatic beta-cell function and fetal acidemia and macrosomia in pregnancies complicated by maternal diabetes mellitus. A cross-sectional study at the Harris Birthright Research Centre for Fetal Medicine, London, was performed. In 32 pregnancies complicated by maternal diabetes mellitus cordocentesis was performed at 36 to 39 weeks' gestation for the measurement of umbilical venous blood pH, PO2, PCO2, lactate, and glucose concentration; plasma insulin immunoreactivity; and insulin/glucose ratio. A reference range for plasma insulin and insulin/glucose ratio was constructed by studying fetal blood samples from 80 women who did not have diabetes mellitus. Mean umbilical venous blood pH was significantly lower and plasma insulin immunoreactivity and insulin/glucose ratio were significantly higher than the appropriate normal mean for gestation. There were significant associations between (1) maternal and fetal blood glucose concentrations (r = 0.95, p < 0.0001), (2) fetal blood glucose and plasma insulin immunoreactivity (r = 0.57, p < 0.01), (3) fetal plasma insulin immunoreactivity and blood pH (r = -0.39, p < 0.05), and (4) fetal insulin/glucose ratio and degree of macrosomia (r = 0.76, p < 0.0001). Fetal pancreatic beta-cell hyperplasia is implicated in the pathogenesis of both fetal acidemia and macrosomia.

  4. Ultrasound diagnosis and monitoring of fetal tachyarrhythmias

    Directory of Open Access Journals (Sweden)

    Yu.А. Ivaniv

    2017-12-01

    Full Text Available The aim – to evaluate the efficiency of prenatal echocardiography in detecting, differential diagnosis and monitoring fetuses with tachyarrhythmias. Materials and methods. Investigations performed in a single center from April 1996 to July 2016 were analysed. During this study 2,073 pregnant women were examined and 213 cases of fetal arrhythmia were found (10.3 %. Prenatal echocardiography was conducted by general protocol, each examination were fixed and saved in electronic and paper form. Results. During this period 25 cases of fetal tachyarrhythmias were diagnosed, representing 11.7 % of all cases of arrhythmia and 1.2 % of all fetal heart examinations. In five fetuses tachyarrhythmia was combined with structural heart disorders, which constitutes 20 % among all tachyarrhythmias. Most fetal tachyarrhythmias (21 were diagnosed during third trimester of pregnancy. The most common fetal tachyarrhythmia was atrioventricular «re-entry» tachycardia – 14 cases (56 %. None case of this group was combined with structural cardiac pathology, however, almost half were accompanied by hemodynamic complications. Drug treatment was effective in this group. Atrial fibrillation was second prevalent in our study, 4 cases (16 % – dangerous arrhythmia, which in most fetuses caused circulatory failure, being combined with congenital heart defect or myocardial pathology. Drug treatment in this group is less effective, depending on comorbidity and age pregnancy. We diagnosed 4 cases of sinus tachycardia (16 %, largely having benign course in the prenatal period and not requiring drug treatment. Prognosis of pregnancy is determined by concomitant diseases of the fetus. One case (4 % of atrial flutter required preterm delivery through the hemodynamic complications. Ectopic atrial tachycardia was diagnosed in two fetuses (8 %. This arrhythmia is insensitive to medical treatment and may persist after birth. Conclusions. Clinical management of pregnancy, the need

  5. Fetal dose evaluation during breast cancer radiotherapy

    International Nuclear Information System (INIS)

    Antypas, Christos; Sandilos, Panagiotis; Kouvaris, John; Balafouta, Ersi; Karinou, Eleftheria; Kollaros, Nikos; Vlahos, Lambros

    1998-01-01

    Purpose: The aim of the work was to estimate the radiation dose delivered to the fetus in a pregnant patient irradiated for breast cancer. Methods and Materials: A 45-year woman was treated for left breast cancer using a 6 MV photon beam with two isocentric opposing tangential unwedged fields. Daily dose was 2.3 Gy at 95% isodose line given by two fields/day, 5 days/week. A total dose of 46 Gy was given in 20 fractions over a 4-week period. Pregnancy confirmed during the second therapeutic week. Treatment lasted between the second and sixth gestation week. Radiation dose to fetus was estimated from in vivo and phantom measurements using thermoluminescence dosimeters and an ionization chamber. In vivo measurements were performed by inserting either a catheter with TL dosimeters or ionization chamber into the patient's rectum. Phantom measurements were performed by simulating the treatment conditions on an anthropomorphic phantom. Results: TLD measurements (in vivo and phantom) revealed fetal dose to be 0.085% of the tumor dose, corresponding to a cumulative fetal dose of 3.9 cGy for the entire treatment of 46 Gy. Chamber measurements (in vivo and phantom) revealed a fetal dose less than the TLD result: 0.079 and 0.083% of the tumor dose corresponding to cumulative fetal dose of 3.6 cGy and 3.8 cGy for in vivo and phantom measurement, respectively. Conclusions: It was concluded that the cumulative dose delivered to the unshielded fetus was 3.9 cGy for a 46 Gy total tumor dose. The estimated fetal dose is low compared to the total tumor dose given due to the early stage of pregnancy, the large distance between fundus-radiation field, and the fact that no wedges and/or lead blocks were used. No deterministic biological effects of radiation on the live-born embryo are expected. The lifetime risk for radiation-induced fatal cancer is higher than the normal incidence, but is considered as inconsequential

  6. Effect of fetal growth on maternal protein metabolism in postabsorptive rat

    International Nuclear Information System (INIS)

    Ling, P.R.; Bistrian, B.R.; Blackburn, G.L.; Istfan, N.

    1987-01-01

    Rates of protein synthesis were measured in whole fetuses and maternal tissues at 17 and 20 days of gestation in postabsorptive rats using continuous infusion of L-[1- 14 C]leucine. Fetal protein degradation rates were derived from the fractional rates of synthesis and growth. Whole-body (plasma) leucine kinetics in the mother showed a significant reduction of the fraction of plasma leucine oxidized in the mothers bearing older fetuses, a slight increase in the plasma flux, with total leucine oxidation and incorporation into protein remaining similar at the two gestational ages. Estimates of fractional protein synthesis in maternal tissues revealed an increase in placental and hepatic rates at 20 days of gestation, whereas the fractional synthetic rate in muscle remained unchanged. A model for estimation of the redistribution of leucine between plasma and tissues is described in detail. This model revealed a more efficient utilization of leucine in fetal protein synthesis in comparison with other maternal tissues, a greater dependency of the fetus on plasma supply of leucine, and a significant increase (2-fold) in the release of leucine from maternal muscle as the fetal requirements increased proportionately with its size. The latter conclusion, supported by nitrogen analysis and the ratio of bound-to-free leucine in maternal tissues, confirms the importance of maternal stores in maintaining the homeostasis of essential amino acids during late pregnancy

  7. Neutrophil NETs in reproduction: from infertility to preeclampsia and the possibility of fetal loss

    Directory of Open Access Journals (Sweden)

    Sinuhe eHahn

    2012-11-01

    Full Text Available The intention of this review is to provide an overview of the potential role of neutrophil extracellular traps (NETs in mammalian reproduction. Neutrophil NETs appear to be involved in various stages of the reproductive cycle, starting with fertility and possibly ending with fetal loss. The first suggestion that NETs may play a role in pregnancy-related disorders was in preeclampsia, where vast numbers were detected in the intervillous space of affected placentae. The induction of NETosis involved an auto-inflammatory component, mediated by the increased release of placental micro-debris in preeclampsia. This report was the first indicating that NETs may be associated with a human pathology not involving infection.Subsequently, NETs have since then been implicated in bovine or equine infertility, in that semen may become entrapped in the female reproductive during their passage to the oocyte. In this instance interesting species-specific differences are apparent, in that equine sperm evade entrapment via expression of a DNAse-like molecule, whereas highly motile bovine sperm, once free from seminal plasma that promotes interaction with neutrophils, appear impervious to NETs entrapment.Although still in the realm of speculation it is plausible that NETs may be involved in recurrent fetal loss mediated by anti-phospholipid antibodies, or perhaps even in fetal abortion triggered by infections with microorganisms such as L. monocytogenes or B. abortus.

  8. Increased oxidative stress in human fetal membranes overlying the cervix from term non-labouring and post labour deliveries.

    Science.gov (United States)

    Chai, M; Barker, G; Menon, R; Lappas, M

    2012-08-01

    Enzymatic breakdown of the collagen-rich extracellular matrix (ECM) that connects the amnion and chorion layers of the fetal membranes is one of the key events leading to rupture of membranes. Oxidant stress caused by increased formation of reactive oxygen species and/or reduced antioxidant capacity may predispose to membrane rupture, a major cause of preterm birth. The aim of this study was to determine the effect of human labour and supracervical (SC) apposition on antioxidant enzymes and 8-isoprostane (a marker of lipid peroxidation). To determine the effect of human labour on oxidative stress status, fetal membranes from the SC site (SCS) were collected from women at term Caesarean section (no labour), and from the site of membrane rupture (SOR) after spontaneous labour onset and delivery (post labour). To determine the effect of SC apposition on oxidative stress status, amnion was collected from the SCS and a distal site (DS) in women at term Caesarean section in the absence of labour. The release of 8-isoprostane was significantly higher in amnion from the SCS compared to DS, and in fetal membranes from the SOR compared to the SCS. Glutathione peroxidase (GPx) and superoxide dismutase (SOD) activity were lower in amnion from the SC compared to DS. SOD gene expression and enzyme activity were lower in fetal membranes after labour. There was no difference in expression or activity in catalase, GPx and glutathione reductase (GSR) between no labour and post labour fetal membranes. In primary amnion cells, SOD supplementation significantly augmented IL-1β induced MMP-9 expression and activity. In summary, non-labouring SC fetal membranes are characterised by reduced antioxidant enzyme activity when compared to distal membranes, and, as such, may be more susceptible to oxidative damage and thus membrane rupture. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Fatores de risco maternos associados à acidose fetal Maternal risk factors associated with fetal acidosis

    Directory of Open Access Journals (Sweden)

    José Mauro Madi

    2010-09-01

    Full Text Available OBJETIVOS: avaliar os fatores de risco maternos associados à acidose fetal. MÉTODOS: estudo tipo caso-controle composto por 188 recém-nascidos, sendo que 47 compuseram o grupo casos (pH de artéria umbilical OBJECTIVES: to assess maternal risk factors associated with fetal acidosis. METHODS: a case-control type study was conducted of 188 neonates, of whom 47 comprised the case group (umbilical arterial pH <7.0 and 141 the control (umbilical arterial pH E7.1 <7.3. The study included only single-gestation neonates without congenital malformations. Both maternal and fetal variables were taken into consideration. Statistical analysis involved the calculation of the raw and adjusted Odds Ratio, Student's t-test, the chi-squared test and multivariate analysis using Enter-method non-conditional logistic regression. The level of statistical significance was set at p<0.05. RESULTS: in the case group higher percentages of caesarian sections and pre-term births were observed, involving almost five times as much intensive care and twenty-five times more likelihood of Apgar in the 5th minute <7. No association was observed between the groups and fetal presentation, mother's age, history of miscarriage, years of schooling of mother or attendance at prenatal sessions. After multivariate analysis, the only risk factors that remained significant were complications relating to the placenta or the umbilical cord. Deliveries involving complications relating to the placenta or the umbilical cord were three times more likely to involve fetal acidemia. CONCLUSIONS: acidemia among neonates was associated with a higher percentage of caesarians, premature births, a need for intensive care and treatment and an Apgar index of <7 in the 5th minute. After multivariate analysis, complications relating to premature displacement of the placenta and the umbilical cord were the only remaining risk factors associated with fetal acidemia.

  10. Lens artifacts in human fetal eyes - the challenge of interpreting the histomorphology of human fetal lenses.

    Science.gov (United States)

    Herwig, Martina C; Müller, Annette M; Klarmann-Schulz, Ute; Holz, Frank G; Loeffler, Karin U

    2014-01-01

    Evaluation of the lens, including cataractous changes, is often of paramount importance in the classification of fetal syndromes or forensic questions. On histology, the crystalline lens is - especially in fetal and infant eyes - an organ susceptible to numerous artifacts. Thus, the aim of our study was to study various factors (including fixatives) that might have an impact on lens histomorphology. Twenty eyes from ten fetuses (formalin fixation: n = 10, glutaraldehyde fixation: n = 10), matched for gestational age and abortion (spontaneous vs. induced), were investigated macroscopically and by light microscopy. Sections were stained with routine hematoxylin & eosin (H&E), and periodic acid schiff (PAS). The age of the fetal eyes ranged from 15 to 36 weeks of gestation. Lens artifacts were analyzed and compared to fetal and adult lenses with definitive cataractous changes. In addition, 34 eyes from 27 fetuses with trisomy 21 were investigated for lens changes. All lenses showed artifacts of varying extent, in particular globules, vacuoles, clefts, anterior/posterior capsular separation, subcapsular proteinaceous material, fragmentation of the lens capsule/epithelium, and a posterior umbilication. Glutaraldehyde-fixed lenses displayed less artifacts compared to those fixed in formalin. Slight differences in the appearance of artifacts were found dependent on the fixative (formaldehyde vs glutaraldehyde) and the kind of abortion (iatrogenous vs spontaneous). The gestational age did not have a significant influence on the type and extent of lens artifacts. The lenses from fetuses with trisomy 21 displayed similar lens artifacts with no specific findings. Alterations in fetal lens morphology are extremely frequent and variable. These artifacts have to be carefully taken into account when interpreting post-mortem findings. Thus, the postmortem diagnosis of a fetal cataract should be made with great caution, and should include, in adherence to our proposed

  11. The investigation of fetal doses in mantle field irradiation

    International Nuclear Information System (INIS)

    Karacam, S. C; Gueralp, O. S; Oeksuez, D. C; Koca, A.; Cepni, I.; Cepni, K.; Bese, N.

    2009-01-01

    To determine clinically the fetal dose from irradiation of Hodgkin's disease during pregnancy and to quantify the components of fetal dose using phantom measurements. The fetal dose was measured with phantom measurements using thermoluminescent dosemeters (TLDs). Phantom measurements were performed by simulating the treatment conditions on an anthropomorphic phantom. TLDs were placed on the phantom 41, 44, 46.5 and 49.5 cm from the centre of the treatment field. Two TLDs were placed on the surface of the phantom. The estimated total dose to all the TLDs ranged from 8.8 to 13.2 cGy for treatment with 60 Co and from 8.2 to 11.8 cGy for 4 MV photons. It was concluded that the doses in different sections were evaluated to investigate dose changes in different points and depths of fetal tissues in phantom. Precise planning and the use of supplemental fetal shielding may help reduce fetal exposure. (authors)

  12. MRI of normal and pathological fetal lung development

    International Nuclear Information System (INIS)

    Kasprian, Gregor; Balassy, Csilla; Brugger, Peter C.; Prayer, Daniela

    2006-01-01

    Normal fetal lung development is a complex process influenced by mechanical and many biochemical factors. In addition to ultrasound, fetal magnetic resonance imaging (MRI) constitutes a new method to investigate this process in vivo during the second and third trimester. The techniques of MRI volumetry, assessment of signal intensities, and MRI spectroscopy of the fetal lung have been used to analyze this process and have already been applied clinically to identify abnormal fetal lung growth. Particularly in conditions such as oligohydramnios and congenital diaphragmatic hernia (CDH), pulmonary hypoplasia may be the cause of neonatal death. A precise diagnosis and quantification of compromised fetal lung development may improve post- and perinatal management. The main events in fetal lung development are reviewed and MR volumetric data from 106 normal fetuses, as well as different examples of pathological lung growth, are provided

  13. Growth assessment in diagnosis of Fetal Growth Restriction. Review.

    Science.gov (United States)

    Albu, A R; Horhoianu, I A; Dumitrascu, M C; Horhoianu, V

    2014-06-15

    The assessment of fetal growth represents a fundamental step towards the identification of the true growth restricted fetus that is associated to important perinatal morbidity and mortality. The possible ways of detecting abnormal fetal growth are taken into consideration in this review and their strong and weak points are discussed. An important debate still remains about how to discriminate between the physiologically small fetus that does not require special surveillance and the truly growth restricted fetus who is predisposed to perinatal complications, even if its parameters are above the cut-off limits established. In this article, we present the clinical tools of fetal growth assessment: Symphyseal-Fundal Height (SFH) measurement, the fetal ultrasound parameters widely taken into consideration when discussing fetal growth: Abdominal Circumference (AC) and Estimated Fetal Weight (EFW); several types of growth charts and their characteristics: populational growth charts, standard growth charts, individualized growth charts, customized growth charts and growth trajectories.

  14. Fetal Urinary Tract Anomalies: Review of Pathophysiology, Imaging, and Management.

    Science.gov (United States)

    Mileto, Achille; Itani, Malak; Katz, Douglas S; Siebert, Joseph R; Dighe, Manjiri K; Dubinsky, Theodore J; Moshiri, Mariam

    2018-05-01

    Common fetal anomalies of the kidneys and urinary tract encompass a complex spectrum of abnormalities that can be detected prenatally by ultrasound. Common fetal anomalies of the kidneys and urinary tract can affect amniotic fluid volume production with the development of oligohydramnios or anhydramnios, resulting in fetal pulmonary hypoplasia and, potentially, abnormal development of other fetal structures. We provide an overview of common fetal anomalies of the kidneys and urinary tract with an emphasis on sonographic patterns as well as pathologic and postnatal correlation, along with brief recommendations for postnatal management. Of note, we render an updated classification of fetal abnormalities of the kidneys and urinary tract based on the presence or absence of associated urinary tract dilation. In addition, we review the 2014 classification of urinary tract dilation based on the Linthicum multidisciplinary consensus panel.

  15. Recommendations for fetal echocardiography in twin pregnancy in 2016

    Directory of Open Access Journals (Sweden)

    Leszczyńska Katarzyna

    2016-01-01

    Full Text Available Progress in the fields of fetal cardiology and fetal surgery have been seen not only in singleton pregnancies but also in multiple pregnancies. Proper interpretation of prenatal echocardiography is critical to clinical decision making, family counseling and perinatal management for obstetricians, maternal fetal medicine specialists, neonatologists and pediatric cardiologists. Fetal echocardiography is one of the most challenging and time-consuming prenatal examinations to perform, especially in multiple gestations. Performing just the basic fetal exam in twin gestations may take an hour or more. Thus, it is not practical to perform this exam in all cases of multiple gestations. Therefore our review and recommendations are related to fetal echocardiography in twin gestation.

  16. MRI of normal and pathological fetal lung development

    Energy Technology Data Exchange (ETDEWEB)

    Kasprian, Gregor [University Clinic of Radiodiagnostics, Medical University of Vienna (Austria)]. E-mail: gregor.kasprian@meduniwien.ac.at; Balassy, Csilla [University Clinic of Radiodiagnostics, Medical University of Vienna (Austria); Brugger, Peter C. [Center of Anatomy and Cell Biology, Medical University of Vienna (Austria); Prayer, Daniela [University Clinic of Radiodiagnostics, Medical University of Vienna (Austria)

    2006-02-15

    Normal fetal lung development is a complex process influenced by mechanical and many biochemical factors. In addition to ultrasound, fetal magnetic resonance imaging (MRI) constitutes a new method to investigate this process in vivo during the second and third trimester. The techniques of MRI volumetry, assessment of signal intensities, and MRI spectroscopy of the fetal lung have been used to analyze this process and have already been applied clinically to identify abnormal fetal lung growth. Particularly in conditions such as oligohydramnios and congenital diaphragmatic hernia (CDH), pulmonary hypoplasia may be the cause of neonatal death. A precise diagnosis and quantification of compromised fetal lung development may improve post- and perinatal management. The main events in fetal lung development are reviewed and MR volumetric data from 106 normal fetuses, as well as different examples of pathological lung growth, are provided.

  17. Investigation of fetal weight determination in x-ray pelvimetry

    International Nuclear Information System (INIS)

    Chung, M. C.; Tae, S.; Lee, H. K.; Kwon, K. H.; Chung, W. K.; Kim, K. J.

    1981-01-01

    The x-ray pelvimetry is widely used for investigation of fetal weight determination by measuring the size of the fetal head. The report concerns 173 cases with Colcher-Sussman method from January, 1, 1977 to December, 31, 1980 at Soonchunhyang College Hospital. We measured fetal head diameter in both A-P and lateral projections. The brief results are as follows: 1) Among the total 173 cases, vaginal delivery is 88 cases and Cesarean section is 85 cases. 2) The rate of Cesarean section is increased over 35 year of age and 4,000 gm of birth weight. 3) The rate of Cesarean section is increased in abnormal presentation. 4) The relationship between the fetal head diameter and the fetal weight is more significant in A-P puus lateral projection tha A-P only. 5) The average size of the fetal head is 0.8 cm larger in Cesarean section than in vaginal delivery

  18. Efeitos da ingestão de glicose sobre a circulação materno-fetal Materno-fetal hemodynamic repercussion of glucose ingestion

    Directory of Open Access Journals (Sweden)

    Rose Mary de Castro Ranciaro

    2006-12-01

    : in spite of the variation in the levels of maternal glycemia and in the fetal heart rate following glucose ingestion, no significant flow alteration occurred in the following vessels: umbilical artery, fetal medial cerebral artery and aorta; nor in the carotid and uterine maternal arteries. We conclude that the glucose concentration used was released without hemodynamic interference in the materno-fetal compartment.

  19. Fetal motion estimation from noninvasive cardiac signal recordings.

    Science.gov (United States)

    Biglari, Hadis; Sameni, Reza

    2016-11-01

    Fetal motility is a widely accepted indicator of the well-being of a fetus. In previous research, it has be shown that fetal motion (FM) is coherent with fetal heart rate accelerations and an indicator for active/rest cycles of the fetus. The most common approach for FM and fetal heart rate (FHR) assessment is by Doppler ultrasound (DUS). While DUS is the most common approach for studying the mechanical activities of the heart, noninvasive fetal electrocardiogram (ECG) and magnetocardiogram (MCG) recording and processing techniques have been considered as a possible competitor (or complement) for the DUS. In this study, a fully automatic and robust framework is proposed for the extraction, ranking and alignment of fetal QRS-complexes from noninvasive fetal ECG/MCG. Using notions from subspace tracking, two measures, namely the actogram and rotatogram, are defined for fetal motion tracking. The method is applied to four fetal ECG/MCG databases, including twin MCG recordings. By defining a novel measure of causality, it is shown that there is significant coherency and causal relationship between the actogram/rotatogram and FHR accelerations/decelerations. Using this measure, it is shown that in many cases, the actogram and rotatogram precede the FHR variations, which supports the idea of motion-induced FHR accelerations/decelerations for these cases and raises attention for the non-motion-induced FHR variations, which can be associated to the fetal central nervous system developments. The results of this study can lead to novel perspectives of the fetal sympathetic and parasympathetic brain systems and future requirements of fetal cardiac monitoring.

  20. Design of a light stimulator for fetal and neonatal magnetoencephalography

    International Nuclear Information System (INIS)

    Wilson, J D; Adams, A J; Murphy, P; Eswaran, H; Preissl, H

    2009-01-01

    The design, safety analysis and performance of a fetal visual stimulation system suitable for fetal and neonatal magnetoencephalography studies are presented. The issue of fetal, neonatal and maternal safety is considered and the maximum permissible exposure is computed for the maternal skin and the adult eye. The risk for neonatal eye exposure is examined. It is demonstrated that the fetus, neonate and mother are not at risk. (note)

  1. Fetal Alcohol Syndrome Disorder: diminished responsibility and mitigation of sentence.

    Science.gov (United States)

    Scott, Russ

    2018-02-01

    The objective of this study was to consider the implications of a recent Western Australia Court of Appeal decision in which an indigenous youth who had been sentenced for the manslaughter of his neonate child was later diagnosed with Fetal Alcohol Syndrome Disorder. The increased use of the 2016 Australian guide to the diagnosis of fetal alcohol spectrum disorder should be encouraged to enable clinicians to not only diagnose and manage Fetal Alcohol Syndrome Disorder, but also counsel families to prevent it.

  2. Distribution of melatonin receptor in human fetal brain

    Institute of Scientific and Technical Information of China (English)

    WANG Guo-quan; SHAO Fu-yuan; ZHAO Ying; LIU Zhi-min

    2001-01-01

    Objective: To study the distribution of 2 kinds of melatonin receptor subtypes (mtl and MT2) in human fetal brain. Methods: The fetal brain tissues were sliced and the distribution ofmelatonin receptors in human fetal brain were detected using immunohistochemistry and in situ hybridization. Results: Melatonin receptor mtl existed in the cerebellun and hypothalamus, melatonin receptor MT2 exists in hypothalamus, occipital and medulla. Conclusion: Two kinds of melatonin receptors, mtl and MT2 exist in the membrane and cytosol of brain cells, indicating that human fetal brain is a target organ of melatonin.

  3. The use of acoustic stimulation to inspect the fetal mouth

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Keun Young; Jun, Hyun Ah; Jang, Pong Rheem; Lee, Keung Hee [Hallym University College of Medicine, Seoul (Korea, Republic of); Nagey, David A. [The Johns Hopkins University, Baltimore (United States)

    2000-12-15

    The normal neonatal response to sound stimulus consists of a generalized paroxysmal startle reflex. We recently noted an increase in fetal movements, head turning, mouth opening, tongue protrusion, cheek motion, hand to head movement and fetal eye blinking subsequent to fetal vibroacoustic stimulation. These movements are thought to represent portions of a startle response. Evaluation of the fetal face is an essential part of routine sonographic examination and of a level II examination. The complexity of the face in combination with suboptimal positioning may make it difficult to obtain adequate images of the fetal mouth. The fetal mouth is especially difficult to examine if it remains closed. It appeared to us that approximately 50% of the time, fetuses may be seen touching their face and head with their hands. This action may make evaluation of the face more difficult because of the shadowing caused by the overlying bones of the hands. We hypothesized that if vibroacoustic stimulation brings about fetal mouth movement and opening and/or withdrawal of the fetal hand from the mouth, it may facilitate anatomic evaluation for cleft lip and palate. Sonographic examination of the fetal mouth is facilitated if the mouth is open or moving. This study was designed to determine whether acoustic stimulation of the fetus would cause it to move its mouth. 109 women with uncomplicated pregnancies between 20 and 39 weeks gestation consented.

  4. The use of acoustic stimulation to inspect the fetal mouth

    International Nuclear Information System (INIS)

    Lee, Keun Young; Jun, Hyun Ah; Jang, Pong Rheem; Lee, Keung Hee; Nagey, David A.

    2000-01-01

    The normal neonatal response to sound stimulus consists of a generalized paroxysmal startle reflex. We recently noted an increase in fetal movements, head turning, mouth opening, tongue protrusion, cheek motion, hand to head movement and fetal eye blinking subsequent to fetal vibroacoustic stimulation. These movements are thought to represent portions of a startle response. Evaluation of the fetal face is an essential part of routine sonographic examination and of a level II examination. The complexity of the face in combination with suboptimal positioning may make it difficult to obtain adequate images of the fetal mouth. The fetal mouth is especially difficult to examine if it remains closed. It appeared to us that approximately 50% of the time, fetuses may be seen touching their face and head with their hands. This action may make evaluation of the face more difficult because of the shadowing caused by the overlying bones of the hands. We hypothesized that if vibroacoustic stimulation brings about fetal mouth movement and opening and/or withdrawal of the fetal hand from the mouth, it may facilitate anatomic evaluation for cleft lip and palate. Sonographic examination of the fetal mouth is facilitated if the mouth is open or moving. This study was designed to determine whether acoustic stimulation of the fetus would cause it to move its mouth. 109 women with uncomplicated pregnancies between 20 and 39 weeks gestation consented.

  5. Fetal MRI: A Technical Update with Educational Aspirations.

    Science.gov (United States)

    Gholipour, Ali; Estroff, Judith A; Barnewolt, Carol E; Robertson, Richard L; Grant, P Ellen; Gagoski, Borjan; Warfield, Simon K; Afacan, Onur; Connolly, Susan A; Neil, Jeffrey J; Wolfberg, Adam; Mulkern, Robert V

    2014-11-01

    Fetal magnetic resonance imaging (MRI) examinations have become well-established procedures at many institutions and can serve as useful adjuncts to ultrasound (US) exams when diagnostic doubts remain after US. Due to fetal motion, however, fetal MRI exams are challenging and require the MR scanner to be used in a somewhat different mode than that employed for more routine clinical studies. Herein we review the techniques most commonly used, and those that are available, for fetal MRI with an emphasis on the physics of the techniques and how to deploy them to improve success rates for fetal MRI exams. By far the most common technique employed is single-shot T2-weighted imaging due to its excellent tissue contrast and relative immunity to fetal motion. Despite the significant challenges involved, however, many of the other techniques commonly employed in conventional neuro- and body MRI such as T1 and T2*-weighted imaging, diffusion and perfusion weighted imaging, as well as spectroscopic methods remain of interest for fetal MR applications. An effort to understand the strengths and limitations of these basic methods within the context of fetal MRI is made in order to optimize their use and facilitate implementation of technical improvements for the further development of fetal MR imaging, both in acquisition and post-processing strategies.

  6. Magnetic resonance imaging (MRI) in obstetrics. II. Fetal anatomy.

    Science.gov (United States)

    Powell, M C; Worthington, B S; Buckley, J M; Symonds, E M

    1988-01-01

    Magnetic resonance imaging (MRI) was performed in 36 patients at between 10 and 38 weeks gestation to determine the fetal anatomy that could be identified at different gestations. Fetal motion significantly degraded the image quality in the first and second trimesters, but in the final trimester fetal anatomy was clearly demonstrated. T2 weighted sequences showed the fetal brain and lungs to have a high signal intensity. Shorter TR leading to a T1 weighting gave better resolution of the overall anatomy. MRI has revealed the potential for assessment of lung maturity and the growth-retarded fetus.

  7. Complete maternal and fetal recovery after prolonged cardiac arrest.

    Science.gov (United States)

    Selden, B S; Burke, T J

    1988-04-01

    A case of complete maternal and fetal recovery after prolonged cardiac arrest from massive lidocaine overdose is presented. A 27-year-old woman at 15 weeks gestation had a complete neurologic recovery after 22 minutes of CPR, including 19 minutes of electromechanical dissociation and asystole, with normal fetal heart function and fetal motion confirmed by ultrasound immediately after resuscitation. The patient delivered a healthy and neurologically normal infant at 40 weeks gestation. This is the longest cardiac arrest in early pregnancy reported in the medical literature with normal maternal and fetal outcome.

  8. Fetal magnetic resonance imaging of thoracic and abdominal malformations

    International Nuclear Information System (INIS)

    Woitek, R.; Asenbaum, U.; Furtner, J.; Prayer, D.; Brugger, P.C.

    2013-01-01

    Diagnosis and differential diagnosis of fetal thoracic and abdominal malformations. Ultrasound and magnetic resonance imaging (MRI). In cases of suspected pathologies based on fetal ultrasound MRI can be used for more detailed examinations and can be of assistance in the differential diagnostic process. Improved imaging of anatomical structures and of the composition of different tissues by the use of different MRI sequences. Fetal MRI has become a part of clinical routine in thoracic and abdominal malformations and is the basis for scientific research in this field. In cases of thoracic or abdominal malformations fetal MRI provides important information additional to ultrasound to improve diagnostic accuracy, prognostic evaluation and surgical planning. (orig.) [de

  9. Fetal Cholelithiasis: A Diagnostic Update and a Literature Review

    Directory of Open Access Journals (Sweden)

    Stefania Triunfo

    2013-01-01

    Full Text Available Fetal gallstones and cholelithiasis, detected by routine third trimester ultrasound, have been described in the literature with controversial clinical significance. We report a case of fetal cholelithiasis detected at 35 weeks gestation during a routine scan. The diagnosis was performed using an integrated 2-dimensional (2-D and 3-dimensional (3-D ultrasound approach in order to obtain a better definition of the fetal gallbladder and its content. A neonatal follow-up was achieved. The present study has a twofold purpose: firstly, to update the diagnostic approach using the innovative 3-D modalities and secondly, to review the management of this condition during fetal and postnatal life.

  10. Methods of fetal MR: beyond T2-weighted imaging

    Energy Technology Data Exchange (ETDEWEB)

    Brugger, Peter C. [Center of Anatomy and Cell Biology, Integrative Morphology Group, Medical University of Vienna, Waehringerstrasse 13, 1090 Vienna (Austria)]. E-mail: peter.brugger@meduniwien.ac.at; Stuhr, Fritz [Department of Radiology, Medical University of Vienna, Waehringerguertel 18-20, 1090 Vienna (Austria); Lindner, Christian [Department of Radiology, Medical University of Vienna, Waehringerguertel 18-20, 1090 Vienna (Austria); Prayer, Daniela [Department of Radiology, Medical University of Vienna, Waehringerguertel 18-20, 1090 Vienna (Austria)

    2006-02-15

    The present work reviews the basic methods of performing fetal magnetic resonance imaging (MRI). Since fetal MRI differs in many respects from a postnatal study, several factors have to be taken into account to achieve satisfying image quality. Image quality depends on adequate positioning of the pregnant woman in the magnet, use of appropriate coils and the selection of sequences. Ultrafast T2-weighted sequences are regarded as the mainstay of fetal MR-imaging. However, additional sequences, such as T1-weighted images, diffusion-weighted images, echoplanar imaging may provide further information, especially in extra- central-nervous system regions of the fetal body.

  11. Methods of fetal MR: beyond T2-weighted imaging

    International Nuclear Information System (INIS)

    Brugger, Peter C.; Stuhr, Fritz; Lindner, Christian; Prayer, Daniela

    2006-01-01

    The present work reviews the basic methods of performing fetal magnetic resonance imaging (MRI). Since fetal MRI differs in many respects from a postnatal study, several factors have to be taken into account to achieve satisfying image quality. Image quality depends on adequate positioning of the pregnant woman in the magnet, use of appropriate coils and the selection of sequences. Ultrafast T2-weighted sequences are regarded as the mainstay of fetal MR-imaging. However, additional sequences, such as T1-weighted images, diffusion-weighted images, echoplanar imaging may provide further information, especially in extra- central-nervous system regions of the fetal body

  12. Does maternal-fetal transfer of creatine occur in pregnant sheep?

    Science.gov (United States)

    Baharom, Syed; De Matteo, Robert; Ellery, Stacey; Della Gatta, Paul; Bruce, Clinton R; Kowalski, Greg M; Hale, Nadia; Dickinson, Hayley; Harding, Richard; Walker, David; Snow, Rodney J

    2017-07-01

    Our aim was to determine the disposition of creatine in ovine pregnancy and whether creatine is transferred across the placenta from mother to fetus. Pregnant ewes received either 1 ) a continuous intravenous infusion of creatine monohydrate or saline from 122 to 131 days gestation, with maternal and fetal arterial blood and amniotic fluid samples collected daily for creatine analysis and fetal tissues collected at necropsy at 133 days for analysis of creatine content, or 2 ) a single systemic bolus injection of [ 13 C]creatine monohydrate at 130 days of gestation, with maternal and fetal arterial blood, uterine vein blood, and amniotic fluid samples collected before and for 4 h after injection and analyzed for creatine, creatine isotopic enrichment, and guanidinoacetic acid (GAA; precursor of creatine) concentrations. Presence of the creatine transporter-1 (SLC6A8) and l-arginine:glycine amidinotransferase (AGAT; the enzyme synthesizing GAA) proteins were determined by Western blots of placental cotyledons. The 10-day creatine infusion increased maternal plasma creatine concentration three- to fourfold ( P creatine content. Maternal arterial 13 C enrichment was increased ( P creatine injection without change of fetal arterial 13 C enrichment. SLC6A8 and AGAT proteins were identified in placental cotyledons, and GAA concentration was significantly higher in uterine vein than maternal artery plasma. Despite the presence of SLC6A8 protein in cotyledons, these results suggest that creatine is not transferred from mother to fetus in near-term sheep and that the ovine utero-placental unit releases GAA into the maternal circulation. Copyright © 2017 the American Physiological Society.

  13. Small-volume amnioinfusion: a potential stimulus of intrapartum fetal heart rate accelerations.

    Science.gov (United States)

    Wax, Joseph R; Flaherty, Nina; Pinette, Michael G; Blackstone, Jacquelyn; Cartin, Angelina

    2004-02-01

    We describe a recurrent nonreassuring fetal heart rate pattern in which small-volume amnioinfusions apparently evoked fetal heart rate accelerations suggested fetal well-being, allowing that progressive labor that culminated in the vaginal delivery of a healthy infant.

  14. Fetal response to maternal hunger and satiation - novel finding from a qualitative descriptive study of maternal perception of fetal movements.

    Science.gov (United States)

    Bradford, Billie; Maude, Robyn

    2014-08-26

    Maternal perception of decreased fetal movements is a specific indicator of fetal compromise, notably in the context of poor fetal growth. There is currently no agreed numerical definition of decreased fetal movements, with the subjective perception of a decrease on the part of the mother being the most significant definition clinically. Both qualitative and quantitative aspects of fetal activity may be important in identifying the compromised fetus.Yet, how pregnant women perceive and describe fetal activity is under-investigated by qualitative means. The aim of this study was to explore normal fetal activity, through first-hand descriptive accounts by pregnant women. Using qualitative descriptive methodology, interviews were conducted with 19 low-risk women experiencing their first pregnancy, at two timepoints in their third trimester. Interview transcripts were later analysed using qualitative content analysis and patterns of fetal activity identified were then considered along-side the characteristics of the women and their birth outcomes. This paper focuses on a novel finding; the description by pregnant women of fetal behaviour indicative of hunger and satiation. Full findings will be presented in later papers. Most participants (74% 14 of 19) indicated mealtimes were a time of increased fetal activity. Eight participants provided detailed descriptions of increased activity around meals, with seven (37% 7 of 19) of these specifying increased fetal activity prior to meals or in the context of their own hunger. These movements were interpreted as a fetal demand for food often prompting the mother to eat. Interestingly, the women who described increased fetal activity in the context of hunger subsequently gave birth to smaller infants (mean difference 364 gm) than those who did not describe a fetal response to hunger. Food seeking behaviour may have a pre-birth origin. Maternal-fetal interaction around mealtimes could constitute an endocrine mediated

  15. Toxics Release Inventory (TRI)

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Toxics Release Inventory (TRI) is a dataset compiled by the U.S. Environmental Protection Agency (EPA). It contains information on the release and waste...

  16. Malnutrition during fetal life, fetal programming and implications for farm aninals productivity

    DEFF Research Database (Denmark)

    Nielsen, Mette Olaf; Khanal, Prabhat; Johnsen, Lærke

    Some 20 years ago, observations from human epidemiological research revolutionized the scientific view of the importance of fetal life development for body functions in postnatal life. Until then, it was believed that the genome received from the parents at conception in mammals would define the ...

  17. Fetal brain disruption sequence versus fetal brain arrest: A distinct autosomal recessive developmental brain malformation phenotype.

    Science.gov (United States)

    Abdel-Salam, Ghada M H; Abdel-Hamid, Mohamed S; El-Khayat, Hamed A; Eid, Ola M; Saba, Soliman; Farag, Mona K; Saleem, Sahar N; Gaber, Khaled R

    2015-05-01

    The term fetal brain disruption sequence (FBDS) was coined to describe a number of sporadic conditions caused by numerous external disruptive events presenting with variable imaging findings. However, rare familial occurrences have been reported. We describe five patients (two sib pairs and one sporadic) with congenital severe microcephaly, seizures, and profound intellectual disability. Brain magnetic resonance imaging (MRI) revealed unique and uniform picture of underdeveloped cerebral hemispheres with increased extraxial CSF, abnormal gyral pattern (polymicrogyria-like lesions in two sibs and lissencephaly in the others), loss of white matter, dysplastic ventricles, hypogenesis of corpus callosum, and hypoplasia of the brainstem, but hypoplastic cerebellum in one. Fetal magnetic resonance imaging (FMRI) of two patients showed the same developmental brain malformations in utero. These imaging findings are in accordance with arrested brain development rather than disruption. Molecular analysis excluded mutations in potentially related genes such as NDE1, MKL2, OCLN, and JAM3. These unique clinical and imaging findings were described before among familial reports with FBDS. However, our patients represent a recognizable phenotype of developmental brain malformations, that is, apparently distinguishable from either familial microhydranencephaly or microlissencephaly that were collectively termed FBDS. Thus, the use of the umbrella term FBDS is no longer helpful. Accordingly, we propose the term fetal brain arrest to distinguish them from other familial patients diagnosed as FBDS. The presence of five affected patients from three unrelated consanguineous families suggests an autosomal-recessive mode of inheritance. The spectrum of fetal brain disruption sequence is reviewed. © 2015 Wiley Periodicals, Inc.

  18. Consistent reconstruction of 4D fetal heart ultrasound images to cope with fetal motion.

    Science.gov (United States)

    Tanner, Christine; Flach, Barbara; Eggenberger, Céline; Mattausch, Oliver; Bajka, Michael; Goksel, Orcun

    2017-08-01

    4D ultrasound imaging of the fetal heart relies on reconstructions from B-mode images. In the presence of fetal motion, current approaches suffer from artifacts, which are unrecoverable for single sweeps. We propose to use many sweeps and exploit the resulting redundancy to automatically recover from motion by reconstructing a 4D image which is consistent in phase, space, and time. An interactive visualization framework to view animated ultrasound slices from 4D reconstructions on arbitrary planes was developed using a magnetically tracked mock probe. We first quantified the performance of 10 4D reconstruction formulations on simulated data. Reconstructions of 14 in vivo sequences by a baseline, the current state-of-the-art, and the proposed approach were then visually ranked with respect to temporal quality on orthogonal views. Rankings from 5 observers showed that the proposed 4D reconstruction approach significantly improves temporal image quality in comparison with the baseline. The 4D reconstructions of the baseline and the proposed methods were then inspected interactively for accessibility to clinically important views and rated for their clinical usefulness by an ultrasound specialist in obstetrics and gynecology. The reconstructions by the proposed method were rated as 'very useful' in 71% and were statistically significantly more useful than the baseline reconstructions. Multi-sweep fetal heart ultrasound acquisitions in combination with consistent 4D image reconstruction improves quality as well as clinical usefulness of the resulting 4D images in the presence of fetal motion.

  19. Predicting intrapartum fetal compromise using the fetal cerebro-umbilical ratio.

    Science.gov (United States)

    Sabdia, S; Greer, R M; Prior, T; Kumar, S

    2015-05-01

    The aim of this study was to explore the association between the cerebro-umbilical ratio measured at 35-37 weeks and intrapartum fetal compromise. This retrospective cross sectional study was conducted at the Mater Mothers' Hospital in Brisbane, Australia. Maternal demographics and fetal Doppler indices at 35-37 weeks gestation for 1381 women were correlated with intrapartum and neonatal outcomes. Babies born by caesarean section or instrumental delivery for fetal compromise had the lowest median cerebro-umbilical ratio 1.60 (IQR 1.22-2.08) compared to all other delivery groups (vaginal delivery, emergency delivery for failure to progress, emergency caesarean section for other reasons or elective caesarean section). The percentage of infants with a cerebro-umbilical ratio cerebro-umbilical ratio between the 10th-90th centile and 9.6% of infants with a cerebro-umbilical ratio > 90th centile required delivery for the same indication (p cerebro-umbilical ratio was associated with an increased risk of emergency delivery for fetal compromise, OR 2.03 (95% CI 1.41-2.92), p cerebro-umbilical ratio measured at 35-37 weeks is associated with a greater risk of intrapartum compromise. This is a relatively simple technique which could be used to risk stratify women in diverse healthcare settings. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. A study on maternal-fetal attachment in pregnant women undergoing fetal echocardiography

    Directory of Open Access Journals (Sweden)

    Concetta Polizzi

    2017-03-01

    Full Text Available Purpose: To investigate the possible effects of the fetal echocardiography experience on the prenatal attachment process. The predictive effect of specific women’s psychological variables will be explored as well.Design and methods: This between groups study involved 85 women with pregnancy at risk who underwent the fetal echocardiography, and 83 women who were about to undergo the morphological scan. The tools employed were: the Prenatal Attachment Inventory (P.A.I. to explore the maternal-fetal attachment; the Maternity Social Support Scale to investigate the woman perception of being socially supported during pregnancy; both the Big Five Questionnaire and the FACES III to explore the personality traits of pregnant women and their perception of their couple relationship functioning.Findings: The outcomes of ANOVA do not show statistically significant differences between the two groups of the mothers-to-be with regard to the scores of the P.A.I. (F = .017; p = .897; η2 = .000, while the regression analysis of the possible effect of the maternal psychological variables on the mother-fetus relationship shows a statistically significant result only with regard to the “social support” variable (r2 = .061; df = 80; p = .025.Conclusions: It would seem that the process of the prenatal attachment develops independently whether the woman has to undergo a first level screening or a second level examination such as the fetal echocardiography.

  1. ST analysis of the fetal ECG : towards evidence based fetal surveillance

    NARCIS (Netherlands)

    Becker, J.H.

    2012-01-01

    It was the aim of this thesis to perform a meta-analysis of published trial on FECG monitoring during labor, to assess its effects on fetal outcome, on the use of FBS, and on instrumental and operative interventions. Furthermore we conducted secondary studies of published data sets to address thus

  2. [Maternal-placental interactions and fetal programming].

    Science.gov (United States)

    Kadyrov, M; Moser, G; Rath, W; Kweider, N; Wruck, C J; Pufe, T; Huppertz, B

    2013-06-01

    Pregnancy-related complications not only represent a risk for maternal and fetal morbidity and mortality, but are also a risk for several diseases later in life. Many epidemiological studies have shown clear associations between an adverse intrauterine environment and an increased risk of diabetes, hypertension, cardiovascular disease, depression, obesity, and other chronic diseases in the adult. Some of these syndromes could be prevented by avoiding adverse stimuli or insults including psychological stress during pregnancy, intake of drugs, insufficient diet and substandard working conditions. Hence, all of these stimuli have the potential to alter health later in life. The placenta plays a key role in regulating the nutrient supply to the fetus and producing hormones that control the fetal as well as the maternal metabolism. Thus, any factor or stimulus that alters the function of the hormone producing placental trophoblast will provoke critical alterations of placental function and hence could induce programming of the fetus. The factors that change placental development may interfere with nutrient and oxygen supply to the fetus. This may be achieved by a direct disturbance of the placental barrier or more indirectly by, e. g., disturbing trophoblast invasion. For both path-ways, the respective pathologies are known: while preeclampsia is caused by alterations of the villous trophoblast, intra-uterine growth restriction is caused by insufficient invasion of the extravillous trophoblast. In both cases the effect can be undernutrition and/or fetal hypoxia, both of which adversely affect organ development, especially of brain and heart. However, the mechanisms responsible for disturbances of trophoblast differentiation and function remain elusive. © Georg Thieme Verlag KG Stuttgart · New York.

  3. The roles of the cyclo-oxygenases types one and two in prostaglandin synthesis in human fetal membranes at term.

    Science.gov (United States)

    Sawdy, R J; Slater, D M; Dennes, W J; Sullivan, M H; Bennett, P R

    2000-01-01

    The aim of this study was to determine the relative contributions of cyclo-oxygenase (COX) types 1 and 2 to prostaglandin synthesis at term. Fetal membranes were collected from 6 pregnancies after elective caesarean section at term, prior to labour. The presence of COX-1 and COX-2 protein was determined using Western analysis. The relative contributions of the two isoforms of COX to prostaglandin synthesis were determined by incubation of fetal membrane discs with either a COX-2 selective inhibitor, SC236, or a COX-1 selective inhibitor, SC560, and measurement of prostaglandin release during 24 h using enzyme-linked immuno-sorbent assay (ELISA). Both COX-1 and COX-2 protein were demonstrated in amnion and chorion-decidua. The COX-2 selective inhibitor, SC-236, significantly reduced prostaglandin synthesis, both in its COX-2 specific and higher, non-specific concentration ranges. The COX-1 selective inhibitor, SC-560, had no effect upon prostaglandin synthesis in its COX-1 specific concentration range, but did significantly reduce prostaglandin synthesis at higher, non-selective concentrations. Fetal membranes contain both COX-1 and COX-2 at term, but only COX-2 contributes towards prostaglandin synthesis. COX-2 selective NSAI drugs will be as effective as non-selective agents in inhibition of fetal membrane prostaglandin synthesis and may represent a new strategy for tocolysis. Copyright 2000 Harcourt Publishers Ltd.

  4. Factors Affecting Estimated Fetal Weight Measured by Ultrasound

    Directory of Open Access Journals (Sweden)

    Hasan Energin

    2016-06-01

    Full Text Available Objective: In this study, we aimed to evaluate the fac­tors that affect the accuracy of estimated fetal weight in ultrasound. Methods: This study was conducted in 3rd degree hospi­tal antenatal outpatient clinic and perinatology inpatient clinic between June 2011 and January 2012. The data were obtained from 165 pregnant women. Inclusion cri­teria were; no additional diseases, giving birth within 48 hours after ultrasound. The same physician executed all ultrasound process. Age, height, weight, obstetric history and obstetric follow –up findings were recorded. Results: Fetal gender, fetal presentation, presence of meconium in amniotic fluid, maternal parity, did not sig­nificantly affect the accuracy of fetal weight estimation by ultrasound. The mean difference between estimated fetal weight and birth weight was 104.48±84 gr in nullipars and 94.2±81 gr in multipars (p=0.44; mean difference was 98.22±79 gr in male babies and 98.15±86 gr in female babies (p=0.99. Mean difference between estimated fetal weight and birth weight was 96.92±81 gr in babies with cephalic presentation and 110.9±90 gr in babies with breech presentation (p=0.53; this difference was 95.36±79 gr in babies with amniotic fluid with meconium and 98.82± 83 gr in babies with amniotic fluid without me­conium (p=0.83. Conclusion: Fetal weight is estimation is one of key points in the obstetrician’s intrapartum managament. And it is important to make fetal weight estimation accurately. In our study, consistent with literature, we observed that fetal gender; meconium presence in amniotic fluid, fetal presentation, maternal parity does not significantly effect the accuracy of fetal weight estimation by ultrasound.

  5. The relationship between fetal biophysical profile and cord blood PH

    Directory of Open Access Journals (Sweden)

    Valadan M

    2009-02-01

    Full Text Available "nBackground: The Biophysical Profile (BPP is a noninvasive test that predicts the presence or absence of fetal asphyxia and, ultimately, the risk of fetal death in the antenatal period. Intervention on the basis of an abnormal biophysical profile result has been reported to yield a significant reduction in prenatal mortality, and an association exists between biophysical profile scoring and a decreased cerebral palsy rate in a given population. The BPP evaluates five characteristics: fetal movement, tone, breathing, heart reactivity, and amniotic fluid (AF volume estimation. The purpose of study was to determine whether there are different degree of acidosis at which the biophysical activity (acute marker are affected. "nMethods: In a prospective study of 140 patients undergoing cesarean section before onset of labor, the fetal biophysical profile was performed 24h before the time of cesarean and was matched with cord arterial PH that was obtained from a cord segment (10-20cm that was double clamped after delivery of newborn. (using cord arterial PH less than 7.20 for the diagnosis of acidosis. "nResults: The fetal biophysical profile was found to have a significant relationship with umbilical blood PH. The sensitivity, specificity, positive predictive value, negative predictive value of fetal biophysical profile score were: 88.9%, 88.6%, 50%, 98.1%. "nConclusion: The first manifestations of fetal acidosis are nonreactive nonstress testing and fetal breathing loss; in advanced acidemia fetal movements and fetal tone are compromised. A protocol of antepartum fetal evaluation is suggested based upon the individual biophysical components rather than the score alone.

  6. Studies in Fetal Behavior: Revisited, Renewed, and Reimagined

    Science.gov (United States)

    DiPietro, Janet A.; Costigan, Kathleen A.; Voegtline, Kristin M.

    2016-01-01

    Among the earliest volumes of this Monograph series was a report by Lester Sontag and colleagues, of the esteemed Fels Institute, on the heart rate of the human fetus as an expression of the developing nervous system. Here, some 75 years later, we commemorate this work and provide historical and contemporary context on knowledge regarding fetal development, as well as results from our own research. These are based on synchronized monitoring of maternal and fetal parameters assessed between 24 and 36 weeks gestation on 740 maternal-fetal pairs compiled from eight separate longitudinal studies, which commenced in the early 1990s. Data include maternal heart rate, respiratory sinus arrhythmia, and electrodermal activity and fetal heart rate, motor activity, and their integration. Hierarchical linear modeling of developmental trajectories reveals that the fetus develops in predictable ways consistent with advancing parasympathetic regulation. Findings also include: within-fetus stability (i.e., preservation of rank ordering over time) for heart rate, motor, and coupling measures; a transitional period of decelerating development near 30 weeks gestation; sex differences in fetal heart rate measures but not in most fetal motor activity measures; modest correspondence in fetal neurodevelopment among siblings as compared to unrelated fetuses; and deviations from normative fetal development in fetuses affected by intrauterine growth restriction and other conditions. Maternal parameters also change during this period of gestation and there is evidence that fetal sex and individual variation in fetal neurobehavior influence maternal physiological processes and the local intrauterine context. Results are discussed within the framework of neuromaturation, the emergence of individual differences, and the bidirectional nature of the maternal-fetal relationship. We pose a number of open questions for future research. Although the human fetus remains just out of reach, new

  7. Fetal MRI: An approach to practice: A review

    Directory of Open Access Journals (Sweden)

    Sahar N. Saleem

    2014-09-01

    Full Text Available MRI has been increasingly used for detailed visualization of the fetus in utero as well as pregnancy structures. Yet, the familiarity of radiologists and clinicians with fetal MRI is still limited. This article provides a practical approach to fetal MR imaging. Fetal MRI is an interactive scanning of the moving fetus owed to the use of fast sequences. Single-shot fast spin-echo (SSFSE T2-weighted imaging is a standard sequence. T1-weighted sequences are primarily used to demonstrate fat, calcification and hemorrhage. Balanced steady-state free-precession (SSFP, are beneficial in demonstrating fetal structures as the heart and vessels. Diffusion weighted imaging (DWI, MR spectroscopy (MRS, and diffusion tensor imaging (DTI have potential applications in fetal imaging. Knowing the developing fetal MR anatomy is essential to detect abnormalities. MR evaluation of the developing fetal brain should include recognition of the multilayered-appearance of the cerebral parenchyma, knowledge of the timing of sulci appearance, myelination and changes in ventricular size. With advanced gestation, fetal organs as lungs and kidneys show significant changes in volume and T2-signal. Through a systematic approach, the normal anatomy of the developing fetus is shown to contrast with a wide spectrum of fetal disorders. The abnormalities displayed are graded in severity from simple common lesions to more complex rare cases. Complete fetal MRI is fulfilled by careful evaluation of the placenta, umbilical cord and amniotic cavity. Accurate interpretation of fetal MRI can provide valuable information that helps prenatal counseling, facilitate management decisions, guide therapy, and support research studies.

  8. Lightning Strike in Pregnancy With Fetal Injury.

    Science.gov (United States)

    Galster, Kellen; Hodnick, Ryan; Berkeley, Ross P

    2016-06-01

    Injuries from lightning strikes are an infrequent occurrence, and are only rarely noted to involve pregnant victims. Only 13 cases of lightning strike in pregnancy have been previously described in the medical literature, along with 7 additional cases discovered within news media reports. This case report presents a novel case of lightning-associated injury in a patient in the third trimester of pregnancy, resulting in fetal ischemic brain injury and long-term morbidity, and reviews the mechanics of lightning strikes along with common injury patterns of which emergency providers should be aware. Copyright © 2016 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.

  9. Fetal dosimetry from natural alpha emitters

    Energy Technology Data Exchange (ETDEWEB)

    Purnell, S.J

    1999-09-01

    The size of marrow cavities in fetal vertebra, rib and sternum was investigated using an image analysis system. The average chord lengths through marrow spaces in the vertebrae were found to increase approximately linearly with gestational age from 140 {mu}m at 20 weeks to 300 {mu}m at 40 weeks. Average chord lengths through marrow spaces in fetal rib and sternum were 330 {mu}m at 35 weeks in both cases. These results can be compared with an average chord length across marrow spaces in adult vertebra of 1172 {mu}m. At natural background UK exposure, activity concentrations of supported {sup 210}Po in fetal bone of 0.075 Bq kg{sup -1} and 0.15 Bq kg{sup -1} at mid- and late gestation respectively were calculated. Monte Carlo simulations modelling the paths of alpha-particles in fetal vertebra gave a total alpha-radiation dose to marrow over the second and third trimesters of 32.0 {+-} 0.8 {mu}Sv with the {sup 210}Po in bone contributing 8.9 {+-} 0.9 {mu}Sv. The dose to primitive haemopoietic stem cells, the target cells for acute lymphoblastic leukaemia, and the survival of these stem cells following a hit by an alpha-particle was investigated, also using Monte Carlo simulations. Alpha-particles emitted from bone and marrow contributed an average dose of 1.9 Gy to stem cells with a nuclear diameter of 3.8 {mu}m. This study has estimated that 1% of babies born each year are born with a mutated primitive haemopoietic stem cell due to in utero irradiation from high LET radiation. That is 7,320 babies compared to an estimated 300 incidences of cALL each year initiated in utero. The probability that a mutated cell will go on to give rise to leukaemia is unknown but it would seem not unlikely that irradiation in utero plays a substantial part in the induction of childhood leukaemia. (author)

  10. Indications for fetal magnetic resonance imaging (MRI)

    International Nuclear Information System (INIS)

    Prayer, D.

    2006-01-01

    Indications to perform fetal magnetic resonance imaging (MRI) are composed of common ones related to methodological problems of ultrasound (US) assessment (such as for instance hydramnios) and special ones. The latter are related to MR capability of high-resolution soft tissue contrast and an extended field of view that allows visualization of the whole fetus, even in later stages of pregnancy. The most important indications include confirmation of US findings, work-up of malformations with respect to individual prognosis and genetic background, differentiation between acquired conditions and malformations, visualization of pathologies that have to be treated surgically immediately after birth, and morphological changes of the placenta. (orig.) [de

  11. Circle of Willis Variants: Fetal PCA

    OpenAIRE

    Amir Shaban; Karen C. Albright; Amelia K. Boehme; Sheryl Martin-Schild

    2013-01-01

    We sought to determine the prevalence of fetal posterior cerebral artery (fPCA) and if fPCA was associated with specific stroke etiology and vessel territory affected. This paper is a retrospective review of prospectively identified patients with acute ischemic stroke from July 2008 to December 2010. We defined complete fPCA as absence of a P1 segment linking the basilar with the PCA and partial fPCA as small segment linking the basilar with the PCA. Patients without intracranial vascular ima...

  12. Fetal polycystic kidney disease: Pathological overview

    Directory of Open Access Journals (Sweden)

    Sunita B Patil

    2013-01-01

    Full Text Available Polycystic kidney disease is a rare developmental anomaly inherited as autosomal dominant or autosomal recessive. It is characterized by cystic dilatation of the collecting ducts frequently associated with hepatic involvement and progression to renal failure. It is included in the differential diagnosis of cystic diseases of the kidney. We report a case of polycystic kidney disease, in 22 weeks fetus incidentally detected on routine antenatal ultrasonography and confirmed by fetal autopsy. This report elucidates the importance of early diagnosis and intervention in cystic kidney diseases.

  13. Gestational Age Estimation Based on Fetal Pelvimetry on Fetal Ultrasound in Iraqi Women

    Directory of Open Access Journals (Sweden)

    Sattar Razzaq Al-Esawi

    2016-08-01

    Full Text Available Ultrasound is an integral part of obstetric practice, and assessment of gestational age (GA is a central element of obstetric ultrasonography. Sonographic estimation of GA is derived from calculations based on fetal measurements. Numerous equations for GA calculation from fetal biometry have been adopted in routine practice. This study reports a new method of estimating GA in the second and third trimester using interischial distance (IID, the distance between the two ischial primary ossification centers, on fetal ultrasound. Four hundred women with uncomplicated normal singleton pregnancies from 16 weeks to term were examined. Standard fetal obstetric ultrasound was done measuring biparietal diameter (BPD and femur length (FL for each fetus. The IID, in millimeters, was correlated with the GA in weeks based upon the BPD and FL individually, and the BPD and FL together. Statistical analysis showed strong correlation between the IID and GA calculated from the FL with correlation coefficient (r =0.989, P < 0.001. Strong linear correlation was also found between the IID and GA based upon BPD and BPD+FL. Further statistical analysis using regression equations also showed that the IID was slightly wider in female fetuses, but this difference was not statistically significant. Resulting from this analysis, we have arrived at an easy-to-use equation: GA Weeks = (IID mm + 8 ±1 week. We feel this method can be especially applicable in the developing world, where midwives may not have access to software for fetal biometry in their basic handheld ultrasound machines. Even more sophisticated machines may not come with loaded software for obstetrics analysis. There are several limitations to this study, discussed below. We recommend further studies correlating the IID with other biometric parameters.

  14. Fetal autonomic cardiac response during pregnancy and labour

    NARCIS (Netherlands)

    Laar, van J.O.E.H.

    2012-01-01

    Timely recognition of fetal distress, during pregnancy and labour, in order to intervene adequately is of major importance to avoid neonatal morbidity and mortality. As discussed in chapter 1, the cardiotocogram (CTG) might be a useful screening test for fetal monitoring but it has insufficient

  15. Fetal endoscopic myelomeningocele closure preserves segmental neurological function

    NARCIS (Netherlands)

    Verbeek, Renate J.; Heep, Axel; Maurits, Natalia M.; Cremer, Reinhold; Hoving, Eelco W.; Brouwer, Oebele F.; Van der Hoeven, Johannes H.; Sival, Deborah A.

    AIM:   Our aim was to compare the effect of prenatal endoscopic with postnatal myelomeningocele closure (fetally operated spina bifida aperta [fSBA]) versus neonatally operated spina bifida aperta [nSBA]) on segmental neurological leg condition. METHOD:   Between 2003 and 2009, the fetal surgical

  16. True Umbilical Cord Knot Leading to Fetal Demise

    African Journals Online (AJOL)

    weight was 140 kg, height 1.69 m, blood pressure 120 mmHg. The booking ... The fetal heart tones were monitored using Doppler sonicaid. They remained normal throughout .... true knot, seemingly because the umbilical cord vessels can be compressed ... Therefore, the Wharton's jelly surrounding the fetal vessels has the ...

  17. Fetal Abuse and the Criminalization of Behavior during Pregnancy.

    Science.gov (United States)

    Farr, Kathryn Ann

    1995-01-01

    Discusses efforts to criminalize fetal abuse, harm caused from a pregnant woman's use of illegal drugs. Such efforts have typically failed to withstand judicial scrutiny. Suggests that criminal prosecution for fetal abuse relies on questionable procedures, is unevenly applied, and may keep women from seeking drug treatment or prenatal care. (LKS)

  18. Fetal contamination with cadmium following chronic exposure of rat ...

    African Journals Online (AJOL)

    Fetal contamination with cadmium following chronic exposure of rat dams during gestation. ... African Journal of Applied Zoology and Environmental Biology ... It was concluded that cadmium, contrary to previous reports, can pass through the placenta in appreciable quantity to contaminate the fetus to possibly cause fetal ...

  19. Performance of a wearable acoustic system for fetal movement discrimination.

    Directory of Open Access Journals (Sweden)

    Jonathan Lai

    Full Text Available Fetal movements (FM are a key factor in clinical management of high-risk pregnancies such as fetal growth restriction. While maternal perception of reduced FM can trigger self-referral to obstetric services, maternal sensation is highly subjective. Objective, reliable monitoring of fetal movement patterns outside clinical environs is not currently possible. A wearable and non-transmitting system capable of sensing fetal movements over extended periods of time would be extremely valuable, not only for monitoring individual fetal health, but also for establishing normal levels of movement in the population at large. Wearable monitors based on accelerometers have previously been proposed as a means of tracking FM, but such systems have difficulty separating maternal and fetal activity and have not matured to the level of clinical use. We introduce a new wearable system based on a novel combination of accelerometers and bespoke acoustic sensors as well as an advanced signal processing architecture to identify and discriminate between types of fetal movements. We validate the system with concurrent ultrasound tests on a cohort of 44 pregnant women and demonstrate that the garment is capable of both detecting and discriminating the vigorous, whole-body 'startle' movements of a fetus. These results demonstrate the promise of multimodal sensing for the development of a low-cost, non-transmitting wearable monitor for fetal movements.

  20. Diverse Placental Pathologies as the Main Causes of Fetal Death

    NARCIS (Netherlands)

    Korteweg, Fleurisca J.; Erwich, Jan Jaap H. M.; Holm, Jozien P.; Ravise, Joke M.; van der Meer, Jan; Veeger, Nic J. G. M.; Timmer, Albertus; van der, Meer J.

    2009-01-01

    OBJECTIVE: To estimate the occurrence of placental causes of fetal death in relation to different gestational ages and their clinical manifestations during pregnancy. METHODS: In a prospective cohort study conducted from 2002 to 2006, we studied 750 couples with singleton intrauterine fetal death

  1. Non-invasive fetal electrocardiogram : analysis and interpretation

    NARCIS (Netherlands)

    Vullings, R.

    2010-01-01

    High-risk pregnancies are becoming more and more prevalent because of the progressively higher age at which women get pregnant. Nowadays about twenty percent of all pregnancies are complicated to some degree, for instance because of preterm delivery, fetal oxygen deficiency, fetal growth

  2. Influence of Infection During Pregnancy on Fetal Development

    Science.gov (United States)

    Adams Waldorf, Kristina M.; McAdams, Ryan M.

    2014-01-01

    Infection by bacteria, viruses and parasites may lead to fetal death, organ injury or limited sequelae depending on the pathogen. Here we consider the role of infection during pregnancy on fetal development including placental development and function, which can lead to fetal growth restriction. The classic group of teratogenic pathogens are referred to as “TORCH” (Toxoplasma gondii, Others like Treponema pallidum, Rubella virus, Cytomegalovirus, Herpes simplex virus), but should include a much broader group of pathogens including Parvovirus B19, Varicella zoster virus, and Plasmodium falciparum to name a few. In this review, we describe the influence of different infections in utero on fetal development and the short- and long-term outcomes for the neonate. In some cases, the mechanisms used by these pathogens to disrupt fetal development are well known. Bacterial infection of the developing fetal lungs and brain begins with inflammatory cascade resulting in cytokine injury and oxidative stress. For some pathogens like P. falciparum, the mechanisms involve oxidative stress and apoptosis to disrupt placental and fetal growth. An in utero infection may also impact the long-term health of the infant; in many cases, a viral infection in utero increases the risk of developing Type 1 diabetes in childhood. Understanding the varied mechanisms employed by these pathogens may enable therapies to attenuate changes in fetal development, decrease preterm birth, and improve survival. PMID:23884862

  3. Intrauterine fetal death and risk of shoulder dystocia at delivery.

    Science.gov (United States)

    Larsen, Sandra; Dobbin, Joanna; McCallion, Oliver; Eskild, Anne

    2016-12-01

    Vaginal delivery is recommended after intrauterine fetal death. However, little is known about the risk of shoulder dystocia in these deliveries. We studied whether intrauterine fetal death increases the risk of shoulder dystocia at delivery. In this population-based register study using the Medical Birth Registry of Norway, we included all singleton pregnancies with vaginal delivery of offspring in cephalic presentation in Norway during the period 1967-2012 (n = 2 266 118). Risk of shoulder dystocia was estimated as absolute risk (%) and odds ratio with 95% confidence interval. Adjustment was made for offspring birthweight (in grams). We performed sub-analyses within categories of birthweight (dystocia occurred in 1.1% of pregnancies with intrauterine fetal death and in 0.8% of pregnancies without intrauterine fetal death (p dystocia occurred in 14.6% of pregnancies with intrauterine fetal death and in 2.8% of pregnancies without intrauterine fetal death (p dystocia occurred in 57.1% of pregnancies with intrauterine fetal death and 9.6% of pregnancies without intrauterine fetal death (p dystocia at delivery, and the absolute risk of shoulder dystocia was particularly high if offspring birthweight was high and the mother had diabetes. © 2016 Nordic Federation of Societies of Obstetrics and Gynecology.

  4. Association of fetal cranial shape with shoulder dystocia

    NARCIS (Netherlands)

    Belfort, M. A.; White, G. L.; Vermeulen, F. M.

    Objective To evaluate whether fetal cranial shape is related to shoulder dystocia. Methods We compared shoulder dystocia cases (n = 18) with controls (normal vaginal deliveries, n = 18) in a retrospective matched- pairs observational study. Subjects were matched for known maternal and fetal risk

  5. Do high fetal catecholamine levels affect heart rate variability and ...

    African Journals Online (AJOL)

    Objectives. To deternrine the relationship between Umbilical arterial catecholamine levels and fetal heart rate variability and meconium passage. Study design. A prospective descriptive study was perfonned. Umbilical artery catecholamine levels were measured in 55 newborns and correlated with fetal heart rate before ...

  6. Long-term neurodevelopmental outcome after fetal therapy

    NARCIS (Netherlands)

    Klink, Jeanine Monica Maria van

    2015-01-01

    An increasing number of fetal diseases are being detected prior to birth due to major improvements in prenatal ultrasound examinations and the wide implementation of screening programs. For various diseases, fetal therapy may be a life-saving option or an alternative to postnatal treatment, to

  7. Fetal megacystis : prediction of spontaneous resolution and outcome

    NARCIS (Netherlands)

    Fontanella, F; Duin, L; Adama van Scheltema, P N; Cohen-Overbeek, T E; Pajkrt, E; Bekker, M; Willekes, C; Bax, C J; Bilardo, C M

    2017-01-01

    Objectives To investigate the natural history of fetal megacystis from diagnosis in utero to postnatal outcome, and to identify prognostic indicators of spontaneous resolution and postnatal outcome after resolution. Methods This was a national retrospective cohort study. Fetal megacystis was defined

  8. 21 CFR 864.7455 - Fetal hemoglobin assay.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Fetal hemoglobin assay. 864.7455 Section 864.7455 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Hematology Kits and Packages § 864.7455 Fetal hemoglobin...

  9. Sex differences in the fetal programming of hypertension.

    Science.gov (United States)

    Grigore, Daniela; Ojeda, Norma B; Alexander, Barbara T

    2008-01-01

    Numerous clinical and experimental studies support the hypothesis that the intrauterine environment is an important determinant of cardiovascular disease and hypertension. This review examined the mechanisms linking an adverse fetal environment and increased risk for chronic disease in adulthood with an emphasis on gender differences and the role of sex hormones in mediating sexual dimorphism in response to a suboptimal fetal environment. This review focuses on current findings from the PubMed database regarding animal models of fetal programming of hypertension, sex differences in phenotypic outcomes, and potential mechanisms in offspring of mothers exposed to an adverse insult during gestation. For the years 1988 to 2007, the database was searched using the following terms: fetal programming, intrauterine growth restriction, low birth weight, sex differences, estradiol, testosterone, high blood pressure, and hypertension. The mechanisms involved in the fetal programming of adult disease are multifactorial and include alterations in the regulatory systems affecting the long-tterm control of arterial pressure. Sex differences have been observed in animal models of fetal programming, and recent studies suggest that sex hormones may modulate activity of regulatory systems, leading to a lower incidence of hypertension and vascular dysfunction in females compared with males. Animal models of fetal programming provide critical support for the inverse relationship between birth weight and blood pressure. Experimental models demonstrate that sex differences are observed in the pathophysiologic response to an adverse fetal environment. A role for sex hormone involvement is strongly suggested,with modulation of the renin-angiotensin system as a possible mechanism.

  10. Reduced fetal androgen exposure compromises Leydig cell function in adulthood

    NARCIS (Netherlands)

    Teerds, K.J.; Keijer, J.

    2015-01-01

    Disruption of normal fetal development can influence functioning of organs and cells in adulthood. Circumstantial evidence suggests that subtle reductions in fetal androgen production may be the cause of adult male reproductive disorders due to reduced testosterone production. The mechanisms through

  11. Growth and development symposium: Fetal programming in animal agriculture

    Science.gov (United States)

    Fetal programming is the ability to improve animal production and well-being by altering the maternal environment and holds enormous challenges and great opportunities for researchers and the animal industry. A symposium was held to provide an overview of current knowledge of fetal programming in re...

  12. Fetal urine biochemistry in antenatal Bartter syndrome: a case report.

    Science.gov (United States)

    Rachid, Myriam L; Dreux, Sophie; Czerkiewicz, Isabelle; Deschênes, Georges; Vargas-Poussou, Rosa; Mahieu-Caputo, Dominique; Oury, Jean-François; Muller, Françoise

    2016-09-01

    Bartter syndrome is a severe inherited tubulopathy responsible for renal salt wasting, and hence electrolyte disorders and dehydration. Prenatally, it is characterized by severe polyhydramnios caused by fetal polyuria. We studied for the first time fetal urine in a Bartter syndrome case and demonstrated that the tubulopathy is already present at 24 weeks of gestation.

  13. Time-scale analysis of antepartum fetal heart rate variability

    NARCIS (Netherlands)

    Peters, C.H.L.

    2011-01-01

    Reliable evaluation of fetal condition and early detection of fetal distress is one of the largest challenges in modern obstetrics. Safely protected within the maternal womb, the fetus is rather inaccessible for physiological measurements. One of few physiological phenomena that can be measured

  14. Biglycan and decorin differentially regulate signaling in the fetal membranes

    Science.gov (United States)

    Wu, Zhiping; Horgan, Casie E.; Carr, Olivia; Owens, Rick T.; Iozzo, Renato V.; Lechner, Beatrice E.

    2014-01-01

    Preterm birth is the leading cause of newborn mortality in the United States and about one third of cases are caused by preterm premature rupture of fetal membranes, a complication that is frequently observed in patients with Ehlers-Danlos Syndrome. Notably, a subtype of Ehlers-Danlos Syndrome is caused by expression of abnormal biglycan and decorin proteoglycans. As compound deficiency of these two small leucine-rich proteoglycans is a model of preterm birth, we investigated the fetal membranes of Bgn−/−;Dcn−/− double-null and single-null mice. Our results showed that biglycan signaling supported fetal membrane remodeling during early gestation in the absence of concomitant changes in TGFβ levels. In late gestation, biglycan signaling acted in a TGFβ–dependent manner to aid in membrane stabilization. In contrast, decorin signaling supported fetal membrane remodeling at early stages of gestation in a TGFβ–dependent manner, and fetal membrane stabilization at later stages of gestation without changes in TGFβ levels. Furthermore, exogenous soluble decorin was capable of rescuing the TGFβ signaling pathway in fetal membrane mesenchymal cells. Collectively, these findings provide novel targets for manipulation of fetal membrane extracellular matrix stability and could represent novel targets for research on preventive strategies for preterm premature rupture of fetal membranes. PMID:24373743

  15. Cholesterol synthesis by human fetal hepatocytes: effect of lipoproteins

    International Nuclear Information System (INIS)

    Carr, B.R.; Simpson, E.R.

    1984-01-01

    The purpose of the present investigation was to determine the effect of various lipoproteins on the rate of cholesterol synthesis of human fetal liver cells maintained in culture. This was accomplished by measuring the rate of incorporation of tritium from tritiated water or carbon 14-labeled acetate into cholesterol in human fetal liver cells. Optimal conditions for each assay were determined. When human fetal liver cells were maintained in the presence of low-density lipoprotein, cholesterol synthesis was inhibited in a concentration-dependent fashion. Intermediate--density lipoprotein and very-low-density lipoprotein also suppressed cholesterol synthesis in human fetal liver cells. In contrast, high-density lipoprotein stimulated cholesterol synthesis in human fetal liver cells. The results of the present as well as our previous investigations suggest that multiple interrelationships exist between fetal liver cholesterol synthesis and lipoprotein-cholesterol utilization by the human fetal adrenal gland and that these processes serve to regulate the lipoprotein-cholesterol levels in fetal plasma

  16. Fetal outcome in emergency versus elective cesarean sections at ...

    African Journals Online (AJOL)

    Introduction: Perinatal mortality rates have come down in cesarean sections, but fetal morbidity is still high in comparison to vaginal delivery and the complications are more commonly seen in emergency than in elective cesarean sections. The objective of the study was to compare the fetal outcome and the indications in ...

  17. Glucocorticoid stimulates expression of corticotropin-releasing hormone gene in human placenta

    International Nuclear Information System (INIS)

    Robinson, B.G.; Emanuel, R.L.; Frim, D.M.; Majzoub, J.A.

    1988-01-01

    Primary cultures of purified human cytotrophoblasts have been used to examine the expression of the corticotropin-releasing hormone (CRH) gene in placenta. The authors report here that glucocorticoids stimulate placental CRH synthesis and secretion in primary cultures of human placenta. This stimulation is in contrast to the glucocorticoid suppression of CRH expression in hypothalamus. The positive regulation of CRH by glucocorticoids suggests that the rise in CRH preceding parturition could result from the previously described rise in fetal glucocorticoids. Furthermore, this increase in placental CRH could stimulate, via adrenocorticotropic hormone, a further rise in fetal glucocorticoids, completing a positive feedback loop that would be terminated by delivery

  18. Fetal growth disorders in twin gestations.

    LENUS (Irish Health Repository)

    Breathnach, Fionnuala M

    2012-06-01

    Twin growth is frequently mismatched. This review serves to explore the pathophysiologic mechanisms that underlie growth aberrations in twin gestations, the prenatal recognition of abnormal twin growth, and the critical importance of stratifying management of abnormal twin growth by chorionicity. Although poor in utero growth of both twins may reflect maternal factors resulting in global uteroplacental dysfunction, discordant twin growth may be attributed to differences in genetic potential between co-twins, placental dysfunction confined to one placenta only, or one placental territory within a shared placenta. In addition, twin-twin transfusion syndrome represents a distinct entity of which discordant growth is a common feature. Discordant growth is recognized as an independent risk factor for adverse perinatal outcome. Intertwin birth weight disparity of 18% or more should be considered to represent a discordance threshold, which serves as an independent risk factor for adverse perinatal outcome. At this cutoff, perinatal morbidity is found to increase both for the larger and the smaller twin within a discordant pair. There remains uncertainty surrounding the sonographic parameters that are most predictive of discordance. Although heightening of fetal surveillance in the face of discordant twin growth follows the principles applied to singleton gestations complicated by fetal growth restriction, the timing of intervention is largely influenced by chorionicity.

  19. Fetal tachyarrhythmia: literature data and case study

    Directory of Open Access Journals (Sweden)

    Lukianova I.S.

    2016-03-01

    Full Text Available Fetal tachyarrhythmia is unfeigned in most cases and occurs in about 1–3% of the total number of pregnancies. Most of it's kinds are ectopic intraatrial reductions. FA is usually diagnosed during the routine, starting from 18 weeks of gestation, ultrasound assessment of the fetal heart rate. Approximately 10% of fetuses with rhythm disorders are at high risk of sudden death. Supraventricular tachycardia and atrial fibrillation are the most common causes of sudden death, the same is observed for bradyarrhythmias: manifest sinus bradycardia (hypoxic genesis and expressed AV-blockade. The examination of all fetuses with arrhythmia was strongly recommended in cases of intrauterine cardiac arrest or death of the fetus in families. Arrhythmias which have been revealed during scheduled prenatal examination of the fetuses are in need of expert echocardiography assessment to determine the extent of possible pre- and postnatal risk of sudden death and the paril of arrhythmogenic cardiomyopathy formation. In case of identified life-threatening arrhythmia in fetus the pharmacological therapy, which greatly affects the favorable outcome is strongly recommended. It should be based on hemodynamic of pregnant and aimed to prevent the development of decompensation or arrhythmogenic cardiomyopathy.

  20. Circle of Willis Variants: Fetal PCA

    Directory of Open Access Journals (Sweden)

    Amir Shaban

    2013-01-01

    Full Text Available We sought to determine the prevalence of fetal posterior cerebral artery (fPCA and if fPCA was associated with specific stroke etiology and vessel territory affected. This paper is a retrospective review of prospectively identified patients with acute ischemic stroke from July 2008 to December 2010. We defined complete fPCA as absence of a P1 segment linking the basilar with the PCA and partial fPCA as small segment linking the basilar with the PCA. Patients without intracranial vascular imaging were excluded. We compared patients with complete fPCA, partial fPCA, and without fPCA in terms of demographics, stroke severity, distribution, and etiology and factored in whether the stroke was ipsilateral to the fPCA. Of the 536 included patients, 9.5% ( had complete fPCA and 15.1% ( had partial fPCA. Patients with complete fPCA were older and more often female than partial fPCA and no fPCA patients, and significant variation in TOAST classification was detected across groups (. Patients with complete fPCA had less small vessel and more large vessel strokes than patients with no fPCA and partial fPCA. Fetal PCA may predispose to stroke mechanism, but is not associated with vascular distribution, stroke severity, or early outcome.

  1. Fetal adaptations for viviparity in amphibians.

    Science.gov (United States)

    Wake, Marvalee H

    2015-08-01

    Live-bearing has evolved in all three orders of amphibians--frogs, salamanders, and caecilians. Developing young may be either yolk dependent, or maternal nutrients may be supplied after yolk is resorbed, depending on the species. Among frogs, embryos in two distantly related lineages develop in the skin of the maternal parents' backs; they are born either as advanced larvae or fully metamorphosed froglets, depending on the species. In other frogs, and in salamanders and caecilians, viviparity is intraoviductal; one lineage of salamanders includes species that are yolk dependent and born either as larvae or metamorphs, or that practice cannibalism and are born as metamorphs. Live-bearing caecilians all, so far as is known, exhaust yolk before hatching and mothers provide nutrients during the rest of the relatively long gestation period. The developing young that have maternal nutrition have a number of heterochronic changes, such as precocious development of the feeding apparatus and the gut. Furthermore, several of the fetal adaptations, such as a specialized dentition and a prolonged metamorphosis, are homoplasious and present in members of two or all three of the amphibian orders. At the same time, we know little about the developmental and functional bases for fetal adaptations, and less about the factors that drive their evolution and facilitate their maintenance. © 2014 Wiley Periodicals, Inc.

  2. Fetal exposure to environmental neurotoxins in Taiwan.

    Science.gov (United States)

    Jiang, Chuen-Bin; Hsi, Hsing-Cheng; Fan, Chun-Hua; Chien, Ling-Chu

    2014-01-01

    Mercury (Hg), lead (Pb), cadmium (Cd), and arsenic (As) are recognized neurotoxins in children that particularly affect neurodevelopment and intellectual performance. Based on the hypothesis that the fetal basis of adult disease is fetal toxic exposure that results in adverse outcomes in adulthood, we explored the concentrations of key neurotoxins (i.e., Hg, Pb, Cd, and As) in meconium to identify the risk factors associated with these concentrations. From January 2007 to December 2009, 545 mother-infant pairs were recruited. The geometric mean concentrations of Pb and As in the meconium of babies of foreign-born mothers (22.9 and 38.1 µg/kg dry weight, respectively) were significantly greater than those of babies of Taiwan-born mothers (17.5 and 33.0 µg/kg dry weight, respectively). Maternal age (≥30 y), maternal education, use of traditional Chinese herbs during pregnancy, and fish cutlet consumption (≥3 meals/wk) were risk factors associated with concentrations of key prenatal neurotoxins. The Taiwan government should focus more attention on providing intervention programs for immigrant mothers to help protect the health of unborn babies. Further investigation on how multiple neurotoxins influence prenatal neurodevelopment is warranted.

  3. Fetal exposure to environmental neurotoxins in Taiwan.

    Directory of Open Access Journals (Sweden)

    Chuen-Bin Jiang

    Full Text Available Mercury (Hg, lead (Pb, cadmium (Cd, and arsenic (As are recognized neurotoxins in children that particularly affect neurodevelopment and intellectual performance. Based on the hypothesis that the fetal basis of adult disease is fetal toxic exposure that results in adverse outcomes in adulthood, we explored the concentrations of key neurotoxins (i.e., Hg, Pb, Cd, and As in meconium to identify the risk factors associated with these concentrations. From January 2007 to December 2009, 545 mother-infant pairs were recruited. The geometric mean concentrations of Pb and As in the meconium of babies of foreign-born mothers (22.9 and 38.1 µg/kg dry weight, respectively were significantly greater than those of babies of Taiwan-born mothers (17.5 and 33.0 µg/kg dry weight, respectively. Maternal age (≥30 y, maternal education, use of traditional Chinese herbs during pregnancy, and fish cutlet consumption (≥3 meals/wk were risk factors associated with concentrations of key prenatal neurotoxins. The Taiwan government should focus more attention on providing intervention programs for immigrant mothers to help protect the health of unborn babies. Further investigation on how multiple neurotoxins influence prenatal neurodevelopment is warranted.

  4. [Fetal neurosonography using 3-dimensional multiplanar sonography].

    Science.gov (United States)

    Chaoui, R; Heling, K S; Kainer, F; Karl, K

    2012-04-01

    This review focuses on the examination of the fetal brain, using three-dimensional (3D) ultrasound and the multiplanar rendering mode (MPR). The routine examination of the brain is achieved with axial planes but a dedicated fetal neurosonogram requires additional coronal and sagittal views, in order to provide a complete view of the different brain structures. Because these planes are difficult to obtain under many conditions, the present paper shows how 3D MPR allows one to obtain 1 or multiple reconstructed images from a digital volume. The display can be either as orthogonal planes, tomographic planes with parallel slices or as one single plane of the region of interest, which can be selected by the examiner. This approach allows easily the demonstration of the corpus callosum, the cerebellar vermis, the three-horn view, the foetal hippocampus and other regions. In addition, early neurosonography of the developing brain from the 7th week of pregnancy onwards can be achieved. © Georg Thieme Verlag KG Stuttgart · New York.

  5. Glucocorticoids and fetal programming part 2: Mechanisms.

    Science.gov (United States)

    Moisiadis, Vasilis G; Matthews, Stephen G

    2014-07-01

    The lifelong health of an individual is shaped during critical periods of development. The fetus is particularly susceptible to internal and external stimuli, many of which can alter developmental trajectories and subsequent susceptibility to disease. Glucocorticoids are critical in normal development of the fetus, as they are involved in the growth and maturation of many organ systems. The surge in fetal glucocorticoid levels that occurs in most mammalian species over the last few days of pregnancy is an important developmental switch leading to fundamental changes in gene regulation in many organs, including the brain. These changes are important for the transition to postnatal life. Exposure of the fetus to increased levels of glucocorticoids, resulting from maternal stress or treatment with synthetic glucocorticoids, can lead to long-term 'programming' of hypothalamic-pituitary-adrenal function and behaviours. Glucocorticoids act at multiple levels within the fetal brain. Growing evidence indicates that they can exert powerful effects on the epigenome, including on DNA methylation, histone acetylation and microRNA, to influence gene expression. Such influences probably represent a critical component of the 'programming' process, and might be partly responsible for the transgenerational effects of antenatal glucocorticoid exposure on neurologic, cardiovascular and metabolic function.

  6. Fetal alcohol exposure and development of the integument

    Directory of Open Access Journals (Sweden)

    Longhurst WD

    2016-05-01

    Full Text Available William D Longhurst,1 Jordan Ernst,2 Larry Burd3 1Center for Emergency Medicine, University Hospitals Case Medical Center, Case Western Reserve University, Cleveland, OH, USA; 2University of North Dakota School of Medicine and Health Sciences, Grand Forks, ND, USA; 3Department of Pediatrics, North Dakota Fetal Alcohol Syndrome Center, University of North Dakota School of Medicine and Health Sciences, Grand Forks, ND, USA Background: The physiology of fetal alcohol exposure changes across gestation. Early in pregnancy placental, fetal, and amniotic fluid concentrations of alcohol exposure are equivalent. Beginning in mid-pregnancy, the maturing fetal epidermis adds keratins which decrease permeability resulting in development of a barrier between fetal circulation and the amniotic fluid. Barrier function development is essential for viability in late pregnancy and in the extra-uterine environment. In this paper we provide a selected review of the effects of barrier function on fetal alcohol exposure. Methods: We utilized a search of PubMed and Google for all years in all languages for MeSH on Demand terms: alcohol drinking, amnion, amniotic fluid, epidermis, ethanol, female, fetal development, fetus, humans, keratins, permeability, and pregnancy. We also reviewed the reference lists of relevant papers and hand-searched reference lists of textbooks for additional references. Results: By 30 gestational weeks, development of barrier function alters the pathophysiology of ethanol dispersion between the fetus and amniotic fluid. Firstly, increases in the effectiveness of barrier function decreases the rate of diffusion of alcohol from fetal circulation across fetal skin into the amniotic fluid. This reduces the volume of alcohol entering the amniotic fluid. Secondly, barrier function increases the duration of fetal exposure by decreasing the rate of alcohol diffusion from amniotic fluid back into fetal circulation. Ethanol is then transported into

  7. Prenatal diagnosis and treatment perspective of fetal hypothyroidism with goiter

    International Nuclear Information System (INIS)

    Gulraze, A.; Kurdi, W.; Tulbah, M.; Niaz, F.A.

    2013-01-01

    We describe two cases of fetal goiter in women with no history of thyroid disease. Diagnosis of fetal goiter during antenatal care was made by ultrasound and MRI. Congenital hypothyroidism was confirmed by fetal blood sampling that was treated with weekly intra-amniotic injections of L-thyroxin. One fetus was initially treated with four weekly intra-amniotic injections of 200 mu gms of L-thyroxin, later increased to 400 mu gms. The other fetus was treated with only three weekly intraamniotic injections of 400 mu gms of L-thyroxin. Therapeutic response was monitored by repeated ultrasound and MRI along with fetal blood sampling. At birth, none of the babies had goiter and were put on oral thyroxin. Post-natal studies were suggestive of congenital hypothyroidism due to dyshormogenesis. No abnormality was detected at follow-up. These cases highlight the role of intra-amniotic thyroxine in management of fetal hypothyroidism with goiter. (author)

  8. Fetal karyotype: can we always trust its result?

    Directory of Open Access Journals (Sweden)

    Carolina Leite Drummond

    2008-09-01

    Full Text Available We retrospectively investigated six cases of discrepancy between prenatal fetal karyotype and postnatal findings. In five cases, the chromosomal abnormalities initially found by CVS or amniocentesis were not confirmed by later analyses and postnatal examination. In one case, the fetal karyotype found to be normal by CVS had to be checked due to sonographic features and clinical anomalies found after birth. In most cases, the normal development on sonographic examination raised the doubt about the abnormal fetal karyotype. Discrepant findings between fetal karyotype results and sonographic findings require great caution in their interpretation and counseling of parents. Placental confined mosaicism seems to be the most frequent cause of such discrepant results. The interpretation of fetal karyotype results should always be correlated with sonographic and clinical findings.

  9. [Medical use of fetal cells and tissue: ethical aspects].

    Science.gov (United States)

    Wolff, H P

    1992-04-01

    After considering the moral status of the living and of the dead human fetus, the article examines various ethical arguments connected with the use of fetal remains following elective abortion: financial or humanitarian incentives for the termination of pregnancy, conflicts of interest between mother and user, authority over fetal remains and modality of donation and utilization of the fetus. To prevent improper use of fetal remains it is recommended: to separate completely the decisions relating to abortion (first) and to the subsequent use of fetal tissues (second); to obtain explicit informed consent from the mother, making it impossible for her to direct any specific use of the fetal tissues; to base decisions on the method and timing of an abortion on the mother's health care needs alone; to exclude those involved in the process of abortion from any use of the fetus; to protect the anonymity of donor and recipient through an intermediary (tissue bank).

  10. Middle cerebral artery flow velocity waveforms in fetal hypoxaemia.

    Science.gov (United States)

    Vyas, S; Nicolaides, K H; Bower, S; Campbell, S

    1990-09-01

    In 81 small-for-gestational age fetuses (SGA) colour flow imaging was used to identify the fetal middle cerebral artery for subsequent pulsed Doppler studies. Impedence to flow (pulsatility index; PI) was significantly lower, and mean blood velocity was significantly higher, than the respective reference ranges with gestation. Fetal blood sampling by cordocentesis was performed in all SGA fetuses and a significant quadratic relation was found between fetal hypoxaemia and the degree of reduction in the PI of FVWs from the fetal middle cerebral artery. Thus, maximum reduction in PI is reached when the fetal PO2 is 2-4 SD below the normal mean for gestation. When the oxygen deficit is greater there is a tendency for the PI to rise, and this presumably reflects the development of brain oedema.

  11. Linear and nonlinear features of fetal heart rate on the assessment of fetal development in the course of pregnancy and the impact of fetal gender.

    Science.gov (United States)

    Spyridou, K; Chouvarda, I; Hadjileontiadis, L; Maglaveras, N

    2018-01-30

    This work aims to investigate the impact of gestational age and fetal gender on fetal heart rate (FHR) tracings. Different linear and nonlinear parameters indicating correlation or complexity were used to study the influence of fetal age and gender on FHR tracings. The signals were recorded from 99 normal pregnant women in a singleton pregnancy at gestational ages from 28 to 40 weeks, before the onset of labor. There were 56 female fetuses and 43 male. Analysis of FHR shows that the means as well as measures of irregularity of FHR, such as approximate entropy and algorithmic complexity, decrease as gestation progresses. There were also indications that mutual information and multiscale entropy were lower in male fetuses in early pregnancy. Fetal age and gender seem to influence FHR tracings. Taking this into consideration would improve the interpretation of FHR monitoring.

  12. The effect of Ramadan fasting on fetal development.

    Science.gov (United States)

    Karateke, Atilla; Kaplanoglu, Mustafa; Avci, Fazil; Kurt, Raziye Keskin; Baloglu, Ali

    2015-01-01

    To evaluate the effects of Ramadan fasting on fetal development and outcomes of pregnancy. We performed this study in Antakya State Hospital of Obstetrics and Child Care, between 28 June 2014 and 27 July 2014 (during the month of Ramadan). A total of two hundred forty healthy pregnant women who were fasting during Ramadan, were included in the groups. The three groups were divided according to the trimesters. The each group was consisted of 40 healthy pregnant women with fasting and 40 healthy pregnant women without fasting. For evaluating the effects of Ramadan on fetus, ultrasonography was performed on all pregnant women in the beginning and the end of Ramadan. We used the essential parameters for the following measurements: increase of fetal biparietal diameter (BPD), increase of fetal femur length (FL), increase of estimated fetal body weight (EFBW), fetal biophysical profile (BPP), amniotic fluid index (AFI), and umbilical artery systole/diastole (S/D) ratio. No significant difference was found between the two groups for the fetal age, maternal weight gain (kilogram), estimated fetal weight gain (EFWG), fetal BPP, AFI, and umbilical artery S/D ratio. On the other hand, a statistically significant increase was observed in maternal weight in the second and third trimesters and a significant increase was observed in the amniotic fluid index in second trimester. In Ramadan there was no bad fetal outcome between pregnant women with fasting and pregnant women without fasting. Pregnant women who want to be with fast, should be examined by doctors, adequately get breakfast before starting to fast and after the fasting take essential calori and hydration. More comprehensive randomized studies are needed to explain the effects of fasting on the pregnancy and fetal outcomes.

  13. Melatonin modulates the fetal cardiovascular defense response to acute hypoxia.

    Science.gov (United States)

    Thakor, Avnesh S; Allison, Beth J; Niu, Youguo; Botting, Kimberley J; Serón-Ferré, Maria; Herrera, Emilio A; Giussani, Dino A

    2015-08-01

    Experimental studies in animal models supporting protective effects on the fetus of melatonin in adverse pregnancy have prompted clinical trials in human pregnancy complicated by fetal growth restriction. However, the effects of melatonin on the fetal defense to acute hypoxia, such as that which may occur during labor, remain unknown. This translational study tested the hypothesis, in vivo, that melatonin modulates the fetal cardiometabolic defense responses to acute hypoxia in chronically instrumented late gestation fetal sheep via alterations in fetal nitric oxide (NO) bioavailability. Under anesthesia, 6 fetal sheep at 0.85 gestation were instrumented with vascular catheters and a Transonic flow probe around a femoral artery. Five days later, fetuses were exposed to acute hypoxia with or without melatonin treatment. Fetal blood was taken to determine blood gas and metabolic status and plasma catecholamine concentrations. Hypoxia during melatonin treatment was repeated during in vivo NO blockade with the NO clamp. This technique permits blockade of de novo synthesis of NO while compensating for the tonic production of the gas, thereby maintaining basal cardiovascular function. Melatonin suppressed the redistribution of blood flow away from peripheral circulations and the glycemic and plasma catecholamine responses to acute hypoxia. These are important components of the fetal brain sparing response to acute hypoxia. The effects of melatonin involved NO-dependent mechanisms as the responses were reverted by fetal treatment with the NO clamp. Melatonin modulates the in vivo fetal cardiometabolic responses to acute hypoxia by increasing NO bioavailability. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Maternal exposure to hurricane destruction and fetal mortality.

    Science.gov (United States)

    Zahran, Sammy; Breunig, Ian M; Link, Bruce G; Snodgrass, Jeffrey G; Weiler, Stephan; Mielke, Howard W

    2014-08-01

    The majority of research documenting the public health impacts of natural disasters focuses on the well-being of adults and their living children. Negative effects may also occur in the unborn, exposed to disaster stressors when critical organ systems are developing and when the consequences of exposure are large. We exploit spatial and temporal variation in hurricane behaviour as a quasi-experimental design to assess whether fetal death is dose-responsive in the extent of hurricane damage. Data on births and fetal deaths are merged with Parish-level housing wreckage data. Fetal outcomes are regressed on housing wreckage adjusting for the maternal, fetal, placental and other risk factors. The average causal effect of maternal exposure to hurricane destruction is captured by difference-in-differences analyses. The adjusted odds of fetal death are 1.40 (1.07-1.83) and 2.37 (1.684-3.327) times higher in parishes suffering 10-50% and >50% wreckage to housing stock, respectively. For every 1% increase in the destruction of housing stock, we observe a 1.7% (1.1-2.4%) increase in fetal death. Of the 410 officially recorded fetal deaths in these parishes, between 117 and 205 may be attributable to hurricane destruction and postdisaster disorder. The estimated fetal death toll is 17.4-30.6% of the human death toll. The destruction caused by Hurricanes Katrina and Rita imposed significant measurable losses in terms of fetal death. Postdisaster migratory dynamics suggest that the reported effects of maternal exposure to hurricane destruction on fetal death may be conservative. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  15. The origin of fetal sterols in second-trimester amniotic fluid : endogenous synthesis or maternal-fetal transport?

    NARCIS (Netherlands)

    Baardman, Maria E.; Erwich, Jan Jaap H. M.; Berger, Rolf M. F.; Hofstra, Robert M. W.; Kerstjens-Frederikse, Wilhelmina S.; Luetjohann, Dieter; Plosch, Torsten; Lutjohann, D.

    OBJECTIVE: Cholesterol is crucial for fetal development. To gain more insight into the origin of the fetal cholesterol pool in early human pregnancy, we determined cholesterol and its precursors in the amniotic fluid of uncomplicated, singleton human pregnancies. STUDY DESIGN: Total sterols were

  16. Non-invasive pulsed cavitational ultrasound for fetal tissue ablation: feasibility study in a fetal sheep model.

    Science.gov (United States)

    Kim, Y; Gelehrter, S K; Fifer, C G; Lu, J C; Owens, G E; Berman, D R; Williams, J; Wilkinson, J E; Ives, K A; Xu, Z

    2011-04-01

    Currently available fetal intervention techniques rely on invasive procedures that carry inherent risks. A non-invasive technique for fetal intervention could potentially reduce the risk of fetal and obstetric complications. Pulsed cavitational ultrasound therapy (histotripsy) is an ablation technique that mechanically fractionates tissue at the focal region using extracorporeal ultrasound. In this study, we investigated the feasibility of using histotripsy as a non-invasive approach to fetal intervention in a sheep model. The experiments involved 11 gravid sheep at 102-129 days of gestation. Fetal kidney, liver, lung and heart were exposed to ultrasound pulses (bones. Histological assessment confirmed lesion locations and sizes corresponding to regions where cavitation was monitored, with no lesions found when cavitation was absent. Inability to generate cavitation was primarily associated with increased depth to target and obstructing structures such as fetal limbs. Extracorporeal histotripsy therapy successfully created targeted lesions in fetal sheep organs without significant damage to overlying structures. With further improvements, histotripsy may evolve into a viable technique for non-invasive fetal intervention procedures. Copyright © 2011 ISUOG. Published by John Wiley & Sons, Ltd.

  17. Fetal Gender and Several Cytokines Are Associated with the Number of Fetal Cells in Maternal Blood - An Observational Study

    DEFF Research Database (Denmark)

    Schlütter, Jacob Mørup; Kirkegaard, Ida; Petersen, Olav Bjørn

    2014-01-01

    OBJECTIVE: To identify factors influencing the number of fetal cells in maternal blood. METHODS: A total of 57 pregnant women at a gestational age of weeks 11-14 were included. The number of fetal cells in maternal blood was assessed in 30 ml of blood using specific markers for both enrichment...

  18. Doppler changes as the earliest parameter in fetal surveillance to detect fetal compromise in intrauterine growth-restricted fetuses

    Directory of Open Access Journals (Sweden)

    Bansal Saloni

    2016-01-01

    Full Text Available Introduction. It is estimated that 3-10% of infants are growth restricted. Growth disturbances may have long-term issues. Doppler allows insight into the fetal response to intrauterine stress. Objective. The aim of this study was to detect fetal compromise in intrauterine growth-restricted (IUGR fetuses by means of biophysical profile (BPP vis-а-vis Doppler velocimetry studies of the fetal umbilical artery, and to find out which of the two is a better and earlier predictor of fetal compromise. Methods. A prospective study was conducted on a total of 50 singleton pregnancies with IUGR between 28 and 42 weeks of gestation. Study patients were managed expectantly with nonstress testing and amniotic fluid assessment, BPP and Doppler velocimetry studies of the fetal umbilical artery. Results. Fetal outcome was poor in 5/50 (10% of the fetuses, defined as presence of all of the following: poor Apgar test score, neonatal intensive care unit stay, necrotizing enterocolitis, and low birth weight. Of the four with abnormal BPP, 50% had poor fetal outcomes. Out of 46 with normal BPP, 6.5% had poor fetal outcomes. Conclusion. Inference drawn from the study is that the Doppler technology provides us the opportunity for repetitive noninvasive hemodynamic monitoring in IUGR pregnancies.

  19. Whole transcriptome analysis of human erythropoietic cells during ontogenesis suggests a role of VEGFA gene as modulator of fetal hemoglobin and pharmacogenomic biomarker of treatment response to hydroxyurea in β-type hemoglobinopathy patients

    DEFF Research Database (Denmark)

    Chondrou, Vasiliki; Kolovos, Petros; Sgourou, Argyro

    2017-01-01

    from whole transcriptome analysis of erythroid cells, isolated from erythroid tissues at various developmental stages in an effort to identify distinct molecular signatures of each erythroid tissue. Results: From our in-depth data analysis, pathway analysis, and text mining, we opted to focus...

  20. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.